Datasets:

xNoper

/

pubmed-sections-test

like 0

[ "plasma cell leukemia ( pcl ) is a rare disease that represents approximately 4% of plasma cell malignant disorders.1 diagnosis of pcl is established based on kyle s criteria , which includes an absolute plasma cell number accounting for greater than 2000/l or 20% of white blood cell differentiation.2 pcl consists of two variants : primary pcl presents in patients with no previous history of multiple myeloma ( mm ) , while secondary pcl consists of a leukemic transformation in previously recognized mm.3 primary pcl is an extremely resistant , rapidly progressive , fatal disease , with a median overall survival of 6.8 months.4 there is no standard therapeutic strategy because none of the treatment options have been prospectively evaluated . we describe herein a successful case of newly diagnosed primary pcl , treated with a regimen that included bortezomib , followed by auto stem cell transplantation ( asct ) and nonmyeloablative allogeneic stem cell transplantation ( allo - sct ) .", "a 37-year - old man with suspected primary pcl was sent from a nearby hospital to our institution in february 2010 . table 1 shows the laboratory data of the initial medical examination , and table 2 shows the data on admission to our hospital . the white blood cell count and its differentiation met kyle s criteria . the patient had acute heart failure . his chest x - ray revealed cardiomegaly ( cardiothoracic ratio was 59% ) with slight pulmonary congestion . amino - terminal pro - brain natriuretic peptide levels were elevated to 811.2 pg / ml . this acute heart failure was probably caused by cardiac amyloidosis , as cardiac ultrasound showed a granular sparkling pattern . these cells were negative for cyclin d1 , cd3 , cd5 , cd10 , cd20 , cd56 , cd79a , and chain , and positive for cd138 and chain . no immunoglobulin h / cyclin d1 ( igh / bcl1 ) translocations were found in fluorescence in situ hybridization analysis . treatment with a pad regimen ( bortezomib 1.3 mg / m [ days 1 , 4 , 8 , and 11 ] , adriamycin 1.3 mg / m [ days 1 , 4 , 8 , and 11 ] , and dexamethasone 40 mg / body [ days 14 , 811 , and 1518 ] ) was started . as soon as the treatment was started , leukemic plasma cell levels rapidly decreased ( figure 1 ) . no organ dysfunction was detected , except that serum creatinine levels temporarily increased to 1.21 mg / dl . on day 27 of the first pad cycle after three pad cycles , we were unable to assess his bone marrow , because it remained dry tap . serum / , a surrogate marker for the treatment effect of this case , became similar to normal levels . in addition , the granular sparkling pattern detected by cardiac ultrasound at the time of admission disappeared . the patient was then administered high - dose therapy ( hdt ) + asct . before hdt + asct , his p eripheral blood stem cells containing 10.9 10/kg cd34-positive cells were harvested with high - dose cyclophosphamide . he received hdt + asct with a conditioning regimen of high - dose melphalan ( 100 mg / m [ days 3 and 2 ] ) and bortezomib ( 1 mg / m [ days 7 , 4 , + 1 , and + 4 ] ) . at the end of hdt + asct sixty - seven days after hdt + asct , the patient received allogeneic bone marrow stem cell transplantation ( allo - bmt ) from his human leukocyte antigen - matched brother , containing 2.1 10/pt kg nuclear cells and 1.44 10/pt kg cd34-positive cells . the conditioning regimen consisted of fludarabine ( 30 mg / m [ day 6 to day 2 ] ) and total body irradiation ( 2 gy [ day 1 ] ) . graft - versus - host disease ( gvhd ) prophylaxis included tacrolimus and short - term methotrexate . twelve months after allo - bmt , the patient s serum / level was maintained at normal levels . he remained in a state of remission , with only the complication of mild skin gvhd .", "there are no established therapeutic regimens for pcl . several regimens that include an alkylating agent are sufficient to improve the overall survival ( os ) of pcl patients . jimnez - zepeda and domnguez reported a median os of 6.8 months for pcl patients treated with a common chemotherapy regimen consisting of vincristine , adriamycin , and dexamethasone , versus 2 months for those who received melphalan and prednisolone.5 it has also been reported that a combination of intermediate doses of melphalan and dexamethasone obtained the highest level of response in pcl patients . however , the median os was only 60 days for the cohort that achieved a partial or complete response.6 by comparison , bortezomib regimens show promise as induction regimens for pcl . katodritou et al reported that a combination of bortezomib and dexamethasone prolonged os ( median , 12 months).7 the efficacy of pad has been reported by chan et al.8 similar to the case presented by chan et al , our case , inducted with pad , showed a very impressive clinical course . as soon as pad was started , leukemic plasma cell levels rapidly decreased ( figure 1 ) . in addition , anemia and platelet depletion improved , and acute heart and kidney dysfunction rapidly recovered . after three pad cycles , serum / levels were normalized , without any adverse effects ( figure 2 ) . in the present case , the absolute values of the immunoglobulin / free light chains in the serum before and after therapy had to be very important although pad is effective for pcl , it remains to be determined whether long - term survival is improved , because of a lack of long - term follow - up . immunomodulatory drugs ( imids ) , such as thalidomide and lenalidomide , are as promising as bortezomib.9 , the reasons we did not choose imids were that lenalidomide was not approved in japan at the onset of the patient s pcl , and we decided to leave an opportunity to use thalidomide at his relapse . our case represented a potential curative strategy for pcl , with the safe introduction of allo - immunization with a n onmyeloablative regimen following pad and hdt + asct . for multiple mm , the most common malignant disease in plasma cells , asct is regarded as the standard therapy for newly diagnosed cases in patients younger than 65 years . however , few patients who undergo the procedure are free of disease for more than 10 years . on the other hand , allo - sct is a promising therapy . because of the graft - versus - myeloma effect , a lower relapse rate and longer remissions have been reported in patients receiving allo - sct.11 presumably , pcl may be the same as mm . however , the high risk of transplant - related mortality ( 30%60% ) is a limitation of the use of allo - sct for mm . to overcome this limitation , maloney et al reported that combining a cytoreductive autograft with a nonmyeloablative allograft lowered transplant - related mortality by approximately 15%.12 meanwhile , ramasamy et al reported that alemtuzumab - based reduced intensity conditioning allogeneic transplantation.13 although progression - free survival of their patient cohort was comparable to previously published data of reduced intensity conditioning allogeneic transplantation in myeloma , there is no plateau on the survival curves , with a significant transplant - related mortality of 21% . although nonmyeloablative conditioning reduces transplant - related mortality , it is difficult for patients older than 65 years to use our strategy . for them we have a successful case of newly diagnosed primary pcl , treated with a regimen that included bortezomib and asct , followed by nonmyeloablative allo - sct . this strategy is promising for pcl , which , though an extremely resistant disease , may become curable ." ]

[ "fitz hugh curtis syndrome is an extra - pelvic manifestation of pelvic inflammatory disease ( pid ) and is characterized by perihepatic adhesions between liver capsule and diaphragm or anterior peritoneal surface(13 ) . most fitz hugh curtis syndrome patients are women of child bearing age and rarely has the syndrome been reported in males . the predominant symptom is pain in the right upper quadrant , which may be confused with biliary disease an abdominal computed tomography ( ct ) scan may reveal subcapsular enhancement of the liver in arterial phase ( 4 ) . we herein report a case of fitz hugh curtis syndrome in a male patient that was diagnosed via laparoscopy .", "a 29 year - old african american male with russel - silver dwarfism presented with one day history of diarrhea , nausea , vomiting , right side abdominal pain , and abdominal distention . the pain was constant , gradually increasing in severity , and not related to food intake . his medical history was significant for russel - silver dwarfism , calcium deficiency , cardiomegaly , and bilateral testicular implants for undescended testicles . the patient was sexually active only with his girlfriend and denied any history of sexually transmitted disease . on examination patient was afebrile and his vitals were stable . laboratory workup revealed white blood cell ( wbc ) count of 14,000/l with normal liver function tests . ct scan of the abdomen and pelvis showed a small amount of free fluid in pelvis ; the proximal appendix appeared normal , however the distal appendix was not visualized . the liver capsule appeared normal and there was no subcapsular fluid collection ( figure 1 ) . ct scan showing normal appearing liver capsule and no perihepatic fluid collection the patient was admitted to the surgical service . he was made nil per os ( npo ) , and placed on intravenous fluids and pain medication . he was refusing any surgical intervention at this point . on hospital day 5 , a repeat abdominal ct scan demonstrated a normal appearing liver , small bowel , large bowel , and appendix , with a mild increase in pelvic free fluid . as the patient 's symptoms did not improve with conservative management , he ultimately agreed to undergo a diagnostic laparoscopy , and was taken to the operating room on hospital day 9 . the small bowel was run in a retrograde fashion starting at the caecum , and no stricture , mass , or perforation was noticed . appendectomy was not performed as per patient'swishes . following the procedure , the patient reported complete resolution of his symptoms . his diet was gradually advanced , which he tolerated well , and was discharged on post operative day 2 .", "fitz -hugh curtis syndrome was first described in 1920 by carlos stajano . in the 1930 's thomas fitz hugh and arthur curtis also described the syndrome and made a connection between right upper quadrant pain following a pelvic infection and violin string like perihepatic adhesions(5 ) . the first case of gonococcal perihepatitis in a male the incidence ranges from 4% to 14% in women with pid , but is as high as 27% in adolescents with pid , whose less mature genitourinary tract anatomy makes them more susceptible to infection(1 ) . the inflammation of the liver capsule has been attributed to the direct bacterial spread from an infected fallopian tube via the right paracolic gutter . in men , hematogenous and lymphatic spread to liver the predominant symptoms are right upper quadrant pain , tenderness , and pleuritic right sided chest pain(2 ) . these symptoms can pose diagnostic challenges as they may be confused with biliary tract symptoms . in a clinical setting , the diagnosis is adequately established by excluding other possible causes of right upper quadrant pain . on laboratory examination , white blood cell count can be elevated in nearly half of the patients , while liver function tests are normal in most patients . because urethral cultures frequently fail to demonstrate the presence of gonorrhea and chlamydia , the serologic microimmunofluorescence antibody test is helpful in diagnosis ( 2 ) . ct scan may show subcapsular fluid collection , thickening of hepatic capsule in the arterial phase , and wedging enhancement of the involved liver parenchyma in more than 50% of patients . most cases of fitz hugh curtis syndrome are managed with antibiotics against gonorrhea and chlamydia . it occurs mostly in premenopausal women , however , cases in males have also been reported ." ]

[ "chemical shifts are now routinely used as a source of local conformational restraints in the structure determination of proteins by nmr , due mostly to the widespread use of programs such as talos ( cornilescu et al . 1999 ) and shiftor / preditor ( neal et al . 2006 ; berjanskii et al . 2006 ) . these programs share a common approach and output similar data ; both search a database that correlates local patterns of chemical shifts with local conformation , and both provide backbone dihedral angle restraints for individual residues . this approach has been very successful , but has some limitations in the stringent criteria needed for selecting proteins or protein fragments to populate the database , i.e. only those with both highly reliable chemical shift and structural data can be included . although this may seem adequate for example , the talos database contains 186 proteins subdivided into over 24,000 tripeptide fragments ( http://spin.niddk.nih.gov/nmrpipe/talos/)the sequence / conformation search space is very large , and the database coverage is unevenly distributed . as a result , rare combinations of amino - acid and conformation may be under - represented in the database , leading to significant under - prediction and even to errors outside of the heavily populated regions of the ramachandran map . we have adopted an alternative approach to extracting structural data from chemical shifts based on our simshiftdb algorithm . the original simshift was designed to test for structural similarities between proteins in a pair wise manner using chemical shifts to supplement sequence data . simshift showed improved ability to detect distant structural relationships when compared to state - of - the - art methods based on the sequence alone . a natural further development of pairwise comparison was to adapt the simshift algorithm for database searching , resulting in simshiftdb ( ginzinger et al . , simshiftdb provides a list of matching proteins in the database , scored by a measure of statistical significance . in effect it searches a synthetic chemical shift database of 13,000 proteins based on the astral library ( chandonia et al . the matching sequence can be of any length , and structurally similar regions can be found ranging from small , locally similar fragments up to full domains . in principle , any structural alignment method can also be used to make predictions of local conformation by extracting torsion angles from matching regions of the target proteins , and it is this implementation of the simshiftdb algorithm we present here . we benchmark the program against talos as a standard for current methods and hhpred , a sequence search method based on hidden markov models ( sding et al . we show that simshiftdb can significantly increase the amount of information that can be derived from chemical shifts . 2007a ) routine for standardizing chemical shift referencing to produce a pipeline for analysis of chemical shift data .", "full details of the simshiftdb algorithm have been published previously ( see ginzinger et al . 2007b ) , but it is worthwhile giving a brief overview here ( see fig . 1 ) . given a target protein , simshiftdb analyzes each possible pairing of the target protein with one of the template protein structures in the database . here we use the proteins from the astral database ( version 1.71 , filtered for 95% sequence identity ) to build the simshiftdb template database . as simshiftdb is based on the comparison of chemical shift data , the chemical shifts for all entries in the template database are back - calculated from the three - dimensional structure using shiftx ( neal et al . 2003 ) . for each combination of the target protein with a template from the database , top : an example for a set of local similarities for a target protein ( s ) and a template protein ( t ) . bottom : combination of a subset of local similarities to yield a self - consistent final alignmentstep 1 : local similarities are found by looking for high scoring combinations of parts of the target protein sequence ( s ) with parts of the template protein sequence ( t ) . for example , block b in the figure shows that the chemical shifts of the target protein sequence from index xmin to xmax are similar to the chemical shifts of the template protein sequence from index ymin to ymax . the similarity is calculated by summing the pairwise scores of the residues in the similar region in analogy to a pairwise sequence alignment . the pairwise similarity scores are given by the so - called chemical shift substitution matrices , which give a score for each combination of two residues with associated chemical shifts ( for more details see ginzinger 2008).step 2 : the set of local similarities from step 1 is taken as an input for step 2 , where the most significant combination of blocks is identified , according to a statistical model of alignment scores ( karlin and altschul 1993 ) . additionally , two blocks have to fulfill two constraints for their combination to be considered : an explanation of the simshift algorithm . top : an example for a set of local similarities for a target protein ( s ) and a template protein ( t ) . bottom : combination of a subset of local similarities to yield a self - consistent final alignment step 1 : local similarities are found by looking for high scoring combinations of parts of the target protein sequence ( s ) with parts of the template protein sequence ( t ) . fig . for example , block b in the figure shows that the chemical shifts of the target protein sequence from index xmin to xmax are similar to the chemical shifts of the template protein sequence from index ymin to ymax . the similarity is calculated by summing the pairwise scores of the residues in the similar region in analogy to a pairwise sequence alignment . the pairwise similarity scores are given by the so - called chemical shift substitution matrices , which give a score for each combination of two residues with associated chemical shifts ( for more details see ginzinger 2008 ) . step 2 : the set of local similarities from step 1 is taken as an input for step 2 , where the most significant combination of blocks is identified , according to a statistical model of alignment scores ( karlin and altschul 1993 ) . additionally , two blocks have to fulfill two constraints for their combination to be considered : blocks may not overlap in the target or in the template protein ; this would otherwise result in an ambiguous alignment.as the three - dimensional structure of the template protein is known , we further require that the euclidean distance between the end of the first block and the beginning of the second block may be bridged ( according to chemical restraints ) by the relevant sequence of amino acids in the target protein . blocks may not overlap in the target or in the template protein ; this would otherwise result in an ambiguous alignment . as the three - dimensional structure of the template protein is known , we further require that the euclidean distance between the end of the first block and the beginning of the second block may be bridged ( according to chemical restraints ) by the relevant sequence of amino acids in the target protein . finally , we calculate an e - value for the optimal combination of blocks . this e - value represents the number of alignments of equal or better quality , which are expected to occur by chance , given the distribution of the amino acids with associated chemical shifts in the target protein and the template database . additionally , the e - value takes the size of the template database into account . according to the following evaluation , an e - value of < 10 guarantees a high quality alignment .", "to test the performance of simshiftdb , a benchmark set has to be defined for which both chemical shifts and the three - dimensional structure of the protein are available . the bmrb ( seavey et al . 1991 ) is the main public repository for chemical shift data . however , there is no consistent mapping to the structural databases , making it difficult to relate structural with chemical shift information reliably . therefore a mapping between bmrb and astral is calculated based on amino acid sequence similarity . every entry in the benchmark set has to fulfill the following constraints : a 100% sequence match to an astral entry.at least 100 residues with associated chemical shifts ( to exclude very short protein fragments ; e.g. single helices ) . at least 100 residues with associated chemical shifts ( to exclude very short protein fragments ; e.g. single helices ) . to identify protein structures corresponding to the respective bmrb entries , a blast - search ( altschul et al . 1990 ) against the sequences from the astral database is conducted for each bmrb entry . if the full bmrb sequence can be matched without gaps against an astral sequence , the corresponding astral structure is assigned to the bmrb entry . as some entries in bmrb match more than one sequence in astral , one representative structure has to be chosen . 2004 ) provided for each astral entry , thereby selecting the structure with the best resolution . through this procedure a benchmark set containing 144 entries was derived . when calculating the similarity score for two residues , simshiftdb is restricted to at most three chemical shifts from the following list : h , h , n , c , c , and c. thus it is important to select a combination of shifts to extract maximum information , and a priority for replacing missing shifts . to identify the most successful strategy , we tested all possible priorities for the six atom types , resulting in 6 ! the most successful priority was : c > c > h > c > h > n. this is the default priority , and is used in the following analysis . to evaluate the prediction accuracy , we applied the program to all entries in the benchmark set , using all proteins from the simshiftdb template database as potential templates . subsequently , we used all alignments that achieved an e - value better than 10 to infer torsion angles for the target residue from the associated template residues . if residues of the target were mapped multiple times , we based the prediction on the highest scoring alignment . it is important to evaluate the performance of simshiftdb as a function of sequence similarity ; therefore 9 evaluations were performed with the maximum allowed sequence similarity in the evaluated alignments set between 20 and 100% . about 70% of all torsion angles predicted using simshiftdb have a high accuracy ( 15 error ) . another 10 to 20% of the predicted angles have an error of less than 30. therefore simshiftdb yields accurate results in 85 to 90% of the evaluated predictions . through the use of the chemical shifts , this performance is nearly independent of the percentage of sequence identity in the respective alignments.fig . 2evaluation of torsion angle predictions calculated using simshiftdb , separated according to the maximum allowed sequence identity between query and target . the boxes show the percentage of dihedral angle predictions with an error of 30. the red part of each box shows the percentage of predictions with an error of 15. the brown line represents the percentage of residues from the test set for which a prediction exists evaluation of torsion angle predictions calculated using simshiftdb , separated according to the maximum allowed sequence identity between query and target . the boxes show the percentage of dihedral angle predictions with an error of 30. the red part of each box shows the percentage of predictions with an error of 15. the brown line represents the percentage of residues from the test set for which a prediction exists also of interest is the performance of simshiftdb on different types of secondary structure . figures 3 and 4 show the difference between the secondary structure content in all predictions versus that in high quality and erroneous predictions , respectively . it can be seen that predictions for sheet ( for both high quality and erroneous predictions ) match well with the percentage observed in all predictions , and this match is largely independent of sequence similarity . in contrast , the percentage of high quality predictions in helix increases with decreasing sequence similarity , whereas the corresponding percentage in coil regions decreases . for erroneous predictions this seems logical , as the structures for coil regions are less reliable , and predictions are clearly harder to make than for secondary structure . this test shows empirically that simshiftdb has no significant bias when comparing performance in predicting helix versus sheet . the independence of sheet predictions from sequence similarity indicates that the chemical shift data is more diagnostic for sheet than for helix.fig . 3difference between secondary structure content in high quality predictions versus the content for all predictions . the bars show the difference in helix , sheet and coil content ( red , yellow and grey , respectively ) . 4difference between secondary structure content in erroneous predictions versus the content for all predictions using the same scheme as in fig . 3 difference between secondary structure content in high quality predictions versus the content for all predictions . the bars show the difference in helix , sheet and coil content ( red , yellow and grey , respectively ) . the lines show the overall secondary structure content in all predictions difference between secondary structure content in erroneous predictions versus the content for all predictions using the same scheme as in fig . 3 to show empirically that simshiftdb uses the information in the chemical shift data to yield more sensitive alignments , especially in the case of low sequence similarity , we compare simshiftdb to hhsearch ( sding 2005 ) . hhsearch , a sensitive search tool based on hidden markov models , calculates alignments between proteins using the primary sequence complemented by sequence - based predictions of secondary structure . 2005 ) , a protein structure prediction method based on hhsearch alignments , ranked second best in the casp7 ( battey et al . additionally , it is freely available for download and gives the user the possibility to define arbitrary template databases . therefore it is perfectly suited to serve as a reference for purely sequence - based methods . to compare the performance of simshiftdb and hhsearch we used the benchmark set defined in the previous section . for both methods we ran each target protein against the simshiftdb template database and used alignments achieving an e - value better than 10 to predict torsion angles for the residues in the target protein . if residues were mapped multiple times , the prediction was based on the highest scoring alignment . the following notation is used for the presentation of the results :- a simshiftdb prediction is called better if it has an error of 30 and the corresponding hhsearch prediction has an error which is worse by more than 5.two predictions are called equal if both have an error of 30 and the difference between the errors is less than 5 , or both predictions have an error > 30.missing predictions are treated as predictions with an error > 30. a simshiftdb prediction is called better if it has an error of 30 and the corresponding hhsearch prediction has an error which is worse by more than 5. two predictions are called equal if both have an error of 30 and the difference between the errors is less than 5 , or both predictions have an error > 30. missing predictions are treated as predictions with an error > 30. figure 5 shows the results of this evaluation for alignments with maximal sequence identities ranging from 10 to 100% . there is a clear trend for simshiftdb to outperform hhsearch as the sequence identity decreases , demonstrating that simshiftdb uses the structural information in chemical shifts to improve alignments.fig . 5simshiftdb predictions compared to the respective hhsearch predictions , separated according to the maximum allowed sequence identity between query and target . the red line shows the percentage of predictions where simshiftdb performs better , the yellow line show the percentage where simshiftdb is either better or gives a result of equal quality . the brown line corresponds to the number of torsion angles predicted ( right axis ) simshiftdb predictions compared to the respective hhsearch predictions , separated according to the maximum allowed sequence identity between query and target . the red line shows the percentage of predictions where simshiftdb performs better , the yellow line show the percentage where simshiftdb is either better or gives a result of equal quality . the brown line corresponds to the number of torsion angles predicted ( right axis ) it is important to compare simshiftdb to the most prominent method for predicting torsion angles from chemical shifts , namely talos ( cornilescu et al . again we used the benchmark set defined earlier , and made torsion angle predictions based on simshiftdb alignments that achieved an e - value better than 10 . we then compared the quality of each torsion angle prediction to the corresponding talos prediction . figure 6 shows that simshiftdb outperforms talos in at least 30% of all cases . it should be noted that there is likely to be a significant bias towards talos in these results , as many members of the benchmark set will have been calculated using talos restraints.fig . 6simshiftdb predictions compared to the respective talos predictions using the same notation as in fig . 5 simshiftdb predictions compared to the respective talos predictions using the same notation as in fig . 5", "to test the performance of simshiftdb , a benchmark set has to be defined for which both chemical shifts and the three - dimensional structure of the protein are available . the bmrb ( seavey et al . 1991 ) is the main public repository for chemical shift data . however , there is no consistent mapping to the structural databases , making it difficult to relate structural with chemical shift information reliably . therefore a mapping between bmrb and astral is calculated based on amino acid sequence similarity . every entry in the benchmark set has to fulfill the following constraints : a 100% sequence match to an astral entry.at least 100 residues with associated chemical shifts ( to exclude very short protein fragments ; e.g. single helices ) . at least 100 residues with associated chemical shifts ( to exclude very short protein fragments ; e.g. single helices ) . to identify protein structures corresponding to the respective bmrb entries , a blast - search ( altschul et al . 1990 ) against the sequences from the astral database is conducted for each bmrb entry . if the full bmrb sequence can be matched without gaps against an astral sequence , the corresponding astral structure is assigned to the bmrb entry . as some entries in bmrb match more than one sequence in astral , one representative structure has to be chosen . 2004 ) provided for each astral entry , thereby selecting the structure with the best resolution . through this procedure", "when calculating the similarity score for two residues , simshiftdb is restricted to at most three chemical shifts from the following list : h , h , n , c , c , and c. thus it is important to select a combination of shifts to extract maximum information , and a priority for replacing missing shifts . to identify the most successful strategy , we tested all possible priorities for the six atom types , resulting in 6 ! = 720 evaluations . the most successful priority was : c > c > h > c > h > n. this is the default priority , and is used in the following analysis . to evaluate the prediction accuracy , we applied the program to all entries in the benchmark set , using all proteins from the simshiftdb template database as potential templates . subsequently , we used all alignments that achieved an e - value better than 10 to infer torsion angles for the target residue from the associated template residues . if residues of the target were mapped multiple times , we based the prediction on the highest scoring alignment . it is important to evaluate the performance of simshiftdb as a function of sequence similarity ; therefore 9 evaluations were performed with the maximum allowed sequence similarity in the evaluated alignments set between 20 and 100% . about 70% of all torsion angles predicted using simshiftdb have a high accuracy ( 15 error ) . another 10 to 20% of the predicted angles have an error of less than 30. therefore simshiftdb yields accurate results in 85 to 90% of the evaluated predictions . through the use of the chemical shifts , this performance is nearly independent of the percentage of sequence identity in the respective alignments.fig . 2evaluation of torsion angle predictions calculated using simshiftdb , separated according to the maximum allowed sequence identity between query and target . the boxes show the percentage of dihedral angle predictions with an error of 30. the red part of each box shows the percentage of predictions with an error of 15. the brown line represents the percentage of residues from the test set for which a prediction exists evaluation of torsion angle predictions calculated using simshiftdb , separated according to the maximum allowed sequence identity between query and target . the boxes show the percentage of dihedral angle predictions with an error of 30. the red part of each box shows the percentage of predictions with an error of 15. the brown line represents the percentage of residues from the test set for which a prediction exists also of interest is the performance of simshiftdb on different types of secondary structure . figures 3 and 4 show the difference between the secondary structure content in all predictions versus that in high quality and erroneous predictions , respectively . it can be seen that predictions for sheet ( for both high quality and erroneous predictions ) match well with the percentage observed in all predictions , and this match is largely independent of sequence similarity . in contrast , the percentage of high quality predictions in helix increases with decreasing sequence similarity , whereas the corresponding percentage in coil regions decreases . for erroneous predictions this seems logical , as the structures for coil regions are less reliable , and predictions are clearly harder to make than for secondary structure . this test shows empirically that simshiftdb has no significant bias when comparing performance in predicting helix versus sheet . the independence of sheet predictions from sequence similarity indicates that the chemical shift data is more diagnostic for sheet than for helix.fig . 3difference between secondary structure content in high quality predictions versus the content for all predictions . the bars show the difference in helix , sheet and coil content ( red , yellow and grey , respectively ) . 4difference between secondary structure content in erroneous predictions versus the content for all predictions using the same scheme as in fig . 3 difference between secondary structure content in high quality predictions versus the content for all predictions . the bars show the difference in helix , sheet and coil content ( red , yellow and grey , respectively ) . the lines show the overall secondary structure content in all predictions difference between secondary structure content in erroneous predictions versus the content for all predictions using the same scheme as in fig . 3", "to show empirically that simshiftdb uses the information in the chemical shift data to yield more sensitive alignments , especially in the case of low sequence similarity , we compare simshiftdb to hhsearch ( sding 2005 ) . hhsearch , a sensitive search tool based on hidden markov models , calculates alignments between proteins using the primary sequence complemented by sequence - based predictions of secondary structure . 2005 ) , a protein structure prediction method based on hhsearch alignments , ranked second best in the casp7 ( battey et al . 2007 ) experiment . additionally , it is freely available for download and gives the user the possibility to define arbitrary template databases . therefore it is perfectly suited to serve as a reference for purely sequence - based methods . to compare the performance of simshiftdb and hhsearch we used the benchmark set defined in the previous section . for both methods we ran each target protein against the simshiftdb template database and used alignments achieving an e - value better than 10 to predict torsion angles for the residues in the target protein . if residues were mapped multiple times , the prediction was based on the highest scoring alignment . the following notation is used for the presentation of the results :- a simshiftdb prediction is called better if it has an error of 30 and the corresponding hhsearch prediction has an error which is worse by more than 5.two predictions are called equal if both have an error of 30 and the difference between the errors is less than 5 , or both predictions have an error > 30.missing predictions are treated as predictions with an error > 30. a simshiftdb prediction is called better if it has an error of 30 and the corresponding hhsearch prediction has an error which is worse by more than 5. two predictions are called equal if both have an error of 30 and the difference between the errors is less than 5 , or both predictions have an error > 30. missing predictions are treated as predictions with an error > 30. figure 5 shows the results of this evaluation for alignments with maximal sequence identities ranging from 10 to 100% . there is a clear trend for simshiftdb to outperform hhsearch as the sequence identity decreases , demonstrating that simshiftdb uses the structural information in chemical shifts to improve alignments.fig . 5simshiftdb predictions compared to the respective hhsearch predictions , separated according to the maximum allowed sequence identity between query and target . the red line shows the percentage of predictions where simshiftdb performs better , the yellow line show the percentage where simshiftdb is either better or gives a result of equal quality . the brown line corresponds to the number of torsion angles predicted ( right axis ) simshiftdb predictions compared to the respective hhsearch predictions , separated according to the maximum allowed sequence identity between query and target . the red line shows the percentage of predictions where simshiftdb performs better , the yellow line show the percentage where simshiftdb is either better or gives a result of equal quality .", "it is important to compare simshiftdb to the most prominent method for predicting torsion angles from chemical shifts , namely talos ( cornilescu et al . 1999 ) . again we used the benchmark set defined earlier , and made torsion angle predictions based on simshiftdb alignments that achieved an e - value better than 10 . we then compared the quality of each torsion angle prediction to the corresponding talos prediction . figure 6 shows that simshiftdb outperforms talos in at least 30% of all cases . it should be noted that there is likely to be a significant bias towards talos in these results , as many members of the benchmark set will have been calculated using talos restraints.fig . 6simshiftdb predictions compared to the respective talos predictions using the same notation as in fig . 5 simshiftdb predictions compared to the respective talos predictions using the same notation as in fig . 5", "we have presented simshiftdb and shown that the program is able to sensitively extract structural information from chemical shift data . this information is to a certain extent complementary to that from currently available tools . on one hand simshiftdb shows its strength especially in cases of low sequence similarity , which underlines the advantage of including chemical shift information in the alignment algorithm . on the other hand , we were able to show that one - third of the predictions by simshiftdb clearly have a higher quality than the corresponding talos predictions , and this is largely independent of sequence similarity . the main advantage of simshiftdb is derived from its superior coverage of the search space , due to the large and quickly adaptable template database . simshiftdb outperforms talos especially in those cases where talos finds no predictions classified as good according to its selection criteria . simshiftdb and talos are therefore complementary , and can be used in parallel to increase the number of available predictions . ph1500c is a 78-residue homo - hexameric domain currently under investigation in our laboratories , and was chosen because it shows no significant sequence similarity to proteins of known structure . we used simshiftdb to search for templates matching ph1500c , using several different chemical shift priorities . the search identifies several templates at e - values around 10 , which correspond to the region g17-f40 of ph1500c and consist of three - stranded -meander linked by two tight turns ( fig . the consensus of simshiftdb predictions shows the first turn to be a standard type i -turn , while the second is a less commonly observed 5-residue -turn . an example template agrees very well with all structural data available in this region ( fig . 7 ) , and suggests local conformational details such as sidechain positions and local hydrogen bonding networks.fig . the left panel shows a representative template structure found in a simshiftdb search for ph1500c ( 1p22 , residues a392-w415 ) . residues shown in green are predicted by talos to be in the -region of ramachandran space and the residue in yellow in the + -region , while for residues in white there is no prediction . only one talos prediction is made for the six residues outside of canonical secondary structure , i.e. the two turns and the -bulge in the first strand . the right panel shows the structure calculated with all available nmr data , showing very good agreement to the template . the coloring is as above , with the addition of blue residues for residues in the -region of ramachandran space . a conserved sidechain hydrogen - bond acceptor ( t101 in ph1500c ) is shown in grey , highlighting the ability of simshiftdb searches to reveal fine structural detailsfig . 8the simshiftdb web - interface at the center for applied molecular engineering an example simshiftdb search result . the left panel shows a representative template structure found in a simshiftdb search for ph1500c ( 1p22 , residues a392-w415 ) . residues shown in green are predicted by talos to be in the -region of ramachandran space and the residue in yellow in the + -region , while for residues in white there is no prediction . only one talos prediction is made for the six residues outside of canonical secondary structure , i.e. the two turns and the -bulge in the first strand . the right panel shows the structure calculated with all available nmr data , showing very good agreement to the template . the coloring is as above , with the addition of blue residues for residues in the -region of ramachandran space . a conserved sidechain hydrogen - bond acceptor ( t101 in ph1500c ) is shown in grey , highlighting the ability of simshiftdb searches to reveal fine structural details the simshiftdb web - interface at the center for applied molecular engineering this example highlights the major difference in the simshiftdb and talos approaches , i.e. the length of the template structures found by simshiftdb when compared to the tripeptides used to make talos predictions . the second difference is the use of the e - value as a continuous measure of quality , rather than a discrete selection criterion based on a consensus of the ten best hits . in some cases there may be only one or two templates found for any region of the protein , but low e - value scores can nevertheless allow predictions with high confidence . we have established an accuracy of above 85% for simshiftdb predictions , based on our benchmark set of proteins . this may at first glance compare poorly to talos , where an accuracy of 9798% is reported . however , it must be considered that this value is based on single simshiftdb predictions , rather than the consensus of 10 predictions . also , it is worth noting that talos is very accurate within secondary structure , and therefore the 23% of errors must be concentrated in the smaller fraction of other predictions . in our experience , these errors often result from predictions made out of structural context ; e.g. for a residue in a -turn based on tripeptides from a helix . the wider context provided by simshiftdb results should therefore add both to the confidence of its predictions and those from talos . the optimum chemical shift priority found for simshiftdb searches is somewhat surprising in that it contains h , which is not generally regarded as containing much structural information . perhaps this is due to some complementarities of the information from h and that from other shifts . it is worth noting , though , that the difference between the best priorities is small , and it may be worth testing a range of priorities . this is easily possible ; although the program searches a database of 13,000 protein structures , an average simshiftdb run takes only 30 seconds on a standard laptop ( intel t2500 , 2.0 ghz , 1 gb ram ) . the different results are comparable using the calculated e - values , thereby enabling the user to select the most promising result ." ]

[ "sutureless clear corneal incisions are now arguably the most common incisions made to perform cataract surgery with phacoemulsification , replacing scleral tunnel and limbal incisions . there are significant differences in the effects of clear corneal and scleral or limbal incisions , related to anatomical and physiological differences in the respective structures where the incisions are made . the cornea is comprised of a regular lamellar structure of collagen fibrils that stretch from limbus to limbus , arranged in a lattice formation ; this is what provides the primary structural support of the cornea and accounts for its transparency . vascular arcades are present , providing a potential source of fibroblasts . the differences in the healing effects of incisions at the limbus and the cornea have been previously discussed in the literature [ 24 ] . limbal incisions appear to heal more quickly and are more resistant to deformation pressure than those in the cornea . clear corneal incisions also appear to increase the likelihood of endophthalmitis , potentially for the reasons above . in short , there are no disadvantages to a limbal incision in terms of surgical safety . from a structural point of view it is known that incisions for cataract surgery will induce a flattening effect when made on ( or near ) the steep axis of the cornea . this effect is positively correlated with incision size ( larger incisions generating more astigmatism , all other things being equal ) and location ( scleral or limbal incision inducing less astigmatism than clear corneal ) , though for small incisions the effect of location appears less critical [ 6 , 7 ] . wound construction also appears to have an effect , with square incisions reported to affect astigmatism the least . data related to surgically induced astigmatism in the recent literature is primarily related to clear corneal incisions . the data reported here summarize the astigmatic changes produced with a small ( 2.2 mm ) square posterior limbal incision .", "a retrospective patient chart review was conducted at one site ( pe ) for a study of toric and spherical iols . those eyes with preoperative and postoperative keratometry results eyes were excluded if they had irregular ( nonorthogonal ) corneal astigmatism or if they had previous corneal surgery . this obviated the need for a specific informed consent or irb approval for the data collection undertaken here . in addition , all patients sign an acknowledgement that their deidentified phi data may be used for research purposes when they are seen in the practice . comparative surgically induced astigmatism data were obtained from one of the authors ( w. hill ) from a website specifically designed to collect preoperative and postoperative keratometry data for the purposes of calculating surgically induced astigmatism . this site provides the necessary spreadsheet and instructions to surgeons for the calculation of sia . an option allows any surgeon who uses the spreadsheet to upload their data to the website for the purposes of aggregate analysis . again , no phi was collected so informed consent was not required for this data set . results from ph and the aggregate data from wh were tabulated in microsoft excel and analyzed using statistica statistical software . differences between groups were calculated with t - tests and analysis of variance ( anova ) tests , with significance at p < 0.05 . for the patients at one site ( p. ernest ) the data were corroborated with an automated keratometry reading and the automated keratometry feature of the iolmaster ( carl zeiss meditec , jena , germany ) . the automated keratometry readings were repeated on all patients postoperatively , and the comparison to the preoperative automated keratometry was used to calculate sia . the surgical technique employed in the time period in which the retrospective data were collected was constant for all patients . all incisions were temporal , 2.2 mm square posterior limbal incisions , using a technique previously described in the literature . surgical technique was not described in the aggregate sia data collected off the web , but incision type ( e.g. , clear corneal , limbal ) was generally indicated , and the size of the incision was noted . these variables were collected so that surgeons could submit different preoperative and postoperative data sets for different incision sizes and locations .", "the review of available clinical records from pe yielded a total of 38 eyes that both met the criteria for inclusion and had available postoperative keratometry data for analysis . surgically induced astigmatism was calculated as the vector difference between preoperative and postoperative anterior corneal astigmatism as measured with automated keratometry . the sia in this cohort averaged 0.25 d with a standard deviation of 0.14 d. a total of 1,712 eyes were available in the aggregate sia data from w. hill , from 51 different surgeons . the data were filtered to remove duplicates , include only incision sizes of 2.2 mm , and exclude those records where the incision type was not indicated . where there were not at least 20 surgeries in any incision category ( size and location ) for a surgeon , those data were also deleted . after this data - screening step , 246 surgeries from 5 surgeons remained for comparative analysis . average preoperative keratometry was not statistically significantly different between surgeons ( p = 0.41 ) ; means ranged from 43.8 d to 44.5 d. the magnitude of preoperative corneal cylinder was also not statistically significantly different between surgeons ( p = 0.13 ) ; means ranged from 0.79 d to 1.04 d. \n table 1 contains a summary of the surgically induced astigmatism by surgeon . looking at the aggregate clear corneal incision data versus the ernest posterior limbal data , there was a statistically significant difference in the surgically induced astigmatism by incision type ( p < 0.001 ) . inside the clear corneal group as a post hoc test , the ernest data were compared to the surgeon with the lowest average sia from the clear corneal incision group ( surgeon 5 ) ; there was a statistically significantly lower mean sia in the ernest cohort ( p = 0.001 ) . note , too , that the standard deviation of the ernest cohort is less than half that of the cohorts of 4 of the 5 other surgeons , and 40% lower than surgeon 5 despite having less than half the sample size . \n surgeons 1 to 5 used 2.2 mm clear corneal incisions , while pe used a 2.2 mm square posterior limbal incision . there was a statistically significant difference in sia by surgeon ( p < 0.001 ) . post hoc testing showed that the ernest data yielded a statistically significantly lower sia than the other surgeons ' data .", "the results suggest that the magnitude and the variability of surgically induced astigmatism with small incision surgery ( 2.2 mm ) is significantly lower if a posterior limbal incision is used instead of a clear corneal incision . results for the clear corneal incisions used here as comparative data are consistent with those recently reported in the literature . wilczynski et al . reported sia values of 0.50 0.25 d with 1.7 mm and 1.8 mm surgical incisions . holland reported sia values of 0.6 0.4 d for 2.4 mm clear corneal incisions . masket reported that sia results were somewhat lower with his 2.2 mm clear corneal incisions ( 0.35 0.21 d ) but it is worth noting that his incision was started with a groove at the temporal limbus . some of the variability of sia data from surgeons other than ernest is likely related to differences in technique between surgeons . in addition , intrasurgeon variability may be slightly higher if surgeons did not measure their postoperative keratometry 1 month or more after surgery , as there is some change in keratometry expected in that first month . the minimization of the magnitude ( and variability ) of surgically induced astigmatism is important for modern day cataract surgery , particularly with the use of toric and multifocal intraocular lenses residual astigmatism after surgery will reduce the likelihood of spectacle independence for distance vision for these patients . minimizing astigmatism for multifocal iols is equally important , as even small amounts of residual astigmatism can compromise the outcome with regard to uncorrected visual acuity at distance . surgeons interested in reducing the magnitude and variability of induced astigmatism at the time of cataract surgery may want to consider the use of a 2.2 mm square posterior limbal incision ." ]

[ "the embryonic development of the cerebellum derives from the hindbrain from the fifth week , originating from the thickening of the dorsal alar plates . anatomically it is formed by a median portion , the vermis , connected to two large lateral masses , the cerebellar hemispheres . the cisterna magna is located in the posterior fossa and occupies the space between the underside of the cerebellum , the posterior side of the bulb and the roof of the fourth ventricle . it continues caudally with the spinal subarachnoid space and binds to the fourth ventricle through the opening median . at ultrasonography the cerebellar hemispheres are usually low to moderately echogenic , connected above by an echogenic cerebellar tentorium . the vermis is a highly echogenic structure , which can be recognized as an oval density in the midline of the axial and sagittal plans . the cerebellum and cisterna magna can be observed on ultrasound around 11 weeks , but the formation of the cerebellar vermis ends around 18 weeks . for this reason , we must be careful in early diagnosis of the posterior fossa anomalies before this period , due to the possibility of a pathological image simulation [ 3 , 4 ] . the measurement of the transverse cerebellar diameter by two - dimensional ultrasonography ( 2dus ) is a very reliable parameter in the evaluation and early detection of intrauterine growth restriction . on the other hand , an adequate evaluation of the posterior fossa abnormalities allows the diagnosis of the cisterna magna as the dandy - walker complex , megacisterna magna , and blake 's cyst . the three - dimensional ultrasonography ( 3dus ) appeared as an important tool in the evaluation of fetal central nervous system in the late 1990s , because of the development of high resolution endocavitary volumetric transducers . currently , with the development of new software like volume contrast imaging allows adequate evaluation of posterior fossa anomalies as well as the biometry of the cerebellar vermis [ 7 , 8 ] . the three - dimensional extended imaging software ( 3d xi - medison , seoul , korea ) is composed of three programs : multislice view , volume ct view , and oblique view . the multislice consists of multiple sequential and adjacent planes arranged in the set screen ( sagittal , axial , and coronal ) . the reference plane , number of images arranged in the screen ( 1 1 , 2 1 , 3 2 , 4 3 , or 6 2 ) , orientation and rotation of the image , the magnitude of the magnification , and depth and range between the planes ( 0.5 to 5.0 mm ) can be adjusted according to the region of interest . a preliminary study evaluated the application of the multislice view in fetal central nervous system anomalies , showing potential benefits . up to date there are no studies evaluating the measures of the fetal cerebellum and cisterna magna by 3dus using the multislice view . the objective of this study is to compare the measurements of transverse cerebellar and anterior - posterior cisterna magna diameter obtained by 2d and 3dus using the software 3d xi in normal pregnant women between 18 and 24 weeks .", "a prospective cross - sectional study between march 2010 and february 2011 , involving 69 normal pregnant women between 18 and 24 weeks was performed . this study was approved by the research ethics committee of the irmandade da santa casa de misericrdia de so paulo , brazil , and the patients who agreed to participate signed a term of consent . this study was carried out at the department of obstetrics and gynecology , faculty of medical sciences of santa casa of so paulo ( fcmscsp ) . the patients were randomly selected , and all evaluation made by a single examiner ( fsbb ) , with five years experience in obstetric ultrasound . the examinations were performed on a sonoace x8 ( samsung - medison , seoul , korea ) device equipped with multifrequency volumetric convex transducer ( 37 mhz ) . the criteria for inclusion were ( 1 ) unique pregnancy with live fetus and ( 2 ) gestational age evaluated by last menstrual period and confirmed by ultrasound performed until the 14th week ( crown - rump length - crl : 484 mm ) . exclusion criteria were ( 1 ) pregnant women carrying fetuses with structural anomalies detected at the time of the examination and ( 2 ) pregnant women carrying chronic diseases that would interfere with fetal growth . initially , a realtime 2d evaluation was performed in order to evaluate the biometry , morphology , and quantification of amniotic fluid volume . for the 2d measurement of transverse cerebellar and anterior - posterior cisterna magna diameter , it was performed a modified transversal slice of the fetal head slightly angled , through the thalamus , cerebellar hemispheres , cisterna magna , cave of septum pellucidum , the occipital bone , and nuchal fold . an insonation angle of the occipital bone was chosen , taking care that it was focused on an angle of 30. it was performed a single measurement of transverse cerebellar and antero - posterior of the fetal cisterna magna diameter in each mother , and this image is saved in the memory of the device . the three - dimensional volume acquisition was performed on the same 2d plane in which was performed the measurements of the transverse cerebellar diameter and anterior - posterior cisterna magna , to encompass the entire fetal skull ( roi - region of interest ) ( figure 1(a ) ) . in order to standardize all 3d measurements , the following preset was used on the device : scanning3d static ; display mode three - dimensional extended imaging ( multislice view ) ; scanning speed slow ; angle scanning70 ; overall gain of the device50% . after the three - dimensional scanning , the image was displayed in the multiplanar mode ( axial , sagittal , and coronal ) ( figure 1(b ) ) . the volumes were saved in the device memory and then stored on compact discs ( cds ) and transferred to a personal computer . the analyses were performed offline in the same apparatus in a time period of 30 to 120 days after the volumetric capture . for measurements of the transverse cerebellar and anterior - posterior cisterna magna diameters the program multislice view on 3 2 ( two rows and three columns ) was chosen , with slice thickness of 0.5 mm ( figure 1(c ) ) . the buttons 3 and 4 of the device were maneuvered , for navigation between tomographic slices , until in one of them the image of the cerebellum disappeared in higher plan than that of the posterior fossa ( figure 1(d ) ) . from this point , the 1 1 ( one row and one column ) option was selected and the number of the image was recorded . with the presence of only one tomographic slice on the screen , the button 4 of the apparatus was rotated clockwise or counterclockwise , depending on the fetus position , leading the exposition of a lower plan , successively until the outline of the cerebellum began to appear . following , each plan of the cerebellum and the cisterna magna was measured , with a difference of 0.5 mm between them to the normal cerebellum outline disappeared and the bone of the skull base could be observed . on average , measurements of the transverse cerebellar diameter and the antero - posterior diameter of the cisterna magna were performed in 25 consecutive plans in each volume , being considered as the value of the measurement of the cerebellum and the cisterna magna by 3d xi method the highest value obtained . the average time for manipulation of the 3d volume measurement of the cerebellum and the cisterna magna was 180 seconds . the data were transferred to an excel 2007 ( microsoft corp , redmond , wa , usa ) spreadsheet and analyzed by the statistical package for social sciences ( spss inc . , chicago , il , usa ) version 19.0 for windows . for the 2d and 3d measurements of the transverse cerebellar diameter and antero - posterior cisterna magna , mean , median , maximum , and minimum values were calculated . and for the 3d measurements percentiles 5 , 10 , 90 , and 95 were also calculated in each gestational age evaluated . to evaluate the difference between the two techniques the wilcoxon test was used . to evaluate the correlation of 2d and 3d , measurements of the transverse cerebellar diameter and antero - posterior cisterna magna as well as measurements of biparietal diameter ( bpd ) and head circumference ( hc ) according to the gestational age , the spearman 's correlation coefficient ( r ) was used . in cases of high correlation , polynomial regression models , with adjustments by the coefficient of determination ( r ) the first examiner ( fsbb ) held a second 2d and 3d measures in 8 cases randomly selected 7 days after the first . for interobserver reproducibility , a second examiner ( lsvf ) , with the same experience in obstetric ultrasound performed a third measure of these same 8 cases , and the results were armored one of the other . for this purpose , to calculate the reproducibility intraclass correlation coefficient ( icc ) and it is considered poor correlation icc < 0.40 ; satisfactory iccs between 0.40 and 0.75 and excellent icc 0.75 . the bland - altman plots evaluate the average of measurements performed by one or two examiners plotted against the difference of their mean values with standard deviation 1.96 ( limits of agreement ) . in all analysis we used a significance level ( p ) < 0.05 .", "the 69 patients initially selected met the criteria for inclusion and exclusion , being allocated in the final statistical analysis . the age of the pregnant women ranged from 17 to 41 years , with an average of 26.93 years ( standard deviation 6.10 years ) . the number of pregnancies ranged from 1 to 6 , with an average of 2.19 pregnancies ( standard deviation of 1.32 pregnancies ) . the average transverse and anterior - posterior cerebellum and cisterna magna diameter by 3dus ranged from 9.23 3.16 mm ( 18.0629.34 ) and 6.62 1.41 mm ( 4.1910.45 ) , respectively . the average transverse diameter and antero - posterior cerebellum and cisterna magna by 2dus ranged from 22.33 3.16 mm ( 18.1429.10 ) and 5.60 1.33 mm ( 3.189.32 ) , respectively . it was observed that on average the measurements obtained by 3dus were significantly higher , 0.76 and 1.02 mm for the length of the cerebellum and cisterna magna , respectively ( p < 0.001 ) ( tables 1 and 2 ) . there was a high correlation between the measurement of transverse cerebellar diameter by 3dus with gestational age ( r = 0.940 , p < 0.001 ) as well as measures of dbp ( r = 0.927 , p < 0.001 ) and hc ( r = 0.938 , p < 0.001 ) . the equation that best represented the correlation between the extent of the transverse cerebellar diameter and gestational age was of a second degree : dtc = 7.231 + 1.851 ga 0.027 ga2 ( r = 0879 ) . for the measurement of antero - posterior diameter of the cisterna magna , a low correlation between gestational age , bpd , and hc ( r = 0.462 , p < 0.001 ; r = 0.430 , p < 0,001 ; r = 0.517 , p < 0.001 , resp . ) ( figure 2 ) was observed . the low correlation between the antero - posterior diameter of the cisterna magna and gestational age did not allow the construction of polynomial regression models . tables 3 and 4 show the percentiles 5 , 10 , 90 , and 95 for measurements of the transverse and anterior - posterior cerebellum and cisterna magna diameter at each gestational age evaluated . an icc > 0.66 for all intra- and interobserver measurements of the cerebellum and cisterna magna length by 3dus was observed , with the exception of the intraobserver measurement of the length of cisterna magna ( icc = 0.792 , 0.668 , 0.691 , and 0.287 , resp . ) . the mean differences as well the limits of agreement for intraobserver and interobserver reproducibility of the cerebellum and cisterna magna length by 3dus were 0.16 mm ( limits of agreement , 0.79 ; 1.11 ) , 0.13 mm ( limits of agreement , 1.22 ; 0.95 ) , 0.08 mm ( limits of agreement , 0.67 ; 0.82 ) , and 0.12 mm ( limits of agreement , 0.69 ; 0.93 ) , respectively ( figures 3 and 4 ) .", "the posterior fossa cystic malformations include abnormalities of the meninges ( arachnoid cyst , megacisterna magna ) and cerebellum ( dandy - walker malformation and variants ) . the prenatal diagnosis of these malformations is of great importance for an adequate followup of pregnancy as well as the relatives counseling . the postnatal results are in general very bad in the dandy - walker malformation and variants , mainly as result of associated anomalies . the postnatal result of megacisterna magna is better , especially if isolated . in this study , we compared the measurements of the transverse and antero - posterior cerebellum and cisterna magna diameters by 2d and 3dus between 18 and 24 weeks . this interval was defined by the fact that the transverse cerebellar diameter showed the highest correlation with gestational age , its measurement in millimeters is similar to the gestational age in weeks . furthermore , the diagnosis of agenesis of the vermis , especially the partial can not be performed before 18 weeks . in relation to the antero - posterior diameter of the cisterna magna , in general , in this period the ultrasound of the second trimester for malformations evaluation will be performed , its normal measure being less than 10 mm . in this study we observed that the transverse cerebellar and anterior - posterior cisterna magna diameters by 2d and 3dus increased from 18 to 24 weeks , however , the cisterna magna measurements by 3dus showed low correlation with the gestational age . in a cross - sectional study carried out by vinkesteijn et al . with 360 normal pregnant women between 17 and 34 weeks , the average of fetal transverse cerebellar diameter by 2dus was 22.1 mm from 18 to 24 weeks , very similar to our results obtained using 2dus ( 22.33 mm ) . in another cross - sectional study carried out by koktener et al . with 194 normal pregnant women between 16 and 24 weeks , the mean antero - posterior diameter of the cisterna magna by 2dus was 4.83 mm , lower than that obtained in our study ( 5.60 mm ) . the test to prove that the antero - posterior diameter of the cisterna magna increased from 18 to 24 weeks is important because the fixed value of 10 mm for the indication of normality can not be real in more advanced gestational ages . we believe that this low correlation measurement of the cisterna magna by 3dus and gestational age is due to a greater difficulty in identifying the edges of the structure as it progresses toward the occipital bone . in general , the mean diameters of the transverse and anterior - posterior cerebellum and cisterna magna by 2dus were lower than those obtained by 3dus . in studies evaluating the volume of fetal cerebellum by 3dus , there was also an increase in this parameter with the gestational age , both by multiplanar and virtual organ computer - aided analysis ( vocal ) methods [ 1820 ] . there are no studies evaluating the volume of the fetal cisterna magna by 3dus throughout gestation . other studies using other softwares such as three - dimensional volume contrast imaging c - plane have shown a positive correlation between the biometrics of the vermis and gestational age [ 821 ] . we observed in this study a statistically significant difference in the measurement of transverse and anterior - posterior cerebellum and cisterna magna by 2d and 3dus using the 3d xi ( multislice view ) software . the program multislice view ( samsung - medison , seoul , korea ) allows the evaluation of multiple plans of sequential and adjacent images arranged on the screen , being the thickness of the slices determined by the operator . in this study , we evaluated an average of 25 plans with 0.5 mm thickness between them , from the plan of the transverse cerebellar diameter measure to a plan in which the usual outline was lost and the bone of the skull base could be observed . we used as the final value the greatest measure found , unlike the 2dus in which we used a single measure . we believe that the measures taken by 3dus should be more reliable because it corrects any small displacement of the sound beam transducer , which can compromise the 2d measure . however , the biggest inconvenience of this technique , which makes its application in clinical practice difficult , is the long time required to perform the measurements , an average 180 seconds . we noticed in this study an icc value > 0.66 for all length measurements of the fetal cerebellum and cisterna magna through 3dus , except for the intraobserver measure of the cisterna magna ( icc = 0.287 ) . such a result could assume a low reproducibility of the new method ; however , by bland - altman plot it was observed that the intraobserver mean difference was similar to the cerebellum and cisterna magna ( 0.16 and 0.13 mm , resp . ) . we believe that the low value of icc is due to the small number of cases we evaluated , and as this is a laborious technique with average rating of 25 plans per volume , with a mean time of 180 seconds , it may have contributed to this low value of icc . however , the real applicability of the method can only be testified in further studies evaluating pathological cases of fetal central nervous system . we believe that the great importance of this study is the evaluation of borderline cases , such as an anterior - posterior diameter of the fetal cisterna magna of 9.0 mm and a transverse cerebellar diameter of 16 mm at 18 weeks of gestational age . in these cases the 3dus with the program multislice view can help in decision making between normal and pathological cases , modifying the prenatal , and counseling of the parents . in summary , this was the first study that compared the measurements of the transverse and antero - posterior fetal cerebellum and cisterna magna diameters by 2d- and 3dus using the 3d xi ( multislice view ) software . the measurements the length of the fetal cerebellum and cisterna magna by 3dus were significantly higher than those obtained by 2dus . the length measurement of the cisterna magna by 3dus showed low correlation with gestational age . measures the length of the cerebellum and cisterna magna by 3dus proved to be reproducible ." ]

[ "the protocol for this cross - sectional study was reviewed and approved by the institutional ethical committee for clinical research at the geneva university hospitals . all patients who had received a whole pancreas or an islet of langerhans transplant at the geneva university hospitals and who had regular follow - ups at our institution were asked to participate in the study . patients were required to have at least partial graft function ( as determined by positive c - peptide levels ) . fifteen islet transplant recipients were enrolled in the islet group , which was further subdivided into an insulin - independent group ( ii - isl ) and an insulin - requiring group ( ir - isl ) . ten healthy nondiabetic volunteers were recruited to serve as control subjects . finally , five patients with type 1 diabetes awaiting pancreas or islet transplant , all of whom demonstrated no c - peptide production at the time of study inclusion , served as negative control subjects . written informed consent was obtained from all patients and control subjects prior to their participation in the study . demographics and population characteristics all samples were obtained from patients during either their annual posttransplantation follow - up or one of their regularly scheduled outpatient consultations . the serum was labeled using the same anonymous codes assigned to the tubes at the time of the test . an arginine stimulation test was performed on all subjects to determine basal and stimulated pancreatic hormone levels . blood was drawn at 10 , 0 , 2 , 3 , 4 , 5 , 7 , and 10 min from intravenous injection of a 5 g arginine bolus . patients who were back on insulin were required to discontinue slow - acting insulin at least 24 h prior to the test and rapid - acting insulin at least 6 h before the test . serum levels of insulin , c - peptide , total proinsulin , and intact proinsulin ( ipi ) were then measured using commercially available elisas as described below . acute insulin response ( air ) was calculated as the mean of the three highest values between 2 and 5 min minus the mean of the basal values at 10 and 0 min . the area under the curve ( auc ) between 0 and 10 min postinjection for insulin and c - peptide was calculated by the trapezoidal rule with the mean of the baseline values subtracted . proinsulin fragments , including split-32,33 proinsulin , des-31,32 proinsulin , split-65,66 proinsulin , and des-64,65 proinsulin , were obtained by subtracting ipi from total proinsulin . ratios of insulin to total proinsulin and insulin [ insulin/(total proinsulin+insulin ) ] as well as proinsulin fragments to total proinsulin ( proinsulin fragments / total proinsulin ) were calculated to quantify the rate of proinsulin processing . ratios representing peak stimulation were calculated as the mean of ratios for the three highest time points between 2 and 5 min after arginine stimulation . insulin/(total proinsulin+insulin ) ratio represents the quantity of fully processed insulin with respect to all circulating forms of the hormone . commercially available elisas were used to measure hormone levels for insulin , c - peptide , total proinsulin , and ipi . the following kits were used : insulin ( mercodia , uppsala , sweden ) , c - peptide ( mercodia ) , total proinsulin ( millipore , zug , switzerland ) , and ipi ( millipore ) . concentrations were determined using a standard curve with high- and low - level control subjects . cross - reactivities of the assays were provided by the manufacturer and are as follows : the insulin assay cross - reacts 98% with des-64,65 proinsulin , < 0.01% with c - peptide and proinsulin , and < 0.05% with des-31,32 proinsulin and split-32,33 proinsulin ; the c - peptide elisa cross - reacts < 0.0006% with insulin , < 1.8% with proinsulin , 10% with split-65,66 proinsulin , 74% with des-64,65 proinsulin , 3% with des-31,32 proinsulin , and 2% with split-32,33 proinsulin ; the total proinsulin elisa cross - reacts 100% with intact and des-31,32 proinsulin , and 81% with des-64,65 proinsulin ; the ipi elisa cross - reacts 36% with des-64,54 proinsulin , and it shows no cross - reactivity with des-31,32 proinsulin . the lower limits of detection of the assays were provided by the manufacturer and are as follows : the insulin assay has a detection limit of 6 pmol / l , the total proinsulin assay has a limit of 0.5 pmol / l , and the ipi assay has a lower limit of 0.1 pmol / l . all statistical analyses were performed using prism 6 software ( graphpad software , la jolla , ca ) . for all analyses , values obtained from healthy subjects were used as control subjects . for data that were normally distributed , student t test was used to compare two groups , and one - way anova was used to compare between more than two groups . for data that had non - gaussian distributions , we used the mann - whitney test to compare between two groups and the kruskal - wallis test to compare between more than two groups .", "all samples were obtained from patients during either their annual posttransplantation follow - up or one of their regularly scheduled outpatient consultations . the serum was labeled using the same anonymous codes assigned to the tubes at the time of the test .", "an arginine stimulation test was performed on all subjects to determine basal and stimulated pancreatic hormone levels . blood was drawn at 10 , 0 , 2 , 3 , 4 , 5 , 7 , and 10 min from intravenous injection of a 5 g arginine bolus . patients who were back on insulin were required to discontinue slow - acting insulin at least 24 h prior to the test and rapid - acting insulin at least 6 h before the test . serum levels of insulin , c - peptide , total proinsulin , and intact proinsulin ( ipi ) were then measured using commercially available elisas as described below . acute insulin response ( air ) was calculated as the mean of the three highest values between 2 and 5 min minus the mean of the basal values at 10 and 0 min . the area under the curve ( auc ) between 0 and 10 min postinjection for insulin and c - peptide was calculated by the trapezoidal rule with the mean of the baseline values subtracted . proinsulin fragments , including split-32,33 proinsulin , des-31,32 proinsulin , split-65,66 proinsulin , and des-64,65 proinsulin , were obtained by subtracting ipi from total proinsulin . ratios of insulin to total proinsulin and insulin [ insulin/(total proinsulin+insulin ) ] as well as proinsulin fragments to total proinsulin ( proinsulin fragments / total proinsulin ) were calculated to quantify the rate of proinsulin processing . ratios representing peak stimulation were calculated as the mean of ratios for the three highest time points between 2 and 5 min after arginine stimulation . insulin/(total proinsulin+insulin ) ratio represents the quantity of fully processed insulin with respect to all circulating forms of the hormone .", "commercially available elisas were used to measure hormone levels for insulin , c - peptide , total proinsulin , and ipi . the following kits were used : insulin ( mercodia , uppsala , sweden ) , c - peptide ( mercodia ) , total proinsulin ( millipore , zug , switzerland ) , and ipi ( millipore ) . concentrations were determined using a standard curve with high- and low - level control subjects . cross - reactivities of the assays were provided by the manufacturer and are as follows : the insulin assay cross - reacts 98% with des-64,65 proinsulin , < 0.01% with c - peptide and proinsulin , and < 0.05% with des-31,32 proinsulin and split-32,33 proinsulin ; the c - peptide elisa cross - reacts < 0.0006% with insulin , < 1.8% with proinsulin , 10% with split-65,66 proinsulin , 74% with des-64,65 proinsulin , 3% with des-31,32 proinsulin , and 2% with split-32,33 proinsulin ; the total proinsulin elisa cross - reacts 100% with intact and des-31,32 proinsulin , and 81% with des-64,65 proinsulin ; the ipi elisa cross - reacts 36% with des-64,54 proinsulin , and it shows no cross - reactivity with des-31,32 proinsulin . the lower limits of detection of the assays were provided by the manufacturer and are as follows : the insulin assay has a detection limit of 6 pmol / l , the c - peptide elisa has a limit of 15 pmol / l , the total proinsulin assay has a limit of 0.5 pmol / l , and the ipi assay has a lower limit of 0.1 pmol / l .", "all statistical analyses were performed using prism 6 software ( graphpad software , la jolla , ca ) . for all analyses , values obtained from healthy subjects were used as control subjects . for data that were normally distributed , student t test was used to compare two groups , and one - way anova was used to compare between more than two groups . for data that had non - gaussian distributions , we used the mann - whitney test to compare between two groups and the kruskal - wallis test to compare between more than two groups .", "subjects in the healthy control group were slightly younger than the rest of the study population ( p < 0.01 ) . islet recipients exhibited higher fasting glycemia and hba1c levels than other groups ( p < 0.05 ) . nonetheless , hba1c levels remained in the normal range for the ii - isl group . creatinine levels were elevated in the pancreas and ir - isl groups with respect to the ii - isl and healthy control groups ( p < 0.005 vs. control , p < 0.05 vs. ii - isl ) . figure 1a and b shows the insulin and c - peptide response curves for all five groups . the insulin and c - peptide response curves maintain the same overall shape in all groups , with the exception of the diabetic control subjects who demonstrate no response to arginine stimulation . insulin levels were higher in pancreas recipients but lower in islet recipients compared with healthy control subjects . insulin levels in the pancreas group were significantly higher than those of the healthy control group . airs for healthy control subjects , ir - isl , ii - isl , and pancreas groups were 217 163 , 23 13 , 125 90 , and 266 the c - peptide acute responses in the same groups were 717 362 , 91 53 , 278 124 , and 550 244 pmol / l , respectively ( supplementary table 1 ) . mean acute c - peptide responses were similar in the healthy control group and pancreas group but significantly lower in the islet groups . the ir - isl transplantees showed a significantly decreased acute insulin and c - peptide response with respect to all other groups . there was no significant difference in air between the ii - isl and control groups . as expected , the diabetic control group showed negligible insulin and c - peptide levels . a : mean insulin levels during arginine stimulation of healthy control group , ir - isl group , ii - isl group , pancreas group , and diabetic control group . b : mean c - peptide levels during arginine stimulation of healthy control group , ir - isl group , ii - isl group , pancreas group , and diabetic control group . auc values demonstrated similar distributions to acute responses in the various study groups ( supplementary table 1 ) . auc values for insulin response in healthy control subjects , ir - isl , ii - isl , and pancreas groups were 1,332 959 , 152 91 , 774 528 , and 1,540 707 pmol these values were higher in pancreas recipients and lower in islet recipients compared with healthy control subjects . auc values for c - peptide response in healthy control subjects , ir - isl , ii - isl , and pancreas groups were 4,955 3,158 , 630 428 , 1,843 875 , and 3,859 2,061 pmol the auc of c - peptide for the ir - isl group was significantly lower than in all other groups . mean values for c - peptide and total proinsulin before and after arginine stimulation are shown in fig . these figures show that total proinsulin levels are reduced in the ir - isl group with respect to all other groups and follow a distribution similar to that of c - peptide . a : box plots of basal c - peptide and total proinsulin levels in healthy control group , ir - isl group , ii - isr group , and pancreas group before arginine injection ( basal values ) . b : box plots of stimulated c - peptide and total proinsulin levels in healthy control group , ir - isl group , ii - isl group , and pancreas group during peak stimulation after arginine injection ( stimulated values ) . data are expressed as median ( solid line ) , interquartile range ( box ) , and range ( whiskers ) . the healthy control group demonstrated lower basal proinsulin - processing rates than the pancreas ( p < 0.01 ) and ii - isl ( p < 0.05 ) groups [ 74 14% vs. 83 7% vs. 86 12% , respectively , for insulin/(total proinsulin+insulin ) and 54 25% vs. 67 18% vs. 76 16% , respectively , for proinsulin fragments / total proinsulin ] . the ir - isl group displayed a basal insulin/(total proinsulin+insulin ) rate of 75 14% and a basal proinsulin fragments / total proinsulin rate of 54 25% . a : box plots of the proinsulin - processing ratios [ ( insulin / total proinsulin+insulin ) and ( proinsulin fragments / total proinsulin ) ] in healthy control group , ir - isl group , ii - isl group , and pancreas group before arginine injection ( basal values ) . b : box plots of the proinsulin - processing ratios [ ( insulin / total proinsulin+insulin ) and ( proinsulin fragments / total proinsulin ) ] in healthy control group , ir - isl group , ii - isl group , and pancreas group during peak stimulation after arginine injection ( stimulated values ) . data are expressed as median ( solid line ) , interquartile range ( box ) , and range ( whiskers ) . i / tp+i , insulin / total proinsulin+insulin ; pf / tp , proinsulin fragments / total proinsulin . 3b . interestingly , healthy control subjects , pancreas recipients , and ii - isl recipients all attain similarly elevated processing ratios after stimulation ( 93 2% vs. 93 3% vs. 93 5% , respectively , for insulin/(total proinsulin+insulin ) and 80 7% vs. 77 9% vs. 76 12% , respectively , for proinsulin fragments / total proinsulin ) , while ir - isl transplant recipients ratios do not demonstrate a comparable increase . although ir - isl proinsulin - processing ratios do increase slightly after stimulation to 87 4% and 58 18% for insulin/(total proinsulin + insulin ) and proinsulin fragments / total proinsulin , respectively , these values remain significantly lower than all other groups ( p < 0.01 vs. control and pancreas groups , p < 0.05 vs. ii - isl ) .", "subjects in the healthy control group were slightly younger than the rest of the study population ( p < 0.01 ) . islet recipients exhibited higher fasting glycemia and hba1c levels than other groups ( p < 0.05 ) . nonetheless , hba1c levels remained in the normal range for the ii - isl group . creatinine levels were elevated in the pancreas and ir - isl groups with respect to the ii - isl and healthy control groups ( p < 0.005 vs. control , p < 0.05 vs. ii - isl ) .", "figure 1a and b shows the insulin and c - peptide response curves for all five groups . the insulin and c - peptide response curves maintain the same overall shape in all groups , with the exception of the diabetic control subjects who demonstrate no response to arginine stimulation . insulin levels were higher in pancreas recipients but lower in islet recipients compared with healthy control subjects . insulin levels in the pancreas group were significantly higher than those of the healthy control group . airs for healthy control subjects , ir - isl , ii - isl , and pancreas groups were 217 163 , 23 13 , 125 90 , and 266 129 pmol / l , respectively . the c - peptide acute responses in the same groups were 717 362 , 91 53 , 278 124 , and 550 244 pmol / l , respectively ( supplementary table 1 ) . mean acute c - peptide responses were similar in the healthy control group and pancreas group but significantly lower in the islet groups . the ir - isl transplantees showed a significantly decreased acute insulin and c - peptide response with respect to all other groups . there was no significant difference in air between the ii - isl and control groups . as expected , the diabetic control group showed negligible insulin and c - peptide levels . a : mean insulin levels during arginine stimulation of healthy control group , ir - isl group , ii - isl group , pancreas group , and diabetic control group . b : mean c - peptide levels during arginine stimulation of healthy control group , ir - isl group , ii - isl group , pancreas group , and diabetic control group auc values demonstrated similar distributions to acute responses in the various study groups ( supplementary table 1 ) . auc values for insulin response in healthy control subjects , ir - isl , ii - isl , and pancreas groups were 1,332 959 , 152 91 , 774 528 , and 1,540 707 pmol these values were higher in pancreas recipients and lower in islet recipients compared with healthy control subjects . auc values for c - peptide response in healthy control subjects , ir - isl , ii - isl , and pancreas groups were 4,955 3,158 , 630 428 , 1,843 875 , and 3,859 2,061 pmol the auc of c - peptide for the ir - isl group was significantly lower than in all other groups .", "mean values for c - peptide and total proinsulin before and after arginine stimulation are shown in fig . these figures show that total proinsulin levels are reduced in the ir - isl group with respect to all other groups and follow a distribution similar to that of c - peptide . a : box plots of basal c - peptide and total proinsulin levels in healthy control group , ir - isl group , ii - isr group , and pancreas group before arginine injection ( basal values ) . b : box plots of stimulated c - peptide and total proinsulin levels in healthy control group , ir - isl group , ii - isl group , and pancreas group during peak stimulation after arginine injection ( stimulated values ) . data are expressed as median ( solid line ) , interquartile range ( box ) , and range ( whiskers ) .", "the healthy control group demonstrated lower basal proinsulin - processing rates than the pancreas ( p < 0.01 ) and ii - isl ( p < 0.05 ) groups [ 74 14% vs. 83 7% vs. 86 12% , respectively , for insulin/(total proinsulin+insulin ) and 54 25% vs. 67 18% vs. 76 16% , respectively , for proinsulin fragments / total proinsulin ] . the ir - isl group displayed a basal insulin/(total proinsulin+insulin ) rate of 75 14% and a basal proinsulin fragments / total proinsulin rate of 54 25% . a : box plots of the proinsulin - processing ratios [ ( insulin / total proinsulin+insulin ) and ( proinsulin fragments / total proinsulin ) ] in healthy control group , ir - isl group , ii - isl group , and pancreas group before arginine injection ( basal values ) . b : box plots of the proinsulin - processing ratios [ ( insulin / total proinsulin+insulin ) and ( proinsulin fragments / total proinsulin ) ] in healthy control group , ir - isl group , ii - isl group , and pancreas group during peak stimulation after arginine injection ( stimulated values ) . data are expressed as median ( solid line ) , interquartile range ( box ) , and range ( whiskers ) . i / tp+i , insulin / total proinsulin+insulin ; pf / tp , proinsulin fragments / total proinsulin .", "3b . interestingly , healthy control subjects , pancreas recipients , and ii - isl recipients all attain similarly elevated processing ratios after stimulation ( 93 2% vs. 93 3% vs. 93 5% , respectively , for insulin/(total proinsulin+insulin ) and 80 7% vs. 77 9% vs. 76 12% , respectively , for proinsulin fragments / total proinsulin ) , while ir - isl transplant recipients ratios do not demonstrate a comparable increase . although ir - isl proinsulin - processing ratios do increase slightly after stimulation to 87 4% and 58 18% for insulin/(total proinsulin + insulin ) and proinsulin fragments / total proinsulin , respectively , these values remain significantly lower than all other groups ( p < 0.01 vs. control and pancreas groups , p < 0.05 vs. ii - isl ) .", "this study explores for the first time proinsulin processing in islet transplant recipients , not only in comparison with healthy control subjects , but also with respect to pancreas transplant recipients . we have shown , first , that the exposure to arginine stimulation is in fact similar in ii - isl transplant recipients and healthy control subjects . as expected , recipients of pancreas transplants with systemic venous drainage demonstrate higher insulin response to arginine than healthy control subjects . second , there is a noticeable difference in the rate of basal proinsulin processing comparing ii - isl and ir - isl transplant recipients . ii - isl patients have proinsulin - processing ratios similar to those of pancreas transplant recipients , which are significantly higher than those of healthy control and ir - isl patients . third , after stimulation , ii - isl , pancreas , and healthy control subjects all increase their proinsulin - processing ratios to a similar level . in contrast , ir - isl patients are unable to achieve the same increase in proinsulin - processing rate . these data suggest that fully functional islet grafts are able to attain optimal proinsulin processing when stimulated but are required to sustain high levels of processing even during a metabolic fasting state in order to maintain glycemic control . islet grafts requiring supplementation with insulin therapy , on the other hand , demonstrate low basal proinsulin - processing rates , which are unable to reach optimal levels even when stimulated . interestingly , total proinsulin levels in this group ( ir - isl ) are low compared with other groups both before and after stimulation . however , the ratio of proinsulin to insulin in the ir - isl group after stimulation is disproportionately high . this suggests that partially functional islet grafts have a defect in proinsulin processing , which manifests itself as relative and not absolute hyperproinsulinemia . it should be noted that the calculation of proinsulin fragments may be slightly biased owing to elisa cross - reactivities . in theory , when we calculate proinsulin fragments as proinsulin fragments = total proinsulin ipi , we are assuming that all of the des-64,65 proinsulin has been measured by the total proinsulin assay and that none of it has been measured by the intact assay . in reality , we measure only 81% of des-64,65 with the total proinsulin assay and 36% with the ipi assay . . however , since the pc2 pathway responsible for the formation of des-64,65 proinsulin is not the primary pathway for the production of insulin , unmeasured levels of des-64,65 proinsulin are relatively insignificant with respect to des-31,32 proinsulin levels . it should also be noted that clearance of proinsulin and proinsulin fragments could be altered by diminished renal function . as seen in table 1 , our ir - isl group demonstrated creatinine levels that were elevated compared with healthy control subjects . however , this difference was not significant comparing the ir - isl group to ii - isl and pancreas groups . in contrast , the reduced processing ratios observed in the ir - isl group are significantly lower than all other groups . both absolute and relative hyperproinsulinemia have already been observed in settings of impaired glucose metabolism ( 1214 ) . first , it has been suggested that dysfunctional -cells present a fundamental defect in the pathway responsible for processing of proinsulin to insulin ( 18 ) . it is possible in the case of islet transplantation that manipulation of islets , introduction of -cells into a foreign microenvironment , or immunosuppressive drugs may render these cells inherently dysfunctional . a second theory suggests that hyperproinsulinemia occurs because of increased demand on -cells , which leads to insufficient time to complete proinsulin processing intracellularly before granule secretion occurs ( 15,19,20 ) . it seems reasonable to suppose that a combination of insulin resistance and decreased -cell mass could lead to unattainable insulin needs and eventual -cell deterioration via exhaustion . our data show that islet grafts initially present increased basal proinsulin processing with respect to healthy control subjects and that this processing deteriorates as graft function declines , a phenomenon that more readily supports the latter theory . we can not , however , exclude the effect of prolonged glucotoxicity on -cell function as an additional possible explanation for the observed processing defects . although our two islet groups had similar fasting glucose levels , hba1c was slightly increased in the ir - isl group , indicating that chronic glucotoxicity may have played a role in the functional deterioration of -cells within this subgroup . ultimately , a longitudinal study on the same or similar populations might help to verify this hypothesis . two studies have previously investigated proinsulin processing in islet transplant recipients ( 16,22 ) . however , neither study used arginine stimulation to explore hormonal processing when under simulated metabolic stress and neither study compared islet and pancreas transplant recipients . it is interesting to note that these studies produced conflicting data and presented contrasting conclusions . we found that functional islet grafts display increased processing and relatively lower proinsulinemia at rest , with an inability to increase their processing rates further when stimulated . these grafts are essentially behaving the same during the metabolic fasting state as fully stimulated healthy control subjects . as islet grafts lose function , however , processing even during the fasting state becomes less effective and proinsulinemia increases . these findings directly correlate with the findings of mcdonald et al . and are supported by the data of klimek at al . , which include mostly ir - isl transplant recipients . two other groups , fiorina et al . it would seem that there is a threshold level of demand beyond which -cells can no longer process proinsulin effectively . as stated earlier , we presume this to be due to an increased demand on decreased -cell mass . further investigation is warranted to explain the exact mechanism responsible for the increased basal proinsulin processing seen in ii - isl grafts . again , a longitudinal study of these patients might help shed more light on the issue . no study previously analyzed the stimulated hormonal response of pancreas grafts with respect to islet grafts . our data show that pancreas grafts behave quite similarly to healthy control subjects but with elevated overall hormone levels . this is undoubtedly a reflection of the systemic venous pancreatic drainage of these patients , in whom there is no hepatic first - pass metabolism of pancreatic hormonal secretions ( 23 ) . pancreas grafts tend to show similar patterns of proinsulin processing to fully functional islet grafts . whether this is peculiar to systemically drained pancreata can not be elucidated from this data . this study used arginine stimulation rather than oral or intravenous glucose tolerance tests to test secretory reserve in our patient populations . arginine stimulation provides the advantage of not inducing hyperglycemia , thus reducing the confounding influence of glucotoxicity to a minimum . other investigators have found the intravenous glucose tolerance tests to be more robust and a better indicator of -cell status ( 24 ) , but this method does not account for host insulin resistance . in summary , ii - isl transplant recipients can maintain basal metabolic parameters similar to healthy control subjects at the cost of a higher rate of basal proinsulin processing . ir - isl transplant recipients demonstrate both lower insulin response and lower basal rates of proinsulin processing , which remain suboptimal even after arginine stimulation ( i.e. , loss of graft function is associated with less effective processing and relative hyperproinsulinemia ) . finally , the higher airs of pancreas transplant recipients are a reflection of systemic venous drainage of endocrine secretions .", "" ]

[ "we have demonstrated that , melatonin is a bioprecursor of hypnotic acetyl metabolites produced by enzymatic acetylation of melatonin and 2-oxomelatonin under the control of acetyltransferases , most probably the nat enzymes . in 1994 , in our laboratory , we developed a specific and highly sensitive gas chromatography - mass spectrometry ( gc - ms ) method to assay , simultaneously and distinct ! ) , plasma concentrations of endogenous melatonin ( d0melatonin ) and exogenous melatonin ( d7-melatonin ) , in which 7 atoms of h have been substituted by 7 atoms of deuterium . using the same human volunteers ( 12 young subjects in june 1994 and 12 elderly subjects in october 1994 ) , we determined the pharmacokinetics of exogenous d7-melatonin , when given orally and intravenously , and the kinetics of the pineal secretion of endogenous d0-melatonin . , the results shown in figure 2 led to the following conclusions : secretion of melatonin by the pineal gland occurs only during the night . pharmacokinetic analysis shows that the rate of melatonin secretion by the pineal gland is constant throughout the whole nocturnal pineal melatonin production , for the same subject . the beginning and end of melatonin secretion from the pineal gland are the same for each subject , whatever the season and night , length . duration of melatonin pineal secretion is between 7.5 and 8 h. therefore , melatonin secretion and sleep are contemporaneous . there is a large interindividual variability in the amount , of melatonin released in plasma by the pineal gland during the night in young and old subjects alike .", "results of previous related studies show that melatonin secretion , and therefore the presence of melatonin in the central nervous system ( cns ) , is necessary for the induction and maintenance of nocturnal sleep . however , the presence of melatonin in the cns is insufficient for the induction and maintenance of sleep . indeed , figure 3 and table i show results of observations in chicks in an alternate light ( l)-dark ( d ) program ( l / d , 12 h:12 h ) , in which the light phase lasted from 8.00 am until 8.00 pm . when melatonin was administered intramuscularly ( pectoralis major muscle ) during the light phase from 2.00 pm to 8.00 pm , the chicks did not . the absence of a hypnotic effect during the light phase correlated with the very low level of nat activity in the pineal glands of chicks measured at the same times . in contrast , when chicks were observed in a 7-day permanent light , program ( l / l , 12 h:12 h ) , during which nat activity level was constantly higher , the administration of melatonin induced a significant , hypnotic effect . the duration of sleep ( between 4 and 5 h ) was much greater than that , observed with diazepam ( between 1 and 2 h ) when it . was administered intramuscularly at the same dose ( 1 m per 100 g body weight , at 2.00 pm ) . these results lead to the following conclusions : the simultaneous presence of melatonin and nat in the cns ( pineal gland ) is a necessary and sufficient condition for the induction and maintenance of sleep . in contrast to the classic so - called hypnotic drugs ( eg , benzodiazepines , barbiturates , zopiclone , and zolpidem ) , melatonin does not have direct , hypnotic properties related to its chemical structure .", "during the development of the gc - ms method for the assay of melatonin in plasma , our attention was focussed on the chemical reactivity of melatonin at position 3 , which allows cyciization of the side chain after acylation . this proceeds by nucleophilic attack and leads to a fluoroacyl--carboline ( figure 4 ) . considering our previous observations , we assumed that melatonin undergoes enzymatic acetylation during the night , under the control of nat , and that this leads to an n - acetyl--carboline , which we call carbo2 . we conclude that melatonin is a bioprecursor of hypnotic acetyl metabolites , such as carbo2 . chick pineal glands were observed during an alternate light - dark program at 37c for 7 days . in the middle of dark phase , they were treated with phjacetyl coenzyme a and melatonin ( or 2-oxomelatonin ) for 30 min . figure 5 and figure 6 show that melatonin ( or 2-oxomelatonin ) undergoes an aeetylation that is significantly higher ( p<0.002 , in the middle of dark phase ; p<0.0005 , 1 h before end of dark phase [ or p<0.00005 for 2oxomelatonin over the whole dark phase ] ) than that observed in controls ( nonsignificant when melatonin was replaced by phosphate buffer ) . gc - ms indicated the biosynthesis of [ h]carbo2 for five chick pineal glands collected in the middle of dark phase ( table ii ) . we have synthesized several acetyl derivatives , such as carbo2 ( figure 7 ) , which is an n-acetyl-p-carboline.we have found 20 to 40 pg carbo2 per gram of lamb pineal gland collected on the middle of the dark phase of an alternate light - dark program . the hypnotic activity of carbo2 has been observed and measured in chicks and beagles : in chicks , the tests were performed at 2.00 pm , in the middle of light phase , a time at which nat activity in the pineal gland is very low . the results are presented in table iii , together with some reference compounds . the essential role of acetyl group is demonstrated by the fact that 10-mcthoxyharmalan ( as well as harmaline ) , which is the product of jv - deacetylation of compound carbo2 , does not exhibit any hypnotic effect . in contrast , it induces excitatory effects in chicks by increasing locomotor activity in beagles , polysomnographic studies showed that when carbo2 was administered intravenously , it induced sleep of longer duration and shorter time latencies than the sleep induced by zolpidem and diazepam ( table iv ) . the most interesting feature , which provides more support for our assumption , is the eeg architecture of the sleep produced , which is similar to that of physiological sleep ( see results with placebo in table iv ) , characterized by the significant proportion of slow - wave deep sleep and rapid eye movement ( rem ) sleep , in sharp contrast to the eeg sleep architecture observed with gabaergic ( gaba , -aminobutyric acid ) compounds , such as zolpidem or diazepam , which induce mainly drowsiness ( light sleep ) and little rem sleep .", "chick pineal glands were observed during an alternate light - dark program at 37c for 7 days . in the middle of dark phase , they were treated with phjacetyl coenzyme a and melatonin ( or 2-oxomelatonin ) for 30 min . figure 5 and figure 6 show that melatonin ( or 2-oxomelatonin ) undergoes an aeetylation that is significantly higher ( p<0.002 , in the middle of dark phase ; p<0.0005 , 1 h before end of dark phase [ or p<0.00005 for 2oxomelatonin over the whole dark phase ] ) than that observed in controls ( nonsignificant when melatonin was replaced by phosphate buffer ) . gc - ms indicated the biosynthesis of [ h]carbo2 for five chick pineal glands collected in the middle of dark phase ( table ii ) .", "we have synthesized several acetyl derivatives , such as carbo2 ( figure 7 ) , which is an n-acetyl-p-carboline.we have found 20 to 40 pg carbo2 per gram of lamb pineal gland collected on the middle of the dark phase of an alternate light - dark program .", "the hypnotic activity of carbo2 has been observed and measured in chicks and beagles : in chicks , the tests were performed at 2.00 pm , in the middle of light phase , a time at which nat activity in the pineal gland is very low . the essential role of acetyl group is demonstrated by the fact that 10-mcthoxyharmalan ( as well as harmaline ) , which is the product of jv - deacetylation of compound carbo2 , does not exhibit any hypnotic effect . in contrast , it induces excitatory effects in chicks by increasing locomotor activity in beagles , polysomnographic studies showed that when carbo2 was administered intravenously , it induced sleep of longer duration and shorter time latencies than the sleep induced by zolpidem and diazepam ( table iv ) . the most interesting feature , which provides more support for our assumption , is the eeg architecture of the sleep produced , which is similar to that of physiological sleep ( see results with placebo in table iv ) , characterized by the significant proportion of slow - wave deep sleep and rapid eye movement ( rem ) sleep , in sharp contrast to the eeg sleep architecture observed with gabaergic ( gaba , -aminobutyric acid ) compounds , such as zolpidem or diazepam , which induce mainly drowsiness ( light sleep ) and little rem sleep .", "we have evidenced the role played by melatonin in both inducing and maintaining nocturnal sleep . melatonin is the bioprecursor of hypnotic acetyl metabolites , such as carbo2 , which result from the enzymatic acetylation of melatonin ( and 2-oxomelatonin ) by nat . since insomnia and sleep disorders may be due to a lack of nat enzymes in the pineal gland , a therapeutic approach to sleep disorders could be suggested . patients with insomnia may be treated by administering hypnotic acetyl metabolites of melatonin or their synthetic analogs ." ]

[ "\n over the next several decades , the number of americans living to advanced ages will increase substantially . although many individuals will age in relatively good health , a growing number will encounter challenges associated with the burdens of chronic conditions and associated disabilities [ 13 ] . this is especially so for the large numbers of women who will continue to outlive their male counterparts and likely live those additional years with chronic illnesses requiring day - to - day management [ 4 , 5 ] . further , with a dramatic increase of female baby boomers with obesity - related chronic conditions , accompanied by reduced fertility rates among this rapidly aging cohort , the additive or multiplicative effects of living with one or more chronic conditions are likely to result in a diminution of ( 1 ) individuals ' capacity to adequately care for themselves , ( 2 ) caregivers to serve as efficient resources , and ( 3 ) healthcare providers to give adequate attention and guidance to complex patients with multiple chronic conditions ( mccs ) . in line with the millions of older women struggling to manage the symptoms associated with chronic disease , there is growing recognition about the importance of self - care behavior , which is supported by strong epidemiological documentation regarding the positive association of self - care and health outcomes [ 710 ] . however , this issue transcends women 's exposure to and understanding of pertinent information and their development of self - care skills . older women with chronic conditions also need to assess their surrounding resources to develop the confidence and efficacy necessary to initiate and maintain self - care behavior [ 1113 ] . self - care behavior are intended to draw upon one 's physical , social , and healthcare environments to compensate for , or delay , physical limitations and chronic conditions from progressing into more severe disabilities . further , self - care skills include ( 1 ) identifying strategies that enable older women to adopt and institute appropriate self - care behavior such as getting adequate exercise , eating healthy , or managing medications [ 15 , 16 ] ; ( 2 ) interacting with healthcare providers to obtain resources and referrals necessary to manage the progression of chronic conditions [ 10 , 17 , 18 ] ; and ( 3 ) locating social and community resources to become more educated about their conditions and alleviate the stressors and frustration acting as barriers to self - care behavior [ 6 , 19 ] . while a growing literature has identified general disparities related to self - care among women with chronic conditions based on their race / ethnicity [ 2022 ] , socioeconomic status [ 2224 ] , and residential rurality [ 22 , 25 ] , the extent to which self - care disparities exist based on these and other sociodemographics requires further investigation . similarly , the role of education an indicator of socioeconomic status , healthcare access , and health behavior engagement emphasizes its importance when assessing disparities issues [ 26 , 27 ] . additional efforts are needed to examine the influence of sociodemographics on self - care skills and behavior among aging women , especially in the presence of perceptions about healthcare - related factors . healthcare provider - patient interactions can foster self - care behavior although such interactions can also have a less - recognized negative effect on disease self - management . women can feel frustrated and helpless when their physicians do not fully explain or clarify the causes of their disease or ways how to best manage their illness . some patients report not having enough time to address their concerns , or that their physicians simply would not listen to them . conversely , among patients with diabetes , those who have good communication with their physicians report feeling more involved in decision - making efforts to manage their condition more effectively . also , patients who report their physicians provided adequate information about their conditions were more likely to better self - manage their illnesses . healthcare professionals often encounter challenges to address their female patients ' mcc alongside existing barriers to self - care behavior in their home or community environments . regardless of the source or cause of these barriers , competing demands on the side of either the patient or provider have potential to create a recursive relationship resulting in disconnect , miscommunication , frustration , and fewer self - care practices . these occurrences may inevitably contribute to decreased health outcomes and rapid chronic disease progression , which highlights the importance of support mechanisms available to the patient . effective self - care support mechanisms and resources identified to promote self - care behavior include traditional in - person , familial , and community support systems ( e.g. , support groups and faith - based organizations ) [ 6 , 3135 ] ; however , an emergence in technology - based support mechanisms has been shown to enable individuals with chronic conditions to access and utilize self - care information , despite traditional barriers [ 18 , 3639 ] . further , the active seeking of self - care support and resources has been shown to enhance self - care behavior among individuals with chronic conditions [ 12 , 38 , 40 ] . the preferred and/or utilized support mechanisms differ by population subgroup and type of chronic condition . evidence shows that racial / ethnic minorities with chronic conditions report increased in - person support mechanisms compared to their non - hispanic white counterparts [ 41 , 42 ] . conversely , those residing in rural areas have shown improvement in their self - care behavior through the use of internet - based support mechanisms , which may be critical to overcome traditional challenges associated with geographic isolation , less healthcare resources , and longer travel distances to healthcare services [ 25 , 44 ] . the advancing study of self - care behavior has identified factors influencing the adoption and maintenance of self - care behavior for different populations and people of all ages , with more recent attention paid to lifestyle relative to disease self - care behavior [ 17 , 45 , 46 ] . to advance the translation of research to practice , this secondary data analysis assesses issues surrounding self - care barriers , healthcare - related frustrations , and perceived supports among middle - aged and older adults with one or more chronic conditions . in an effort to further understand the multilevel influences on perceived barriers to self - care , this study will examine the roles of healthcare frustrations and doctor - patient interactions alongside other simultaneously occurring contextual factors ( see figure 1 ) . more specifically , the purposes of this study were to ( 1 ) describe sociodemographic variables , health indicators , healthcare - related frustrations , and perceptions of physician support among middle - aged and older adult women with one or more chronic conditions and ( 2 ) identify these factors ' association with reporting the need to help learning how to take better care of their health among this female population .", "\n the national council on aging ( ncoa ) , with support from atlantic philanthropies and the california healthcare foundation ( chcf ) , commissioned the ncoa chronic care survey , which offers unique insight into the lives of americans with chronic health conditions . the ncoa chronic care survey is a nationally representative probability survey of 960 community - dwelling men and women aged 44 years and older with at least one chronic condition . lake research partners utilized telephone - based interviewing to collect data using random digit dialing ( rdd ) sampling techniques , which oversampled those aged 65 and older and hispanics / latinos . the dataset was weighted by age , race , and region to reflect the overall population of americans 44 + with chronic condition(s ) . margin of error is greater when analyzing smaller subgroups within the sample . to be eligible for inclusion in the ncoa chronic care survey , participants had to report having at least one chronic condition at the time of the study . participants were screened for chronic condition(s ) with the following question(s ) : have you ever been told by a doctor , nurse , or other health professional that you have ( name of chronic condition ) ? chronic conditions included in the screening process included heart disease , cancer , stroke , diabetes , arthritis , asthma , hypertension or high blood pressure , emphysema , chronic bronchitis , depression , anxiety , and others . only participants who reported yes to at least one of these items of the 960 adults age 44 years and older in this sample , only women were included in study analyses ( n = 427 ; 44.5% ) . of these women , an additional 140 cases ( 32.8% ) more specifically , cases were omitted for incomplete data on rurality ( n = 48 ) , frustration with the healthcare system ( n = 25 ) , perceived physician support ( n = 18 ) , self - reported chronic conditions ( n = 17 ) , marital status ( n = 8) , using the internet for general support ( n = 7 ) , race / ethnicity ( n = 6 ) , education ( n = 4 ) , perceived barriers to self - care ( n = 4 ) , and activity limitations ( n = 3 ) . the analytic sample for this study contained 287 community - dwelling women , aged 44 years and older who self - reported having at least one chronic condition . when comparing characteristics of women omitted from the study ( n = 140 ) with those in the analytic sample ( n = 287 ) , a significantly larger proportion of the analytic sample was younger ( = 4.98 , p = 0.026 ) , non - hispanic white ( = 4.60 , p = 0.032 ) , and married ( = 11.78 , p = 0.001 ) . participants were asked to self - report their perceived barriers to self - care using an item intended to measure their need for help to learn how to take better care of their health . more specifically , participants were asked to rate their level of agreement to the following statement : i need help learning how to take better care of my health in a way that works for me and my life . responses were scored on a 5-point likert - type scale ranging from strongly disagree to strongly agree . based on the frequency distribution , participant responses were then dichotomized into two categories : disagree ( scored 0 ) and agree ( scored 1 ) . participants were asked to report their frustrations with healthcare interactions using items intended to measure their feelings about repeatedly having to describe their conditions at each doctor visit , the self - care instructions they received from the healthcare provider , the time spent interacting with the healthcare provider , and having a friend or family member attend physician 's visits with them . for example , participants were asked to rate their level of agreement to statements like how often do you feel tired of describing your same conditions and problems every time you go to a hospital or doctor 's office ? and how often do you wish you had a friend or family member who could go to the doctor with you ? responses were scored using a 3-point likert - type scale with categories of never ( scored 0 ) , occasionally the healthcare - related frustration scale ( ranging from 0 to 12 ) was created using these six items . all items loaded on one factor and the items were summed into a single - composite score ( = 0.766 ) . higher scores for the healthcare - related frustration scale indicate a higher level of frustration with healthcare interactions . based on the frequency distribution , the highest tertile ( i.e. , representing the highest frustration levels ) served as the referent group . participants were asked to self - report the degree to which their physician engages them in treatment - related problem - solving / decision - making , refers them to other healthcare services and professionals , and asks if they understand their medications and associated regimens . for example , participants were asked to rate their level of agreement to statements like how often does your physician ask for your ideas about how you can take care of your health problems ? and how often does your physician talk to other doctors and nurses who are taking care of you ? responses were scored using a 5-point likert - type scale with categories of never ( scored 1 ) , rarely ( scored 2 ) , occasionally ( scored 3 ) , frequently ( scored 4 ) , and always ( scored 5 ) . the perceived physician support scale ( ranging from 6 to 30 ) was created using these six items . all items loaded on one factor and the items were summed into a single - composite score ( = 0.776 ) . higher scores for the perceived physician support scale indicate a higher level of perceived physician support . based on the frequency distribution , this scale was converted into tertiles for the analytic purposes . the lowest tertile ( i.e. , representing the lowest perceived support levels ) served as the referent group . participants were asked to self - report aspects of their current health status using items intended to measure activity limitations , the number of prescription medications taken regularly each day , and the number of physician visits in the previous 12 months . participants were asked are you limited in any way in any activities because of physical , mental , or emotional problems ? responses were scored as no ( scored 0 ) or yes ( scored 1 ) . participants were also asked in the past 12 months , how many times have you , yourself made a doctor visit ? participants were asked to self - report their perceptions about their use of the internet for general support related to managing their health problems . participants were asked how much do you rely on the internet for ongoing help and support with your health problems ? responses were scored on a 4-point likert - type scale with categories of not at all ( scored 0 ) , a little ( scored 1 ) , some ( scored 2 ) , and a lot based on the frequency distribution , participant responses were then dichotomized into two categories : no ( scored 0 ; indicating that they do not rely on the internet at all ) and yes ( scored 1 ; indicating that they rely on the internet at least a little ) . participants were also asked how often do you feel you get the help and support you need to improve your health and manage your health problems ? responses were scored using a 5-point likert - type scale with categories of never ( scored 0 ) , rarely ( scored 1 ) , occasionally ( scored 2 ) , frequently ( scored 3 ) , and always sociodemographic variables in this study included age ( i.e. , 4464 years , 65 + years ) ; race / ethnicity ( i.e. , non - hispanic white , non - white ) ; education level ( i.e. , high school or less , some college or more ) ; marital status ( i.e. , unmarried , married ) ; and residential rurality ( i.e. , urban , suburban , and rural ) . frequencies were calculated for all major study variables , which were initially examined in relationship to participants ' age group ( 4464 years , 65 + years ) and whether they reported needing help learning how to take better care of their health ( yes or no ) . pearson 's tests were performed to assess the independence between the dependent variable and categorized independent variables . logistic regression was performed to examine how sociodemographics , health indicators , perceived support , and frustrations were associated with reporting the need to help learning how to take better care of their health ( i.e. , not needing help served as the referent group ) .", "sample characteristics of study participants are presented in table 1 . of the 287 females participating in this study , over 65% of participants were between the ages of 44 and 64 years and 34.4% were aged 65 years and older . respondents were disproportionately non - hispanic white ( 88.5% ) , married ( 69.0% ) , and had an education level of some college or more ( 61.7% ) . fifty percent of the study population resided in suburban areas , 25.2% resided in urban areas , and 24.8% resided in rural areas . approximately 33% of participants reported being limited from activities because of physical , mental , or emotional problems . on average , participants reported taking 3.67 ( 3.83 ) medications daily and visiting a physician 3.07 ( 1.94 ) times in the previous 12 months . over 45% of participants reported relying on the internet for ongoing help and support to manage their health problems , and 67% of participants reported frequently or always getting the help and support they need to improve their health and manage their health problems . compared to women aged 65 years and older , a significantly larger proportion of participants aged 4464 years had some college education or more ( = 7.14 , p = 0.008 ) and relied on the internet for ongoing support to manage their health problems ( = 21.15 , p < 0.001 ) . a significantly larger proportion of participants who reported needing help learning how to better care for their health problems were non - white ( = 4.78 , p = 0.029 ) and had a high school education or less ( = 4.23 , p = 0.040 ) . healthcare - related frustration scale characteristics are presented in table 2 . of those who reported healthcare - related frustrations , 16.4% reported frequently wishing their doctor had more time to spend talking to them ; 16.0% reported frequently feeling tired of describing their same conditions and problems every time they go to a hospital or doctor 's office ; 8.7% reported frequently wishing they had a friend or family member who could go to the doctor with them ; and 8.3% reported frequently being tired of feeling on their own when it comes to taking care of their health problems . fewer respondents ( 5.6% ) reported frequently feeling their doctor does not realize what it is really like for them at home trying to take care of their health problems or ( 5.2% ) frequently leaving the hospital or doctor 's office feeling confused about what they should do . on average conversely , when comparing frustrations by whether the participant reported needing help learning how to better care for their health problems , those needing help reported significantly higher scores on the healthcare - related frustration scale ( t = 4.79 , p < 0.001 ) and higher frustration levels for five of the six individual scale items ( t = 25.94 , p < 0.001 ) . perceived physician support scale characteristics are presented in table 3 . of those who reported receiving physician support , 50.9% reported their physician always helped them get an appointment they needed ; 46.5% reported their physician always asked if they understood their medications when their doctor prescribed them ; 15.7% reported their physician always talked to other doctors and nurses who were taking care of them ; and another 15.7% reported their physician always made plans to contact them after a visit to see how they were doing . fewer respondents ( 13.3% ) reported their physician always told them about other people who could help them with their health problems or ( 13.2% ) their physician always asked for their ideas about how they can take care of their health problems . on average , participants scored 18.70 ( 5.84 ) on the perceived physician support scale . conversely , when comparing support by whether the participant reported needing help learning how to better care for their health problems , a significantly smaller proportion of those needing help reported asked for their ideas about how they can take care of their health problems ( = 10.48 , p = 0.033 ) . \n table 4 displays the results of the logistic regression analysis explaining factors associated with participants reporting they need help learning how to better care for their health problems ( i.e. , not needing help served as the referent group ) . participants who were non - white were significantly more likely to report needing help learning how to better care for their health problems ( compared to non - hispanic whites , or = 2.26 , p = 0.049 ) , whereas those with some college or more were significantly less likely to report needing help learning how to better care for their health problems ( compared to those with high school or less education , or = 0.55 , p = 0.044 ) . compared to participants with the highest level ( tertile ) of healthcare - related frustrations , those with middle ( or = 0.17 , p < 0.001 ) and lowest ( or = 0.44 , p = 0.017 ) frustration levels were significantly less likely to report needing help learning how to better care for their health problems , respectively . compared to participants with the lowest level ( tertile ) of perceived physician support , those with the highest level of perceived support were significantly less likely to report needing help learning how to better care for their health problems ( or = 0.49 , p = 0.033 ) .", "despite our concerns that the majority of older women would likely experience self - care problems [ 4850 ] , our analyses revealed that only about one - third of the women in our sample reported needing help learning how to take better care of their chronic conditions . but consistent with health disparities in the epidemiology of chronic illnesses [ 22 , 24 ] , persistent health disparities related to self - care behavior were noted among minorities and those with less education . the rural healthcare disparity often reported in other studies [ 25 , 5153 ] was not observed in this study , nor were unmarried women disadvantaged relative to their married counterparts . these findings suggest middle - aged and older women in this sample were comparable in terms of having a variety of social supports for learning how to take care of their health . additionally , despite the previous assumption that older women might be disadvantaged relative to younger baby - boomers , no significant differences in help needed based on age group were reported . similarly , our proxy measures for disease magnitude and severity ( i.e. , number of medications , physician visits , and limitations in activities ) did not differentiate those needing help . however , the existence of an age - based digital divide was observed [ 5456 ] , with older women less likely to use online / technology as a resource for chronic condition self - management . further investigation is needed to examine differences in the types of methods / strategies in which these older women engage when caring for their health conditions outside of the healthcare setting . this study helps elucidate the complex relationships among contextual factors , healthcare frustrations , and patient - provider interactions and support and points to potential opportunities for intervention . the lack of a significant relationship between age and healthcare - related frustrations or perceptions about physician support may be attributed to the fact that the sample was selected based on the presence of chronic conditions . however , the lack of a significant relationship is consistent with the fact that participation in community - based disease self - management programs is not limited to those of only older ages ; rather , program enrollment is based on the participant 's chronic disease status . this study reveals two strong modifiable correlates of women needing help learning how to care for their chronic conditions , even after controlling for sociodemographic and health status indicators in multivariate analyses : healthcare - related frustrations and perceived physician support . the majority of identified frustrations were significantly related to middle - aged and older women 's perceptions of needing help learning how to care for their health , which is supported in other studies [ 8 , 16 , 58 , 59 ] . the recent emphasis on patient - centered care and medical homes is designed to help reduce such frustrations and hence can be expected to help boost women 's self - efficacy to care for their own health conditions . additionally , perceived physician support was another significant factor for knowing how to self - manage chronic conditions , especially in terms of patient activation as exemplified by wanting physicians to ask for your ideas about how you can take care of your health problems . this reinforces previous research about the importance of perceived physician support for motivating patients to engage in healthier lifestyles and recommended medical regimens [ 9 , 31 , 61 , 62 ] . from the health professional point of view , fostering beliefs of patient support can be accomplished through continuing education units ( ceus ) or expanded emphasis during medical school training to develop strategies in which clinicians can engage and implement to be supportive , listen to their patients , and solicit their patients ' thoughts so they have an active role in their healthcare team [ 29 , 63 ] . from the patient point of view , widely available evidence - based self - management programs include elements within their curricula to teach older women how they can more effectively communicate with their healthcare providers . considering perspectives from each side of the healthcare interaction is essential to improve self - management both within and outside of the healthcare setting , which has implications for reducing disease mismanagement , unnecessary healthcare utilization ( e.g. , emergency room use ) , and medical costs .", "this secondary dataset did not contain all variables necessary to fully contextualize barriers and challenges associated with chronic disease self - care behavior among this aging population . however , this national study contained many variables of interest to address the current research gaps in knowledge about associations of healthcare frustrations , physician support , and self - care needs to chronic disease management . substantial numbers of participants were lost due to incomplete data on particular scale items , resulting in an analytical sample that was systematically different from the full sample ( e.g. , younger , married , and more white ) and potentially limited the generalizability of study findings . this is especially true in that the reduction of cases in the analytic sample reduced the potential proportion of older adults in the study from 42.1% to 33.4% , which may especially influence generalizability of findings to populations aged 65 years and older . study participants reported a variety of chronic conditions , but subanalyses based on disease type were not performed because the sample size was inadequate to make such comparisons . recognizing that needed self - care behavior may differ based on women 's particular condition diagnoses , disease stage , and the number of comorbidities in which they are diagnosed , future studies should strive to compare about barriers to self - care , perceived physician support , and frustrations with the healthcare system by their chronic condition profile . further , because women 's ability to cope with and adjust to their disease self - care may differ based on their available resources and socioeconomic status , future studies should examine such variables to determine their relationship with self - care disparities . another study limitation reducing the ability to widely generalize findings to the greater female community was the self - report and cross - sectional nature of these data . however , the sample was derived from random digit dialing and included items that deeply explore the challenges and frustrations with chronic condition self - management , which are not typically seen in other studies that investigate correlations between self - care behavior and other healthcare or physical health indicators . thus , this study contributes to a fuller understanding of the complex interrelationships that exist between self - care strategies , provider - patient interactions , and policies / programs in community contexts .", "the current study adds to the existing science base by examining barriers to self - care with a new lens , exploring healthcare - related frustrations and perceptions of physician support , and how these perceptions relate to various life domains , including diverse health status and sociodemographic contexts . identifying these common and unique challenges and correlates of these challenges , with a representative national population , advance our current knowledge about self - care issues among middle - aged and older women . learning more about healthcare - related frustrations of and self - management supports utilized by middle - aged and older women has the potential to help program deliverers , healthcare providers , and health agencies provide the services and resources that women with chronic conditions want and think are helpful . findings from this investigation has potential to inform and guide modifications in the implementation and dissemination of evidence - based programs for older women to better match individuals with programs that meet their needs ." ]

[ "patients with schizophrenia ( scz ) exhibit a wide variety of cognitive deficits , particularly with memory ( barch and ceaser , 2012 ; ranganath et al . , 2008 ) . these deficits are predictive of overall functional outcome and clinical remission ( bodnar et al . , 2008 ; green , 2006 ; green et al . , 2004 ; kahn and keefe , 2013 ) , and it has recently been suggested that schizophrenia should be viewed primarily as a cognitive disorder ( kahn and keefe , 2013 ) . understanding the nature of the memory deficits is therefore a critical goal when moving towards improved clinical interventions in scz . when considering episodic memory , one area in which patients with scz have a substantial deficit is with source monitoring ( identifying the context in which a stimulus was encountered ; johnson et al . , 1993 ) . for successful source monitoring it is necessary to bind elements of a memory together into a memory trace , along with their context ( spatial context , temporal context , etc . ) . patients demonstrate source monitoring deficits even when stimulus recognition is preserved ( danion et al . , 1999 ; this deficit in source monitoring is in many ways not surprising given that patients with scz also demonstrate difficulties with relational or associative memory ( binding items together during memory encoding , and later recalling which stimuli were presented together ) , while object memory is not as severely impaired ( achim et al . most typically , source monitoring problems in scz are considered in the context of attributing events from internal ( self ) to external sources . patients with predominant hallucinations and thought disorder have a greater tendency or bias to attribute internally generated events to an external source , while still being able to correctly identify externally generated stimuli ( brunelin et al . this bias for scz to misattribute internal sources has been observed in the absence of recognition memory deficits or false positive responses ( fisher et al . , 2008 ) . interestingly , in a repetitive magnetic stimulation trial of low frequency ( 1 hz , inhibitory ) stimulation to the left temporal parietal junction over 5 consecutive days not only improved auditory hallucinations but also resulted in an improvement in source monitoring compared to sham stimulation ( brunelin et al . , 2006 ) . the improvement in auditory hallucination was marginally correlated with the improvement in source monitoring , further suggesting the relationship between source monitoring and hallucinations . patients with schizophrenia have also been found to have a deficit in source memory ( remembering the context in which experimental stimuli occurred ; brebion et al . , 2002 ; the deficit in source memory has been related to deficits in binding contextual cues together into a holistic memory representation ( diaz - asper et al . , 2008 ; waters et al . , 2004 ) , which is an essential component of source memory . source memory errors are present in scz even for short - term recognition ( when source information is tested immediately , minimizing the need to recollect information stored in long - term memory ) , suggesting that source memory deficits in scz may be related to encoding errors rather than problems in recognition ( achim et al . , 2011 ) . ( 2009 ) performed a list learning task in scz and found that patients who hallucinate had more intrusions ( indicating a word was part of the memory set when it was not ) than non - hallucinating patients . this finding was related to source misattribution ( patients attributing an internally generated stimulus to an external source , the original memory set ) . overall , scz appears to have a noteworthy deficit in source memory which is likely intricately related to other memory and cognitive processes , such as contextual binding and episodic memory . within healthy controls , source memory involves a range of cortical regions known to be involved in episodic memory , including the medial temporal lobes , prefrontal cortex , and parietal cortex . increased hippocampal activity has been related to trials in which the source was correctly identified ( davachi et al . , 2003 ; ranganath et al . , 2004 ) , probably due to the role of the hippocampus in relational binding ( davachi , 2006 ) . one of the first fmri studies to examine source memory found greater left prefrontal activity for source memory and for old new recognition ( nolde et al . , 1998 ) , with subsequent studies finding activity in the left lateral prefrontal cortex associated with source memory for a variety of stimuli types ( mitchell and johnson , 2009 ) . prefrontal lesions have been found to disrupt the self - initiation of processes which promote feature binding ( stuss and benson , 1986 ) , and left prefrontal damage is associated with deficits in source monitoring ( duarte et al . , 2005 ) . prefrontal activity during source recognition may be more involved in the evaluation of source information ( e.g. does this stimuli fit with source x ) rather than retrieving source information per se ( mitchell et al . , activity in medial parietal areas ( intraparietal sulcus and precuneus ) has been suggested to be present regardless of the type of source information being assessed ( uncapher et al . , 2006 ) , while activity in lateral parietal areas may be more dependent on how well the information has been encoded ( wheeler and buckner , 2004 ) and/or to attentional processes ( cabeza , 2008 ) . examining declines in source memory with age has proven fruitful for examining structural and functional correlates of source memory , with evidence that age - related decline in source memory is related to decreased activity mainly in the prefrontal and medial temporal lobes ( see mitchell and johnson , 2009 , for review ) . ( 2006 ) examined source monitoring in scz using a level - of - processing framework . patients were presented words with either deep ( semantic ) or shallow ( orthographic ) encoding instructions . during recognition , when participants successfully identified a previously encountered stimuli they were asked under which encoding condition the word was encountered ( the source memory aspect being recalling the context in which the word was encountered , in this case , which encoding condition ) . when contrasting correct vs. incorrect source , both patients and controls activated areas of prefrontal and parietal cortices . patients showed activity in the middle and superior temporal gyrus , thalamus , and parahippocampal gyrus , which was correlated with more severe positive and negative symptoms independent of memory performance . other neuroimaging studies of source monitoring in scz have focused on deficits related to attributing stimuli as self - generated or externally - generated ( reality monitoring ) . deficits in reality monitoring appear to involve the medial prefrontal cortex ( subramaniam et al . , 2012 ; vinogradov et al . , 2008 ; wang et al . , 2011 ) . following computerized training to improve source monitoring , activity was found to be increased in the medial prefrontal cortex ( subramaniam et al . , 2012 ) . the purpose of this study was to examine the neural correlates of source memory in schizophrenia . while most previous studies of source memory ( in both controls and schizophrenia ) have used less ecologically valid task ( e.g. identifying the color of the stimuli during encoding ) , we utilized a paradigm involving encounters ( with a person and an object in a specific place ) within a realistic 3d environment ( burgess et al . , 2001 ; king et al . , 2005 ) , which may better evaluate source memory networks used in everyday life . we examined participants with early schizophrenia ( within the first 4.5 years of treatment , with 75% of patients within the first 2 years ) thus minimizing potential confounds associated with prolonged illness such as cognitive decline , social isolation and long - term medication effects . during fmri scanning a source recognition memory task was employed , which was contrasted with an object memory task . by directly comparing source memory to object memory , we can identify regions in the cortex which are specific to source memory compared to object memory and determine if any deficits observed in schizophrenia are source - memory specific . we hypothesized that patients would show deficits in source memory relative to object memory and may show compensatory activation in source memory retrieval contrasts . furthermore , as deficits in source memory have been associated with auditory hallucinations ( woodward et al . , 2007 ) we expected to observe relationships between hallucinations and the neural activity of source memory retrieval .", "all participants with scz were treated at the douglas mental health university institute in montreal , canada , at the prevention and early intervention program for psychoses , a specialized service providing treatment to individuals aged 1435 years from a local catchment area . individuals with an iq > 70 who had not taken antipsychotic medication for more than 1 month were consecutively admitted as in- or out - patients . patients were assessed with the scale for assessment of positive symptoms ( saps ) ( andreasen , 1984 ) and the scale for assessment of negative symptoms ( sans ) ( andreasen , 1983 ) at numerous time - points following clinic admission ( baseline ; at 1 , 2 , 3 , 6 , 9 , and 12 months ; and every 6 months thereafter ) . ( 2003 ) or visit http://www.douglas.qc.ca/pages/view?section_id=165 for more details . for the neuroimaging study , only individuals aged 1830 years with no previous history of neurological disease , head trauma causing loss of consciousness , or lifetime diagnosis of substance dependence twenty - five people with schizophrenia spectrum disorders were recruited , diagnosed according to the structured clinical interview for dsm - iv ( first et al . , 1997 ) and confirmed between two senior research psychiatrists ( a.m. and r.j . ) . twenty - four healthy controls were recruited through advertisements in local newspapers and were included only if they had no current or previous history of any axis i disorders , neurological diseases , or head trauma causing loss of consciousness , and no first - degree family members with schizophrenia or related schizophrenia - spectrum disorders . all patients provided written informed consent , and the study was approved by the research ethics boards of the douglas hospital research centre and the montreal neurological institute . participants performed an encoding task ( outside the mri ) using a modified version of the virtual city developed by burgess and colleagues ( burgess et al . , 2001 ; king et al . , 2005 ) , created using 3ds max ( 3ds max , 2011 ) and unity software ( unity , 2011 ) . participants navigated through a 3d virtual city , following a path indicated by green arrows to the site of an encounter ( an encoding trial , a character at a location ) . after approaching within five virtual meters of the character , the participant 's view was frozen and the character stepped aside , and a life - sized object appeared on a small table displayed to the right . participants were instructed to pay careful attention to the object , character and location , and try to remember for a later memory test . after a 5 s study delay the person and object disappeared , and participants then followed the arrows to the next encounter . there were a total of 20 encounters , each with a unique person , location and object . a total of 80 recognition trials were administered , in which participants were shown an image consisting of a typical viewpoint encountered within the virtual city ( in one of 20 places where encounters occurred ) , with a person in the center of the screen , and two objects , one on each side of the person . participants were then asked one of four possible recognition questions : ( 1 ) person ( which object was paired with this person ) , ( 2 ) place ( which object did you view in this location ) , ( 3 ) object ( which object was viewed in the city ; the other object was new ) , and ( 4 ) bright ( which object is brighter in appearance ) . participants responded on an mri - compatible button box to indicate which item ( left or right ) was selected . for the person condition , the place was not associated with either object , while in the place condition the person was not associated with either object . the person and place conditions were designed to access source memory ( in what context was an object encountered ) while the object condition assesses object memory ( old vs. new ) . including two source memory conditions allows us to better understand if the observed activity is modality specific . the bright condition was not considered in this analysis as we were specifically interested in source vs. object memory . images ( with encoding question ) were presented on the screen for 8000 ms , with a 20008000 ms isi ( in 100 ms increments ) , with an average trial length of 13 s. stimuli were presented and results were recorded through e - prime 1.0 software . 1 . a practice route was designed to allow participants to become familiar with the arrow key and mouse , and to practice following the arrows and encounter two characters with objects in independent locales . participants also practiced answering two of each of the four forced - choice recognition questions regarding the objects collected . echo - planar images were collected on a siemens 3 t tim trio mri ( tr = 2000 ms , te = 30 ms , flip angle = 90 , 36 slices of 4 mm thick , 64 64 voxel plane with an fov of 256 mm 4 mm slices ) . each bold run was preceded by 4 volumes that were later discarded to allow a magnetic steady state . the anatomical scan was an mprage ( tr = 2300 ms , te = 2.98 ms , fov 256 , 1 1 1 mm voxels , flip angle = 9 ) and lasted 5.21 min . data analysis was conducted using spm 8 ( wellcome department of cognitive neurology , london , uk ) . data was motion corrected by realigning to the 3rd tr , normalized to the icbm template ( and resampled at 2 2 2 mm voxel size ) and smoothed with an 8 mm isotropic gaussian kernel . the general linear model was implemented by convolving a standard hemodynamic response function and its first temporal derivative and dispersion . events were defined based upon recognition question ( person , place , object , or bright ) , with incorrect answers modeled as distinct event types and excluded from further analysis . accuracy data was not available for three controls and four scz patients due to technical problems during initial data collection . for these participants , contrasts were person vs. object and place vs. object ( both performed bidirectionally ) to identify voxels which are differentially activated by source or object memory . a second level analysis was performed separately for each group ( controls or scz ) using a one sample t - test . corrections for multiple comparisons were performed at the cluster level using an individual voxel threshold of p < 0.001 ( uncorrected ) . a monte - carlo simulation of 1000 iterations ( slotnick et al . , 2003 ) resulted in a cluster extent threshold of 49 resampled voxels . to test for differences between groups , an independent - samples t - test was performed , using the contrast value derived for each participant from the above contrasts . given that between - group differences often have smaller effect sizes , we used a slightly more liberal single - voxel threshold of p < 0.005 , but corrected to p < 0.01 at the cluster level ( resulting in an extent threshold of 97 voxels ) . a regression analysis in patients was performed to examine the relationship between source memory and clinical symptoms . as patients were stabilized and undergoing treatment at the time of scanning , few patients were actively experiencing positive symptoms as of the assessment closest to the date of scanning . as a result , the data did not possess sufficient variability for a regression analysis ( the majority of cases had global scores of 0 or 1 on the saps at closest assessment ) . furthermore , positive symptoms are often highly responsive to treatment ( malla et al . , 2006 ; robinson et al . , 1999 ) . as such any patient displaying continued positive symptoms may represent treatment resistant patients or those with a more severe illness , rather than relate to the symptoms themselves per se . instead , we utilized scores from the assessment at the initial visit to the clinic , prior to treatment onset . the presence of specific symptoms at initial clinical assessment was considered as a proxy of how prone to those symptoms each patient may be . we propose that the pre - treatment ratings best represent the underlying neurobiology and clinical characteristics of individual patients , as they show their symptom characteristics in an untreated state of illness . while it is not possible to make several such assessments prior to treatment onset ( which would best capture the potential symptom profile of each patient ) , such an approach may allow for a data exploration which separates patients who are prone to certain symptoms ( such as hallucinations ) from those who have experienced less or never experienced those symptoms while in an untreated state . as such , this can be conceptualized as a trait based approach to symptom evaluation . saps scores for global hallucinations and global thought disorder were entered into a whole - brain regression model with the person > object and place > object contrasts . the global delusion score was not included as most patients were highly delusional at baseline . in order to account for differences in time since initial diagnosis , the interval between baseline assessment and mri scan ( in days ) was entered as a covariate in the second - level regression analysis . cluster threshold for the regression was 49 voxels at p < 0.001 uncorrected ( voxel threshold ) .", "there were no significant differences in age or gender distribution between groups , though patients had a marginally significant lower parental ses and significantly fewer years of education . accuracy in the person , place and object conditions was assessed using independent samples t - test . schizophrenia patients had significantly lower accuracy in the person condition , t(40 ) = 2.247 , p = 0.03 , but not for place , t(40 ) = 0.44 , p = 0.66 , or object , t(40 ) = 0.07 , p = 0.95 . numerous cortical regions showed significant increases in neural activity for retrieval of source memory over retrieval of object memory , similar to the pattern observed in previous studies using a similar paradigm ( burgess et al . , 2001 ; king et al . , 2005 ) . activated regions in the source memory contrasts ( person > object and place > object ) included bilateral activity around the parietal occipital sulcus ( including the precuneus and retrosplenial cortex ) extending into the superior parietal cortex , left inferior frontal gyrus ( vlpfc ) , fusiform gyrus bilaterally , and the occipital cortex . activity in the person > object contrast included the head of the caudate nucleus , the right inferior frontal ( vlpfc ) , and the medial aspect of the superior frontal gyrus . object > place showed widespread activity in the medial frontal cortex and parietal cortices ( supramarginal gyrus bilaterally ) and smaller clusters in the frontal and occipital cortices . for the object > person contrast , activity was observed in the left and right angular gyrus . 2 . when examining source vs. object retrieval contrasts in scz , a smaller number of significantly activated voxels were observed relative to the activity maps of controls . in the person > object contrast only smaller clusters in the head of the caudate and occipital cortex were significant . in place > object , mainly posterior activity was observed ( e.g. parietal occipital sulcus and fusiform cortex ) . in both the object > person and object > place , scz showed a right inferior frontal ( vlpfc ) activity which was not observed in controls . 2 . when comparing between groups , controls demonstrated regions of greater differences between conditions than scz for person > object condition ( including bilaterally in the precuneus and superior parietal , and left and right inferior frontal in the vlpfc ) and for place > object ( bilaterally in the superior parietal , and the left precuneus ) . schizophrenia patients had greater differences between conditions than controls when considering place > object across a wide range of areas . the group comparison was run using contrast values , which can be positive ( e.g. if place > object ) or negative ( e.g. if object > place ) . thus , while we observed greater activity in scz than control in the place > object contrast , it is not clear from the activation maps if such a difference is due to changes in activity in either object or place . in order to visualize the results for each condition , beta values were extracted for an roi of 11 voxels ( 9 in - plane voxels surrounding the selected voxel and one above and one below ) . rois were selected to represent a range of representative patterns of activity across the brain ( e.g. regions in which controls showed differences from scz in both person > object and place > object , and regions in which scz showed greater activity in place > object ) . which controls had greater differences between conditions than scz , controls are showing increased activity to the source memory conditions ( person and/or place ) relative to object , while values in scz do not show any such differentiation . interestingly , in regions in which we observed greater differences between conditions ( in this case , place > object ) in scz than controls , we again observe little differences between source memory and object memory in scz . thus , it is not that patients with scz are showing greater activity in the place condition , but that they are failing to modulate brain activity in the same way as control participants . results of the regression analysis with positive symptoms are presented in table 6 and fig . we observed significant negative correlations with the global hallucination score from the saps ( at first assessment ) and place > object contrast , in the right midtemporal gyrus , left prefrontal cortex , and right cerebellum ( in a region noted in at least one lesional case study to be associated with source memory deficits ; tamagni et al . , 2010 ) . in order to examine the relationship between recognition memory performance and neural activity , spearman 's correlations were run on global hallucination score , memory performance in the place and object conditions , and values from the three clusters . while hallucinations did not significantly correlate with performance in either condition ( place , rho = .228 , p = 0.32 ; object , rho = 0.28 , p = 0.22 ) , there was a marginally significant correlation between performance in the object condition and value in the dlpfc cluster ( rho = 0.38 , p = 0.088 ) .", "this study examined differences in the neural correlates of source memory in patients with schizophrenia and controls . we examined this issue using a virtual reality paradigm , which has improved ecological validity when assessing the source of a memory , as compared to other studies which have used less ecologically valid tasks . furthermore , we examined a group of patients , who were within the first 4.5 years of treatment avoiding potential issues associated with illness chronicity such as cognitive decline , prolonged exposure to medications ( although medication exposure remains an issue ) , social isolation , and sedentary lifestyle ( pelletier et al . , 2005 ) . while patients with scz demonstrated some activation in the source memory contrasts , the extent and magnitude of activity were substantially less than those in controls . even in regions in which the difference appeared to be in the directions of scz > controls , it seems to be the case that controls differentiate between source and object memory while patients do not . as discussed below , this finding may be true of other forms of memory , and may therefore be representative of the underlying deficit across a range of memory subtypes . more specifically , patients with scz may fail to activate cortical regions which facilitate elaborative memory processes . this is consistent with previous findings of relatively intact object memory in scz ( achim et al . 2009 ) , but deficits in source memory ( johnson et al . , 1993 ) and associative memory ( achim and lepage , 2003 ) . it may be that the vr environment minimizes these behavioral differences , in that the place condition may be easier than person as locations were more distinct from each other relative to the 3d rendered characters . alternatively , our recent - onset sample may have better preserved function than the more enduring schizophrenia samples often examined . however , this lack of behavioral difference has a positive aspect , in that it removes performance as a potentially major confound in the fmri analysis . had patients with schizophrenia demonstrated profound deficits in performance , it would beg the question if any observed neural activity differences were due to disease pathology or simply related to poor performance ( and as such would be similar to poor performing healthy controls ) . we did observe a performance difference in the person condition , and interestingly very little significant activity in the schizophrenia group for person > object . however , some activations observed in the group analysis , particularly in the posterior regions , were present in both person > object and place > object , suggesting that these differences were not at all modality specific . negative correlations were observed between the difference in neural activity in place > object and global hallucinations , measured at intake baseline using the saps . this suggests that the propensity of an individual to experience hallucination may modulate differences between source and object memory in these areas . we did not observe significant correlations with global thought disorder , which is not surprising as hallucinations but not thought disorder are generally associated with source memory ( woodward et al . , 2007 ) . while these regions did not directly overlap activity observed in the healthy control group , the left frontal cluster was proximal to significant activity in place > object in controls , while the middle - temporal cluster was proximal to significant voxels in the object > place clusters in controls , suggesting that these regions are at least similar to those observed in healthy controls . however , the lack of direct overlap and given the nature of the result ( greater difference with more hallucinations ) , it is possible that these regions represent malfunctioning cortical regions which are more active in patients who have experienced hallucinations as part of their disorder . this over - activation within these regions when considering source information may play an important role in generating hallucinations , which are essentially the misattribution of internally generated stimuli to an external source . at least one study has found relationships between the left prefrontal cortex and the right temporal cortex while patients are actively experiencing hallucinations ( hoffman et al . , 2011 ) , and a meta - analysis suggests that these regions among others are frequently active during hallucination ( jardri et al . , 2011 ) . as such , the regions found to be significantly active in our regression are consistent with the existing literature on the neurobiology of hallucinations . while many studies examining hallucinations have utilized either general state based measurements ( approximately how much the participant is hallucinating in general at the time ) or direct analysis of overall activity during hallucinations , we have attempted to utilize a our sample of patients early in treatment makes such an approach possible with minimal confounding for chronicity ( which we attempted to control for by including length of treatment as a covariate in the regression ) . our results overall suggest a relationship between mal - adaptive neural activity related to source memory retrieval and how prone participants are to hallucinatory symptoms , further verifying the relationship between source memory and hallucinations ( woodward et al . , 2007 ) . however , some limitations must be considered as well . while we have attempted to use baseline scores as a trait measure of how prone an individual is to hallucinations , it is well known that clinical symptoms can vary across time . as such , the appropriate method for evaluating trait symptoms is to take repeated symptom measurements over time ( mathalon and ford , 2012 ) . it would be preferable to have several assessments of pre - treatment symptoms to have a complete picture of the symptom profile of a given patient , but this is not possible as it would require delaying treatment . as such we utilized the best available measure to assess pre - treatment symptom profile , which produced results which are consistent with the existing literature on those symptoms . however , it is important to remain considerate of the limitations of our measures when considering these results . source memory can be considered a form of associative / relational memory , as participants are binding elements together during encoding and storing these elements together as part of a larger whole . a deficit in source memory can be viewed as a failure to associate a memory item with its context . in the case of this study in particular , our source memory paradigm is not far removed from studies examining associative memory ( achim et al . , 2007 ; achim and lepage , 2005 ; murray and ranganath , 2007 ) , which is known to be more impaired in scz than object memory ( achim and lepage , 2003 ) . some studies have suggested that patients with schizophrenia do not properly differentiate between associative and item memory ( achim et al . 2012 ) , in keeping with suggestions that source memory impairments are part of associative memory impairments ( achim et al . , 2011 ) . our present study focused on source retrieval , and as such we can not definitively determine if the differences observed in our contrasts are driven by deficits in encoding ( in that the information was not properly moved into memory ) or retrieval ( in that the memories may have been encoded but are not properly accessed ) , or a combination of both ( which seems likely given the plurality of evidence for memory deficits in scz ) . ( 2011 ) found deficits in source memory even when using short term recall , minimizing the need for retrieval of information from long - term memory . this suggests that at least part of the source memory deficit in scz is related to problems with encoding . our finding of an overall pattern of lack of differentiation between conditions may be a fairly consistent finding in the cognitive neuroscience of memory in scz , regardless if one considers activity during encoding or retrieval / recognition . core regions required for task performance may be relativity intact in scz , while deficits in activity will be observed in that is to say , the deficits in memory ( and possibly cognition in general ) are related to a lack of engagement of extended cortical regions . these extended regions are not critically required for minimal task performance , but instead serve to enhance performance ( such as regions involved in cognitive control processes ) . healthy controls will tend to utilize such areas automatically , while patients with schizophrenia will fail to do so . for example , patients with scz have been shown to have impairments in initiating elaborative encoding processes which may be beneficial during associative encoding ( brebion et al . however , when patients are specifically instructed to utilize effective encoding strategies they show an improvement in memory performance , demonstrating that patients with scz can utilize such encoding strategies when specifically instructed but fail to do so spontaneously ( brebion et al . , 1997 ) . this pattern of results is similar to that in patients with prefrontal cortical lesions ( alexander et al . , 2003 ) . bonner - jackson et al . ( 2008 ) examined memory strategies in schizophrenia by contrasting intentional but unstructured encoding ( simply instructing participant to memorize words ) with an externally imposed deep encoding strategy ( having participants perform an abstract / concrete judgement on words , deep semantic encoding which facilitates memory encoding ; craik and lockhart , 1972 ) . they observed group encoding interactions in several regions , including the left inferior frontal gyrus and precuneus , with the most common finding being a difference between controls and scz in the incidental , unstructured encoding condition . for example , in the left inferior frontal cortex , scz patients showed no activity for unstructured encoding , but substantial activity for deep encoding . that is to say , when scz patients were provided a structured encoding strategy they activated this region , but failed to do so spontaneously . likewise , controls showed significantly better memory performance than scz patients for the deep encoding condition . further support for the importance in strategic and/or cognitive control comes from findings of changes and/or normalization of activity in scz following cognitive training ( hooker et al . , 2012 ; penades et al . , within both encoding and recognition studies in schizophrenia , the most prevalent finding is a decrease in the extent or magnitude of activity in scz patients relative to controls , although many studies also report findings in the direction of scz > controls ( ragland et al . , 2009 ) . while it is likely that scz often shows compensatory networks or inefficient over - activation during cognitive tasks , it can be difficult to judge from many of the published studies on cognition in scz . many papers report differences in group activities without also reporting the parameter estimates which accompany those changes . if we had done so in this study ( by only presenting the activation maps in fig . 3 and not the beta values ) we may have concluded that scz showed greater activity in some regions for place vs. object and concluded that this was compensatory of maladaptive over - activation . however , when examining the beta values , we realize that this is not the case but instead these are regions where controls show greater activity for object over place ( often in the form of a decrease in activity for place ) . this highlights the importance of carefully examining parameter estimates when performing between - group comparisons . it is possible that in at least some cases in the existing literature , the so - called compensatory activity may instead be a lack of activity relative to the control group , such as was the case in this study . such ambiguity and misinterpretation can be avoided if studies fully report parameter estimates for contrasts which differ between groups .", "we have reported the results of a study looking at source memory retrieval in scz using a virtual reality environment on a group of patients relatively early into treatment . while controls activated a large , extensive network for source relative to object retrieval , scz showed a marked reduction in activity . this reduction was borne out in the group comparison , and appears to be related to the fact that patients with scz are failing to activate these regions or differentiate between object and source retrieval . despite the large - scale group differences , patients were still able to perform the source retrieval tasks , suggesting that at least some of the core system involved in source retrieval is intact . instead , we propose that the observed differences are related to supporting regions which are not critical to task performance but instead facilitate source retrieval . that is , patients may generally fail to engage extended cortical networks which facilitate task performance and facilitate overall cognitive functioning ." ]

[ "ras is a multifunctional signaling molecule acting as an essential component of signal transduction pathways that regulate cellular physiology ( campbell et al . members of the ras family of proteins that are constitutively activated by point mutations play a major role in the onset of a large number of human cancers , including those originating from skeletal muscle tissue ( yoo et al . these skeletal muscle tumors are incapable of differentiation and thus do not withdraw from the cell cycle . up to 35% of these tumors contain activating ras point mutations , suggesting a major involvement of ras in rhabdomyosarcomas ( stratton et al . constitutively active ras mutants stimulate secretion of growth and angiogenic factors ( rak et al . 1995 ) , potentially allowing neoplastic cells to overcome growth restrictions in their normal tissue environment . in skeletal muscle cells , activated ras mutants have been shown to promote secretion of an unidentified factor that can repress myogenic differentiation and may participate in the development of rhabdomyosarcomas ( weyman and wolfman 1997 ) . of particular interest is the observation that cultured human embryonal rhabdomyosarcoma cells express the fgf-2 gene and produce biologically active fgf-2 ( schweigerer et al . release of fgf-2 may stimulate the growth and neovascularization of human rhabdomyosarcomas and contribute to tumor development . although ectopic expression of oncogenic ha - ras in myogenic cell lines represses terminal differentiation , it is not reported to elicit a proliferative response ( olson et al . 1987 ; konieczny et al . 1989 ; weyman and wolfman 1997 ) . from these studies , it has been concluded that ras inhibits muscle differentiation without affecting proliferative response pathways . fgfs are likely candidates for such factors since they play critical roles in regulation of skeletal muscle differentiation in cultured cells ( linkhart et al . 1981 ; allen et al . 1985 ; kardami et al . 1985 ; seed and hauschka 1988 ; rando and blau 1994 ; flanagan - steet et al . 2000 ) , in skeletal muscle development in vivo ( flanagan - steet et al . 2000 ) , and in skeletal muscle regeneration ( anderson et al . 1995 ; floss et al . mm14 myoblasts express fgf-1 , -2 , -6 , and -7 but are absolutely dependent on exogenously supplied fgfs to repress myogenesis and promote cell proliferation ( clegg et al . fgf-2 is one of four fgfs that do not possess signal peptides and do not use the classical er / golgi - dependent secretory pathways for export from the cell ( florkiewicz et al . since ectopically expressed ha - ras can repress differentiation of mm14 cells ( fedorov et al . 1998 ) , we asked if ha - ras was capable of stimulating proliferation in mm14 cells . here we report that constitutively active ras stimulates mm14 myoblast proliferation via a novel mechanism that is dependent on export of endogenously produced fgf-2 and subsequent release or activation of the exported fgf-2 . moreover , we also found that the signaling pathways used by oncogenic ras to stimulate proliferation and repress differentiation in myogenic cells are distinct and mediated independently .", "mouse mm14 cells ( lim and hauschka 1984 ) were cultured as described previously ( kudla et al . baf3/fr1 cells , a baf3 cell clone stably expressing fgf receptor ( fgfr)-1 , was cultured as described by ornitz et al . 1992 . wehi3 cells were purchased from the american type culture collection and baf3/fr1 cells ( ornitz et al . human recombinant fgf-2 was purified from a yeast strain expressing this growth factor ( rapraeger et al . heparin , nacl , and naclo3 were purchased from sigma - aldrich . a monoclonal anti 1993 ) and anticysteine - rich fgfr control antibody ( zuber et al . 1997 ) were used as described previously ( hannon et al . dna was transiently transfected into mm14 cells by a calcium phosphate dna precipitation method as described previously ( kudla et al . equivalent dna concentrations were maintained by the addition of a pbssk+ ( stratagene ) plasmid . the pdcr - h - ras ( g12v ) expression vector encoding a constitutively active mutant of human ha - ras , rasg12v ( white et al . mm14 cells were grown on 6-well plates to a density of 5 10 and transfected with the indicated expression vectors or control plasmids . cells were trypsinized ( 0.05% trypsin , 0.53 mm edta ) and replated at clonal density ( 1,000 cells per 10-cm plate ) 1 h after transfection . the cells were maintained in the presence or absence of fgf-2 ( 0.3 nm unless otherwise indicated ) , cultured for 36 h , then processed for -galactosidase histochemistry as described elsewhere ( sanes et al . a differentiation - sensitive muscle - specific reporter activity assay was used to determine the extent of mm14 differentiation after transient transfection . the reporter contained the firefly luciferase gene driven by a muscle - specific promoter ( msp ; human anti - cardiac actin promoter ) ( kudla et al . transfected cells were plated at 10 cells per well in 6-well plates and incubated for 36 h in growth media without fgf . cells were then washed once with pbs ( ph 7.2 ) and incubated for 1 h at room temperature in 1 ml of baf3/fr1 growth medium supplemented with 50 g / ml of heparin . baf3/fr1 cells ( 10 cells per well in 24-well plates ) were incubated in the collected medium for 72 h. the number of living cells in each well was quantified by counting the number of cells that exclude trypan blue .", "mouse mm14 cells ( lim and hauschka 1984 ) were cultured as described previously ( kudla et al . baf3/fr1 cells , a baf3 cell clone stably expressing fgf receptor ( fgfr)-1 , was cultured as described by ornitz et al . 1992 . wehi3 cells were purchased from the american type culture collection and baf3/fr1 cells ( ornitz et al . human recombinant fgf-2 was purified from a yeast strain expressing this growth factor ( rapraeger et al . heparin , nacl , and naclo3 were purchased from sigma - aldrich . a monoclonal anti 1993 ) and anticysteine - rich fgfr control antibody ( zuber et al . 1997 ) were used as described previously ( hannon et al .", "dna was transiently transfected into mm14 cells by a calcium phosphate dna precipitation method as described previously ( kudla et al . equivalent dna concentrations were maintained by the addition of a pbssk+ ( stratagene ) plasmid . the pdcr - h - ras ( g12v ) expression vector encoding a constitutively active mutant of human ha - ras , rasg12v ( white et al .", "mm14 cells were grown on 6-well plates to a density of 5 10 and transfected with the indicated expression vectors or control plasmids . cells were trypsinized ( 0.05% trypsin , 0.53 mm edta ) and replated at clonal density ( 1,000 cells per 10-cm plate ) 1 h after transfection . the cells were maintained in the presence or absence of fgf-2 ( 0.3 nm unless otherwise indicated ) , cultured for 36 h , then processed for -galactosidase histochemistry as described elsewhere ( sanes et al .", "a differentiation - sensitive muscle - specific reporter activity assay was used to determine the extent of mm14 differentiation after transient transfection . the reporter contained the firefly luciferase gene driven by a muscle - specific promoter ( msp ; human anti - cardiac actin promoter ) ( kudla et al .", "to determine their fgf-2 export capabilities , transfected cells were plated at 10 cells per well in 6-well plates and incubated for 36 h in growth media without fgf . cells were then washed once with pbs ( ph 7.2 ) and incubated for 1 h at room temperature in 1 ml of baf3/fr1 growth medium supplemented with 50 g / ml of heparin . the medium was then collected and filtered through a 0.2-m filter . baf3/fr1 cells ( 10 cells per well in 24-well plates ) were incubated in the collected medium for 72 h. the number of living cells in each well was quantified by counting the number of cells that exclude trypan blue .", "mm14 cells are absolutely dependent on exogenously supplied fgfs to repress myogenesis and promote proliferation , yet they express several fgfs ( hannon et al . 1996 ) , suggesting that the endogenously produced fgfs are inaccessible to fgfr-1 . in addition , we have established that distinct fgfr-1 signaling pathways mediate the proliferative and differentiation inhibitory responses in mm14 cells ( kudla et al . ectopic ha - ras expression stimulated proliferation and repressed differentiation of mm14 cells in the absence of exogenous fgf ( fig . 1 ) . activated ras appears to replace only fgf - dependent signaling events since mm14 cells transfected with oncogenic ras were unable to proliferate in growth medium with reduced ( 2.5% ) serum ( data not shown ) . we hypothesized that ha - ras may induce fgf export or secretion of endogenously produced fgfs and therefore treated mm14 cells expressing rasg12v with agents that block fgf signaling . addition of suramin , a negatively charged polysulfonated binaphthyl urea used as a general heparin - binding growth factor antagonist ( lozano et al . 1998 ) , to cells ectopically expressing oncogenic ras inhibited proliferation in a dose - dependent manner ( fig . fgf-2 antibody completely abolished the capacity of ha - ras to stimulate proliferation ( fig . 2 a ) , whereas addition of a control monoclonal antibody had no effect ( fig . unexpectedly , we found that the ability of ha - ras to stimulate proliferation appears dependent on extracellularly supplied fgf-2 . fgf signaling is dependent on heparan sulfate , which involves the interaction of heparan sulfate with both fgf and the fgfr tyrosine kinases ( rapraeger et al . in addition , heparan sulfate proteoglycans ( hspgs ) participate in fgf storage , sequestration , and release ( rifkin and moscatelli 1989 ) . treatment of mm14 cells with sodium chlorate , a reversible inhibitor of intracellular sulfation , prevents fgf binding and induces terminal differentiation ( rapraeger et al . incubation of oncogenic ras - transfected mm14 cells with heparitinase ( not shown ) or sodium chlorate significantly decreases cell proliferation ( fig . 3 a ) . both heparitinase ( not shown ) and chlorate - induced inhibition of mm14 cell proliferation was rescued by addition of heparin ( 50 g / ml ) , indicating that the effect is heparan sulfate specific ( fig . 3 a ) . surprisingly , addition of 600 pm fgf-2 to chlorate - treated ha - ras transfected cells promoted proliferation , ameliorating the inhibitory chlorate effect ( fig . this was unexpected since addition of fgf-2 had no effect on chlorate - treated parental mm14 cells or mm14 cells transfected with a pcdna3 vector control ( fig . 3 b ) . the requirement for hspgs and the ability to overcome this requirement with high concentrations of exogenously added fgf-2 suggests a more complicated role for hspgs in addition to their known requirement for signaling . taken together , our data demonstrate that rasg12v induces proliferation of skeletal muscle cells and that induction of proliferation requires an autocrine fgf-2 response . little is known regarding the mechanisms involved in fgf-2 export since fgf-2 has no signal peptide sequence and is not secreted through the established golgi - dependent secretory pathway ( mignatti et al . 1992 ) . instead , an unusual atp - dependent pathway that includes the na / k - atpase appears to be involved ( florkiewicz et al . whether oncogenic ras is directly involved in regulating fgf-2 export , we asked if mm14 cells expressing ha - ras exhibited increased levels of extracellular fgf-2 . although transfection of mm14 cells with fgf-2 results in export of biologically active fgf-2 ( hannon et al . 1996 ) , this extracellular fgf-2 can not be detected in the tissue culture media , presumably due to its strong association with membrane - bound and extracellular matrix associated heparan sulfate . one assay utilizes heparin treatment of mm14 cells to release bound fgf-2 , which is then assayed on baf3 cells expressing fgfr-1 ( baf3/fr1 ) . baf3 cells are pre - b cells that undergo apoptosis after interleukin 3 withdrawal and do not express either fgfrs or hspgs . as such , these cells are unresponsive to fgfs , unless they ectopically express fgfrs and heparin is added as an hspg substitute ( ornitz et al . we found that both ras - g12v and control ( pcdna3)-transfected mm14 cells release similar levels of factor(s ) that support baf3/fr1 survival and promote baf3/fr1 proliferation ( fig . a second assay involves cotransfection of mm14 cells with a construct encoding an fgf-2luciferase fusion protein and either ras - g12v or a control vector . the results from this assay are indistinguishable from the baf3/fr1 cell assay , suggesting that similar levels of fgf-2 are exported by control and ha - ras transfected cells ( data not shown ) . we conclude that oncogenic ras does not affect the level of fgf-2 export from mm14 cells . although mm14 cells produce fgf-2 and export fgf-2 that can be recovered in an active form , this fgf-2 is not normally available to the cells ( hannon et al . thus , our data suggest that exported fgf-2 is normally retained in an inactive form on the cell surface . we propose that ha - ras activates this inactive extracellular pool of fgf-2 either by promoting its release from hspgs or by providing a mechanism for fgf-2 to gain access to cell surface fgfr-1 . although the mechanisms involved are not understood , the ability of the ha - ras mutant to promote proliferation is dependent on exogenous fgf-2 and subsequent fgf-2mediated signaling events . the ability of oncogenic ras to inhibit skeletal muscle differentiation has been well documented , but the ras effector mediating repression of differentiation is not known ( ramocki et al . we wanted to determine if the ability of ras to effectively inhibit mm14 differentiation was dependent on extracellular fgf-2 , as is the proliferation response . fgf-2 antibody did not affect the ability of ras - g12v to repress myogenesis ( fig . these data are consistent with our results published previously , which demonstrate that independent fgf signaling events mediate repression of differentiation and proliferation ( kudla et al . thus , similar to fgfr , ha - ras appears to utilize independent signaling mechanisms to repress terminal differentiation and promote proliferation . although the downstream signaling events that mediate the repression of myogenesis by ras are not understood , it is well documented that oncogenic ras stimulates secretion of growth factors and angiogenic factors ( rak et al . moreover , ectopic expression of activated ras releases a factor that represses myogenic differentiation ( weyman and wolfman 1997 ) . data presented in this report argue that oncogenic ras may be involved in the activation or release of extracellularly localized fgf-2 that is normally sequestered in a biologically inactive state . it is noteworthy that all of the extracellular activity observed is neutralized by a specific blocking fgf-2 monoclonal antibody , since proliferating mm14 cells synthesize fgf-1 , -2 , -6 , and -7 ( hannon et al . 1996 ) . although detectable , fgf-2 mrna is present at extremely low concentrations in many adult tissues despite the presence of high levels of fgf-2 activity , suggesting a mechanism for retaining or storing fgf-2 in a biologically inert form ( baird et al . oncogenic ras appears to be involved in activating or releasing inactive , extracellularly localized fgf-2 . the fgf-2 produced by skeletal muscle cells can not be detected in the tissue culture medium , forming the basis for previous conclusions that the ras - secreted myogenic inhibitory factor was not an fgf ( weyman and wolfman 1997 ) . the ras - dependent proliferation factor we identified is released by a heparin wash and its activity is abrogated by treatment with either chlorate , heparitinase , suramin , or a monoclonal anti fgf-2 antibody , implying that the proliferation factor is fgf-2 . together with the prevalence of oncogenic ras mutants in rhabdomyosarcomas and the involvement of fgfs in regulation of myogenesis , our data suggest that fgf-2 may be a critical factor for supporting ras - dependent growth of rhabdomyosarcomas ." ]

[ "lipomas represent uncommon neoplasms of the oral cavity ; only 1% to 5% of cases occur at this site . based on their histopathological features of conspicuous multiple components , lipomas can be divided into some subclasses [ 2 , 3 ] , and the most common is the fibrolipoma [ 1 , 3 , 4 ] . cases reporting on lipoma with osteo / chondroid differentiaion were only 16 cases as a result of retrieving literature from 1960 to 2008 . further , other names of this subclassification exist in literature ; osteo / chondrolipoma , ossifying / osseous lipoma , lipoma with chondro / osseous metaplasia , and lipoma with cartilaginous / osseous change . the obscure etiology of osseous / chondroid differentiaion led to confusion of the name . to clarify the etiology of osseous / chondroid differentiaion in lipoma , the authors report additional 2 cases of oral lipoma / fibrolipoma with osseous and/or chondroid differentiation and describe the clinical , histopathological , and immunohistological features of these . review of the literature and clinicopathological analysis from the files of the oral pathology department , nihon university school of dentistry at matsudo from 1995 to 2007 of these cases were performed and compared .", "two cases that had been diagnosed as lipoma with osteo / chondroid differentiation were retrieved from the files mentioned earlier . in these cases , sections of 2 cases were deparaffinized in xylene and dehydrated in tris - buffered saline ( ph 7.6 ) . primary antibodies against e29 ( epithelial membrane antigen ( ema ) ) , qbend 10 ( cd34 class ii ) , ki - s5 ( ki-67 antigen ) , 5.8a ( myo d1 ) were purchased from a commercial source ( dako , denmark ) , and sc-12488 ( runx-2 ) , sc-20095 ( sox-9 ) , sc-71992 ( s-100 chain ) , sc-71993 ( s-100 chain ) , sc-55520 ( fgf-1 ) , and sc-57494 ( vegf ) were purchased from a commercial source ( santa cruz biotechnology , inc , usa ) . for detection of the antigen , the dextran polymer method ( chem mate envision kit , dako , denmark ) was used . to improve detection , the deparaffinized sections were pretreated by microwave heating with citrate buffer ( ph 6 ) . the primary antibodies were generally used at a dilution of 1 : 50 , and the incubation time was 1 hour at room temperature . positive controls consisted of specimens of schwannoma for s-100 and ; squamous cell carcinoma for ema , cd34 and ki-67 ; ossifying fibroma for fgf-1 and runx-2 , normal lung tissue for sox-9 ; and inflammatory granulation tissue for myod-1 . as a negative control , mouse igg1 ( ki-67 , vegf , cd34 , s-100 ) , igg2a ( ema , s-100 ) and igg2b ( fgf-1 ) , goat igg ( runx-2 ) and rabbit igg ( sox-9 ) were used instead of the primary antibodies . at least 500 nuclei were counted in 5 high - power ( x400 ) fields and ki-67 labeling index was calculated . mean intratumor microvessel density was obtained by calculating the average counts of these 5 fields . the protocol was approved by the committee on studies involving human beings of nihon university school of dentistry at matsudo ( ec 05 - 002 ) . clinical data were retrieved from patient records , and all cases were reviewed microscopically and subclassified . the literature from 1960 to 2008 of lipoma with osseous / chondroid differentiation was reviewed .", "\n case 1a 28-year - old woman presented with a painless relatively hard mass on the dorsal surface in the midline of the tongue that had recently grew slightly . the patient 's mother first noticed a tiny nodule when the patient was 6 months old . examination showed a well - defined hard nodular mass , approximately 16 16 9 mm in size , which was sharply demarcated within the muscles of the tongue and freely mobile . a yellowish tinge was visible through the overlying mucous membrane and the lesion was firm on palpation . clinical diagnosis of lipoma with calculus was made and the tumor was completely excised from the tongue under general anesthesia . gross examination showed a yellowish soft to hard smooth mass measuring 16 15 12 mm in size . microscopically , the tumor consisted of a well - circumscribed mass of fatty tissue with a cellular chondroid component . chondromatous nodules within uniform adipose tissue were seen in large areas of mature fat cells supported by fibrous connective tissue ( figure 1 ) . pathological diagnosis was made as lipoma with chondroid differentiation . \n a 28-year - old woman presented with a painless relatively hard mass on the dorsal surface in the midline of the tongue that had recently grew slightly . the patient 's mother first noticed a tiny nodule when the patient was 6 months old . examination showed a well - defined hard nodular mass , approximately 16 16 9 mm in size , which was sharply demarcated within the muscles of the tongue and freely mobile . a yellowish tinge was visible through the overlying mucous membrane and the lesion was firm on palpation . clinical diagnosis of lipoma with calculus was made and the tumor was completely excised from the tongue under general anesthesia . gross examination showed a yellowish soft to hard smooth mass measuring 16 15 12 mm in size . microscopically , the tumor consisted of a well - circumscribed mass of fatty tissue with a cellular chondroid component . chondromatous nodules within uniform adipose tissue were seen in large areas of mature fat cells supported by fibrous connective tissue ( figure 1 ) . case 2a 59-year - old man presented with a relatively painless hard mass on the left side of the lower labial vestibule surface , which appeared the sense of incompatibility 2 months prior to consultation . examination showed a well- defined hard nodular mass , approximately 5 mm in diameter , and freely mobile , and covered with mucosa of normal aspect and color . there was no tenderness , no sign of inflammation . to retrieve more - detailed relativity with the surrounding tissue , ct was taken and showed a lesion in the left side of the lower lip that appeared to be a small mass with areas of little calcification within . gross examination showed a yellowish soft to hard smooth mass measuring 9 5 5 mm in size . microscopically , the tumor consisted of a well - circumscribed mass of mature fat cells supported by fibrous connective tissue septa and myxoid tissue characterized by spindle cells . a focal island of consecutive chondroid and woven bone component was surrounded by spindle / fusiform - shaped mesenchymal cells throughout the lesion ( figure 2 ) . pathological diagnosis was made as fibrolipoma with osseous / chondroid differentiation . \n a 59-year - old man presented with a relatively painless hard mass on the left side of the lower labial vestibule surface , which appeared the sense of incompatibility 2 months prior to consultation . examination showed a well- defined hard nodular mass , approximately 5 mm in diameter , and freely mobile , and covered with mucosa of normal aspect and color . there was no tenderness , no sign of inflammation . to retrieve more - detailed relativity with the surrounding tissue , ct was taken and showed a lesion in the left side of the lower lip that appeared to be a small mass with areas of little calcification within . gross examination showed a yellowish soft to hard smooth mass measuring 9 5 5 mm in size . microscopically , the tumor consisted of a well - circumscribed mass of mature fat cells supported by fibrous connective tissue septa and myxoid tissue characterized by spindle cells . a focal island of consecutive chondroid and woven bone component was surrounded by spindle / fusiform - shaped mesenchymal cells throughout the lesion ( figure 2 ) . the patients made an uneventful recovery , and after 15 years ( case 1 ) and 1-year ( case 2 ) follow - up , there was no sign of recurrence . all chondrocytes were stained for s-100 & , some for runx-2 ( figure 3(a ) ) and some of the outer layer for sox-9 . spindle cells were divided into 2 groups ; peripheral spindle cells around osteo / chondroid tissue and distant spindle cells inside the myxoid area . peripheral spindle cells around chondroid tissue stained diffusely for s-100 & and sox-9 ( figure 3(b ) ) , though peripheral spindle cells around osteoid tissue only stained for runx-2 ( figure 3(c ) ) . distant spindle cells inside the myxoid area stained diffusely for s-100 and focally for s-100 , myod , sox-9 , and cd34 . as for the number of vessels detected by cd34 , there were 5.0 vessels in this tumor , and there was no differences among the inside areas . none of the cases stained for either ema or fgf-1 or with vegf . between 1995 and 2007 , the files for all cases of oral lipoma at this department showed 909 cases of nonepithelial tumors in the oral soft tissue . of all the lipoma cases , 27 occurred in males and 19 in females ; their mean age was 53.8 years ( range : 2872 years ) . most lesions were located in the buccal mucosa ( n = 16 ) , margin of tongue ( n = 10 ) , lower lip ( n = 7 ) , gingiva ( n = 4 ) , and others . microscopically , 28 cases ( 61.0% ) were classified as lipoma and 18 ( 39.0% ) as fibrolipoma . the literature from 1960 to 2008 of lipoma with osseous / chondroid differentiation was reviewed . fourteen reports ( including 16 cases ) were described , and our cases are number 17 and 18 . of all cases , 10 occurred in males and 8 in females ; their mean age was 52.4 years ( range : 2181 years ) . most lesions were situated in the tongue ( n = 6 ) , lower lip ( n = 5 ) and other areas . microscopically , 6 cases ( 33.3% ) had an osseous component , 11 cases ( 61.1% ) had a chondroid component , and 1 case ( our case , 5.6% ) had an osseous / chondroid component .", "\n\t\t\t\t according to our review of the english - language literature , which included our cases , 6 cases were described as lipoma with osseous component [ 57 , 9 , 14 , 15 ] , 11 cases as chondroid component [ 4 , 813 , 16 , 17 ] and 1 case as fibrolipoma with osseous / chondroid components . our case 2 is namely the first report of fibrolipoma with osseous / chondroid differentiation . osteolipomas are less common than chondrolipomas in the whole body , and almost the same tendency was described in oral lesion . lipoma with osseous / chondroid differentiaion is extremely rare and occurs mainly in large long - standing lipomas [ 15 , 19 ] . case 1 also showed 28-year duration , and this might cause the osseous / chondroid to change into lipoma . as with many tumors , further indistinct etiology of osseous / chondroid change in lipoma has been discussed and most researchers mentioned that their origin is from different types of undifferentiated mesenchymal cells . the hypothesis is that the neoplastic transformation occurs in multipotential undifferentiated mesenchymal cells that later differentiate into lipoblasts , chondroblasts , or osteoblasts and fibroblasts . another hypothesis is that only the adipose cells have a neoplastic transformation , and that the cartilage and bone is produced by differentiation of undifferentiated mesenchymal cells of stroma in chondroblasts or osteoblasts . immunohistochemical results in this study indicated that there was no proliferative characteristic in mesenchymal ( spindle ) cells with small positive rates by ki-67 . chondrocytes and peripheral spindle cells around chondroid tissue with positive findings for s-100 , , and sox-9 had chondromatous characteristics . sox-9 belongs to the sox ( sry - related high - mobility group box ) family of transcription factors and is a key regulator of developmental processes including chondrogenesis . runx-2 is essential for skeletal mineralization when it stimulates osteoblast differentiation of mesenchymal stem cell and mature chondrocyte differentiation . positive findings for runx-2 in spindle cells around osteoid components and some of chondrocytes indicated osteoblast / chondrocyte characteristics of them . these characteristics are synthesized and thought to be differentiation on account of small positive rate for ki-67 and negative findings for vegf and fgf-1 in this study . osseous / chondroid formation occurred in the central part of these tumors in which a small amount of vessels existed . multipotential undifferentiated mesenchymal cells had undergone differentiation to osteoblast / chondroblast by topical modification , such as nutrition disorder or asphyxia . the bone formation adjacent to chondroid tissue should not be dystrophic calcification because of its positive findings for runx-2 in spindle cells surrounding chondrocytes . these immunohistochemical results supported the conclusion that endochondral ossification and/or perichondral ossification had occurred in these tumor . these results supported lipoma with osseous / chondroid differentiation . lipomas are benign mesenchymal neoplasms composed of mature adipocytes and are rare soft tissue tumors with a 2.2% incidence rate of the whole body . a 20% incidence rate of lipoma has been reported in the head and neck region . a 5% incidence rate in oral lesion of this study showed lower than in the head and neck region , but this rate is almost the same tendency compared to previous reports [ 1 , 20 , 21 ] . the average age of the patient of lipoma was 53.8 years old , and male - to - female ratio was 1.4 : 1.0 in this study . our study supports the current reports that lipomas are generally more common in males than in females ( soft tissue ) , and occurred in adult patients most often between the ages of 40 and 60 years [ 1 , 3 ] . the predominant locations were the buccal mucosa and the margin of the tongue and the lower lip , where there is plenty of adipose tissue . the patients ' characteristics and location distribution , cheek and tongue , were similar to previous reports [ 1 , 20 , 22 ] . microscopically , 28 cases ( 61.0% ) were classified as lipoma and 18 ( 39.0% ) as fibrolipoma . fujimara have reported , but our case 2 is the first report of fibrolipoma with osseous / chondroid differentiation . the two cases this reports contributed to pile up of rare lipoma / fibrolipoma with osseous / chondroid differentiation case , and , in addition , immunohistochemical result is contributed to the clarification of the etiology ." ]

[ "leydig cell tumours are rare stromal tumours of the testis accounting for 13% of testicular neoplasms . they exhibit a peak incidence in the preadolescent as well as in the older ( > 50 years ) age groups [ 1 , 2 , 3 , 4 ] . the diagnosis of a malignant leydig cell tumour is not always easy since no definite histological criteria for malignancy exist .", "a 35-year - old man presented to our hospital with a 3-month history of a painless left testicular mass . blood concentrations of chorionic gonadotrophin , fetoprotein and human placental lactogen were within the reference range . a left radical orchidectomy was performed and the specimen submitted for histopathological examination . on microscopic examination , a malignant leydig cell tumour was found . the cells displayed acidophilic cytoplasm , intranuclear inclusions and increased mitotic activity ( > 3/10 hpf ) . many cells with large atypical pleomorphic nuclei could also be observed ( fig . 1 , fig . 2 ) . there was no angiolymphatic invasion , foci of necrosis or extension beyond the capsule of the testis . the immunohistochemical study showed that the tumour cells were positive for vimentin , melan a and inhibin , and negative for ckae1 , ckae3 , s100p , p63 , cea , afp and actin . 3 ) . retroperitoneal lymph node dissection was suggested , but the patient declined further surgery .", "leydig cell tumours are rare and only about 3% of them are bilateral . about 1520% of the patients already present with metastatic disease , particularly in the lymph nodes , lung and liver . these tumours may be hormonally active , and gynaecomastia is seen in 30% of the cases [ 2 , 3 , 6 ] . leydig cell tumours in an undescended testis may exhibit only manifestation of endocrinological disorders such as gynaecomastia , impotence and loss of libido . however , among the 480 cases of leydig cell tumours reported in the literature , only 20 cases were associated with cryptorchidism , and there is no evidence that undescended testes are more prone to develop leydig cell tumours [ 2 , 5 , 7 ] . features associated with malignancy include a large tumour size ( 5.7 cm ) , nuclear atypia , a mitotic count of > 3/10 hpf , foci of necrosis , angiolymphatic invasion , infiltrative margins , dna aneuploidy and an increased expression of ki67/mib-1 and p53 [ 2 , 3 , 8 , 9 , 10 ] . our patient was young and did not fit into either of the known age incidence peaks . microscopic features such as the severe nuclear atypia and increased mitotic activity ( > 3/10 hpf ) favoured the diagnosis of malignancy . however , there was no angiolymphatic invasion or extension beyond the capsule of the testis . also , the small size of the tumour was remarkable ." ]

[ "the prevalences of asthma , allergic rhinitis and allergic eye disease in antalya , on the south coast of turkey , have been reported as 8.2% , 10.8% and 7.5% , respectively . allergic diseases are most likely due to complex interactions between largely unknown genetic and environmental factors [ 36 ] . the micro - array techniques for the detection of specific ige have improved the diagnostic procedures for allergic diseases . a detailed knowledge of the sensitization pattern may have relevant implications for the prescription of specific immunotherapy . a number of epidemiologic studies have also supported a relationship between allergic rhinoconjunctivitis and diet , hygiene , and life - style , suggesting that environmental factors also impact the development of allergic rhinoconjunctivitis . apoptosis is an active physiological process that can cause an inflammatory reaction and tissue damage , and is fundamental to maturation and homeostasis in the immune system . it can be induced passively , through lack of essential survival signals , or actively , through ligand - induced trimerization of specific death receptors of the tumor necrosis factor ( tnf ) receptor family , such as fas , the tnf receptor , or the tnf - related apoptosis - inducing ligand ( trail ) receptor . trail also is able to prevent apoptosis through the actions of its decoy receptors , dcr-1 and dcr-2 . various regulators of trail include fadd , iaps , bcl-2s , p53 , and flips . trail is present in cells involved in asthma , including eosinophils , mast cells , fibroblasts , and airway epithelial cells . it is expressed in airway remodeling and may be linked with the pathways of transforming growth factor beta1 , which is thought to cause damage to the epithelium . the repair process of the epithelium is hindered as a result of increased apoptosis induced by tgf - beta1 , which overlaps with the pathways of trail . trail is also seen as the basis for a miracle drug for cancer because of its ability to selectively kill cancer cells . it has previously been reported that negative selection of t cells in the thymus is controlled by trail . for example , mice deficient in trail had a severe defect in thymic deletion of t cells and were hypersensitive to collagen - induced arthritis . mast cells activation through fc epsilon ri cross - linking has a pivotal role in the initiation of allergic reactions . ige - dependent activation increases trail - induced caspase-8 and caspase-3 cleavage , and regulates human mast cell apoptosis by fine - tuning anti - apoptotic and pro - apoptotic factors . our study aimed to identify the role of strail in the pathophysiology of allergic rhinoconjunctivitis , and to explore whether allergen - specific subcutaneous immunotherapy treatment of allergic rhinoconjunctivitis patients altered any observed effect of strail .", "the study was conducted in antalya , turkey between 9 january 2009 and 28 january 2010 . the study was approved by the local ethics committee , and written consent was obtained from all patients and healthy volunteers . all patients were followed in the immunology and allergy clinic of antalya education and research hospital . subjects with kidney disease , heart disease , liver disease , diabetes mellitus , cancer status , obesity , ( body mass index ( bmi ) 30 kgm ) , and autoimmune disease were excluded clinically and serologically . the first group of 25 patients included 11 male and 14 female subjects with allergic rhinoconjunctivitis , having a combined mean age of 38.5612.03 years . the first group included 2 measurements in the same patients ; group - ia represents data recorded before subcutaneous allergen - specific immunotherapy , and group - ib shows data recorded 12 months after the subcutaneous allergen - specific immunotherapy . all patients received immunotherapy every 4 weeks . the symptoms and severity of allergic reactions were recorded before and after treatment . a second group of 25 healthy individuals ( 11 male and 14 female ) ( group ii ) had a mean age of 38.2312.21 years ( table 1 ) . subjects with kidney disease , heart disease , liver disease , diabetes mellitus , cancer status , obesity ( body mass index ( bmi ) 30 kgm ) , and autoimmune disease were excluded clinically and serologically . blood samples were collected into 5 ml plain vacutainer tubes and centrifuged at 3000 g for 10 min . serum ige levels , hepatitis markers ( hbs ag , anti hbs , anti hcv ) were evaluated in all patients . total and specific ige levels were enumerated by fluoroenzyme immunoassay ( immunocap - feia ) using an immunocap kit ( phar - macia , uppsala , sweden ) . values above 100 ku / l and 0.35 ku / l for total and specific ige levels were considered abnormal . serum strail levels in all individuals ( patients and healthy controls ) were measured by a sandwich enzyme - linked immunosorbent assay ( diaclone , france ) . skin prick tests on the forearm were performed in all patients , using standardized latex extract containing high ammonia natural rubber latex , and a full set of 10 common allergens . in addition , venom spt was performed on 1 patient based on the subject s clinical history . student s t test was used for comparison of controls and patient groups ( group ia and group ib ) .", "the study was conducted in antalya , turkey between 9 january 2009 and 28 january 2010 . the study was approved by the local ethics committee , and written consent was obtained from all patients and healthy volunteers . all patients were followed in the immunology and allergy clinic of antalya education and research hospital . subjects with kidney disease , heart disease , liver disease , diabetes mellitus , cancer status , obesity , ( body mass index ( bmi ) 30 kgm ) , and autoimmune disease were excluded clinically and serologically . the first group of 25 patients included 11 male and 14 female subjects with allergic rhinoconjunctivitis , having a combined mean age of 38.5612.03 years . the first group included 2 measurements in the same patients ; group - ia represents data recorded before subcutaneous allergen - specific immunotherapy , and group - ib shows data recorded 12 months after the subcutaneous allergen - specific immunotherapy . all patients received immunotherapy every 4 weeks . the symptoms and severity of allergic reactions were recorded before and after treatment . a second group of 25 healthy individuals ( 11 male and 14 female ) ( group ii ) had a mean age of 38.2312.21 years ( table 1 ) . subjects with kidney disease , heart disease , liver disease , diabetes mellitus , cancer status , obesity ( body mass index ( bmi ) 30 kgm ) , and autoimmune disease were excluded clinically and serologically .", "blood samples were collected into 5 ml plain vacutainer tubes and centrifuged at 3000 g for 10 min . serum ige levels , hepatitis markers ( hbs ag , anti hbs , anti hcv ) were evaluated in all patients . total and specific ige levels were enumerated by fluoroenzyme immunoassay ( immunocap - feia ) using an immunocap kit ( phar - macia , uppsala , sweden ) . values above 100 ku / l and 0.35 ku / l for total and specific ige levels were considered abnormal . serum strail levels in all individuals ( patients and healthy controls ) were measured by a sandwich enzyme - linked immunosorbent assay ( diaclone , france ) .", "skin prick tests on the forearm were performed in all patients , using standardized latex extract containing high ammonia natural rubber latex , and a full set of 10 common allergens . in addition , venom spt was performed on 1 patient based on the subject s clinical history .", "student s t test was used for comparison of controls and patient groups ( group ia and group ib ) .", "in this clinical follow - up study , 25 patients were already receiving subcutaneous immunotherapy , and these subjects were included for further analysis at our clinic . the mean ige levels were : group ia 699.505 iu / ml ; group ib 164.115 iu / ml ; and group ii 41.08 iu / ml . there was a statistically significant difference between the values of the research group before and after immunotherapy ( p=0/0005 ) . prick tests in all patients in group i were detected in mite , olive and grass allergy . these results correlated with specific ige , and hepatitis markers were negative in all patients . as shown in figure 1 , significant difference was seen in the mean values of strail in allergic rhinitis patients before immunotherapy ( n=25 ; 939.85352.52 pg / ml ) , afterc immunotherapy ( n=25 ; 628.93170.5 pg / ml ) and healthy controls ( n=25 ; 612.64135.6 pg / ml ) . there was a statistically significant difference between the values of the research group before and after immunotherapy ( p=0.001 ) . while there was a statistically significant difference between the pre - treated group and control group ( p<0.0001 ) , there was no difference between the post - treated group and healthy individuals ( p=0.801 ) . as shown in table 3 , there was a statistically significant difference between the values of the research group before and after immunotherapy ( grasses mixture , barley mixture , oleaauropeae , d. pteronyssinus , d. farinae )", "in this clinical follow - up study , 25 patients were already receiving subcutaneous immunotherapy , and these subjects were included for further analysis at our clinic . the mean ige levels were : group ia 699.505 iu / ml ; group ib 164.115 iu / ml ; and group ii 41.08 iu / ml . there was a statistically significant difference between the values of the research group before and after immunotherapy ( p=0/0005 ) . prick tests in all patients in group i were detected in mite , olive and grass allergy . these results correlated with specific ige , and hepatitis markers were negative in all patients . as shown in figure 1 , significant difference was seen in the mean values of strail in allergic rhinitis patients before immunotherapy ( n=25 ; 939.85352.52 pg / ml ) , afterc immunotherapy ( n=25 ; 628.93170.5 pg / ml ) and healthy controls ( n=25 ; 612.64135.6 pg / ml ) . there was a statistically significant difference between the values of the research group before and after immunotherapy ( p=0.001 ) . while there was a statistically significant difference between the pre - treated group and control group ( p<0.0001 ) , there was no difference between the post - treated group and healthy individuals ( p=0.801 ) .", "as shown in table 3 , there was a statistically significant difference between the values of the research group before and after immunotherapy ( grasses mixture , barley mixture , oleaauropeae , d. pteronyssinus , d. farinae )", "allergen - specific immunotherapy has been used in the management of allergic diseases for nearly 100 years . the results of our previous study suggest that in our region 51.8% of the allergens determined by prick test are mite and 42.3% are pollens . pollen positivity rate of the cases that had immune - therapy was 61.8% , and mite positivity rate was 60.4% . allergens are known to exhibit regional variation in expression , which suggests that the allergen profiles and skin prick tests should be designed with reference to individual locales . allergen - specific immunotherapy treatment significantly reduced the nasal symptom score across all group i patients studied . in this study , spt was a statistically significant difference between the values of the research group before and after allergen - specific subcutaneous immunotherapy ( grasses mixture , barley mixture , oleaauropeae , d. pteronyssinus , d. farinae ) . our earlier studies provided a novel perspective on severe persistent allergic asthma and the effect of anti - ige treatment , using as markers serum soluble tnf - related apoptosis - inducing ligand , total antioxidant capacity , hydrogen peroxide , malondialdehyde , ceruloplasmine oxidase activity , high sensitive c reactive protein and total nitric oxide concentrations measurements [ 1316 ] . in our previous study we found that the trail levels in variances of the patients who had the effective anti ige treatment were significantly lower than the healthy controls . engagement of the fas / fasl system has not yet been shown to contribute to increase apoptosis . recent interest has focused on the molecule trail , which is involved in the pathophysiology of different diseases , including cancer , diabetes mellitus , autoimmune diseases , and inflammation [ 1721 ] . trail also present in cells that involved in asthma including eosinophils , mast cells , fibroblasts , and airway epithelial cells . it is expressed in airway remodeling and may be linked with the pathways of transforming growth factor - beta ( tgf- ) , which is thought to cause damage to the epithelium . the repair process of the epithelium is hindered as a result of increased apoptosis induced by tgf - beta , which overlaps with the pathways of trail . these results reflect the different mechanism(s ) in the pathogenesis of allergic diseases by the regulation of apoptosis . desloratadine ( dcl ) is a non - sedating antihistamine approved for the treatment of allergic rhinitis . patients in groups i - a and b had a dcl usage history during the exacerbation phase from may to november . blood samples from the patients were obtained in january , when they would be expected to have fewer allergic symptoms . mast cells ( mc ) play a key role in allergy and are involved in several chronic inflammatory diseases . furthermore , they are involved in innate immunity and in tissue repair [ 2427 ] . the regulation of mc numbers , as of any other normal cells , depends on both their generation rate and survival time within tissues . the critical event in allergic reactions is allergen - induced crosslinking of specific ige molecules bound to fc_ri receptors on the mc surface , which triggers mc degranulation and release of inflammatory mediators . non - ige - mediated activation may also contribute to continued degranulation of mc during the late phase of allergic reactions . allergic mechanism are involved in the increased susceptibility of human mc to trail - induced apoptosis after ige - dependent activation . in this study , ige levels had a statistically significant difference between the values of the research group before and after allergen - specific subcutaneous immunotherapy .", "taken together , our results and those of others , suggest that characterization of the specific receptor systems activated , and the pro - inflammatory factors regulated , by trail in vivo may lead to the development of novel therapeutic strategies for diseases as diverse as infection , autoimmunity , and allergy ." ]

[ "calcimimetics provide an alternative approach to the traditional therapy with active vitamin d and phosphate binders for the management of secondary hyperparathyroidism ( shpt ) . type ii calcimimetics are positive allosteric modulators of the parathyroid gland calcium - sensing receptor ( car ) that increase its sensitivity to serum calcium , so that lower concentrations of calcium are sufficient to mediate signalling through the car . this suggests that , despite the reduced car expression observed in hyperplastic parathyroid tissues , calcimimetics have the potential to control even advanced disease by enhancing the function of the remaining car [ 47 ] . in addition , calcimimetics have the potential to influence both car expression and car functions that have been implicated in the progression of disease , particularly effects on parathyroid hormone ( pth ) , cell proliferation and hyperplasia . these characteristics suggest that targeting the car presents a therapeutic option for the stabilization of early disease , as well as remaining a viable therapeutic target in the face of advancing disease . in addition to being effective in patients with mild to moderate disease , calcimimetics may be the most viable option for chronic kidney disease ( ckd ) patients with advanced hyperparathyroidism , who are often refractory to standard calcitriol therapy [ 810 ] . the data below summarize preclinical findings providing a rationale for the clinical use of calcimimetics . administration of cinacalcet or the calcimimetic r-568 to 5/6 nephrectomized rats prevented hyperplasia or increased car expression . interestingly , in an in vitro study , the calcimimetic cinacalcet suppressed pth secretion in human parathyroid cells with advanced hyperparathyroidism , even though car expression was significantly diminished . expression of vitamin d receptor ( vdr ) mrna is reduced in the parathyroid gland of hypocalcaemic rats compared with normocalcaemic rats . because the vdr is a transcriptional repressor of pth recent studies indicate that type ii calcimimetics , in the presence of low concentrations of calcium , can up - regulate vdr mrna . rats injected with a calcimimetic ( r-568 , 1 mg / kg intravenously 3 and 6 h before euthanasia ) exhibited an increase in vdr mrna expression compared with controls ( p < 0.001 ) , with a marked increase observed when r-568 and calcitriol were coadministered ( figure 1 ) . rats were treated with r-568 ( 1 mg / kg intravenously 3 and 6 h before euthanasia ; n = 22 ) , calcitriol ( 10 pmol / kg intraperitoneally every 30 min for 5.5 h before euthanasia ; n = 22 ) , or a combination of r-568 and calcitriol ( n = 22 ) before euthanasia and measurement of vdr mrna by quantitative real - time polymerase chain reaction . a control group ( n = 20 ) received no treatment . mean serum concentrations of ionized calcium and pth are also included . data are mean standard error . adapted with permission from rodriguez et al . . these data indicate that , in addition to regulating pth levels and restoring car density , calcimimetics can up - regulate vdr expression in parathyroid cells . this effect of calcimimetics on vdr expression is of clinical importance because it may result in an additive interaction between calcimimetic and vitamin d sterol therapy . although parathyroid cells are relatively quiescent under normal conditions , the mineral and hormonal imbalances characteristic of shpt , particularly low serum calcium and high serum phosphorus , drive cell proliferation leading to polyclonal and oligoclonal cell expansion . the importance of maintaining calcium homeostasis is evidenced in weanling rats fed a low - calcium diet for 10 days , in which the number of proliferating cell nuclear antigen ( pcna)-positive parathyroid cells was increased sixfold compared with controls . calcimimetics , in the presence of low serum calcium , can hold proliferation in check , as evidenced by decreased parathyroid cell proliferation in uraemic rats following treatment and their ability to cause regression of advanced hyperplasia in some experimental animal models . long - term administration of the calcimimetic cinacalcet significantly reduced the number of proliferating ( pcna - positive ) cells and glandular hyperplasia , as measured by weight , in 5/6 nephrectomized rats . this effect was parathyroid tissue - specific and was due to a direct effect on cell growth , rather than to induction of apoptosis . taken together , the mechanistic data presented here , and reviewed in greater detail in another article in this supplement ( riccardi and martin ) , suggest that calcimimetics have the potential to retard shpt disease progression . preclinical studies in uraemic rats indicate that calcimimetics can modify the defining parameters in shpt by significantly lowering pth and blood - ionized calcium in a dose - dependent manner without inducing significant changes in serum phosphate .", "administration of cinacalcet or the calcimimetic r-568 to 5/6 nephrectomized rats prevented hyperplasia or increased car expression . interestingly , in an in vitro study , the calcimimetic cinacalcet suppressed pth secretion in human parathyroid cells with advanced hyperparathyroidism , even though car expression was significantly diminished .", "expression of vitamin d receptor ( vdr ) mrna is reduced in the parathyroid gland of hypocalcaemic rats compared with normocalcaemic rats . because the vdr is a transcriptional repressor of pth recent studies indicate that type ii calcimimetics , in the presence of low concentrations of calcium , can up - regulate vdr mrna . rats injected with a calcimimetic ( r-568 , 1 mg / kg intravenously 3 and 6 h before euthanasia ) exhibited an increase in vdr mrna expression compared with controls ( p < 0.001 ) , with a marked increase observed when r-568 and calcitriol were coadministered ( figure 1 ) . rats were treated with r-568 ( 1 mg / kg intravenously 3 and 6 h before euthanasia ; n = 22 ) , calcitriol ( 10 pmol / kg intraperitoneally every 30 min for 5.5 h before euthanasia ; n = 22 ) , or a combination of r-568 and calcitriol ( n = 22 ) before euthanasia and measurement of vdr mrna by quantitative real - time polymerase chain reaction . a control group ( n = 20 ) received no treatment . mean serum concentrations of ionized calcium and pth are also included . p < 0.01 versus control ; p < 0.05 versus calcimimetic ; p < 0.05 versus control . data are mean standard error . adapted with permission from rodriguez et al . . these data indicate that , in addition to regulating pth levels and restoring car density , calcimimetics can up - regulate vdr expression in parathyroid cells . this effect of calcimimetics on vdr expression is of clinical importance because it may result in an additive interaction between calcimimetic and vitamin d sterol therapy .", "although parathyroid cells are relatively quiescent under normal conditions , the mineral and hormonal imbalances characteristic of shpt , particularly low serum calcium and high serum phosphorus , drive cell proliferation leading to polyclonal and oligoclonal cell expansion . the importance of maintaining calcium homeostasis is evidenced in weanling rats fed a low - calcium diet for 10 days , in which the number of proliferating cell nuclear antigen ( pcna)-positive parathyroid cells was increased sixfold compared with controls . calcimimetics , in the presence of low serum calcium , can hold proliferation in check , as evidenced by decreased parathyroid cell proliferation in uraemic rats following treatment and their ability to cause regression of advanced hyperplasia in some experimental animal models . long - term administration of the calcimimetic cinacalcet significantly reduced the number of proliferating ( pcna - positive ) cells and glandular hyperplasia , as measured by weight , in 5/6 nephrectomized rats . this effect was parathyroid tissue - specific and was due to a direct effect on cell growth , rather than to induction of apoptosis . taken together , the mechanistic data presented here , and reviewed in greater detail in another article in this supplement ( riccardi and martin ) , suggest that calcimimetics have the potential to retard shpt disease progression . preclinical studies in uraemic rats indicate that calcimimetics can modify the defining parameters in shpt by significantly lowering pth and blood - ionized calcium in a dose - dependent manner without inducing significant changes in serum phosphate .", "one of the primary treatment goals of shpt is to restore mineral and hormone balance . the national kidney foundation kidney disease outcomes quality initiative ( kdoqi ) has established recommendations regarding levels of serum calcium , phosphorus , calcium phosphorus product ( ca p ) , and intact pth ( ipth ) for patients based on their degree of kidney function . as kidney function decreases , mineral homeostasis is increasingly perturbed , resulting in increased pth , serum phosphorus , and ca p. as this dysregulation progresses , the response to standard therapy worsens . consequently , pth can become high enough to increase mortality and impede adequate control of phosphate [ 1921 ] . these findings underscore the need for new or adjunct treatments with improved efficacy over current modalities that can stabilize disease progression during a long - term course when initiated early , but can also maintain effectiveness in patients with more severe disease . because of the ability of calcimimetics , demonstrated in animal studies , to modulate disease - related processes through multiple mechanisms of action implicated in the development of disease , this therapeutic modality appears to be well suited for use in combination with moderate doses of vitamin d as the primary mode of treatment in shpt management . as described earlier , calcimimetics up - regulate car and vdr expression and inhibit parathyroid cell proliferation and hyperplasia . these multiple mechanisms of action may allow calcimimetics to ( 1 ) maintain effectiveness during long - term therapy ; ( 2 ) maintain enhanced efficacy in patients with severe disease despite decreased car and vdr expression and ( 3 ) halt development of severe disease if initiated early in patients with mild or moderate shpt . phase 3 clinical trials in shpt patients with advanced disease have shown that cinacalcet decreased pth , as well as serum calcium , phosphorus and ca p . analysis of the data from these trials has been performed to investigate the efficacy of cinacalcet in the treatment of both early- and later - stage shpt and to investigate the potential of long - term cinacalcet therapy to stabilize disease progression . results of these analyses , presented below , suggest that calcimimetics have the ability to address these unmet therapeutic needs .", "a post - hoc analysis of the combined results of three 26-week , placebo - controlled , phase 3 studies evaluating the efficacy and safety of a once - daily dose of cinacalcet for the treatment of shpt demonstrated the impact of therapy initiated in early or advanced disease . these studies included adult patients on maintenance dialysis who had ipth levels 300 pg / ml despite standard treatment with active vitamin d and phosphate binders . patients received standard therapy in combination with cinacalcet ( n = 546 ) or placebo ( n = 408 ) . patients included in the analysis were divided into eight subgroups according to their baseline ipth level , which was used as a marker of disease severity ( 300 to > 1000 pg / ml ) . findings from this analysis indicated that the use of cinacalcet ( 30 mg titrated up to 180 mg ) significantly decreased both ipth and ca p levels regardless of disease severity at baseline , compared with standard therapy ( figure 2 ) . the progressive nature of shpt , even when patients receive standard therapy , is evidenced by positive changes from baseline in ipth seen in these patients ( figure 2a ) . furthermore , the effect of cinacalcet on ca p ( figure 2b ) and serum phosphorus levels was more pronounced in patients with more severe disease , suggesting a more significant impact of cinacalcet on bone turnover in these patients . percentage change in ( a ) ipth and ( b ) ca p by disease severity . patients were treated with cinacalcet ( beginning at 30 mg with possible titration up to 180 mg ; n = 546 ) or placebo ( n = 408 ) for 26 weeks . patients were divided into groups according to baseline ipth levels ( pg / ml ) . however , although these data demonstrate that cinacalcet is effective in reducing serum ipth and ca p , even in patients with severe disease , these patients remain less likely to achieve their kdoqi targets than patients with less severe disease . after 6 months of treatment with cinacalcet , 76% of patients with a baseline ipth of 300500 pg / ml achieved a serum ipth level of < 300 pg / ml compared with 55% of patients with a baseline ipth of 500800 pg / ml and 16% of patients with a baseline ipth of > 800 pg / ml . similarly , 54% of patients with a baseline ipth of 300500 pg / ml achieved an ipth of < 300 pg / ml and their ca p target ( < 55 mg / dl ) , compared with 36% and 9% of patients in the 500800 and > 800 mg / ml groups , respectively . these data suggest that early treatment of shpt provides the best opportunity to maintain control of serum pth , calcium , phosphorus and ca p. treatment with cinacalcet for up to 1 year resulted in increased attainment of kdoqi targets compared with standard therapy . after 12 months , 66% of patients on dialysis receiving cinacalcet achieved an ipth of 300 pg / ml compared with 15% in the placebo group . similarly , 55% of patients receiving cinacalcet achieved their ca p target ( < 55 mg / dl ) compared with 43% in the placebo group . furthermore , the proportion of patients able to achieve both an ipth of 300 pg / ml and their ca p target was considerably higher in the cinacalcet group than in the placebo group ; 42% of patients in the cinacalcet group achieved both targets simultaneously , whereas only 8% of patients in the placebo group reached both targets ( figure 3a ) . proportion of patients achieving serum ipth 300 pg / ml and ca p < 55 mg / dl during treatment with either cinacalcet ( n = 122 ) or placebo ( n = 126 ) . ( a ) achievement of serum ipth 300 pg / ml and ca p < 55 mg / dl after 1 year . ( b ) maintenance of serum ipth 300 pg / ml after 6 and 12 months of treatment . ( c ) maintenance of combined serum ipth and ca p target after 6 and 12 months of treatment . adapted with permission from frazo et al . . in this study , treatment with cinacalcet not only improved the ability of patients to achieve their kdoqi targets , but also their ability to maintain these targets . seventy - one percent of cinacalcet - treated patients were able to achieve an ipth of 300 pg / ml after 6 months of cinacalcet treatment . of the group who achieved an ipth of 300 pg / ml at 6 months , 82% also maintained an ipth of 300 pg / ml after 1 year . in contrast , in the standard care group , 13% of patients achieved an ipth concentration of 300 pg / ml , with 53% of this group continuing to maintain an ipth 300 pg / ml after 1 year ( figure 3b ) . cinacalcet also improved maintenance of the combined ipth and ca p targets . in the cinacalcet group , 52% of patients reached the combined target after 6 months compared with 7% in the standard care group . of these patients , 59% in the cinacalcet group maintained the combined target after 1 year compared with just 22% in the standard care group ( figure 3c ) . these data demonstrate that cinacalcet effectively reduces and maintains the four critical disease biomarkers associated with shpt in ckd patients . cinacalcet , therefore , reduces the shifting in and out of targets often observed in patients using standard therapy . open - label extension studies have evaluated the ability of cinacalcet to stabilize disease in shpt patients for up to 4 years [ 2628 ] . these analyses were based on a series of double - blind randomized clinical trials in which patients received standard care treatment in combination with either placebo or cinacalcet for 26 or 52 weeks , after which patients could receive open - label cinacalcet treatment . in one such open - label extension study , serum ipth was found to progressively increase in patients treated with standard care for 52 weeks . after open - label cinacalcet treatment was started , serum ipth was rapidly reduced to a level matching that of cinacalcet - treated patients . ( n = 59 ) had achieved an ipth of 300 pg / ml at each study visit . serum ca p did not increase during this period . in a separate study , a limited number of patients ( n = 21 ) taking cinacalcet were followed up for as long as 4 years . a substantial upward trend in ipth was noted in control patients who received standard therapy during the first year of treatment in this study , before switching to cinacalcet therapy , with levels increasing from approximately 600850 pg / ml . in these patients , cinacalcet reduced and maintained ipth levels throughout the follow - up period ( figure 4 ) . after 4 years , the mean serum ipth was 396 pg / ml , 65% of patients achieved a serum ipth of 300 pg / ml , and the mean serum ca p was 50.5 mg / dl . these findings again highlight the progressive nature of shpt in patients receiving standard therapy as first - line treatment , as well as the inability of traditional therapies to effectively control or stabilize disease in both the short and long term . these and other clinical observations discussed in this section are also consistent with preclinical evidence supporting the car as a therapeutic target to optimize the achievement of treatment goals and slow or prevent disease progression . patients received double - blind treatment with either cinacalcet ( n = 9 ) or placebo ( n = 12 ) for 1 year followed by a 3-year open - label extension treatment with cinacalcet .", "calcimimetics are highly specific therapeutic agents that effectively lower concentrations of plasma pth and partially correct disturbances in mineral metabolism that are characteristic of shpt . the mechanism of action involves allosteric modification of the car , rendering it more sensitive to calcium signalling , thereby helping counteract the decreased car expression and prevent and halt the progression of parathyroid hyperplasia . in addition to effects on car signalling , new experimental studies indicate that calcimimetics may act to increase vdr expression . these studies raise the possibility that treatment with calcimimetics might improve the sensitivity of the parathyroid glands to calcitriol and vitamin d analogues , allowing reduced doses to be used and thus minimizing the risk of hypercalcaemia and hyperphosphataemia . preclinical mechanistic studies with calcimimetics have suggested that this modality may arrest disease progression , even in patients with advanced disease at treatment onset , and stabilize shpt , thereby allowing improved maintenance of kdoqi targets . , cinacalcet was found to be effective for the reduction and long - term maintenance of ipth , calcium and phosphorus levels in patients with shpt . cinacalcet has been shown to allow more patients to achieve and maintain kdoqi targets compared with standard therapy , and extended use ( up to 4 years ) has been shown to be effective and well tolerated ." ]

[ "many neurodegenerative disorders are characterized by \n their presence in neural tissue of aberrant protein aggregates \n ( see table 1 ) . in general , these aggregates arise after the modification of a \n native protein . that modification could result in a conformational \n change of the native protein that promotes the aberrant \n aggregation . the most studied model of this mechanism has been the prion \n protein where a change from an alpha helix to beta sheet structure \n facilitates the polymerization of a protein with a different \n conformation that appears to have a cytotoxic effect . in a similar way , conformational changes between a native protein \n and its aberrant protein counterpart with capacity for \n self - assembly have been studied in many neurodegenerative \n diseases . among the most common techniques used for these analyses \n are x - ray diffraction , nuclear magnetic resonance , circular \n dichroism , or fourier - transformed infrared spectroscopy . \n similarly , to the case of prion protein , in some disorders a \n change from alpha helix to beta sheet conformation has been \n suggested to cause protein aggregation ( table 1 ) , \n probably because in alpha helix , intramolecular hydrogen bonds \n could occur whereas intramolecular hydrogen bonds are facilitated \n in beta sheet conformation , facilitating protein aggregation . \n however , there is one case , the formation of aberrant aggregates \n of tau , where the aggregated protein contains also a high \n proportion of alpha helix structure . although , in some cases , like that of prion protein , the formation \n of aberrant aggregates of protein could result in a toxic effect \n in the affected neurons , in other cases , like huntingtin \n aggregates , the formation of the aberrant aggregates could be a \n survival response of the affected neurons . in other \n neurodegenerative diseases , it will be of interest to know if \n protein aggregation is synonymous of cell toxicity or not . protein conformation could also play a role in a possible toxic \n mechanism . in this way , a protein with a high proportion of alpha \n helix and hydrophobic regions could be inserted in cell membrane \n promoting toxic effects . additionally , the presence of \n aberrant polymers could affect the protein degradation cell machinery ( the proteasome complex ) , decreasing its activity \n and promoting a toxic effect . recently , some good reviews have been published on protein \n aggregation and neurodegenerative disorders [ 6 , 7 ] . in this \n review we will mainly focus on those aggregates assembled from tau \n protein , aggregates that could be present in the neurological \n disorders known as tauopathies ( for a review see ) ( table 1 ) .", "it has been described that large amounts of native or unmodified \n tau protein were enough to promote tau assembly into fibrillar \n polymers resembling those found in ad [ 912 ] . thus , \n obviously , an increase in tau concentration will favour the \n formation of tau polymers . recently , it has been reported that not \n all the brain areas have a similar amount of tau protein \n . thus , it suggests a different probability in the formation of tau polymers in different brain regions . the amount of tau will be the consequence of its synthesis and its \n degradation . changes in transcription have been indicated for \n other proteins related to neurodegenerative disorders , where a tata binding protein may play a role . tau degradation may \n take place through the proteasome complex [ 15 , 16 ] and it has \n been suggested that such degradation could be regulated by \n posttranslational modifications occurring in tau molecule , like \n its phosphorylation . also , tau degradation by other proteases could be regulated by its level of phosphorylation \n . it should be also indicated that in some cases like parkinson 's disease or lafora disease , mutations in the e3 \n ubiquitin ligases like parkin or malin will \n result in the appearance of aberrant protein aggregates . a conformational change , that could be followed by antibodies that \n react with tau molecule after that conformational change \n [ 2124 ] has been also suggested to be required for the \n transition tau monomer - tau polymer . also , it has been suggested that different posttranslational \n modifications like phosphorylation , glycation , \n or truncation , may play a role in the formation of tau \n polymers . due to the alternative splicing of its heterogenous ( or nuclear ) \n rna , different tau isoforms could be expressed and , therefore , \n different tau aggregates with different tau isoforms in different \n tauopathies could occur , but we will not discuss this point here . \n for further information see . , it has been suggested that removal of the amino \n and/or carboxy terminal regions , leaving the tubulin binding \n region will facilitate tau polymerization [ 21 , 22 , 28 ] . some work has been done in vitro and in vivo [ 30 , 31 ] about a possible role of tau phosphorylation on tau \n assembly , suggesting that in some conditions tau phosphorylation \n may increase the capacity of tau for its self - assembly . not only \n an increase in serine / threonine phosphorylation of tau could \n regulate its aggregation but also an increase in tau tyrosine \n phosphorylation may increase the formation of tau aggregates \n . this assembly process may involve the formation of oligomers , filaments , and aggregates of filaments \n ( tangle - like structures ) . in the formation of these aggregates of \n filaments , glycation may play a role . the possible relation between phosphorylation and tau aggregation \n has been studied in transgenic mice expressing human tau bearing \n some mutations found in human fronto - temporal dementia linked to \n chromosome 17 ( ftdp-17 ) . in this mouse , tau \n phosphorylation mainly occurs by gsk3 . when a specific \n inhibitor of this kinase , lithium , was given to the transgenic \n mice no tau phosphorylation was found , and in addition no \n aggregation of the protein was detected suggesting a \n correlation between tau phosphorylation and aggregation in this \n model . this result was supported by an additional experiment using \n another mouse also expressing human tau with a ftdp-17 mutation \n . alternatively , protein chaperones , acting on tau or in phosphotau , \n could modify the level of tau aggregation , examples could be the \n protein 14 - 3 - 3 , musashi-1 , or pin-1 \n [ 37 , 38 ] . the chaperone associated ubiquitin ligase chip could \n be able to target phosphotau for proteasomal degradation \n [ 16 , 18 ] .", "it has been described that tau binding to microtubules is regulated by the level of tau phosphorylation at some specific sites . it is known that hyperphosphorylated tau binds with less affinity to microtubules resulting in the decrease in the interaction with microtubules , in a decrease of \n microtubule stability , and probably in a microtubule dysfunction inside the cell that could result in a toxic effect \n . also , tau phosphorylation could result , as indicated above , in a decrease of its proteolysis . more recently , it has been indicated that expression of a tau mutant ( p301l ) \n could result in an increase of its phosphorylation , since once it is phosphorylated , that mutation can prevent the binding of those phosphatases involved in its dephosphorylation . this \n phosphotau could have a decreased capacity for microtubule binding \n and it could be toxic for the cell . additionally , it has been \n indicated that hyperphosphorylated tau can cause \n neurodegeneration , in the absence of large tau aggregates \n . on the other hand , only the overexpression of wild - type human tau in a mouse is sufficient to cause tau phosphorylation , aggregation , and neural toxicity . on the other hand , it has been suggested that tau phosphorylation may represent a \n protective function in ad .", "sometime ago , the development of tau pathology , related with \n dementia in ad , was clearly described by braak and braak \n by following the development of neurofibrillary lesions at different stages of the disease . also , the formation of \n neurofibrillary ( tau aggregates ) pathology within those neurons of \n hippocampus and cerebral cortex affected at different stages was \n found . these neurons could degenerate yielding extracellular ghost \n tangles ( enft ) . in the hippocampus , an inverse relation has been found between the number of enft and the number \n of surviving neurons [ 4851 ] . it suggests that neurons that \n degenerate , have previously developed tau aggregates . on the other \n hand , it has been indicated that neurons bearing neurofibrillary \n lesions could survive for a long period of time , and , by comparing with other neurodegenerative disorders , like huntington \n disease , it can be suggested that tau aggregates could protect against neurodegeneration by sequestering toxic ( phospho ? ) \n monomeric tau that could be present in a high amount inside a cell \n in pathological conditions . also , it has been suggested , using a \n transgenic mouse model , that behavioural ( memory ) deficits could be unrelated to the formation of tau polymers , \n although , more recently , the discussion of those experiments suggested that hyperphosphorylated , aggregated tau intermediates could be the ones that cause neurodegeneration . in this way , the implication of different types of protein aggregates in neurodegeneration has been extensively \n discussed [ 19 , 54 ] . a possibility about the existence of neurotoxic tau intermediate aggregates in human tauopathies is \n based in the fact that patients with ftdp-17 show an extensive \n neurodegeneration with a high level of tau phosphorylation but \n with a low number of tangles . in any case , even if the formation of tau aggregates has a \n protective function for the neurons , that function is not working \n well , as described by braak and braak , and afterwards by delacourte et al , indicating a correlation between \n progression of tau pathology and progression of the disease . this \n idea is supported by those experiments indicating that neural loss \n and neurofibrillary tangle number increase in parallel with the \n progression of the disease . similar results have been described in other neurological disorders like brain encelphalopathies , where the formation of aberrant polymers are related to the onset of neurodegeneration ; whereas this is far from clear in other disorders like \n huntington disease .", "examples of neurological diseases where aberrant protein \n aggregates are found , and the suggested conformations in the \n aberrant aggregates are indicated ." ]

[ "only those contraceptive methods are new in which synthetic steroid is used . regarding the current status of growth , the world population is doubled every 54 years ; however , in poor countries , population is doubled in less than 20 years . to complete and preserve personal health during pregnancy , the optimal use of contraceptive methods is effective , and planning is necessary before pregnancy . the rate of pregnancy in women with a high potency for fertility who use no contraceptive method is 90% during one year . therefore , conscious and accurate decision making for pregnancy and precise care play an important role in decreasing the maternal mortality . induced abortion that can be the important complication followed by unwanted pregnancy play a significant role in the incidence of infection , fever , risk of the next premature delivery , low birth weight , and infertility [ 1 , 4 ] . pregnancy is a temporary crisis that creates deep mental , physical , and behavioral changes in a woman . conscious and accurate decision making for pregnancy , continuation , and precise care play an important role in declining the maternal mortality . according to the studies by world health organization , close to one - third of the pregnancies in the third world countries considering the fact that induced abortion may create some significant complications such as infection , septic shock , fever , risk of the next premature delivery , low birth weight , and infertility , it can also cause some anatomic complications resulting from the surgery such as uterus , bladder , and intestinal rupture [ 1 , 4 ] . planning for pregnancy can help the safety of childbirth , and unplanned pregnancies increase the maternal mortality . despite the attempts by the authors in health centers , some unwanted pregnancies occur that can danger the women . therefore , we decided to evaluate some factors related to unwanted pregnancy in women referred to health centers .", "\n\t\t\t\t it was a cross - sectional study on 400 randomly pregnant women , who were referred to several clinics and health center in ahwaz city during 2010 . data was collected through interview and filling up a designed questionnaire containing demographic characteristics , fertility , and so forth .", "the mean age of women with unwanted pregnancy was 27.5 5.7 years , and in women with intended pregnancy was 24.6 4.5 years . the percentage of the older women ( 35 years ) in unwanted pregnancy was 3 times of intended pregnancy which was statistically significant . most of pregnant women lived in urban area ( 70.1% ) , and the percentage of rural women who intended pregnancy was higher ( 35.6% ) . the educational level in the subjects was 36% in secondary school and 44% in high school . 37% of subjects with unwanted pregnancy were illiterate and primary school ( table 1 ) . the findings have shown that most of pregnant women were housewives ( 82% ) , and their husbands had self - employment ( 40% ) , and 7.1% of subjects with unwanted pregnancy had unemployed husband . half of the women with unwanted pregnancy had low economic status , while , in women with intended pregnancy , this rate was only 20% . according to the interviews , good relationship with regarding fertility characteristics , the findings showed that more than half of the women with unwanted pregnancy were in the third trimester 54% , ( figure 1 ) . 80% of unwanted pregnancy had more than two times pregnancies , but the percentage in intended pregnancy was 38% . this study showed that more than half of the pregnant women had used one of the contraceptive methods before the recent pregnancy , and 30% had used natural ( interrupted ) methods . the most percentage of women with unwanted pregnancy used unreliable methods like interrupted method ( 59.1% ) . the incidence of pregnancy followed by the consumption of contraceptive pills in women unwanted pregnancy was 16% . this study has shown that 26% of women who wish to become pregnant had more knowledge and performance about pregnancy health 26% , and the low levels of knowledge and performance were more observed in unwanted pregnancy .", "\n\t\t\t\t the incidence of unwanted pregnancy is different in the world , but it has the same undesired outcomes . our study has shown that prevalence of unwanted pregnancy was 26% , and similar conducted studies indicated that the incidence rate of unplanned pregnancy was 25% , 30% , 43% , and 52% [ 69 ] . in this study , relative decrease in the incidence of unwanted pregnancy in our country in comparison with the other countries may be due to the hopeful success of health centers . considering the point that intended pregnancy which results in a healthy childbirth from a healthy mother as an aim of midwifery science [ 10 , 11 ] , pregnancy must be occurred based on the accurate and conscious decision and according to the physical , mental , economic , social , and cultural status [ 2 , 3 ] . alenova in a study after evaluating the activities of consultation clinics guiding women for that the prevention of pregnancy states that prevention of unwanted pregnancy is more necessary in aged women , and it becomes more vital with the increase of age . mohammadloo in his study declares that more than half of the unwanted pregnancies occur in women more than 30 years . one of the causes of not intending pregnancy is the age of more than 35 years that has been noted in other studies too [ 6 , 8 , 13 , 14 ] . in the present study , low education has a close relationship with increased incidence of unwanted pregnancy , and , in a study by bennett et al . most of the women have the ability to become pregnant for at least three decades in their life , but most of men are potentially fertile all over their life . in our study , the rate of unwanted pregnancy was higher in individuals with more number of children . also , in similar studies , the increased prevalence of unwanted pregnancy is observed with an increase in the number of children , from 7.9% in childless women to 92.8% in women with 4 children or more . in our study , unwanted pregnancy was more observed in employee women , and some other studies have achieved this result too . low income , poverty , unemployed husband , and inappropriate job play significant role in the incidence of unplanned pregnancy [ 7 , 1519 ] . a study in zimbabwe has shown that women with unemployed husbands were more exposed to the unwanted pregnancy . some studies in africa and new york indicated that unwanted pregnancy more occurred in poor , low income , and homeless women , which necessitates more concern about the poor women . other studies in thailand and usa have found that one of the related factors with unwanted pregnancy is the relationship with the spouse ; also they showed that good relationship with the spouse in women with unwanted pregnancy was less than intended cases . a study from london has found that planned pregnancy was more observed in couple with more strengthened union in marriage . it seems that couples ' relationship is an important and positive factor which affects the increase of their cooperation in regarding the fertility health . it was indicated in this study that , in 20% of women with unwanted pregnancy , no contraceptive method was used , and more than half of them used unreliable methods of which failure was more observed in unwanted pregnancies . a study in egypt states that 47% of pregnant women with unplanned pregnancy do not use adequate prevention , and 28.8% encounter with the failure of their contraceptive method . in a study in china , it has been indicated that the failure of the contraceptive method has been the main cause of unwanted pregnancy . it seems that of the most important educational needs and the most effective attempts to prevent unwanted pregnancy are creating motivations in families , providing necessary facilities , and helping them in selection and accurate use of different methods by holding educational classes in health centers . therefore , introducing accurate information about the contraceptive methods acquires a profound understanding , and using this information is very important in planning for the pregnancy . considering the lack of safe methods , educational programs , introducing adequate contraceptive options , and consultation before pregnancy 76% of world population live in developing countries , 85% of births , 95% of neonatal mortality , and 99% of maternal mortality occur in these countries . so , regulating reproduction and adequate planning for pregnancy is significant in these countries . in conclusion , more attempts must be taken to decrease complication of pregnancies such as unwanted cases . in the recent years , it has been proved that , in addition , the population control and educational program for contraceptive methods are important and necessary in preventing unwanted pregnancy . because in iran abortion is illegal consider in the muslim religious , unwanted pregnant women can not do abortion except if physician has diagnosis that mother has complication to continue of her pregnancy or there is intrauterine growth retardation in the first trimester ." ]

[ "at the end of past millennium , flexible bronchoscopy was regarded as one of the most frequently performed procedures by the physicians of multiple disciplines to inspect the airway . in our institute , the fibreoptic bronchoscopies are performed by either the pulmonologists or the anaesthetist . at many places , fibreoptic bronchoscopies are still performed after topical anaesthesia only , without any sedation . this simplified approach is safe and results in decreased expenditures . in a retrospective study done by colt et al . , intravenous sedation was reported in 50% of the procedures ; however , this technique requires the use of adequate anaesthetic resources and is associated with a low but real morbidity and mortality . the intravenous sedation limits dynamic analysis of the airways such as vocal cords , presence of local or diffuse malacia or effects of voluntary cough . therefore , a risk benefit approach comparing the same procedure performed under sedation and under local anaesthesia alone is indicated . there are several techniques for anaesthetising the vocal cords and tracheobronchial tree , each with its own potential advantages and disadvantages . topical lignocaine applied by the spray as you go technique with direct instillation of 4% solutions is used by a few bronchoscopists , while the others use transcricoid route for local anaesthesia of the vocal cords and tracheobronchial mucosa . we have compared a transcricoid injection of local anaesthesia with the spray as you go technique without sedation in patients posted for elective fibreoptic bronchoscopies requiring only bronchoalveolar aspirate for diagnosis and not biopsies of any kind . it is a very safe technique which can be performed with or without conscious sedation .", "after obtaining institutional ethical committee approval , 60 patients in the age group 2070 years of either sex , undergoing elective fibreoptic bronchoscopies for diagnostic bronchoalveolar aspirate , were included in this study . the patients of the specified age group coming to the bronchoscopy suit , requiring only diagnostic bronchoalveolar lavage over a period of 6 months , were selected and alternatively divided into two groups of 30 each . group i patients were given a single transcricoid injection of lignocaine , while in group ii patients lignocaine was used as spray as the bronchoscopist entered inside , after the lignocaine sensitivity test was done in all the patients . if any contraindication for transcricoid injection was present , like any local pathology , then these patients were included in the other group . after taking an informed written consent and lignocaine sensitivity test was done , the patients were alternatively assigned to different groups . all the patients were given injection atropine 0.6 mg intramuscularly , 20 min prior to the procedure . nebulisation with 3 ml of 4% lignocaine was done in all the patients for 15 min before starting the procedure . the blood pressure , pulse and oxygen saturation ( spo2 ) were recorded before the procedure in both the groups . the patency of the nostril was checked , and in the more patent nostril , 2 ml of 2% lignocaine gel was applied in all the patients . group i patients received transcricoid injection of 3 ml of 4% lignocaine solution given as a bolus through a 21-g hypodermic needle in the sitting position after confirming its position by aspirating air under aseptic conditions . in group ii patients , 2 ml of 4% lignocaine was instilled on to the vocal cords under direct vision after insertion of the bronchoscope . further boluses of lignocaine were instilled through the bronchoscope if local anaesthesia was thought to be inadequate in both the groups . the assistant as well as the bronchoscopist could not be blinded to the local anaesthetic techniques . a single endobronchial procedure was selected and the bronchoscopist was also not changed to allow a fair comparison of the two techniques studied . the pulse rate and systolic blood pressure were recorded before the procedure and 5 min after the bronchoscopy . the time from the nasal insertion of bronchoscope to reach the carina was recorded in both the groups . a bout of coughing was considered as a single episode of cough . the total dose of lignocaine used in both the groups was also noted . record of any complication like bleeding from the transcricoid site was made , as well as any other complication if detected was observed and noted . thirty min after the procedure , an assistant who was unaware of the patients group was asked to assess any discomfort to the patients , using a 10-cm visual analogue scale ( vas ) . the vas score of 0 was considered as no discomfort , 1 as mild , 2 as moderate discomfort and 3 or more as severe discomfort . the data were analysed using chi - square test and the p values were calculated .", "group i was transcricoid group and group ii patients received spray as you go technique . the age of patients in group i ( 51.6614.08 years ) was comparable with that in group ii patients ( 48.2613.32 , p = ns ) . as shown in table 1 , mean basal values of systolic blood pressure in both the groups were comparable before starting the procedure . in group ii , the systolic blood pressure increased significantly from the baseline when measured 5 min after the procedure ( p<0.02 ) . similarly , as shown in table 2 , the pulse rate was comparable in both the groups before starting the procedure ( p = ns ) , but it increased significantly in group ii when measured 5 min after the procedure . the total dose of lignocaine used in group ii ( 372.6624.90 mg ) was significantly higher than that used in group i ( 3149.32 mg , p<0.001 ) as shown in figure 1 . the number of coughs in group i ( 40.98 ) was significantly lesser than in group ii ( 4.91.24 , p<0.05 ) , as shown in figure 2 . the mean time to reach the carina was significantly shorter in group i ( 57.3312.98 sec ) compared to group ii ( 79.3322.35 sec , p<0.02 ) . systolic blood pressure before and 5 min after the procedure pulse rate before and 5 min after the procedure dose of lignocaine used plotted against the no . of patients cough episodes plotted against the no . of patients as shown in table 3 , the values of vas score were comparable after 30 min of the procedure in both the groups . there were no cases of haematoma or subcutaneous emphysema when the neck was examined after the procedure in the transcricoid group .", "lignocaine is the most commonly used local anaesthetic agent for fibreoptic bronchoscopy and has a wide margin of safety . it has been suggested that the total dose should be limited to 300400 mg as absorption of lignocaine from the respiratory mucosa is known to be rapid . the risk of more serious side effects increases when blood concentrations exceed 5 mg / l , with seizures and hallucinations occurring at concentrations of 812 mg / l and cardiorespiratory arrest at 2025 mg / l . the peak concentration is influenced by dose per unit weight administered and not by the factors considered likely to influence mucosal absorption from the bronchial tree , such as sputum production , airflow obstruction or cigarette smoking . a major proportion of the total dose of lignocaine is required to anaesthetise the nose , pharynx and larynx , with only a small proportion needed for the bronchial tree . although most clinical studies have reported non - toxic blood lignocaine concentration associated with bronchoscopy , several have reported concentration in the toxic range ( > 5 mg / l ) . the control of coughing is of paramount importance for the quality of a bronchoscopy as this facilitates ease of viewing the bronchial tree and obtaining good biopsy samples . activation of the cough centre in the brain stem causes the respiratory muscles to induce cough , the bronchial smooth muscle to cause bronchoconstriction and subsequently the airway submucosal glands to secrete mucus . various local anaesthetic techniques can be used to anaesthetise the respiratory mucosa for fibreoptic bronchoscopy . it would be safe and not unpleasant for the patient and would at the same time provide acceptable conditions for the bronchoscopist . in our institute these patients are malnourished and have deranged liver function tests as well as the pulmonary function tests , hence doing fibreoptic bronchoscopy under local anaesthesia only without sedation is a routine . the present study was designed to compare the techniques of applying topical anaesthesia to the respiratory mucosa for elective diagnostic fibreoptic bronchoscopy . the bronchoscopist was not changed , to allow a fair comparison of the two techniques studied . although the current british thoracic society guidelines provide a consensus statement on the current evidence base without specific guidance on drugs or techniques and without defining methods of sedation , the guidelines recommend offering sedation to all , except where there are contraindications . if a centre has experience of performing unsedated diagnostic flexible bronchoscopy , it is reported that patient co - operation is not improved with sedation . performed a double - blinded , placebo - controlled trial in 100 patients in a centre that normally performs unsedated bronchoscopy , and could not demonstrate improved patient tolerance , comfort and co - operation with lorazepam . tried to identify the common fears of patients undergoing fibreoptic bronchoscopy and also determine whether any factors might contribute to reducing these fears . it was found that doctors were more likely to explain the indication for bronchoscopy than how it would be performed . they concluded that provision of detailed information about sensations that are likely to be experienced in bronchoscopy could be used to allay some of the common fears . improved preparation of patients with lower education , inferior health status and asthma may lead to decreased pain during fibreoptic bronchoscopy . although sedation is associated with major complications , sedative drugs are often given immediately before fibreoptic bronchoscopy in the belief that patient 's comfort is improved . compared two such regimens with placebo and concluded that routine sedation has little part to play in patients undergoing a single diagnostic procedure . the present study compared two techniques of anaesthetising the respiratory mucosa for diagnostic bronchoscopy without sedation . the transcricoid method was more effective than the spray as you go technique . no complication was associated with transcricoid injection and minor bleeding associated with the technique did not interfere with the bronchoscopy . they recommended transcricoid technique as a safe method of inducing effective local anaesthesia that is well tolerated by the patient . in our study , we nebulised all the patients with 3 ml of 4% lignocaine for 15 min before the procedure . the systolic blood pressure and pulse rate were compared between the two groups before the procedure and 5 min after the procedure . the systolic blood pressure and the pulse rate were comparable in both the groups before the procedure , but the systolic blood pressure increased significantly in group ii after the procedure ( p<0.02 ) . similarly , the pulse rate also increased significantly after the procedure in group ii ( p<0.001 ) . the vas score was similar in both the groups , 30 min after the procedure ( p = ns ) . the incidence of side effects was negligible in both the groups . the dose of lignocaine used in group ii ( 372.6624.90 mg ) was significantly higher than that used in group i ( 3149.32 mg , p<0.001 ) . the number of coughs in group i ( 40.98 ) was also significantly lower than in group ii ( 4.91.24 , p<0.05 ) . the time to reach the carina was also significantly lesser in group i ( 57.3312.98 sec ) compared to group ii ( 79.3322.35 sec , p<0.02 ) as the transcricoid injection given probably brought about excellent relaxation of the vocal cords , making the introduction of the bronchoscope smooth .", "diagnostic fibreoptic bronchoscopy without sedation with transcricoid injection of lignocaine can be recommended as a safe method of anaesthetising the respiratory mucosa , which is well tolerated by the patients with negligible side effects and provides acceptable conditions for the bronchoscopist as compared to the spray as you go technique ." ]

[ "charcot - marie - tooth disease ( cmt ) is the most common hereditary motor and sensory neuropathy , and cmt type 1a ( cmt1a ) neuropathy , which is the most common type of cmt , is subject to a gene dosage effect.1 the primary genetic cause of cmt1a is a duplication of pmp22 resulting from the unequal crossover between two homologous repetitive elements that flank the 1.4-mb region of chromosome 17p12.2 a new mechanism responsible for the outbreak of cmt1a - which is related to a nonrecurrent rearrangement has recently been reported.3 cmt1a is also caused by a point mutation in pmp22.4 abnormal axon - schwann cell interactions cause abnormalities in axonal structure and function , but the exact pathogenic mechanism causing cmt1a is unknown.5 one obvious possibility is that the weakness and sensory loss are the result of axonal degeneration ; secondary axonal degeneration is common in cmt1a patients , and its degree determines the patient 's functional disability.6 this finding is consistent with the electrophysiological and clinical findings in patients with cmt1a and in several animal models of demyelinating neuropathy.7,8 axonal dysfunction induced by demyelinating schwann cells can also occur without axonal degeneration.9 the relationship between motor nerve conduction velocities ( mncvs ) and disease disabilities has been the subject of much debate.10 - 14 most cmt1a research groups have found a relatively weak correlation between the severity of muscle weakness and nerve conduction velocities,10 - 12 although some have noted that patients with slower velocities developed more weakness.13,14 moreover , longitudinal studies have shown that the velocities remained unchanged over decades , whereas the compound muscle action potential ( cmap ) amplitudes decreased.15,16 however , the relationship between mncvs , cmaps , and the disease severity has not been investigated in koreans . therefore , we determined whether there is a correlation between clinical disabilities and electrophysiological values in korean cmt1a patients with pmp22 duplication .", "we enrolled 167 cmt1a patients ( 93 males , 74 females ) with pmp22 duplication who took part in nerve conduction studies at 20 university hospitals in korea . this study was approved by the institutional review board of the ethics committee of the ewha womans university hospital . the patients ' clinical information was obtained and analyzed , including assessment of the gender ratio , age at onset , disease duration , motor and sensory impairment , deep tendon reflex , and muscle atrophy . the age at onset was determined by asking the patients when their symptoms - such as distal muscle weakness , foot deformity and/or sensory change - first appeared . the impairment and progression of cmt was evaluated in these patients using two scales : the functional disability scale ( fds)13 and the cmt neuropathy score ( cmtns).17 disease severity was quantified for each patient using a 9-point fds based on the following criteria : 0 , normal ; 1 , normal but with cramps and fatigability ; 2 , unable to run ; 3 , difficulty walking but still able to walk unaided ; 4 , walking with a cane ; 5 , walking with crutches ; 6 , walking with a walking frame ; 7 , wheelchair bound ; and 8 , bedridden . in addition , we determined the cmtns based on the motor and sensory symptoms , and according to the pain and vibration , muscle strength , and neurophysiologic test results . the scores of this test were used to divide the patients into two groups : mild ( 0<cmtns10 ) and moderate or severe ( cmtns11 ) . the mncvs and sensory nerve conduction velocities ( sncvs ) for the median , ulnar , peroneal , tibial , and sural nerves were determined in all 167 patients . the mncvs of the median and ulnar nerves were determined by stimulating at the elbow and wrist , respectfully , while cmaps were recorded over the abductor pollicis brevis and the adductor digiti quinti , respectively . the mncvs of the peroneal and tibial nerves were determined by stimulating at the knee and ankle while recording the cmaps over the extensor digitorum brevis and adductor hallucis , respectively . the sncvs and sensory nerve action potentials ( snaps ) were obtained over a finger - wrist segment from the median and ulnar nerves , and they were also recorded for the sural nerves . the terminal latency indices ( tlis ) that adjust the distal motor latency for the terminal distance and the proximal mncv were calculated . the calculated tli was compared to the tli of the normal population as reported previously.18 tlis were calculated for the median nerves as follows : tli = terminal distance ( mm)/[mncv ( ms)distal motor latency ( ms ) ] . 11.0 ( spss , chicago , il , usa ) . percentages and means were compared by the chi - square test and student 's t - test , respectively . correlations were determined using pearson 's correlation coefficient ( r ) , and probability values of p<0.05 were considered to be indicative of statistical significance .", "we enrolled 167 cmt1a patients ( 93 males , 74 females ) with pmp22 duplication who took part in nerve conduction studies at 20 university hospitals in korea . this study was approved by the institutional review board of the ethics committee of the ewha womans university hospital .", "the patients ' clinical information was obtained and analyzed , including assessment of the gender ratio , age at onset , disease duration , motor and sensory impairment , deep tendon reflex , and muscle atrophy . the age at onset was determined by asking the patients when their symptoms - such as distal muscle weakness , foot deformity and/or sensory change - first appeared . the impairment and progression of cmt was evaluated in these patients using two scales : the functional disability scale ( fds)13 and the cmt neuropathy score ( cmtns).17 disease severity was quantified for each patient using a 9-point fds based on the following criteria : 0 , normal ; 1 , normal but with cramps and fatigability ; 2 , unable to run ; 3 , difficulty walking but still able to walk unaided ; 4 , walking with a cane ; 5 , walking with crutches ; 6 , walking with a walking frame ; 7 , wheelchair bound ; and 8 , bedridden . in addition , we determined the cmtns based on the motor and sensory symptoms , and according to the pain and vibration , muscle strength , and neurophysiologic test results . the scores of this test were used to divide the patients into two groups : mild ( 0<cmtns10 ) and moderate or severe ( cmtns11 ) .", "the mncvs and sensory nerve conduction velocities ( sncvs ) for the median , ulnar , peroneal , tibial , and sural nerves were determined in all 167 patients . the mncvs of the median and ulnar nerves were determined by stimulating at the elbow and wrist , respectfully , while cmaps were recorded over the abductor pollicis brevis and the adductor digiti quinti , respectively . the mncvs of the peroneal and tibial nerves were determined by stimulating at the knee and ankle while recording the cmaps over the extensor digitorum brevis and adductor hallucis , respectively . the sncvs and sensory nerve action potentials ( snaps ) were obtained over a finger - wrist segment from the median and ulnar nerves , and they were also recorded for the sural nerves . the terminal latency indices ( tlis ) that adjust the distal motor latency for the terminal distance and the proximal mncv were calculated . the calculated tli was compared to the tli of the normal population as reported previously.18 tlis were calculated for the median nerves as follows : tli = terminal distance ( mm)/[mncv ( ms)distal motor latency ( ms ) ] .", "11.0 ( spss , chicago , il , usa ) . percentages and means were compared by the chi - square test and student 's t - test , respectively . correlations were determined using pearson 's correlation coefficient ( r ) , and probability values of p<0.05 were considered to be indicative of statistical significance .", "the mean age at examination was 36.9 years ( range , 5 - 75 ye - ars ) and the mean age at onset was 15.5 years ( range , 2 - 45 years ) . the mean disease duration at the time of examination was 22.3 years ( range , 0 - 57 years ) . the disease had manifested before the second decade of life in 69% of the patients . twelve individuals ( 7% ) with pmp22 duplication did not complain of any clinical symptoms . muscle weakness and atrophy started predominantly in the distal legs , with these symptoms being noted to a lesser extent in the distal upper limbs . the paresis in the distal regions of the lower limbs varied from asymptomatic to severe weakness . pinprick sensory loss was found in 87 ( 52% ) patients , and proprioception loss was found in 112 ( 67% ) . heel gait defects occurred more commonly than toe gait defects ( p<0.001 ) , and high - arched foot deformities were common ( 89% ) . both the mncv and sncv of the median nerve were uniformly reduced in the cmt1a patients . the cmap of the median nerve was significantly correlated with the disease duration ( fig . 1a ; p<0.001 ) and the cmap of the ulnar nerve ( fig . 1b ; p<0.01 ) . however , no correlations were found between the age at onset and the cmaps in the median and ulnar nerves ( fig . the tli of the patients ' median nerve ( 0.310.10 , meansd ; range , 0.13 - 0.72 ) did not differ significantly from the normal values seen in healthy control subjects ( 0.310.04 ; range , 0.23 - 0.43 ) . these results suggest that demyelination in cmt1a patients is uniformly distributed between the proximal and distal portions of the nerves . the characteristics of the mild ( 0<cmtns10 ) and the moderate or severe ( cmtns11 ) cmtns groups are listed in table 1 . the gender ratio was similar in the two groups , and the mean age at onset did not differ significantly between them . however , the disease duration at the time of examination was significantly longer in the moderate or severe cmtns group ( p<0.001 ) . the patients in the moderate or severe cmtns group were more severely affected than those of the mild cmtns group by muscle weakness ( p<0.001 ) , muscle atrophy ( p<0.001 ) , sensory loss ( p<0.001 ) , the frequency of areflexia ( upper , p<0.001 ; lower , p<0.01 ) , heel and toe gait defects ( p<0.001 ) , and foot deformity ( p<0.05 ) . the amplitudes of the evoked median nerve motor responses were more severely affected in the moderate or severe cmtns group than in the mild cmtns group . in contrast , neither the mncvs nor the sncvs differed significantly between the two groups . the cmaps of the median ( p<0.001 ) , ulnar ( p<0.001 ) , peroneal ( p<0.05 ) , and tibial ( p<0.001 ) nerves were significantly correlated with the cmtns , and the cmaps of the median ( p<0.001 ) , ulnar ( p<0.001 ) , peroneal ( p<0.05 ) , and tibial ( p<0.001 ) nerves were correlated with the fds score ( table 2 ) . in contrast , the mncv of the median nerve was only correlated with the cmtns ( p<0.05 ) . the snaps and sncvs of the median , ulnar , and sural nerves", "the mean age at examination was 36.9 years ( range , 5 - 75 ye - ars ) and the mean age at onset was 15.5 years ( range , 2 - 45 years ) . the mean disease duration at the time of examination was 22.3 years ( range , 0 - 57 years ) . the disease had manifested before the second decade of life in 69% of the patients . twelve individuals ( 7% ) with pmp22 duplication did not complain of any clinical symptoms . muscle weakness and atrophy started predominantly in the distal legs , with these symptoms being noted to a lesser extent in the distal upper limbs . the paresis in the distal regions of the lower limbs varied from asymptomatic to severe weakness . pinprick sensory loss was found in 87 ( 52% ) patients , and proprioception loss was found in 112 ( 67% ) . heel gait defects occurred more commonly than toe gait defects ( p<0.001 ) , and high - arched foot deformities were common ( 89% ) .", "both the mncv and sncv of the median nerve were uniformly reduced in the cmt1a patients . the cmap of the median nerve was significantly correlated with the disease duration ( fig . 1a ; p<0.001 ) and the cmap of the ulnar nerve ( fig . 1b ; p<0.01 ) . however , no correlations were found between the age at onset and the cmaps in the median and ulnar nerves ( fig . the tli of the patients ' median nerve ( 0.310.10 , meansd ; range , 0.13 - 0.72 ) did not differ significantly from the normal values seen in healthy control subjects ( 0.310.04 ; range , 0.23 - 0.43 ) . these results suggest that demyelination in cmt1a patients is uniformly distributed between the proximal and distal portions of the nerves .", "the characteristics of the mild ( 0<cmtns10 ) and the moderate or severe ( cmtns11 ) cmtns groups are listed in table 1 . the gender ratio was similar in the two groups , and the mean age at onset did not differ significantly between them . however , the disease duration at the time of examination was significantly longer in the moderate or severe cmtns group ( p<0.001 ) . the patients in the moderate or severe cmtns group were more severely affected than those of the mild cmtns group by muscle weakness ( p<0.001 ) , muscle atrophy ( p<0.001 ) , sensory loss ( p<0.001 ) , the frequency of areflexia ( upper , p<0.001 ; lower , p<0.01 ) , heel and toe gait defects ( p<0.001 ) , and foot deformity ( p<0.05 ) . the amplitudes of the evoked median nerve motor responses were more severely affected in the moderate or severe cmtns group than in the mild cmtns group . in contrast , neither the mncvs nor the sncvs differed significantly between the two groups .", "the cmaps of the median ( p<0.001 ) , ulnar ( p<0.001 ) , peroneal ( p<0.05 ) , and tibial ( p<0.001 ) nerves were significantly correlated with the cmtns , and the cmaps of the median ( p<0.001 ) , ulnar ( p<0.001 ) , peroneal ( p<0.05 ) , and tibial ( p<0.001 ) nerves were correlated with the fds score ( table 2 ) . in contrast , the mncv of the median nerve was only correlated with the cmtns ( p<0.05 ) . the snaps and sncvs of the median , ulnar , and sural nerves", "the present study investigated the correlations between disease disabilities and the electrophysiological findings in korean cmt1a patients with pmp22 duplication , and found that the disabilities were related to the cmaps rather than to the ncvs . it has been reported that cmt symptoms progress due to axonal degeneration and loss,5,19 with axonal loss being the major cause of impairment and disability in patients with cmt1a.20 the accentuation of muscle wasting and sensory impairment in the distal extremities was correlated with the corresponding reduction in the cmaps and snaps but not with the decrease in mncv or sncv.10 - 12 our results support the hypothesis that the disease - related disabilities are correlated with the decreased nerve action potentials rather than the conduction velocities . it is important to determine how the demyelination of sch - wann cells causes axonal injury , but this remains elusive.21 many hypotheses have been postulated.22 - 25 for example , local biochemical changes in axons , such as decreased neurofilament phosphorylation , increased neurofilament density , and decreased axonal transport due to demyelinating schwann cells , could lead to axonal dysfunction and eventual axonal loss.9 some longitudinal cmt studies have revealed that nerve conduction velocities remain unchanged for more than 10 years , but that the cmaps progressively decrease over the same period.16,26 in the present study we also found an absence of velocity changes over a 10-year period in nine patients despite gradually increasing clinical severities . these results suggest that the degree of change in cmap amplitude is useful for predicting the clinical severity of the disease . as a marker of axonal loss , we also found that the clinical manifestations of muscle atrophy were also strongly correlated with the cmaps and axonal loss , which became more pronounced as the disease progressed . the disease severity varies considerably among patients with cmt1a.27 attempts to identify the mitigating factors are underway , and these efforts could lead to effective therapeutic approaches for reducing the expression of pmp22.28 pmp22 duplication mainly induces a demyelinating phenotype , while the features of axonal pathology appear concomitantly with advancing age.6 the patients with pmp22 duplication show a great variability of disease severity , ranging from asymptomatic individuals to wheelchair - bound patients . these results suggest that other molecular , endogenous , and environmental factors ( e.g. , genetic factors related to the pmp22 expression ) influence the progression of this disease . in the present study , the age at onset was the first decade in 44% of the cmt1a patients and before 20 years of age in 69% . the age at onset as an indicator of the cmt disease severity has been the subject of debate.11,12,26 although birouk et al.13 reported an association between the age at onset and the severity of the disorder , others have suggested that the age at onset is not a reliable indicator of disease severity ; the latter is consistent with our findings.11,26 instead , one of the most important disease - modifying factors in our study appeared to be the disease duration . a longitudinal study found that axonal involvement progressed in a time - dependent manner , and that axonal degeneration proceeded concomitantly with advancing disease.10,16 the age - dependent reduction in the cmaps , and the increase in axonal degeneration and clinical disability observed in our study were also in good agreement with previous reports.15,29 furthermore , the median nerve tli did not differ between korean cmt1a patients and healthy controls . despite the distal location of the cmt symptoms , the nerve conduction velocities slowed uniformly along the proximal and distal segments , which implies a uniform pathological process of demyelination . in conclusion , a significant correlation was found between the clinical - electrophysiological manifestations and the physical disabilities among the korean cmt1a patients in this study . although our study was cross - sectional in design and involved only a single race , we propose that the clinical disease severity in patients with cmt1a is determined by the extent of axonal dysfunction ." ]

[ "a negative balance between the formation and resorption of bone mass can lead to the development of osteoporosis . moreover , osteoporosisis characterized by skeletal fragility resulting from reduced bone mass and disrupted bone microarchitecture . osteoporosis increases the risk of fracture and thus has been considered a major public health concern . traditionally , the development of osteoporosis is related to several risk factors , such as aging , immobility , hypertension , antihypertensive agents , hyperparathyroidism , menopause , diabetes mellitus , corticosteroid usage , low calcium intake , vitamin d deficiency , and genetic vulnerability . vertebral fracture is the most common osteoporotic fracture , but only from one - third to one quarter of the patients with vertebral fracture can be clinically identified . furthermore , it is reported that asymptomatic vertebral fractures are associated with future hip fracture by threefold and other nonvertebral fracture by twofold . hip fracture is the second common osteoporotic fracture and it may incur substantial healthcare costs resulted from disability . furthermore , the effect of hip fracture on mortality increase can adversely extend up to 10 years or more . the mortality following a hip fracture generally increases with the increment of age and is greater in men , but the sex difference declines after age 80 . although the rates of hip fracture have declined in the west , the rate is increasing in the developing world . it is estimated that > 50% of hip fractures worldwide will occur in asia by 2050 . the functional outcome and increased mortality of osteoporotic fracture are heterogeneous and depend on age , activity of daily living prior to fracture , pre - fracture comorbidities , and the cognition . hepatitis c virus infection ( hcv ) is a global health problem estimated to affect 170 million people worldwide . hepatitis c virus infection is a hepatotropic virus that mainly causes inflammation and fibrosis of the liver . it is reported that 20% of hcv - infected patients will progress to liver cirrhosis . however , hcv can also cause several extrahepatic manifestations , such as diabetes mellitus , rheumatic disorders , lymphoproliferative disease , cardiovascular events , and cognitive impairment . although the role of osteoporosis as a sequence of cirrhosis or advanced liver disease has been thoroughly documented , the effect of hcv exposure on bone mineral density in the absence of advanced liver disease remains debated . some scholars have proposed that chronic hcv infection without liver cirrhosis contributes to reduced bone mineral density , whereas other scholars have asserted the opposite . to assess the association between hcv exposure and subsequent development of osteoporosis , we conducted a nationwide population - based cohort study by analyzing data from a nationwide medical database , the national health insurance research database ( nhird ) .", "the national health insurance ( nhi ) program , initiated on march 1 , 1995 , provides comprehensive coverage for the medical care of taiwan residents . at the end of 2014 , 23.75 million people ( 99.9% of the population ) were enrolled in the program . in cooperation with the bureau of national health insurance ( bnhi ) , the national health research institutes established several data sets for public use , including the longitudinal health insurance database 2000 ( lhid2000 ) , a cohort data set comprising 1,000,000 randomly selected cases from the registry of nhi beneficiaries in 2000 . to maintain confidentiality , personal information , such as patient identification numbers and sensitive personal data , are encrypted in the database , and international classification of diseases , ninth edition , clinical modification ( icd-9-cm ) codes are used for disease classification . this study was approved to fulfill the condition for exemption by the institutional review board ( irb ) of china medical university ( cmuh-104-rec2 - 115 ) . the irb also specifically waived the consent requirement . from 2000 to 2011 , patients aged 20 years and older with diagnosed hcv infection ( icd-9-cm codes 070.41 , 070.44 , 070.51 , and 070.54 ) identified from the lhid2000 comprised the hcv infection cohort . patients with a history of osteoporosis ( icd-9-cm codes 733.0 and 733.1 ) and hepatitis b virus ( hbv ) infection ( icd-9-cm codes 070.20 , 070.22 , 070.30 , and 070.32 ) diagnosed before the index date , those with missing information , and those younger than 20 years were excluded . using 1:m case - control studies is to increase the power and to control possible confounding . based on the statistical efficiency does not gain much when m > 4 , we constructed a 1:4 matched cohort study . for each hcv case , 4 insurers with no history of hcv exposure , hbv infection , and osteoporosis were assigned to a comparison cohort and frequency matched with the hcv exposure cohorts according to age ( every 5-year span ) , sex , and index year . individuals were excluded from the comparison cohort using the same criteria used for the hcv exposure cohort . the primary endpoint in this study each participant was followed from the index date until the endpoint , withdrawal from the nhi program , or december 31 , 2011 . the baseline characteristics of participant comorbidities were also analyzed ; the comorbidities included diabetes ( icd-9-cm code 250 ) , hypertension ( icd-9-cm codes 401405 ) , hyperlipidemia ( icd-9-cm code 272 ) , heart failure ( icd-9-cm code 428 ) , stroke ( icd-9-cm codes 430438 ) , obesity ( icd-9-cm code 278 ) , and cirrhosis ( icd-9-cm codes 571.2 , 571.5 , and 571.6 ) . the chi - square test and t test for categorical and continuous variables , respectively , were first used to compare the distributions of age , sex , and baseline comorbidities between the hcv exposure and the comparison cohorts . the incidence densities of osteoporosis were estimated in person - years for the various risk factors . to estimate the hazard ratios ( hrs ) and 95% confidence intervals ( cis ) of osteoporosis , multivariable models were simultaneously adjusted for age , sex , and the comorbidities of diabetes , hypertension , hyperlipidemia , heart failure , stroke , and cirrhosis . meier estimates were plotted to illustrate the cumulative incidence of osteoporosis , and the log - rank test was performed to examine the difference between the hcv exposure and the comparison cohorts . all statistical analyses were performed using the sas package ( version 9.4 for windows ; sas institute , inc , cary , nc ) .", "the national health insurance ( nhi ) program , initiated on march 1 , 1995 , provides comprehensive coverage for the medical care of taiwan residents . at the end of 2014 , 23.75 million people ( 99.9% of the population ) were enrolled in the program . in cooperation with the bureau of national health insurance ( bnhi ) , the national health research institutes established several data sets for public use , including the longitudinal health insurance database 2000 ( lhid2000 ) , a cohort data set comprising 1,000,000 randomly selected cases from the registry of nhi beneficiaries in 2000 . to maintain confidentiality , personal information , such as patient identification numbers and sensitive personal data , are encrypted in the database , and international classification of diseases , ninth edition , clinical modification ( icd-9-cm ) codes are used for disease classification . this study was approved to fulfill the condition for exemption by the institutional review board ( irb ) of china medical university ( cmuh-104-rec2 - 115 ) .", "from 2000 to 2011 , patients aged 20 years and older with diagnosed hcv infection ( icd-9-cm codes 070.41 , 070.44 , 070.51 , and 070.54 ) identified from the lhid2000 comprised the hcv infection cohort . the date for hcv exposure coding patients with a history of osteoporosis ( icd-9-cm codes 733.0 and 733.1 ) and hepatitis b virus ( hbv ) infection ( icd-9-cm codes 070.20 , 070.22 , 070.30 , and 070.32 ) diagnosed before the index date , those with missing information , and those younger than 20 years were excluded . using 1:m case - control studies is to increase the power and to control possible confounding . based on the statistical efficiency does not gain much when m > 4 , we constructed a 1:4 matched cohort study . for each hcv case , 4 insurers with no history of hcv exposure , hbv infection , and osteoporosis were assigned to a comparison cohort and frequency matched with the hcv exposure cohorts according to age ( every 5-year span ) , sex , and index year . individuals were excluded from the comparison cohort using the same criteria used for the hcv exposure cohort .", "each participant was followed from the index date until the endpoint , withdrawal from the nhi program , or december 31 , 2011 . the baseline characteristics of participant comorbidities were also analyzed ; the comorbidities included diabetes ( icd-9-cm code 250 ) , hypertension ( icd-9-cm codes 401405 ) , hyperlipidemia ( icd-9-cm code 272 ) , heart failure ( icd-9-cm code 428 ) , stroke ( icd-9-cm codes 430438 ) , obesity ( icd-9-cm code 278 ) , and cirrhosis ( icd-9-cm codes 571.2 , 571.5 , and 571.6 ) .", "the chi - square test and t test for categorical and continuous variables , respectively , were first used to compare the distributions of age , sex , and baseline comorbidities between the hcv exposure and the comparison cohorts . the incidence densities of osteoporosis were estimated in person - years for the various risk factors . to estimate the hazard ratios ( hrs ) and 95% confidence intervals ( cis ) of osteoporosis , multivariable models were simultaneously adjusted for age , sex , and the comorbidities of diabetes , hypertension , hyperlipidemia , heart failure , stroke , and cirrhosis . meier estimates were plotted to illustrate the cumulative incidence of osteoporosis , and the log - rank test was performed to examine the difference between the hcv exposure and the comparison cohorts . all statistical analyses were performed using the sas package ( version 9.4 for windows ; sas institute , inc , cary , nc ) .", "of the 51,535 sampled patients , 41,228 and 10,307 were categorized as the comparison and hcv exposure cohorts , respectively ( table 1 ) . most patients were aged 50 years ( 61.7% ) , and 54.6% of the patients were women . the mean age was 54.1 15.3 years in the hcv exposure cohort and 53.7 15.5 years in the comparison cohort . regarding baseline characteristics , the hcv exposure cohort exhibited a higher prevalence of diabetes , hypertension , hyperlipidemia , heart failure , stroke , obesity , and cirrhosis than did the comparison cohort . during the mean follow - up periods of 5.44 and 6.01 years for the hcv exposure and comparison cohorts , respectively , the kaplan meier curve revealed that the cumulative incidence of osteoporosis was higher in the hcv exposure cohort than in the comparison cohort ( figure 1 , log - rank test p < 0.001 ) . demographic characteristics and comorbidities in cohorts with and without hcv exposure cumulative incidence comparison of osteoporosis for patients with ( dashed line ) or without ( solid line ) hcv exposure.hcv = hepatitis c virus . the overall incidence of osteoporosis in the hcv exposure cohort was higher than that in the comparison cohort ( 8.27 vs 6.19 per 1,000 person - years ; crude hr = 1.33 , 95% ci = 1.201.47 ) ( table 2 ) . after we adjusted for factors such as age , sex , and comorbidities , namely diabetes , hypertension , hyperlipidemia , heart failure , stroke , and cirrhosis , the risk of developing osteoporosis was significantly higher in the hcv exposure cohort than in the comparison cohort ( adjusted hr [ ahr ] = 1.35 ; 95% ci = 1.211.51 ) . compared with patients aged 49 years , the risk of developing osteoporosis was 4.05-fold higher in those aged 50 to 64 years ( 95% ci = 3.8454.760 ) and 8.82-fold higher in those aged 65 years or older ( 95% ci = 7.4810.40 ) . in the multivariate model , the risk for osteoporosis was 3.10-fold higher for women than for men ( 95% ci = 2.813.43 ) and was higher for patients with the comorbidities of hypertension ( ahr = 1.19 , 95% ci = 1.071.31 ) , hyperlipidemia ( ahr = 1.17 , 95% ci = 1.051.29 ) , and heart failure ( ahr = 1.23 , 95% ci = 1.021.49 ) . the incidence and hazard ratio for osteoporosis and osteoporosis - associated risk factor the incidence of osteoporosis increased with age , was higher in women than in men , and increased with comorbidity in both cohorts ( table 3 ) . the overall risk of osteoporosis related to several variables including age , sex , and presence of comorbidities was compared in the hcv exposure cohort and the comparison cohort . the risk of osteoporosis in patients exposed to hcv in all stratifications was higher than that in the comparison cohorts . however , the risk of osteoporosis contributed by hcv decreased with age ( aged 49 : ahr = 1.79 , 95% ci = 1.322.43 ; aged 5064 : ahr = 1.36 , 95% ci = 1.141.62 ; aged 65 : ahr = 1.23 , 95% ci = 1.051.44 ) and the presence of comorbidity ( no comorbidity : ahr = 1.54 , 95% ci = 1.261.89 ; comorbidity : ahr = 1.27 , 95% ci = 1.121.43 ) . incidence of osteoporosis by age , sex , and comorbidity and cox model measured hazards ratio for patients with hcv infection compared those without hcv exposure the patients exposed to hcv exhibited a 1.38-fold ( 95% ci = 1.241.55 ) higher risk of developing osteoporosis compared with the patients who were not exposed to hcv ( table 4 ) . the risk of osteoporotic fracture did not differ significantly between patients exposed to hcv and the comparison cohorts ( ahr = 0.80 , 95% ci = 0.441.45 ) . comparisons of hazard ratios between patients with and without hcv exposure for different outcomes osteoporosis ( or osteoporotic fracture )", "consistent with the literature proposing that hcv seroprevalence peaks after age 55 and that women are predisposed to hcv infection , our results revealed that most patients ( 61.7% ) were aged 50 years and that 54.6% of the patients were women . the mean age in the hcv exposure cohort was 54.1 15.3 years . compared with patients who were not exposed to hcv , patients who were exposed to hcv tended to have more comorbidities , including diabetes , hypertension , hyperlipidemia , heart failure , stroke , obesity , and cirrhosis . our results revealed that the hcv exposure cohort had more comorbidities ; however , the risk of osteoporosis remained higher in the hcv exposure cohort after adjusting for age , sex , and the comorbidities of diabetes , hypertension , hyperlipidemia , heart failure , stroke , and cirrhosis . the mechanism affecting the pathophysiology that causes comorbidities in patients exposed to hcv may include hcv - associated insulin resistance and atherosclerosis . hcv may cause diabetes mellitus by directly interfering with insulin signaling and inducing insulin resistance in hepatocytes ; hcv - infected hepatocytes can secrete mediators that induce extrahepatic insulin resistance , notably in the skeletal muscle . hepatitis c virus may increase the risk of cardiovascular and cerebrovascular events through atherosclerosis induced by systemic inflammation , chronic endothelial injury , or direct infection of the arterial wall . our study revealed that the osteoporosis incidence increased with age and was higher in women than in men . the association between osteoporosis and aging has been confirmed in the literature , and the gene expression of the rennin the decreasing rate of bone mineral density is swifter in the early postmenopausal period , which typically begins after age 50 , and women aged 40 to 59 years have the highest risk of developing osteoporosis . consistent with our result that women are predisposed to osteoporosis , the us preventive services task force indicated that as many as 1 in 2 postmenopausal women and 1 in 5 men are at risk for osteoporosis - related fracture . moreover , in the present study , osteoporosis was associated with hypertension , hyperlipidemia , and heart failure . both osteoporosis and hypertension are common among the aging population and may share similar etiologies , such as low calcium intake and levels , vitamin d and vitamin k deficiency , high salt consumption , imbalanced nitric oxide levels , and antihypertensive agents that exert detrimental effects on the skeletal metabolism , strength , and density . hyperlipidemia can reduce bone formation and promote bone loss by causing the products of lipid oxidation to accumulate in the subendothelial spaces of the vasculature and bone . moreover , hyperlipidemia can induce secondary hyperparathyroidism , thereby impairing bone regeneration and mechanical strength . heart failure and osteoporosis share several risk factors , such as aging , smoking , and postmenopausal and antihypertensive agents ; heart failure can also accelerate bone loss by inducing hyperaldosteronism and secondary hyperparathyroidism . however , the effect of obesity on bone metabolism is controversial . obesity is traditionally regarded as a protective factor for osteoporosis , conferring a positive mechanical loading on bone formation . for example , both osteoblasts and adipocytes are derived from a common mesenchymal stem cell and agents inhibiting adipogenesis - stimulated osteoblast differentiation and vice versa . furthermore , the reduced bone formation caused by aging is usually accompanied by adipogenesis in bone marrow cavities . moreover , elevated oxidative stress is common in people with obesity and osteoporosis . to our knowledge , this is the first population - based study to assess the relation between hcv exposure and the incidences of osteoporosis and osteoporotic fracture . our statistical analyses benefited from the use of a nationwide database and the 12-year observation of participants selected from a representative cohort comprising 1,000,000 residents covered by the nhi program . hansen et al conducted a large - scale population - based study to explore the association between hcv exposure and all - site fracture , but omitted discussing osteoporosis development . they concluded that the risk of fracture equally increased in patients exposed to hcv ( chronic or cleared infections ) , and the major determinants of fracture in such patients are lifestyle - related factors , such as alcohol and drug abuse , which substantially increases fracture risk . by contrast , our epidemiological study demonstrated that hcv exposure increases the risk of osteoporosis and the detrimental effect of hcv on osteoporotic fracture was not obvious . several pathogenic mechanisms are involved in bone mineral density loss in patients exposed to hcv . first , fibronectin can infiltrate the bone matrix to enhance matrix mineralization , reducing its production by the liver . second , insulin - like growth factor 1 , involved in osteoblast differentiation and proliferation , is produced by the liver and is reduced in patients with chronic liver disease . third , the receptor activator ratio of nuclear factor kappa ligand and osteoprotegerin is higher in patients with chronic liver disease , enhancing bone resorption . fourth , interleukin-6 is increased by chronic hcv infection and can activate osteoclasts to increase bone resorption . by contrast , the association between hcv and osteoporosis may be due to shared risk factors since the prevalence of important osteoporosis risk factors was higher in the hcv exposed patients as compared to the patients without hcv exposure . however , it is reasonable to conclude that the increased risk of osteoporosis observed in hcv exposed patients was more likely to be due to the effect of their hcv status since the possible confounding effect of osteoporosis risk factors has been significantly minimized in our study . moreover , the osteoporosis risk contributed by hcv decreased with the increment of age may be due to the absence or low prevalence of osteoporosis - associated comorbidities in the younger patients . the results of our subgroup analyses in which we excluded patients with important comorbidities at baseline also confirmed the validity of our results . this finding , coupled with the results of the subgroup analyses , affirms the possible causal association between hcv and osteoporosis , and suggested that hcv may be a possible risk factor for osteoporosis . nevertheless , hcv may be less influential than other risk factors , such as hypertension , hyperlipidemia , and heart failure , in contributing to the development of osteoporosis . first , the large - scale national database provided statistical benefits to our longitudinal study to evaluate the association between hcv and osteoporosis . second , the recruited subjects were a stable population and 99% of the residents in taiwan have been covered by the nhi program . first , we could not ascertain the patients viremic status , such as the viral loads or the genotypes of the hcv . nevertheless , all patients in our case cohort exhibited positive anti - hcv antibodies , which mean recent or past hcv exposure . moreover , the effect of antiviral therapy on the stage of liver fibrosis or the grade of liver inflammation could not be ascertained in our study . therefore , we could not prove the ameliorating effect of antiviral therapy on bone mineral density through the arrest of liver cirrhosis even though the association between osteoporotic fracture and cirrhosis has been thoroughly documented . . however , to enhance the accuracy of diagnosis , we only recruited patients who received medical care for osteoporosis > 3 separate visits . moreover , the bnhi organizes regular audits performed by medical experts to ensure the accuracy of insurance claim codes in taiwan . finally , we can not clarify the temporal association between hcv exposure and osteoporosis since the date of hcv exposure could not be ascertained . in conclusion , this nationwide population - based cohort study concludes that hcv exposure increases the risk of developing subsequent osteoporosis , but no detrimental effect on osteoporotic fracture was observed . furthermore , hcv may be less influential than other risk factors , such as hypertension , hyperlipidemia , and heart failure , in contributing to the development of osteoporosis ." ]

[ "each disaster leaves an imprint on the affected population , a singular signature . a critical unmet need in the field of disaster mental / behavioral health is the capability to tailor mental health and psychosocial support ( mhpss ) to the unique constellation of psychological risk factors operating within each disaster event . we have developed and introduced trauma signature ( tsig ) analysis to the fields of disaster mental / behavioral health and disaster public health in response to this identified need . we define tsig analysis in the following manner : trauma signature ( tsig ) analysis is an evidence - based method that examines the interrelationship between population exposure to a disaster , extreme event , or complex emergency and the interrelated physical and psychological consequences for the purpose of providing timely , actionable guidance for effective mental health and psychosocial support ( mhpss)or disaster behavioral health ( dbh ) * \n support that is organically tailored and targeted to the defining features of the event . according to shultz et al . 2013 ( in press ) , tsig examines the extent to which disaster survivors were exposed to empirically - documented risk factors for psychological distress and mental health disorders . grounded on the disaster ecology model , tsig is premised on the assumption that each disaster exposes the affected population to a novel pattern of traumatizing hazards , loss , and change . this singular signature of exposure risks is a predictor ( or series of predictors ) of the psychosocial and mental health consequences . disaster - specific analysis is important because , as kessler and team have documented across a spectrum of international disasters , secondary stressors unique to a particular disaster situation have more impact than the disasters themselves in determining the prevalence of post - disaster mental disorders . too frequently , mhpss response to disasters is unguided , uncoordinated , and unscientific . for example , in our tsig analysis of the 2010 haiti earthquake it was evident that mhpss was never prioritized . the disaster behavioral health response that was cobbled together in haiti evidenced many serious deficits ( table 1 ) including : self - deployment and arrival on - scene of many uninvited personnel , lack of coordination among response teams , provision of non - evidence - informed services loosely labeled as psychosocial , provision of services such as critical incident stress debriefing ( cisd ) that are known to be ineffective and potentially harmful for survivors , provision of services that were not culturally - adapted or language - appropriate for haiti , premature cessation of many services , and minimal or no program evaluation . from the perspective of responders , there was a lack of pre - deployment guidance about the specific stressors that would be encountered , and lack of on - scene psychological support , leading to high rates of traumatization among response personnel . disaster - specific risk factors can be identified from disaster situation reports issued in the early aftermath allowing mhpss response to be tailored and timed to the defining features of the event . it is time to infuse science into mhpss response ; we need evidence - based support and intervention .", "optimal mhpss response that incorporates tsig analysis can be summarized as a sequence of six steps ( see also figure 1 ) : 1 ) initial tsig analysis to guide response based on the defining features of the disaster or potentially - traumatizing event ( pte ) , 2 ) tsig - guided preparation of responders for what to expect and deployment of appropriate response assets , 3 ) delivery and evaluation of evidence - informed early interventions , 4 ) implementation of onsite validated disaster behavioral health needs assessment , 5 ) identification and intervention with individuals at high risk for disaster - related psychological distress , impairment , or psychopathology , and 6 ) continuous monitoring of responder and survivor mental health throughout recovery with comprehensive ( end - to - end ) evaluation of the mhpss response . optimal mental health and psychosocial support ( mhpss ) : six sequential steps while the components that are uniquely contributed by tsig analysis are primarily incorporated into steps 1 and 2 , in order to achieve optimal mhpss response , significant quality improvement is needed and desirable for steps 36 . an electronic appendix , entitled operationalizing tsig ( www.landesbioscience.com/journals/disasterhealth/commart-sup.pdf ) provides details for each of the six steps in the categories of description , rationale , operationalization , unmet needs , research questions , and opportunities .", "the initial tsig analysis is the first step of six that comprise an optimal evidence - based mhpss response ( summarized in figure 1 ) . as illustrated in figure 2 , initial tsig analysis consists of these elements : 1 ) characterization of the affected communities ( geographic scope , numbers affected , demographics ) ; 2 ) real - time collection and synthesis of information from disaster situation reports ( sitreps ) issued regularly in the early days and weeks post - impact ; 3 ) identification and data collection from disaster monitoring and scientific resources specific to the disaster event ( e.g. , united states geological survey ( usgs ) earthquake data on the haiti earthquake , national hurricane center ( nhc ) data on superstorm sandy ) ; 4 ) consultation with disaster sciences subject matter experts ( e.g. , usgs geophysicists for haiti earthquake , nhc meteorologists for superstorm sandy ) ; 5 ) construction of a hazard profile based on open - source data developed in the preceding steps ; 6 ) review and integration of the scientific literature on evidence - based risk factors for psychological distress and psychopathology for persons exposed to the event - specific hazards ; 7 ) incorporation of information on disaster stressors identified anecdotally in media and social media accounts of the event ; 8) creation of an event - specific stressor / risk factor matrix that is cross - referenced with the evidence - based literature ( stressors are enumerated by disaster phase within the categories of exposure to hazard , loss , and change ) , ccounts , cross - referenced with the evidence - based literature ; and 9 ) generation of a tsig summary for the disaster based on the estimated psychological severity of exposures to hazards , loss , and change . figure 2 . initial post - impact trauma signature analysis several key points in this process require more explanation . initial tsig analysis is triggered when a disaster alert or warning is issued , or when disaster strikes without warning . local disaster response is activated immediately and higher - level response ( regional , national , international ) is brought into play as needed depending upon the scale of the event . for major events , publicly - accessible disaster situation reports ( sitreps ) are generated and hosted on websites such as the global disaster alert and coordination system ( gdacs ) , united nations office for the coordination of humanitarian assistance , and reliefweb within the early hours or days , hazard profile . to create the hazard profile that provides a scientifically - sound description of the event , tsig begins with review of disaster data including sitreps from governmental and ngo agencies and available data from disaster monitoring and scientific resources . subject matter experts ( smes ) may be contacted to assure that the event is correctly described from a disaster sciences perspective . this step describes the physical forces of harm that impact the human population in harm s way in order to characterize exposure to hazard . disaster epidemiologic data are also collected on numbers of deaths , injuries , displaced , affected . the next step involves matching the scientific event description to the ever - expanding literature on psychological risk factors ( for distress , disorder , and psychiatric diagnosis ) . this is summarized in a stressor matrix : risk factors are arrayed by disaster phase for categories of exposure to hazard , loss , and change . news media and social media feeds may also be incorporated at this stage to enrich the list of stressors . trauma signature summary . the final step in the initial tsig analysis involves the construction of a summary table of salient psychological risk factors , grouped into categories of exposure to hazard , loss , and change with an estimate of the exposure severity for each risk factor .", "to demonstrate the feasibility of conducting tsig analysis , we developed a series of disaster case studies , beginning with post hoc analyses of historical disasters and progressing to real - time analyses of unfolding events . our first tsig case study was performed on data from the 2010 haiti earthquake which we described as a potent example of the rare catastrophic event where all major risk factors for psychological distress and impairment are prominent and compounding . our tsig case studies have been wide - ranging , including examples of natural , human - generated , and hybrid disasters , and complex emergencies . in addition to tsig analyses for the 2010 haiti earthquake , we performed analyses on other natural disaster events including the 2011 us , super tornado outbreak , 2009 and 2011 river floods in the upper midwest , and 2012 superstorm sandy . in the realm of hybrid ( interacting natural and human - generated components ) , we carefully analyzed the 2011 great east japan disaster . the 2010 deepwater horizon oil spill provided an application of tsig for an anthropogenic ( human - generated ) event . in the realm of complex emergencies / humanitarian crises , we have examined patterns of internal displacement in colombia and the russia - georgia conflict in south ossetia . with each case study , the research literature database of evidence - based research studies is expanded . the case studies have provided an open invitation for colleagues with interest in a particular disaster event to join with us both in authorship and in advancing the tsig methodology . tsig developers and co - authors have presented a series of invited papers , workshops , and institutes to introduce the methodology and actively seek feedback . currently , an international cadre of co - authors and co - developers spans five continents .", "however , at present we are soliciting additional disaster case studies , consulting with subject matter experts , creating the structure for the literature database , and launching an internet - based delphi process in 2013 to develop expert consensus regarding the methodology . we will then seek opportunities to partner with lead response agencies in real - world , real - time applications of the tsig process . once refined , our intention is to develop a practical system that can help infuse evidence - based science into the decision - making process for matching mhpss response to the defining features of the disaster event . tsig is designed to contribute to the creation of mhpss response that increasingly approaches the attributes of optimal response outlined in table 2 .", "", "" ]

[ "cerebrovascular diseases ( cvds ) are associated with balance disturbances , dependency in \n performing daily living activities , and limited ambulation . as life expectancy increases spasticity is a speed - dependent resistance to the passive motion of muscles and tendons , \n developing secondary to enhanced stretch reflexes in patients with upper motor neuron \n lesions . spasticity is a major problem in rehabilitation programs , and it hampers patient \n progress and may trigger severe complications2 , 3 . quantitative assessment of spasticity is \n critical when gauging responses to medical treatment and physical therapy , and when making a \n prognosis . at present , rather limited clinical scoring systems of spasticity , and \n biomechanical and electrophysiological data , are used . electroneuromyographic evaluation of \n the spinal reflex organization allows detailed follow - up of physiological changes . this measure , \n and also the f reflex , assessed using various techniques , are employed to quantitate and \n explore spasticity4 . transcutaneous electrical nerve stimulation ( tens ) is a rehabilitative form of physical \n therapy used to treat pain . various types of nerve fiber are stimulated at different \n frequencies , wavelengths , and amplitudes . tens delays the h reflex \n through the 1a fibers , which mediate presynaptic inhibition8 . in the present study , we evaluated the utility of tens for patients with spasticity due to \n cvd , who were undergoing rehabilitation , was evaluated using clinical scoring systems and \n electrophysiological assessment . this study also aimed to explore whether tens affects \n spasticity electrophysiologically , and the extent of the effects on clinical features .", "patients hospitalized in ankara physical therapy and rehabilitation training and research \n hospital , who were participating in a rehabilitation program for hemiplegia with spasticity \n in the lower extremity , were recruited . patients who had received any treatment for spasticity , who lacked spasticity , who had a \n history of any systemic disease that might cause peripheral neuropathy , or symptoms of \n radiculopathy in the lower extremities , who had suffered strokes less than 30 days prior , \n who had a prior history of cerebrovascular disease , who had upper motor neuron damage on the \n non - hemiplegic side , who could not co - operate , or who were obese , were excluded . aphasic and \n geriatric patients were also excluded ; because their co - operation was lacking . patients with spasticity of at least ashworth grade 1 in the lower extremities were \n included . the active motor power and spasticity of all patients reflex , and superficial and deep \n sensorial examinations were performed . the time taken to walk 10 m by patients who could \n walk was measured before and after tens . after a clinical evaluation , emg examinations were initially performed on healthy controls \n and , later , on the affected sides of patients . all electrophysiological work was performed \n in a calm , intermediately lit room with patients in the supine position . their feet extended \n from the examination bed , commencing at the ankle joints , each of which was in the 90 \n neutral position ; the knee joint was at 180 of extension . all patients were asked to relax \n their muscles as much as possible during the electrophysiological study . the h reflexes and \n m responses of the gastrocnemius - soleus muscle were electrophysiologically recorded on both \n the healthy and hemiplegic sides . subsequently , a single 30 min session of tens was applied \n to the hemiplegic lower extremity . ten minutes later , the h reflexes and m responses were \n re - assessed and compared with the pre - tens data . a nihon kohden neuropack four - channel emg platform was used for measurements in the \n single - channel mode . the active \n electrode was placed on the gastrocnemius - soleus muscle , in a slightly medial position , \n 14 cm proximal to the junction of the achilles tendon and the heel . the reference electrode \n was placed at the junction of the tendon and the heel , and a velcro ground electrode was \n placed between the active electrode and the stimulator . the latter electrode was placed on \n the fossae popliteal , to stimulate the tibial nerve , and the cathode was placed across the \n active electrode . the stimulus intensity \n was increased in steps of 2 ma , commencing at zero , and the combined action potentials of \n the soleus muscle were recorded . the \n peak - to - peak amplitudes and latencies of the h and m responses were measured . the latencies \n were assessed at the point of separation of each response from the baseline . the \n sensitivity , low frequency filter , and high frequency filter were 2 mv / dv , 200 hz , and 3 \n khz , respectively . stimuli were created randomly , \n and delivered to the popliteal fossa with the posterior tibial nerve lying proximal to the \n cathode . a rectangular flow 1 ms in duration , delivered every 2 s , served as the stimulus . \n the sweep speed and sensitivity were 10 ms and 2 mv / dv , respectively . subsequently , the largest h wave was determined by \n varying the strength of the stimulus with the location of the stimulator unchanged . after all electrophysiological work was completed , and all wave amplitudes calculated , the \n h / m maximum amplitude ratio was calculated for each patient by dividing the maximal \n amplitude of the h reflex by that of the m responses from both the healthy and affected \n sides . in addition , to evaluate alpha motor neuron excitability and the extent of \n spasticity , the slopes of the rising sides of the h and m amplitude - stimulus severity slopes \n were calculated using excel and the h slope , m slope , and h slope / m slope values were \n obtained . tens was performed in the supine position with the feet hanging in a neutral manner . \n electrodes were placed bilaterally on the tibialis nerve , between the tendon of the muscle \n and the medial malleolus ; thus the gastrocnemius muscle was included . the recording \n electrodes used in the electrophysiological study were not removed . a systems 200e tens platform was used . this equipment has two output channels the flow \n intensity in each channel can be adjusted independently . the frequency was 50 hz and the \n pulse width was 100 ms in normal stimulation . the current intensity was not allowed to \n exceed a mean of 50 ma and no contractions were noted . electrophysiological data were collected before and after tens , the same as \n for the patient group . controls were positioned the same as patients , and tens was applied \n for 30 min . electrophysiological data were gathered from only the right lower extremities of \n the controls and the pre- and post - tens values were compared . the , wilcoxon signed - rank , and kruskal - wallis tests , were used , as \n appropriate , to evaluate the experimental parameters .", "the patient group with hemiplegia secondary to cvd numbered 27 [ 12 females ( 44.4% ) and 15 \n males ( 55.6% ) ] . a total of 24 healthy subjects [ 10 females ( 41.7% ) and 14 males ( 58.3% ) ] \n served as controls . the mean ages of the patients and controls were 60.9312.8 and \n 49.886.85 years , respectively . the mean heights of the patients and controls were \n 160.858.99 and 165.38 + 8.56 cm , respectively . the mean age , but fourteen ( 51.9% ) and 13 ( 48.l% ) patients respectively had left- and right - side hemiplegia . \n thromboembolic and \n hemorrhagic stroke were the principal causes of hemiplegia in 21 ( 77.8% ) and 6 ( 22.2% ) \n patients , respectively . superficial sensory nerve \n examinations revealed hypoesthesia in 10 patients ( 37% ) , but 17 were normal ( 63% ) . the deep \n tendon reflexes ( dtrs ) on the hemiplegic sides were normal in the upper extremity of one \n patient ( 3.7% ) but hyperactive in 26 ( 96.3% ) ; the lower extremity on the affected side was \n hyperactive in all patients . on the healthy sides , the dtrs were normative in both the upper \n and lower extremities of 26 ( 96.3% ) patients , and hyperactive in one ( 3.7% ) . no significant \n difference in the mean pre- and post - tens lower - extremity dtrs on the hemiplegic side was \n found ( p>0.05 ) . the values of the spasticity parameters before and after tens differed significantly in the \n patient group ( table 1table 1.change in the spasticity between pre- and post - tensashworth 1ashworth 2ashworth 3pre - tens10 ( 37%)13 ( 48.2%)4 ( 14.8%)post - tens14 ( 51.9%)11 ( 40.7%)2 ( 7.4% ) all p values < 0.05 ) . fourteen patients were able to walk , either with support or independently , but 13 were not . \n after tens , 11 patients \n exhibited increased walking speeds and 3 reduced speeds . when patient hemiplegic and healthy lower extremities were electrophysiologically compared , \n the mean maxima of the h reflex , the h / m ratio , the h slope , and h slope / m slope ratio , were \n significantly greater on the affected side . in addition , the mean m response amplitude was \n significantly different ( greater on the healthy side ) . the differences in the h / m maximum \n and h slope / m slope ratios were particularly marked ( table 2table 2.electrophysiological variables of the healthy and affected sides of the \n patientsvariablehealthy sideaffected sideh max amp ( mv)1,669.851559.792,899.701,698.69h max lat ( msec)31.212.1831.082.28 m max amp ( mv)8,735.892,820.527,439.892,825.16 m max lat ( msec)4.900.444.930.40h / m max amp ( mv)0.190.160.420.22h slope0.010.0090.030.22 m slope0.030.0060.030.006h / m slope0.40.320.910.43 ) . the h maximum amplitude values were higher on the spastic hemiplegic side than on the \n healthy side . the h / m ratio , h slope , and h slope / m slope ratio were higher on the affected \n side . however , the mean m amplitude was higher on the normal than on the hemiplegic side . \n the mean h reflex amplitude , the h / m amplitude ratio , the h maximum latency , the h slope , \n and the h / m slope ratio , differed significantly pre- and post - tens on the hemiplegic \n side . the post - tens electrophysiological changes in the control group were similar to those in \n the patient group . the h maximum amplitude , the h / m ratio , the m maximum amplitude , and the \n m slope ratio , decreased , whereas the h and m maximum latencies increased , with statistical \n significance . the duration of disease was positively associated with the mean h maximum amplitude , the \n h / m ratio , and the h / m slope ratio ; however , no association was statistically significant . \n the h maximum latency was lowest in patients with disease durations greater than 100 \n days . higher mean h maximum amplitudes , h / m ratios , and h slopes evident as spasticity worsened . \n however , only the mean h slope differed significantly among the spasticity subgroups , with \n significant differences being found between subgroups i and iii , and ii and iii , in parallel \n with worsening of spasticity .", "tens significantly reduced spasticity scores and increased the walking speed . on the \n spastic side , tens significantly reduced the m amplitude and increased the h reflex \n amplitude , the h / m maximum amplitude ratio , the h slope , and the h slope / m slope ratio . \n also , the mean patient h reflex amplitude , the h / m ratio , the h slope , and the h slope / m \n slope ratio , decreased significantly , and the h reflex maximum latency increased , after \n tens . in controls , tens significantly decreased the h maximum amplitude , the h / m ratio , the \n m maximum amplitude , and the m slope ratio , and lengthened the h and m maximum latencies . \n the h maximum latency was the only variable affected by lesional duration . the mean h \n maximum amplitude , the h / m ratio , and the mean h slope increased as spasticity worsened on \n the ashworth scale . explored changes in the spasticity of patients with medulla spinalis injuries \n after tens , and found there were short - term reductions in spasticity9 . robinson et al . applied 20 min electrical stimulation to \n the quadriceps muscles of patients with medulla spinalis injuries and reported a significant \n decrease in leg spasticity10 . cho et al . \n found that a single session of high - frequency tens significantly improved the spasticity \n ( for less than 1 day ) of chronic stroke patients . similarly , tens reduced the spasticity of stroke \n patients , and repeat tens reduced the hyperactive tension reflexes of the plantar flexors , \n and the passive resistance to plantar flexor movement11 . in a study that included acute stroke patients , tens applied to \n acupuncture points for 3 weeks decreased plantar flexor spasticity and increased \n dorsiflexion of the ankle joint . in chronic stroke patients , however , ankle joint \n dorsoflexion was strengthened by stimulation , and muscle co - contraction was decreased . in \n addition repeated skin stimulation was \n advocated , to increase the number of cortical fields represented12 . in a study that included chronic stroke patients , \n addition of tens to a 20-session rehabilitation program decreased spasticity by 30% and \n markedly improved muscle strength13 . park \n et al . showed that balance , walking , and the functional activity of chronic stroke patients \n improved after 30 tens sessions ( each 30 min in duration ) , and a combination of exercise and \n tens increased the activation of pathways associated with proprioception and balance14 . in the present study , a significant \n decrease in spasticity and an increase in walking speed were evident after acute hemiplegic \n the patients in a rehabilitation program received a single session of tens . fisher reported that the m amplitudes of patients with first - motor neuron diseases \n decreased , after tens , compared to the amplitudes of polyneuropathic patients15 . angel and hoffman , who first showed that \n the h / m ratio was increased in spastic patients , reported mean ratios of 9.17 and 0.48 in \n the extremities of control and spastic groups , respectively . the excitability of alpha motor \n neurons increased when various physiopathological mechanisms were in play ; therefore , the \n responses to stimuli carried by 1a afferent fibers increased16 . garcia - mullin and mayer reported mean h / m ratios of 0.33 and 0.46 \n on the healthy and paretic sides , respectively , of spastic hemiplegic stroke patients in \n whom the disease duration was longer than 90 days17 . bakhtiary showed that spasticity was reduced by electrical stimulation , but no significant \n change in the h reflex amplitude was evident . also , the h / m maximum ratio did not change , \n and this was attributed to muscle weakness caused by stimulation18 . gaft et al . noted significant decreases in both \n spasticity and the h reflex amplitude after stimulation . in the present study , significant \n differences were found in the m response and h reflex amplitude between the healthy and \n affected sides of spastic the hemiplegic stroke patients . the mean maximum amplitudes of the \n h reflexes of the triceps surae were 1,669 and 2,899 mv on the healthy and paretic sides , \n respectively , and the difference was significant . the difference in the h / m ratio between \n the healthy and plegic sides was also significant19 . huang et al . reported that the h / m maximum and h2/h1 ratios were not adequate for defining \n the extent of spasticity as assessed by the ashworth scale . the mean h / m maximum and h2/h1 \n values increased in stroke patients , compared to healthy controls , but the m maximum ratio \n did not significantly differ between the groups . the h2/h1 and m maximum ratios did not \n significantly correlate with other measures of spasticity . in contrast to other previous \n studies , huang et al . concluded that the mas value correlated with the h / m ratio20 . in the present study , we noted a decrease \n in the m amplitude on the spastic side was observed , whereas the h reflex amplitude and the \n h / m maximum amplitude ratio , increased . higashi et al . found that the change in the h slope / m slope ratio was more significant on \n the spastic than the healthy side , and no significant difference in the h / m maxima of the \n two sides was evident . as the h slope / m slope graph is bell - shaped , such data are more \n compatible with the brunnstrom stage of hemiplegic patients than are other indicators . in \n conclusion , the h slope/ m slope ratio is primarily useful for objectively evaluating the \n extent of spasticity , and the excitability of the motor neuron pool of the spastic sides of \n hemiplegic patients21 . measured the excitability of the motor neuron pool and compared the h / m ratios , the h \n maximum amplitude , and the h slope / m slope ratio , in spastic and normal individuals , and \n found there were marked differences between the two groups . they concluded , the h slope / m \n slope ratio was particularly useful for evaluating motor neuron pool excitability22 . in the present study , steeper h slope and \n greater h slope / m slope ratio on the spastic ( compared to healthy ) side of hemiplegic \n patients prior to tens were observed . one study evaluating the electrophysiological components of the h reflex and f wave \n compared the pre- and post - tens h reflexes , and f wave latencies and amplitudes , and \n reported the reduction in spasticity was associated with electrophysiologically proven \n decreases in the h reflex amplitude , the f wave amplitude , and the h / m and f / m ratios23 . in another study , tens was applied \n segmentally and heterosegmentally to the median nerve of the wrist , and to the common \n peroneal nerve ( placebo ) . the h reflex latencies increased in 75% of the patients in the \n experimental groups , but the h amplitude did not change significantly . aydin et al . compared tens with baclofen , the commonest drug prescribed to treat spasticity \n in patients with medulla spinalis injuries . significant improvements in all parameters , \n except pain , were evident in the tens group , and they were associated with decreases in the \n h amplitude and h / m ratio , and the m response . the electrophysiological and clinical changes \n did not differ significantly between the tens and baclofen group25 . tekeoglu et al . also reported that tens reduced \n spasticity in stroke patients , and improved their capacity to engage in activities of daily \n living , concluding that tens effectively improved motor function26 . in the present study , a single session of tens resulted in significant clinical inhibition \n of spasticity ; however , lower extremity strength did not improve . on the spastic side , tens \n significantly decreased the mean h reflex amplitude , the h / m ratio , the h slope , and the h \n slope / m slope ratio ; and increased the h reflex maximum latency . this study had some \n limitation walking speed was not measured after several tens applications . in conclusion , tens for hemiplegic patients with spastic lower extremities due to cvd \n markedly improved clinical parameters and significantly changed electrophysiological \n variables . the results of this study suggest that tens is effective when used to manage \n spasticity ." ]

[ "proteinase - activated receptors ( pars ) belong to a family of g - protein - coupled receptors with seven transmembrane domains activated via proteolytic cleavage by serine proteinases . a total of four pars have been identified and cloned . among them , par-1 [ 2 , 3 ] , par-3 , and par-4 are targets for thrombin , trypsin , and cathepsin g , whereas par-2 is resistant to thrombin but can be activated by trypsin , mast cell tryptase [ 6 , 7 ] , neutrophil elastase , and insect - derived proteinase . pars are expressed by various cells involved in inflammatory and immunological responses , such as vascular endothelial cells , epithelial cells , mast cells , t cells , monocyte , eosinophils , and neutrophils [ 10 , 11 ] . in these cells , activation of pars affects their main functions such as proliferation , degranulation , and release of inflammatory mediators [ 10 , 11 ] . in our previous study , we have showed the expression of par-1 , par-2 , and par-3 on t cells , and thrombin- , trypsin- , and tryptase - induced interleukin ( il-6 ) release from t cells . it has also been reported that cytoplasmic free calcium and phospholipase c and protein kinase c activation are increased in t - leukemic cell lines following stimulation with thrombin or the thrombin receptor agonist peptide . thrombin and thrombin receptor agonist also enhanced cd69 expression and il-2 productions by cross - linking t cell receptors in both jurkat t cells and peripheral blood lymphocytes . we , therefore , anticipated that thrombin , trypsin , and tryptase might induce tnf release from t cells through pars . tnf is a major proinflammatory cytokine that is thought to be important in the pathogenesis of asthma , food allergy , ocular allergy , and atopic dermatitis . it has been reported that the increased number of tnf expressing cells and levels of tnf is observed in the bronchoalveolar lavage ( bal ) and in the airways of asthmatics . inhaled tnf increases airway responsiveness to methacholine in asthmatic subjects associated with a sputum neutrophilia . since pars , tnf , and t cells all play roles in inflammation , we believe , there must be some linkages between them . the aim of the present study is to investigate roles of thrombin , tryptase , trypsin , elastase , and agonist peptides of pars in the secretion of tnf from purified human t cells and subtypes of t cells .", "\n human thrombin , trypsin ( specific activity : 10,000 baee u / mg protein ) , soybean trypsin inhibitor ( sbti ) , and bovine serum albumin ( bsa , fraction v ) were purchased from sigma ( st louis , mo , usa ) . recombinant hirudin and human neutrophil elastase ( specific activity : 20 meo - suc - ala - ala - pro - val - pna u / mg protein ) were obtained from calbiochem ( san diego , ca , usa ) . recombinant human lung tryptase ( specific activity : 1,000 n cbz - l - lysine thiobenzyl ester u / mg protein ) was from promega ( madison , wi , usa ) . agonist peptides of pars , and their reverse forms , and par-2 antagonist peptide fsllry - nh2 were synthesized in cl bio - scientific inc . the sequences of the active and reverse peptides were par-1 , sfllr - nh2 and rllfs - nh2 , tfllrn - nh2 and nrllft - nh2 ; par-2 , sligkv - nh2 and vkgils - nh2 as well as trans cinnamoyl ( tc)-ligrlo - nh2 and tc - olrgil - nh2 ; par-3 , tfrgap - nh2 and pagrft - nh2 . rpmi 1640 and newborn calf serum ( ncs ) were obtained from gibco ( carlsbad , ca , usa ) . pe - conjugated mouse anti - human cd3 monoclonal antibody , pe - conjugated goat - anti rabbit igg , and tnf opteia elisa kits were purchased from bd pharmingen ( san jose , ca , usa ) . trizol reagent and sybr green i stain were purchased from invitrogen ( carlsbad , ca , usa ) . cellular activation of signaling kits for extracellular signal - regulated kinase ( erk ) , 2-(2-diamino)-3-methoxyphenyl-4h-1-benzopyran-4-one ( pd98059 ) , akt , pi3k , and p38 2-(4-morpholinyl)-8-phenyl-4h-1-benzopyran-4-one ( ly294002 ) was purchased from cell signaling technology ( beverly , ma , usa ) . exscript rt reagent kit and sybr premix ex taq ( perfect real time ) were obtained from takara ( dalian , china ) . rabbit anti - human par-1 and rabbit anti - huamn par-2 polyclonal antibodies were purchased from santa cruz biotechnology ( santa cruz , ca , usa ) . fitc - conjugated mouse anti - human cd4 monoclonal , pe - conjugated mouse anti - human cd8 monoclonal , percp - cy5.5-conjugated mouse anti - human tnf monoclonal , fitc - conjugated mouse anti - human ifn monoclonal , pe - conjugated mouse anti - human il-4 monoclonal , apc - conjugated mouse anti - human cd25 monoclonal , and apc - conjugated mouse anti - human il-17 monoclonal antibodies were purchased from ebioscience . all other reagents were of analytic grade and obtained from sigma ( st louis , mo , usa ) . human t cells were isolated from peripheral blood mononuclear cells ( pbmcs ) by a macs system with t cell isolation kit i according to the manufacturer 's protocol . in brief , pbmcs were isolated from fresh blood donated by healthy volunteers , 100 ml from each individual per visit . the informed consent from each volunteer and agreement with the ethical committee of the first affiliated hospital of nanjing medical university were obtained . after being separated from red blood cells by ficoll - paque density gradient , pbmcs were collected and incubated with microbead - linked anti - cd3 monoclonal antibody for 15 min at 8c . cd3 + t cells were separated from other cells by passing through a magnetic cell separation system . for purity analysis , the cells were resuspended in pbs and incubated with pe - conjugated monoclonal antibody against human cd3 for 1 h. the purity of t cells was consistently more than 95% and cell viability was more than 98% . the purified cd3 + t cells were then used for the further cell challenge tests . t cells were cultured in 24-well culture plates at a density of 5 10cells / well in rpmi 1640 medium containing 10% ncs at 37c for 2 h with 5% co2 , respectively . the culture supernatants were then removed and cells were washed twice with fresh serum - free rpmi 1640 medium at 300 g for 10 min . for challenge experiments , cells were exposed to various doses of thrombin ( 0.013.0 g / ml , 1 u = 0.5 g , 1 u / ml = 5.6 nm , u = nih unit ) , trypsin ( 0.010.3 g / ml , 1 g / ml = 42 nm ) , tryptase ( 0.252.0 g / ml , 1 g / ml = 7.4 nm ) , and elastase ( 0.010.3 g / ml , 1 g / ml = 34 nm , 1 u / ml = 1700 nm ) with or without their inhibitors ; and to agonist peptides of par-1 , par-2 and par-3 ( all at 0.1100 m ) and their reverse peptides , respectively , for 16 h before the culture , supernatants were harvested and stored at 40c till use . quantitative expression of tnf mrnas in t cells was determined by real - time pcr following the manufacture 's protocol . briefly , after synthesizing cdna from the total rna by using exscripttm rt reagent kit , real - time pcr was performed by using sybr premix ex taq on the abi prism 7000 sequence detection system ( perkin elmer applied systems , foster city , ca , usa ) . each reaction contains 12.5 l of 2 sybr green master mix , 1 l of 10 m of primers , 1 l of the cdna , to a total volume of 25 l . the thermal cycling conditions included an initial denaturation step at 50c for 2 min , 95c for 10 min ; 40 cycles at 95c for 15 s , annealing temperatures at 60c for 30 s , and extension at 72c for 30 s. the sequences of pcr primers for tnf and -actin were 5-ccccagggacctctctctaatc-3 ( forward ) and 5-ggtttgctacaacatgggctaca-3 ( reverse ) ; 5-aggggccggactcgtcatact-3 ( forward ) , and 5-ggcggcaacaccatgtaccct-3 ( reverse ) , respectively . consequently , at the end of the pcr cycles , specificities of the amplification products were controlled by dissociation curve analysis . expression of mrna in each sample was finally determined after correction with -actin expression . the gene specific threshold cycle ( ct ) for each sample ( ct ) was corrected by subtracting the ct for the housekeeping gene -actin . untreated controls were chosen as the reference samples , and the ct for all experimental samples was subtracted by the ct for the control samples ( ct ) . t cells were preincubated with 50 m of pd98059 , 20 m of ly294002 , or medium alone for 30 min before adding thrombin 3.0 g / ml , trypsin 0.3 g / ml , or medium alone for 30 min , 2 h , or 6 h. the cells were lysed in a buffer containing 20 mm of tris - hcl ( ph 7.4 ) , 137 mm of nacl , 10% glycerol , 1% triton x-100 , 2 mm of edta , 25 mm of -glycerophosphate , 2 mm of sodium pyrophosphate , and 0.5 mm of dithiothreitol at 4c for 30 min . cell debris was removed by centrifugation of the lysate at 12,000 g for 10 min . the supernatants were mixed with equal volumes of 2x sodium dodecyl sulphate ( sds ) sample buffer and heated to 100c for 10 min . an equal volume of sample was fractionated by sds - page on a 10% acrylamide gel and transferred onto polyvinylidene difluoride ( pvdf ) membranes with a bio - rad transfer system , according to the manufacturer 's instructions . after blocking nonspecific binding sites with 5% bsa in tbst ( 50 mm of tris , 0.15 m of nacl , 0.1% tween 20 , ph 7.6 ) for 1 h , membranes were probed with phospho - erk1/2 , phospho - akt , phospho - p38 , or phospho - pi3k antibodies at 4c overnight , followed by incubation with hrp - conjugated secondary antibodies . immunoreactive bands were visualized by using enhanced chemiluminescence reagents according to the manufacturer 's protocol . densitometry analysis of immunoblots was carried out using quantity one software ( bio - rad , usa ) . the levels of tnf in culture supernatants were measured with opteia elisa kits according to the manufacturer 's instructions . the plates were read on a plate reader ( molecular devices , menlo park , ca ) with the softmax data analysis program . the minimum detectable concentration of tnf was 2.2 pg / ml . to test the par1 and 2 expressions after treatment of trypsin and thrombin , isolated t cells were pelleted by centrifugation at 450 g for 10 min after cells were stimulated with thrombin 3.0 g / ml , trypsin 0.3 g / ml , or medium alone for 16 h. for par1 and par2 staining , cells were incubated with rabbit anti - human par1 or par2 antibodies at 37c for 1 h. after washing , cells were incubated with pe - conjugated goat anti - rabbit igg antibody 37c for 45 min . after washing , cells were analyzed on a fluorescence - activated cell sorting ( facs ) arial flow cytometer with celldevia software ( bd biosciences , usa ) . to test the secretion of tnf from subtypes of t cells , isolated t cells were pelleted by centrifugation at 450 g for 10 min and then fixed and permeabilized by using a cell fixation / permeabilization kit ( bd pharmingen ) . briefly , thoroughly resuspended cells were added in 100 l of bd cytofix / cytoperm solution and incubated for 20 min at 4c . cells were then incubated with fluorescence labeled anti - human cd4 , cd8 , cd25 , tnf , ifn , il-4 , and il-17 monoclonal antibodies or isotope control , respectively ( at a final concentration of 4 g / ml ) at 4c for 30 min . after washing , cells were analyzed on a fluorescence - activated cell sorting ( facs ) arial flow cytometer with celldevia software ( bd biosciences , usa ) .", "the purity of t cells was consistently more than 95% ( date was shown in supplementary material , figure s1 ) . it has been shown that thrombin , trypsin , and tryptase can induce proinflammatory cytokine il-6 release from t cells , but little is known of serine proteinase - induced tnf release from t cells . here , we showed that thrombin at concentrations of 1.0 and 3.0 g / ml provoked tnf release from t cells following 16 h incubation period in a dose - dependent manner . approximately up to 2.5-fold increase in tnf release was observed when t cells were incubated with thrombin for 16 h. at 6 h following incubation , data ( not shown ) on both basal and induced tnf release from t cells were inconsistent . this is most likely due to the limitation of the assay sensitivity and relatively low secretion of tnf . par-1 agonist peptides , sfllr - nh2 at the concentration of 100 m and tfllrn - nh2 at the concentration of 5 m , induced a significant release of tnf at 16 h following incubation . however , rllfs - nh2 , a reverse peptide of sfllr - nh2 , and nrllft - nh2 , a reverse peptide of tfllrn - nh2 , had little effect on release of tnf from t cells ( figure 1(a ) ) . hirudin , a specific thrombin inhibitor , was able to inhibit thrombin - induced secretion of tnf . approximately up to 82.4% inhibition of thrombin - induced secretion of tnf was observed when 3.0 g / ml of thrombin and 10 u / ml of hirudin were added to t cells for 16 h. hirudin alone at the concentrations tested had little effect on tnf secretion from t cells . sch 79797 , a par-1 antagonist at the concentration of 1 m , inhibited 89% thrombin - induced tnf release from t cells ( figure 1(a ) ) . similarly , trypsin at the concentration of 0.3 g / ml induced 2.3-fold increase in tnf release from t cells at 16 h ( figure 1(b ) ) . however , tryptase at the concentrations up to 2 g / ml and elastase at the concentrations up to 6 u / ml had little effect on tnf release from t cells ( data not shown ) . inhibitors of trypsin , sbti at the concentrations of 10 and 30 g / ml , eliminated 0.3 g / ml trypsin - induced tnf release by a value up to 94.8 and 94.2% , respectively . sbti alone at the concentrations tested had little effect on tnf secretion from t cells . sch 79797 , a par-1 antagonist at the concentration of 1 m , inhibited 96.8% trypsin - induced tnf release from t cells ( figure 1(b ) ) . sligkv , an agonist peptide of par-2 and tfrgap - nh2 , an agonist peptide of par-3 at the concentrations up to 100 m , did not appear to have any effect on tnf release from t cells ( data not shown ) . in order to confirm the findings above , we investigated the influence of the serine proteinases on the expression of tnf mrna in t cells . it was found that the expression of tnf mrna was upregulated when t cells were incubated with thrombin at 1 and 3 g / ml for 2 and 6 h. the maximum enhanced expression of tnf mrna was 4.2-fold over baseline control ( figure 2(a ) ) after 6 h incubation . hirudin , a specific thrombin inhibitor at the concentration of 3 u / ml , completely abolished thrombin - induced upregulated expression of tnf mrna after 6 h incubation ( figure 2(b ) ) . trypsin at the concentration of 0.3 g / ml also induced increased expression of tnf mrna by a value up to approximately 4.0-fold in t cells ( figure 2(a ) ) , which was completely blocked by sbti ( figure 2(b ) ) . similarly , sch 79797 at the concentration of 1 m inhibited both thrombin- and trypsin - induced upregulated expression of tnf mrna in t cells by a value up to 72 and 72.5% , respectively ( figure 2(b ) ) . sfllr - nh2 at the concentration of 100 m and tfllrn - nh2 at the concentration of 5 m significantly increase the expression of tnf mrna at 2 and 6 h following incubation ( figure 2(a ) ) . but rllfs - nh2 , a reverse peptide of sfllr - nh2 , and nrllft - nh2 , a reverse peptide of tfllrn - nh2 , had little effect on expression of tnf mrna in t cells ( data not shown ) . at the same time , neither thrombin nor trypsin showed obvious effect on the expression of par-1 and par-2 ( data not shown ) . it is wellknown that there are numerous subtypes of t cells and each of them has distinctive functions . we , therefore , investigated subtypes of t cells by flow cytometer analysis in order to determine the subtypes that upregulate tnf in response to trypsin or thrombin . the results showed that trypsin and thrombin induced upregulated expression of tnf in cd4 + t cells , but not cd8 + t cells , following 16 h incubation period . among cd4 + t cells , trypsin and thrombin enhanced tnf expression in il-4 + or cd25 + t cells , but not in ifn+ or il-17 + t cells . sch 79797 was able to inhibit enhanced tnf expression induced by trypsin and thrombin ( figures 3(a ) and 3(b ) ) . in order to examine signal transduction pathways of thrombin and trypsin , t cells were preincubated with pd98059 , ly294002 , or medium alone for 30 min before adding thrombin 3.0 g / ml , trypsin 0.3 g / ml , or medium alone for 16 h. following 16 h incubation period , pd98059 an inhibitor of mapk pathway , and ly294002 , an inhibitor of pi3k , completely blocked thrombin- and trypsin - induced release of tnf ( figure 4(a ) ) . furthermore , pd98059 inhibited thrombin- and trypsin - induced upregulation of expression of tnf mrna by a value up to 91.2 and 98.6% , and ly294002 eliminated thrombin- and trypsin - induced expression of tnf mrna by 95.5 and 83.2% in t cells following 6 h incubation ( figure 4(b ) ) . 3 g / ml ) induced enhanced phosphorylation of erk1/2 in t cells following 0.5 , 2 , and 6 h incubation periods . however , thrombin and trypsin did not significantly affect phosphorylation of p38 in t cells following 0.5 , 2 , and 6 h incubation periods ( date was shown in supplementary material , figure s2 ) . pd98059 was able to completely block thrombin- and trypsin - induced phosphorylation of erk1/2 when it was preincubated with t cells for 30 min . thrombin at a concentration of 3 g / ml and trypsin at a concentration of 0.3 g / ml induced significantly increased phosphorylation of akt in t cells following 0.5 , 2 , and 6 h incubation periods . however , thrombin and trypsin did not significantly affect phosphorylation of pi3k in t cells following 0.5 , 2 , and 6 h incubation periods ( date was shown in supplementary material , figure s3 ) . ly294002 was able to block thrombin- and trypsin - induced phosphorylation of akt when it was incubated with t cells for 30 min .", "we discovered in the present study that serine proteinases thrombin and trypsin , but not tryptase induced tnf release from human t cells . since tnf is a potent proinflammatory cytokine , our observation is likely to add some novel information for , understanding of actions of serine proteinases in causing inflammation . as little as 1.0 g / ml of thrombin was able to induce significant tnf release from t cells , suggesting this proteinase is a potent secretagogue of tnf . this concentration of thrombin should be easily achieved in blood , particularly when the processes of platelet aggregation and coagulation are initiated . inhibition of thrombin - induced tnf release by a specific inhibitor of thrombin and hirudin indicates that action of thrombin on t cells was dependent on the enzymatic activity of this serine proteinase . there are 3 receptors for thrombin on cells , including par-1 , par-3 , and par-4 [ 2 , 3 ] . since par-1 agonist peptides sfllr - nh2 , and tfllrn - nh2 , but not par-3 agonist peptide tfrgap - nh2 were capable of stimulating tnf release , a par-1 antagonist sch 79797 almost completely abolished thrombin - induced tnf release from t cells , and purified human t cells do not express par-4 ; the action of thrombin on t cells is most likely through activation of par-1 . our previous report which found thrombin - induced il-6 secretion from human peripheral blood t cells may support our current findings . while little information is available on induction of tnf release from t cells by trypsin , the ability of trypsin to stimulate il-6 secretion from t cells may support the anticipation that trypsin is capable of inducing cytokine release from t cells . as little as 0.3 g / ml of trypsin was able to provoke tnf secretion from t cells proved that it is a potent stimulus of tnf release . as for thrombin , inhibitor of trypsin sbti was able to inhibit trypsin - induced tnf release from t cells , indicating that an intact catalytic site is required for the serine proteinase to stimulate tnf release . since par-1 is one of three receptors of trypsin , par-1 agonist peptides sfllr - nh2 and tfllrn - nh2 are capable of stimulating tnf release from t cells , and sch 79797 almost completely abolished trypsin - induced tnf release from t cells , the action of trypsin on t cells is most likely through activation of par-1 . since par-2 agonist peptide sligkv - nh2 and tryptase are not capable of stimulating tnf release from t cells , the action of trypsin on t cells is not likely through activation of par-2 . trypsin- and thrombin - induced upregulated expression of tnf was observed in cd4 + , il-4 + or cd25 + t cells , indicating that il-4 + , and cd25 + t cells are major sources of tnf . while little information on the relationship between cd25 + t cells and tnf is available , a study which found that the percentage of cd4(+)cd25(+ ) t cells were significantly high , but the percentage of foxp3(+ ) cells were low in allergic rhinitis patients , and that il-4 , il-5 , and tnf levels in nasal lavage fluids were high indicates that the increased tnf release may be from cd4(+)cd25(+ ) , nonregulatory t cells . we believe that the current study is the first work that demonstrates coexpression of cd25 and tnf in the subtype of cd4(+ ) t cells . similarly , we clearly found that il-4 + t cells express enhanced tnf , though little information on co - expression of il-4 and tnf in t cells is available . this finding implicates that trypsin and thrombin may be involved in the inflammation through induction of tnf release from il-4 + or cd25 + t cells . it was demonstrated that nickel - specific cd4 + t cell lines and th17 cells corelease il-17 and tnf , but trypsin- and thrombin - induced tnf release appears not from il-17 + t cells as tnf expression in il-17 + t cells was not upregulated by these two proteinases . mapk / erk pathway is the signaling pathway that is most likely involved in the thrombin- and trypsin - induced tnf release from highly purified t cells , as pd98059 , an inhibitor of mapk / erk pathway , almost completely blocked thrombin- and trypsin - provoked phophorylation of erk and tnf release . while little information on signaling pathways associated with par-1 signaling in purified t cells is available , the previous reports that par-1 agonists activated mapk / erk and p38 mapk signaling pathways in dermal and cardiac fibroblasts may support our current observation that mapk / erk pathway is the signaling pathway that is most likely involved in the thrombin- and trypsin - induced tnf release . in addition , pi3k / akt signaling pathway seems also to be involved in thrombin and trypsin induced tnf secretion , as ly294002 an inhibitor of pi3k / akt signaling pathway partially diminished thrombin and trypsin induced tnf secretion and completely abolished thrombin and trypsin provoked phosphorylation of akt . this finding is in the same line with the report , which showed that thrombin stimulated enhance pi3k activity in hamster embryonic fibroblasts , but different from our previous report , which showed that thrombin did not enhanced pi3k activity in human dermal fibroblasts . the discrepancy between these studies may be due to the difference in cell origin and species . tnf is a member of a growing family of peptide mediators comprising at least 19 cytokines , including lymphotoxin- , fas ligand , and cd40 ligand . the family is now considered as central mediators of a broad range of biological activities in protective immune responses against a variety of infectious pathogens . on the other hand , tnf also exerts host - damaging effects in sepsis and autoimmune disease [ 30 , 31 ] . these findings indicate that tnf is one of key mediators of inflammation ; therefore , our current study is of importance in understanding tnf - related inflammation and the mechanism of proteinase - induced cytokine production in t cells .", "in conclusion , it is discovered in the present study that serine proteinases thrombin and trypsin are potent stimuli of tnf secretion from highly purified t cells . their actions on t cells depend on their enzymatic activities and are likely through activation of par-1 . stimulation of tnf secretion from t cells by serine proteinases further proved that these proteinases are actively involved in the pathogenesis of inflammation and regulation of immune response in man ." ]

[ "relapsing chronic inflammation found in the gut of individuals affected by inflammatory bowel diseases ( ibd ) is a result of several overlapping factors , including dysregulation of the immune response to the enteric microbiota , genetic susceptibility , and environmental factors [ 1 , 2 ] . reactive oxygen ( ros ) and nitrogen ( rns ) species generated by inflammatory cells during an immune response create oxidative stress and are considered as important factors contributing to the pathogenesis of ibd . lymphocytes , neutrophils , and macrophages activated during the gut inflammation produce high amounts of ros / rns destroying surrounding tissue . although oxidative stress is a major factor in the inflamed tissue leading towards necrosis , dna damage , and carcinogenesis , certain amounts of ros and other free radicals have an indispensable role in regulating different cell signalling pathways . in addition , some immune cells , namely , the macrophages and neutrophils , use ros to combat the microorganisms responsible for the infection . current therapies of ibd , including immunosuppressive drugs , antibiotics , and biological drugs , are efficient in controlling the course of the disease . however , for many affected individuals , conventional therapy becomes an inadequate choice for long - term treatment because of significant side effects and risk factors , such as increased cancer risk , development of tuberculosis , and heart failure [ 57 ] . in recent years , hyperbaric oxygen ( hbo2 ) therapy has been introduced as a possible additional treatment for ibd patients , especially in the case of refractory disease when the standard therapy is ineffective . hbo2 involves exposure to 100% oxygen under pressure greater than 1 atmosphere of absolute pressure ( atm ) . it is a well - established procedure frequently applied in the medical practice , especially effective in treating wounds of various aetiologies [ 811 ] . hbo2 increases blood and tissue oxygen saturation resulting also in enhanced production of ros and rns . previous studies have verified that the clinical efficacy of hbo2 derives from modulation of intracellular transduction cascades , leading to synthesis of growth factors which promote wound healing , neoangiogenesis , and ameliorates postischemic and postinflammatory injuries . additional investigations on the mechanism underlying hbo2-induced wound healing have revealed a central role of hypoxia inducible factor-1 alpha ( hif-1 ) as transcriptional regulator of genes involved in angiogenesis , energy metabolism , and cell proliferation [ 9 , 14 , 15 ] . a further important function attributed to the hif-1 is modulation of the immune responses , including the helper t - cell differentiation towards regulatory ( treg ) versus th17 phenotype [ 16 , 17 ] and its strong anti - inflammatory activity in the gastrointestinal mucosa and hypoxic epithelium as a result of the transactivation of specific genes encoding for barrier - protective elements such as mucins [ 1820 ] . hypoxia and ros / rns can induce stabilization of hif-1 leading to the activation of the hypoxia signal transduction pathway . increased oxidative stress in the gut mucosa has been verified in humans suffering from ulcerative colitis [ 22 , 23 ] , as well as in experimentally induced colitis in animals [ 24 , 25 ] . a recent study revealed increased activity of antioxidative enzymes and reduced oxidative stress in the inflamed gut mucosa following hbo2 exposure ; however , specific mechanisms inducing activation of antioxidative enzymes in the inflamed colonic tissue upon hbo2 remain unknown . since there is evidence that the intracellular redox status is in a close correlation with the inflammatory microenvironment , and it can also be changed by hbo2 , the aim of this study was to investigate the effects of hbo2 on the mrna expression of hif-1 , proinflammatory cytokines , and antioxidative enzymes in the gut and peripheral lymphoid organs of balb / c mice with dss - induced colitis . an additional aim was to assess the activity of antioxidative enzymes and whether hif-1 gene expression regulation during the gut inflammation and hbo2 treatment correlates with the changes in antioxidative and proinflammatory gene expression . our findings reveal that hbo2 treatment may effectively modulate the intestinal milieu in inflammatory conditions involving hif-1-mediated regulation of antioxidative gene expression .", "balb / c mice , obtained from charles river ( calco , italy ) , were bred at the animal facility of the medical faculty osijek ( croatia ) . mice were provided with standard rodent chow ( mucedola , settimo milanese , italy ) and water ad libitum . the experimental facility was maintained at 22 2c , 55 5% humidity , and 12-hour light / dark cycle . all procedures involving live animals were conducted in accordance with the european guidelines for the care and use of laboratory animals ( directive 86/609/eec ) and were approved by the local ethical committee ( faculty of medicine , university of osijek ) and croatian ministry of agriculture . for each experiment male mice at the age of 1012 weeks were randomized into 4 groups ( n = 4 - 5 mice / group / experiment ) : control mice ( ctrl ) , control mice undergoing hbo2 ( ctrl + hbo2 ) , mice receiving dextran sodium sulphate ( dss ) , and dss treated mice undergoing hbo2 ( dss + hbo2 ) . the average body weight of the mice at the time of inclusion into the study was 22.8 0.4 g. colitis was induced by 5% ( w / v ) of dss ( mr 36.00050.000 , mp biomedicals , illkrich , france ) in drinking water ad libitum for 7 consecutive days [ 26 , 27 ] . the hbo2 treatment was initiated at day 1 and was administered twice a day , 12 hours apart , until the end of experiment ( the last session was applied in the morning of day 8 ; 15 sessions in total ) . during one hbo2 session , mice were exposed to 100% o2 for 60 minutes at 2.4 bars with addition of 15 minutes for gradual compression and decompression . mice were sacrificed by cervical dislocation on day 8 , after the morning hbo2 session . disease activity index ( dai ) was assessed by daily measurement and scoring of animal body weight loss , stool consistency , and the presence of occult or gross blood per rectum . measurements were performed at the same time each day until the end of experiment ( day 8) . dai was determined as a sum of body weight loss score ( 0 , none ; 1 , 15% loss ; 2 , 510% ; 3 , 1015% ; 4 , > 15% ) , stool consistency score ( 0 , normal ; 2 , loose stool ; 4 , diarrhea ) , and score of occult / gross bleeding ( 0 , normal ; 2 , occult bleeding ; 4 , gross hematochezia ) . mice were sacrificed by cervical dislocation on day 8 following the last morning hbo2 treatment . colons , mesenteric lymph nodes ( mln ) , and spleens were collected for further analysis . colonic tissue was removed immediately after the animals were sacrificed , washed in pbs , and fixed in 4% paraformaldehyde . after 72 hours fixed tissue was embedded in paraffin and cut into a series of 6 m thick sections . histological evaluation was preformed according to modified geboes score as follows : \n grade 0 ( structural ( architectural changes ) ) : \n 0 : no abnormality , 1 : mild abnormality , 2 : mild or moderate diffuse or multifocal abnormalities , 3 : severe diffuse or multifocal abnormalities . \n 2 : mild or moderate diffuse or multifocal abnormalities , 3 : severe diffuse or multifocal abnormalities . \n grade 1 ( chronic inflammatory infiltrate ) : \n 0 : no increase , 1 : mild but unequivocal increase , 2 : moderate increase , 3 : marked increase . \n 1 : mild but unequivocal increase , 2 : moderate increase , \n grade 2 ( lamina propria leukocytes ) : \n 0 : no increase , 1 : mild but unequivocal increase , 2 : moderate increase , 3 : marked increase . \n 1 : mild but unequivocal increase , 2 : moderate increase , \n grade 3 ( intraepithelial neutrophils ) : \n 0 : none , 1 : < 5% crypts involved , 2 : < 50% crypts involved , 3 : > 50% crypts involved . \n 1 : < 5% crypts involved , 2 : < 50% crypts involved , 3 : > 50% crypts involved . \n grade 4 ( crypt destruction ) : \n 0 : none , 1 : probable , local excess of neutrophils in part of crypt , 2 : probable , marked attenuation . \n 1 : probable , local excess of neutrophils in part of crypt , 2 : probable , marked attenuation . \n grade 0 ( structural ( architectural changes ) ) : \n 3 : unequivocal crypt destruction . \n 3 : unequivocal crypt destruction . \n grade 5 ( erosion or ulceration ) : \n 0 : no erosion , ulceration , or granulation tissue , 1 : recovering epithelium + adjacent inflammation , 2 : probable erosion focally stripped , 3 : unequivocal erosion , 4 : ulcer or granulation tissue.slides were analysed using light microscopy at magnifications 40x , 100x , 200x , and 400x and photographed at 200x ( olympus bx50 microscope , olympus c-5050 digital camera , and quickphoto pro imaging software ( promicra s.r.o . , prague , czech republic ) ) . 0 : no erosion , ulceration , or granulation tissue , 1 : recovering epithelium + adjacent inflammation , 2 : probable erosion focally stripped , 3 : unequivocal erosion , 4 : ulcer or granulation tissue . after isolation , the colon was cleaned of intestinal content and freed of fat tissue , washed in dmem ( sigma aldrich , steinheim , germany ) , cut into 5 cm long pieces , and , while shaken at 100 rpm , incubated at 37c for 20 minutes in dmem with 25 mm edta . the tissue was then thoroughly washed in pbs buffer for at least 5 times , cut into 2 mm long strips , and digested in dmem containing 5 u / ml dnase ( roche , mannheim , germany ) and collagenase ii ( gibco , paisley , uk ) at 37c for 20 min . following this , supernatant was removed , and the previous step was repeated until complete digestion of the tissue was achieved . the supernatant was then filtered through a 100 m sized filter ; dmem + 2% fbs ( sigma aldrich , steinheim , germany ) was added and centrifuged at 800 g for 10 min at room temperature . cells were resuspended in 5 ml of 40% percoll ( ge healthcare , uppsala , uk ) , overlaid on 4 ml of 80% percoll , and centrifuged at 900 g/20 min/4c . lymphocytes were isolated from the mesenteric lymph nodes ( mln ) and spleen by teasing apart the organs between the frosted ends of two microscopic slides . the cells were incubated with a mixture of pe anti - cd4 ( clone gk1.5 , exbio antibodies ) , fitc anti - b220 ( clone ra3 - 6b2 , obtained from the american type culture collection and conjugated with fitc using standard procedures ) , and apc anti - cd3 antibodies ( clone 145 - 2c11 , exbio antibodies ) and the other panel with percp anti - cd45 ( clone 30-f11 , bd biosciences ) , fitc anti - gr-1 ( clone rb6 - 8c5 , bd biosciences ) , and pe anti - f4/80 ( clone bm8 , stemcell technologies inc . ) or pe anti - cd4 ( clone mem-241 , exbio antibodies ) and percp anti - cd8 ( clone mem-31 , exbio antibodies ) antibodies . dead cells were excluded based on 7-aminoactinomycin d ( 7-aad ) ( applichem , darmstadt , germany ) staining . at least 20,000 live cells were collected by a bd facs canto ii cytometer ( facs canto ii , becton dickinson , san jose , ca , usa ) and analysed using the flowlogic software ( inivai technologies , mentone , australia ) . to assess hydrogen peroxide ( h2o2 ) and peroxynitrite ( onoo ) level , 10 lymphocytes isolated from mln and spleens were incubated for 30 min on + 4c with 10 m dichlorofluorescein diacetate ( dcf - da ) ( biomol , hamburg , germany ) , washed for 5 min at 400 g on + 4c , and analysed with the facs canto ii . following this , cells were stimulated with 100 nm phorbol 12-myristate 13-acetate ( pma , calbiochem , darmstadt , germany ) , incubated for 30 min , and analysed for the second time . at each measurement minimum of 10,000 target cells colon , mln , and spleen samples were isolated , snap frozen in liquid nitrogen , and stored at 80c till analysis . rna purity and concentration was assessed by nanophotometer p - class p330 - 30 ( implen , munich , germany ) . in order to purify rna from all polysaccharides , including dss , an additional purification step using 8 m licl was performed , followed by the standard genomic dna purification step using deoxyribonuclease i kit ( sigma aldrich , st louis , mo , usa ) . one microgram of rna was used for cdna synthesis by high capacity cdna kit with rnase inhibitor ( applied biosystems , foster city , ca , usa ) . real - time pcr was performed on cfx96 system ( bio rad , singapore ) to assess relative expression of catalase ( cat ) , glutathione peroxidase 1 ( gpx1 ) , superoxide dismutase 1 ( sod1 ) , hif-1 , il-1 , il-2 , and il-6 . except for the primers for il-6 gene published by jeong et al . , all other primers were custom made using primer 3 software . messenger rna expression was determined using ssofast evagreen supermix ( bio rad , singapore ) . tissue powder was additionally homogenized in 100 mm phosphate buffer solution ( ph 7.0 ) containing 1 mm edta ( 1 : 10 , w / v ) using ultra turrax t10 homogenizer ( ika , staufen , germany ) while kept on ice . tissue homogenates were sonicated for 30 seconds on ice in three 10 seconds intervals and then centrifuged at 20,000 g for 15 minutes at 4c . cat , gpx , and sod enzyme activities were determined using a lambda 25 uv - vis spectrophotometer equipped with uv winlab 6.0 software package ( perkin elmer for the better , massachusetts , usa ) . catalase ( ec 1.11.1.6 ) activity was estimated spectrophotometrically using h2o2 as a substrate . the reaction mixture consisted of 10 mm h2o2 in 50 mm phosphate buffer ph 7.0 . changes in absorbance of the reaction mixture were measured at 240 nm during 2 minutes after the sample addition . one unit of activity corresponds to the loss of 1 mol of h2o2 per minute . cat activity was calculated using molar extinction coefficient ( = 0.04 mm cm ) and expressed as u mg protein . to assess glutathione peroxidase ( ec 1.11.1.9 ) activity a modified method described by wendel using h2o2 as a substrate was employed . gpx activity was determined indirectly by measuring the rate of nadph oxidation to nadp+ , accompanied by a decrease in absorbance at 340 nm . the assay mixture consisted of 50 mm phosphate buffer with 0.4 mm edta and 1 mm sodium azide ( ph 7.0 ) , 0.12 mm nadph , 3.2 units of gr , 1 mm glutathione , and 0.0007% ( w / w ) h2o2 in a total volume of 1.55 ml . one unit catalyses the oxidation by h2o2 of 1.0 mole of reduced glutathione to oxidized glutathione per minute at ph 7.0 and 25c . gpx activity was calculated using molar extinction coefficient for nadph ( = 6.220 mm cm ) and expressed as u mg protein . superoxide dismutase ( ec 1.15.1.1 . ) activity was determined using cytochrome c ( 0.05 mm ) as an inhibitory molecule in pbs buffer saline with 0.1 mm edta in system xanthine ( 1 mm)/xanthine oxidase ( 50 u ) by flohe method . total soluble protein concentration in protein extracts was determined by bradford reagent ( sigma aldrich , steinheim , germany ) following manufacturer 's protocol and using bovine serum albumin as a standard . were tested by one - way anova or kruskal - wallis test followed by the holm - sidak / tukey or dunn 's post hoc multiple comparison procedure , respectively ( sigma plot 11.0 , sigmastat inc . , the student t - test and mann - whitney u statistic were used to compare the differences between the two groups in the case of normally distributed variables and variables that violated assumption of normality , respectively . spearman 's correlations were calculated where appropriate ( sigma plot 11.0 , sigmastat inc . ) . dai results were analysed by two - way anova and bonferroni post hoc test ( graphpad prism 5.0 , graphpad software , inc . , la jolla , ca , usa ) . a p value of < 0.05 was considered statistically significant for all procedures . all data are presented as mean values standard error of mean ( s.e.m . ) .", "in order to determine the effects of hbo2 on the course of acute colitis , balb / c mice were exposed to 5% dss in the drinking water ad libitum and daily monitored for body weight , stool consistency , and occult / gross rectal bleeding to calculate dai . in this study the dss treatment induced substantial weight loss , rectal bleeding , loose stool , and colon shortening resulting in significantly higher dai compared to the control ( ctrl ) group , starting from day 3 until the end of the experiment ( p < 0.01 ; figure 1(a ) ) . mice that received dss and underwent hbo2 treatment ( dss + hbo2 group ) also presented with significantly higher dai compared to the ctrl group ; however , in this group of mice hbo2 treatment significantly reduced dai compared to the dss mice , starting from day 5 throughout day 8 ( days 5 and 8 p < 0.01 ; days 6 and 7 p < 0.05 ; figure 1(a ) ) . in addition , average colon length in the dss group of mice was significantly shorter ( 8.14 0.23 cm ) compared to the ctrl group ( 13.88 0.45 cm ; p < 0.0001 ) , while this effect was significantly ameliorated by hbo2 treatment in the dss + hbo2 group ( 11.34 0.38 cm ) compared to the dss group ( p = 0.0001 , figure 1(b ) ) . dss induced colitis resulted in significant body mass loss compared to ctrl group , irrespective of hbo2 treatment ( 11.89 0.03% and 8.24 0.01% in the dss and dss + hbo2 group , resp . ; ctrl and ctrl + hbo2 gained body mass during the experiment , 8.25 0.2% and 0.33 0.01% , respectively . histological assessment of the colon revealed severe inflammation and ulceration extending into the deep portions of the mucosa with loss of crypts and with increased number of lamina propria leukocytes in dss group of mice . we also found structural changes of mucosa in the colonic tissue of dss + hbo2 mice but with reduced infiltration of inflammatory cells and decreased crypt distortion . when compared to the dss + hbo2 group , the dss group had significantly higher total histological score as well as individual scores ( see modified geboes score in section 2.3 , figure 1(d ) , p < 0.001 ) , except for the intraepithelial neutrophil infiltration score ( p = 0.104 ) . distribution of inflammatory cells among the peripheral lymphoid organs , including gr-1 leukocytes ( monocytes and neutrophils ) , f4/80 leukocytes ( monocytes ) , cd3 t lymphocytes , and b220 b lymphocytes ( figure 2 ) , was assessed at the end of the experiment . in the mln , frequencies of gr-1 cells did not differ among the experimental groups , while dss induced a significant increase in f4/80 and decrease in cd3 cell frequencies ( p < 0.05 and p = 0.032 , resp . ; figure 2(b ) ) . these findings in the dss group were accompanied by a b - cell increase which was not statistically significant . hbo2 alone had no effect on the cell frequencies in mln of control mice , whereas it substantially ameliorated these changes in mice with dss - induced colitis ( dss + hbo2 group ) but without reaching statistical significance . in the spleen , gr-1 cell frequencies were significantly decreased in the dss group compared to ctrl ( p = 0.006 ) and ctrl + hbo2 groups ( p < 0.001 ; figure 2(a ) ) . hbo2 treatment reversed gr-1 cell frequencies to control values in the dss + hbo2 group ( p = 0.056 ; figure 2(a ) ) . in addition , the dss mice showed reduced frequencies of b220 lymphocytes compared to the ctrl group ( p = 0.016 ) , and hbo2 treatment abolished these effects in the dss + hbo2 group ( p = 0.034 ; figure 2(c ) ) . in addition , our study revealed that dss - induced immune responses in the mln and the spleen were significantly dampened by hbo2 treatment . frequency of cd4 cells among the colon lamina propria lymphocytes of dss and dss + hbo2 groups was significantly increased compared to the ctrl group ( p = 0.015 and p = 0.047 , resp . ) , while the frequency of cd8 cells was significantly increased only in the dss group when compared to the ctrl group ( p = 0.011 ; figure 3 ) . inflammatory conditions have been known to include the enhanced production of ros and other oxidative mediators that may affect transcriptional regulation via hif-1. to investigate the role of hif-1 in the regulation of the antioxidative response / capacity during dss - induced colitis and hbo2 treatment , hif-1 , cat , gpx1 , and sod1 mrna expressions were determined using quantitative pcr method . mrna expression was significantly changed by the hbo2 treatment and the inflammatory microenvironment in the gut mucosa . dss - induced colitis resulted in significant upregulation of hif-1 gene in colonic mucosa ( p = 0.008 for dss group compared to ctrl ) , and the hbo2 treatment further increased hif-1 mrna expression in the dss + hbo2 group ( p = 0.028 compared to ctrl ; figure 3(a ) ) . in addition , the activity of hif-1 protein was indirectly confirmed by measuring mrna expression of well - established hif-1 target genes , vegf and pgk1 . both genes showed strong positive correlation to the hif-1 mrna ( supplementary figure 1 ) ( see supplementary material available online at http://dx.doi.org/10.1155/2016/7141430 ) . there was also a tendency for upregulation of hif-1 gene in mln and spleens of the dss group and its downregulation via hbo2 in the dss + hbo2 group ( figure 4(a ) ) ; however , these changes did not reach statistical significance . inflammation during dss - induced colitis and the hbo2 treatment also induced significant changes in mrna expression of target antioxidative genes . dss - treated mice presented with significant downregulation of the cat gene in the colon compared to the ctrl group ( p = 0.031 ) , while there was a significant upregulation of cat gene in the spleen of the dss + hbo2 mice compared to the ctrl group ( p = 0.026 ; figure 4(b ) ) . in the colon , gpx1 mrna expression was increased in the dss ( p = 0.034 ) and the dss + hbo2 ( p = 0.003 ) group compared to ctrl group . the upregulation was even greater in mice with dss - induced colitis that underwent the hbo2 treatment ( dss + hbo2 group ; figure 4(b ) ) . sod1 mrna expression was significantly reduced in the colon of the dss + hbo2 group compared to ctrl ( p = 0.008 ) and ctrl + hbo2 ( p = 0.007 ) groups . similar changes in sod1 gene expression were also found in the mln of the dss + hbo2 group ( p = 0.025 compared to ctrl ; figure 4(b ) ) . to summarize , colitis resulted in gpx1 gene upregulation and cat gene downregulation , while hbo2 downregulated sod1 and further upregulated gpx1 in a tissue - specific manner . to examine the possible role of hif-1 in transcriptional control of antioxidative genes in the colon , the results revealed a strong negative correlation between hif-1 and sod1 ( r = 0.651 , p = 0.001 ) and a positive correlation of hif-1 to the gpx1 gene ( r = 0.750 , p < 0.001 ) , while there was no significant correlation between the hif-1 and the cat gene in the colonic tissue ( figure 4(c ) ) . the early phase of inflammation is mediated by several proinflammatory mediators , which prompted us to assess how hbo2 treatment affects their production . we found that gut mucosa inflammation was accompanied with a significant increase in il-1 and il-6 gene expression . in the case of il-6 gene , this was significant for dss and dss + hbo2 groups compared to the ctrl + hbo2 group ( p = 0.024 and p = 0.021 , resp . ; furthermore , il-6 gene was significantly upregulated in the mln of the dss group ( p = 0.001 compared to ctrl ) , and hbo2 reduced its expression almost to control values in the dss + hbo2 group ( p = 0.016 compared to dss ; figure 5(a ) ) . il-1 mrna expression in the colonic mucosa was significantly increased during inflammation in dss group compared to ctrl ( p = 0.014 ) and ctrl + hbo2 groups ( p = 0.041 ) . il-1 mrna levels in the colon of the dss + hbo2 group did not significantly differ from the control groups , suggesting that hbo2 treatment blocked the increase of il-1 gene expression in the inflamed mucosa . \n il-2 gene was significantly upregulated in the mln of the dss group compared to the ctrl group ( p = 0.003 ) , and hbo2 treatment resulted in its significant downregulation in the dss + hbo2 group ( p = 0.032 ) . similarly , il-2 gene was significantly downregulated in the spleen of mice from the dss + hbo2 group compared to the ctrl group ( p = 0.025 ) . in addition , there was a strong positive correlation between hif-1 and il-6 gene ( r = 0.749 , p < 0.001 ; figure 5(b ) ) , while there was no correlation between hif-1 and il-1 or il-2 genes in the colonic tissue ( figure 5(b ) ) . in addition to their mrna expression , we also tested the enzymatic activity of antioxidative enzymes . we found that both the inflammation and the hbo2 treatment per se were able to change the activity of antioxidative enzymes in the colonic mucosa and the peripheral lymphoid organs ( mln and spleen ) . in spleen hbo2 treatment per se induced significant increase of sod activity ( p = 0.040 compared to ctrl ) . mice with dss - induced colitis presented with significantly increased activity of sod ( p = 0.012 compared to ctrl ) in the colon and reduced cat activity in mln and spleen ( p = 0.023 and p = 0.032 , resp . ) compared to ctrl group . treatment did not change sod activity in the inflamed colonic mucosa , which was comparable to the levels found in dss and ctrl + hbo2 groups ( significantly increased compared to ctrl , p = 0.010 ) . on the other hand , hbo2 treatment significantly increased cat ( p = 0.020 ) and gpx ( p = 0.001 ) activities in the spleens of the dss + hbo2 . immune cells at the site of inflammation and in the peripheral lymphoid organs are an important source of ros . therefore we assessed the basal levels of intracellular h2o2 and onoo and their production upon pma - induced activation in the lymphocytes isolated from mln and spleens of the mice from all experimental groups ( figure 6 ) . basal h2o2 and onoo production in the mln was not significantly different among the groups , except for the lymphocytes from the dss + hbo2 group which presented with a significant increase of h2o2 and onoo levels compared to the ctrl group ( p = 0.033 ) . pma stimulation resulted in increased intracellular h2o2 and onoo production , although statistically significant only for ctrl ( p = 0.031 ) and dss + hbo2 ( p = 0.012 ) groups . in the spleen , hbo2 increased lymphocyte h2o2 and onoo production in ctrl + hbo2 and dss + hbo2 groups ( p = 0.004 and p = 0.007 compared to the ctrl ; and p = 0.005 and p = 0.009 compared to the dss group ) . their production after pma - induced activation was decreased in all experimental groups except the ctrl group ; however , this effect reached statistical significance only in the ctrl + hbo2 group ( p = 0.018 compared to unstimulated lymphocytes ) .", "in the present study , the experimental model of dss - induced colitis in balb / c mice was employed to explore the effects of hbo2 on the antioxidative enzymes , transcription factor hif-1 , and proinflammatory cytokine genes during colonic inflammation and their role in modulating the course of the disease via hbo2 treatment . the most important findings are that ( a ) hbo2 significantly reduces symptoms and severity of dss - induced colitis , as evidenced by clinical appearance , contraction of the immune cell expansion and mobilization , and reversal of il-1 , il-2 , and il-6 gene expression ; ( b ) hbo2 modulates the expression of antioxidative enzyme genes and enzyme activities during colitis ; and ( c ) hbo2 enhances hif-1 mrna expression in the inflamed colonic tissue which is in a strong correlation with gpx1 , sod1 , and il-6 mrna expression . several previous studies in animals and humans demonstrated the positive effects of hbo2 treatment in influencing the severity of colitis and reducing gut mucosa inflammation [ 27 , 34 ] ; however , data on the precise underlying mechanisms are scarce . considerably more data on the beneficial anti - inflammatory effects of hbo2 are available for other conditions such as septic shock , ischemia / reperfusion injuries , and atherogenesis , where the previous studies reported reduced proinflammatory cytokine expression , suppressed development of th cells , shrinking of spleen and lymph nodes , decreased responses to antigens , and reduced frequencies of circulating leukocytes [ 3542 ] . although this is the first animal study investigating the effects of hbo2 performed on dss - induced colitis in balb / c mice and correlating it with the immune cell frequencies , our results are in line with previous findings on the changes associated with dss - induced acute immune response , as well as on the effects of hbo2 on the antioxidative enzyme activities determined in other animal models , such as tnbs and acetic acid induced colitis in rats [ 27 , 43 , 44 ] . during colitis mice presented with decreased t and b cell frequencies in the spleen and reduced t cell frequencies in the mln , suggesting that lymphocytes are recruited from the peripheral lymphoid organs and probably migrate to the inflamed colonic mucosa . one element of the beneficial effect of hbo2 may be linked to normalized t and b cells frequency in the mln and spleen of mice with dss - induced colitis after hyperbaric treatment ( figures 1 and 2 ) . by measuring cd4 and cd8 lymphocyte in colon we confirm our hypothesis of t - cell recruitment from the peripheral lymphoid organs and their migration to the inflamed colonic mucosa , as well as immunomodulatory effect of hbo2 . in our model hbo2 did not affect cell frequencies in the peripheral lymphoid organs of control mice , in contrast to previous findings where hbo2 treatment per se was able to change lymphocyte subset populations in the spleen . for a long time macrophages and neutrophils have been considered as immune cells exclusively producing proinflammatory cytokines , chemokines , and large amounts of ros / rns contributing to aggravated inflammation . we have found decreased spleen gr-1 cell frequencies during colitis and their normalization upon hbo2 treatment ( figure 2 ) . in addition , we showed increased mln frequencies of f4/80 cells in dss group , while hbo2 treatment reversed their frequencies almost to control values . these findings indicate that hbo2 can modulate distribution of phagocytes by retaining neutrophils in the spleen and instigating macrophage migration towards the site of inflammation , in agreement with previous findings describing inhibited neutrophil infiltration into the gut of mice with dss - induced colitis . furthermore , hbo2 treatment alone did not change the expression of proinflammatory cytokines in the colon , mln , or spleen of the control mice ; however , dss - induced colitis resulted in a significant il-1 and il-6 gene upregulation in the colonic tissue and il-2 gene upregulation in the mln ( figure 5 ) . consistent with previous studies , hbo2 treatment abolished these effects , further confirming its anti - inflammatory potential [ 4749 ] . several animal studies on the effects of hbo2 on the experimental colitis reported an increased antioxidative capacity and changes in antioxidative enzyme activity [ 24 , 25 ] . it has been proposed that an optimal hbo2 treatment could generate ros which would function primarily as intermediates in the antioxidative signalling pathways leading to increased expression of antioxidative enzymes , reduced inflammation , and ameliorated colitis symptoms but would not further damage the colonic tissue [ 50 , 51 ] . . showed that 24 hours after a two - hour hbo2 treatment at 2 bars in rats oxidative stress is not elevated , as evidenced by assessing ferric reducing antioxidant power ability of plasma ( frap ) and thiobarbituric acid reactive substances ( tbars ) level . in addition , a recent study also suggests that ros produced by nadph oxidase complex are important mediators inducing anti - inflammatory response in autoimmune diseases . data on the cat mrna level during dss - induced colitis and upon hbo2 treatment were not available prior to this study . we found that cat mrna expression is tissue and treatment specific ( figure 4 ) . colitis resulted in a significant downregulation of cat mrna expression in the colonic mucosa , and the hbo2 treatment induced its upregulation in the spleen of dss + hbo2 group of mice . these results were largely in accordance with our finding on enzymatic catalase activity that was decreased in all measured tissues in the dss group and reversed to control values in the spleen of dss + hbo2 group ( table 2 ) , as well as with a previous study demonstrating decreased catalase activity in colonic tissue upon dss treatment . this is also in line with a study on skin transplanted balb / c mice where hbo2 treatment increased catalase , gpx , and sod activity in the spleen . furthermore , upregulation of protein and mrna catalase levels 14 days after hbo2 treatment , but not after 7 days , was also observed in the ulcer tissue of patients with diabetic foot , indicating a time - course for the effect of hbo2 to prevail . we found that gpx1 mrna level was upregulated in the colon of dss treated mice , irrespective of the hbo2 treatment , and there were no significant differences in the gpx1 mrna expression in mln and spleen . in contrast to our findings on mrna expression , colon gpx enzyme activity was slightly reduced in dss + hbo2 group compared to other groups , which is consistent with previous results obtained in acetic acid induced colitis in rats receiving combined hbo2 and ozone treatment . however , other reports indicate decreased gpx and sod activity in the inflamed distal colon mucosa and the plasma of rats with acetic acid induced colitis , and hbo2 normalized gpx but not sod activity in the colon . the observed discrepancies in the results may be related to the differences in experimental models used among the studies . in addition , in our study hbo2 treatment induced enhanced gpx and sod activity in the spleen of dss mice which is in contrast to reduced sod1 mrna expression and might be explained by additional sod2 and sod3 function in regulation of antioxidative capacity . although intracellular h2o2 and onoo levels were slightly increased during inflammation and hbo2 treatment in the mln and hbo2 per se increased its level in spleen , impaired lymphocyte function was not observed . intensive research on the beneficial wound healing effects of hbo2 revealed its capacity to induce neovascularization , reduce oedema , decrease leukocyte adhesion , stimulate fibroblast expansion , and inhibit bacterial growth [ 14 , 57 ] . some of these processes are transcriptionally regulated by hif-1 , namely , the vascular endothelial growth factor ( vegf ) expression , regulatory t lymphocyte differentiation , and preservation of epithelial thigh junction integrity . in addition , previous studies employing conditional deletion of epithelial hif-1 or pharmacologic activation of hif-1 in a murine model of colitis demonstrated a protective role for hif-1 in colitis . it has also been shown that hif-1 increases expression of barrier - protective genes ( multidrug resistance gene-1 , intestinal trefoil factor , cd73 ) , decreases tnf mrna expression , and enhances antimicrobial activity by transcribing beta - defensin 1 . in the present study we found increased expression of hif-1 gene in inflamed colonic tissue , and hif-1 gene expression was changed ( upregulated ) by the inflammation while hbo2 treatment showed a tendency to reverse this increase . these data suggest involvement of different mechanisms controlling hif-1 gene expression at the site of inflammation ( colon ) and the peripheral lymphoid organs ( mln and spleen ) , responsible for the initiation of the immune response and the t / b - cell expansion and differentiation , respectively . we also demonstrated a strong positive correlation between hif-1 and gpx1 mrna levels in the colon ( figure 4(b ) ) . this is in line with in vitro studies where overexpressed hif-1 in colorectal cancer cells resulted in enhanced gpx1 expression through tgf-ri / smad2/erk1/2/hif-1 signalling cascade , suggesting transcriptional regulation of gpx1 by hif-1 . in the present study we found strong negative correlation between hif-1 and sod1 mrna expression this is in accordance with a previous study showing that docosahexaenoic acid downregulates sod1 gene transcription through an hre - mediated mechanism ( hre , hypoxia - response element ) , involving hif signalling in human cancer cells ; thus our results indicate similar mechanism involved in sod1 control in the murine colon mucosa in vivo during colitis and hbo2 . previous studies revealed that hif-1 mediated transcriptional regulation of different proinflammatory cytokines and growth factor genes are tissue and cell specific and include regulation trough alternative splicing , mrna stability , and interactions with other transcription factors like nf-b [ 6669 ] . in our study we found a strong correlation between hif-1 and il-6 mrna levels suggesting involvement of hif-1 in transcriptional regulation of il-6 gene during colonic inflammation and hbo2 . in conclusion , our results confirmed that hbo2 exerts an anti - inflammatory effect on dss - induced colitis in mice , and this effect at least involves hif-1 and antioxidative genes expression regulation ( as outlined in figure 7 ) . however , further studies are necessary to identify the cells that may contribute to or are influenced by the effects upon hbo2 treatment ." ]

[ "sexuality in women is a complex issue with physiological , psychological , and cultural components . determination of sexual partner involvement , intimate relationships , and past abusive relationships is crucial in female sexual dysfunction ( fsd ) ( 1 , 2 ) . sexual dysfunction is more prevalent among women compared to men ( 43% vs. 31% ) ( 3 - 5 ) . in 1960 , masters and johnson studied and reported both on healthy sexual function and sexual dysfunction for the first time . they described four phases of the human sexual response cycle , as follows : excitement , plateau , orgasm , and resolution . nowadays , the accepted classification of fsd consists of disturbances in desire , including hypoactive sexual desire disorders ( hsdd ) , sexual aversion disorders , sexual arousal disorders , orgasmic disorders , and sexual pain disorders , including dyspareunia and vaginismus ( 3 , 6 - 9 ) . fsd can further be classified as primary or secondary and persistent or situational ( 10 ) . intimate sexual function is one of the best predictors of quality of life , and sexual dysfunction causes many problems for couples . some researchers have found that the frequency of sexual relationship and sexual satisfaction are positively associated with marital satisfaction ( 11 , 12 ) . among other factors , illicit drug dependency changes . moreover , opioids act on a variety of neurotransmitters in the brain , including endorphins . furthermore , morphine has been found to inhibit sexual behavior in a dose - dependent manner through a complex pharmacological domain ( 13 , 14 ) .", ", most studies on drug abuse and sexual performance have focused on addicted populations , and have usually considered men . although many studies have looked at the frequency of sexual dysfunction in women , limited research has focused on the impact of addiction on spouse sexual function . to the best of our knowledge , few studies have been conducted on the effect of males opium dependency on their wives sexuality . thus , the present cross - sectional study aimed to assess the prevalence of fsd among women with addicted partners . we hypothesized that substance dependency in males would affect their wives sexual function .", "this cross - sectional controlled study was conducted on 340 women of reproductive age ( 25 - 50 years old ) selected through convenience sampling . the case group included 160 women whose husbands were opioid dependent . some of them were the wives of opioid - dependent males hospitalized in the addiction treatment units of teaching hospitals affiliated with the shiraz university of medical sciences , shiraz , iran . other women were encountered in centers where opioid - dependent males spouses were referred for group therapies . in contrast , the control group ( n = 160 ) included women whose spouses were not opioid dependent ; they were selected from the general population referring to the clinics of the shiraz university of medical sciences . after giving informed consent , the participants were interviewed privately according to the dsm - iv - tr criteria by a senior female medical student who was one of the researchers and had been properly trained regarding the nature of the study . the interview focused on hsdd , sexual arousal disorder , orgasmic disorder , and sexual pain disorder . in addition , the subjects demographic information , such as age , level of education , marital status , and duration of marriage , was obtained using a self - constructed questionnaire designed by the authors . to include the women in the study the exclusion criteria of the study were a history of substance use disorders , gynecological disorders ( gyn ) , and chronic medical disease that has been shown to affect sexual functioning ( e.g. hypertension , diabetes mellitus , chronic kidney disease , cancer , spinal cord injury , lupus , fibromyalgia , chronic pain and chronic depression ) . it should be noted that the questionnaires were anonymous and participation in the study was voluntary . the chi - square test was used for categorical data , while the t - test was utilized for continuous data . the protocol for this study was approved by the ethics committee of the shiraz university of medical sciences , shiraz , iran .", "out of the 340 women who were selected , 5 in the case group and 15 in the control group were excluded due to missing data . the mean ages of the case and the control group were 36.35 and 33.2 years , respectively . in this study , statistical significance was defined as p < 0.05 . it should be noted that in terms of demographic characteristics , there was no significant difference between the case and the control group ( p > 0.05 ) , so , we could use further statistical methods on the data . table 2 shows the frequency of sexual dysfunction in the two study groups . according to the results , approximately more than 50% of the participants had problems in at least one domain of sexual function . moreover , the main fsd observed in the case women was hsdd ( 75.46.9% ) followed by sexual aversion disorder ( 73.46.2% ) , sexual arousal disorder ( 65 .40.9% ) , orgasmic disorder ( 59.37.1% ) , and sexual pain disorder ( 45.28.5% ) . furthermore , 75 out of the 155 women in the case group ( 46.9% ) and 16 out of the 145 women in the control group ( 10% ) had hsdd , and the difference between the two groups was statistically significant ( p < 0.05 ) . in addition , 73 women in the case group ( 46.2% ) and 20 in the control group ( 12.6% ) had sexual aversion disorder , with a significant difference between the two groups ( p < 0.05 ) . in this study ,", "this disorder was a significant problem affecting a considerable number of women in both the case and control groups ( table 2 ) . this high prevalence may have resulted from various causes . although studies have shown that many factors , such as age and level of education , affect sexual function ( 15 - 17 ) , the findings of the current study revealed no relationship between the demographic characteristics , that is , age , duration of marriage , and level of education , and sexual dysfunction . as can be seen in table 2 , the frequency of hsdd and aversive sexual desire disorder was more common in the case group than the control group , and the difference was statistically significant ( p < 0.05 ) . the high frequency of hsdd among the addicts spouses exhibited in this study was in line with the study performed by noori et al . however , noori et al . included no control groups in their study , and consequently , it was not possible to compare the characteristics of the subjects with those of women whose husbands were not addicted . the findings of the present study showed that the addicts spouses suffered from hsdd significantly more than the control group . another finding was the higher frequency of orgasmic disorder in the case group ; however , this difference was not statistically significant . the higher rate of orgasmic disorder among the addicts spouses obtained in this research was in line with the study by noori et al . in contrast to our research , in one study conducted on 2626 women in iran in 2006 , 31.5% of the subjects ( 759 ) suffered from sexual disorder , and the most prevalent disorder was orgasmic disorder , followed by desire disorder ( 19 ) . in the dsm - iv - tr , sexual desire disorders are divided into two classes , as follows : 1 ) hsdd characterized by a deficiency or lack of sexual fantasies and desire for sexual activity and 2 ) sexual aversion disorder characterized by an aversion to and avoidance of genital contact with a sexual partner . no single cause of hsdd has been defined ; however , physiological , psychological , and sociocultural factors that contribute to female sexual desire may all be important in its development ( 20 , 21 ) . master and johnson s linear model of sexual response does not always work for females . some factors , such as emotional intimacy and relationship satisfaction , may change this model . studies have shown that the motivating factors for female sexual desire are very complicated . sexual desire and the presence or absence of orgasm could result from multiple cultural and environmental factors , as well as from interpersonal and intrapersonal distresses , and are greatly affected by emotional intimacy ( 2 ) . since addiction in the family could be the origin of many stressors and disputes , such stresses and interpersonal turmoil could have a decisive role in decreasing females sexual desire toward their addicted husbands . researchers have found that sexual response phases in women are a combination of mental and physical responses which overlap with one another ( 2 , 3 ) . in general , women have diverse reasons to initiate or agree to have sex with their partners . sexual motivation in females is far more complicated than just the presence or absence of sexual desire and is characterized by thinking or fantasizing about sex and longing to have sex . moreover , the decision to be sexual may originate from a conscious wish for emotional closeness or result from seduction or a suggestion from a partner . addicted couples often have conflicts over money and drugs ; so that love gradually flies out of the window , and most often these couples relationships end at a sad , bitter point ( 11 , 22 , 23 ) . hence , this kind of relationship is expected to have a negative impact on sexuality . of course , further studies are needed in order for better characterization and understanding of fsd epidemiology . one of the limitations of this study was the difficulty of gaining access to the case group sample and persuading them to cooperate with the researchers . in addition , when they agreed to take part in the study , the interviewer had to meet them out of their group . moreover , the subjects might have answered the questions conservatively due to the particular nature of the study subject , that is , sexual behavior , in iranian culture . another limitation of the study was a lack of control of other contributing factors , such as the economic status of the family and sexual disorders and duration of opioid dependency in addicted husbands , which are assumed to have an effect on their wives sexual dysfunctions ." ]

[ "laparoscopic surgery has gained widespread acceptance in a variety of procedures , ranging from gastric fundoplication to cholecystectomy . although laparoscopic appendectomy ( la ) is more expensive than is open appendectomy ( oa ) due to the costs of the disposable equipment , and can be more technically challenging in children , the overall cost of the operation has been shown to be similar to that of open appendectomy . the real cost savings of la are due to the shorter postoperative length of hospital stay ( los ) and the infrequent postoperative complications . the ultimate reduction in postoperative hospital costs to make la most cost - effective would be to perform the procedure as same - day surgery or so - called fast - track surgery . because it has been our observation that many children can be discharged within 24 hours after a laparoscopic appendectomy , we reviewed our records to determine its feasibility .", "a retrospective chart review was performed on 79 children who underwent a laparoscopic operation for the suspected diagnosis of acute appendicitis over a 3-year period between july 1997 and july 2000 . prior to the operation , if the diagnosis of acute appendicitis was unclear , the patients were evaluated with further laboratory and diagnostic testing , which included an abdominal computed tomography scan or ultrasound evaluation , or both of these , in select patients . laboratory information included white blood count and urinalysis , and depending on the circumstances , might also include a beta human chorionic gonadotropin and rapid streptococcal screen , as well as other tests as indicated . all patients underwent the operation while under general anesthesia , and all received a single dose of a broad - spectrum antibiotic preoperatively for wound infection prophylaxis . the standard laparoscopic operative technique was used , with either a 5-mm or 12-mm port introduced at the umbilicus after inducing pneumoperitoneum with carbon dioxide . a 0- or 30-degree laparoscopic telescope was then introduced through this port , and the abdominal and pelvic cavities were directly visualized with the laparoscope to inspect for other possible pathologies . next , two 5-mm ports were introduced under direct vision , one in the suprapubic region or the left lower quadrant and another in the right iliac fossa or in the right upper quadrant . the appendix was identified and grasped by its distal end to fully expose the entire organ and its attached structures . the appendiceal artery was isolated , ligated , and divided or cauterized . at that point , a staple line was fired across the base of the appendix by using an endoscopic stapler , or endoscopic loops were used to isolate the base of the appendix , and it was divided . if the appendix was particularly enlarged or friable , it was removed from the abdomen through the umbilical incision with the use of an endoscopic bag . all ports were removed under direct visualization , and the fascia was reapproximated to prevent future incisional hernia occurrences . if any evidence of localized or generalized peritonitis was visualized during the operation , patients were sent home on oral antibiotics , usually a 5-day course of amoxicillin plus clavulanate . if the appendix was perforated prior to removal , patients were placed on triple antibiotic coverage intravenously , which included ampicillin , gentamicin , and clindamycin for 5 days while in the hospital . if any evidence of abscess formation or peritoneal soilage was noted , the abdominal cavity was vigorously lavaged with normal saline . postoperative analgesia was obtained usually with ketorolac tromethamine and acetaminophen . to be discharged home , patients had to be tolerating oral liquids , be afebrile , and free of nausea and vomiting .", "seventy - nine children ( 44 boys and 35 girls ) between 2 to 17 years of age ( mean , 11 years ) underwent la . in 4 ( 5% ) children , all with perforated appendicitis , the la was converted to an open appendectomy , secondary to technical difficulties in completing the operation laparoscopically . at operation , 51 ( 64.5% ) had acute appendicitis , 22 ( 27.8% ) had perforated appendicitis , 4 ( 5% ) had ruptured ovarian cysts , and 2 ( 2.5% ) had no obvious pathology . total los for all 79 patients was a median of 58 hours , and median postoperative los was 35 hours . complications included wound infection , 2 ( 2.5% ) ; abdominal abscess , 4 ( 5% ) ; drug rash , 2 ; and epididymoorchitis , 1 . all but one complication ( drug rash , 1 ) occurred in the perforated group . in the 57 ( 72% ) children without perforated appendicitis , the total los was a median of 42 hours , while median postoperative los was only 28 hours . thirty - two ( 56% ) of the children without perforated appendicitis went home in 24 hours following la . no significant morbidity occurred in the nonperforated group ( drug rash , 1 ; fever > 24 hrs , 3 ) ; and no readmissions or reoperations were necessary on follow - up .", "although most appendectomies , especially in children , are not done laparoscopically , many studies have shown that laparoscopic appendectomy ( la ) is at least as good as open appendectomy ( oa ) , with several benefits , including less postoperative pain and shorter lengths of stay ( los ) . the disadvantages of la , which include increased operative time and increased cost of equipment , are easily offset by the decreased postoperative recovery time and the apparent decreased incidence of postoperative complications . additionally , it has been suggested that with increasing operative experience the operative time required for la will decrease significantly . lastly , it has been suggested that even if patients are not discharged from the hospital soon enough after la to make a significant difference between the cost of la versus oa , la has a much shorter recovery time and returns patients to a productive lifestyle sooner , thus justifying la . although most children are not working , the care - givers or parents can return to work sooner , when their child goes back to school . adult series have documented a decreased incidence of postoperative complications and a decreased incidence of wound infection after la . , in our series , 2 patients had wound infection and 4 patients developed abscesses , which is a similar complication rate to that in other series . in all instances , these complications arose in the perforated group . although perforation was at first considered a contraindication for la , it has now been utilized successfully in the management of acute appendicitis as well as perforated appendicitis . it has been suggested that thorough lavage of the abdominal cavity after appendectomy can help to decrease the incidence of abscess formation , and this is a practice that we utilize and is facilitated by the use of laparoscopy . certainly , the laparoscopic approach facilitates the complete irrigation of the abdominal cavity and identification of all loculated collections . an additional benefit of laparoscopic surgery is that it leads to greater accuracy of diagnosis , especially in teenage female patients with suspected appendicitis . in cases such as obesity and mental retardation , the diagnosis of appendicitis laparoscopy can be used to delineate the source of abdominal pain when the diagnosis of appendicitis is suspected but not certain . in 4 of our patients with the presumed diagnosis of appendicitis , intraoperative visualization revealed normal appendices , and ruptured ovarian cysts were identified as the source of their pain . obviously , all four patients were female . others have also found an increased preponderance of unclear diagnoses in the female population . in our patients , the appendix was always removed at the time of operation , despite the fact that occasionally ( in 4 patients ) the gross appearance of the appendix was normal . in the past , it has been unclear whether it would be of any benefit to the patient to remove a healthy organ , but it has been argued that with advances in laparoscopy and its proven benefit , there is no justification for leaving a visually normal appendix in place . additionally , microscopic evidence of early appendicitis is occasionally seen . in our study , it was noted that 2 visually normal appendices were found to have microscopic evidence of appendicitis . outpatient surgery has been widely accepted in a variety of procedures , and many are done laparoscopically . the idea that an appendectomy can be done in the pediatric patient as outpatient surgery is not a new one . in 1993 , ramesh and gallard suggested early discharge after open appendectomy , even within 24 hours . in another study , velhote et al also found that most children could be sent home within 24 hours after appendectomy . in that study , the appendectomy was performed through a standard gridiron incision of 2 cm or less . brosseuk and bathe suggested laparoscopic appendectomy as outpatient surgery in 1999 , and they advocated early discharge in both perforated and simple appendicitis . the fact that all major complications in our study occurred in perforated cases would argue against these cases being performed as same - day surgery , although others have disputed this approach . in our treatment protocol , perforated appendicitis would not be placed on a fast - track surgery list because these patients usually receive inpatient intravenous antibiotic therapy for 72 hours . we suggest that laparoscopic appendectomy is a safe and effective treatment in the pediatric population , and that in cases of nonperforated appendicitis this may be performed as a fast - track or short - stay procedure . we believe that this not only is more convenient for patients and their families , but it also adds to the overall cost - effectiveness of laparoscopic appendectomy . our findings are based on a retrospective review of our charts over the past 3 years , and this is an obvious criticism of the study . in no instance was it prospectively decided that the child would be discharged within 24 hours . in fact , a small number of children met exclusion criteria due to delays in discharge not related to their medical condition . we made our best attempt to identify when the order was given for the child to be released rather than the actual time that the child left the hospital . however , the documentation was occasionally unclear , and these children were excluded if it could not be ascertained exactly when the order was given or when they left the hospital . we believe that in cases of simple appendicitis , there is no reason not to dismiss a child within 24 hours if the above - mentioned discharge criteria are met . we anticipate that in the future , a greater percentage of our pediatric patients will be discharged within 24 hours , and we feel that in cases of simple appendicitis , laparoscopic appendectomy can be done as fast - track or short - stay surgery .", "it may be safely performed as fast - track or same - day surgery , in select children without perforated appendicitis , with a postoperative stay of 24 hours in the majority of such patients ." ]

[ "a major effort in the nucleocytoplasmic transport field has been directed towards the analysis of all members of the importin family , in particular with the aim of identifying specific transport cargoes . this has led to the characterization of a large number of related proteins ( both importins and exportins ) in all eukaryotic species analyzed . new members have primarily been identified by sequence homology or biochemically via their interaction with the small gtpase ran . strikingly , the roles of many of these receptors is conserved from yeast to humans . there are 14 putative members of the importin family in the completed saccharomyces cerevisiae genome , nine of which have been shown to function as importins and four as exportins . the genes encoding yeast transport receptors are dispersed throughout the genome and none of them contains introns . little is known about the gross structure of the genes encoding these nuclear transport receptors , and our knowledge of the chromosomal localization or the organization of the individual genes encoding members of this family is very poor .", "the relative molecular masses of members of importin--like proteins vary between 90 kda and 130 kda , but all are characterized by an acidic isoelectric point . the overall sequence similarity between various transport receptors is low ( less than 20% amino acid identity ) and , in many cases , is restricted to the amino - terminal domain . work mainly on importin has demonstrated that these receptors bind rangtp via the amino - terminal domain and cargo via the carboxy - terminal domain . to permit shuttling through the nuclear pore complex ( npc ) , transport receptors also contain one or multiple binding domains for components of the npcs , called nucleoporins . truncation studies using importin indicate that the binding site for nucleoporins containing fxfg repeats ( in the single - letter amino acid code , where x is , in many cases , a small polar residue or glycine ) is located in an amino - terminal / central region of importin ( residues 152 - 352 ) . this was recently confirmed in the crystal structure of an amino - terminal fragment of importin in a complex with five fxfg nucleoporin repeats . additional information comes from the crystal structures of importin and of transportin 1 ( also known as karyopherin 2 ) , which were solved either in a complex with rangtp , with a cargo , or in the free form . overall , the structures of importin--like receptors are characterized by a very similar series of helical heat repeats ( 19 in importin and 18 in transportin 1 ; figure 1 ) . heat repeats are approximately 40 residues in length and are found in many eukaryotic proteins such as the pr65/a subunit of protein phosphatase 2a . the fundamental repeat unit is a right - handed superhelical structure consisting of a hairpin made up of two helices , named a and b , separated by a sharp turn . each hairpin is connected to the next by a linker region . in transportin 1 , almost all linkers contain a third helix , but there are very few linker helices in importin . in both receptors , one turn is extended into a long acidic loop , which has been suggested to be important for rangtp - mediated cargo release . full - length importin complexed with the importin--binding domain of importin ( ibb ) forms a snail - like superhelical structure wrapping tightly around the ibb domain . the structure of the uncomplexed amino terminus of importin reveals a different superhelical architecture with a much steeper helical pitch than the cargo - bound or rangtp - bound forms . this suggests that importin undergoes twisted conformational changes in its heat - repeat helix stacking , which could be essential for the regulation of cargo binding and release and/or for protein interactions during the translocation through the npc . although the sequence homology is limited , it is expected that exportins will fold in a similar way to the reported importin structures . it still remains unclear , however , why rangtp is required for binding of cargo to exportins but causes cargo dissociation from importins . structure of importin . ( a ) importin is composed of 19 helical - repeat motifs ( heat repeats ) . each consists of an a and a b helix connected by a short turn , which in heat-8 is replaced by an acidic loop critical for the regulation of substrate binding and release . the heat repeats 1 - 8 are required for high - affinity binding to rangtp . the importin--binding ( ibb ) domain of importin interacts mainly with residues located in repeats 7 - 19 of importin . the binding site for nucleoporins of the npc is located between residues 152 and 352 , corresponding to repeats 4 - 8 . on the basis of the crystal structure , the a helices of heat repeats 5 and 6 and a region between heat repeats 6 and 7 are thought to be critical for recognition of the fxfg motif . ( b ) structure of importin bound to the ibb domain of importin ( adapted from ) . importin ( yellow ) forms a superhelical structure that wraps like a snail around the ibb domain ( blue ) . the 19 heat repeats share a common core of 21 residues , comprising the a helix with about three turns and the b helix with about four turns . the helices critical for the interaction with fxfg - repeat nucleoporins are in green . note the acidic loop , which contacts both rangtp and the ibb domain ( white arrow ) .", "a major function of transport factors of the importin family is to mediate the transport between the nucleus and cytoplasm of macromolecules that contain nuclear import or export signals . to this end , , they can be found in the nucleus , at the npc or in the cytoplasm . at present , very little is known about the tissue distribution of this family of proteins . all members have the ability to recognize and bind specific cargoes , either directly or via adaptor molecules , to bind rangtp and to interact with nucleoporins at the npc . interactions between the proteins of the importin family and nucleoporin repeats have been shown both in vitro and in vivo . these interactions contribute to the import or export of importin family members and their cargoes through the central transporter of the npc . import and export are multistep processes that are initiated by the recognition of nuclear localization signals ( nlss ) and nuclear export signals ( ness ) . the most thoroughly studied import signals are the ' classical ' and the bipartite nlss , first identified in sv40 large t antigen and nucleoplasmin , respectively . their transport is mediated by importin , the first - characterized member of this protein family . additional importin--dependent adaptors in vertebrates include snurportin 1 ( involved in import of m3g - capped small nuclear ribonucleoproteins , snrnps ) and xrip , ( involved in the import of replication protein a , rpa ) . importin can also form a complex with another importin--like factor , importin 7 , in order to transport the linker histone h1 into the nucleus . in addition , importin is able to interact directly with a large variety of different cargoes , including the t - cell protein tyrosine phosphatase , the human immunodeficency virus ( hiv ) tat and rev proteins , human t - cell leukemia virus rex protein , ribosomal proteins l23a , s7 , and l5 , cyclin b1 , smad and the parathyroid - hormone - related protein . table 1 details known importins , exportins and their cargoes and adaptors . proteins in the importin--like family and their cargoes abbreviations : h.s . , homo sapiens ; s.c . , saccharomyces cerevisiae ; x.l . , xenopus laevis . genbank accession numbers are given in square brackets for each protein , and alternative names are in parenthesis . the import of ribosomal proteins seems to rely on at least partially redundant mechanisms . in yeast , / yrb4p has been shown to be an important mediator of ribosomal - protein import , but the related protein kap121p / pse1p can functionally substitute for kap123p in vivo . in mammalian cells , at least four importin--like transport factors are able to mediate import of ribosomal proteins . interestingly , both the -like importin receptor binding ( bib ) domain and some ribosomal proteins can be imported by any of the four receptors importin , transportin 1 , importin 5 or importin 7 . the yeast importin kap104p mediates nuclear import of the mrna - binding proteins nab2p and nab4p . its vertebrate homolog , transportin 1 ( kap2 ) , also mediates import of the rna - binding proteins hnrnp a1 and hnrnp f , but also of ribosomal proteins . mammalian transportin - sr mediates nuclear import of a group of abundant arginine / serine - rich proteins , which are essential pre - mrna splicing factors . in yeast , the tata - binding protein ( tbp ) is imported into the nucleus by kap114p . exportin 1 ( crm1p , xpo1p ) has been identified in both yeast and higher eukaryotes as an export receptor for leucine - rich nes - containing proteins . human exportin 1 has been found to export protein kinase inhibitor ( pki ) and hiv rev , ib , snurportin 1 , htlv rex , the small nuclear rna , cyclin b1 and the transcription factor nf - at4 . targets for exportin in s. cerevisiae include the transcription factors yap1p , and ace2p , the mitogen - activated protein kinase hog1p , and the heat - shock protein ssb1p . msn5p was first identified as a yeast exportin that exports the phosphorylated form of the transcription factor pho4p . interestingly , msn5p was recently shown to function as an import receptor for the trimeric rpa , suggesting that individual members of the importin--like protein family can function both as import and export receptors . the first cellular rna export receptor to be discovered , named exportin - t in higher eukaryotes or los1p in yeast , mediates nuclear export of trnas . many of the nuclear transport factors identified in s. cerevisiae are not essential for viability , even though they transport essential cargoes . this phenomenon can be explained by the fact that cargoes can use alternative transport pathways . this is probably best exemplified in the import pathway of ribosomal proteins , which is mediated by at least four different import receptors ( see above ) . nuclear transport mediated by importins and exportins is strongly directional in vivo : importins bind their cargo in the cytoplasm and transfer it to the nucleus , whereas exportins interact with their substrates in the nucleus and mediate their export to the cytoplasm ( figure 2 ) . protein translocation through the npc is thought to occur by an essentially similar mechanism for all importin--related receptors , except for the fact that , in some situations , additional adaptors are required to bridge the cargo - receptor interaction . this is mediated by importin together with its adaptor importin , which binds both the nls - containing cargo and importin in the cytoplasm . after a trimeric importin -importin -nls complex is formed , importin mediates docking at the npc . in the presence of rangdp and free gtp , this trimeric complex translocates through the npc . translocation is terminated by binding of rangtp to importin , which releases the complex from the npc and dissociates importin from importin ( reviewed in ) . free importin has a lower affinity for the nls cargo , and release from importin is therefore believed to trigger release of the nls cargo as well . thereafter , the importin -rangtp complex , and importin bound to its exportin ( cas ) and rangtp , are re - exported to the cytoplasm for another round of import . a schematic representation of nuclear import and export cycles through the npc . the cargo - loaded importin translocates through the npc into the nucleus , where the cargo is dissociated from the importin by binding of importin to rangtp . the importin - rangtp complex recycles back to the cytoplasm , where rangtp hydrolysis is stimulated by rangap and ranbp1 ; this frees the importin for the next round of import . exportins bind their export substrates in the nucleus , forming a trimeric cargo - exportin - rangtp complex . this complex is exported from the nucleus and dissociated in the cytoplasm by hydrolysis of rangtp to rangdp and inorganic phosphate ( pi ) . this releases the export substrate , and the exportin is recycled back into the nucleus . for details , see text . transport in the reverse direction , mediated by exportins , is regulated in a converse manner ( figure 2 ) . a paradigm for transport out of the nucleus is the export of leucine - rich nes - containing proteins . exportin 1 binds to substrates containing a leucine - rich nes in the nucleus , forming a trimeric complex with rangtp . this complex is then transferred to the cytoplasm by a mechanism involving binding of exportin 1 to the npc . once in the cytoplasm , gtp hydrolysis results in dissociation of ran from the complex , allowing exportin 1 to release its cargo . free exportin 1 re - enters the nucleus to bind and export additional cargo molecules . as illustrated in these examples , the rangtp cycle plays a key role in conferring directionality to nucleocytoplasmic transport events and rangtp acts as a marker of the nuclear compartment for both nuclear import and export ( figure 2 ; reviewed in ) . remarkably , this model predicts that only a single molecule of gtp is hydrolyzed per import / export cycle ; it strictly requires that rangtp is highly enriched in the nucleus . it is thought that a steep rangtp - rangdp gradient is generated by the cellular compartmentalization of regulators of the ran cycle . specifically , the guanine - nucleotide exchange factor of ran ( rangef or rcc1 ) , which regenerates rangtp is nuclear and bound to chromatin . in contrast , the main gtpase - activating protein ( rangap ) , and the ran - binding proteins , ranbp1 and ranbp2 , which stimulate gtp hydrolysis by ran , are found in the cytoplasm . this asymmetric distribution predicts that ran is present mainly in the gtp - bound form in the nucleus , whereas ran is immediately converted to a gdp - bound state in the cytoplasm . recently , it was suggested that in addition to the ran cycle , the npc itself could provide an additional mechanism to ensure transport directionality . given that several nucleoporins implicated in binding to importins and exportins have distinctive locations in the structure of the npc , the asymmetric design of the npc may also be important to efficiently drive nuclear import and export .", "nuclear transport mediated by importins and exportins is strongly directional in vivo : importins bind their cargo in the cytoplasm and transfer it to the nucleus , whereas exportins interact with their substrates in the nucleus and mediate their export to the cytoplasm ( figure 2 ) . protein translocation through the npc is thought to occur by an essentially similar mechanism for all importin--related receptors , except for the fact that , in some situations , additional adaptors are required to bridge the cargo - receptor interaction . this is mediated by importin together with its adaptor importin , which binds both the nls - containing cargo and importin in the cytoplasm . after a trimeric importin -importin -nls complex is formed , importin mediates docking at the npc . in the presence of rangdp and free gtp , translocation is terminated by binding of rangtp to importin , which releases the complex from the npc and dissociates importin from importin ( reviewed in ) . free importin has a lower affinity for the nls cargo , and release from importin is therefore believed to trigger release of the nls cargo as well . thereafter , the importin -rangtp complex , and importin bound to its exportin ( cas ) and rangtp , are re - exported to the cytoplasm for another round of import . a schematic representation of nuclear import and export cycles through the npc . the cargo - loaded importin translocates through the npc into the nucleus , where the cargo is dissociated from the importin by binding of importin to rangtp . the importin - rangtp complex recycles back to the cytoplasm , where rangtp hydrolysis is stimulated by rangap and ranbp1 ; this frees the importin for the next round of import . exportins bind their export substrates in the nucleus , forming a trimeric cargo - exportin - rangtp complex . this complex is exported from the nucleus and dissociated in the cytoplasm by hydrolysis of rangtp to rangdp and inorganic phosphate ( pi ) . this releases the export substrate , and the exportin is recycled back into the nucleus . for details , see text . transport in the reverse direction , mediated by exportins , is regulated in a converse manner ( figure 2 ) . a paradigm for transport out of the nucleus is the export of leucine - rich nes - containing proteins . exportin 1 binds to substrates containing a leucine - rich nes in the nucleus , forming a trimeric complex with rangtp . this complex is then transferred to the cytoplasm by a mechanism involving binding of exportin 1 to the npc . once in the cytoplasm , gtp hydrolysis results in dissociation of ran from the complex , allowing exportin 1 to release its cargo . free exportin 1 re - enters the nucleus to bind and export additional cargo molecules . as illustrated in these examples , the rangtp cycle plays a key role in conferring directionality to nucleocytoplasmic transport events and rangtp acts as a marker of the nuclear compartment for both nuclear import and export ( figure 2 ; reviewed in ) . remarkably , this model predicts that only a single molecule of gtp is hydrolyzed per import / export cycle ; it strictly requires that rangtp is highly enriched in the nucleus . it is thought that a steep rangtp - rangdp gradient is generated by the cellular compartmentalization of regulators of the ran cycle . specifically , the guanine - nucleotide exchange factor of ran ( rangef or rcc1 ) , which regenerates rangtp is nuclear and bound to chromatin . in contrast , the main gtpase - activating protein ( rangap ) , and the ran - binding proteins , ranbp1 and ranbp2 , which stimulate gtp hydrolysis by ran , are found in the cytoplasm . this asymmetric distribution predicts that ran is present mainly in the gtp - bound form in the nucleus , whereas ran is immediately converted to a gdp - bound state in the cytoplasm . recently , it was suggested that in addition to the ran cycle , the npc itself could provide an additional mechanism to ensure transport directionality . given that several nucleoporins implicated in binding to importins and exportins have distinctive locations in the structure of the npc , the asymmetric design of the npc may also be important to efficiently drive nuclear import and export .", "despite the large amount of progress that has been made in the nucleocytoplasmic transport field in recent years , many important questions remain unsolved . many import and export receptors have now been characterized and their first cargoes have been identified . the further characterization of new transport receptors and adaptors , and the identification of new import and export substrates , will lead to a more complete picture of nucleocytoplasmic transport . a big challenge for the future will be to understand how translocation through the npc occurs , and how nucleocytoplasmic transport is regulated . to gain insight into these questions , a quantitative analysis of interactions between transport receptors and nucleoporins will be required . it will be also interesting to see whether an increasing affinity gradient of receptors for nucleoporins along the npc exists and , if so , whether it makes an important contribution towards the direction of transport . other issues that remain to be solved include the structural differences between members of the importin and exportin family . how does rangtp dissociate import complexes in the nucleus but promote binding of export cargoes to exportins ? a key mechanistic topic that is poorly understood is the export of rnas and rnps . although a trna - export factor has been identified , the mechanism of rrna or mrna export is still poorly understood . several proteins in s. cerevisiae , such as mex67p and yra1p , and their metazoan counterparts tap and aly , have been indicated to play an important role in mrna export . mex67p / tap does not belong to the family of importin--like proteins , suggesting that there are alternative translocation pathways through the npc ." ]

[ "musculoskeletal conditions , or disorders of the muscles and bones , are the most common causes of chronic disability in the world . in the us alone , disease of the musculoskeletal system was the primary diagnosis during 83,228,000 office visits in 2009 ( 8.0% of total visits ) . a stroke can also cause many of the same physical deficiencies seen in musculoskeletal conditions . approximately 2.6% of all americans over the age of 20 have had a stroke , and each year 795,000 more people suffer a stroke ( 1 every 40 seconds ) . the most common non - medication treatment for musculoskeletal conditions and stroke is rehabilitation . for patients , rehabilitation is a tedious chore that involves many months of treatment , resulting in low compliance . rehabilitation regimens combine home - based exercises with therapist - monitored sessions ; during the latter , the therapist assesses the patient 's capabilities and adjusts the exercise tasks accordingly . previous research on upper body rehabilitation has shown that positive functional outcomes are achieved from programs that emphasize task - oriented , repetitive training exercises combined with biofeedback , . thus , virtual reality ( vr ) rehabilitation systems have been developed that can repetitively simulate these task - oriented training exercises , . vr rehabilitation has been shown to be successful for improving upper body function in stroke patients , most likely because the interesting and engaging virtual tasks encourage increased repetition . some vr rehabilitation programs have also been designed to be used without the supervision of a physiotherapist . however a previous study demonstrated that subjects trained with an adaptive vr rehabilitation system had improved upper body functionality when compared to subjects trained with conventional rehabilitation . robotic rehabilitation systems , designed to address the limitations of traditional physiotherapy , have been developed primarily for upper extremity rehabilitation of stroke patients . these robots generally consist of an arm attachment with multiple actuated degrees of freedom that is affixed to the patient and guides them through different exercise tasks through the use of an immersive visual environment . studies have shown that patients achieved significant motor recovery and improved upper extremity functionality after participating in robotic rehabilitation . some shortcomings of the current rehabilitation robots are their limited availability and portability , and their high cost ( $ 50,000 usd ) ; as a result , few patients can benefit from robotic rehabilitation . pneumatic actuators have previously been used in upper body robotic rehabilitation systems because they are lightweight , strong , and mechanically compliant to human anatomy . in terms of control strategies , impedance control and admittance control have been used to ensure the safety of the subjects while they interact with the robot . in these control laws , the controller uses both the position of the robot 's joints and the force produced by the actuators in order to limit the amount of force applied to the subject . in terms of efficacy , previous research has suggested that pneumatically actuated rehabilitation robots can be used by patients with movement disabilities or stroke to improve their motor function . the primary drawbacks of pneumatic actuators are that they are difficult to control due to non - linear behavior during actuation , and that they require an external supply of compressed air . the overall objective of this research was to create an adaptive home - use robotic rehabilitation system for the upper body . the specific goals for the system were to collect data from the subject in real - time using simple and portable sensors , to create a customized exercise task for the subject by adapting a standard exercise task , and to build a simple and non - rigid wearable robot that will provide subject - specific resistance training . this paper presents results from comparison testing between the customized exercise tasks and the standard exercise tasks , as well as preliminary testing of a pneumatically actuated prototype for the wearable robot .", "a microsoft \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ { \\rm kinect}^{\\rm tm}$ \n \\end{document } sensor and an electromyograph ( emg ) system were combined with custom software written in c++ in order to collect data from the subject in real time . data was obtained from the microsoft \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ { \\rm kinect}^{\\rm tm}$ \n \\end{document } using official microsoft software ( \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ { \\rm kinect}^{\\rm tm}$ \n \\end{document } sdk version 1.6 , microsoft , redmond , wa , usa ) . the 3d joint position data ( mediolateral , anteroposterior , and vertical axes ) for 20 joints per subject was acquired at the \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ { \\rm kinect}^{\\rm tm}$ \n \\end{document } native sampling frequency of 30 hz . the data was subsequently smoothed using the \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ { \\rm kinect}^{\\rm tm}$ \n \\end{document } smoothing algorithm and adjusted based on the height and angle of the \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ { \\rm kinect}^{\\rm tm}$ \n \\end{document } sensor . simultaneously , a wireless surface emg system ( cometa , milan , italy ) was used to collect electrical signals at 1000 hz from two electrodes , one on the subject 's biceps muscle and one on the lateral head of the subject 's triceps muscle . the emg signals ' linear envelopes were processed in real - time using a previously described method \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ ( { \\rm bandpass~filter}=10~{\\rm hz}\\hbox{--}500~{\\rm hz};~{\\rm lowpass~filter}=30~{\\rm hz})$ \n \\end{document } \n . the emg data were normalized to the subject 's maximum voluntary contraction ( % mvc ) . a 3d visual environment ( ve ) previously created using custom software in c++ and opengl was modified to display the data from the sensors as well as the exercise task ( see section iii ) . 1 , part a ) where the joint center data collected from the subject by the \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ { \\rm kinect}^{\\rm tm}$ \n \\end{document } was displayed as a skeleton figure . the subject navigated the ve by using leg gestures to indicate directional arrows that rotated and translated the environment . separate from the ve , an additional window displayed the color video data from the \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ { \\rm kinect}^{\\rm tm}$ \n \\end{document } as well as the real - time emg data ( fig . 1 , part b ) . this window was used to ensure that the subject remained positioned in front of the \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ { \\rm kinect}^{\\rm tm}$ \n \\end{document } sensor and that the emg sensors were functioning properly . \n 1.visual environment : a ) virtual room , b ) video and emg data . visual environment : a ) virtual room , b ) video and emg data . 1 ) and the subject used his right hand to follow the sphere as closely as possible as it moved around the ve in a repeating cyclical 2d pattern . the 2d pattern was projected in the 3d visual environment as perpendicular to the subject . from the subject 's view , the pattern was constrained to an orthogonal plane directly in front of his viewpoint . the distance to this plane was held constant . as the subject turned and moved within the environment , the pattern turned at the same rate and moved with the subject . in this way , the 2d pattern always appeared in front and perpendicular to the subject 's viewpoint . biofeedback was used to aid the subject 's accuracy ; the sphere changed color and the volume of music playing in the background increased as the subject 's hand approached the center of the sphere . for data , the 3d position of the sphere , the 3d position of the subject 's hand , and the subject 's biceps and triceps emg signals were recorded simultaneously during the exercise tasks . the protocol for creating the customized exercise tasks , described previously by barzilay and wolf , consisted of generating an inverse model of the subject , which was modeled by a neural network . the subject first completed 10 full cycles of a visual follow training exercise task , or approximately 3 minutes of training . the subject 's performance during this training exercise ( in terms of the 3d position of the hand , the 3d velocity of the hand , and the biceps and triceps emg signals ) for all 10 cycles was averaged together and smoothed to create one full cycle of the subject 's performance for each of the 8 measured variables . the averaged 3d position and 3d velocity ( 6 variables ) of the sphere during the training exercise task were used as targets to train the neural network . after the neural network was trained , it was used to simulate the subject 's individual performance during a standard exercise task . averaged emg data from 10 healthy subjects performing the standard exercise task were used as the additional inputs to the neural network . the wearable robot prototype consisted of the test platform , the pneumatics assembly ( and associated electronic components ) , and the control architecture . a test platform was built to model the human arm and elbow joint ; in this way , the basic prototype and the control algorithms for the wearable robot could be developed and validated in a safe environment without a risk of injury . the platform was designed to replicate the mass properties \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ ( { \\rm total~mass}=1.6~{\\rm kg})$ \n \\end{document } , inertial properties \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ ( { \\rm i}=0.1~{\\rm kg}{^{\\ast}}{\\rm m}^{2})$ \n \\end{document } , and dimensions of the human arm . the test platform consisted of two \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ 7\\times 7\\times 30~{\\rm cm}$ \n \\end{document } aluminum cages ( simulating the upper arm and forearm segments ) connected together by two ball bearing assemblies to simulate an elbow joint ( fig . the upper arm cage was bolted to a wooden base while the forearm cage was allowed to swing freely up to 45\\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ ^{\\circ}$ \n \\end{document } in either direction about the elbow joint . in future iterations , the primary requirements for the assembly were that the components be both non - rigid and highly compliant as the robot will eventually be worn on the subject 's arm . as such , mckibben - type pneumatic artificial muscles ( pams ) were chosen as the actuation components ; as an additional benefit , these actuators closely replicate the behavior of natural muscles . two festo dmsp-10 - 120 pams ( festo , denkendorf , germany ) were attached to the upper arm cage of the test platform to replicate the biceps and triceps muscles ( fig . the muscles were rigidly anchored to the base of the upper arm cage and then connected to the forearm cage at the elbow joint with non - elastic metal wire ( fig . , actuation of the upper arm cage was accomplished by transforming the force from the antagonistic pams into torque about the joint , as in the human arm . each pam was independently controlled by using two 2/2 normally closed festo mhj-10 pneumatic valves ( festo , denkendorf , germany ) , one for inlet and one for outlet . motorola mpx5700 pressure sensors ( motorola solutions , schaumburg , il , usa ) measured pressure in the pams and output an analog signal to the microcontroller . finally , an austriamicrosystems as5145 magnetic encoder ( ams ag , unterpremstatten , austria ) was used to determine the position of the elbow joint , and an arduino uno board ( sparkfun , boulder , ca , usa ) was used as the microcontroller for the entire prototype . in order to identify the robot 's passive dynamic properties , an impulse torque disturbance was applied to the joint and the angular position was recorded with respect to time . the system was modeled as a standard 2nd order linear system , with the following equation for the angular position:\\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ $ \\theta\\left(s\\right)=\\thinspace{{m_{in}(s)}\\over{is^{2}+2crs+2kr}}\\quad=\\quad{{^{\\textstyle m_{in}(s)}\\!\\bigl/\\!_{\\textstyle i}\\over{s^{2}+\\left(^{\\textstyle 2cr}\\!\\bigl/\\!_{\\textstyle i}\\right)s+{^{\\textstyle 2kr}\\!\\bigl/\\!_{\\textstyle i}}}}}\\eqno{\\hbox{(1)}}$$ \n \\end{document } where \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ c$ \n \\end{document } and \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ k$ \n \\end{document } are the damping and spring coefficients of the moveable parts of the robot prototype and \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ r$ \n \\end{document } is the distance from the center of the joint to the attachments of the non - elastic metal wire ( fig . 2 ) . the response in time to an impulse in the form of\\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ $ m_{in}\\left(t\\right)=t\\delta ( t)\\eqno{\\hbox{(2)}}$$ \n \\end{document } therefore leads to the following equation ( in the time domain via the inverse laplace transform):\\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ $ \\theta\\left(t\\right)=l^{-1}\\left\\{{{^{\\textstyle t}\\!\\bigl/\\!_{\\textstyle i}}\\over{s^{2}+\\left(^{\\textstyle 2cr}\\!\\bigl/\\!_{\\textstyle i}\\right)s+{^{\\textstyle 2kr}\\!\\bigl/\\!_{\\textstyle i}}}}\\right\\}\\!.\\eqno{\\hbox{(3)}}$$ \n \\end{document } \n \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ \\omega_{d}$ \n \\end{document } , \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ \\omega_{n}$ \n \\end{document } , and \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ \\zeta$ \n \\end{document } were defined as follows:\\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ $ \\eqalignno{\\omega_{n}^{2}=&\\,{^{\\textstyle \\rm 2kr}\\!\\bigl/\\!_{\\textstyle \\rm i}},\\quad{2\\zeta\\omega}_{n}^{2}={^{\\textstyle \\rm 2cr}\\!\\bigl/\\!{\\textstyle \\rm i}},\\;\\;{\\rm and}\\cr\\omega_{d}=&\\,\\omega_{n}\\sqrt{1-\\zeta^{2}}.&{\\hbox{(4)}}}$$ \n \\end{document } as such , the resultant response was \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ $ \\theta\\left(t\\right)=\\thinspace{{t}\\over{i\\omega_{d}}}{\\rm sin}(\\omega_{d}t)e^{-\\omega_{n}\\zeta t}\\!.\\eqno{\\hbox{(5)}}$$ \n \\end{document } the damping coefficient \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ \\zeta$ \n \\end{document } was assumed to be relatively small \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ ( \\zeta\\leq 0.1)$ \n \\end{document } and therefore the difference between \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ \\omega_{d}$ \n \\end{document } and \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ \\omega_{n}$ \n \\end{document } was neglected . the final approximated function was \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ $ \\theta\\left(t\\right)=\\thinspace a\\cdot{\\rm sin}(\\omega_{n}t)e^{-\\omega_{n}\\zeta t}.\\eqno{\\hbox{(6)}}$$ \n \\end{document } the control architecture for the robot was based on pressure control of the pams . the pams were controlled through pulse - width modulation ( pwm ) of the pressure valves . a simplified dynamic equation for the robot was used for analysis due to the complexity of modeling the highly non - linear behavior of the pams . the dynamic equation used for the control architecture was \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ $ i{\\mathddot{\\theta}}=\\tau_{dist}+\\thinspace\\tau_{cont},\\eqno{\\hbox{(7)}}$$ \n \\end{document } where \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ \\tau_{dist}$ \n \\end{document } is the disturbance torque due to dampening , friction , gravity , spring constant , and so on , and \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ \\tau_{cont}$ \n \\end{document } is the control torque applied by the pams and controlled using the sensors , microprocessor , and valves . the control torque applied by the pams was modeled as \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ $ \\tau_{control}=\\left(f_{left}-f_{right}\\right)\\cdot r\\eqno{\\hbox{(8)}}$$ \n \\end{document } and a simple proportional loop was implemented ( fig . the pwm parameters that determined the duty cycle for the valves were chosen so as not to exceed the limits of the valves , which had a minimum switching time of 1 msec ( 1000 hz ) . a 16 msec ( 60 hz ) pwm period ( divided into 10% duty cycles ) and a 600 hz switching frequency were selected , which resulted in a minimum switching time of 1.6 msec for each 10% duty cycle . in terms of the control rule for the pams , when the pressure error was positive \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ ( { \\rm reference}>{\\rm measured})$ \n \\end{document } , the inlet valve duty cycle was determined as:\\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ $ duty\\thinspace cycle = k_{pressure}\\cdot\\delta pressure\\eqno{\\hbox{(9)}}$$ \n \\end{document } and the outlet duty cycle remained closed ( 0% ) . two different experiments were performed for the assessment of the subject data collection and visual environment . the first experiment focused on the accuracy of the \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ { \\rm kinect}^{\\rm tm}$ \n \\end{document } sensor , while the second experiment focused on a comparison of the customized exercise task . 10 young , healthy subjects \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ ( { \\rm age}\\!:27.1~{\\rm years}\\pm{2.9},~{\\rm height}\\!:128.6~{\\rm cm}\\pm{7.9},~{\\rm male}={6})$ \n \\end{document } with no history of upper body impairment volunteered to participate in this study . the subjects wore minimal clothing on their upper bodies to allow for placement of 25 reflective markers on their torsos and arms . each subject completed three trials of two different upper body exercises : 1 ) a range - of - motion ( rom ) exercise where the subject slowly raised both of his arms , elbow joints extended , from the sides of his torso to 45\\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ ^{\\circ}$ \n \\end{document } above the transverse plane and back down , three repetitions per trial , and 2 ) a visual follow task , where the subject used his right hand to follow a moving sphere flying in a 3d figure 8 pattern in the ve for a total of 45 seconds . data was collected during these exercise tasks using both the robotic rehabilitation system and a 10 camera opto - electronic vicon mx motion capture system ( vicon , oxford , uk ) as a gold - standard for validation . for the robotic rehabilitation system , 3d joint center data was recorded for the wrist , elbow , and shoulder joints of the right arm using the \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ { \\rm kinect}^{\\rm tm}$ \n \\end{document } sdk version 1.5 and custom c++ software . additionally , a synchronization signal was sent from the robotic rehabilitation system to indicate to the vicon system when data were being collected . for the vicon system , the reflective markers were placed on the subjects according to the vicon upper body model marker set . vicon nexus software ( version 1.8.2 ) was used to record the position of the markers during the exercise tasks as well as the synchronization signal . the data was post - processing in vicon nexus to obtain the joint center locations of the right wrist , elbow , and gleno - humeral ( shoulder ) joint . analysis of the data was completed in matlab r2012a ( mathworks , natick , ma , usa ) . a homogenous transformation was used to align the coordinate systems of the \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ { \\rm kinect}^{\\rm tm}$ \n \\end{document } and vicon measurement systems . to find the best parameters for the homogenous transformation , a minimum cost maximal matching optimization was used ( cost function : average distance between a small , randomized set of paired points from each system ) . the data was then resampled to a common frame rate of 120 hz , and the synchronized subset of the data extracted . the pearson 's correlation ( r ) coefficient and the root - mean - square error ( rmse ) were calculated between the resampled and synchronized vicon and \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ { \\rm kinect}^{\\rm tm}$ \n \\end{document } data for each trial . twelve young , healthy subjects \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ ( { \\rm age}\\!:29.8~{\\rm years}\\pm{4.2},~{\\rm height}\\!:169.0~{\\rm cm}\\pm 9.3,~{\\rm male}={5})$ \n \\end{document } with no history of upper body impairment volunteered to participate in this study . the subjects wore close - fitting short sleeve shirts to allow for the placement of the two emg electrodes on their biceps and triceps . each subject was first asked to complete 10 full cycles of one of two different training exercise tasks , either a vertical double figure 8 pattern ( fig . 4 , part a ) or a vertical half figure 8 pattern ( fig . 4 , part b ) . after the neural network was trained , a related exercise task , consisting of either a full horizontal figure 8 pattern ( fig . 4 , part a ) or half of a horizontal double figure 8 pattern ( fig . 4 , part b ) , was given to the neural network as input data ( combined with the healthy emg data for that particular task ) , and a customized exercise task was output from the neural network . the subject then completed 10 full cycles of this customized output exercise task ( custom ) , as well as 10 full cycles of the unmodified original task used as input to the neural network ( standard ) ( fig . 4 ) . a full exercise set consisted of the three linked exercise tasks ( training , custom , standard ) , and each subject completed 4 full sets ( two of each type of set ) , for a total of 12 exercise tasks per subject . \n fig . analysis of the data was completed in matlab r2012a ( mathworks , natick , ma , usa ) . for the custom and standard exercise tasks , the root - mean - square error ( rmse ) was calculated between the subject 's hand and the sphere for both position and velocity . for the emg signals , the peak value and the area under the linear envelope were calculated . finally , the data from the subjects were merged , and paired \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ t$ \n \\end{document}-tests ( two - tailed , \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ \\alpha=0.05 $ \n \\end{document } ) were conducted between the standard exercise data and the corresponding custom exercise data in the set for the aforementioned variables . for the system identification , the final approximated function ( 6 ) was tested experimentally by applying an external impulse torque disturbance to the robot and then recording the measurements from the encoder in the elbow joint ; this test measured the passive properties of the robot because the valves were sealed after the initial impulse . the experiment was conducted five separate times , and the approximations for \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ \\zeta$ \n \\end{document } , \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ \\omega_{n}$ \n \\end{document } , and \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ a$ \n \\end{document } were determined using the nlinfit function in matlab . to test the pressure control algorithm , continuous sine wave pressure reference input signals were sent to the robot prototype at 60 hz . sine wave frequencies of 0.25 hz , 0.5 hz , 0.75 hz , and 1 hz were tested ( \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ { \\rm gain}=0.10 $ \n \\end{document } for all tests ) . during the tests , after the trials , the rmse and pearson 's correlation coefficient ( r ) were calculated between the reference pressure and the measured pressure . as a comparison to the passive system identification testing , an external impulse torque disturbance was applied to the robot when the control algorithm was active , and the measurements from the encoder in the elbow joint were subsequently recorded . this test measured the closed - loop properties of the robot because control algorithm was active and the valves were open after the initial impulse . the experiment was conducted 15 separate times , and the approximations for \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ \\zeta$ \n \\end{document } , \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ \\omega_{n}$ \n \\end{document } , and \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ a$ \n \\end{document } were again determined using the nlinfit function in matlab . , a subject moved his right arm from full extension to full flexion at different speeds . the angle of the subject 's right elbow was continuously updated in real - time based on the 3d position of the subject 's shoulder , elbow , and wrist joints . this angle was then converted into a voltage signal ( between 0 and 5 volts ) that corresponded to the relative angle of the elbow ( between a minimum of 35\\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ ^{\\circ}$ \n \\end{document } when the hand touched the shoulder , to a maximum of 175\\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ ^{\\circ}$ \n \\end{document } when the elbow was fully extended ) . any angle measured beyond these limits was considered either 0 or 5 volts , depending on which limit was exceeded . a national instruments usb-6218 ( bnc ) data acquisition device ( national instruments corporation , austin , tx , usa ) was connected to the rehabilitation system , and the elbow angle voltage was sent as an output analog signal from this device . this signal was then connected to the analog input of the arduino uno to provide a real - time position reference signal for the robot prototype based on the subject 's elbow angle . this position signal was then converted into two corresponding pressure reference input signals for the pams , where 0 volts corresponded to the minimum \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ ( { -}45^{\\circ})$ \n \\end{document } and 5 volts corresponded to the maximum \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ ( { + } { 45}^{\\circ})$ \n \\end{document } allowable angle of the robot from the neutral position ( 0\\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ ^{\\circ}$ \n \\end{document } ) . in this way , the subject could actuate the robot by changing the angle of his elbow . five 30-second duration tests were conducted . during the tests , the real - time angle of the subject 's elbow ( measured by the \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ { \\rm kinect}^{\\rm tm}$ \n \\end{document } ) and the real - time angle of the robotic elbow joint ( measured by the encoder ) were simultaneously recorded . after the tests , the angle data were resampled and independently normalized on a scale of 0 to 1 . finally , the rmse and pearson 's correlation coefficient ( r ) were calculated between the normalized angle of the subject 's elbow and the normalized angle of the robotic elbow joint .", "the results from the validation testing between the \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ { \\rm kinect}^{\\rm tm}$ \n \\end{document } data and the vicon data are presented for all trials of the 10 subjects for the right arm joints ( wrist , elbow , and shoulder ) by exercise task in table i. for the rom task , the largest rmse was observed for the shoulder joint . for the visual follow task , the largest rmse was observed for the elbow joint , then the wrist joint , and last the shoulder joint . furthermore , the rmse for the elbow and shoulder joints was greater during the visual follow task when compared to the rom task , while the rmse for the shoulder joint was greater during the rom task . \n table ivicon - kinect comparisons by joint and task vicon - kinect comparisons by joint and task a comparison of the standard and custom exercise tasks by exercise set is presented in table ii . the subjects had greater rmse for the position and the velocity variables during the custom tasks ( as compared to the standard tasks ) for both sets . \n table iikinematic and emg variables by set kinematic and emg variables by set the results from the external impulse response tests of the robot prototype are presented in table iii for \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ \\zeta$ \n \\end{document } , \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ \\omega_{n}$ \n \\end{document } , and \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ a$ \n \\end{document } , derived from the final approximated function ( 6 ) . the joint angle measured by the encoder was then compared to the predicted joint angle , which was calculated by using function ( 6 ) and the experimentally - determined function parameters . \n table iiiimpulse response the average values for the five passive properties tests were \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ \\zeta=0.064 $ \n \\end{document } and \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ \\omega_{n}=15.01~{\\rm rad}/{\\rm sec}$ \n \\end{document}. compared to the predicted joint angle , the average rmse was 0.23\\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ ^{\\circ}$ \n \\end{document } with a high correlation \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ ( { \\rm r}=0.99)$ \n \\end{document}. the average values for the fifteen active properties tests were \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ \\zeta=0.13 $ \n \\end{document } and \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ \\omega_{n}=14.84~{\\rm rad}/{\\rm sec}$ \n \\end{document}. compared to the predicted joint angle , the average rmse was 0.90\\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ ^{\\circ}$ \n \\end{document } with a high correlation \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ ( { \\rm r}=0.97)$ \n \\end{document}. the results from the pressure control algorithm tests are presented in table iv , figs . 5 and 6 . \n 5.reference vs. measured pressure in the pams by frequency for sine wave input signals . \n fig . table ivref - meas comparisons by frequency and pam reference vs. measured pressure in the pams by frequency for sine wave input signals . ref - meas comparisons by frequency and pam the continuous joint angles during the pressure control algorithm tests are shown in fig . for the 0.25 hz and 0.5 hz continuous sine wave pressure reference input signals , the measured pressure accurately followed the reference pressure for both pams \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ ( { \\rm r}=0.99,~{\\rm average~rmse}=0.093~{\\rm bar})$ \n \\end{document}. however , for the 0.75 hz and 1 hz input signals , the measured pressure did not follow the reference pressure during pressurization when the reference pressure was greater than 2.5 bars , indicating saturation of the pams . the range for the joint angles was 38.8\\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ ^{\\circ}$ \n \\end{document } at 0.25 hz , 39.0\\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ ^{\\circ}$ \n \\end{document } at 0.5 hz , 51.9\\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ ^{\\circ}$ \n \\end{document } at 0.75 hz , and 53.6\\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ ^{\\circ}$ \n \\end{document } at 1 hz . the wearable robot prototype was able to accurately mimic the angle of the subject 's elbow in real - time . the rmse between the normalized position of the subject 's elbow and the normalized position of the robot elbow ranged from 0.073 to 0.103 ( average 0.088 ) , and the correlation ranged from 0.94 to 0.97 ( average 0.96 , \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ { \\rm p}<0.001 $ \n \\end{document } ) .", "the overall objective of this research was to create an adaptive home - use robotic rehabilitation system for the upper body . this paper presented results from comparison testing between different exercise tasks and from preliminary testing of a pneumatically actuated prototype for the wearable robot , all of which demonstrate that this robotic rehabilitation system achieved the stated objective . the first specific goal for this research was to collect data from a subject in real - time using simple and portable sensors . during the subject testing , the \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ { \\rm kinect}^{\\rm tm}$ \n \\end{document } sensor measured the 3d position and 3d velocity of the subject 's hand at 30 hz . experimental testing was conducted to determine the accuracy of the joint center measurements from the \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ { \\rm kinect}^{\\rm tm}$ \n \\end{document } as compared to the vicon gold - standard measurements during two upper - body exercise tasks ( table i ) . the results presented in table i show that the largest rmse for any joint during either task was 35.8 mm , while the smallest was 25.5 mm . these results are similar to a previous study comparing the \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ { \\rm kinect}^{\\rm tm\\thinspace}$ \n \\end{document } measurements to vicon measurements for upper body exercise tasks . clark et al . showed that between the two systems , there was approximately 42.9 mm difference during a lateral reaching task and 13.1 mm difference during a forward reaching task for hand measurements . these results suggest that the \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ { \\rm kinect}^{\\rm tm}$ \n \\end{document } measurements are sufficiently accurate for clinical significance , and therefore the robotic rehabilitation system is sufficiently accurate for measurements of rehabilitation exercises . since traditional physiotherapy regimens for the upper body are managed by physiotherapists , easily identified visual landmarks are used to quantify the success of the exercises . one study , focused on rehabilitation after a thrower 's elbow injury , used visual quantification landmarks such as extend elbow to full extension , raise arm to shoulder level and stand with shoulder abducted 90\\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ ^{\\circ}$ \n \\end{document } to describe the exercises . the current standard is to evaluate the exercises based on visual observation ( which can result in substantial errors when compared to a quantitative system like vicon ) . as such , rmse of 35 mm to 40 mm in joint center measurements can be considered insignificant for clinical purposes because visual observation error in a clinical setting has been shown to be approximately 10% and this rmse is less than 10% of the movement range . therefore , the joint center measurements from the \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ { \\rm kinect}^{\\rm tm}$ \n \\end{document } sensor are accurate enough to quantify rehabilitation exercises of the upper body , and are an improvement to the current standard of visual observation by a physiotherapist . the second specific goal of the system was to create a customized exercise task for each subject . a neural network was created using the subject 's training exercise data and was then used to modify a standard exercise task into a custom exercise task . for both sets of exercises , the subjects had greater rmse for the position and the velocity variables during the custom tasks ; in other words , during the custom task , their kinematic performance was worse in terms of accuracy to the instructed task . these results show that the subjects were less able to replicate the custom task , suggesting that the custom task was more difficult to complete . this may be a result of the unconstrained nature of the neural network used to create the custom task . no output constraints were placed on the neural network , and the researchers did not manually alter the output . as a result , consequently , the subjects were continually reacting to the unpredictable trajectory of the moving sphere during the custom task but were able to anticipate the trajectory of the standard task , thereby making the standard task easier to complete . adding constraints to the neural network previous successful adaptive rehabilitation systems , used trained physiotherapists to adapt the rehabilitation tasks to the subjects based on the quantitative data . therefore , the therapist acted as a constraint on the output of the systems , and could modify the output exercise task to achieve the desired goal . future iterations of the system will include constraints on the neural network and/or a trained physiotherapist who can modify the output task in order to ensure that the custom task is an anticipatory task , not a reactionary task . both the \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ { \\rm kinect}^{\\rm tm}$ \n \\end{document } sensor and the emg system are easily transportable and simple to use after minimal training . thus , it is feasible to use the entire rehabilitation system in a home setting , as the only additional requirements are a computer and a display device like a television . the third specific goal for the system was to build a simple and non - rigid wearable robot that will provide subject - specific resistance training . the results for the wearable robot prototype demonstrate the feasibility of using pams for actuation . table iii shows that the exoskeleton can be modeled as a second order linear system described by ( 6 ) . the measured damping coefficient \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ \\zeta=0.064 $ \n \\end{document } was low , suggesting that it might be difficult to control the robot . however , it is likely that a human elbow will have a higher damping coefficient than the test platform and therefore will be more controllable . furthermore , the measured damping coefficient was higher during the closed - loop comparison testing of the robot \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ ( \\zeta=0.13)$ \n \\end{document } , showing that the simple pressure control algorithm increased the damping of the robot . overall , these results indicate that a robust controller can be built that will control the robot . the first controller developed for the robot was based on pressure control of the pams . the results from the pressure control algorithm tests indicate that there was saturation of the pams at 0.75 hz and 1 hz during pressurization ; the valves did not pressurize the pams fast enough to follow the reference signal . this saturation most likely occurred because the reference pressure input signals were both high amplitude and high frequency , and as such required a high change rate ( 7 bar / second ) of the pressure inside the pams ( corresponding to an angle change of 100\\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ ^{\\circ}/{\\rm second}$ \n \\end{document } ) . as the pressure rose inside the valves , the pressure differential between the valves and the pressure source decreased , thereby decreasing the flow rate to the valves . eventually , the decreased flow rate was insufficient to achieve the high change rate required by the reference pressure input signals , and saturation occurred . this trend was not observed during depressurization because it would only occur near 0 bar , and the pressure reference input signals did not reach this level . while the motion bandwidths of normal human arm movements are centered at approximately 2 hz , most of these movements are relatively low amplitude and would not require high pressure change rates of the pams . nevertheless , future versions of the wearable robot will use a higher pressure source to increase the pressure differential ( and therefore the flow rate ) of the pams so that the robot can follow reference pressure input signals of at least 5 hz . additionally , force sensors will be added to the robot so that advanced control algorithms can be implemented , such as impedance or admittance control , in order to more accurately control the pneumatically actuated robot . the control performance of the wearable robot did not account for additional loading from the subject . in a wearable robot , the subject would also be exerting force on the robot ( both assistive and resistive force ) . this force would need to be measured and compensated by the controller in order to accurately control the position of the robot . future prototypes of the robot arm should include sensors to measure the force exerted on the robot by the subject . the results from the tests of the combined system indicate that the pressure loop can successfully follow low amplitude pressure reference input signals at frequencies greater than 1 hz . during these tests , saturation was not observed when the subject actuated the robot with a low amplitude reference input signal greater than 1 hz . varying the rate of change of the elbow angle also did not affect the accuracy of the robot , as it was able to follow the subject 's slow and fast movements . due to a slightly noisy input signal ( caused by small inaccuracies in the measured elbow angle from the \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ { \\rm kinect}^{\\rm tm}$ \n \\end{document } ) and insufficient damping in the control algorithm , the robot sometimes oscillated about the desired angle . furthermore , this test demonstrates the feasibility of the entire robotic rehabilitation system because the subject was able to actuate the wearable robot using only the movement of his elbow . future iterations of the entire system will implement real - time smoothing of the elbow angle reference signal in order to compensate for the small inaccuracies in the \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ { \\rm kinect}^{\\rm tm}$ \n \\end{document } measurements , and the damping terms in the control algorithm will be increased .", "this study described a promising home - use robotic rehabilitation system comprised of low - cost components . further research is necessary to create a commercial version of this system , specifically on the prototype of the wearable robot . however , the data collection component of the system could be used in the near future for large scale research studies . the immediate next steps are to create a gui for the system to increase usability and to optimize the model generation code for speed and accuracy . afterwards , this part of the rehabilitation system could be used by a variety of end - users for large scale research studies on rehabilitation exercises . given the low cost and easy portability of the microsoft \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ { \\rm kinect}^{\\rm tm}$ \n \\end{document } sensor , these studies should include home - based exercise components . concurrently , the next prototype of the wearable robot should be developed with the goal of having a fully functioning wearable prototype within two years . a limitation of this study is that the current system does not provide force feedback to the subjects . the wearable robot was designed to provide force feedback during the exercise tasks , but the current prototype was not tested on human subjects . future iterations of the robot prototype should be designed for wearability and human safety so that it can be worn by the subjects in order to provide force feedback . the addition of force feedback to the system should significantly enhance the results as the subject will have additional biofeedback information to help them complete the rehabilitation exercises ." ]

[ "international diabetic federation estimated that in india there are 66.8 million patients in 2013 , with nearly 50% undiagnosed . diabetes was related to one million deaths and mortality was higher under age of 60 years . by 2030 there will more than 79 million diabetics , making it one of the major public health challenge to the country . observed retinopathy in 28.9% , nephropathy in 32.5% , neuropathy in 30.1% , cardio - atherosclerotic diseases in 19.2% and peripheral vascular diseases in 18.1% diabetic patients . the investigators of a1 cheive study observed high prevalence of macrovascular and microvascular complications among the indian diabetic patients . different studies conducted in countries like united states have observed the positive association of patient 's knowledge regarding the disease and self care to the treatment compliance . hence , this study was planned to assess knowledge about diabetes and its correlation with pharmacological and non - pharmacological compliance , among the diabetics attending a rural health center from sangli district , maharashtra ( india ) .", "this was a cross - sectional study conducted in a rural health center attached to a medical college from sangli district of maharashtra , india . the study population was adult type-2 diabetes patients on oral hypoglycemic drugs for at least 6 months attending the rural health centre . the patients attending for routine check up or drug re - prescription and consenting to participate were included in the study . minors , patients on insulin , hospitalized patients , patients who had undertook any sensitization program other than routine counseling by physician and those who can not read in the local language were excluded from the study . prevalence of knowledge regarding diabetes in the pilot study was 52.71% ; considering level of significance as 5% and error 15% ; study instrument was a pretested , prevalidated , self - administered questionnaire with good test - retest reliability ( spearman correlation coefficient , r = 0.81 ) and internal consistency ( cronbach 's , r = 0.78 ) . it was developed in marathi language with the help of subject experts and published literature and finalized after the pilot study . it consists of initial section with general information of patient like age , gender etc . , the occupations reported by patients were classified as sedentary work , moderate work and heavy work . the second section consisted of questions regarding knowledge of patients about diabetes and its complications and the answers were scored . those scoring under 50% , 5075% and more than 75% were considered to be having poor , moderate and good knowledge , respectively . pharmacological compliance was self - reported , with participants reporting to have missed more than two doses in last 15 days were considered as non - compliant . due to lack of exact definition of compliance to the non - pharmacological management , a scale was developed with equal importance to diet modifications and physical exercises . the maximum possible score was 12 and the participants scoring above 9 ( 75% ) were considered as compliant to non - pharmacological management . mean , standard deviation , percentage , chi - square and binary logistic regression were applied . data from the pilot study and incomplete questionnaires were not included in the final analysis .", "out of 329 questionnaires collected , 307 were complete and hence used in the final analysis . two hundred twenty - three ( 72.6% ) participants were male while 84 ( 27.4% ) were female [ table 1 ] . the mean age of study participants was 55.6 years ( range 3585 years and standard deviation 12.22 years ) . two hundred ninety - two ( 95.1% ) participants were married . while considering the educational status , 106 ( 34.5% ) had studied up to secondary school and 201 ( 65.5% ) had attended college . among the participants : 208 ( 67.8% ) , 56 ( 18.2% ) and 43 ( 14% ) were sedentary , moderate and heavy workers , respectively . the mean morbidity with diabetes was 10.7 years ( range : 1 to 44 years and ; standard deviation : 10.02 years ) . age group and gender distribution of the participants the pharmacological compliance was reported by 234 ( 76.2% ) participants . the mean score for the non - pharmacological compliance was 8.35 ( standard deviation : 2.8 ) . based on preset criteria of score , 156 ( 50.8% ) participants were considered to compliant to the non - pharmacological management . the mean score for knowledge regarding diabetes was 14.82 ( standard deviation : 3.5 ) . only 29 ( 9.4% ) participants had good knowledge , whereas 219 ( 71.3% ) had moderate and 59 ( 19.2% ) participants had poor knowledge . age was not associated with the knowledge ( chi - square 5.47 , p = 0.49 ) , however , higher percentage of older age group ( 75 yrs ) participants had poor knowledge . gender was associated with knowledge ( chi - square 10.78 , p = 0.005 ) ; higher percentage of male participants ( 81.6% ) had moderate to good knowledge as compared to females ( 78.6% ) . marital status and occupation education was not associated with the knowledge ( chi - square 2.23 , p = 0.33 ) , however higher percentage of participants who had attended college had moderate to good knowledge . pharmacological compliance was associated with knowledge . among the participants with good compliance , 88.5% had moderate to good knowledge as compared to only 56.2% participants with poor compliance . the moderate to good knowledge was present in 87.8% participants with good compliance as compared to only 73.5% with poor compliance [ table 2 ] . association between knowledge regarding diabetes with pharmacological compliance and non - pharmacological management compliance binary logistic regression was applied with knowledge regarding diabetes as dependent variable , while age , gender , education , occupation , pharmacological compliance and non - pharmacological management compliance as independent variables . the chance accuracy rate for the model is 83.6% , which was greater than calculated chance accuracy rate ( 67.3% ) . pharmacological and non - pharmacological management compliance were the highly significant predictors , while education and age were also significant predictors for knowledge regarding diabetes [ table 3 ] . binary logistic regression model - association of age , gender , education occupation , pharmacological compliance and non - pharmacological management compliance with knowledge regarding to diabetes", "in the current study , we observed that the patients compliant with pharmacological and non - pharmacological management had good knowledge regarding diabetes . al - qazaz hkh et al . , ( 2010 ) , observed significant correlations between the knowledge about diabetes and adherence to the treatment in subjects from penang . when carried out a study at al - makhfia governmental diabetes primary healthcare clinic in nablus , palestine in 2012 , observed that diabetic patients with high knowledge were less likely to be non - adherent . chaudhary et al . , from multan ( pakistan ) in 2010 , observed that male gender , higher education and older age ( > 40 years ) were associated with the knowledge regarding diabetes mellitus . however , age groups used by them were only two : < 40 years and > 40 years , while in the current study four age groups were considered with lowest being 3550 years . abdella and mohammad studied awareness of diabetic patients about their illness and associated complications in ethiopia ( 2012 ) ; majority of patients ( 67% ) had good knowledge on actions to be taken on the occurrence of acute complications and reasons for developing acute complications . while we observed that less than 10% participants had good knowledge . however , there is difference in the questionnaire used in both the studies and most of the participants from abdella study had undergone sensitization unlike the current study subjects . ( bangladesh ) 2013 , observed that 19% respondents had poor knowledge , while 68% had average and 13% had good knowledge . they also deduced that male gender and higher educated people are likely to have better knowledge regarding diabetes . conducted a study on adults in tamaka village , kolar ( india ) in 2009 . observed that male gender , higher education and younger age of respondents was significantly associated with level of knowledge , while type of occupation is not associated with it . bansal et al . observed compliance to medication in 82.5% patients from rural area of ludhiana district , india . rao et al . observed that 83.6% patients from southern karnataka were on regular medication . santhanakrishnan et al . observed compliance to oral hypoglycemic agents in 76% subjects , dietary modifications in 81.4% and physical activity in 37% subjects from puducherry , india . while in the current study , pharmacological compliance was reported by 76.2% participants and compliance to the non - pharmacological management was reported by 50.8% participants . being a self - administered questionnaire reporting bias can not be totally eliminated ; there may be over - estimation of compliance . confounders like economical state , availability of medications , counseling by health professionals , exposure to information through media , additional use of ayurvedic / homeopathic / other indigenous systems of medicines etc . , may be present and are not considered in the current study . only self - reported compliance was considered without confirming .", ". however , many of the patients have poor knowledge regarding the disease , the situation is worse among the females . lower level of literacy and old age hinder the presence of knowledge regarding the diabetes . seminars , counseling sessions and workshop should be arranged periodically for diabetic patients to increase their awareness regarding diabetes disease in total per say ." ]

[ "lactic acid was first found and described in sour milk by the swedish chemist karl wilhelm scheele ( 17421786 ) in 1780 . the swedish chemist jns jakob berzelius ( 17791848 ) found lactic acid in fluid extracted from meat in 1808 [ 2 , 3 ] , and the german chemist justus von liebig ( 18031873 ) , who established the world 's first school of chemistry at giessen , proved that lactic acid was always present in muscular tissue of dead organisms . in 1859 , emil heinrich du bois - reymond ( 18181896 ) published several articles on the influence of lactic acid on muscle contraction [ 59 ] . araki and zillessen found that if they interrupted oxygen supply to muscles in mammals and birds , lactic acid was formed and increased [ 1014 ] . this was the first demonstration of the relationship between tissue hypoxia and the formation of lactate . the occurrence of increased lactic acid in blood ( hyperlactataemia ) nowadays reflects severe illness , in which the increased blood lactate levels may result from both anaerobic and aerobic production or from a decreased clearance . it was the german physician chemist johann joseph scherer who first demonstrated the occurrence of lactic acid in human blood under pathological conditions after death in 1843 and 1851 [ 15 , 17 ] , and carl folwarczny in 1858 who first demonstrated lactic acid in blood of a living patient . in this article we wish to honour scherer 's forgotten observations and describe the influence of his finding on further research on lactic acid at the end of the 19th century .", "born on 18 march 1814 in aschaffenburg , germany , scherer studied medicine , chemistry , geology and mineralogy at the university of wrzburg between 1833 and 1836 . he obtained his phd in medicine and surgery in 1838 with a thesis entitled versuche ber die wirkung einiger gifte auf verscheidene thierclassen he practised medicine in wipfeld , but inspired by the chemist ernst von bibra ( 18061878 ) he completed his studies in chemistry at the university of munich between 18381840 . in 1840 he was employed at the laboratory of justus liebig at giessen , and became professor at the medical faculty in 1842 , professor of organic chemistry in 1847 , and later professor of general , anorganic and pharmaceutical chemistry . his work especially concerned quantitative research on blood and urine in pathological conditions . in 1843 he published his book chemische und mikroskopische untersuchungen zur pathologie angestellt an den kliniken des julius - hospitales zu wrzburg ( chemical and microscopic investigations of pathology carried out at the julius clinic at wrzburg ) ( fig . 1 ) , in which he described 72 case reports , giving details on clinical course , diagnosis , and results obtained during autopsy and analysis of body fluids .", "in one chapter in his 1843 book entitled ' untersuchungen von krankhaften stoffen bei der i m winter 18421843 in wrzburg und der umgegend herrschenden puerperal - fieber - epidemie ' ( investigations of pathological substances obtained during the epidemic of puerperal fever which occurred in the winter of 18421843 in and around wrzburg ) scherer described the cases of seven young women who all died peripartum . one of the women , the 23-year - old primipara eva rumpel , gave birth to a healthy child on 9 january 1843 . the same night she developed a painfully swollen abdomen and became ill , feverish , and sweaty , with rapid pulse and severe thirst . the next evening she deteriorated , became delirious , with anxious breathing , a tense abdomen , cold extremities and rapid pulse , finally losing consciousness . a.m. , 36 h after the onset of the first symptoms , she died . during autopsy , severe purulent endometritis , vaginal pus , pulmonary oedema , and shock liver and shock spleen were found . the blood that was obtained directly from the heart was chemically analysed , in which lactic acid was found . most likely this unfortunate woman had died from a fulminant septic shock caused by group a haemolytic streptococci ( streptococcus pyogenes ) . another patient , the 28-year - old , 7 months pregnant ( second pregnancy ) margaretha glck , was , after being icteric , nauseous , vomiting and complaining about epigastric pain for 8 days , admitted to the lying - in birth clinic on 6 february 1843 . four days later she was transferred to the hospital with severe nosebleeds and generalised exanthema or purpura . in the evening she suffered from severe gastric bleeding and epistaxis , showing rapid pulse , cold extremities and dizziness . the next morning , she was transferred back to the birth clinic , where she gave birth to a premature child ( 30 weeks ) and suffered from a severe post - partum fluxus . she was again transferred to the hospital with the following symptoms : cold clammy skin , tachycardia , severe lochia and persistent exanthema or purpura , but without signs of an acute abdomen . during the night of february 11 autopsy revealed a small intracerebral haematoma , normal lungs without pulmonary oedema , ascites and an anaemic , foul smelling uterus filled with purulent and decayed tissue and pus . blood was also obtained directly from the heart during autopsy and lactic acid was found . in this case we could think of a haemorrhagic shock and cerebral haemorrhage due to clotting disorders possibly resulting from either acute fatty liver of pregnancy / hellp syndrome , idiopathic thrombocytopenic purpura , thrombotic microangiopathy ( ttp / hus ) or dic . in the conclusions of his 1843 book , scherer attached high importance to the fact that he found lactic acid in cases of puerperal fever , which he had not found before in healthy persons . he held the opinion that lactic acid was formed in blood during bodily deterioration in severe diseases like puerperal fever . lactic acid was thus described for the first time in human blood and was demonstrated for the first time as a symptom of septic and haemorrhagic shock . in the same period a junior obstetrician in vienna , ignaz philipp semmelweis ( 18181865 ) , discovered in 1847 that physicians carried infectious particles on their hands from the mortuary to the obstetrical clinic , causing puerperal fever and puerperal sepsis , and he introduced a successful method for its prevention . louis pasteur ( 18221894 ) found in 1879 that infection with streptococci was the most important cause of puerperal fever .", "scherer worked closely with the famous pathologist rudolf virchow ( 18211902 ) on several projects ( fig . 2 ) . in 1851 virchow performed an autopsy on a patient who had died from leukaemia and offered scherer blood from this patient for analysis . the results of this analysis were published the same year in the verhandlungen der physikalisch - medicinischen gesellschaft in wrzburg . virchow and scherer had previously studied the spleens of patients who died from leukaemia , and were curious if they could find the same results in the blood . scherer reached the conclusion that : the blood of this patient contains : ameisensure , essigsure und milchsure , die gleichfalls von mir schon frher als in der milzflssigkeit vorkommend bezeichnet wurden ( formic acid , acetic acid , and lactic acid , as also found by me previously in fluids from the spleen ) . \n 2johann joseph scherer ( left ) and rudolf virchow ( right ) in 1849 johann joseph scherer ( left ) and rudolf virchow ( right ) in 1849", "scherer 's observations inspired others to conduct further research , primarily in patients with leukaemia [ 1922 ] , but also in patients with other conditions and diseases and in animal experiments with dogs and rabbits . while scherer found lactic acid in blood obtained after death during autopsy , mosler and krner mention an observation made by carl folwarczny , published in the allgemeinen wiener medicinischen zeitung in 1858 , where blood was withdrawn from a leukaemia patient during life , analysed according to scherer 's method , and found positive for lactic acid . in addition , carl folwarczny described in 1863 in his ' handbuch der physiologischen chemie ' that lactic acid can be found in the blood of patients with leukaemia , septicaemia ( pyaemia ) and in conditions leading to septicaemia like puerperal fever , the latter probably after scherer 's observations . in an extensive article , the berliner physician georg salomon , who had serious doubts that the occurrence of lactic acid in blood was mostly related to leukaemia , proved in 1878 that lactic acid was also present in the blood of patients who were suffering and died from other diseases . he studied blood obtained during autopsy from cadavers , but also blood from patients obtained by bloodletting or cupping , and in some cases he compared the blood before and after death . he was able to demonstrate lactic acid in the blood of patients suffering from leukaemia , ( pernicious ) anaemia , congestive heart failure , chronic obstructive pulmonary disease , pleuritis , pericarditis , pneumonia and several solid malignant tumours . gaglio is often erroneously mentioned as the first author to find lactic acid in blood [ 2729 ] . he was able to demonstrate lactic acid in fresh arterial blood withdrawn from dogs and rabbits after bloodletting . both gaglio and berlinerblau , however , neglected previous research , as indignantly described by salomon in 1888 [ ich erlaube mir , den inhalt meiner arbeiten , die von gaglio nur ganz flchtig , von berlinerblau gar nicht berhrt sind , in krze zu reproduciren ( i take the liberty of summarizing the contents of my work , which was mentioned only briefly by gaglio and not at all by berlinerblau ) ] . the japanese chemist trasaburo araki showed that the amount of lactic acid in exhausted muscle results from muscle activation . irisawa , inspired by the results obtained by salomon and gaglio , obtained fresh blood of 11 dying patients with serious conditions . in six cases he found hyperlactataemia , in four cases normal values . he speculated on the aetiology of hyperlactataemia , the most plausible cause being the severe hypoxia during the dying process . in an experiment in which he made a dog anaemic for several days , he found a rise in lactic acid levels during the time leading up to death . in cambridge ( uk ) , walter morley fletcher ( 18731933 ) and frederick gowland hopkins ( 18611947 ) worked together on the metabolic changes occurring in muscular contractions and rigor mortis under anaerobic conditions , and found that lactate was the product of carbohydrate metabolism . their classic 1907 paper demonstrated rigorously that muscle contraction is accompanied by the anaerobic formation of lactic acid , which is removed aerobically , at a rate depending on the level of exposure to oxygen . poul astrup and john severingshaus mentioned scherer 's 1851 article as first demonstration of lactic acid in blood , but overlooked the 1843 cases and folwarczny 's work . in conclusion , scherer 's 1843 case reports should be cited as the first description of lactic acid in human blood and also as the first demonstration of lactic acid as a pathological finding in septic and haemorrhagic shock . folwarczny , in 1858 , was the first to demonstrate lactic acid in blood in a living patient ." ]

[ "panax ginseng ( ginseng ) has been used traditionally in eastern asia over thousands of years . it has been used orally to treat various diseases including hypertension , diabetes mellitus , liver and kidney dysfunction , mental disorders , and postmenopausal disorders . in addition , topical applications have also been used to heal wounds and reduce skin inflammation . in the past few decades , it has been proved that ginseng extracts actually show a wide range of effects against human diseases . their potential therapeutic effects have been mainly attributed to its immunomodulatory , neuroprotective , antioxidative , antitumor , and hepatoprotective activities . ginseng contains a number of active ingredients including ginsenosides , polysaccharides , phytosterols , peptides , polyacetylenes , fatty acids , and polyacetylenic alcohols , which have different effects on carbohydrate and lipid metabolism , cognition , angiogenesis , and the neuroendocrine , immune , cardiovascular , and central nervous systems . among the active constituents of ginseng , ginsenosides are known to be the major biologically active components of ginseng and the most widely studied . several studies have shown that ginsenosides play important roles in the pharmacological effects of ginseng . . however , ginseng contains other constituents , including ginsenoyne , phenolic compounds , polyacetylenes , sesquiterpenes , methoxypyrazine , alkylpyrazine derivatives , sesquiterpene alcohols , panasinsanols , and -carboline . white ginseng is peeled , dried , ginseng root and red ginseng is produced by steaming fresh ginseng root at 98100c for 23 h , and then drying until the moisture content is < 15% . red and white ginseng have both been shown to have immunomodulatory , anti - inflammatory , antioxidant , and antiatopic activities . moreover , red ginseng has been reported to have more potent pharmacological activities than white ginseng in some respects [ 2022 ] . the differences in biological activities between red and white ginseng are caused by the chemical changes of ginsenosides after the steaming process . steaming partially converts the original ginsenosides to deglycoslated derivatives . as a result , the species and amounts of ginsenosides are quite different based on the processing method used . chu et al showed that a total of 53 and 43 compounds were tentatively identified in white ginseng and red ginseng samples , respectively . the featured compounds are mainly malonyl ginsenosides in white ginseng , and decarboxyl products of mal - ginsenosides and the dehydrated compounds from polar ginsenosides were characteristic in red ginseng . it is interesting that ginsenosides show a wide variety of biological activities , although the absorption rates from orally administered intact ginsenosides are very low . in the human intestinal tract , thus , the pharmacological actions of these ginsenosides have been closely related to their biotransformation by human intestinal bacteria . in this context several studies showed that the transformation of ginsenosides into deglycosylated ginsenosides is needed to increase ginseng 's effectiveness in vivo \n . abnormal changes in skin color induce significant cosmetic problems with a negative effect on quality of life . there are two groups of pigmentary disorders : disorders of the quantitative and qualitative distribution of normal pigment and the abnormal presence of exogenous or endogenous pigments in the skin . hyperpigmentation - related diseases include melasma , lentigines , nevus , ephelis , freckles , postinflammatory hyperpigmentation , and age spots . postinflammatory hyperpigmentation appears in many skin conditions , including acne , eczema , and contact dermatitis . skin color is determined by various factors including melanin content , oxygenation state of hemoglobin in capillary vessels , carotenoid content , water content , and organization of collagen fibers in the dermis . among these factors , melanin is the major determinant of skin color . in this context , melanogenesis is a biochemical pathway responsible for melanin synthesis that is controlled by complex regulatory mechanisms . melanogenesis occurs in melanocytes confined in separate cytoplasmic organelles called melanosomes , which contain key enzymes of melanogenesis . differences in skin color are related to the size , number , shape , and distribution of melanosomes , whereas melanocyte density typically remains relatively constant . although tyrosinase is the key regulatory enzyme of melanogenesis , tyrosinase - related protein ( trp)-1 , dopachrome tautomerase ( dct / trp2 ) , and melanosomal matrix proteins ( pmel17 , mart-1 ) carry out important roles in regulating melanogenesis . the genes of tyrosinase , trp-1 , and dct contain common transcription starting sites , the microphthalmia - associated transcription factor ( mitf ) binding sites . the intracellular signal transduction pathways of protein kinase c , cyclic amp ( camp ) , and nitrogen oxide are involved in the regulation of melanogenesis . various endogenous and exogenous factors , such as estrogen and ultraviolet ( uv ) radiation , affect melanogenesis via signal transduction pathways . these endogenous / exogenous factors exert their actions directly on melanocytes or indirectly via surrounding skin cells . melanocytes , keratinocytes , dermal fibroblasts , and other skin cells communicate with each other by factors that are secreted and cell cell contacts . it has been shown that the interactions between keratinocytes and melanocytes are critical in the regulation of melanogenesis . in addition , dermal factors have been found to be involved in the regulation of melanogenesis . at the same time , stimulated melanocytes secret a number of signal molecules targeting not only keratinocytes but also skin immune cells . soluble factors released by melanocytes include proinflammatory cytokines and chemokines such as interleukin ( il)-1/1 , il-6 , il-8 il-10 , tumor necrosis factor ( tnf)- , transforming growth factor ( tgf)- , catecholamines , eicosanoids , serotonin , -melanocyte stimulating factor ( -msh ) , and nitric oxide ( no ) . a variety of hypopigmenting agents including hydroquinone , arbutin , tretinoin , kojic acid , azelaic acid , vitamin c , n - acetylglucosamine , niacinamide , linoleic acid , ellagic acid , methimazole , dioic acid , soy extract , licorice extract , rucinol , and glycolic acid have been used alone or in combination to treat abnormal hyperpigmentation . these agents can interfere with the pigmentation process at several different steps of skin pigmentation . however , the treatment of hyperpigmented conditions still remains challenging and the results are often discouraging . thus there is a need for novel skin - whitening agents that are highly effective and tolerable . in this article , we review recent reports investigating the skin - whitening effect of ginseng and its components and the underlying mechanisms of action , and then discuss their potential as candidates for novel skin - whitening agents .", "p. ginseng is one of the most widely used medicinal plants in traditional oriental medicine . over thousands of years , it has been used to improve the overall condition of skin , as well as to treat a wide variety of diseases . however , genuine scientific approaches to clarify the efficacy of ginseng in skin have only been made in recent years . several reports have shown that ginseng extract , powder , or some other constituents could inhibit melanogenesis in vitro and in vivo . table 1 summarizes the direct effects of ginseng and its components on skin color and key enzymes involved in melanogenesis . song et al reported that red ginseng powder improved melasma in a human clinical trial . they orally administered korean red ginseng powder for 24 weeks to female patients with melasma . after 24 weeks , the melasma area and severity index score decreased and melasma quality of life scale showed improvement in 91% of patients . in addition , 74% of the patients showed some improvement on the patient- and investigator - rated global improvement scales . most of reports investigating the antimelanogenic effect of ginseng were conducted in vitro used purified tyrosinase or melanocyte cell lines . in melan - a cells treated with ethanol extract of ginseng seeds , melanin content and in addition to the crude extract or powder , several studies tested the effects of specific constituents of ginseng . the phenol compounds inhibited tyrosinase activity while ginsenoside prevents uvb - induced intracellular increase of reactive oxygen species [ 4648 ] . in some reports , ginsenosides alone exerted antimelanogenic effects . aglycone of ginsenoside rh4 inhibited melanin synthesis in b16 melanoma cells , possibly by involvement of protein kinase a pathway . it significantly reduced melanin content and tyrosinase activity in -msh and forskolin - stimulated b16 melanoma cells . it reduced the camp level and camp response - element binding protein level in b16 melanoma cells , and this might be responsible for the downregulation of mitf and tyrosinase . in addition , ginsenoside rb1 inhibited melanogenesis through the inhibition of tyrosinase activity in -msh - stimulated b16 cells in a dose - dependent manner . the crude methanol extract of the fresh leaves of p. ginseng showed inhibitory activity on mushroom tyrosinase , and p - coumaric acid was characterized as the principal tyrosinase inhibitor in the extract . p - coumaric acid inhibited melanogenesis in b16f10 melanoma cells stimulated by -msh , and was suggested to interfere with melanogenesis by its structural similarity with tyrosine . interestingly , p - coumaric acid showed weaker inhibition against mushroom tyrosinase but more strongly inhibited human or murine tyrosinase in comparison with kojic acid and arbutin . enzyme kinetics analysis indicate that p - coumaric acid is a mixed type ( for tyrosine ) or competitive inhibitor ( for dopa ) of human tyrosinase . in addition , p - coumaric acid potently inhibits melanogenesis in human epidermal melanocytes exposed to uvb . cinnamic acid , one of the major components of cinnamomum cassia blume , is found in the root and seed of p. ginseng \n . cinnamic acid significantly reduced melanin production , tyrosinase activity , and tyrosinase expression in the melan - a cells . in addition , cinnamic acid showed depigmenting activity on the uvb - tanned skin of brown guinea pigs . it is already known that the pharmacological actions of these ginsenosides have been closely related to their biotransformation by human intestinal bacteria . although the contents of total ginsenosides in red ginseng and fermented red ginseng using lactobacillus brevis were not significantly different , the ginsenoside metabolite content was higher in fermented red ginseng compared to red ginseng . the tyrosinase inhibitory activity of fermented red ginseng extract was more potent compared with red ginseng extract in a test using mushroom tyrosinase .", "as reviewed above , crude extract or some components of ginseng and its components showed antimelanogenic activities by direct inhibition on key enzymes of melanogenesis , such as tyrosinase . moreover , ginseng and its components could exert antimelanogenic activity via action on the several factors related in melanocyte physiology . among a large number of soluble factors produced from melanocytes , keratinocytes , fibroblasts , and immune cells in skin , adrenocorticotropic hormone ( acth ) , -msh , endothelin-1 , prostaglandin e2 , prostaglandin f2 , no , and histamine are well - known stimulators of melanogenesis [ 37,5963 ] . il-1/1 and granulocyte - macrophage colony - stimulating factor ( gm - csf ) stimulate melanogenesis , while il-6 , tgf-1 , and tnf- downregulate melanin production . gm - csf has been reported to be involved in regulating the proliferation and differentiation of epidermal melanocytes . treatment of melan - a cells with conditioned media from uv - irradiated sp-1 keratinocytes increased melanocyte proliferation , and the proliferative effect of the conditioned media was blocked by anti - gm - csf antibody treatment . when uv - irradiated sp-1 keratinocytes were treated with red ginseng extract or saponin of red ginseng , the increased melanocyte proliferation by the conditioned media was blocked . in that report , red ginseng extract or saponin of red ginseng treatment decreased the expression of gm - csf induced by uv - b irradiation in sp-1 keratinocytes . as mentioned above , inflammatory cytokines such as il-1 and tnf- take part in the regulation of melanogenesis . ginseng extracts and ginsenosides have been reported to have anti - inflammatory activities in several different studies . ginsenosides inhibit different inducer - activated signaling protein kinases and transcription factor nuclear factor ( nf)-b , and then decrease the production of proinflammatory cytokines and mediators of inflammation . korean red ginseng extracts decreased tnf- and il-8 production in lipopolysaccharide ( lps)-stimulated hacat keratinocytes and show radical scavenging and antioxidant activity in human dermal fibroblasts . these findings suggest that ginseng extracts and ginsenosides might affect melanogenesis through their anti - inflammatory activities . the effect of ginseng on no production is still questionable . sun ginseng , a new processed ginseng prepared by steaming at high temperature , reduced uv - b - induced cell damage and decreased no production by inhibition of inducible no synthase mrna synthesis in hacat keratinocytes and human dermal fibroblasts . red ginseng marc oil inhibited inducible no synthase and cyclooxygenase-2 via nf-b and p38 pathways in lps - stimulated raw264.7 cells . in addition , ginsenjilinol , a protopanaxatriol - type saponin obtained from the roots of p. ginseng , shows inhibitory activity on no production in lps - stimulated raw264.7 cells . by contrast , there are some controversial reports that ginseng extract enhanced no production or no signaling . hong et al reported that ginseng extract administration stimulated nongenomic endothelial no synthase activation and enhanced no production in spontaneously hypertensive rats . in another report , water extract of korean red ginseng exerted vasoprotective effects through augmentation of no production by inhibiting arginase . therefore , the effect of ginseng on melanogenesis via no signaling remains to be clarified by further study . considerable numbers of immune cells including langerhans cells , macrophages , mast cells , and t cells are working actively in skin tissue . because the immunostimulatory activities of many ginsenosides are known , it is not surprising that ginsenosides could enhance the reactivity of skin immune cells . in a recent paper , a cream containing 0.1% ginsenoside f1 ( a metabolite of ginsenoside rg1 ) showed a significant whitening effect on artificially tanned human skin . however , ginsenoside f1 did not directly inhibit mrna expression of tyrosinase or dct in normal human epidermal melanocytes . instead , ginsenoside f1 enhanced production of il-13 from human epidermal t cells , and il-13 significantly reduced the mrna expression and protein amount of both tyrosinase and dct resulting in visible brightening of normal human epidermal melanocyte pellets . these results suggest that ginsenosides might be able to regulate melanogenesis via their effect on skin immune cells .", "recently , several reports have shown that extract , powder , or some constituents of ginseng could inhibit melanogenesis in vivo or in vitro . the underlying mechanisms of the antimelanogenic effect of ginseng or its components included the direct inhibition of key enzymes of melanogenesis ( tyrosinase and dct ) , inhibition of transcription factors ( mitf , nf-b ) or signaling pathways ( protein kinase a pathway and protein kinase c pathway ) involved in melanogenesis , decreasing the production of inducers of melanogenesis ( camp , gm - csf ) , and enhancing production of antimelanogenic factor ( il-13 ) . fig . although issues surrounding the antimelanogenic activity of ginseng still remain controversial , especially in its effect on the production of proinflammatory cytokines and no , these recent findings suggest that ginseng and its constituents might be potential candidates for novel skin - whitening agents .", "" ]

[ "chronic kidney disease ( ckd ) is associated with a number of comorbidities and prognosis is poor , because many patients experience progression to end - stage renal disease . also , in the majority of patients disease progression may be altered due to more or less suitable immunosuppressive protocol treatments and therapeutic approaches . the mechanisms of injury underlying progression are blurred , but traditional opinion pointed to an association between decline in renal function with the degree of proteinuria and histological findings of glomerulosclerosis and interstitial fibrosis [ 2 , 3 ] . kidney injury molecule-1 ( kim-1 ) is a new specific biomarker of proximal tubule injury that can be measured both in urine and kidney tissue samples . it is an apoptotic - cell phagocytosis and scavenger receptor that is most highly upregulated in proximal tubular epithelium in acute and chronic kidney injury . also , much attention has been paid to its possible pathophysiological role in modulation of tubular damage and repair [ 57 ] . besides a close relationship between tissue kim-1 expression and urinary kim-1 concentration , our previous six - month prospective pilot study showed that kim-1 expression in tissue correlated better with tin features and renal function in different chronic kidney diseases than with urinary kim-1 concentration . therefore , that investigation was the basis of this long - term retrospective study , where only kim-1 tissue expression as a predictor of long - term kidney function was examined . the aim of this retrospective investigation was to evaluate ( 1 ) possible associations between tissue kim-1 expression and tubulointerstitial ( tin ) inflammation , atrophy , and fibrosis in different chronic kidney diseases and ( 2 ) possible associations between tissue kim-1 expression and some demographic and laboratory parameters as well as kidney function and proteinuria at the time of biopsy and 6 , 12 , 24 , and 36 months later .", "the retrospective study included 60 patients ( 27 men ) of mean age 34.42 12.15 years ( range 1859 years ) , who were hospitalized in the clinical center of serbia for kidney biopsy from 2006 to 2009 . indications for kidney biopsy were nephrotic syndrome , pathologic proteinuria without nephrotic syndrome , and abnormal urinary sediment ( erythrocyturia and leukocyturia ) in several samples . pathohistological analysis revealed minimal change glomerulonephritis ( mcgn ) in two patients , non - iga gn in nine , iga gn in six , membranous and membranoproliferative gn in seven patients each , focal glomerulosclerosis in eleven , lupus nephritis in ten , and crescentic gn in eight patients . after diagnosis , the participants were treated according to established protocols for each type of gn with immunological and nonimmunological therapy ( nonsalt diets , statins , angiotensin - converting - enzyme - ace inhibitors , and angiotensin receptor type 1 blockers atb ) . the institutional review committee approved our study protocol therebys following local biomedical research regulations ( irb no . a complete blood count ; serum urea and creatinine , albumin ; lipid status , and urine sediment were determined in blood and urine samples collected 1 day before kidney biopsy as well proteinuria / day . only samples with a sterile urine culture were processed . urine sediments with more than 3 rbc / hpf or 5 wbc / hpf were defined as clinically significant erythrocyturia or leukocyturia . estimated glomerular filtration rate ( egfr ) was calculated with a shortened version of the modification of diet in renal disease ( mdrd ; patients 18 years ) . alteration in tin were assessed after routine hematoxylin - eosin staining by a qualified nephropathologist who was not familiar with the preset histopathologic or clinical diagnosis , nor the identity of patients . inflammation activity was then scored numerically ( 0 : no inflammation , 1 : slightly marked inflammation , 2 : moderate inflammation , and 3 : strong inflammation ) as well as atrophy and fibrosis advancement ( 0 : no atrophy and no fibrosis , 1 : slightly marked atrophy and fibrosis , 2 : moderate atrophy and fibrosis , 3 : very pronounced atrophy and fibrosis ) . after deparaffinization tissue samples were rehydrated and stained immunohistochemically for kim-1 using the tissue kim-1/tim-1 kit ( r & d systems inc . , minneapolis , mn , usa ) with contrasting hematoxylin and eosin staining . a tubule was considered to be kim-1 positive if it contained at least one kim-1 positive cell regardless of whether the kim-1 expression was cytoplasmic or apical . kim-1 staining was scored semiquantitatively by estimating the percentage of cortical tubules expressing kim-1 per field ( the complete biopsy area was scored , with a minimum of five fields ; in controls 30 fields were scored ) . unaffected parts of kidneys from patients with renal cell carcinoma were used as the negative control . the 6- , 12- , 24- , and 36-month followup for all patients included measurement of serum creatinine concentration , egfr , and proteinuria . data are presented as mean 1 standard deviation ( sd ) and the range of values . the one - sample kolmogorov - smirnov test was used to check for normal distribution of the variables . relationships between variables were estimated using pearson 's rank and spearmen 's correlation tests as appropriate . independent predictors of renal function 6 , 12 , 24 , and 36 months after the kidney biopsy were identified by stepwise multivariant regression analysis .", "\n table 2 presents the demographic , clinical , and laboratory data for the patients at the time of kidney biopsy . tissue kim-1 expression was significantly induced in all kidney biopsies except in one patient with mcgn . tissue kim-1 had a typically apical localization , but it could also be found in the cytoplasm with no apparent affinity for the apical membrane of tubulocytes . kim-1 positive tubules were located mainly in the tin regions affected by inflammation or fibrosis but were not observed in regions with end - stage fibrosis . kim-1 univariate analysis showed significant positive associations between tissue kim-1 expression and age ( r = 0.313 ; p = 0.015 ) , tin inflammation ( r = 0.4563 ; p = 0.004 ) , tin fibrosis ( r = 0.317 ; p = 0.021 ) , and hemoglobin ( r = 0.440 ; p = 0.001 ) as well as negative associations with albumin concentration ( r = 0.376 ; p = 0.011 ) and egfr ( r = 0.572 ; p < 0.001 ) at the time of biopsy and 6 ( r = 0.442 ; p = 0.002 ) , 24 ( r = 0.398 ; p = 0.012 ) , and 36 ( r = 0.412 ; p = 0.015 ) months later . tissue kim-1 expression correlated significantly only with proteinuria / day 6 months after biopsy ( r = 0.394 ; p = 0.026 ) but not with proteinuria at the time of biopsy and 12 , 24 , and 36 months later . \n table 3 gives the correlation coefficients between egfr at the time of biopsy and 6 , 12 , 24 , and 36 months later and the examined variables . multivariant stepwise regression analysis showed that the best predictor of kidney function at the time of biopsy ( egfr 0 ) was tin inflammation ( p < 0.001 ) , as well as of egfr12 ( p = 0.015 ) , egfr 24 ( p = 0.039 ) , and egfr 36 ( p = 0.012 ) . however tissue kim-1 expression was the best predictor of egfr 6 ( p = 0.016 ) along with tin inflammation ( p = 0.016 ) ( table 4 ) . figure 2 presents the linear correlation between tin inflammation ( p < 0.001 ) , tissue kim-1 expression ( p < 0.001 ) , and egfr 6 .", "in our previous 6-month prospective study , we found higher urine kim-1 concentrations in twenty chronic renal patients than in control subjects and a significant positive correlation between urine kim-1 level and kim-1 expression in tissue . although , urine kim-1 content reflected tissue kim-1 expression , tissue kim-1 correlated better with tin inflammation and fibrosis as well as with kidney function at the time of biopsy and 3 and 6 months later . therefore , we retrospectively examined sixty patients with different kidney diseases in order to evaluate the importance of tissue kim-1 expression in predicting kidney function in the ensuing 36 months after kidney biopsy . in the present study tissue in addition , kim-1 positive tubules were located in parts of the cortex that were imbued with inflammatory infiltrate and/or fibrotic changes but not in completely atrophic areas . it is well known that the expression of kim-1 in tubules is associated with inflammation and tin damage . double - labeling studies have shown simultaneous expression of kim-1 and markers of prefibrotic changes , repair , and chemotaxis [ 10 , 11 ] . the study of van timmeren et al . also demonstrated a connection between kim-1 expression in tissue , interstitial fibrosis , and macrophage accumulation . . first showed that tubular epithelial cells expressing kim-1 on their surface could act as phagocytes for apoptotic and necrotic renal epithelial cells . kim-1 is expressed predominantly in renal tubules , which , judging by the simultaneous expression of markers of dedifferentiation , are currently under the influence of agents that cause injury , but is absent from completely atrophic tubules . controversy remains about the function of kim-1 : is it actively regulating the inflammatory process ? or is its expression just a response to damage , attempted recovery , and/or repair ? . the present study revealed a significant negative correlation between tissue kim-1 expression and all estimated gfr at the time of kidney biopsy and 6 , 24 , and 36 months later . however multivariate analysis pointed to tin inflammation , but neither tin fibrosis nor proteinuria , as the best predictor of kidney function at biopsy and 6 , 12 , 24 , and 36 months afterwards . however , along with tin inflammation , tissue kim-1 expression was the best predictor of kidney function 6 months after biopsy . interstitial infiltration of inflammatory cells can be seen in a variety of immune and nonimmune kidney diseases and is thought to play a significant role in tin damage and fibrosis . upon exposure to high protein concentrations , renal tubule cells produce a host of chemokines , vasoactive mediators , and adhesion molecules , which may contribute to interstitial fibrosis . protocol immunosuppressive therapy and treatment with ace inhibitors and at blockers for chronic renal patients with different chronic immune and nonimmune - mediated kidney disorders proven by biopsy have the strongest effects during the first 6 months of therapy . the severity of pretreatment tin damage predicts a dulled response to renoprotective intervention , with a worse long - term renal outcome . therefore , we can speculate that patients with less interstitial inflammation at the time of kidney biopsy will have a more favorable response to treatment and better kidney function afterwards . also , the finding that kim-1 was the strongest predictor of kidney function 6 months after biopsy along with tin inflammation may support the hypothesis about its potential role in the development of interstitial fibrosis and an unsatisfactory treatment response . association between higher urinary kim-1 levels and poorer kidney function was found in some human studies in native [ 10 , 14 ] and transplanted kidneys but data on human tissue kim-1 expression are scarce . zhang et al . found that kim-1 expression in transplant biopsies is a sensitive measure of cell injury . in addition , they showed that more intense kim-1 staining predicts a better graft outcome over the ensuing 18 months and speculated that its level of expression may be an indicator of graft function recovery . it is well known that proteinuria is an ominous biomarker of progressive kidney disease and our study revealed that only proteinuria 6 months after kidney biopsy correlated negatively with kidney function 24 and 36 months after the biopsies and positively with kim-1 expression in tissue . earlier investigations [ 10 , 14 , 17 ] have yielded conflicting data regarding the relationship between urinary kim-1 level or tissue kim-1 expression and proteinuria . one explanation may be that proteinuria is not always accompanied by tin damage and a progressive decline in renal function [ 18 , 19 ] . data regarding the selectivity of proteinuria were not available for the purposes of this study .", "the present study exposed a strong association between kim-1 tissue staining and tin inflammation and fibrosis but not with tin atrophy . although multivariate analysis pointed to tin inflammation , as the best predictor of kidney function at biopsy and 6 , 12 , 24 , and 36 months later , tissue kim-1 expression is one of the best predictor of kidney function 6 months after biopsy , the time when treatment effects are the strongest . therefore , we can speculate that kim-1 has a potential role in the development of interstitial fibrosis and poor treatment responses . the major limitation of this investigation is the relatively small number of patients examined but it could be the basis for a larger prospective follow - up study for evaluation of urinary kim-1 concentration and tissue kim-1 expression in patients with various chronic and acute renal diseases ." ]

[ "these range from various slow - growing benign tumors and low - grade malignancies to fast growing high - grade malignancies . angiofibromas are one such group of tumors arising in this region , which present as swellings . of these , nasal angiofibromas ( nas ) are the most common and nas occurring in the region other than the nose are called as extranasopharyngeal angiofibromas ( ena ) .", "a 54-year - old male reported to our department with history of swelling over the right side of face since 5 years . the patient reported insidious onset of swelling with a gradual progress to the present size . he also reported mild , intermittent , and dull pain in the region of swelling . clinical examination confirmed a solitary , oval , well - defined swelling measuring approximately 7 5 cm in the preauricular region [ figure 1 ] . it extended superioinferiorly from the level of outer canthus of the eye to inferior border of mandible and anterioposteriorly extended from 2 cm in front of anterior border of ramus to the mastoid notch [ figure 1 ] . on palpation , the swelling was firm , non - tender , free from skin , and mobile over the underlying structures . ultrasonography revealed a large lobulated solid mass of 6 4 cm in the right parotid region with multiple vessels with low velocity flow and without any areas of calcification or cystic changes . findings were suggestive of a low - grade vascular tumor . computed tomography scan with contrast medium revealed a large well - circumscribed , solitary isodense lesion measuring 6.36 4.39 cm [ figure 2 ] . it was observed to be extending anteriorly over the superficial lobe of the parotid gland , with anterior displacement of parotid gland . fnac revealed numerous vascular channels with occasional singly scattered and single cluster of plump spindle cells . ct- scan transverse section classical superficial parotidectomy was performed under general anesthesia using a modified appiani incision . tumor mass was dissected anteriorly and excised along with the superficial lobe of parotid gland [ figure 3 ] . facial nerve was located using the anterograde method and all the branches of facial nerve were preserved . follow up , facial nerve function was intact and no sign of reoccurrence was observed . histopathological sections revealed connective tissue with numerous vascular spaces of variable sizes ranging from small capillary - like vessels to partly lined vessels . around the endothelial cells , cells were plump or stellate - shaped with mild inflammatory cell response and composed predominantly of plasma cells and a few lymphoid follicles [ figure 4 ] . photomicrograph shows numerous endothelial lined blood capillaries with collagen fibres interspersed with fibroblasts and fibrocytes ( h&e stain , 40 ) . ( b ) photomicrograph shows endothelial lined blood vessels with connective tissue wall in the background of collagen fibres interspersed with fibroblasts and fibrocytes ( h&e stain , 400 ) photomicrograph of the sections showing the blood vessels positive for cd 34 ( ihc stain , 100 )", "various soft tissue tumors , both benign and malignant , present as swelling in the parotid region . clinical examination confirmed a smooth - surfaced , solitary , oval , firm , well - defined swelling measuring approximately 7 5 cm in the preauricular region . based on the clinical findings of location , consistency and borders a differential diagnosis of pleomorphic adenoma , solitary fibrous tumor ( sft ) , low - grade fibrosarcoma , and lipoma was made . as the most common tumors found in the region are parotid tumors , a provisional diagnosis of mixed parotid tumor was made . however , fnac and contrast - enhanced ct scan were in favor of a tumor with vascular component , shifting the differential diagnosis towards tumors with a vascular component presenting as slow - growing , circumscribed firm swellings . histopathological examination of the excised lesion revealed features suggestive of angiofibroma and had to be differentiated from lesions with similar features . the differential diagnosis included low - grade vascular lesions , spindle cell neoplasms , comprising of a large range of benign and low - grade malignant soft tissue lesions , including cellular angiofibroma , sft , low - grade fibromyxoid sarcoma ( lgfms ) , low - grade myxofibrosarcoma , myxoid liposarcoma , giant cell angiofibroma ( gca ) , angiomyolipoma , and angiomyofibroblastoma . cellular angiofibroma , usually occurs in the pelviperineal region , which would be an unusual location for the tumors reported herein ; however , cases have been reported to have occurred in the buccal mucosa , raising a diagnostic possibility . cellular angiofibroma shows more rounded , non - branching vessels , often of medium size with thicker walls . the tumors are generally more uniformly cellular , composed of lesional cells with short , stubby nuclei resembling those of spindle cell lipoma . sfts occur in a variety of locations in the head and neck region ; myxoid examples may be particularly difficult to identify and should be considered in the differential diagnosis . microscopically , besides the so - called patternless architecture , there is pronounced regional variation in cellularity , prominent thick collagen bundles and characteristic branching ectatic staghorn vessels , which are not accompanied by the abundant smaller - sized vessels present in angiofibroma of soft tissue . in addition , the tumor cells in sft express strong and diffuse cd34 in most cases . this entity lacks the innumerable , evenly distributed , arborizing thin - walled vessels characteristic of angiofibroma . lgfms is a distinctive fibroblastic malignant neoplasm characterized by a peculiar tendency to give rise to very late metastases . histologically , it shows alternating collagenous and myxoid areas with a usually swirling or whorled growth pattern , a frequently lobular appearance , and deceptively bland spindle cell morphology . the lesions tend to be more hypocellular , with a fibrous component that has uniform collagen deposition rather than the fibrillary or coarsely banded collagen fibers in angiofibroma of soft tissue . although lgfms may contain arcades of thin - walled vessels , vascularity is usually not prominent . usually occurring in subcutaneous tissues of the extremities , it shows distinctive histologic features including a lobulated growth pattern with infiltrative margins and fusiform , round , or stellate tumor cells with frequently slightly eosinophilic cytoplasm and hyperchromatic atypical or pleomorphic nuclei . obvious features of malignancy are usually present , characteristic elongated curvilinear vessels with perivascular hypercellularity , these features bear little or no resemblance to the rich vascular network of angiofibroma . myxoid liposarcoma contains a prominent plexiform network of thin - walled capillaries ( which has been referred to as a chicken wire or however , it also shows scattered univacuolar and multivacuolar lipoblasts throughout , as well as stromal mucin pools not seen in angiofibroma . gca has been reported as a benign mesenchymal tumor with 2 cases originating in the buccal mucosa . although benign , the lesion has potential for local reoccurrence , especially after incomplete resection . histopathologically , it has similar presentation to that of sft , with presence of multinucleated giant cells not seen in angiofibroma . angiomyolipoma differs from angiofibromas because of the presence of prominent muscular arteries while angiomyofibroblastoma differs because of the presence of fibrovascular component with a loose myxoid fibroelement . enas have interstitial stromal tissue predominance with less vascular elements such as that of long - standing na . other distinctive histologic features are angiofibroma of soft tissue , consisting of a vaguely lobular , variably cellular proliferation of bland , uniform spindle cells set in an abundant , variably myxoid or collagenous extracellular matrix with numerous small , and thin - walled , branching blood vessels . the complexity of the vascular pattern , often also including larger vessels of varying size and shape , is the most noticeable feature . immunohistochemical analyses may show that stromal cells have strong cytoplasmic reactivity for vimentin and are generally immunonegative for smooth muscle actin and desmin . histopathology coupled with immunohistochemistry usually confirms the diagnosis in favor of angiofibroma . in our case , the tissue specimen showed features consistent with the diagnosis of ena . in 1980 , de vincentiis and pinelli reviewed a series of 704 cases of angiofibroma and found that 13 cases manifested outside the nasopharynx , thus suggesting that extra nasopharyngeal localization of this tumor is a possible although rare occurrence . a review article by windfuhr and remmert in 2004 summarized 65 patients with enas . the most common site reported for enas is the maxillary sinus followed by the ethmoid , nasal cavity , and nasal septum . enas are also reported to originate from the ethmoid sinus , nasal cavity , nasal septum , larynx , sphenoid sinus , cheek , conjunctiva , oropharynx , retromolar area , middle turbinate , inferior turbinate , and tonsil . other rare sites for enas occurrence have also been described - external nose , hard palate , external ear , lacrimal sac , carotid bifurcation , oesophagus , trachea , facial nerve , middle cranial fossa , and infratemporal fossa . the most common age of incidence was the second decade ( 46% ) in comparison to 80% of patients with nas . enas have a higher mean age , i.e , 22 years compared to nas , which have a mean age of 18 years . this lesion has been described as different from that of the classical nasopharyngeal variety in being more common in females , older individuals with an early presentation , and being capsulated with poor vascularity and infrequent recurrence . unlike nas , enas present non - specific and numerous symptoms . imaging modalities such as ct scan , mri , ct angiography , and ultrasonography are required for optimal preoperative evaluation of nas and enas . imaging of nas with a contrast agent leads to diffuse and usually homogenous involvement in ct and mri scans with strong contrast enhancement . in contrast , enas enhances moderate amount of contrast or none due to its weak vascular involvement . surgical excision is the prime modality of treatment for enas ; radiotherapy maybe applied for non - resectable lesions . occurrence of enas , although rare in the maxillofacial region , should be considered in differential diagnosis of swellings in this region ." ]

[ "atherosclerotic renal artery hypertension is reported in almost 7% of adults older than 65 years1 ) and is associated with cardiovascular events , and may double risk of mortality2 ) . in the 1990s , radiological angioplasty began to replace surgical revascularization . galaria et al . showed that percutaneous and open renal revascularization had equivalent long - term functional outcomes3 ) . over time , the less - invasive procedure became more accessible . most cases of atherosclerotic renovascular disease ( arvd ) are located in the ostium , and are extensions of calcified aortic plaques4 ) . stent placement might also provide additional force to increase the rates of technical success5 ) and to reduce the rate of restenosis at 6 months after the initial procedure6 ) . intervention with stents has become a standard procedure ; in patients with stenosis of the renal artery , placement of a stent is likely to be the initial form of treatment . however , there is limited evidence to support revascularization over medical therapy for patients with atherosclerotic renal artery stenosis7 , 8) .", "retrospective studies previously reported that renal artery lesions might progress to severe stenosis and ultimately to renal artery occlusion9 ) . michael et al . performed a prospective study that reported that the progression of renal artery disease was a frequent occurrence with an annual rate of progression of renal artery lesions reported to be 7%10 ) . however , at the time of these studies , statins were being used in fewer patients . a retrospective study of the effects of statins on the progression of arvd has shown that the use of statins reduces the risk of progression and the development of arvd11 ) . another prospective population - based study reported that the progression to significant arvd was observed in only 4.0% during 8 years of follow - up ( annualized rate , 0.5% per year ) , and no case of arvd progressed to occlusion12 ) .", "essential hypertension and clinically silent renal artery stenosis often coexist , and essential hypertension also coexists with renovascular hypertension13 ) . renal injury distal to an atherosclerotic renovascular obstruction is due to multiple intrinsic factors producing parenchymal tissue injury ( fig . non - traditional mediators of arvd such as inflammatory pathways , reactive oxygen species production , ischemia / reperfusion damage and modulation of matrix turnover have been proposed as causes of the renal failure related to arvd15 ) . this complexity of the pathophysiology might explain why the severity of the stenosis is not correlated with renal dysfunction . clinical data support dissociation of improved renal artery patency from clinical outcome in patients with atherosclerotic renal artery stenosis ; this may illustrate the effects of irreversible injury on the post stenotic kidney . a prospective clinical study reported by wright et al . showed absence of a correlation between renal artery anatomy and baseline renal function or functional outcome , and a good correlation between renal functional outcome and proteinuria ; these findings suggest that renal parenchymal damage is a major determinant of renal dysfunction and outcome rather than the severity of the renal artery stenosis in arvd16 ) . reported that the mean arterial pressure did not decrease by 10 mmhg or more after revascularization and renal function declined in most patients with arvd that had high resistance - index values before revascularization17 ) . chrysochou et al . showed a correlation between baseline proteinuria and decline in estimated glomerular filtration rate ( gfr ) with time after revascularization18 ) . therefore , post stenotic renal injury can lead to renal parenchymal injury reflected by high intrarenal resistance and/or the presence of proteinuria . proteinuria and other factors involved in intrarenal resistance are predictors of a poor outcome after renal revascularization in arvd . when patients with chronic kidney disease undergo renal angioplasty with / without stent placement , the response with regard to renal function can be negative as well as positive . positive responses include improvement of renal function , and stabilization or attenuation of declining renal function , as expected . possible causes of these adverse outcomes include contrast induced nephropathy , atheroembolism , and restenosis or stent thrombosis19 ) . the administration of contrast might increase the risk of acute renal dysfunction , especially in patients that have preexisting renal impairment . an ex vivo study reported that each manipulation of atheroma specimens , from simply advancing the guidewire through the atherosclerotic lesion to positioning and deploying the wallstent , releases thousands of fragments , and that these atherosclerotic fragments are of sufficient size to create vascular occlusion and initiate significant renal parenchymal damage20 ) .", "the nature of this disorder suggests that a systemic approach is necessary to provide cardiovascular protection . previously , statin therapy was discussed as a method of altering the natural history of arvd11 ) . angiotensin - converting enzyme inhibitors and angiotensin receptor blockers effectively reduce blood pressure in patients with renovascular disease . in addition , a population - based cohort study of over 3,500 patients with arvd in canada found that angiotensin inhibitors could cause acute renal toxicity in a small subset of vulnerable patients ; however , they still improved the cardiovascular and renal outcomes in patients with arvd , but at the expense of acute renal toxicity21 ) . recently three randomized controlled trials have been performed : the stent placement and blood pressure and lipid - lowering for the prevention of progression of renal dysfunction caused by atherosclerotic ostial stenosis of the renal artery ( star ) trial , the angioplasty and stenting for renal artery lesions ( astral ) trial , and the cardiovascular outcomes in renal artherosclerotic lesions ( coral ) trial ( table 1 ) . two large randomized trials of intervention vs. medical therapy showed negative results for the intervention . the star trial was a european multicenter trial that enrolled 140 patients with ostial renal artery stenosis greater than 50% , blood pressure controlled to less than 140/90 mmhg , and creatinine clearance 15 to 80 ml / min7 ) . all patients received angiotensin blocking agents and a statin , regardless of their lipid levels . after a 2-year interventional period , no difference was observed in the decline of renal function , the degree of blood pressure control , and the rates of cardiovascular morbidity and death . investigators in the astral trial enrolled 806 patients with at least one stenotic renal artery considered suitable for balloon angioplasty , stenting , or both in their international , multicenter trial8 ) . the mean estimated gfr was 40 ml / min , and most of the patients were on statin and angiotensin blocking therapy . at a mean follow - up of 33.6 months , no difference was noted between the treatment groups in the decline of renal function or blood pressure control , and the renal function worsened slightly in both groups . most of the enrolled patients in the two clinical trials had relatively asymptomatic atherosclerotic renal artery stenosis . therefore , the practice of indiscriminately performing revascularization , without strong evidence , is no longer acceptable . the coral trial is an ongoing multicenter randomized controlled trial in the united states22 ) . it is still enrolling patients that have drug - resistant hypertension or a gfr < 60 ml / min . it is using a standardized medical protocol to control blood pressure , and embolic protection devices during procedures are encouraged . thus far , intervention has not been recommended if renal function has remained stable over the past 6 to 12 months and if hypertension can be controlled medically . according to a clinical classification of atherosclerotic renal artery stenosis with guidelines for vascular intervention of surveillance published in 2008 by the atherosclerotic peripheral vascular symposium23 ) , additional recommendations favoring medical therapy were as follows : very advanced age and/or limited life expectancy , extensive co - morbidities that make revascularization too risky , high risk for or previous experience with atheroembolic disease , and other concomitant renal parenchymal diseases that cause progressive renal dysfunction ( e.g. , interstitial nephritis , diabetic nephropathy)23 ) . they also recommended factors favoring medical therapy and intervention as follows : progressive decline in gfr during treatment of systemic hypertension , failure to achieve adequate blood pressure control with optimal medical therapy ( medical failure ) , rapid or recurrent decline in the gfr in association with a reduction in systemic pressure , decline in the gfr during therapy with angiotensin - converting enzyme inhibitors or angiotensin receptor blockers , and recurrent congestive heart failure in a patient in whom the adequacy of left ventricular function does not provide an explanation23 ) . the best evidence supporting intervention is for bilateral stenosis with \" flash \" pulmonary edema , but the evidence is from retrospective studies24 - 26 ) .", "the aim of treatment for arvd should include the prevention of cardiovascular and/or renal events . treatment of patients with arvd should include consideration of the following factors : age , co - morbidity , blood pressure , renal function , and kidney size . the results of two recent studies suggest that patients with arvd and stable renal function can be controlled medically . intervention should be considered only in patients with arvd and rapidly progressive cardiac or renal dysfunction . the results of the coral and the post hoc analysis of astral might provide additional evidence for revascularization ." ]

[ "tuberculosis ( tb ) caused by mycobacterium tuberculosis ( m. tb ) continues to be a significant global health problem , affecting millions of people worldwide [ 1 , 2 ] . it is a prevalent infectious disease in china , with 250,000 deaths from tb annually and 6 million active tb patients at present . the global incidence of tb is raising due to coinfection with the human immunodeficiency virus ( hiv ) and the emergence of multidrug - resistant ( mdr ) m. tb strains [ 5 , 6 ] . according to the report of world health organization ( who ) , m. tb will cause 1 billion new cases and about 35 million deaths worldwide by 2020 . therefore , effective treatment and control strategies are urgently needed to counteract the global threat of tb . the current vaccine against tb , m. bovis bacilli - calmette - gurin ( bcg ) , is a live attenuated vaccine which has been widely used throughout the world for many decades . bcg protects children efficiently against miliary and meningeal tb , but protective efficiency against pulmonary tb in adults has been found to vary highly from 0% to 80% . much effort has been devoted to improving bcg efficacy by genetic engineering technology because of its strong immunostimulatory properties and proven safety for human use [ 9 , 10 ] . recombinant bcg ( rbcg ) expressing different immunodominant antigens of m. tb , such as secreted antigens ( ag85b , ag85c , esat-6 , etc . ) or latency associated antigens ( -crystallin , rv2659c , rv3407 and rv1733c , etc . ) , have been tested as candidate vaccines against tb and are demonstrated to have an enhanced ability to induce th1 immune response and protection against m. tb challenge in animal models [ 11 , 12 ] . also , it is definitely no doubt that doses of antigens could subtly influence the magnitude of host immune response as well as protection efficacy , no matter antigen is administered in the form of rbcg , protein , dna , or rna . we have previously reported the construction of a m. tb fura gene operator / promoter ( pfura)-based differential expression system , from which it is feasible to express target antigens of interest in a modular fashion . m. tb chimeric antigen ag856a2 , which is coded by a recombinant ag85a gene with 2 copies of esat-6 gene inserted at the acc i site of ag85a ( see figure s1 in supplementary material available online at http://dx.doi.org/10.1155/2014/196124 ) , shows improved immunogenicity in mice when it is inoculated intramuscularly as a dna vaccine . for the current study , we selected two rbcg strains overexpressing the same chimeric antigen ag856a2 at the maximum difference : rbcg186 and rbcg486 overexpressing the fusion protein under control of the wild - type or the optimized double - mutated fura promoters , respectively . we tested their efficacy as vaccines in c57bl/6 mice , comparing immune response and protection against m. tb challenge . the results showed that mice vaccinated with rbcg186 or rbcg486 generally induced higher antigen - specific effector and memory immune responses , as well as protective efficacies compared to mice vaccinated with the parent bcg strain . however , the two rbcg strains between themselves , which expressed the chimeric antigen ag856a2 at different levels , induced different antigen - specific ifn- production and comparable number of m. tb - specific cd4 t cells expressing il-2 . and the protective efficacies imposed by the two rbcg strains displayed no significant differences although higher protection was observed in rbcg486 vaccinated mice than that in rbcg186 vaccinated mice .", "female specific pathogen - free ( spf ) c57bl/6 mice aged 68 wks were purchased from shanghai slac laboratory animal co. , ltd . ( shanghai , china ) and kept under spf conditions with food and water ad libitum until challenge . infected mice were maintained in a biosafety level 3 ( bsl-3 ) biocontainment animal facility . all animal experiment protocols were approved by chinese science academy committee on care and use of laboratory animals and were performed according to the guidelines of the laboratory animal ethical board of shanghai public health clinical center . \n bcg and its derivative recombinant strains were grown in liquid middlebrook 7h9 broth ( bd difco , usa ) supplemented with 10% oleic acid - albumin - dextrose - catalase enrichment ( oadc , bd difco , usa ) , 0.2% glycerol , and 0.05% tween 80 . cultures in the exponential phase were frozen and stored at 80c . when required , kanamycin was added at a final concentration of 50 or 20 g / ml for e. coli or mycobacteria , respectively . two rbcg strains overexpressing m. tb chimeric immunodominant antigen ag856a2 at different levels were constructed as previously described . briefly , the ag856a2 coding gene , which is a recombinant ag85a gene with 2 copies of esat-6 gene inserted in its acc i site , was amplified from the plasmid template of dna vaccine hg856a and then cloned into mycobacterial differential expression vectors pmfa11 and pmfa41 under control of the prototypical and double - mutated ( mutations : initial codon change from gtg to aug and 6 bp substitution at upstream at - rich region ) fura promoter , respectively . the resulting constructs were electroporated into bcg - danish competent cells and selected on middlebrook 7h11 agar with kanamycin . the rbcg transformants were grown to midexponential phase in complete middlebrook 7h9 broth and then verified the recombinant protein expression by routine western - blotting assay . mice were vaccinated subcutaneously ( s.c . ) with 2 10 colony - forming units ( cfu ) of bcg or rbcgs in 100 l saline . eight weeks after vaccination , groups of 6 mice were either sacrificed for assessment of antigen - specific t cell responses in splenocytes or exposed to an aerosol of virulent m. tb h37rv strain to deposit an inhaled dose of 100200 cfu per lung by an inhalation exposure system ( glas - col , usa ) . ifn- elispot assay kit ( bd biosciences , usa ) was used as described by the manufacturer . plates were coated with anti - ifn- mab overnight at 4c and then blocked with rpmi 1640 medium containing 10% fetal bovine serum ( fbs ) for 1 h at room temperature . splenocytes ( 2.5 10 cells / well ) from immunized mice were isolated , plated , and cultured with 10 g / ml ppd ( statens serum institute , denmark ) or 2 g / ml recombinant ag85a , 6 g / ml recombinant esat-6 to provide stimulation at 37c , 5% co2 for 20 h. after washing the plates with pbs - t20 ( 1 pbs , ph 7.4 , 0.05% tween 20 ) , biotinylated anti - ifn- was added for 2 h at room temperature . streptavidin - hrp was added for 45 min , and the color was developed with 3-amino-9-ethylcarbazole ( aec ) substrate ( bd biosciences ) . an immunospot analyzer ( cellular technology , usa ) was used to count the spots . splenocytes ( 2 10 cells / well ) isolated at 8 weeks after immunization were plated in 96-well plates and stimulated with 10 g / ml ppd for 14 h in the presence of 1 g / ml anti - cd28 ( bd biosciences ) and subsequently incubated for an additional 5 h at 37c following the addition of 0.5 l / ml monensin / golgistop ( bd biosciences ) . following overnight incubation at 4c , the cells were washed in facs buffer ( pbs containing 0.1% sodium azide and 1% fbs ) and subsequently stained for 30 min at 4c for surface markers with mabs as indicated using anti - cd3-pacific blue , anti - cd8-fitc , and anti - cd44-v500 ( all from bd biosciences ) . cells were then washed in facs buffer , fixed , permeabilized using the cytofix / cytoperm kit ( bd biosciences ) according to the manufacturer 's instructions and stained intracellularly for 30 min at 4c using anti - ifn--apc - cy7 , anti - tnf--percp - cy5.5 , and anti - il-2-apc mabs ( all from bd biosciences ) . cells were subsequently washed , resuspended in facs buffer , and then analyzed by multiparameter flow cytometry using a bd facsaria flow cytometer ( bd biosciences ) . for each sample , at least 300,000 events were collected and responses were analyzed using flowjo software ( tree star , usa ) . five weeks after infection , mice were sacrificed and the mycobacterial burden was determined by plating homogenates of lung , excluding right postcaval lobe , and entire spleen onto middlebrook 7h11 agar plates supplemented with 10% oadc enrichment and a 4-antibiotic mixture ( 40 u / ml polymycin b , 4 g / ml amphotericin , 50 g / ml carbenicillin , 2 g / ml trimethoprim ) that prevents growth of contaminating microorganisms . plates were incubated at 37c for 3 weeks in semisealed plastic bags and then cfu were counted and expressed as log10 cfu per organ . then , the embedded lung lobes were sectioned in thickness of 5 m , stained with haematoxylin and eosin ( h & e ) and photographed using a olympus ckx41 microscope ( olympus , japan ) fitted with an olympus dp20 camera connected to a computer . the image pro plus program ( media cybernetics , usa ) was utilized to objectively assess the level of inflammation present in each image . the mean percent of area inflamed was quantified averaging from three to five lung sections of each of the different groups of mice . the antibodies were rabbit polyclonal anti - mouse tnf- ( abcam , uk ) , rabbit polyclonal ifn- antibodies ( invitrogen , usa ) , and rabbit polyclonal anti - mouse inos antibody ( cayman chemical , usa ) . all sections were examined by light microscopy , and the expression of tnf- , ifn- , or inos was semiquantified by intensity of positive signal using image pro plus software . immune responses , protective efficacies , and histopathological staining were tested by one - way anova followed by tukey 's multiple comparison tests of the means .", "we have previously developed a novel mycobacterial differential expression system ( pmfa series ) based on the m. tb fura gene operator / promoter ( pfura ) or its derivatives . ag856a2 was cloned into two of these plasmids , pmfa11 and pmfa41 , which drives low and high gene expression under the control of the wild - type and modified fura promoters , respectively . by transformation of bcg , we obtained two strains , rbcg186 and rbcg486 , which drove correspondingly low and high expression of chimeric immunodominant antigen ag856a2 ( figure 1 , upper panel ) . quantification of the band intensities of western - blot indicated that rbcg486 roughly expressed > 3-fold of ag856a2 than rbcg186 did ( figure 1 , lower panel ) . eight weeks after vaccination , elispot assay of splenocytes showed that more cells in the rbcg486-vaccinated mice expressed ag85a - specific ifn- compared to those of rbcg186- and bcg - vaccinated mice ( figure 2 , left panel ) . also , significantly elevated numbers of splenocytes expressed esat-6-specific ifn- in both rbcg186- and rbcg486-vaccinated mice compared to that of bcg - vaccinated mice ( figure 2 , middle panel ) . additionally , esat-6-specific ifn- was induced at much higher level in rbcg486-vaccinated mice compared to rbcg186 group ( figure 2 , middle panel ) . a similar pattern of ppd - specific ifn- responses as ag85a - specific response was also observed but the difference was not statistically significant , regarding to the comparisons of rbcg486-vaccinated mice and other immunized groups ( figure 2 , right panel ) . we used flow cytometry to measure the capacity of m. tb - specific cd4 t cells from spleens of vaccinated mice producing cytokines ifn- , tnf- , and il-2 at single cell level after stimulation in vitro with ppd . the cytokine - producing cd3cd4 cells were classified into seven subpopulations based on their production of ifn- , tnf- , and il-2 in any combination ( figure 3(a ) ) . significantly increased frequencies of ppd - specific il-2 cd4 t cells were identified in rbcg - vaccinated mice , whereas increased frequencies of ifn- cells were identified in bcg - vaccinated mice even though statistically insignificant ( figure 3(a ) ) . the pie chart of this data clarified the dominance of il-2 cd4 t cells in rbcg - vaccinated mice , while ifn- cd4 t cells dominated the responses of bcg - vaccinated mice ( figure 3(b ) ) . rbcg and bcg - vaccination did not differ in their ability to induce m. tb - specific cd4 t cells producing other combinations of cytokines ( p > 0.05 ) . in accordance , we also observed higher integrated mean fluorescence intensities ( imfi = % frequency mfi ) of il-2 in il-2-producing cd4 t cells , even though it is statistically insignificant ( figure 3(c ) ) . in general , rbcg induced higher antigen - specific cytokine responses as compared to bcg ( figures 2 and 3 ) , and rbcg486 induced higher antigen - specific ifn- response ( figure 2 ) and comparable frequency of m. tb - specific cd4 t cells expressing il-2 ( figure 3 ) . then , we further compared the protective efficacies of rbcg486 , rbcg186 , and bcg against m. tb - challenge . as shown in figure 4(a ) , 5 weeks after challenge all vaccinated mice had a significantly reduced bacillary load in lungs , when compared to the saline - treated mice . vaccination with bcg and rbcg186 resulted in a comparable reduction in bacillary load ( figure 4 ) . however , even though rbcg486 vaccination induced a significantly greater protection when compared to the bcg - vaccinated mice , it showed no difference of protection when compared to the rbcg186-vaccinated mice ( figure 4(a ) ) . the bacillary loads in spleens shared the similar pattern as those in lungs , with rbcg486-vaccinated mice having far fewer bacilli when compared to the saline - treated or bcg - vaccinated mice and having comparable bacilli compared to the rbcg186-vaccinated mice ( figure 4(b ) ) . five weeks after challenge , m. tb infection caused severe pathology changes in saline - treated mice , with about 24.3% of the tissue showing extensive multifocal granulomatous infiltration , characterized by numerous foamy macrophages surrounded by inflammatory cells ( figure 5 ) . however , all the vaccinated groups of mice had significantly reduced pulmonary granulomatous consolidation compared to the unvaccinated mice ( i.e. , 13.42% consolidation in bcg - vaccinated group , 7.24% in rbcg186-vaccinated group , and 4.87% in rbcg486-vaccinated group ) . the rbcg - vaccinated mice showed the mildest pathology , and all of the mice in these two groups had mainly well - preserved alveolar spaces with only a few scattered areas of diffused infiltration ( figure 5 ) . immunohistochemical staining of the lung tissues showed the presence of tnf- , ifn- , and inos in all groups of infected mice and staining was strongest in the granulomatous lesions compared to that in the nongranulomatous areas . five weeks after infection , a very high level of tnf- was observed in the lungs of saline - treated mice ( figure 6(a ) ) ; tnf- staining was extensive in necrotic areas within the advanced coalescent granulomas . vaccination with bcg resulted in the reduced amounts of tnf- expression , even though statistically insignificant . in contrast , rbcg - vaccinated mice , especially rbcg486-vaccinated mice , showed only a little weak staining for tnf- and this was restricted primarily to the granuloma core ( figure 6(a ) ) . similar patterns of ifn- and inos staining were also observed except that there was relatively much weaker staining in the lungs of ( r)bcg - vaccinated mice compared to the saline - treated mice ( figures 6(b ) and 6(c ) ) . similar pattern of tnf- , ifn- , and inos staining was also observed in the infected spleens of vaccinated mice , with the highest staining in saline - treated mice , moderate staining in bcg - vaccinated mice , and the lowest staining in rbcg - vaccinated mice ( figure s2 ) .", "during the past decades , great efforts have been focused on modifications of the current bcg vaccine to develop new anti - tb vaccine candidates . some modified rbcg strains , such as rbcg30 and rbcgurec::hly , have been demonstrated to yield improved protection against m. tb infection in experimental animal model compared to the existing bcg vaccine and have entered into clinical trial . nevertheless , it is promising to keep on optimization of bcg protective immune if two points are being issued . one is the fact that the best immunodominant antigen for tb should be precisely defined . another is that the expression levels of such antigens should be optimal enough to elicit effective immune responses . here , we constructed two rbcg strains overexpressing immunodominant chimeric antigen ag856a2 at varying levels depending upon the strengths of the different fura promoters and then compared the cellular immune response and protection in mice induced by these two rbcg strains . one way to improve bcg efficacy is to overexpress mycobacterial immunodominant antigens to induce optimal host immune responses in the life cycle of bcg within host [ 12 , 19 ] . this kind of strategy reflects that the doses of antigens are one of pivotal factors influencing the protective efficacies of vaccines . demonstrated that protective efficiency of tb subunit vaccines is highly dependent on the antigen dose . they vaccinated mice with different doses of fusion protein ag85b - tb10.4 which were emulsified in adjuvant ic31 , and the higher immune response and protective efficacy were only observed when the antigen was administered in proper doses , and decreasing or increasing of the antigen dose would dramatically dwarf the protection efficacies of the antigens . in our study , the cognate antigen ag856a2 in rbcg186 and rbcg486 was expressed under the control of promoters pfura and pfurama ( figure s1 ) . these two promoters , by their nature , were verified to have varied promoter activities , with pfura the lower one and pfurama the higher one , and were consequently used to develop the rbcg strains overexpressing chimeric antigen ag856a2 at different levels , with lower expression in rbcg186 and higher expression in rbcg486 ( figure 1 ) . and different ag856a2 antigen loading in rbcgs resulted in differential host immune responses , with the higher antigen - specific effector immune response in the rbcg486-vaccinated mice as validated through in vitro ifn- elispot assay ( figure 2 ) . however , we did not observe the significant differences in the qualities of m. tb - specific cd4 t cells coexpressing ifn- , tnf- , and il-2 ( figure 3 ) , nor the protection efficacies and lung inflammations , between the two groups of rbcgs - vaccinated mice ( figures 4 and 5 ) . interestingly , subtly higher percent of polyfunctional cd4 t cells ( ifn-il-2tnf- ) was observed in bcg - vaccinated mice compared to other groups of mice ( figure 3(a ) ) ; however , the protective efficacy elicited by bcg vaccination is not that effective as rbcgs ( figure 4 ) . this contradictory result could be explained with the fact that the lower imfi values of ifn- , il-2 , and tnf- in bcg - vaccinated mice were observed ( see the case of il-2 in figure 3(c ) as representative ) . mfi provides one measure of the quality of the immune response since the cells that are more actively producing cytokine stain more brightly , thus the lower imfi values of cytokines reflected poor quality although mildly higher frequency of polyfunctional cd4 t cells was seen in bcg - vaccinated mice , and this further emphasizes that not only the magnitude but also the quality of vaccine - induced t cells responses are critical to guide development of effective immunization strategies . in addition , higher il-2 secretion , both in the levels of percentage and imfi , were seen in the rbcg486-vaccinated mice than that of bcg group ; this data support our recent findings that il-2 production in the spleens of vaccinated mice after vaccination can predict vaccine efficacy ( kang h , et al . immunology , 2014 ; in press ) . the same explanation might also be used to account for the fact that although the saline - treated mice showed high numbers of cells producing tnf- , the imfi is relative low ( data not shown ) . the quality of t cell response has significant effect on the establishment of protective memory . as with the phenotypic heterogeneous nature of t cells thus , in addition to monitoring exclusively the ifn- response after vaccination , researchers have been focusing on the coexpression of more cytokines at single cell level through flow cytometry technique [ 24 , 25 ] . the rbcg186 or rbcg486 , at least at the time we tested , induced much higher frequencies of il-2 cd4 t cells responding to ppd stimulation in splenocytes compared to the saline - treated or bcg - vaccinated mice after vaccination , which was further confirmed by higher il-2 production when cytokine concentration was measured as imfi value ( figure 3 ) . although il-2 has little direct effector function , it has the ability to expand effector functions of other t cells . in the linear model of differentiation for cd4 th1 cells , il-2 cd4 t cells belong to memory cells and have the potential to differentiate into ifn--producing cells after recalling by the relevant antigens . thus , rbcg186 and rbcg486 , because of the incorporation of chimeric antigen ag856a2 , enhance the memory capacity of host to m. tb pathogen . however , we did not detect any differences of cd4 t cells between rbcg186-vaccinated and rbcg486-vaccinated mice . this may attribute to the short vaccination time window we chose , or the real differences lies in other functions of t cells which is beyond the scope of the t cell functions currently tested and may need to be further exploited in the future . those relevant th1 cytokines ( e.g. , tnf- and ifn- ) , in a larger extent , function through activation of macrophages . tnf- and ifn- synergistically inhibit the growth of m. tb in macrophages through stimulating the production of reactive nitrogen intermediates ( rnis ) [ 27 , 28 ] . as for rnis , inos is the vital enzyme involved for the production of rnis [ 29 , 30 ] . tnf- , ifn- , and inos give proper containment of m. tb in the early stage . at later stage of infection when inhibition or killing of m. tb is well established , their levels of expression will go down to a reasonable value ; otherwise immune - pathological response would happen . rbcgs , especially rbcg486 , induced enhanced protection against m. tb infection in this study ( figure 4 ) . consistent with the protective efficacy , the inflammation responses in the infected lungs alleviated greatly in rbcgs - vaccinated mice after infection ( figure 5 ) . when measuring the expression levels of inflammatory molecules , the rbcgs - vaccinated mice also displayed reduced levels of expression which were in accordance with the remissive granulomatous inflammation ( figures 5 and 6 ) ." ]

[ "a 6-year - old boy presented with a history of penetrating injury to the upper left eyelid sustained while diving head - first into a pond . on presentation , he could only perceive hand movements very close to his face . since a computed tomography ( ct ) scan done at this time did not reveal the presence of any foreign body , the patient was treated for orbital cellulitis . one month later , he returned reporting discharge from the eyelid wound , which had formed a fistula . a repeat ct scan showed an abscess with an empty sinus tract but no distinguishable foreign body [ fig . 1 ] . the patient subsequently developed septic arthritis of the left hip joint , which was treated separately . subsequent re - evaluation of the patient 's left eye revealed a queried perception of light , relative afferent pupillary defect , optic disc pallor , and inferotemporal displacement of the globe . a superonasal quadrant granulation mass was observed from the non - healing wound , but elevation and depression of the globe in adduction were minimally restricted . re - evaluation of the ct scan showed a single hypodense superomedial lesion corresponding to the previously noted sinus tract . a superomedial orbitotomy resulted in the removal of 4 wooden foreign bodies , each approximately 1.5 inches in length . by post - operative day 5 , the patient 's edema and proptosis had resolved . at 1-month follow - up , the eyelid wound was completely healed , and left eye visual acuity had improved to 20/120 . axial ( a ) and coronal ( b ) ct of a 6-year - old boy with a history of penetrating injury shows an empty abscess tract without obvious foreign body . subsequent orbitotomy recovers four wooden fragments ( d ) a 12-year - old boy presented to an outside hospital with fever , vomiting , and a prominent right eye with a painful , swollen lower lid . he had a history of a penetrating injury sustained while diving head - first into a river 12 days previously . after 1 week of treatment with systemic antibiotics , the patient presented to our institution with continued swelling at the injury site . he had an indurated swelling of the lower lid with a discharging sinus , mechanical ptosis , diplopia , eccentric upward displacement of the globe , and 3-mm of proptosis . repeat ct scan showed a hypodense body surrounded by secondary granulomatous inflammation [ fig . 2 ] . post - operatively , the patient showed symptomatic improvement with a reduction in proptosis and a visual acuity of 20/30 in the affected eye [ fig . 3 ] . coronal ( a ) and axial ( b ) ct scans taken one week after initial ct showed no evidence of retained foreign body . ct now shows a hypodense body surrounded by secondary granulomatous inflammation pre - operative ( a ) and post - operative ( b ) photographs of 12-year - old boy with a history of penetrating injury by a 2 inch wooden foreign body ( c ) sustained while pond - diving", "a 6-year - old boy presented with a history of penetrating injury to the upper left eyelid sustained while diving head - first into a pond . on presentation , he could only perceive hand movements very close to his face . since a computed tomography ( ct ) scan done at this time did not reveal the presence of any foreign body , the patient was treated for orbital cellulitis . one month later , he returned reporting discharge from the eyelid wound , which had formed a fistula . a repeat ct scan showed an abscess with an empty sinus tract but no distinguishable foreign body [ fig . 1 ] . the patient subsequently developed septic arthritis of the left hip joint , which was treated separately . subsequent re - evaluation of the patient 's left eye revealed a queried perception of light , relative afferent pupillary defect , optic disc pallor , and inferotemporal displacement of the globe . a superonasal quadrant granulation mass was observed from the non - healing wound , but elevation and depression of the globe in adduction were minimally restricted . re - evaluation of the ct scan showed a single hypodense superomedial lesion corresponding to the previously noted sinus tract . a superomedial orbitotomy resulted in the removal of 4 wooden foreign bodies , each approximately 1.5 inches in length . by post - operative day 5 , the patient 's edema and proptosis had resolved . at 1-month follow - up , the eyelid wound was completely healed , and left eye visual acuity had improved to 20/120 . axial ( a ) and coronal ( b ) ct of a 6-year - old boy with a history of penetrating injury shows an empty abscess tract without obvious foreign body .", "a 12-year - old boy presented to an outside hospital with fever , vomiting , and a prominent right eye with a painful , swollen lower lid . he had a history of a penetrating injury sustained while diving head - first into a river 12 days previously . after 1 week of treatment with systemic antibiotics , the patient presented to our institution with continued swelling at the injury site . he had an indurated swelling of the lower lid with a discharging sinus , mechanical ptosis , diplopia , eccentric upward displacement of the globe , and 3-mm of proptosis . repeat ct scan showed a hypodense body surrounded by secondary granulomatous inflammation [ fig . 2 ] . post - operatively , the patient showed symptomatic improvement with a reduction in proptosis and a visual acuity of 20/30 in the affected eye [ fig . 3 ] . coronal ( a ) and axial ( b ) ct scans taken one week after initial ct showed no evidence of retained foreign body . ct now shows a hypodense body surrounded by secondary granulomatous inflammation pre - operative ( a ) and post - operative ( b ) photographs of 12-year - old boy with a history of penetrating injury by a 2 inch wooden foreign body ( c ) sustained while pond - diving", "the injuries sustained in the cases we present are troubling since swimming and diving in rivers , ponds , and other natural bodies of water is a common pastime of children in rural areas worldwide . penetration injuries by wooden foreign bodies embedded in shallow riverbeds have not been previously recognized as a risk of outdoor swimming and diving . however , in our experience these types of injuries represent a true threat to vision . this danger is compounded by the fact that retained organic foreign bodies are not often immediately apparent on imaging studies , making prompt removal difficult . previous studies report that wood , depending on its level of hydration , can be isodense to either air or orbital fat on ct scan . in our two cases , ct scans taken within a few days of injury did not show a distinct foreign body , but only edema and signs of inflammation . only after the foreign body became infected did a discharging sinus cavity form and become evident on ct scans . while nasr et al . found magnetic resonance imaging ( mri ) to be slightly better at identifying organic foreign bodies , other studies recommend using ct scans for the initial identification of wooden foreign bodies , so the best imaging method remains controversial . as in our case , serial imaging in patients with a high - risk mechanism of injury may be a useful non - invasive method of identifying a retained wooden orbital foreign body . unfortunately , orbital exploration does not always identify the presence of a wooden orbital foreign body . as in our two cases , these fragments are often not lodged in a tissue , but embedded within orbital fat . they are thus mobile within the orbital cavity until becoming enclosed within a discharging sinus . thus , even after a negative orbital exploration , it is important to keep a high index of suspicion for a retained wooden orbital foreign body . in summary , ophthalmologists attending to cases of penetrating orbital injuries sustained during river and pond diving should maintain a high index of suspicion for a retained wooden orbital foreign body and realize that neither orbital exploration nor imaging may be sufficient for diagnosis . consideration should be given to serial imaging in the event of a negative initial scan . a thorough history as to the mechanism of injury , a meticulous exam , and frequent follow - up visits are also of utmost importance ." ]

[ "postcataract surgery endophthalmitis is a relatively uncommon but devastating complication of modern cataract surgery , and there is not complete consensus regarding the ideal practice patterns for prophylaxis . the european society of cataract and refractive surgeons ( escrs ) prospective multi - center interventional trial ( and many other case control , cross - sectional , and longitudinal studies ) supported the hypothesis that the use of icc at the conclusion of cataract surgery reduces the incidence of postoperative endophthalmitis . it is estimated that two to four cases of endophthalmitis per 1000 surgeries can be avoided if surgeons adopt the use of icc , and the absence of an icc prophylactic regimen at a dose of 1 mg/0.1 ml was associated with an almost 5-fold increase in the risk of postoperative endophthalmitis . the injection is expedient , painless , and achieves high antibiotic concentrations in the immediate postoperative period . in addition , intracameral injection may be particularly effective in patients who sustain posterior capsule rupture and would otherwise incur an increased the risk of endophthalmitis . when considering the implementation of any intervention , cost - effectiveness is another important variable . estimated the cost - effectiveness ratio for icc to be $ 1403 per case of postoperative endophthalmitis prevented . many commonly used topical antibiotics are not cost - effective compared with icc , even under optimistic assumptions about their efficacy . another economic analysis comparing different prophylaxis regimens concluded that icc provided the best cost - effectiveness ratio . therefore , the decision to adopt this therapy is supported by studies demonstrating efficacy and cost - effectiveness . the final variable that must be included when one weakness inherent in any meticulously performed clinical trial is that the results may not be generalizable to a more diverse patient population and varying scenarios of care . most clinical trials make great effort to reduce the risk of enrollment in the study , and therefore the safety profile reported may be a best - case scenario . the purpose of this review is to provide an evidence - based review and synthesis of the literature regarding the risks of icc when administered for the prevention of postcataract surgery endophthalmitis , thereby informing decisions regarding best practices for cataract surgery . the categories of risk to be reviewed are : \n risk of anaphylaxis , especially in penicillin or cephalosporin allergic patientsrisk of toxicity at routine clinical dosesrisk of toxicity at increased doses due to compounding errorsidiosyncratic reactions , including toxic anterior segment syndrome ( tass ) . \n risk of anaphylaxis , especially in penicillin or cephalosporin allergic patients risk of toxicity at routine clinical doses risk of toxicity at increased doses due to compounding errors idiosyncratic reactions , including toxic anterior segment syndrome ( tass ) .", "we performed a systematic review of the existing scientific literature using pubmed and google scholar . the key words used were cefuroxime , endophthalmitis and cataract surgeries . all articles were read in full by both authors with the exception of two that were available only as abstracts . the highest level of evidence for each aspect of the intervention was assigned utilizing the oxford center for evidence - based medicine guidelines .", "cross - reactivity between penicillins and most second- and all third- and fourth - generation cephalosporins is negligible . it is generally considered safe to administer a cephalosporin with a side chain that is structurally dissimilar to that of penicillin . in patients with a documented ige - mediated reaction to penicillin , use of cephalosporins with a similar side chain however , cephalosporins with different side chains ( such as cefuroxime ) may be given . it should be noted that the escrs study excluded patients with penicillin or cephalosporin allergy , as did several other large studies . icc injection during cataract surgery was well tolerated in a prospective study of forty penicillin - allergic patients with a negative preoperative cefuroxime skin test . the use of icc in patients with penicillin allergy was explored between 2004 and 2012 in a case control registry study ; the control group was the cohort of patients undergoing cataract surgery under a hospital policy of excluding patients with self - reported penicillin allergy . after a critical review of the literature and pilot study in 817 patients with reported penicillin allergy , this policy was altered , and all patients without a specific history of cephalosporin anaphylactic reaction were administered icc . out of 13,592 subsequent cataract surgeries , there were no reported cases of anaphylaxis or allergic reaction . this study is limited by the registry design , which may underreport or miscategorize adverse events . a similar longitudinal observational study by shorstein et al . reported a decreasing endophthalmitis rate after instituting a standard icc protocol ; there were no reports of anaphylaxis or allergic reaction among 12,609 surgeries , but some patients received other intracameral antibiotics , and it is unclear if penicillin - allergic patients routinely received cefuroxime or other antibiotics such as moxifloxacin or vancomycin . control study comparing the endophthalmitis rates before and after instituting a standard icc regimen ; patients with cefuroxime allergy were excluded , but penicillin - allergic patients received icc . there were no cases of anaphylaxis among 2289 patients receiving icc , but the prevalence of penicillin allergy was not reported . there are two case reports of an anaphylactic reaction in penicillin or cephalosporin allergic patients who received icc . the number of patients from these centers that had received icc were not reported , preventing an estimation of the incidence of this complication . adverse effects that have rarely been reported with routine clinical doses include serous macular detachment , cystoid macular edema ( cme ) , increased central foveal thickness , decreased best - corrected distance visual acuity , anterior chamber inflammation , and vitritis . however , a prospective study found that icc at the standard dose of 1 mg/0.1 ml did not have a statistically significant effect on postoperative macular thickness compared with nonadministration of intracameral antibiotic ; although , this study was under - powered to detect rare events . the escrs study and other longitudinal cohort studies were not designed to assess safety or adverse events as primary endpoints , but a large number of patients enrolled without a reported increase in these adverse events suggests that they are not associated , are masked by confounding factors , or are exceedingly rare . a lingering concern for some ophthalmologists is the risk of ocular toxicity attributable to inadvertent exposure to elevated concentrations ( typically due to compounding errors ) . high doses of cefuroxime are associated with anterior and posterior segment inflammation with fibrin formation , corneal edema , elevated intraocular pressure , serous macular detachment , cme , hemorrhagic retinal infarction , and reduced rod photoreceptor cell function by electroretinography . table 1 summarizes the reported complications related to inadvertent administration of increased concentrations or volumes of cefuroxime . a limitation in assigning risk based on studies such as this is the lack of incidence data ; it is unknown how many patients have received increased doses of icc , and therefore , the rate of these adverse events is unknown . the incidence rate of compounding errors for icc is also unknown and is presumably highly dependent on local factors such as the mechanisms of medication preparation and quality control measures . adverse events attributed to cefuroxime compounding errors tass after cataract surgery has been reported in association with the intracameral use of cefuroxime . reported an ongoing cluster of tass cases at a single center , with a resolution of the outbreak after discontinuing icc in favor of intracameral moxifloxacin . as expected , there was no rechallenge in affected patients to determine conclusively if cefuroxime or other factor contributed to tass . there was also no reported analysis of cefuroxime concentration to ascertain the potential role of dilution errors or other factors related to preparation . no other studies were found that studied the relationship of cefuroxime to tass , or the effects of specific interventions to reduce the incidence of tass related to cefuroxime .", "cross - reactivity between penicillins and most second- and all third- and fourth - generation cephalosporins is negligible . it is generally considered safe to administer a cephalosporin with a side chain that is structurally dissimilar to that of penicillin . in patients with a documented ige - mediated reaction to penicillin , use of cephalosporins with a similar side chain however , cephalosporins with different side chains ( such as cefuroxime ) may be given . it should be noted that the escrs study excluded patients with penicillin or cephalosporin allergy , as did several other large studies . icc injection during cataract surgery was well tolerated in a prospective study of forty penicillin - allergic patients with a negative preoperative cefuroxime skin test . the use of icc in patients with penicillin allergy was explored between 2004 and 2012 in a case control registry study ; the control group was the cohort of patients undergoing cataract surgery under a hospital policy of excluding patients with self - reported penicillin allergy . after a critical review of the literature and pilot study in 817 patients with reported penicillin allergy , this policy was altered , and all patients without a specific history of cephalosporin anaphylactic reaction were administered icc . out of 13,592 subsequent cataract surgeries , there were no reported cases of anaphylaxis or allergic reaction . this study is limited by the registry design , which may underreport or miscategorize adverse events . a similar longitudinal observational study by shorstein et al . reported a decreasing endophthalmitis rate after instituting a standard icc protocol ; there were no reports of anaphylaxis or allergic reaction among 12,609 surgeries , but some patients received other intracameral antibiotics , and it is unclear if penicillin - allergic patients routinely received cefuroxime or other antibiotics such as moxifloxacin or vancomycin . control study comparing the endophthalmitis rates before and after instituting a standard icc regimen ; patients with cefuroxime allergy were excluded , but penicillin - allergic patients received icc . there were no cases of anaphylaxis among 2289 patients receiving icc , but the prevalence of penicillin allergy was not reported . there are two case reports of an anaphylactic reaction in penicillin or cephalosporin allergic patients who received icc . the number of patients from these centers that had received icc were not reported , preventing an estimation of the incidence of this complication .", "adverse effects that have rarely been reported with routine clinical doses include serous macular detachment , cystoid macular edema ( cme ) , increased central foveal thickness , decreased best - corrected distance visual acuity , anterior chamber inflammation , and vitritis . however , a prospective study found that icc at the standard dose of 1 mg/0.1 ml did not have a statistically significant effect on postoperative macular thickness compared with nonadministration of intracameral antibiotic ; although , this study was under - powered to detect rare events . the escrs study and other longitudinal cohort studies were not designed to assess safety or adverse events as primary endpoints , but a large number of patients enrolled without a reported increase in these adverse events suggests that they are not associated , are masked by confounding factors , or are exceedingly rare .", "a lingering concern for some ophthalmologists is the risk of ocular toxicity attributable to inadvertent exposure to elevated concentrations ( typically due to compounding errors ) . high doses of cefuroxime are associated with anterior and posterior segment inflammation with fibrin formation , corneal edema , elevated intraocular pressure , serous macular detachment , cme , hemorrhagic retinal infarction , and reduced rod photoreceptor cell function by electroretinography . table 1 summarizes the reported complications related to inadvertent administration of increased concentrations or volumes of cefuroxime . a limitation in assigning risk based on studies such as this is the lack of incidence data ; it is unknown how many patients have received increased doses of icc , and therefore , the rate of these adverse events is unknown . the incidence rate of compounding errors for icc is also unknown and is presumably highly dependent on local factors such as the mechanisms of medication preparation and quality control measures .", "tass after cataract surgery has been reported in association with the intracameral use of cefuroxime . reported an ongoing cluster of tass cases at a single center , with a resolution of the outbreak after discontinuing icc in favor of intracameral moxifloxacin . as expected , there was no rechallenge in affected patients to determine conclusively if cefuroxime or other factor contributed to tass . there was also no reported analysis of cefuroxime concentration to ascertain the potential role of dilution errors or other factors related to preparation . no other studies were found that studied the relationship of cefuroxime to tass , or the effects of specific interventions to reduce the incidence of tass related to cefuroxime .", "the efficacy of icc as a prophylaxis for postcataract surgery endophthalmitis has been well established , but concerns regarding the risks of this intervention remain . the consensus of the literature from systemic administration of antibiotics is that the risk of cross - reactivity between second - generation cephalosporins ( such as cefuroxime ) and penicillin is very low . our review of the literature supports a low rate of anaphylactic reactions , even among penicillin - allergic patients . a postal survey conducted among consultant ophthalmic surgeons working in the national health service ophthalmic departments in england revealed that of 262 consultants , 103 ( 37% ) used cefuroxime in patients allergic to penicillin . we propose that an acceptable practice pattern would be to consider icc in all cataract surgery patients , including those with a history of penicillin allergy ; administration to those patients with cephalosporin allergy may be considered , but skin testing may be indicated to identify those patients that are at increased risk of anaphylaxis and should not receive icc . alternative intracameral antibiotics , such as vancomycin and moxifloxacin , may reduce the risk of anaphylaxis in cefuroxime - allergic patients , but the efficacy of those interventions has been less well established . the latest survey of members of the american society of cataract and refractive surgeons revealed that 30% of the united states ophthalmologists were utilizing intracameral antibiotics , compared to 70% of european respondents . however , many us cataract surgeons believe that intra - cameral antibiotics are unnecessary , based on concerns about the methodology of the escrs and other studies , or that the absolute benefits do not outweigh the risks of dilution errors and toxicity . not surprisingly , a clinical study demonstrated that the mathematical accuracy of a dilution protocol does not ensure dosage accuracy in a real - world clinical scenario . the authors suggest that a commercial preparation would likely reduce the risk of dilution errors , but commercial preparations of intracameral antibiotic agents may not be financially viable in all health care environments . implementation of icc should include measures to audit and provide quality assurance of the cefuroxime dilution protocol .", "half of the risk - benefit equation of icc has been solved to the satisfaction of most clinicians ; the efficacy is clear . the remaining barriers to more widespread adoption include concerns about risks such as anaphylaxis , dilution errors , and toxicity ( especially with noncommercial preparation ) and finally , the additional costs of this therapy . since endophthalmitis is a rare event , even a slight increase in the risk of prophylactic therapy may negate the potential benefits . our review and synthesis of the literature regarding the risks of cefuroxime therapy support the following recommendations : \n cefuroxime may be used safely in patients with penicillin allergy ( level 2a evidence)efforts to reduce the risk of dilution errors may include the use of a commercially prepared product , or strict quality assurance measures ( level 4 evidence)routine measures to reduce tass should also apply to the use of cefuroxime ( level 5 evidence ) ; even though , there is no proven association . \n cefuroxime may be used safely in patients with penicillin allergy ( level 2a evidence ) efforts to reduce the risk of dilution errors may include the use of a commercially prepared product , or strict quality assurance measures ( level 4 evidence ) routine measures to reduce tass should also apply to the use of cefuroxime ( level 5 evidence ) ; even though , there is no proven association . future studies may further define the cost - effectiveness of icc , and continued efforts to reduce the risk attributable to dilution errors are indicated . finally , comparative studies of the efficacy and safety of cefuroxime compared to other intracameral antibiotics are needed to help define the optimal endophthalmitis prophylaxis regimen for our patients undergoing cataract surgery .", "", "" ]

[ "thyroid cancer is the most common endocrine neoplasia and accounts for 1% of all human cancers ( 1 ) . medullary thyroid carcinoma ( mtc ) is a rare neoplasm of the calcitonin - secreting thyroid cells and accounts for 510% of all thyroid cancers . mtc can occurs as sporadically ( 75% ) or as a part of the autosomal dominantly inherited forms ( 25% ) , ( 2 , 3 ) . the inherited type of mtc can be divided in three clinically distinct forms : multiple endocrine neoplasia type2a ( men2a ) , multiple endocrine neoplasia type2b ( men2b ) , and familial mtc ( fmtc ) ( 4 ) . men2a is defined by mtc , bilateral pheochromocytoma , and multiple tumors of the parathyroid glands ( parathyroid adenomas , primary hyperparathyroidism or hpt ) , within a single patient or family . men2b is characterized by the early development of an aggressive form of mtc in all affected individuals ( typically during the first year of life ) , pheochromocytoma , the absence of hyperparathyroidism , and visible physical stigmata such as raised bumps on the lips and tongue , ganglioneuromas of the intestine , marfanoid body habitus with skeletal deformations . fmtc is characterized by a strong predisposition to mtc in families with a very low incidence of other endocrinopathies related to men2 ( 1 , 5 ) . the molecular pathology of inherited mtcs is constitutive of ret ( rearranged during transfection ) proto - oncogene . the ret gene is located on chromosome 10q11.2 , consisting of 21 exons and encodes a tyrosine kinase receptor . this complex plays a critical role in cell proliferation and differentiation of tissues derived from neural crest cells , such as c - cells of thyroid gland ( 5 , 6 ) . ret is a tyrosine kinase protein and includes three domains ; a large extracellular domain containing a cysteine - rich region and a series of cadherin homology domains , a trans - membrane domain , and an intracellular tyrosine kinase domain , required for ret phosphorylation and downstream signaling ( 5 , 7 ) . this protein is activated by binding a soluble ligand of the glial cell - line - derived neurotrophic factor ( gdnf ) family and requires a co - receptor of the gdnf family receptors ( gfr ) ( 8) . the majority of men2a families are associated with one of the six point mutations in conserved cysteine residues in exon10 ( codons 609 , 611 , 618 , and 620 ) or exon11 ( codons 630 , 634 ) in the extracellular domain of the ret ( 2 , 5 , 810 , 12 ) . in fmtc cases , ret mutations are mainly detected in the same six codons as for men2a and also in exon13 ( codon 768 ) , or in exon15 ( codon 891 ) , in the intracellular region of ret ( 5 , 8 , 12 ) . mutation of codon 918 in ret exon16 in the tyrosine kinase domain , accounts for the vast majority of patients with men2b ( 5 , 8) . for the first time , ret polymorphisms g691s and s904s were described in 1994 ( 13 , 14 ) . recent studies have found g691s in exon11 , s904s single neucleotide polymorphisms in exon15 of the ret pathway to be associated with the risk of developing sporadic mtc ( smtc ) ( 7 ) . it seems , two of these ret snps ( g691s and s904s ) may modify the age at onset of mtc tumor in family members ( 5 , 15 ) but fabienne lesueur et al . have rejected this hypothesis ( 7 ) . in the present study , we report the frequency of g691s / s904s haplotype in iranian mtc patients and their relatives .", "over the last ten years , one hundred ninety mtc patients , were referred to cellular and molecular research center of shahid beheshti university of medical sciences in order to ret genetic screening . this study has been approved by the ethics committee of cellular and molecular research center , research institute for endocrine sciences , shahid beheshti university of medical sciences . a questionnaire was used to collect information about age , sex , and history of neoplasia . if any mutation was found in patients , their first - degree relatives were invited for screening . 121 first - degree relatives from 31 index cases comprised 57 males and 64 females , with meansd age 29.0916.34 years . genomic dna was extracted from peripheral blood leucocytes using standard salting out / proteinase k method and stored at -20c . for identification of ret variant 691 ( rs1799939 , codon 691 of exon 11 , ggt > agt , gly > ser ) and 904 ( rs1800863 , codon 904 of exon 15 , tcc > tcg , ser > ser , ) , dna samples were amplified using the polymerase chain reaction ( pcr ) and the specific oligonucleotides primers ( table1 ) . the exon11 running profile was constituted initial denaturation at 96 c for 1min and , followed by 30 cycles with 96 c for 45s , annealing at 60 c for 1min dependent on the primer sequences , and extension at 72c for 45s , with a final extension at 72 c for 10 min . sequences of oligonucleotide primers used for pcr amplification of exons 11 , 15 of the ret pcr reaction for exon 15 was constituted initial denaturation at 94c for 3min and , followed by 35 cycles of 94c for 30s , annealing starting at 56c for 1min , 72c for 1min , and a final extension at 72c for 10min . the amplimers were confirmed for the presence or absence of mutations by direct dna sequencing method ( abi 3100 genetic analyzer and big dye terminator v3.1 cycle sequencing kit , applied biosystems , california , usa ) . to detect the ret mutations and snps , sequences were analyzed by chromas 2.33 software and were also compared with the reference ret gene sequence using web based tool ncbi blast .", "over the last ten years , one hundred ninety mtc patients , were referred to cellular and molecular research center of shahid beheshti university of medical sciences in order to ret genetic screening . this study has been approved by the ethics committee of cellular and molecular research center , research institute for endocrine sciences , shahid beheshti university of medical sciences . a questionnaire was used to collect information about age , sex , and history of neoplasia . if any mutation was found in patients , their first - degree relatives were invited for screening . 121 first - degree relatives from 31 index cases comprised 57 males and 64 females , with meansd age 29.0916.34 years .", "genomic dna was extracted from peripheral blood leucocytes using standard salting out / proteinase k method and stored at -20c .", "for identification of ret variant 691 ( rs1799939 , codon 691 of exon 11 , ggt > agt , gly > ser ) and 904 ( rs1800863 , codon 904 of exon 15 , tcc > tcg , ser > ser , ) , dna samples were amplified using the polymerase chain reaction ( pcr ) and the specific oligonucleotides primers ( table1 ) . the exon11 running profile was constituted initial denaturation at 96 c for 1min and , followed by 30 cycles with 96 c for 45s , annealing at 60 c for 1min dependent on the primer sequences , and extension at 72c for 45s , with a final extension at 72 c for 10 min . sequences of oligonucleotide primers used for pcr amplification of exons 11 , 15 of the ret pcr reaction for exon 15 was constituted initial denaturation at 94c for 3min and , followed by 35 cycles of 94c for 30s , annealing starting at 56c for 1min , 72c for 1min , and a final extension at 72c for 10min . the amplimers were confirmed for the presence or absence of mutations by direct dna sequencing method ( abi 3100 genetic analyzer and big dye terminator v3.1 cycle sequencing kit , applied biosystems , california , usa ) .", "to detect the ret mutations and snps , sequences were analyzed by chromas 2.33 software and were also compared with the reference ret gene sequence using web based tool ncbi blast .", "among 311 participants , 18 dna samples did not have enough quality , so were excluded from the study . we analyzed germline dna mutations of ret gene in 181 iranian mtc patients and 112 relatives , with a total of 293 members . the patients included , 33 fmtc , 6 men2a , 2 men2b , 1 pheochromocytoma and 145 apparently smtc cases ( table 2 ) . the frequency of females in our population was a little higher than males , but this ratio was not significant ( 160 vs. 133 , p > 0.05 ) . specifically , we found 2 germline polymorphisms of ret gene at codon691 ( ggt > agt , exon 11 , rs1799939 ) that causes glycine to serine amino acid substitution , and codon 904 ( tcc > tcg , exon 15 , rs1800863 ) that does not lead to an ami - no acid alteration . furthermore , the allele frequencies of each of these snps were similar in all patients and relatives ( 21.5% and 10.75% , respectively ) . the frequency of patients with medullary thyroid carcinoma as the g691s and s904s variants were in complete linkage disequilibrium , so the results were grouped together and referred to as g691s / s904s haplotype ( fig.1 ) . the analysis of g691s / s904s ret gene haplotype showed that 104 of 181 ( 57.45% ) mtc patients and 55 of 112 ( 49.1% ) relatives had this haplotype . in particular , 82 mtcs and 47 relatives were heterozygous and 22 mtcs and 8 relatives were homozygous for the g691s / s904s haplotype ( table 3 ) . there was not significant correlation between age of diagnosis and the presence of g691s / s904s haplotype . the frequency of g691s and s904s variants in the population the frequency distribution of g691s and s904s variants among mtc patients and their relatives", "in this study , we found two variants of ret gene , g691s ( ggt > agt , exon 11 , rs1799939 ) and s904s ( tcc > tcg , exon 15 , rs1800863 ) that are cosegregated together as a haplotype , suggesting that these polymorphisms are in linkage disequilibrium with each other . the assessment of the occurrence of two polymorphic changes g691s , and s904s in our population is similar to the study performed by lucieli ceolin et al . unfortunately , in our study we did not have control group to compared with healthy population , but some studies have demonstrated that the ret variant g691s is more frequent in mtc patients than in the general population ( 16 , 17 ) . it has also been postulated that such variants are relatively common in the population which may confer a much higher attributable risk in the general population than mutations in high penetrance cancer susceptibility genes ( 5 , 11 ) . some studies support our data that both g691s and s904s snps are associated with sporadic mtc and men2a ( 5 , 7 , 18 ) . two studies have shown that this haplotype may modify the age at onset of mtc tumor in family members ( 5 , 15 ) , however , this hypothesis is controversial ( 7 ) . the ret - g691s polymorphism has been suggested as a genetic modifier in men2a ( 15 ) . overall , these data strengthen the potential role of the ret - g691s polymorphism in mtc . one of the probable mechanisms is that the g691s polymorphism seems to enhance ret on - cogenicity of other distinct mutations affecting ret ( 1820 ) , on the other hands , bases exchange in the dna molecule could create a new alternative splicing site , leading to the synthesis of a truncated protein , erroneous ligand binding , micro - rna binding , change of structure and mrna stability as well as a number of copies , and also the change in the secondary structure of proteins ( 16 ) . the ret gene mutations are a critical factor in patient management , e.g. to decide on total or partial thyroidectomy or the age at which the child should be subject to surgery ( 6 ) . ret gene mutations are very important in mtc patient management , especially in decision making for total or partial thyroidectomy or the age at which the child should be subject to surgery . in the case of inherited mutations , those who test negative for germline mutations will be reassured ; those who test positive for germline mutations will be screened for calcitonin levels and will be offered a prophylactic thyroidectomy depending on the complete clinical and biochemical picture .", "this data showed the frequency of g691s / s904s haplotype among iranian mtc patients and their family , for the first time . even though g691s / s904s haplotype are not considered as oncogenic mutations at this time , its functional role should be investigated . further researches on this issue can contribute toward clarifying the prevalence of this haplotype and its probable modifying effect on the phenotypic characteristic of mtc .", "ethical issues ( including plagiarism , informed consent , misconduct , data fabrication and/or falsification , double publication and/or submission , redundancy , etc ) have been completely observed by the authors ." ]

[ "after initial establishment and derivation of human embryonic stem cells ( hesc ; thomson et al . , 1998 ; reubinoff et al . , 2000 ) first the infection free status of the donors has to be addressed , in europe couples are tested before any fertility treatment is offered , but the cells themselves have to be tested , too ( hovatta , 2011 ) . second , optimized good manufacturing practice ( gmp ) compliant systems must be implemented for derivation , scaling - up , banking of cells , and their corresponding quality assurance controls ( unger et al . , 2008 ; ausubel et al . , 2011 ) . the culture systems currently encounter the problem of suboptimal quality of xeno - free culture constituents . thus strategies are needed to overcome this difficulty ( sidhu et al . , 2008 ) . steps have been taken ; initially , hesc were grown on irradiated mouse feeders , later human fore - skin fibroblast were used ( hovatta et al . , 2003 ) , now we can use gmp compliant coating substrates specially designed for hesc growth ( rodin et al . , steps were also taken for the generation defined xeno - free gmp compliant medium for derivation and for expansion ( ludwig et al . , 2006 ;", "the potential of somatic cell reprogramming via expression of specific transcription factors and thus the generation of hesc induced pluripotent stem cells ( hipsc ; takahashi and yamanaka , 2006 ; takahashi et al . , 2007 ) has the advantage that they could be generated from the recipient patients own cells . there is no deep understanding of the effects that the reprogramming events have ; for instance on extracellular signaling ( okita et al . , 2011 ) , and the way that this could lead to immune reaction . hence fast reactivity is already present in healthy individuals for controlling any rapidly amplifying cells ( dhodapkar et al . , 2010 ) . un - silenced expression of the reprogramming factor oct-4 might then cause undesired immunoreactivity on the transplanted cells . immunoreactivity toward graft - derived hipsc of the same genetic background was also shown in animal models ( zhao et al . , 2011 ) . for successful reprogramming of somatic cells , many epigenetic changes must occur in an adequate manner . dna methylation changes during reprogramming must occur in important developmental and oncogenic regions , which increases the oncogenic risk of the reprogrammed cells ( doi et al . there is an additional risk for abnormalities and high tumorigenic potential , especially if c - myc is used as one of the transcription factors ( okita et al . , 2007 ) . also , genetic and epigenetic stability and large - scale genomic rearrangements after reprogramming and subsequent culture ( kim et al . , 2010 ; gore et al . , 2011 ; hussein et al . , 2011 ; lister et al . , 2011 ) it is also important to address the safety of long - term culture , as shown recently ; the occurrence of chromosomal rearrangements in long - term culture of 125 hesc and 11 hipsc ( amps et al . , 2011 ) .", "there is a consensus that undifferentiated pluripotent stem cells ( psc ) will not be used directly in any clinical transplantations procedure , but instead their psc derived differentiated cells recently , results using hesc derived dopaminergic neurons have shown correct phenotype differentiation and grafting potential given by no tumor formation , maintenance of the grafted cells , and functional recovery in parkinsonian animal models in mice , rats , and monkeys ( kriks et al . , 2011 ) . the protocols designed for this cell replacement assay were optimal regarding the phenotype , quantity of the cells , functionality , and immunological properties . integration of transplanted cells was achieved when single cells were transplanted , the use of proper biodegradable scaffolds must also be considered . in addition to this initial report regarding the neural lineage , differentiation protocols for other cell types are needed . even if transplantation in animal models is successful , it is important to generate safety strategies before clinical trials to appropriately remove undifferentiated psc from their psc derived therapeutic cells . strategies such as inserting suicide gene ( drobyski et al . , 2003 ; uchibori et al . , 2009 ) might have controversial outcomes under clinical trials given their safety ( yi et al . alternatively , strategies such as removal of undifferentiated cells using antibodies might be safer ( tang et al . , 2011 ) .", "as discussed earlier , an optimal engraftment and cell replacement strategy should account for a minimal immune reaction in the recipient . this immune reaction occurs because the immune system of the recipient recognizes the grafted cells as foreign material or mismatched cellular components and thus generates a cascade of events that ultimately results in destruction and rejection of the grafted cells . this destruction can also compromise the recipient s immune status ( petersen et al . , 1975 ) . immunoreactivity toward the graft is mainly caused by t cell response toward unmatched major histocompatibility complex ( mhc ) ; in humans called human leukocyte antigen ( hla ) . if the profile is unmatched , it will result in rejection ( lechler et al . , 2005 ) . this rejection can occur via direct allorecognition of the donor antigen presenting cells ( apc ) or via indirect recognition of apoptotic cells ingested by the recipients apc , in both cases apcs presenting unmatched mhcs ( walsh et al . , 2004 ) . several groups have studied mhc profiles of hesc and their differentiated cells ( swijnenburg et al . , 2008 ; pearl et al . , 2011 ) . findings are that undifferentiated cells express mhc i antigens , though at low levels compared with somatic cells ; but they do not express mhc ii molecules ( drukker et al . , 2002 , 2006 ; li et al . , 2004 ) . during in vitro differentiation toward germ lineages , embryoid body ( eb ) formation , or teratoma formation mhc i expression increases dramatically ( drukker and benvenisty , 2004 ) . also culture methods of hesc can change antigen expression levels ( rajala et al . , 2010 ) . careful selection of culture conditions , both for the undifferentiated hesc and for their differentiated derivatives is needed . human embryonic stem cells adopts the expression of non - human cell surface markers if exposed to such substances during culture ( martin et al . , 2005 ; hisamatsu - sakamoto et al . , 2008 ) hence , optimal culture conditions must be xeno - free from the initial derivation and onward . these culture conditions must be carefully analyzed and scientific consensus must be achieved in order to raise current methodologies .", "challenges with the immunoreactivity of the transplantable cells could be addressed by rigorous immunosuppressive treatments . unfortunately , this is not desired , since there is a clear correlation between the length and intensity of exposure to immunosuppressive therapy and post - transplant risk of malignancy and tumor aggressiveness ( gutierrez - dalmau and campistol , 2007 ) . an interesting solution is costimulatory blockage of t cell response ( grinnemo et al . , 2006 , 2008 ; swijnenburg et al . , 2008 ; pearl et al . , 2011 . this immunosuppression strategy will generate tolerance to the grafted cells and thus increase graft survival ; initial pharmaceutical agents have been developed and pending clinical applications to the fda are to give in the near future more information .", "in this mini - review we highlighted the most important areas to be considered under a cell replacement therapy . the possibility of using hipsc derived therapeutic cells in cell replacement therapies requires still long - term studies in non - human animal models addressing the questions of immunogenicity , epigenetic and genetic stability of these cells , and the optimized differentiation of the cells . the importance of profiling immunogenic markers as part of the stem - ness characterization and profiling of cells allocated in stem cell banks must be consider . such information has to be well protected so that it will not be lost in any given situation . adequate culture conditions , supporting correct immunogenicity of the cells under a transplantation assay is also required . next , the management of immunosuppression schemes must aim to a minimal time influencing the immunological status of the recipient . from all the information obtained , these profiles can then be used in combination with methodologies focused at monitoring the status of the transplanted cells . in a given scenario that undesired cells persist in the transplant , adequate counteracting actions have immediately to be taken . such possibilities have to be tested and the removal of undesired effects confirmed before starting cell transplantations .", "the authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest ." ]

[ "to report two cases of femtosecond laser - assisted small incision deep lamellar endothelial keratoplasty ( dlek ) for patients with corneal endothelial decompensation by fuchs dystrophy and glaucoma", "irvine , ca ) with 15 khz of repetition rate , was used for a 9.5 mm diameter by 400 m thickness donor corneal lamellar dissection .", "in case 1 , the graft was clear and compact without interface haze , orbscan showed smooth and regular corneal surface , specular microscopy was unremarkable without sign of corneal endothelial damage , and optical coherence tomography showed uniform graft well attached to recipient stroma with minimal interface reflection at 2 months postoperation . in case 2 , the graft was clear and compact with minimal interface haze at 1 month postoperation . femtosecond laser - assisted small incision dlek was safe and technically feasible in our cases ; however , further evaluation is required to determine long - term effects .", "the donor corneoscleral button was mounted in a dedicated artificial anterior chamber ( bausch & lomb , st . this was to assure a donor corneal thickness between 500 and 565 m , in order to approximate a graft thickness of 100 to 165 m . the femtosecond laser ( intralase ; intralase corp . , irvine , ca ) was then used to create a corneal flap of 9.5 mm diameter and 400 m thickness . femtosecond laser parameter settings were as follows : raster energy 3.6 j , spot separation 10 m , line separation 10 m , side cut energy 3.8 j , spot size 2.4 m , and repetition rate 15 khz . after laser application , stromal and side cut adhesions were fully released and the anterior corneal flap was fully lifted . the donor corneoscleral button was then placed in medium and transported to the operating room , where the anterior flap was excised with scissors and an 8.0 mm trephine ( katena products , inc . , denville , nj ) was used to punch out the posterior donor corneoscleral button . the recipient corneal lamellar dissection and graft transplantation was performed as previously described.5,6 briefly , following an 8.0 mm epithelial marking and 5.0 mm scleral incision , a deep lamellar pocket was created to approximately 75 - 85% of corneal thickness . the posterior recipient disc was then excised with cindy scissors ( bausch & lomb ) using the 8.0 mm epithelial mark as a template . the excised posterior recipient disc was removed from the lamellar pocket and spread over recipient corneal epithelium to verify size . an 8.0 mm pre - prepared posterior donor disc was then folded , endothelial side inside , with a layer of viscoelastic ( healon ; pharmacia , peapack , nj ) coating the endothelium and inserted into the anterior chamber through the small incision using forceps . the folded donor disc was opened and attached to the recipient stromal bed by injecting air underneath the graft . the scleral wound was closed with 2 or 3 interrupted 10 - 0 nylon sutures and air was replaced with balanced salt solution to normalize intraocular pressure ( iop ) . femtosecond laser - assisted small incision dlek was performed in the right eye of a 73-year - old male with fuchs dystrophy ( fig . 1 ) . preoperative uncorrected visual acuity ( ucva ) and best spectacle corrected visual acuity ( bscva ) was 20/100 and 20/80 respectively and manifest refraction was + 0.75 -1.7530 . donor corneoscleral button lamellar dissection was performed using intralase femtosecond laser ( intralase corp . ) , set at a depth of 400 m and flap diameter of 9.5 mm . ucva and bscva was 20/150 and 20/100 respectively and manifest refraction was + 2.75 -1.0050 . corneal topography showed smooth and regular corneal surface and specular microscopy was unremarkable without sign of corneal endothelial damage ( fig . optical coherence tomography ( oct ) findings showed compact and uniform graft , well attached to the recipient stromal bed with minimal interface reflection ( fig . 3 ) . femtosecond laser - assisted small incision dlek was performed in the left eye of a 94-year - old female with corneal edema , glaucoma , and dry type age - related macular degeneration ( armd ) . her preoperative ucva and bscva was 20/400 and 20/200 respectively and her manifest refraction was -1.00 -1.7595 . iop was well controlled with topical medication ( cosopt ; merck & co. , whitehouse station , nj ) . postoperation , the graft was clear and compact , iop was 19 mmhg , and ucva was 20/400 . at one month , the graft was clear and compact with minimal interface haze ; iop measured 31 mmhg . anti - glaucoma medication ( alphagan ; allergan , irvine , ca ) was added and topical steroid tapered . we were not able to perform further examinations due to follow - up loss at two months postoperation . all methods adhered to the declaration of helsinki of the world medical association for research involving human subjects .", "the donor corneoscleral button was mounted in a dedicated artificial anterior chamber ( bausch & lomb , st . this was to assure a donor corneal thickness between 500 and 565 m , in order to approximate a graft thickness of 100 to 165 m . the femtosecond laser ( intralase ; intralase corp . , irvine , ca ) was then used to create a corneal flap of 9.5 mm diameter and 400 m thickness . femtosecond laser parameter settings were as follows : raster energy 3.6 j , spot separation 10 m , line separation 10 m , side cut energy 3.8 j , spot size 2.4 m , and repetition rate 15 khz . after laser application , stromal and side cut adhesions were fully released and the anterior corneal flap was fully lifted . the donor corneoscleral button was then placed in medium and transported to the operating room , where the anterior flap was excised with scissors and an 8.0 mm trephine ( katena products , inc . , denville , nj ) was used to punch out the posterior donor corneoscleral button . the recipient corneal lamellar dissection and graft transplantation was performed as previously described.5,6 briefly , following an 8.0 mm epithelial marking and 5.0 mm scleral incision , a deep lamellar pocket was created to approximately 75 - 85% of corneal thickness . the posterior recipient disc was then excised with cindy scissors ( bausch & lomb ) using the 8.0 mm epithelial mark as a template . the excised posterior recipient disc was removed from the lamellar pocket and spread over recipient corneal epithelium to verify size . an 8.0 mm pre - prepared posterior donor disc was then folded , endothelial side inside , with a layer of viscoelastic ( healon ; pharmacia , peapack , nj ) coating the endothelium and inserted into the anterior chamber through the small incision using forceps . the folded donor disc was opened and attached to the recipient stromal bed by injecting air underneath the graft . the scleral wound was closed with 2 or 3 interrupted 10 - 0 nylon sutures and air was replaced with balanced salt solution to normalize intraocular pressure ( iop ) .", "femtosecond laser - assisted small incision dlek was performed in the right eye of a 73-year - old male with fuchs dystrophy ( fig . preoperative uncorrected visual acuity ( ucva ) and best spectacle corrected visual acuity ( bscva ) was 20/100 and 20/80 respectively and manifest refraction was + 0.75 -1.7530 . donor corneoscleral button lamellar dissection was performed using intralase femtosecond laser ( intralase corp . ) , set at a depth of 400 m and flap diameter of 9.5 mm . ucva and bscva was 20/150 and 20/100 respectively and manifest refraction was + 2.75 -1.0050 . corneal topography showed smooth and regular corneal surface and specular microscopy was unremarkable without sign of corneal endothelial damage ( fig . 2b and c ) . optical coherence tomography ( oct ) findings showed compact and uniform graft , well attached to the recipient stromal bed with minimal interface reflection ( fig .", "femtosecond laser - assisted small incision dlek was performed in the left eye of a 94-year - old female with corneal edema , glaucoma , and dry type age - related macular degeneration ( armd ) . her preoperative ucva and bscva was 20/400 and 20/200 respectively and her manifest refraction was -1.00 -1.7595 . iop was well controlled with topical medication ( cosopt ; merck & co. , whitehouse station , nj ) . postoperation , the graft was clear and compact , iop was 19 mmhg , and ucva was 20/400 . at one month , the graft was clear and compact with minimal interface haze ; iop measured 31 mmhg . anti - glaucoma medication ( alphagan ; allergan , irvine , ca ) was added and topical steroid tapered . we were not able to perform further examinations due to follow - up loss at two months postoperation . all methods adhered to the declaration of helsinki of the world medical association for research involving human subjects .", "posterior keratoplasty refers to removal of diseased posterior corneal layers ( endothelium , descemet 's membrane , and posterior stroma ) and replacement by partial - thickness donor tissue . this procedure can be an attractive alternative to penetrating keratoplasty ( pkp ) in treating corneal endothelial diseases such as fuchs dystrophy and aphakic and pseudophakic bullous keratopathy.13 - 15 the endothelial replacement technique via scleral incision was first described by melles and later modified by terry and ousley to ' deep lamellar endothelial keratoplasty ' ( dlek).3,4 recent modification includes introducing the folded donor disc through the a small incision.6 one problem in performing dlek is the technical difficulty associated with manual lamellar dissection . it is not only time consuming , but also has the potential risk of corneal perforation.8 moreover , even with uncomplicated dissection , the plane may not be smooth and uniform , which results in interface scarring and reduction in potential best vision.6,7 in a recent paper , azar and coauthors described microkeratome - assisted posterior keratoplasty.16 given that laser - assisted in situ keratomileusis ( lasik ) shows almost no interface haze on the cornea,17,18 this technique 's potential advantage is less interface scarring than manual dissection . however , microkeratome - assisted lamellar dissection does have the risk of corneal perforation in deeper dissection . recently , the femtosecond laser was introduced in refractive surgery fields for lasik flap creation . according to recent papers , it demonstrated improved flap uniformity and better flap thickness predictability than mechanical microkeratomes.9 - 12,19 similar to the microkeratome , femtosecond laser technology has evolved . after initial procedures with a 2 khz laser in 1996 , 15 khz ( 2003 ) , 30 khz ( 2005 ) , and soon after , 60 khz ( 2006 ) engines were introduced . pulses are scanned and placed in a vertical pattern for trephination ( side ) cuts or in a spiral or raster ( zigzag ) pattern to achieve lamellar cuts . the smoothness of optical surfaces is determined by programmable parameters : energy per pulse , separation of adjacent laser spots ( spot separation ) , and raster pattern row spacing ( line separation ) . the closer the laser spots , the less energy required.20 the intralase system scans tissue at a repetition rate which depends on laser engine capacity . higher repetition rates allow use of lower pulse energy and closer spot / line separation settings , which results in a smoother lamellar interface , an easier anterior corneal flap lift , and a faster procedure . the newer 60 khz engine permits a line / spot separation down to 66 m and energy less than 1 j per pulse , which may show superior efficiency for harvesting the posterior corneal disk.21 one concern during preoperative femtosecond laser - assisted donor eye posterior lamellar discs ( plds ) preparation is the possibility of endothelial cell loss ( ecl ) . ecl has been reported at 4% after 150 to 200 m thick endothelial side plds preparations , and did not appear to be caused by laser pulse energy.22 another in vitro study reported 4.3% versus 7.7% ecl after 30 khz laser lamellar cutting compared to 15 khz laser for horizontal lamellar cuts at corneal depth of 400 m and 9.5 mm diameter.23 favorable outcomes are consistent with histological results showing adjacent thermal damage to be on the order of 1 m.24 clinical results from case 1 showed relatively intact postoperative endothelium status , which was comparable to previous reports . moreover , the femtosecond laser is expected to be applied in full - thickness pkp . cuts are customizable to achieve different graft geometric configurations , potentially allowing for sutureless , self - adhesive , or shaped keratoplasty . two or more side / lamellar cut segments can be combined to create patterns for shaped keratoplasty , including top - hat ( larger diameter cut posteriorly ) , mushroom ( larger diameter cut anteriorly ) , zigzag , and christmas tree patterns.25 peripheral wound edge shaping can provide stronger healing by increasing surface area , reduce corneal astigmatism by decreasing suture number , reduce donor - host topographic distortion disparity , and quicken visual recovery . following we describe small incision dlek by femtosecond laser for donor corneal lamellar dissection . before performing femtosecond laser - assisted donor lamellar dissection , we measured donor corneal thickness by ultrasound pachymetry . if corneal thickness was thicker than 565 m , glycerin was applied to dehydrate the cornea , and avoid a thinner graft than intended , as well as to ascertain graft thickness of 100 to 165 m for transplantation . the laser was then used to create a corneal flap of 9.5 mm diameter and 400 m thickness . afterwards , two possible methods to obtain the posterior donor disc were used . in the first method , this bi - hinged donor corneoscleral button is then placed in medium , transported to the operating room , and punched out with an 8.0 mm trephine . separation of the anterior and posterior donor corneal disc follows . in the second method , stromal and side cut adhesions this donor corneoscleral button is placed in medium and transported ; following , the anterior flap is excised using scissors and the posterior part is punched out with an 8.0 mm trephine . in our cases although the disadvantage is using scissors for anterior cap removal , there are other advantages . by removing the anterior cap , it is easier to visualize the posterior donor button edge , which may reduce a decentered donor cut . furthermore , anterior and posterior donor disc separation is much easier , since the anterior flap is fully lifted and removed before trephination . case 1 clinical results showed a clear and compact graft without interface haze at two months postoperation . these findings were further confirmed in oct , which showed a clear and uniform graft with minimal interface reflection and good graft attachment . despite good clinical findings , postop visual acuity was not as expected . however , the patient was satisfied and his vision fluctuation ( previously worse in the morning ) was eliminated . considering findings and short - term follow - up , we may expect further improvement with time . however , postop visual acuity did not improve because of low visual potential from dry armd and glaucoma . unfortunately , this patient had an iop increase at one month postoperation and was unable to follow - up . visual acuity after either pkp or dlek is mainly a function of retinal macular potential and cornea optical quality . in studies of pkp in young patients with keratoconus , postoperative visual results are uniformly better compared to results in older fuchs ' dystrophy patients , despite similar graft problems of high or irregular astigmatism.26 this suggests that older maculas , may play a role in visual loss after any form of corneal transplantation , including dlek . in contrast to pkp where the cornea contributes to refractive visual loss , often resulting from high or irregular astigmatism , in dlek , topography is usually normal and corneal visual loss is most likely attributed to the donor - recipient stromal interface . the interface in dlek may account , on average , for 1 line of visual loss compared to the individual macular potential vision.27 other potential corneal factors include increased corneal thickness and posterior corneal curvature . how this irregularity influences visual acuity requires further investigation . due to lack of long term follow - up and small case number , we can not fully determine potential advantages of ' femtosecond laser - assisted small incision dlek ' . however , these cases demonstrate graft uniformity , technical feasibility , and potential application of femtosecond laser in lamellar keratoplasty . further evaluation with longer follow - up and more cases would reveal potential advantages . unfortunately , the use of femtosecond laser in recipient corneas is currently limited by the institutional review board . also the femtosecond laser is not approved for cuts deeper than 400 m ; therefore recipient cornea posterior lip creation requires scissors . hopefully in the near future , we can use the femtosecond laser and perform both donor and recipient corneal lamellar dissection ." ]

[ "the prevalence of diabetes has explosively increased worldwide , leading to an increase in the number of patients who suffer from diabetic vascular complications such as diabetic nephropathy ( dn ) . dn is not only the leading cause of end - stage kidney disease but also a significant risk factor for cardiovascular disease . although the treatment for dn is important to improve patients ' prognosis , the current treatment remains suboptimal and therefore novel approaches for dn are urgently needed . dipeptidyl peptidase-4 inhibitors ( dpp4i ) have been recently introduced in clinic as a new oral hypoglycemic agent . dpp4 is a serine exopeptidase and processes the substrates that have either n - terminal proline or alanine including glucagon - like peptide-1 ( glp-1 ) and glucose - dependent insulinotropic polypeptide ( gip ) known as incretin hormones . these incretin hormones are secreted from the small intestine after foods intake and induce the release of insulin from the pancreatic beta cells in the islets of langerhans . in addition to the reduction in the blood glucose level , it has been reported that dpp4i possesses properties and can protect the cardiovascular system , kidney , liver , and bone from injuries . since it has been reported that receptors for incretins were not expressed within glomerulus , protective effects of dpp4i for kidney might depend on another substrate for dpp4 . for instance , stromal cell - derived factor-1 ( sdf-1 ) , one of the substrates for dpp4 , can be stabilized by dpp4i . because sdf-1 is the most important protein for the recruitment and homing of bone marrow - derived regenerative stem cells , increased levels of sdf-1 through dpp4 inhibition has reportedly increased the intragraft number of progenitor cells that had contributed to the recovery from ischemia - reperfusion lung injury throughout the mammalian system . it has also been reported that dpp4i decreased the levels of urinary albumin excretion in diabetic patients [ 9 , 10 ] ; however , the mechanism behind how dpp4i ameliorates kidney injuries is not yet clear . pituitary adenylate cyclase - activating polypeptide ( pacap ) is one of the substrates of dpp4 . pacap belongs to the glucagon superfamily of peptides and was originally purified from sheep hypothalamus in 1989 . pacap is able to potentiate cyclic adenosine monophosphate ( camp ) production in pituitary cells and has a diverse array of biological functions , particularly neuroprotective and general cytoprotective roles , such as anti - apoptosis and anti - inflammation . although the highest concentrations are observed in the nervous system , a wide variety of tissues , such as heart , pancreas , liver , and kidney , produce pacap ; secreted pacap also has protective effects on the different types of tissues and cells through the three different receptors : pac1 , vpac1 , and vpac2 . pacap was found to exist in two forms : 38-amino - acid , a major form , and 27-amino - acid , a short one , truncated at c - terminal and to a much lesser extent in blood stream , respectively . recently , it has been reported that dpp4 degraded pacap ( 127 ) and ( 138 ) to form pacap ( 327 ) and ( 338 ) . it has been reported that pacap has protective effects in the kidney against various insults , including ischemia / reperfusion injury , drug - induced nephrotoxicity , and myeloma light chain - induced nephropathy . pacap treatment in streptozotocin - induced diabetic animals decreased cytokine expression and prevented kidney injuries . these results indicated that pacap has protective roles in the kidney ; however , it is unknown which cell types pacap affects and how it decreases cytokine expression . therefore , in this study , we investigated the effects of pacap on kidney cells and the mechanisms of how pacap decreases the expression of inflammatory cytokines .", "lipopolysaccharide ( lps ) and u-73122 ( phospholipase c ( plc ) inhibitor ) were obtained from sigma aldrich and h89 ( protein kinase a ( pka ) inhibitor ) was obtained from cell signaling . cultured mouse podocytes , transformed by ectopic expression of cyclin - dependent kinase 4 , were kindly provided by dr . podocytes were maintained in roswell park memorial institute ( rpmi ) 1640 medium containing 10% fetal bovine serum ( fbs , sigma aldrich , usa ) , penicillin ( 100 u / ml ) , and streptomycin ( 100 u / ml , sigma aldrich , usa ) . all procedures were performed in accordance with the guidelines of the research center for animal life science of chiba university of medical science . six- to nine - week - old male c57bl/6j mice were purchased from clea japan ( japan ) and housed in cages and maintained on a 12 h light/12 h dark cycle . the glomeruli were isolated by dynabeads ( invitrogen , norway ) perfusion technique as previously described . the kidney tissues were dissected from the mouse , fixed in oct compound , and stored at 80c until use . several 6 m thick frozen sections were prepared and fixed with ice - cold methanol , air - dried for 30 min at room temperature , and then blocked with blocking buffer containing 2% bovine serum albumin ( bsa ) and 0.05% tween-20 in pbs . after washing with tween in pbs ( pbst ; 0.1% tween-20 in pbs ) , the slides were coincubated with vpac1 antibody ( 1 : 50 dilution , santa cruz : sc-30019 ) , podocalyxin ( 1 : 200 dilution , r&d systems : mab1556 ) , and toll - like receptor 4 ( 1 : 50 dilution , santa cruz : sc-10741 ) . the slides were imaged by the axio observer d1 ( zeiss ) or with a confocal laser scanning microscope ( leica lsm5 pascal ) . the podocytes were cultured in lab - tek ii chamber slides ( nalge nunc international ) , deprived of serum for 24 h , and stimulated with 100 ng / ml lps for 1 h. then the podocytes were fixed in ice - cold methanol for 10 min , rinsed with pbs , and incubated in a blocking buffer containing 0.5% bsa and 0.25% tween-20 in pbs for 1 h at room temperature . the slides were then incubated with an anti - nuclear factor - kappa b ( nf-b ) antibody ( 1 : 50 , santa cruz : sc-372 ) overnight at 4c , washed several times with pbs , and then incubated with 1 : 1000 dilution of fluorescent - conjugated secondary antibody ( alexa fluor 488 goat anti - rabbit igg , invitrogen ) for 1 h at room temperature . the slides were then washed with pbst , nuclear - stained with hoechst 33342 , and mounted with a fluorescence mounting medium . for the evaluation of immunostaining for nf-b , the cells that had accumulated nf-b in their nuclei were counted at 10 randomly selected areas . the total rna was extracted using the purelink rna mini kit ( ambion : 12183 - 018a ) according to the manufacturer 's protocols . two micrograms of total rna were reverse - transcribed with the superscript iii reverse transcriptase kit ( invitrogen : 18080 ) . the complementary dna product was then subjected to pcr using the system with different pairs of oligonucleotide primers that were shown in supplemental table 1 , available online at http://dx.doi.org/10.1155/2015/727152 . the cycling conditions were as follows : a denaturation step at 94c for 30 s followed by 30 cycles , annealing at 55c for both pac1 and -actin and 58c for vpac1 for 30 s , and elongation at 72c for 30 s with the final extension at 72c for 7 min . the pcr products were separated by gel electrophoresis on a 2% agarose gel with ethidium bromide ; the signals were quantified using a chemidoc mp imagelab pcsystem ( bio - rad ) . quantitative pcr was performed in the 7500 fast real - time pcr system ( applied biosystems ) using the fast sybr green master mix ( applied biosystems : 4385612 ) . pcr conditions were set for incubation at 95c for 20 s followed by 40 cycles of 3 s at 95c and 30 s at 60c . podocytes were lysed in a sds sample buffer containing 0.5 m tris - hcl , 10% sds , glycerol , bromophenol blue , and 3% 2-mercaptoethanol . they were boiled at 95c for 10 min , and then the protein was fractionated on 10%15% polyacrylamide gels ( e - pagel , atto corporation , japan ) . the protein was transferred to pvdf membranes ( immobilon - p transfer membrane ) ; the membranes were blocked for 1 h at room temperature to block the nonspecific binding of the protein and incubated for 18 h at 4c with primary antibodies . the primary antibodies that were used were as follows : anti - vpac1 antibody ( 1 : 200 dilution , santa cruz : sc-30019 ) , anti - phospho - p44/42 mapk ( extracellular signal - regulated kinase ( erk1/2 ) ) antibody ( 1 : 1000 dilution , cell - signaling : number 9106 ) , and anti - p44/42 mapk ( erk1/2 ) antibody ( 1 : 1000 dilution , cell - signaling : number 9102 ) . the blots were then washed and incubated with second antibodies , peroxidase - conjugated anti - rabbit immunoglobulins ( 1 : 2500 dilution , ge healthcare ) , or goat anti - mouse igg - hrp ( 1 : 2500 dilution , santa cruz : sc-2055 ) for 1 h at room temperature . after washing for several times , the antibody binding sites were visualized using an ecl western blotting detection system ( ge healthcare : rpn2106 ) . the blots were quantified using a chemidoc mp imagelab pcsystem ( bio - rad ) . podocytes were plated in 96-well dishes at 50% confluency and transfected with 10 ng per well camp response element- ( cre- ) lux construct that contained consecutive camp response element by lipofectamine ltx and plus reagents ( invitrogen ) . at six hours after transfection , cells were deprived of serum for 48 h. and then , the cells were stimulated with pacap for 1 h. the luciferase activities in the cell lysate were measured in a 1420 arvo sx multilabel counter ( wallac , inc . , gaithersburg , md ) using the dual luciferase reporter assay system ( promega , madison , wi ) . to correct for potential variation in transfection efficiency , prl - tk vector ( promega ) was cotransfected in all experiments . statistical analyses were done using sas 9.3 and/or microsoft office excel by student 's unpaired t - test .", "pacap works as a ligand and binds with specific receptors in order to transduce intracellular signals . therefore , we first examined in which cell types pacap transduces intracellular signal within the glomeruli . reverse transcriptase pcr revealed that mrna for vpac1 but not pac1 was detected in glomeruli as shown in figure 1(a ) . immunohistochemistry revealed that vpac1 was primarily expressed in podocalyxin - positive cells ( figures 1(b ) and 1(c ) ) . complete absence of signal was observed when primary antibodies were omitted ( data not shown ) . rt - pcr ( figure 1(a ) ) and western blotting ( figure 1(d ) ) also confirmed that the vpac1 mrna and protein were expressed not only in isolated glomeruli but also in cultured podocytes . because vpac1 , a pacap receptor , was expressed on podocytes , we next examined whether pacap acted on podocytes . it has been reported that pacap binds with vpac1 , which is coupled with gs protein and induces rapid camp production , which ultimately activates the pka pathway . ten nm pacap significantly increased the cellular contents of camp in a time dependent manner ( supplemental figure 1 ) . increased levels of camp in the presence of pacap was associated with increased levels of camp responsive element promoter activities ( figure 2(a ) ) and phosphorylated camp response element binding protein ( creb ) ( figure 2(b ) ) . these results indicated that pacap primarily sent signals to glomerular podocytes , especially activating the camp / pka pathway in the podocytes . it has been reported that pacap also played an anti - inflammatory role in peripheral and central tissues . toll - like receptors ( tlrs ) are the principal mediators of innate immunity and are reportedly activated by bacterial endotoxins . the tlr4 proteins were localized to podocytes and endothelial cells by immunohistochemistry as shown in figure 3 . as shown in figure 4 , lps , a ligand of tlr4 , significantly increased the expression of il-6 and mcp-1 . in the presence of pacap , the increased expressions of il-6 and mcp-1 were significantly attenuated . the expression of tlr2 , tlr4 , and myeloid differentiation primary response gene 88 ( myd88 ) , a tlr adaptor protein , but not that of il-1 receptor associated kinase-1 ( irak1 ) , a down steam signaling molecule of myd88 , was decreased in the presence of pacap . it has been reported that pacap activates not only adenylate cyclase ( ac ) , which eventually activates the pka signaling pathway , but also plc , which leads to an increase in intracellular calcium signaling . then , we examined the effect of h89 , an inhibitor of the pka signaling pathway , and of u-73122 , a known plc inhibitor , on the increased levels of mcp-1 . mcp-1 expression was reversed by h-89 but not by u-73122 as shown in figure 5 . these results indicated that pacap suppressed the expression of mcp-1 through the camp / pka - dependent signaling pathway . it has been reported that lps can activate tlr4 and subsequently the myd88 transfers signals by activating nf-b and mitogen - activated protein kinase , which eventually results in the expression of proinflammatory cytokines . therefore , we examined the effects of pacap on the nf-b transnuclear localization and phosphorylation of erk . figures 6 and 7 showed that , in the presence of lps , nf-b transnuclear localization and phosphorylation of erk were significantly increased and pacap significantly ameliorated both .", "in the present study , we reported that vpac1 , a pacap receptor , was exclusively expressed in glomerular podocytes . pacap , a substrate for dpp4 , activated the camp / pka signaling pathway in cultured podocytes and inhibited the expression of inflammatory cytokines , which were induced by lps / tlr4 signaling . pacap was first identified 25 years ago and has become one of the most studied neuropeptides [ 11 , 12 ] . pacap is expressed not only throughout the nervous system but also in peripheral tissues , such as the gastrointestinal tract , the endocrine tissues , and the urinary tract . in addition to widespread expression of pacap , it reportedly has a variety of biological functions that are primarily neuroprotective and general cytoprotective roles through the specific receptors , such as pac1 , vpac1 , and vpac2 . for instance , pacap has protected the kidney from ischemia - induced kidney injuries , myeloma injuries , cisplatin - induced renal failure , cyclosporine a - induced nephrotoxicity , and dn . these renoprotective actions appeared to depend on the anti - inflammatory actions on circulating cells , glomerular cells , and tubular cells . the kidney is injured by a wide variety of insults leading to chronic kidney diseases ( ckd ) . among ckd reported that pacap - treated streptozotocin - induced diabetic mice had fewer histological changes , such as pas - positive areas within the glomeruli , tubular damage , and arteriolar hyalinosis compared with the controls . pacap treatment also decreased the expression of a number of cytokines that were upregulated in diabetic conditions . however , the specific cell types that are affected by pacap directly have not been reported . jean cr reported that vpac1 , but not pac1 and vpac2 , was expressed in human glomeruli . in agreement with this previous report , we found that vpac1 was expressed within the glomerulus and localized its expression to podocytes . recent studies of podocyte - expressed genes have considerably enhanced our knowledge of the molecular mechanisms of glomerular filtration . a number of podocyte - expressed genes , such as nephrotic syndrome type-1 ( nphs-1 ) , nephrotic syndrome type-2 ( nphs-2 ) ; actin - related proteins such as -actinin 4 , inverted formin 2 , and cd2-associated protein ( cd2ap ) ; and cytoplasmic signaling molecules , such as phospholipase c , epsilon-1 ( plce1 ) and transient receptor potential cation channel , subfamily c , member 6 ( trpc6 ) , were all involved in maintaining the cytoskeletal dynamics . therefore , among the glomerular cells , the podocytes are becoming the most highlighted cell type in the field of glomerular research of most glomerular diseases . thus , it is intriguing that pacap may give signals to podocytes . because it has been reported that pacap has anti - inflammatory effects in a wide variety of disease models , we focused on the anti - inflammatory effects of pacap on cultured podocytes . among the inflammatory signals , tlr , a sensor in the innate immune system , has been highlighted in the development of dn . it has been reported that tlr2 and tlr4 have been expressed in podocytes and activated in diabetic conditions . activated tlrs have been reported to induce proinflammatory cytokines in podocytes and a disorganized podocyte cytoskeletal structure which eventually led to proteinuria . therefore , our finding about the inhibition of podocytes ' tlr - related signaling in the presence pacap is significant in terms of treating dn . indeed , it has been recently reported that the treatment of pacap effectively counteracted diabetes induced podocyte injury in vivo . tlr is a conserved family of pattern recognition receptors , which is triggered by microbial pathogens , fatty acids , uric acids , oxidative stress , and high glucose . when tlr is activated , it recruits different adaptor molecules , such as myd88 and irak-1 . activated myd88-dependent or myd88-independent pathway engages the activation of erk and nf-b signaling , which results in inflammatory cytokines . because pacap attenuated both activation of erk and nf-b in our case it has reported that administration of pacap attenuated the expression of tlrs and its adaptor protein in kidney . in agreement with these previous reports , lps - induced inflammation related genes , such as mcp-1 and il-6 , and tlr signals related genes , such as tlr2 , tlr4 , and myd88 but not irak-1 were suppressed by pacap in this study . it has been reported that lps - induced expression of tlr2 has been suppressed by ciprofloxacin through the production of prostaglandin ( pg ) e2 but not through pka in monocyte / macrophages . because pge2 was reportedly induced in the presence of pacap , ns398 , an inhibitor of pge2 , was tested and was not able to reverse the effects of pacap , which attenuated the tlr4 expression ( data not shown ) . thus , the precise mechanisms of how pacap inhibits the expression of tlrs and myd88 need to be further analyzed . dpp4i has been introduced in clinic and has become one of the most promising options to treat diabetic patients owing to their effectiveness in glucose lowering and low risk of hypoglycemia and weight gain . dpp4i stabilizes its substrates and incretins ( glp-1 and gip ) , which are the main substrates for lowering blood glucose . beyond the hypoglycemic action , it has been reported that dpp4i has numerous potential benefits in diabetic vascular complications , including dn . the possible renoprotective effects of dpp4i include the reduction of oxidative stress and anti - inflammation and the improvement of endothelial dysfunctions through incretin - dependent and -independent pathways . since it has been reported that glp-1 receptor was not detected in glomerulus and we were also able to detect neither glp-1 receptor nor gip receptor both in glomerulus and cultured podocyte ( supplemental figure 2 : expression of glp-1 receptor and gip receptor were evaluated by rt - pcr ) , incretin independent pathway might have roles in protecting against dn . pacap is n - terminally truncated by dpp4 , and it has been reported that dpp4-degraded pacap loses its insulinotropic effects . because the n - terminal of pacap is a high - affinity site for vpac1 binding , dpp4-degraded pacap may reduce the signals through vpac1 . we also confirmed that the treatment of linagliptin , dpp4i , inhibited the degradation of pacap which secreted from cultured cells ( supplemental figure 3 : linagliptin protect pacap from degradation ) . in this study , we demonstrated that pacap had anti - inflammatory effects on podocytes , leading to an assumption that dpp4i protects kidney from injuries through the stabilization of pacap . nevertheless , we have not confirmed that pacap has protective roles in vivo . because the half - life of pacap injected into mice and humans is between 2 and 10 min due to enzymatic degradation , truncated pacap is required to be produced in order to get pacap more stable in vivo without losing receptor activating effects .", "in conclusion , we have shown that pacap has anti - inflammatory effects on glomerular podocytes . because treatment options for dn are still limited , pacap may be a good candidate for prevention / attenuation of dn . however , more study is definitely needed to prove this possibility ." ]

[ "opsoclonus - myoclonus - ataxia syndrome ( omas ) , also called kinsbourne syndrome or dancing eye syndrome , is a serious , rare , and often chronic neurological disorder . omas consists of three main symptoms : opsoclonus ( conjugate , multidirectional , chaotic eye movements ) , myoclonus ( nonepileptic limb jerking that can also involve the head and face ) and truncal ataxia , which cause gait imbalance . omas is generally a paraneoplastic or parainfectious entity , but in children , it is most commonly associated with occult neuroblastoma ( nb ) in about 50% of cases and between 2% and 3% of children with nb have omas . although most patients with nb and omas have good survival rates , 70%80% of these children will have long - term neurologic sequelae . in pediatric age , omas may be associated with neuroblastic tumors ( nb , ganglioneuroblastoma , or ganglioneuroma ) . the diagnosis of omas may be difficult in some patients and should be considered even when only some of the features are present . international consensus has described three of the following four diagnostic criteria should be present to describe the typical syndrome : ( 1 ) opsoclonus , ( 2 ) myoclonus / ataxia , ( 3 ) behavioral change and/or sleep disturbance , and ( 4 ) nb . we present a retrospective study of five children presented to the pediatric oncology clinic ( poc ) of all india institute of medical sciences ( aiims ) with a diagnosis of opsoclonus - myoclonus syndrome ( oms ) . the objective of this study was to describe the clinical profile and outcome of this disorder .", "the medical records of all children presented to poc , department of pediatrics , aiims , with a diagnosis of opsoclonus - myoclonus were retrieved and reviewed . the diagnosis of opsoclonus - myoclonus was based on a constellation of any three of the four clinical features : opsoclonus , myoclonus , ataxia , and encephalopathy / irritability / behavioral change / sleep disturbance . outcome was assessed on follow - up by direct assessment and by telephonic communication ( in one patient ) .", "a total of six patients with a diagnosis of opsoclonus - myoclonus were admitted over 4-year period [ table 1 ] . opsoclonus , myoclonus , ataxia , and encephalopathy / behavioral abnormalities ( irritability / sleep disturbance ) were present in all children at presentation . the duration of symptoms at the time of presentation was in the range of 610 months . clinical profile and outcome in six children with opsoclonus - myoclonus syndrome the reasons for the delay in diagnosis included misdiagnosis by peripheral physicians and delayed referral to our center . all children had paraneoplastic opsoclonus - myoclonus ( two left paravertebral ganglioneuroblastoma , two left paravertebral nb , one left paravertebral plus left psoas muscle ganglioneuroblastoma , and one right paravertebral ganglioneuroblastoma ) [ figures 13 ] . the diagnosis of tumor was made on contrast - enhanced computed tomography scan ( ct ) and magnetic resonance imaging ( mri ) of the chest , abdomen , and pelvis ( 3 ct scan and 3 mri ) . tests for urinary excretion of vanillylmandelic acid ( vma ) were negative in all cases . iodine-131 metaiodobenzylguanidine scintigraphy scan ( i-131 mibg ) was performed in all cases , but it detected mibg concentrating tumor only in two cases . ( case 2 ) ( original ) axial section showing well - defined enhancing soft - tissue mass lesion ( 3.5 cm 2 cm 1.4 cm ) seen in the left upper psoas muscle extending into left neural foramen in between l2 and l3 vertebra up to dura mater ( a and b ) ( case 3 ) axial section and coronal section showing right paravertebral mass of size 1.5 cm 0.6 cm 2.4 cm at the level of d6 to d8 vertebral body ( a and b ) ( case 5 ) axial and coronal section showing well - defined left paravertebral mass lesion 2 cm 1.8 cm 2.9 cm at the level of d6 to d8 vertebral body an initial diagnosis of omas was made in all children . three children received injection adrenocorticotropic hormone ( acth ) ; two children received injection acth plus injection methylprednisolone followed by oral steroids over 4 weeks . one child ( case 1 ) also received intravenous immunoglobulin ( ivig ) and oral clonazepam and risperidone in view of abnormal behavior ( excessive irritability , biting , and head banging ) . one child ( case 5 ) had spontaneous improvement and complete recovery without specific immunomodulator therapy . of the six cases with paraneoplastic oms , four cases were treated with surgical resection of tumor and chemotherapy . in one child ( case 5 ) , treatment was deferred by parents but on telephonic communication that the child was symptoms free and healthy at 9 months after presentation to us . in another case ( case 6 ) , she received only injection acth , surgery , and chemotherapy were denied by parents . after follow - up of 24 months , the child was asymptomatic , but ct of the abdomen revealed mass of same size that was documented 2 years back . one child ( case 3 ) died of febrile encephalopathy ( not related to disease ) .", "other names for oms include omas , paraneoplastic opsoclonus - myoclonus ataxia , kinsbourne syndrome , myoclonic encephalopathy of infants , dancing eyes - dancing feet syndrome , and dancing eyes syndrome . in our study , all six children were between 2 and 3 years of age , similar to the trend seen in other reports , in which oma was uncommonly diagnosed before 1 year of age . one possible explanation for the low incidence in infancy may be due to ability to develop specific antibodies is less in younger infants . we observed , alike to previously published studies , a similar median age at clinical presentation , acute / subacute onset of presentation , association of nb , and response to immunomodulator therapy . we have found poor sensitivity of urine vma in our case series with similar findings reported by brunklaus et al . we also observed poorer sensitivities for mibg scintigraphy scan in contrast with the reported high sensitivity ( up to 95% ) for detection of nb as compared to an abdominal ct scan / mri . in adults , oms is seen in relation to malignancies of the breast and lung ( small cell carcinoma ) , in association with antibodies which are directed against an rna binding antigen from the anti - hu antibody . this antibody is not found in children in oms of nb . in children , nb which presents with oms is more mature , shows a favorable histology , and absence of n - myc oncogene amplification than tumors which occur without symptoms of oms . oms , the most frequent paraneoplastic syndrome in pediatric age group , remains a challenge for treatment . various immunomodulatory therapies have been used including steroids , ivig , cyclophosphamide , and more recently , rituximab . patients with nb and oma have been reported to have excellent survival . according to children 's cancer group data , the 3-year survival rate for children with nonmetastatic nb and oma was 100% ( reported from 675 patients who were diagnosed between 1980 and 1994 ) in compared to 77% in non - oma . described a case series of 11 patients ( largest case series from india ) with a diagnosis of opsoclonus - myoclonus ( of the 11 , 4 had paraneoplastic etiology ) and concluded that children with paraneoplastic opsoclonus had more relapses and had a poor outcome as compared to an idiopathic group . , in our series , all six children had paraneoplastic oms , and all had good outcome . this tumor is known to have spontaneous regression . our one child ( case 5 ) had spontaneous symptomatic resolution , and another child ( case 6 ) is doing well without surgery and chemotherapy . we have seen a good therapeutic response with immunomodulators , including acth , ivig , and corticosteroids . because of the small number of patients , it is difficult to compare these therapies . no one had relapse in our series contradicting to those reported by tate et al . ( up to 52% ) could be due to the small number of patients in our study . in most children with nb , the characteristic feature is the response of this syndrome to corticosteroids and acth and the resolution of the neurological signs when the nb is treated . children often develop lifelong neurologic sequelae that impair motor , cognitive , language , and behavioral developments . observed that in older children , late effects are less likely seen because basic motor and cognition have already been formed . rudnick et al . reported that children with more advanced stage disease had better outcomes with regard to neurologic sequelae . one possible explanation for this association may be that patients with advanced stage disease require more intensive therapy that usually includes chemotherapy . russo et al . suggested that chemotherapy may improve neurologic outcome in children with oma and nb , possibly due to its immunosuppressive effects . in our study , five children with oms responded with acth and steroids ; one child recovered spontaneously . the outcome was good in our all children , whereas in the study by tate et al . , the outcome was independent of etiology . other studies have also observed better outcome of idiopathic opsoclonus - myoclonus . we did not observe progressive developmental and behavioral problems in our patients , which could be due to small number of patients and short follow - up .", "oms is a rare disorder , but it affects children more frequently than adults and exhibits an excellent rate of survival . screening for an occult nb is necessary in all children with this syndrome . oms ( paraneoplastic ) had a good outcome without significant neurological deficits in our experience .", "", "" ]

[ "to the surprise and deep disappointment of all involved in the treatment of lung cancer , several large trials did not demonstrate any benefit of tyrosine kinase inhibitors ( tkis ) as an addition to chemotherapy [ 13 ] . basic and clinical research then focused on mutations of the gene for epidermal growth factor receptor ( egfr ) as a predictive factor for response to monotherapy with tkis and to development of new compounds with broader and/or irreversible inhibition . the biological basis for the negative experience with combined treatment gefitinib and erlotinib met all three standard criteria for inclusion in a combination with chemotherapy : activity as monotherapy , different mechanism of action , and different toxicity . why , then , did the combination not work ? as explained in a recent editorial , we believe that the cells of tumors sensitive to tkis are pushed into the g-0 phase of the cell cycle and therefore become resistant to cytotoxic drugs . if antagonism between the two classes of drugs is really the biological basis for the aforementioned negative experience , then an optimal combination of tkis and chemotherapy should be in an intermittent , rather than a continuous schedule . this brief report presents a single - institution experience on intermittent chemotherapy and tki in a small series of patients with advanced adenocarcinoma of the lung . our hypothesis was that intermittent treatment would lead to superior time to progression , when compared to experience with chemotherapy alone . if confirmed , such a result would be a solid basis for a randomised clinical trial .", "patients eligible for the trial were chemonave with microscopically confirmed adenocarcinoma of the lung , had stage iii b ( wet ) or iv according to uicc - tnm classification ( 6th edition ) , had smoking history of less than 10 packs in years , had an ecog performance status 0 or 1 , and had adequate parameters of hematological , liver , and renal function to receive cisplatin - based chemotherapy . in the absence of neurological symptoms , patients with brain metastases were eligible and were treated with brain irradiation only in case of intracranial progression . all patients had their diagnosis confirmed by biopsy or cytology . at the time when the trial was initiated , testing for egfr mutations was not available . within three weeks prior to treatment , the precise extent of the disease was determined by chest x - ray and ct scanning of the chest , upper abdomen , and brain . since 2008 , pet - ct scanning has been available and included in the initial diagnostics and in followup . the treatment started with four cycles of intermittent chemotherapy and erlotinib according to the following schedule : day 1 : gemcitabine 1250 mg / m in 30-minute infusion , day 2 : cisplatin 75 mg / m , with appropriate hydration and antiemetics , day 4 : gemcitabine 1250 mg / m in 30-minute infusion , days 515 : erlotinib 150 mg daily p.o . the number of cycles depended on tolerance to cisplatin - based chemotherapy and was determined individually . immediately after the last cycle , patients continued with erlotinib 150 mg / m daily continuously until progression or unacceptable toxicity . definition of complete response ( cr ) , partial response ( pr ) , stable disease ( sd ) , and progression followed the recist criteria . the first evaluation of response was done during the third cycle of intermittent therapy , with confirmation of response during the fifth cycle . control radiological examinations were repeated every 2 months for chest x - ray , every 4 months for ct , and at 6 and 12 months for pet - ct ( only patients who had this examination during their initial diagnostics ) . in october 2010 , all biopsy samples were reviewed , and specimens with more than 10% of tumour tissue were analyzed . genomic dna was extracted from formalin - fixed , paraffin - embedded tissue sections using qiaamp dna ffpe tissue kit ( qiagen , hilden , germany ) according to the manufacturer 's instructions . quantification of extracted dna was done on qubit fluorometer ( invitrogen , carlsbad , usa ) . to detect egfr gene - activating mutations , we used therascreen egfr29 mutation kit ( dxs diagnostics , qiagen , manchester , uk ) . all realtime pcr reactions were performed in a 25 l final volume on abi 7500 instrument ( applied biosystems , carlsbad , usa ) . after standard chemotherapy for metastatic nonsmall cell carcinoma , the expected ttp is 5 months . the size of this single - arm nonrandomised trial of intermittent therapy was based on the assumption of 9 months as the median time to progression ( ttp ) . to obtain such a result with a confidence interval of 612 months , we planned to recruit 40 patients . the investigators strictly followed recommendations of the helsinki declaration ( 1964 , with later amendments ) and of the european council convention on protection of human rights in bio - medicine , as accepted in oviedo in 1997 . the protocol was approved by the institutional review board ( institute of oncology , ljubljana ) and by the national committee for medical ethics , ministry of health , republic of slovenia .", "one patient was later found to have metastatic carcinoma of the pancreas rather than primary lung cancer and was excluded from all further analyses . with 12 patients each , twelve patients were never - smokers , and most were in good general condition ( ps 0 - 1 for 21 patients ) . with the exception of a single patient with wet bone metastases were the most common site of metastatic disease , followed by pleura / pericardium , contralateral lung metastases , and liver . two or more sites of metastatic disease were documented in 4 and 12 patients , respectively ( table 1 ) . three patients had only cytological diagnosis , and an additional 3 had biopsy samples too small to allow for analysis of egfr mutations in tumor cells . of the 18 adequate samples , 8 were positive for egfr gene - activating mutations . the actual number of cycles of intermittent therapy was from 1 to 6 cycles ( median : 4 cycles ) . due to early progression , 7 patients were still on maintenance treatment with erlotinib , and an additional patient stopped treatment with erlotinib after 12 months in pet - ct confirmed complete remission ( figures 1 and 2 ) . for the remaining patients , median total duration of treatment was 10 months . during the initial phase , side effects of maintenance with erlotinib were skin toxicity ( grade 3 : 1 pt ; grade 2 : 11 pts ) and diarrhea ( grade 2 in 1 pt ) . all patients are evaluable for response , and no patient has been lost to followup . for the whole group of 24 patients , complete remission ( cr ) was seen in 5 pts ; partial remission ( pr ) in 9 pts ( response rate 58% ) , minimal response or stable disease ( sd ) in 8 pts , and progression in 2 pts . a clear and statistically significant ( p < .05 ) correlation was seen between the presence of activating egfr mutations and response . among the 8 patients who were positive for egfr gene - activating mutations , 4 complete and no cr and only 2 pr were seen among the 10 patients negative for mutations ( table 2 ) . for the whole group , median time to progression ( ttp ) was 13.4 months , and median overall survival ( os ) was 23 months . median ttp and os for this group was 21.5 months and 24.2 months , respectively . for patients without egfr mutations , ttp was 5 months , and os was 7 months ( table 2 and figures 3 and 4 ) .", "this clinical trial was launched at a time when routine testing for egfr gene - activating mutations was not yet available . selection of patients for a combination of chemotherapy and erlotinib was made on the basis of classical histopathology ( adenocarcinoma ) and smoking status . since testing for egfr gene mutations is now available , it is clear that patients with activating mutations are those who really benefit from tkis . in addition , standard first - line treatment for patients with activating egfr mutations is now monotherapy with a tki [ 6 , 7 ] . since continuing a trial with the same selection criteria and without considering the status of egfr gene activating mutations was not justified , the research group made a decision to close the trial and analyse the experience . in order to get a longer interval for intermittent erlotinib , gemcitabine was given on days 1 and 4 of the cycle . when compared to the standard day 1 and day 8 schedule , this minor modification in timing of cytotoxic drugs did not have any adverse effect on the tolerance to treatment . clearly , other platin - based schedules which apply chemotherapy on a 3-weekly basis ( such as pemetrexed - cisplatin or paclitaxel - carboplatin ) can offer an even longer interval for tkis and might be considered for future trials of intermittent treatment . two other groups recently reported promising experience with intermittent chemotherapy and tkis . in a trial from the usa , two schedules of intermittent treatment were tested . in combination with pemetrexed ( 500 mg / m on day 1 ) , erlotinib was given either as a pulse application in a high dose ( range : 800 to 1400 mg ) given on days 2 , 9 and 16 , or in lower doses ( 150250 mg daily ) on days 2 to 16 . while tolerance to this treatment was good , the small number and heterogeneity of patients recruited into this trial do not allow for any clear conclusion regarding the effectiveness of intermittent treatment . of more importance this study from asia compared gemcitabine and either cisplatin or carboplatin to a schedule with addition of intermittent application of erlotinib ( 150 mg on days 14 to 28 of the cycle ) and reported significantly superior ttp with the intermittent schedule . their experience is most valuable but may not be of direct relevance for the rest of the world , due to the well - known differences in sensitivity of lung cancer to tkis between asian and caucasian patients . despite its small size , our trial can offer valuable experience for further research on optimisation of treatment with combinations of chemotherapy and tkis . looking at the whole series of patients , we can conclude that intermittent chemotherapy and erlotinib is a treatment of very low toxicity . it is also clear that the efficacy of treatment is closely related to the presence or absence of egfr gene - activating mutations . the most important finding is the excellent response rate with a substantial proportion of complete responses and prolonged ttp and os for patients positive for egfr gene - activating mutations . for many years , the maximal expectation of a patient with metastatic nonsmall cell lung cancer was a partial remission of relatively short duration in the range of 5 to 9 months . with intermittent treatment , while the number of patients in our trial is small and any definitive conclusion would be premature , we nevertheless believe that further research of intermittent therapy for patients positive for egfr gene - activating mutations is warranted . a randomised trial comparing first - line tki as monotherapy to the intermittent schedule should clarify the real value of this new approach .", "" ]

[ "using metagenomic deep sequencing , we analyzed fecal samples from 180 infants and children ages 7 days96 months ( mean 18.7 months ) in tunisia who had unexplained diarrhea that tested negative for rotavirus , norovirus , astrovirus , sapovirus , adenovirus types 40 and 41 , and aichi virus by reverse transcription pcr ( 7 ) . the fecal supernatants were filtered through a 0.45-m filter ( millipore , darmstadt , germany ) to remove bacterium - sized particles , and the filtrates were digested with a mixture of dnases ( turbo dnase from ambion , carlsbad , ca , usa ; baseline - zero from epicenter , madison , wi , usa ; and benzonase from novagen , san diego , ca , usa ) and rnase ( fermentas , pittsburgh , pa , usa ) to digest unprotected nucleic acids . enriched viral nucleic acids ( rna and dna ) were then extracted and amplified by using scriptseq v2 rna - seq library preparation kit ( epicenter ) and analyzed in pools of 10 specimens in 2 illumina miseq run of 250-bp end reads , yielding 20,693,619 unique sequences . we compared the illumina sequences with the genbank nonredundant protein databases using blastx ( http://blast.ncbi.nlm.nih.gov/blast.cgi ) . using a blastx e - score cutoff of 10 , we identified , in decreasing frequency , sequences related to the mammalian viruses : sapovirus ( 120,177 reads ) , anelloviridae ( 14,841 reads ) , parechovirus ( 10,557 reads ) , norovirus ( 4,551 reads ) , enterovirus ( 3,857 reads ) , circoviridae ( 2,127 reads ) , group a rotavirus ( 839 reads ) , adeno - associated virus ( 812 reads ) , picobirnavirus ( 274 reads ) , bufavirus ( 168 reads ) , wu polyomavirus ( 136 reads ) , bocavirus ( 62 reads ) , adenovirus ( 58 reads ) , papillomavirus ( 22 reads ) , cosavirus ( 20 reads ) , group c rotavirus ( 17 reads ) , human astrovirus 1 ( 14 reads ) , salivirus ( 4 reads ) , and aichi virus ( 2 reads ) . one pool showed a single read encoding a parvovirus - like protein segment with high levels of genetic similarity ( blastx e - score of 5 10 ) to the nonstructural protein ( ns ) 1 of rat parvovirus ( genbank accession no . was then identified by using pcr and underwent further deep sequencing as above , generating 11 more parovirus sequences . no other eukaryotic viral sequences were identified from 260,000 unique sequence reads from this patient . the near complete parvovirus genome was then acquired by filling genome gaps by pcr and amplifying 5 and 3 extremities using race ( rapid amplification of cdna ends , life technologies ) . we named this virus tusavirus 1 for tunisian stool - associated parvovirus . \n a nearly complete 4,424-bp genome ( tusavirus 1 , genbank accession no . kj495710 ) was successfully acquired with partial 5 untranslated region ( 243 bp ) , complete ns1 open reading frame ( 625 aa ) , complete viral protein ( vp ) 1 open reading frame ( 715 aa ) , and a partial 3 untranslated region ( 68 bp ) . tusavirus has a potential upstream start codon mss in a weaker kozak consensus sequence than maq ( figure , panel a ) , which we selected as the start codon . the walker loop gpattgks [ gxxxxgk(t / s ) ] , which is an atp- or gtp - binding motif , was found in the ns1 . potential splicing signals to express vp1 were identified on the basis of alignments to other protoparvoviruses and classic rna splicing motifs ( figure , panel a ) . the phospholipase a2 ( pla2 ) motif was identified in vp1 n - termini with expected calcium - binding site and catalytic residues . the methionine codon of vp2 was located upstream of glycine - rich sequence ( gggaraggvg ) . an unusual serine - rich sequence ( sssdsgpsss ) was also seen near vp1 n - termini . the alignment of the pla2 regions of representatives of 5 protoparvovirus species show the calcium - binding region and catalytic residues in tusavirus . pairwise sliding window of percentage nucleotide similarity of tusavirus aligns with the genetically closest kilham rat parvovirus . b ) phylogenetic trees generated with nonstructural protein ( ns ) 1 and vp1 of tusavirus and of the 5 international committee on taxonomy of viruses designated species in the protoparvovirus genus . fpv , feline parvovirus ; mev , mink enteritis virus ; cpv , canine parvovirus ; rapv , raccoon parvovirus ; rpv1 , rat parvovirus 1 ; mvmp , minute virus of mice , prototype ; hapv , hamster parvovirus ; ppv - kr , porcine parvovirus kresse ; simian bupv , simian bufavirus ; bupv1 , bufavirus 1 ; bupv2 , bufavirus 2 ; amdv , aleutian mink disease virus ; gfav , gray fox amdovirus ; b19v - lali , human parvovirus b19-lali . bootstrap values ( based on 100 replicates ) for each node are given if > 70% . protein sequence alignments were made by using clustalx version 2.0.3 ( http://www.clustal.org ) with the default settings ; a phylogenetic tree with 100 bootstrap resamples of the alignment datasets was generated by using the neighbor - joining method based on the jones - taylor - thornton matrix - based model in mega5 ( http://www.megasoftware.net ) . phylogenetic analysis showed that tusavirus 1 was distinct from known members of the protoparvovirus genus ( figure , panel b ) . vp1 and vp2 shared identities of 39% and 37% , respectively , to those of kilham rat parvovirus . according to the international committee on taxonomy of viruses , the members of the same parvovirus genus should share > 30% and members of the same species > 85% aa identity in ns1 . the protoparvovirus genus currently comprises species infecting carnivores , rodents , pigs , and humans ( 1 ) . tusavirus 1 is proposed as prototype for primate protoparvovirus 2 species that would join bufaviruses as human viruses in this genus . we used a nested pcr targeting ns1 to determine the prevalence of this virus in the 180 tunisia diarrhea samples . primers tusa - f1 ( 5-gaagaagctggaaactgtggtca-3 ) and tusa - r1 ( 5-ctcgtctttctcccaggcatct-3 ) were used for the first round of pcr , and primers tusa - f2 ( 5-attgctccaacaccagtcatca-3 ) and tusa - r2 ( 5-tctggtctggtccaatcttcttc-3 ) for the second round of pcr . the pcr conditions were : 95c for 5 min , 35 cycles 95c for 30 s , 52c or 51c ( for the first or second round , respectively ) for 30 s , and 72c for 1 min , a final extension at 72c for 10 min . no samples except the one initially detected by deep sequencing were pcr positive , yielding a low prevalence of 0.56% ( 1/180 ) in this tunisian population .", "we detected fecal shedding of a previously uncharacterized parvovirus in a child with unexplained diarrhea . the 18-month - old girl showed twice daily liquid and greenish feces over 3 days but no fever ( 37.4c ) , vomiting , or dehydration . to identify other viral infections in this patient , no other mammalian virus was detected , suggesting a possible role for tusavirus 1 in this patient s gastrointestinal illness , although the lack of testing for pathogenic bacteria and parasites does not enable us to exclude these alternative explanations . control pcr studies of unexplained diarrhea and serologic tests , are needed to define the prevalence and disease association of this new parvovirus species in different age groups and populations ." ]

[ "it may be regarded as the localized equivalent of the systemic inflammatory response seen after any trigger of inflammation , which recently has been described as systemic inflammatory response syndrome . the complex nature of surgical infections , the multifaceted aspects of treatment , and the complexity of intensive care unit ( icu ) support makes evaluation of new diagnostic and therapeutic advances in this field very difficult . mannheim peritonitis index ( mpi ) is a scoring system used in peritonitis which is simple and cost - effective . mpi was originally derived from data collected from 1253 patients with peritonitis treated between 1963 and 1979 and was developed by discriminant analysis of 17 possible risk factors , by wacha , 8 of these were of prognostic relevance and was currently employed widely for predicting mortality from peritonitis . the information is collected at the time of admission and first laparotomy [ tables 1 and 2 ] .", "the study was done in fifty patients with peritonitis who presented at government medical college , amritsar , and were operated after taking informed consent . patients were followed up for the final outcome , and results were analyzed with the score of mpi .", "in this study , majority of patients belonged to age group of 21 - 50 years . the youngest patient was 8-year - old female , whereas to oldest was a 65-year - old male . there were 82% male patients and 18% female patients with the male to female ratio being 4.6:1 [ figure 1 ] . it was further found that mortality for female patients was 55.56% , and for male patients , it was 9.76% . in patients with localized peritonitis , there was no mortality as compared to diffuse peritonitis which had mortality of 20.45% . majority of the patients presented to hospital after 24 h ( 86% ) , and most commonly during 48 - 72 h ( 44% ) . the mortality of patients was highest ( 66% ) who were presented to hospital after 72 h , and it was 33% who were presented between 48 and 72 h. there was no mortality for patients who presented within 48 h. the mortality of patients who had clear , cloudy , and fecal character of exudates was 12.5% , 15% , and 100% , respectively . for patients with no malignancy , patients having no organ failure preoperatively , mortality was 7.14% as compared to patients having organ failure , mortality was 75% [ table 3 ] . summary of risk factors of mannheim peritonitis index and mortality the study showed that mortality steadily increases with increase in mpi score showing statistically significant results [ p < 0.001 , figure 2 ] . various postoperative complications seen in the study group were wound sepsis , wound dehiscence , acute renal failure , pneumonitis , acute respiratory distress syndrome , and shock . the study also showed that morbidity steadily increases with mpi score [ p < 0.001 , figure 3 ] . mortality and mannheim peritonitis index score morbidity and mannheim peritonitis index score for a score of 27 , the sensitivity was 66.67% , specificity was 100% , and positive predictive value for mortality is 100% at an accuracy of 94% [ p < 0.001 , table 4 ] . sensitivity and specificity of mannheim peritonitis index score 27", "peritonitis , inflammation of serosal membrane lining the abdominal cavity and abdominal viscera , is associated with high mortality rate . peritonitis remains a hot spot for the surgeons despite advancements in surgical technique and intensive care treatment . various factors such as age , sex , duration , site of perforation , extent of peritonitis , and delay in surgical intervention are associated with morbidity and mortality . bacteria and digestive enzymes act on the peritoneal serosal surface lead to enzymatic digestion and necrosis and an outpouring of serum protein and electrolytes from the blood to the cavity . there is formation of exudate rich in granulocytes , which may be diffuse or confined to an abscess . systemically , there is paralysis of the bowel , hemoconcentration occurs , and alterations of the cardiac output due to the shift of fluids and later acidosis . intrapulmonary shunting , hypo- or hypercapnia , hypoxemia , progressive azotemia , acute tubular necrosis , weight loss by protein consumption , fall of body temperature , loss of heat production , and exhaustion are other complications that may lead to the death of the patient , if the process is not interrupted . a successful outcome depends on early surgical intervention , source control , and exclusive intraoperative peritoneal lavage . it may also depend on exact recognition of the seriousness of the disease , an accurate assessment , and classification of the patient 's risks . despite the surgical treatment and sophisticated icus , last generation antibiotics and a better understanding of pathophysiology of peritonitis mortality rate are still very high , i.e. , 1020% even in good institutions . early prognostic evaluation is necessary to select high - risk patients for more aggressive therapeutic procedures such as radical debridement , lavage systems , open management , and planned reoperations . classification of the severity of disease means the definition of groups by risk , and it is of confirmed value in both controlled and uncontrolled clinical trials . an accurate risk index classification is only method to settle a standard of comparison between groups of patient and different treatment methods which would allow further prospective adequate comparative study . the mpi has a definite score for an individual , which has a good accuracy . mpi can be used to define risk groups as well as predict outcome in patients with peritonitis , as indicated by various studies . showed patients who obtained < 21 points and more than 29 points , mortality rate was 6% and 50% , respectively . showed mortality at score of above 21 and 29 of 60% and 100% , whereas fgger et al . showed below 21 , no mortality ; between 21 and 29 , mortality was 29% ; and more than 29 , it was 100% . studies showed mortality among patients who obtained < 21 points varied between 0% and 2.3% , in the 2129-point group between 3.85% and 60% , and in patients with score of > 29 between 15% and 100% . billing 's meta - analysis showed the following mean mortality rates in the groups with < 21 points , between 21 and 29 points , and above 29 points : 2.3% ( 011% ) , 22.5% ( 10.650% ) , and 59.1% ( 4187% ) , respectively . other studies have also shown statistically significant relation of morbidity and mortality with increasing mpi score . yoshiko and masayuki showed patients with mpi score of 26 or less have mortality of 3.8% , whereas score of 26 or more had mortality of 41% . such difference in cutoff values might be due to different demographics and therapeutic options offered to patients at different institutions . in our study , score of 27 showed the sensitivity , specificity , and positive predictive value at 66.67% , 100% , and 100% , respectively , at an accuracy of 94% . in our study showed mortality rate with score < 21 , 21 - 27 , and > 27 was 0% , 27.28% , and 100% , respectively . similarly , morbidity rate for patients with a score < 21 , 21 - 27 , and > 27 was 13.33% , 65.71% , and 100% , respectively . the predictions resulting from mpi were reliable , indicating stratification of risk groups can be done by probability intervals . study showed that age > 50 years out of a total of 79.3% death was seen in 85.2% and survival in 67.6% and p = 0.04 , thus showing that age > 50 years is a significant risk factor . in our study , patients < 50 years , mortality rate is 13.16% , and for patients more than 50 years , the mortality rate is 33.33% although it did not reach statistically significant values ( p = 0.113 ) . wittmann showed in his study , a high mortality rate ( 50% ) when the diagnosis of peritonitis was made after 48 h. the observed high frequency of patients with preoperative peritonitis duration longer than 24 h ( 65.5% ) was correlated with high death rate . our study also showed similar results with mortality of patients who presented between 48 and 72 h was 33% and > 72 h was 66% as compared to no mortality who presented within 24 and 48 h ( p < 0.001 ) . a study by basnet and sharma , out of the fifty patients included in the study , 21 ( 42% ) were female and 29 ( 58% ) were male . about 24.1% of the males and 19% of females requiring relaparotomy expired in the study , making female sex not a bad prognosticator in their study ( p = 0.100 ) . mortality for female patients was 55.56% as compared to male patients having mortality of 9.76% ( p = 0.001 ) . the study by notash et al . had mortality 17.5% mostly due to organ failure and septicemia . our study also showed organ failure , a significant risk factor as patients having organ failure had mortality of 75% as compared to no organ failure having mortality of 7.14% ( p < 0.001 ) . another study concluded that with age more than 50 years , late presentation , diffuse peritonitis , purulent exudate , noncolonic pathology , and organic failure associated with high mpi score and more mortality . this study proves that mpi scoring system is a simple and effective tool for assessing the morbidity and mortality in patients with peritonitis with statistically significant results . duration of pain > 24 h , organ failure on admission , female sex , and feculent exudate were found to be independently significant factors in predicting the mortality .", "such patients should be monitored closely with close attention to be given to support the vital systems . to conclude , mpi is a simple and reliable tool in predicting the outcome in cases of peritonitis .", "", "" ]

[ "during 20092010 , serum samples from patients with suspected dengue were received by the fdoh for dengue diagnostic testing ; the samples came from 16 of florida s 67counties . specific , real - time rt - pcr ( 8) and igm anti - denv elisa ( 9 ) . samples with highly positive rt - pcr results were spread onto cultured ae . albopictus c6/36 cells , and the presence of virus and genome were confirmed by immunofluorescence ( 10 ) and rt - pcr , respectively ( 11 ) . isolates were further propagated and viral rna was extracted from culture supernatants by using the universal biorobot system ( qiagen , valencia , ca , usa ) . the envelope glycoprotein ( e ) gene was amplified ( technical appendix ) , and the e gene open - reading frame ( 1,485 bp ) was sequenced . multiple sequence alignments were performed by using the muscle module available in mega 5 ( www.megasoftware.net ) . evolutionary history was inferred by using maximum likelihood and phylogenetic trees constructed by using neighbor - joining methods . evolutionary distances were computed , and several e gene sequences from genbank were included in the phylogenetic tree to support tree topology by genotype ( technical appendix ) . in 2009 , five denv-1positive cases were identified by rt - pcr in key west . subsequently , in 2010 , the fdoh tested 195 serum samples by real - time rt - pcr . fifty - six ( 29% ) samples were positive for denv rna : denv-1 ( 37 [ 66% ] samples ) , denv-2 ( 13 [ 23% ] samples ) , denv-3 ( 3 [ 5% ] samples ) , and denv-4 ( 3 [ 5% ] samples ) . monroe county submitted 73 serum samples , of which 31 ( 42% ) had results positive for recent dengue infection : denv-1 was detected in 22 by rt - pcr , and 9 had positive igm anti - denv elisa results . none of the denv-1 patients from monroe county had a history of recent travel to a dengue - endemic region before the onset of symptoms . fifteen other florida counties submitted serum samples : 13 counties submitted < 10 specimens , 1 submitted 2030 specimens , and 1 submitted > 60specimens . denv-1 was found in 15 serum samples from 6 of these counties ; however , all the patients had a history of recent international travel . we sequenced the e gene of 12 denv-1 strains isolated in florida during 20092010 to determine their genetic relatedness ; of the 12 strains , 8 were from key west and 1 each was from dade , broward , orange , and pinellas counties . in addition , 23 denv-1 e sequences published in genbank , including the 2010 key west isolates obtained from a blood donor and a mosquito pool ( 6,7 ) , were used to construct a maximum - likelihood phylogenetic tree . this phylogenetic analysis showed that all the florida denv-1 isolates belong to the american african genotype ( genotype v ) ( 12,13 ) together with other viruses isolated throughout the americas ( figure 1 ) . maximum - likelihood phylogenetic tree of dengue virus type 1 , including isolates from key west , florida , usa , and representative isolates from 5 genotypes with global geographic distribution . solid circles , 8 key west viruses ( monroe county ) isolated during 20092010 ; solid diamonds , isolates from other florida counties ( dade , pinellas , orange , and broward counties ) . each taxon represents a single virus isolate and is labeled with the geographic origin and collection year . thirty - six envelope glycoprotein gene sequences obtained from genbank were included to support tree topology and identify genotypes . all genotypes except the american african genotype ( v ) have been collapsed . key west denv-1 viruses grouped among central american viruses , which configure a distinct lineage separate from the caribbean viruses . this divergence between the central american and caribbean lineages is well supported by high bootstrap values . moreover , the key west and monroe county viruses grouped together and indicated a distinct sublineage supported by a high bootstrap value ( 99% ) , separating them from viruses isolated in dade , orange , pinellas , and broward counties that were more closely related to other central american viruses ( figure 1 ) . one 2009 isolate ( iq425062 ) from a key west patient is related to this group , suggesting a separate introduction of denv-1 in key west . the sequence similarity between the 2009 and 2010 key west strains was < 0.9% ; however , the evolutionary distance and taxa positions between the 2009 and 2010 strains presented in the phylogenetic tree suggests that the 2010 strains diverged from the 2009 strains . the observed differences between e gene sequences for the key west strains ( 20092010 ) and the rest of the strains in this phylogeny were < 2.1% with the other florida strains , < 1.2% with central american strains , and < 4.8% with the rest of the american african genotype .", "evolutionary distances and the topology of the central american lineage suggest this lineage is the genetic origin of the florida denv-1 strain . most viruses isolated in monroe county diverged from the central american lineage into a distinct sublineage the key west denv-1 strain associated with the 20092010 outbreak . the high level of genetic similarity among the viruses isolated in monroe county , their close evolutionary distances , and the lack of recent international travel for the case - patients suggest endemic transmission and microevolution of this denv . conversely , the scattered and separate phylogenetic positioning of virus strains from patients with travel - associated cases from other florida counties indicates a different origin from the majority of key west isolates . although the 2009 broward isolate ( jq425067 ) is positioned near the central american lineage , the low bootstrap value ( 53% ) does not support lineage ancestry . the epidemiologic and phylogenetic evidence suggests that the 2010 cases appeared to be a continuation of the 2009 outbreak . unlike cases along the texas mexico border ( 14 ) , in addition , denv-1 was detected in a blood donation from the monroe county in 2010 , further supporting local transmission of denv ( 7 ) . collectively , these findings indicate that endemic denv-1 was transmitted in key west over a period of > 2 years .", "table showing the dengue virus type 1 ( denv-1 ) envelope gene reverse transcription pcr and another showing denv-1 strains used in a study of the genetic relatedness of dengue viruses in key west , florida , usa , 20092010 ." ]

[ "corneal epithelium is able to alter its thickness to mask subepithelial stromal irregularities and maintain a smooth anterior surface of the eye . laser refractive surgery such as lasik alters the anterior corneal contour and leads to remodeling of corneal epithelium . we estimated the extent of the epithelial remodeling after lasik with a mathematical model in a previous study . however , in that study , we did not have the capability to measure the corneal epithelial thickness to validate the model directly . instead , we constructed the model constants based on regression in manifest refraction after lasik . direct measurement of epithelial thickness change may help to better understand corneal epithelial remodeling after lasik and improve lasik ablation patterns with less regression and surgery - induced aberrations . previous studies used confocal microscopy to measure epithelial thickness , but the number of points measured was limited and the measurement was time consuming . very high - frequency digital ultrasound was also used to map corneal epithelium and stromal thickness [ 4 , 5 ] . however , because ultrasound can not pass through air , this technique required immersing the cornea in a fluid bath . though both confocal microscopy and very high - frequency digital ultrasound are feasible in measuring corneal epithelial thickness , they are not often used in routine lasik because they required touching the cornea . optical coherence tomography ( oct ) is a noncontact imaging technique based on principles of low - coherence interferometry . the current generation of oct is based on fourier - domain technique [ 6 , 7 ] . in a recent article , we demonstrated that a commercial fourier - domain oct could automatically map the corneal epithelial thickness with good repeatability . in this study , we use this algorithm to map corneal epithelial thickness for eyes before and after myopic lasik surgeries . the changes in epithelial thickness were used to validate the smoothing model we mentioned above .", "this prospective observational study was conducted at doheny eye institute , los angeles , ca . the lasik subjects enrolled in this study had no history of eye surgery and were comprehensively examined to exclude any eye diseases including dry eye . soft contact lenses wearers were asked to stop wearing contact lenses at least two weeks prior to lasik . the treatment of study subjects was in accordance with the tenets of the declaration of helsinki . the laser settings were based on manifest and cycloplegic refractions calculated at the corneal plane . the lasik flap was created with a 60 khz femtosecond laser ( intralase , abbott medical optics , santa ana , ca ) . the femtosecond flap thickness was programmed to 110 m with a diameter of 9.0 mm and a 70-degree angled side cut . the stromal ablations were performed with visx star s4 ir customvue excimer laser ( abbott medical optics , santa ana , ca ) . the optical zone was set to 6.5 mm in diameter centered on the pupil center with blend / transition zones up to 8.0 mm . to measure epithelial thickness before and after lasik , a commercial fourier - domain oct system ( rtvue , optovue inc . , fremont , ca ) with a speed of 26,000 axial scans per second was used . a pachymetry + cpwr scan pattern ( 6 mm scan diameter , 8 radials , 1024 axial - scans each , repeated 5 times ) centered at the pupil center was used to map the cornea . the subjects were asked to look straight ahead and fixate on the internal fixation target of the oct system . the oct scan pattern was repeated 2 times on each eye during the same visit . the algorithm was described in a previous article and was available in the commercial rtvue software . the average epithelial thickness over the central 1 mm diameter , 1~2 mm , 2~3 mm , 3~4 mm , 4~5 mm , and 5~6 mm annular zones , was used in the analysis . correlation of lasik - induced change in epithelial thickness with the amount of spherical equivalent of lasik correction was investigated . a smoothing constant based on our epithelial smoothing model , the change in epithelial thickness could be calculated by applying a first - order , 2-dimensional butterworth low - pass filter to the ablation profile . the cutoff frequency of the butterworth filter was the reciprocal of the smoothing constant . if we simulated the ablation profile for 1 d special myopic lasik using munnerlyn algorithm and assumed the optical zone diameter to be 6.5 mm , the smoothing contact could be estimated . the smoothing constant has a unit of length and can be thought of as the radius over which epithelial smoothing occurs . ablation simulations were performed using matlab software version 5.3 ( the mathworks , inc . , paired t - test was used to compare the difference of preoperative and postoperative epithelial thickness . generalized estimating equation was used to account for the intereye correlation in the variance of t - test . statistical analysis was performed using the microsoft excel and sas 9.1 ( sas institute inc . , cary , nc , usa ) .", "nineteen eyes ( 10 right eyes , 9 left eyes ) from 11 myopic lasik patients ( 6 women , 5 men ) were analyzed in the study . the spherical equivalent of lasik correction ranged from 1.69 d to 6.75 d ( mean : 4.39 1.63 d ) . corneal epithelium was thicker on the inferior side compared to that on the superior side both before ( figure 1(a ) ) and after lasik ( figure 1(b ) ) . the average central epithelial thickness was measured to be 52.6 4.1 m ( 40.9~60.6 m ) before lasik and 56.2 4.3 m ( 50.0~65.5 m ) 3 months after lasik ( p = 0.013 , figure 2 ) . the average epithelial thickness at 5~6 mm annular zone was 51.6 6.6 m ( 39.6~67.4 m ) before lasik and 54.8 4.3 m ( 49.8~68.0 m ) 3 months after lasik ( p = 0.024 , figure 2 ) . the epithelial thickening reached maximum at about 4 mm diameter and tapered off toward the peripheral ( figure 3 ) . the change in average central epithelial thickness was significantly correlated with lasik spherical equivalent setting ( figure 4 ) . the slope of 1.15 indicated that , for every diopter of myopic lasik correction , the central epithelial thickness increased by 1.15 m , which corresponded to a smoothing constant of about 0.46 mm . based on this smoothing constant pattern ; that is , the maximum epithelial thickening occurred at an annular area around the center ( figure 5 ) .", "previous studies have demonstrated that it is feasible to use oct to measure the thickness of different layers of the cornea , such as the epithelium , stroma , and lasik flap using time - domain oct . however , the axial resolution of the earlier oct systems was low and the manual computer - caliper measurement was time consuming . in this study , we used newer fourier - domain oct which has faster scan rate and higher axial resolution with automated measurement of epithelial thickness . the finding agreed with previous oct studies [ 8 , 12 ] as well as results with very high - frequency digital ultrasound . the asymmetry might be caused by the movement of upper eyelids during blinking [ 4 , 13 ] . similar inferior / superior asymmetry in the thickness of corneal epithelium was also found after lasik ( figure 1(b ) ) . the average central epithelial thickening was about 3.6 m at the 3-month followup for a mean spherical equivalent correction of 4.39 d. this finding is in agreement with previous studies that demonstrated the correlation between central epithelial thickening and the amount of myopia correction [ 5 , 1419 ] . using confocal microscopy , spadea et al . demonstrated that epithelial thickness increased within the first week after lasik , with a maximum increase of approximately 6.5 m by the third month for a mean spherical equivalent correction of 10.48 d. using very high - frequency digital ultrasound , reinstein et al . found that there was a central approximately 5 mm zone of epithelial thickening of up to 7.5 m 1 year after lasik for a mean spherical equivalent correction of 3.34 d. in a recent study where a similar oct system was used , kanellopoulos and asimellis found that increases in central ( 0~2 mm diameter ) , midperipheral ( 5 mm diameter ) , and overall mean epithelial thickness appeared to be in almost a linear correlation with the amount of targeted myopic correction ( 1.39 m / d for midperipheral region ) . the authors hypothesized that epithelial hyperplasia might be caused by a thinned cornea which was biomechanically unstable . this hypothesis was also supported by a study of epithelial thickness changes after collagen cross - linking ( cxl ) . however , the epithelial thickness changes could actually be explained by the simultaneous topography - guided ablation to reduce the cone . in other words , the epithelial thickness changes could be a response to focal curvature changes in addition to corneal biomechanical properties . the average central epithelial thickening was significantly correlated with lasik spherical equivalent setting . for every diopter of the 1.15 m per diopter epithelial thickening was matched to a smoothing constant of 0.46 mm . this value was larger than our previous estimate ( 0.32 mm ) probably because of the mix of spherical astigmatism subjects in this dataset . our results showed more epithelial thickening centrally ( 1 mm diameter zone ) than that paracentrally ( 5 - 6 mm annular zone ) . this does not agree with a previous study with very high - frequency digital ultrasound where epithelial thinning was observed between the 5.6 mm and 8 mm diameters except superiorly . we speculated that the discrepancy may be caused by larger optical zone ( 6.5 mm ) and use of transition zone ( up to 8.0 mm diameter ) in our study compared to the 6 mm optical zone used in the previous study . in figure 2 , if we could measure epithelial thickness beyond 6 mm diameter and the plot could be extrapolated , epithelial thinning would have been observed at the periphery . however , because we did not have access to the proprietary ablation profiles of the laser companies nor had our current oct system the ability to measure a larger area , we could not provide a more concrete explanation for the disagreement . on the other hand , both clinical data ( figure 3 ) and simulation ( figure 5 ) showed that the maximum epithelial thickening occurred at an annular area about 3~4 mm in diameter , not at the center . the difference was more obvious on the average epithelial change map from the clinical data than the simulation . we speculated the reason being that the actual lasik ablation pattern might precompensate for the laser - induced spherical aberration , which meant that the actual ablation at the paracentral area would be deeper than munnerlyn 's algorithm used in the simulation which did not account for spherical aberrations . in addition , after the compensatory remodeling of corneal epithelium to surface curvature changes , the area with increased epithelial thickening was most likely to be annular because of the ring shape of spherical aberration . one limitation of this study was that it only included epithelial thickness measurements 3 months after lasik . however , central epithelial thickening has been reported 1 year up to 7 years after excimer laser ablation , all of which found no statistically significant change in central epithelial thickness after 3 months . therefore , it may be reasonable to assume that the epithelial thickness is stable 3 months after lasik . it also should be pointed out that , besides focal corneal curvature , changes in corneal biomechanical properties , such as dry eye and cross - linking [ 23 , 24 ] , may result in corneal remodeling as well . therefore , it is important to take multiple factors into consideration if they are mixed . in summary , fourier - domain oct was demonstrated to be a valuable tool for noncontact measurements of corneal epithelial thicknesses change caused by lasik . the maximum epithelial thickening occurred at an annular area about 3~4 mm in diameter . however , wider scans are needed to measure epithelial thickness change toward the edge of the ablation zone ." ]

[ "this is particularly the case of the health of people living in contaminated site(s ) ( cs ) which is affected by the legacy of past industrialization and current industrial activities , often in absence of environmental remediation . european community legislation addresses the concept of cs only in the context of the thematic strategy for soil protection and the soil framework directive proposed by the european commission ( ec ) in 2006 ; for details on the legal framework and definitions at eu level refer to who 2013 . according to 2007 estimates , soil contamination requiring clean up is present in approximately 250,000 sites in the european environment agency ( eea ) member countries . although main polluting sources may vary across europe , industrial production and commercial activities , oil industry and waste disposal and treatment are reported to be the major ones . national reports indicate that heavy metals and mineral oils are the main soil contaminants , while mineral oils and chlorinated hydrocarbons are the most frequent pollutants found in groundwater . a general definition , following the public health perspective , is areas hosting or having hosted human activities which have produced or might produce environmental contamination of soil , surface or groundwater , air , and food chain , resulting or being able to result in human health impacts . given this definition , an area affected by a single chemical contamination of a single environmental matrix ( e.g. , the soil contamination caused by a given pesticide ) and a large area with soil , water , air , and food chain contamination by multiple chemicals ( e.g. , the contamination caused by long - term emissions of a petrochemical complex ) can be both considered contaminated sites . there are several approaches and methods for assessing the health impact of national priority contaminated sites ( npcs ) . on the one hand , one can apply risk assessment techniques , where available data on the degree of contamination ( typically measures of concentration of specific hazardous chemical agents ) are used to quantitatively estimate the risk of occurrence of health endpoints causally associated with the agents ; on the other hand , epidemiological approaches applicable to npcss involve the inclusive collection of available health information of resident population , and various agents and exposures . in these assessments , a first descriptive level is based on epidemiological tools that do not require an ad hoc collection of data and aims at describing the health profile of populations documenting ascertained or suspected associations with local environmental risks and the potentiality to provide efficient answers . more detailed analyses can be carried out , at a higher level of definition , by collecting specific data on health outcomes and/or on exposure . sentieri project ( epidemiological study of residents in italian contaminated sites ) [ 6 , 7 ] is an example of first level descriptive approach adopting an ecological study design , looking at the aggregate population level rather than at individual level . sentieri project is a national project developed to evaluate the health profile of populations residing in the italian sites of national interest for environmental remediation - national priority contaminated sites ( npcs ) . these sites were labelled as sites of national interest because of their substantial contamination , documented in qualitative and/or quantitative terms , and the consequent potential impact on the health of residents . the methods proposed under the approach exemplified by sentieri can be generalized and applied to other npcss . this paper 's objective is to present the rationale and methods underlying sentieri project and to describe data and resources required to apply a similar approach in other countries .", "when studying how the environment can adversely affect human health , it is usually very difficult to identify clear cause - effect relationships because they are characterized by multicausality with different strengths of association . in addition , these relationships are influenced by individual factors ( e.g. , genetic , diet , life - style , occupation , and socioeconomic status ) that can also have a role on both exposure level and disease development . it describes the health profile of residents in contaminated sites through small area analysis by applying the multistep procedure described in the following sections . a selection of epidemiologic terms are defined in glossary to facilitate the reading of the paper .", "as a first step , npcss to be studied should be chosen , and the criteria adopted to define npcs / npcss are clearly indicated . the npcs selection will depend on the aims of the study to be undertaken , on the availability of the npccs - related information , and on any other consideration researchers would make and consider appropriate . in many instances , npcss to be studied are chosen by third parties , such as an environmental authority , by public concern , and media pressure . it is advisable that the criteria used throughout this phase are clearly stated . in most instances npcss are characterized by the presence of numerous and different environmental sources of contamination possibly leading to human exposures . all the available npcs data should be collected and described in a standardized , homogeneous way . geographical characteristics , extension of the contaminated area , and demographic information about residents potentially affected should be listed . detailed description of contamination characteristics should be included as well as the presence of industries and all other human activities that have contributed to the environmental deterioration of the npcs . researchers will specify the sources used for this task : scientific reports , acts , and so on . populations at risk can be identified as people living in the neighborhood of npcss sources or living in areas defined as contaminated . typically , the distance from the areas affected by contamination is used , but also dispersion modelling results are used . in the latter case , the definition of the areas most affected by contamination , and the consequent identification of at - risk populations , depends on the accuracy of the model . there are several models used to evaluate the areas affected by contaminants ; their implementation and improvement depend on the available information on several parameters . for example , in the case of emissions into the air from oil refineries , the parameters to be considered should be characteristics of emission sources : for example , height , flow rate , composition of emissions , exit temperature , local orography , and meteorological conditions . areas characterised by contamination processes different from direct industrial emissions require other parameters . in the case of landfills many early disposal sites did not have liners to trap rainwater that percolate through the landfill , and some newer landfills have liners that leak . the percolating water leaches toxic chemicals ( e.g. , from batteries , electronic equipment , and discarded household chemicals ) that can contaminate soil and groundwater in ways that make it difficult to adequately identify the population at risk . furthermore , in defining contaminated areas in case of complex industrial contamination , it should be considered that populations can experience several routes of exposure , mainly through inhalation of pollutants emitted into the atmosphere , and through ingestion when contaminants are accumulated in soil , water , and food chain . for the reference population the same data of the area units under study are needed : cases and populations stratified by gender and age categories . the reference population should be selected considering two different needs : ( 1 ) it should be comparable to the studied populations for factors that can affect the health profile with the exception of the contamination at study the differences in the health profile between the compared populations should be ideally due only to the differences in environmental exposures , namely , to the contamination ; ( 2 ) it should be sufficiently numerous to obtain stable reference rates also for rare diseases . these two needs have opposite requirements , as the first one is usually negatively correlated with the dimension of the population , while the second one is positively correlated with the dimension of the population . usually one or two populations among the following are selected as reference population : national , and regional , local ( i.e. , a population composed of populations residing in the neighbourhood of the contaminated area ) . the aims of the study will imply a sound outcomes selection to include the ones for which environmental exposure / s ( see environmental data ) is suspected or ascertained to play an etiologic role . the possible health impact from environmental exposures is measured in terms of mortality , morbidity , incidence of neoplastic diseases , and so forth . general considerations about the quality of available information and data as well as intrinsic limitations of the selected outcome measures should be described and discussed . health indicator characteristics should be carefully examined and multiple aspects considered taking into account the inherent uncertainty . sources of national or local routinely collected data , spatial and temporal coverage , and quality aspects are all of extreme importance for the validity of study results and their usefulness in terms of general knowledge and public health relevance . an appropriate length of the period under study will make research results and conclusions more informative for diseases with long latency times ; precision of the epidemiological parameters will also improve with a longer study period . the specific value of small - area analysis is that it permits the examination of data for population which tend to be more homogeneous in character and in their environmental circumstances than the larger and more widely spread populations . the smallest territorial unit that can be used in small area studies depends on data availability that may vary in different countries . for example , in italy small area studies can be carried out at the census tract ( average of 200 residents ) and municipality levels . in 2001 about 70% of the italian municipalities included less than 5,000 residents ; this compares with great britain , where small area studies can be carried out at the following levels : enumeration districts400 residents , electoral wards5,100 inhabitants , and postcode sectors6,600 people . in geographical studies of environment and health , confounding from social and economic factors may occur . to control such confounding effect , standardisation techniques have been extensively used since the mid-1990s . to account for possible confounding from socioeconomic factors in sentieri project , deprivation can be defined as a state of observable and demonstrable disadvantage relative to the local community or the wider society or nation to which an individual , family , or groups belong . deprivation indices are area - based measures of material and social disadvantageous circumstances , that is , indicators of relative deprivation at population level . a detailed discussion on the use and critical aspects of the application of di in small area studies of environment and health can be found in an open access systematic review . when performing epidemiologic studies , there is a risk for researchers to become data - driven . this can be the case when commenting results for causes showing an increase , possibly on the basis of statistical significance . as an example , sentieri dealt with the complexity of the relation between area contamination and health effects . for each npcs studied the project focused on those causes identified a priori from the epidemiological evidence of their association with selected environmental exposures . it is suggested that researchers use environmental contaminants information considering the available level of details . in sentieri possible relevant exposures were abstracted from legislative decrees , that is , administrative sources defining npcss boundaries and coded on a productive sectors basis ( i.e. , petrochemicals and/or refineries , harbours areas , etc . ) . while for some npcss information on specific chemical contaminants was available , for others only productive plants were listed . this is to point out that researchers should be able to adapt this approach to their specific situation . when studying factors that determine changes in the occurrence of a given health condition or its predictive factors , it should always be kept in mind that most diseases have a multiple etiology . therefore also exposures different from those specifically present in npcss should be considered , as well as every known cause or risk factor , such as smoking habits , alcohol consumption or other sources independent from those at study , that is , socioeconomic factors and occupational exposures , and air pollution due to combustion of fuels for transport activities and domestic heating . the latter aspects are particularly relevant when studying complex industrial settings close or overlapping to urban highly populated areas . once the environmental exposures of interest identified , researchers should examine the updated scientific literature to evaluate the associated health effects . this apparently easy task is in fact quite demanding , because by browsing the literature different kinds of publications are collected : handbooks , original articles , letters to scientific journals , multicentric studies , editorials , reviews , meta - analyses , and so on . therefore , the first decision to be taken is about the relevance to give to the collected material and how to use it to define the strength of the association between the specific health outcome and the environmental exposure / s that characterize / s the npcss . sources expressing the epidemiological community consensus , evaluating scientific evidence by means of standardized criteria , and weighting the study design and the occurrence of biased results were considered most important ( i.e. , iarc monographs , who publications , european environment agency reports , handbooks of environmental , and occupational medicine ) . they were followed in the hierarchy by quantitative meta - analyses . consistency among sources was a criterion used to classify the strength of the causal association . this process was performed considering not only the environmental exposures , but also those risk factors previously mentioned ( smoking habits , alcohol consumption , air pollution , socioeconomic aspects , and occupational exposures ) . literature sources were presented in the final report in a tabular form to let the reader follow the entire process of evaluation for each cause combined with different exposures . on the basis of explicit criteria the strength of the causal association for each cause - exposure combination was classified ( matrix of a priori evidence evaluation ) . expertise in environmental and occupational epidemiology , statistics , and public health clinical medicine , toxicology , and analytical chemistry are needed to tackle this complex environmental issue .", "all data about contamination sources and characterization of contamination should be collected and examined to identify the contamination diffusion and finally define the areas and populations possibly affected by contaminants . sentieri project studied populations residing in the sites of national interest for environmental remediation ( national priority contaminated sites npcss ) . in sentieri the production activities and sources of contamination listed in the decrees defining the sites ' boundaries were used as a proxy for environmental residential exposures ; they are coded as chemical industries , petrochemicals and refineries , steel plants , power plants , mines and/or quarries , harbour areas , and asbestos or other mineral fibres , landfills , and incinerators . for each npcs contamination data the study population comprised residents in 44 npcss ; each one included one or more municipalities , a total of 5.5 million inhabitants in the 44 npcss , about 10% of the italian population at the time of 2001 census . in sentieri project the italian 2001 standard population was used as a reference to calculate crude and standardized rates . each outcome and cause analysed should be characterized to define its specific contribution in evaluating the possible health impact of contamination . for this aim , mortality , morbidity ( e.g. , hospital discharge records ) , cancer incidence , and congenital malformations prevalence could be of major interest . as described in the previous section , for each outcome a matrix of a priori evaluation each outcome can be considered usable for the sentieri approach if its validity is previously verified , and appropriate epidemiological parameters can be estimated . briefly , sentieri studied mortality in 44 npcss using data at municipality level ( 19952002 ) , calculating indicators such as crude and standardized rates ( italian 2001 standard population as reference ) and standardized mortality ratio ( smr ) , using regional comparison rates , both crude ( smr ) and adjusted for an ad hoc deprivation index ( smr i d ) . to control for confounding from social and economic factors an ad hoc deprivation index was built and applied to the smr estimates in sentieri project ( sentieri di ) . the deprivation index was constructed using the 2001 national census variables representing the following socioeconomic domains : education , unemployment , dwelling ownership , and overcrowding . the epidemiological evidence was examined on the basis of explicit criteria to build a matrix of the a priori epidemiological evaluation of the strength of the causal association for each combination of selected outcome and environmental exposure . for details concerning the a priori evaluation firstly a multidisciplinary group of researchers ( see the previous section ) draws up the list of causes to be submitted to the evidence evaluation . secondly , the epidemiologists classify the strength of the causal association of each outcome / exposure combination . firstly a multidisciplinary group of researchers ( see the previous section ) draws up the list of causes to be submitted to the evidence evaluation . secondly , the epidemiologists classify the strength of the causal association of each outcome / exposure combination . to complete this phase in sentieri project , the epidemiologists developed a procedure to examine the epidemiological literature published from 1998 to 2009 on the health risk of populations living in npcss . the epidemiologists examined each cause of death / exposure combination ( mortality was the first outcome to be analyzed ) in terms of strength of causal inference . environmental exposures the former were fixed on the basis of the possible sources of contamination in npcss listed in the decrees that defined each site boundaries ( e.g. , chemical industry , steel plants ) ; the other exposures were the environmental , lifestyle and occupational most important known etiological factors : air pollution , active and passive smoking , alcohol intake , occupational exposures , and socioeconomic status . the procedure finally led to classify the evidence of the causal association into three categories : sufficient to infer the presence of a causal association , limited to infer the presence of a causal association , and inadequate to infer the presence or the absence of a causal association . the criteria adopted for the classification are reported in table 1 . at the end of the second phase , a matrix of epidemiological a priori evidence about the strength of each outcome - cause / environmental exposure or outcome - cause/other exposure causal association was prepared ( example in table 2 ) .", "specific causes with a certain level of strength of causal association with the environmental exposures present in each npcs were reported and discussed in detail in sentieri . in order to have a general description of the residents ' health profile , main broad groups of causes of death the assessment and appropriate consideration of previous studies performed on the same npcs , if any , ameliorate the level of knowledge , reducing scientific uncertainties about the heath impact of contamination and facilitating the process of identification and implementation of remediation interventions . when more than one npcs are studied , a homogeneous way of presenting and discussing results can make the study results clearer and more readable . it included a summary description of population and contamination data : specific sections dedicated to ( a ) results by gender ( general health profile and specific , a priori selected causes ) ; ( b ) previous studies carried out in the investigated area ; and ( c ) a conclusive paragraph with suggestions for further scientific and/or remediation priorities as well as recommendations for public health interventions . in single sites examples of recommendations aimed at a better description and clarification of the observed health effects include the investigation of the respiratory diseases prevalence in children , the conduction of occupational and residential cohort studies , and health surveillance activities as well as exposure assessment and biological monitoring investigations . an example is the one of sassuolo - scandiano npcs presented in a following paragraph . the presence of asbestos or asbestiform fibres was the motivation for including six npcss in the national environmental remediation programme . in five of these sites increases in malignant pleural neoplasm mortality were observed ; in four of them the excess was in both genders . in four out of six other sites where in addition to asbestos other sources of environmental pollution most causes of death analyzed in sentieri have multifactorial etiology ; furthermore in most npcss multiple sources of different pollutants are present , sometimes concurrently with air pollution from urban areas : in these cases , drawing conclusions on the association between environmental exposures and specific health outcomes might be a hard task . notwithstanding these difficulties , in a number of cases the attribution could be possible on the basis of the increases observed in both genders and in different age classes , and the exclusion of a major role of occupational exposures was thus allowed ( in italy most of the workforce in industrial setting is still represented by males ) . for example , a role of emissions from refineries and petrochemical plants was hypothesized for the observed increases in mortality from lung cancer and respiratory diseases in two npcss ; a role of emissions from metal industries was suggested to explain increased mortality from respiratory diseases in two other sites . in six npcss an etiological role of air pollution in the raise of congenital anomalies and perinatal disorders was suggested , and a causal role of heavy metals , pah 's , and halogenated compounds was suspected for mortality from renal failure in six sites . according to the 2001 census , the npcs sassuolo - scandiano includes 6 municipalities with a 102,811 overall population . the perimetration decree of this npcs lists the presence of pottery manufacturing plants , an environmental exposure that sentieri qualifies as c ( plants producing chemicals and/or chemical products ) . sentieri results among the main causes of death show in this npcs some excesses for all causes and circulatory and respiratory systems diseases in men . some excesses are also observed for digestive system diseases in women ( table 3 ) . for the causes of death with an a priori sufficient or limited evidence of causal association with the environmental exposure in this npcs , an excess for respiratory diseases and asthma was observed in men ( table 4 ) , and for congenital anomalies ( malformations ) in all age classes , both genders ( table 5 ) . previous studies in this npcs showed that lead , a metal used in the pottery production , polluted subsoil , surface , and ground waters . notwithstanding a decrease in occupational exposure between the beginning of the seventies and half of the nineties , in 1995 , the lead levels remained high . at the beginning of the eighties , lead exposure levels in children were high ; during the second half of the nineties a sharp decrease was observed , and blood concentrations were lower than the 10 g/100 ml limit . according to sentieri , the evidence of the causal association between occupation and respiratory system diseases and asthma was classified as sufficient . since silicosis was not separately analyzed in sentieri and its risk is known to increase in pottery production , as observed in the cohort study of workers compensated for silicosis in italy , it was probably conducive to the observed respiratory diseases excess in this npcs . the occupational exposure to lead in pottery production might have contributed to the mortality excess due to parkinson 's disease and hypertension . a hypertension excess was pointed out for both genders ( men : smr = 192 ( 90% c.i . data acquisition for the appraisal of the present lead environmental pollution and occupational exposure is suggested . the mortality for causes of death with a priori sufficient or limited evidence of causal association with the environmental exposure showed , for the period 19952002 , 3,508 excess deaths for all causes , corresponding to 439 deaths / year ; the number of excess deaths was 1,321 for respiratory diseases , 898 for lung cancer , and 588 for pleural neoplasms . when considering excess mortality with no restriction to causes of death with a priori sufficient or limited evidence of causal association with the environmental exposure , the number of excess deaths for all causes was 9,969 ( smr 102.5 , about 1,200 excess deaths / year ) ; the excess was 4,309 for all neoplasms ( about 538 excess deaths / year ) , 1 887 for circulatory system diseases , and 600 for respiratory system diseases .", "the ecological approach used in sentieri does not allow to draw firm conclusions on the causal relationships between residential exposure and health status in residents in a contaminated site ; furthermore , the causal inference might be complicated for causes with multifactorial etiology in areas with multiple sources of different pollutants and concurrent presence of air pollution from urban areas . notwithstanding these difficulties , in a number of instances , the a priori evaluation of the epidemiological evidence as carried out in sentieri reinforced the findings and strengthened the case of an etiological role to some environmental exposures . this has varying degrees of persuasiveness for example , an increased lung cancer and respiratory disease risk was observed in sites hosting refineries and petrochemical plants , suggesting the need for further studies ; the ascertained exposure - disease association between pleural neoplasm mortality and asbestos was confirmed in sites with documented presence of asbestos and asbestos - like fibres . another aspect which could increase the persuasiveness of environmental - related health effects is the identification of raised health risks in children living in contaminated sites . in the 44 combined npcss , among children 0 - 1 year old , mortality from all causes and from perinatal conditions was , respectively , 4% ( 3,328 cases ) and 5% higher ( 1,903 cases ) than the italian reference population , and the overall mortality was significantly increased in one or more age groups ( 0 - 1 , 014 , and 019 years ) among children living in 11 ( 25% ) npcss . the value of an ecological study like sentieri should be measured , as recently suggested , against the baseline level of knowledge ; in this context sentieri contribution can be considered high given the absence of systematic and standardized epidemiological investigations of the health impact of residents in npcss . exposure ascertainment is a key phase in ecological environmental investigations ; the exposures affecting the study population should ideally be described in detail , while in practice a number of limitations affect this crucial aspect in most studies . in some investigations the exposure / s is a time - bound event in a limited geographical area , leading to a point source emission of a limited number of contaminants whose nature has been identified and whose toxicological properties can be partially known . events such as the explosion of seveso in 1976 and bhopal in 1984 belong to this category . more frequently the environment has been progressively and perhaps surreptitiously contaminated by a heterogeneous mixture of pollutants originating from industry ( often a variety of industrial activities ) or waste treatment / disposal activities . in this case several environmental matrices are contaminated over a period of years , leading to multiple sources of exposure to a variety of exogenous agents , possibly changing qualitatively or quantitatively overtime . for example , in sentieri project the sources of environmental exposures were abstracted from the legislative decrees defining sites ' boundaries , and chemical industry , petrochemicals and refineries plants , steel plants , power plants , mines and/or quarries , harbour areas , asbestos or other mineral fibres , landfills , and incinerators subsequently coded . such data are insufficient to give a full picture of space and time distribution and variability of the exposures . in addition , for most npcss no information is available on sources of exposure that can have a health impact , such as concurrent air pollution from road traffic and exposures in the occupational setting . another limitation in exposure ascertainment lies in the implicit assumption that all residents in the area under investigation experience the same exposures , while exposure variability is likely to be substantial , due to many factors ( e.g. , concentration of contaminants and their diffusion to soil and water , distance of residence from polluting sources ) . the possible consequences of such nondifferential exposure misclassification are complex , and direction of the resulting bias is not predictable . an additional limitation in exposure ascertainment derives from the territorial size and the population dimension of the areas at study for which vital statistics are available . whatever the administrative boundaries are , they hardly correspond to the distribution of environmental pollutants , so that the misclassification of exposure ( and loss of statistical power ) is common . as far as outcome measures . however , the analysis of hospital discharge records , ad hoc registry data of specific pathologies ( e.g. , cancer , congenital malformations ) can give a better picture of the health profile of residents in npcss . each vital statistics is able to provide information only about the events that is designed to record , and databases need to be validated for use in epidemiological studies . in the majority of countries death rates from all causes are unlikely to be biased because reporting the event of death is exhaustive . therefore the overall mortality , which is an important indicator of conditions of life , can be analyzed with confidence . in italy mortality data are available for the whole country , and validity of cause of death certification has been documented for specific diseases [ 1922 ] . in most european countries hospital discharge records ( hdrs ) are indicators of hospital activity , and their main use is for administrative purposes : validity when employed in ecologic studies some italian reports [ 24 , 25 ] comment on some critical aspects of this novel utilization of hdrs . the analysis of cancer incidence and congenital malformations data in environmental epidemiology investigations can be considered , subject to validity evaluation . in italy in the context of contaminated sites congenital anomalies have been used in a descriptive study and the investigation of cancer incidence has been planned . mortality statistics and hospital discharge statistics have been using the succeeding versions of the international classification of diseases ( icd ) that guarantees homogeneity and comparability of results obtained in different places . however , particularly for cancer , the resolution power of the icd is far lower than that of classifications based on pathological diagnosis such as the succeeding versions of the international classification of diseases for oncology ( icd o ) . some associations between environmental agents and cancer are limited to specific pathological variants of the disease ( e.g. , wood dust and adenocarcinoma of the nose and nasal sinuses ) ; for populations served by cancer registries where the histological type of cancer is systematically recorded this problem is solved . in environmental health studies factors as socioeconomic status , occupational exposures , and individual lifestyles can have an etiologic role on the health effects under study thus possibly confounding the exposure - disease relationships . socioeconomic status is a determinant of health and disease . since the mid-1990s ecologic studies of environment and health in uk adjusted for deprivation using census data ; for a review refer to pasetto 2010 . to account for deprivation in sentieri project mortality data were analyzed both crude and adjusted based on an ad hoc deprivation index ( sentieri di ) . occupational exposures are potential confounders in ecological studies of environment and health ; individual based studies may be needed to disentangle environmental and occupational risk . the present paper referred as a common thread to sentieri project , in its main components of mortality study and a priori evaluation of the epidemiological evidence . its major strengths are the standardization of the mortality analysis and npcss classification in terms of environmental exposure which allow the study of all npcss in one country ; the a priori evidence evaluation to comment and interpret study results is a key characterizing element of the project . additional assets are that the mortality analysis can be updated and other vital statistics data can be analysed ; also the a priori evidence evaluation can be brought up to date following the established criteria and procedures .", "the sentieri approach allows the description of the health status of populations living in the italian npcss . furthermore , it is suitable for an overall analysis of data from different npcss and comparative analysis of data from npcss with the same contamination sources . the sentieri approach is , in its essence , a tool to describe the health profile of residents in npcss to document ascertained or suspected associations with local environmental risks ; it does not require an ad hoc data collection . the approach can also be of value for health surveillance activities in npcss ( possibly analysing different outcomes ) ; in addition it can contribute to etiological evaluation of cause - effect associations if additional data from biomonitoring investigations , risk assessment studies , and individual - based epidemiological studies are available . the links between environmental exposures and health effects depend on the environmental pollutants and diseases being considered but are also influenced by factors such as genetic constitution , age , nutrition and lifestyles , occupation , and socioeconomic factors such as poverty and level of education . identifying these relationships is therefore challenging ; however , the effort is often worthwhile as it may help to redefine priorities and unlock resources . other strengths of the sentieri approach are that the a priori evidence evaluation and mortality analysis can be updated ; other health outcomes in addition to mortality can be analyzed , for example , cancer incidence , morbidity , and adverse reproductive effects ; also the a priori evaluation can be carried out for environmental exposures different from the ones in sentieri project . notwithstanding the remarkably laborious activities required to set up a national project such as sentieri , major benefits in terms of quality and quantity of findings , and a favourable cost / gain balance can be expected inasmuch as this becomes a permanent system of epidemiological observation on health of residents in npcss ." ]

[ "the study population included 1177 patients who underwent different types of cardiac surgeries with cardiopulmonary bypass method at sina private hospital ( isfahan , iran ) , between april 2008 and september 2009 . all patients underwent a cardiovascular diagnostic procedure requiring the use of a contrast agent for left ventriculography , coronary or carotid angiography , and thoracic and/or abdominal aorta angiography before their surgeries . thus , the patients requiring emergency dialysis therapy or those that underwent the off - pump method surgery were excluded . data for the studied patients including demographics , clinical characteristics , laboratory data , medical treatments , angiographic data , ( including amount and type of the contrast agent used ) , comorbid conditions and cardiac procedural data ( including its timing in relation to the preceding angiography ) , were collected by reviewing hospital record files in a computerized database . the study was approved by the research ethics committee of isfahan university of medical sciences , isfahan sina heart center . the contrast agent used were meglumine compound 76% ( urografin , bayer , usa ) as hyperosmolar , iopromide 370 ( ultravisit , berlex montville , usa , mfd . in : germany ) and iohexol 300 ( iopaque , iran or omnipaque 300 , usa ) as low - osmolar contrast agents . use of nonsteroidal anti - inflammatory agents and other nephrotoxic drugs were avoided or withheld for 48 hours before angiography . postoperative renal risk was assessed using 2 different risk scores of a simplified predictive index for renal replacement therapy after cardiac surgery and a risk score for prediction of contrast - induced nephropathy.9 the main outcome of interest was the incidence of postoperative arf , defined as postoperative serum creatinine > 2 times baseline and/or the need for renal replacement therapy . the mean value of baseline creatinine was 0.99 mg / dl.6 the obtained results are presented as mean sd , frequency , and percentage . comparisons were made using chi - square test or fisher 's exact test for categorical variables and nonparametric test for continuous variables . the amount of contrast media was entered into the model as both a linear ( continuous variable ) and a dichotomous term ( median or less and greater than median value ) . multivariable logistic regression analysis was used to identify independent predictors of arf using variables found to have marginal association ( p > 0.10 ) on univariate analysis . odds ratio ( or ) and 95% confidence interval ( ci ) were constructed to provide an estimate of adjusted risk posed by post - procedural arf .", "comparisons were made using chi - square test or fisher 's exact test for categorical variables and nonparametric test for continuous variables . the amount of contrast media was entered into the model as both a linear ( continuous variable ) and a dichotomous term ( median or less and greater than median value ) . multivariable logistic regression analysis was used to identify independent predictors of arf using variables found to have marginal association ( p > 0.10 ) on univariate analysis . odds ratio ( or ) and 95% confidence interval ( ci ) were constructed to provide an estimate of adjusted risk posed by post - procedural arf .", "comparisons were made using chi - square test or fisher 's exact test for categorical variables and nonparametric test for continuous variables . the amount of contrast media was entered into the model as both a linear ( continuous variable ) and a dichotomous term ( median or less and greater than median value ) . multivariable logistic regression analysis was used to identify independent predictors of arf using variables found to have marginal association ( p > 0.10 ) on univariate analysis . odds ratio ( or ) and 95% confidence interval ( ci ) were constructed to provide an estimate of adjusted risk posed by post - procedural arf .", "of 1177 patients who underwent different types of cardiac surgeries after angiography , arf occurred in 465 subjects , 2 of these patients needed dialysis . mean dose of hyperosmolar and low - osmolar contrast agents used overall were 1.23 and 1.21 ml / kg , respectively . baseline clinical features between the two cohorts with and without postoperative arf are listed in table 1 . postoperative arf was more prevalent in older and male patients ( p = 0.003 and 0.002 , respectively ) , and those with a higher history of hypertension(p = 0.012 ) , but prevalence of other risk factors as well as left ventricular ejection fraction were similar in both group of patients . there was a significant difference between last pre and post- operative creatinine in both groups ( p < 0.001 ) . patients with arf were also more likely to have undergone combined coronary artery bypass grafting and valve surgery the same day as angiography and also underwent more postoperative intra - aortic balloon pump insertion ( iabp ) ( table 2 ) . the patients with arf were more likely to have received higher doses of both hyper - osmolar and low - osmolar contrast agents compared to mean doses ( p = 0.17 and 0.035 , respectively ) . however , the time interval between cardiac surgery and last catheterization was not different between the patients with and without arf ( p > 0.05 ) ( table 2 ) . clinical and demographic characteristics of the studied population contrast agent and cardiac surgery data overall postoperative peak creatinine was highest on day 0 ( figure 2 ) , then decreased and remained significantly unchanged after this period ( p < 0.05 ) . however , overall prevalence of acute renal failure during follow - up period ( figure 2 ) had a changeable trend and had the highest rates in days 1 ( 53.57% ) and 6 ( 52.17% ) ( p < 0.05 ) . relationship between the time interval flanked by angiography and surgery and postoperative serum creatinine relationship between the time interval flanked by angiography and surgery and postoperative acute renal failure independent correlates of postoperative arf in a multivariate model are listed in table 3 . combined coronary artery bypass grafting ( cabg ) and valve surgery was the strongest predictor of postoperative arf ( or : 4.976 , p = 0.002 ) , followed by intra - aortic balloon pump insertion ( or : 6.890 , p = 0.009 ) and higher dose of contrast agent ( or : 1.446 , p = 0.031 ) .", "the major findings of the present study were that the higher dose of the used contrast agents besides some other determinants such as combined coronary bypass and valvular surgery as well as iabp insertion could effectively predict post - procedure acute arf . on the other hand , the use of high dose of contrast agent was strongly related to the incidence of arf after combined cardiac surgery . in fact , our data confirmed findings of other investigations that arf after cardiac surgery was associated with the amount of prescribed contrast agents . in a similar study by ranucci and his colleagues,6 cardiac surgery performed on the day of cardiac catheterization and higher dose of contrast agent although these investigators demonstrated a correlation between the time interval of cardiac catheterization and surgical procedure with the incidence of acute arf , we could not demonstrate this relationship in our multivariable regression model . in another study by del duca et al4 cardiac catheterization performed within 5 days before operation , baseline glomerular filtration rate of less than 60 ml / min and prolonged cardiopulmonary bypass duration , were significant risk factors for acute renal failure after cardiac surgery . moreover , other studies established similar clinical and surgical characteristics associated with increased risk of arf after cardiac surgery , including age,168 baseline serum creatinine,10 diabetes mellitus,1113 congestive heart failure,1012 emergency surgery,1114 concomitant valve surgery with coronary artery bypass grafting,11 preoperative use of iabp,14 and low cardiac output syndrome in the postoperative course.1415 however , these studies consistently failed to account for the influence of the timing between previous angiography and cardiac surgery and the amount of the contrast agent used in this event . multiple mechanisms have been suggested to contribute to the renal damage following cardiac diagnostic procedures , including non - pulsatile flow , embolization , and trauma to the blood constituents , hypothermia , and activation of known inflammatory pathways.16 iodinated contrast as a common contrast agent , after causing a brief period of vasodilation , can cause sustained intrarenal vasoconstriction and ischemic injury . the ischemic injury sets off a cascade of events largely driven by oxidative injury , causing death of renal tubular cells . if a sufficient mass of nephron units are affected , then a recognizable rise in serum creatinine will occur.1718 therefore , minimizing the amount of contrast agent during preceding angiography is recommended . similar studies need to be conducted regarding alternate imaging modalities that do not use iodine - based contrast agents to obtain information about ventricular function , valvular dysfunction and aortic pathologic characteristics.6 finally , strategies to prevent contrast - induced nephropathy during angiography that is continued in the postoperative period may also have the potential to decrease arf after early cardiac surgery .", "mms designed the study and drafted this manuscript ; mg carried out the study and drafted the tables ; pn carried out the study and drafted the tables ; hsh helped in designing the study ; hms helped in final drafting ; ak helped in designing and carried out the study ; pms data analysis ; and nf data collection ." ]

[ "colorectal cancer ( crc ) is one of the most common human malignancies in western countries . colorectal adenomas have high malignancy potential when they are large in diameter and/or present with severe dysplasia and/or a villous component . colonoscopic polypectomy has been documented to significantly reduce the incidence of colorectal cancer [ 3 , 4 ] . therefore , the identification of factors associated with the development of colorectal adenoma represents a major goal in colorectal cancer prevention . they could indeed allow the selection of individuals at risk of crc who may benefit from a screening by colonoscopy . the adenoma - carcinoma sequence suggests that colorectal adenomas and adenocarcinomas share common environmental and genetic risk factors . an increased risk of colorectal tumors has been found in relatives of patients with large adenomas [ 5 , 6 ] . a case - control study had suggested that family history of colorectal cancer influenced only the growth of adenomas or their malignant transformation . however , relatively few epidemiologic studies explored genetic risk factors in colorectal adenomas . we investigated , through a case - control study , the relation between polymorphisms within a series of candidate genes involved in colorectal tumorigenesis and putatively in the formation and the development of colorectal adenomas such carcinogen metabolism enzymes , methylation enzymes , dna repair genes , oncogenes and tumor suppressor genes .", "the genetics of adenomas ( geade ) study is a case - control and family study of patients with high - risk adenomas ( 10 mm ) . the data were obtained from 18 participating gastroenterology units of general hospitals in france . from september 1995 to march 2000 , 306 consecutive patients with newly diagnosed colorectal large adenoma ( la ) were enrolled in the study . patients with personal cancer history , familial adenomatous polyposis , established hereditary nonpolyposis colorectal cancer or inflammatory bowel disease were excluded . to distinguish genetic factors involved in the occurrence of adenomas or in their growth , 307 cases with small adenomas ( with a diameter smaller than 0.5 cm ) ( sa ) and 572 polyp - free controls ( with normal colonoscopy ) ( pf ) reason for referral , family history of crc , completeness of colonoscopy were registered for all patients and controls . two pf per la cases were selected as controls within over 2000 pf for matching on age , gender , and geographic area . blood specimens were obtained at time of colonoscopy and those patients who presented with a polyp were included only when histological examination revealed the adenomatous nature of the lesion . as polyps were totally removed during colonoscopy , their natural evolution could not be scored . after longitudinally section , half of the tumor material was fixed for histologic analysis and half was frozen for molecular characterization . twenty individuals had to be excluded because of insufficient tumor material : 11 patients with la , 5 with sa , and 4 pf . the final groups contained 295 patients with la , 302 with sa , and 568 pf as controls . all patients and controls signed an informed consent after approval of the study by an ethic committee for biomedical research ( le kremlin - bictre ) and the database was declared to the national committee commission nationale de linformatique et des liberts ( cnil ) . genes have been selected for their role in colorectal tumorigenesis and for the presence of frequent neutral polymorphisms . the polymorphisms of mmp1 , mmp3 , and mmp7 gene promoters , that are responsible for the degradation of extracellular matrix components , had been previously studied and were not considered in the present analysis . three genes , ts , ugt1a1 , and mdr1 , are implicated in folates , bilirubin metabolism , and transport of xenobiotic respectively . all these pathways are suspected to play a role in cancer occurrence or in the transformation of benign lesions , folates by interfering with dna synthesis and repair , bilirubin by its known antioxydant properties , and transport of xenobiotic by its detoxication function . case - control reports exemplified the relevance of these three genes in addition to hras1 . three additional pathways have been secondary studied including the wnt pathway ( apc , ctnnb1 , axin2 ) , the p53 pathway ( tp53 , bax ) , the tgfb pathway ( tgfbr2 ) , the main mmr and ber genes ( msh2 , mlh1 , myh ) , and card15 as part of the family with lrr domains . all these genes have been strongly assessed for their major role in oncogenesis , cycle cell control , apoptosis regulation , cell adhesion and migration , proliferation , dna repair as their main functions . the vntr of hras1 was studied by conventional electrophoresis after pcr amplification on 1.2% agarose gels at 2 volts / cm for 1518 hours . hardy - weinberg proportions were tested for each polymorphism . linkage disequilibrium ( ld ) between pairwise loci genotype - specific odds ratio ( or ) and 95% confidence intervals ( cis ) were computed using unconditional logistic regression adjusted on matching factors ; wald test was used to assess the global effect of each polymorphism . the homozygous genotype for the more frequent allele among controls was set as the reference class . the association was further examined using the combination test , that allows the analysis of all possible combinations of snps within a given gene or tightly linked genes to test their association with the disease . for each snps combination , the method computes a statistic test contrasting the genotypic ( or haplotypic ) distribution between cases and controls . because all these tests are correlated ( many of them are nested in each other and the snps are likely to be in ld ) , a permutation procedure has been implemented which displays a significance level adequately adjusted for multiple testing . first , we used the famhap12 software to apply this method by performing haplotypic tests . then the combintest ( jannot , personal communication ) was used to perform genotypic tests . the method was extended to the test of combined polymorphisms on different genes that may act interactively . to avoid multiple tests biases , we chose a three - step strategy that minimizes the number of comparisons . first , we considered two - by - two combinations of polymorphisms chosen on their plausibility to interact with each other , for instance , apc and myh both responsible , when mutated , for adenomatous polyposis . finally , as a combination of polymorphisms may have an effect even if the genes are not suspected to interact with each other and are not involved in the same pathway , all possible combinations were considered if the first two steps did not reveal any significant association . when several combinations of polymorphisms were significant within a given test , it was possible to test nested combinations using chi - square calculation to determine whether a given polymorphism adds a significant contribution to the association found .", "the average age was very similar in patients ( 62 years for la and 61 years for sa ) and in pf controls ( 61 years ) . the sex ratio ( male / female ) was quite similar in la ( 1.7 ) and in pf controls ( 1.5 ) , slightly lower in sa ( 1.2 ) because of the absence of matching . \n table 1 describes the characteristics of the polymorphisms studied and the allele frequencies in controls . the distribution of genotypes in controls was consistent with hardy - weinberg proportions for all polymorphisms except for tp53.3 ( p = .0013 without correction for multiple testing ) . a similar departure from h - w proportions ( p = .010 ) was found in the hapmap european population ( http://www.ncbi.nlm.nih.gov/projects/snp/ ) for this polymorphism . all polymorphisms within a same gene were moderately or not found in ld except myh ; myh.1 and myh.2 are in quasicomplete disequilibrium ( d = 1 and r = 0.99 ) . analysis of single polymorphisms for the different comparisons , la versus pf , la versus sa , and sa versus pf did not reveal any association for most of the genes studied . the p - values found to be less than .05 were obtained for apc.1 , mdr1.2 , and axin2.9 . the results of the haplotypic and genotypic combination tests performed for each gene or gene combination are shown in table 4 . when considering each gene separately , only apc displayed a significant difference between small and large adenomas ( p = .014 in haplotypic analysis and p = .07 in genotypic analysis ) . as apc.1 alone and the combination apc.1-apc.2 appeared both significant , we tested whether apc.2 provided a significant contribution to the association , which was not the case ( = 2.12 , 1df ) showing that the association was solely due to the apc.1 ( p.glu1317gln ) polymorphism . the combination apc - myh appeared also significant with a global p - value of .045 . however , the only significant combination was apc.1-apc.2 already found , showing that myh does not provide any additional contribution to the association between apc and adenomas . no difference was found for the other two comparisons , that is , sa versus pf and la versus pf . finally , the analysis of all possible combinations did not provide any significant result .", "we investigated the role of candidate gene polymorphisms in a case - control study of patients with large adenomatous polyps ( n = 295 ) , compared to patients with small adenomatous polyps ( n = 302 ) and polyp - free controls ( n = 568 ) . the 38 polymorphisms studied belonged to 14 genes possibly involved in increasing of colorectal cancer risk . the reason for comparing these different groups of patients was that different genes might be involved in the different steps of carcinogenesis . using this case - control study , we had shown that mmp polymorphism was most probably involved in the occurrence , but not in the growth of polyps . using the combination test , we had shown that the effect was due to a specific combination of mmp1-mmp3 polymorphisms which was not found using logistic regression . indeed , a major property of this test is that it allows the detection of polymorphisms with low marginal effects . multiple testing may be a limitation of studies in which several polymorphisms in several genes are tested . the combination test allows a correction for multiple tests on tightly linked markers , which other methods of correction such as bonferroni , benjamini - hochberg , or fdr ( false discovery rate ) do not . in the present study , we could show that the positive results obtained for axin2 and mdr1 when analyzing single polymorphisms were false positives as these results were not confirmed when using the combination test . for independent markers , there was no need for correcting for multiple testing as our results were essentially negative . our study did not give evidence for an effect of any of the gene polymorphisms studied except the p.glu1317gly variant of the apc gene . some studies reported an effect of this variant in patients with multiple adenomas or colorectal cancer [ 1517 ] , and some others found an effect in adenomas but not in cancer [ 18 , 19 ] . more recently , hahnloser et al . reported an effect of this variant in a group of patients with a small number of adenomas ( 1 to 3 lifetime adenomas ) and in a group of crc cases . none of these studies considered the size of adenomas and could differentiate adenomas at high - risk from those at low - risk of cancer . our results favour the hypothesis that the p.glu1317gly variant would influence the growth and not the occurrence of adenomas , and would have thus indirectly an influence on colorectal cancer risk . nevertheless , although the three groups are paired on gender and geographic origin , it is not stated if other known risk factors would influence adenoma growth . it is thus important to plan a specific multivariate analysis when building a replication sample . regarding the ts polymorphisms chen et al . found a significant effect of the 3r allele of ts.2 , particularly of the 3r/3r genotype ( or = 3.3 ) . in our study , the or associated with 3r/3r genotype was 1.43 ( ci 0.942.16 ) for la versus pf and 1.10 ( ci 0.681.78 ) for la versus sa . on the other hand , ulrich et al . found no marginal effect with any of these two polymorphisms but found a significant interaction of ts.2 with folate intake . similarly , the most recent studies [ 23 , 24 ] found no marginal effect of either polymorphism but a slight interaction with folate or vitamin b6 intake . the groups ' sizes in our study were of the same order of magnitude as in the study of chen et al . , but the three other studies which did not show any marginal effect included larger groups ( more than 500 individuals in each group ) . given the size of our population , we could a priori detect an or of 1.7 with a power of at least 80% . it is highly probable that the ts gene , which produces a key enzyme in folate metabolism , has an effect only in interaction with dietary exposures , which would explain why this effect was not found in our study . moreover a new snp has been recently identified in the second repeat of the 3r allele leading to split the allele 3r in 3rc and 3rg alleles as a tri - allelic polymorphism . this variant could explain these discrepant results since patients with 3rc/3rc genotype have a transcriptional activity of ts comparable to those with 2r/2r genotype . in our study , the problem of multiple testing was adequately controlled for each test performed by the permutation procedure implemented in the combination test . in the last analysis step , the tremendous number of comparisons resulted in a drastic correction of each p - value , which considerably lowered the testing power . thus , our negative results certainly do not definitively demonstrate the absence of specific combination influencing colorectal tumorigenesis , but more probably that , if it exists , this ( of these ) effect(s ) is ( are ) low and could be found through the initial ( and further ) genome - wide association studies of colorectal cancer testing much larger numbers of patients and controls [ 26 , 27 ] ." ]

[ "a 56-year - old man suffering from diabetes and hypertension was admitted to the neurology department in a hospital elsewhere with signs of epileptic seizure . after a brief period , a diagnostic laparotomy with gastrotomy was performed , at which over 3 liters of blood were found , but no active bleeding . the site of origin of hemorrhage was suspected at the gastroesophageal junction , although no peptic ulcer could be discovered . gastroscopy was performed 1 day later , demonstrating a large , ulcerating tumor at the cardia , of which biopsies were taken . because the patient was now diagnosed with a bleeding tumor at the gastroesophageal junction , he was transferred to the icu of the canisius - wilhelmina hospital in nijmegen ( in formation with the radboud university hospital comprising the esophagus centre eastern netherlands , scon ) . a computed tomography ( ct ) scan was performed , showing a large tumor at the gastroesophageal junction , extending towards the pancreatic tail ( fig . a second gastroscopy with new biopsies , 8 days later , proved the same results . at the time of the third gastroscopy , a second ct scan revealed a remarkable decline of the entire process , emanating from the pancreatic tail as a pseudocyst ( fig . our patient experienced hypovolemic shock following massive gastrointestinal hemorrhage caused by a burst - through of a pancreatic pseudocyst to the stomach .", "the incidence of upper gastrointestinal hemorrhage in the netherlands is 45 - 70 per 100,000 per year , most of which are caused by peptic ulcers of the stomach and duodenum . a pseudocyst of the pancreas consists of one or several collections of pancreatic fluid , surrounded by inflamed pancreatic tissues . the wall is formed by the enclosing structures , i.e. stomach , transverse colon or omentum . the pseudocyst is usually connected to the pancreatic duct . the distinctive feature between a genuine cyst and a pseudocyst is the lack of an epithelial layer . pseudocysts of the pancreas arise as a result of episodes of acute pancreatitis or blunt force abdominal trauma . the cause is often disruption or obstruction of the pancreatic duct , with subsequent accumulation of pancreatic fluids , containing high concentrations of pancreatic enzymes . in acute pancreatitis , ( pseudo)cyst and necrosis can be difficult to distinguish by contrast - enhanced ct scan , whereas magnetic resonance imaging ( mri ) is distinctive . pseudocysts can damage adjacent arteries by means of mechanical pressure and digestion by pancreatic enzymes , hereby causing the formation of pseudoaneurysm with possible subsequent hemorrhage into the pancreatic duct . usually , this involves the splenic artery , but also the gastroepiploic arteries and gastroduodenal branches can be affected . the old motto is to drain pseudocysts larger than 6 cm or existing longer than 6 weeks , although literature on the subject scarcely supports this . the possibilities for drainage are to marsupialize the pseudocyst through laparotomy or laparoscopy to the stomach or jejunum , or to perform resection of the pancreatic tail pseudoaneurysms or hemorrhages are eligible for endovascular embolization , and transgastric drainage of cysts is contraindicated during hemorrhages , unless embolization is performed first . case series and case reports in the available literature on hemorrhaging pseudocysts all advocate endovascular embolization , followed by resection of the pancreatic tail [ 5 , 8 , 9 , 10 , 11 , 12 , 13 ] . our patient was diagnosed with hemorrhaging pseudocyst 16 days after admission and initial laparotomy . because of the improving clinical condition and decline of the pseudocyst on ct scan , it was decided to pursue a the initial plan was to perform pancreatic tail resection after clinical recovery ; however , ultrasonography and ct scan revealed a rapid decline and full disappearance of the pseudocyst . our patient made a full recovery and has adjusted his life style . in all case reports , operative intervention is advocated , precipitated by endovascular embolization in case of serious hemodynamic instability . one case series of 16 patients reports a 62% mortality rate , in which endovascular embolization is combined with pancreatic tail resection . there is evidence to support the role of angiography in case of acute upper gastrointestinal hemorrhage , simultaneously offering the possibility for endovascular treatment [ 2 , 5 , 8 , 9 , 10 , 11 , 12 , 13 ] . embolizing the splenic artery does not inevitably necessitate splenectomy , for the remaining blood supply to the spleen is routed through the vasa brevia , which should be sufficient . furthermore , the course of our patient proves that surgical intervention such as pancreatic tail resection is not always an absolute necessity .", "however , surgery is nowadays not the only option for treatment , as possibilities in radiological endovascular diagnostics and techniques are increasing and will eventually be the first step in treating acute upper gastrointestinal hemorrhage ." ]

[ "today , implant therapy is regarded as an extremely reliable approach to replace missing teeth . the introduction of osseointegrated implants in dentistry represented a turning point in dental clinical practice.1 as a general principle in implant surgery implant surfaces should be surrounded by alveolar bone.2 following loss of teeth , natural process of bone resorption occurs.3 sometimes due to prosthetic or anatomical limitations of alveolar ridge , it is not possible to insert implants in bone appropriately.2 and also , while preparing implant sites in narrow ridges , dehiscence or fenestration defects may occur frequently that threaten the survival of implants.4 successful implant treatment depends on sufficient bone volume at the implant surface.5 insufficient amount of supporting bone , will limit the effectiveness of osseointegrated dental implants3 and will have an adverse effect on dental implant prognosis.6 several clinical studies have shown that to ensure long term success of implants , at least one millimetre thickness of bone in buccal surface and lingual surface of implant is essential . if the implant surface is not completely covered with bone , it will result in gingival recession , unpleasant appearance , problems in keeping good oral hygiene and ultimately increases the risk of infection around the implant.7 implants can be placed in alveolar ridges with defects including dehiscence , intraalveolar defects , and fenestration.8 several methods are presented to reconstruct the destroyed alveolar bone which include osteoconduction , osteoinduction and guided bone regeneration ( gbr).6 many surgical techniques are introduced to enhance alveolar bone volume for placing implants that include various grafting techniques , bone - building using emineral method , and expanding the bone and guided tissue regeneration ( gtr).5 among these techniques , gbr is widely used . gbr procedures performed in dental implants enable clinicians to increase the width and height of defected alveolar ridges or to treat fenestrations and dehiscence around implants . many researchers have reported predictable results in the simultaneous use of gbr technique when placing implants.7 in most cases of gbr , membranes are supported by protective materials consisting allografts , synthetic materials and xenografts.6 using autograft in augmentation has always been considered as a gold standard , but limited access to autogenous sources , particularly in the areas inside the mouth , prolongation of surgical procedures and bacterial contamination complication have always been considered as the limiting factors in autogenous transplantation . in addition , general surgical risks such as infection , bleeding , pain and swelling , damage to inferior alveolar nerve and the adjacent teeth should also be noted . therefore , using biomaterials on its own or in combination with autogenous bone is very common.9 dfdba can be named as one of the allograft materials which has osteoinductive potential , because this substance contains some major bone morphogenetic proteins ( bmps ) of donor tissue matrix . against this view , many recent reports have shown that augmentation with dfdba is not os - teoinductive , because it does not contain the necessary bmps to induce bone formation . in the united states , emineralised bone matrix ( dbm ) is considered a transplantable tissue and therefore , is regulated primarily by the american association of tissue banks.10 treatment of dehiscence and fenestration lesions with gbr technique and placing of implants simultaneously have predictable results.11 recent clinical studies have proven that the use of bone substitute materials together with placing implants led to successful coverage of pre - exposed implant surfaces.12", "this prospective clinical trial animal study was conducted in professor torabinejad dental research centre isfahan university of medical sciences , isfahan , iran . samples dissection was carried out in the department of materials science and engineering , sharif university of technology , tehran , iran . studied population included three healthy adult iranian dogs that were chosen by convenient method . inclusion criteria included healthy 2 to 4 years old dogs that held all the teeth . at the beginning of the study , after examination to confirm their health and having the required criteria ; seven step vaccination was carried out and the dogs were quarantined for 15 days . all the mandibular premolars teeth were extracted and then , the area was left to heal for three months . after healing period , the area assessed by periapical radiography in order to ensure full recovery , after preparing two sits on one side of each mandible and three sites on the other side which were more appropriate in terms of size and bone quality to place the implants , dehiscence bone defects , were prepared with dimensions of 5 mm apicocronaly , 4 mm mesiodistaly and 3 mm buccolingual in buccal plate using high - speed handpiece and diamond fissure bur and abundant irrigation . 10 mm periodontal probes were used to measure dimensions of the artificial dehiscence defects ; all measurements were performed by a specialist investigator . euroteknika implants with 10 mm in length , 4.1 mm in diameter and sla surface ( natea system ) inserted into the prepared sites . implant stability quotient ( isq ) of each implant was recorded using ostell device ( ostell integration diagnostics , svedalen , sweden ) which was higher than 56 % in all cases , indicating good initial stability of all implants placed . after that in two lesions , that was chosen in random , dfdba cenobone , hamanand saz baft , iran and in two other lesions dfdba dembone , pacific coast tissue bank , u.s were placed and the fifth lesion was left empty ; finally , they all were covered by collagen membranes ( bicon , usa ) . both dfdba brands were powder in sahape in 0.5 and 1 grams vials the size of the particles were almost similar and of the existing type to treat small lesions . dfdba particles were placed in the lesions and were gently pressed against the implant ; the lesion were with particles filled up in a way that all the screws were covered and the primary bone contour was maintained . then , the grafted material and surrounded bone were covered completely by collagen membrane . moreover , the gingival flaps were replaced without stretching to submerge the implant and were stitched by polyglycolic acid sutures ( vicryl ) using simple and interrupted loop sutures . then , final status of implants were determined by periapical radiography . during the first week after surgery , animals were examined several times a day to control the health and complications after the operation and also to ensure the sutures are not opened . the animals mouth was washed twice a day using 0.2 chlorhexidine mouthwashes during the first week and thereafter , once a week . after four months of osseointegration period , dogs were anesthetized and periapical radiographs were taken to observe implants situation within the bone . then , crestal incision was done and the implants were exposed and the value of isq was recorded . samples were taken and immediately transferred to formaldehyde 10% and kept for 24 hours to be prepared for optical microscope study . samples were sectioned by with the ground section method using microtome ( accutom-50 cutting machine , copenhagen , denmark ) . sectioned samples were obtained buccolingualy and parallel to the axis of implants in 100 micron thickness . sectioned samples prepared with trichro massons staining studied by optical microscope ( olympus , japon ) . using histomorphometric method , the percentage of bone implant contact ( bic ) was cal - culated and type of bone ( lamellar , woven ) was determined at 40 times magnification and recorded by an experienced pathologist using optical microscope . in this method , the area of 2 mm around the implants is evaluated . spss 11.5 software was used to analyse data , using one - way anova and pearson correlation and regression tests .", "average bic in cenobone group ( iranian dfdba ) , dembone group ( american dfdba ) and control group were 77.36% 9.96 ( max 89.1% and min 63.4% ) , 78.91% 11.99 ( max 91% and min 56.3% ) and 71.56% 5.61 ( max 75.8% and min 65.2% ) , respectively . therewas no significant difference in bic amounts among the three groups ( p = 0.607 ) . there was not significant difference in the bic amounts among the three groups defects ( p=0.388 ) . comparison of average bic of lamellar bone , woven bone , cenobone and dembone groups defects and control group is presented in figure 1 . comparison of average bic of lamellar bone , woven bone , cenobone and dembone groups defects and control group ( lamellar bone p = 0.298 and woven bone p = 0.380 ) . furthermore , there was not meaningful difference in rate of lamellar bone ( p=0.298 ) and woven bone ( p = 0.380 ) formation in defects among the three groups . the total sample average isq was 70.83% 6.30 ( max 82.5% and min 61.5% ) . average isq in cenobone group , dembone group and control group were 70.29% 7.74 ( max 82.25% and min 61.5% ) , 72.25% 6.81 ( max 82.5% and min 65.25% ) and 69.08% 2.67 ( max 72% and min 66.75% ) , respectively . there was no significant difference in isq amounts among the three groups ( p = 0.781 ) . there was a positive relationship between total sample bic and isq ( p = 0.004 , r = 0.692 ) . histological view under light microscope showes contact of lamellar new bone with implant in cenobone group magnification x40 massons 's trichrom staning . histologic view under light microscope showes contact of lamellar new bone with implant in dembone group ( magnification x40 massons 's trichromstaning ) .", "results of the current study indicated that adding dfdba ( dembone and cenobone ) to membrane , on its own did not significantly increase the obtained bic and isq amounts . caplanis and colleagues placed , implants in the alveolar defects which treated with membrane on its own and membrane plus dfdba in dogs , the average bic was about 70%13 which is consistent to our study . and also , the bic obtained in this study is consistent with the findings of von arx and colleagues study14 that placed implants in areas grafted with dfdba and other hybrid materials in dogs and gained a high percentage of bic ( 59% to 75% ) . in this study , adding dfdba to the collagen membrane did not lead to strengthen induction of bone formation , and these findings were consistent with the results of other studies that showed adding dfdba to the membrane on its own did not significantly increase the clinical results obtained with the gbr procedure.151920 there were significant differences between the products of bone banks in terms of induction of bone formation . some studies found the use of dfdba to have a positive impact to increase bone growth while others considered it not to be beneficial . schwartz and colleagues have shown that there is a wide variety of dfdba products on the market which have different inductive capabilities.21 these differences may be related to the origin and methods of preparation of dfdba and if the preparation methods were the same in different bone banks , this would be due to individual donors ages and sexs , disease and injury , medical treatment or genetic differences . also , the variations of time between death and the bone extraction , may result in significant loss of the bone inductive ability . there are many differences in size and the surface shape of dfdba particles that may affect their inductive ability . bone cells distinguish different surface shapes and roughness and this will lead to differences in phenotypic diversity.22 in de vicente and colleagues study , the implants which the bone defects around them were filled with dfdba showed similar bic to the implants which their defects had just covered with collagen membranes.23 therefore , adding dfdba did not have any advantages over membrane on its own , which was in line with other studies.15161920242526 in stentz and colleague 's study,26 using dfdba together with membrane in bone defects around implants improved the healing of the bone density . since they had used radiographic method , the obtained information could not determine the value of bic , which is a better evaluating index for outcome of implant treatment and for these reason , they could not show the dfdba efficiency to increase bic . becker and colleagues27 did not find the use of dfdba beneficial for periodontal regeneration and bone regeneration around implants , while abolfazli and colleagues found the use of dfdba ( cenobone ) beneficial to repair periodontal lesions in two or three walls alveolar bone defects and reported its effect on bone - formation being the same as aotogenous bone graft . in some studies dfdba was enriched with rhbmp-2 and growth factors and produced better results.2230 the current study results indicated that the relationship between indices of bic and isq was positive and significant . these findings are compatible with huang and colleagues study31 as well as nkenke and colleagues study32 which also found the significant and positive relationship between bic and isq amounts in implants placed in human cadaver bone . results of this study are coincident with the findings of other researchers in efficiency of using the resonance frequency analysis method to determine the implants stability3133 and showed the resonance frequency analysis is a suitable and reliable method to determine implant stability .", "adding dfdba ( dembone and cenobone ) , either the american or iranian type , to membrane on its own did not significantly increase the obtained bic and isq with the gbr procedure . the resonance frequency analysis is still a suitable and reliable method to determine implant stability ." ]

[ "the goal to achieve ideal pediatric drug therapy is a worldwide challenge for regulatory bodies and clinicians . children are treated with medicines not tested for safety and efficacy and are frequently supported by the low quality of evidence . in the absence of standard prescribing information , clinicians prescribe drugs in an off - label manner . off - label use means use of medicine which is outside the terms of product license with respect to dose , route of administration , indication , or age . off - label medicine use among children represents an important health issue as the effects and health risks may be unexpected . various national and international studies have been published about the amount of and problems associated with off - label medicines in children . the magnitude of off - label prescribing is accounted to be between 18% and 60% in infants but it may be up to 90% in neonates [ 39 ] . most of these studies have been conducted outside india and may not be applicable as hospitalization and prescribing patterns differ based on culture , healthcare infrastructure , and health policies . only one previous study has been conducted in india which reported 50.62% of off - label prescribing based on british national formulary . currently there is no study conducted in india based on national formulary of india ( nfi ) . hence , the objective of the research study was to quantify off - label use based on nfi , various predictors and discusses some strategies to monitor it .", "the prospective observational study was carried out at a tertiary care hospital in ahmedabad ( india ) for the period of six months . all the pediatric patients in ages between 0 and 12 years receiving at least one medication and admitted in pediatric ward were included in the study . the pediatric ward was of 60 bed size and attended by 10 academic pediatricians and 28 postgraduate students . patients were not considered if they were in age of more than 12 years , not taking any prescription medication and undergoing surgery . demographics , clinical characteristics , and medication usage were obtained from the medical records using predefined paper case record forms . the data collection was carried out by one of the researchers ( mms ) who discussed each of the medicines with attending pediatrician and clinical pharmacologist ( dr ) . drugs were entered into the database using the world health organization anatomical therapeutic chemical ( who - atc ) classification system . we utilized national formulary of india ( nfi , 4th edition , 2011 ) which is an official publication of indian pharmacopoeia commission , ministry of health and family welfare , government of india . categories for off - label use were allocated for each medicine according to the reason(s ) why their use was deemed off - label when compared to the terms of the product labeling for that medicine in nfi . we followed a published algorithm and used these dimensions to determine whether there is strong scientific evidence for frequently prescribed off - label medicines ( table 4 ) . variables such as age , number of medications , number of diagnoses , and length of hospital stay were regarded as continuous and expressed as mean with standard deviation ( sd ) . the odds ratio ( or ) with 95% confidence interval ( ci ) was used to determine the predictors for off - label prescribing . the data were analyzed using statistical package for the social sciences ( spss inc . , this study was reported according to the strengthening the reporting of observational studies in epidemiology ( strobe ) guidelines .", "the study included a total of 320 patients admitted in pediatric general ward of the public teaching hospital over a period of six months . the mean age was 2.73 years ( range = 0.1 to 12 years and standard deviation : 3.09 ) . the most common age group was 0 to 1 years representing 43% of total sample size . on average each patient had 1.2 number of diagnosis and 48 patients ( mean = 2.5 ) had more than one diagnosis during hospitalization . the majority of patients suffered from respiratory diseases ( 33% ) , central nervous system diseases ( 16.5% ) , and gastrointestinal disease ( 11% ) . a total of 1645 medications were prescribed to the study cohort during hospitalization , with a total hospital stay of 1743 days . this constituted the mean number of five ( sd = 2 ) medications prescribed per patient and 5.48 ( sd = 3.62 ) days of hospital stay . the number of medications and hospital stay ranged from one to 13 and one to 33 days , respectively . the majority of patients received antibiotics , cough , and cold preparations , antipyretics , inhaled corticosteroids , bronchodilators , and antiepileptic drugs . medications were mostly administered by oral route ( 40% ) and intravenous route ( 35% ) followed by inhalation route ( 25% ) . of the 320 patients included in the study , 310 ( 97% ) patients received at least one off - label medication . a total of 1645 medications were administered during the hospitalization ; 1152 ( 70% ) medicines were prescribed in off - label manner when its usage was validated with national formulary of india , 2011 , for five different off - label categories . patients received on average ( sd ) 3.66 ( 2.13 ) off - label medicines within a range of one to 10 . the most common cause of off - label prescribing 893 ( 63% ) was due to higher dose use ( category 1 ) than stated for particular pediatric patients . off - label medicines use for age ( category 2 ) and indication ( category 3 ) was found to be 282 ( 19.8% ) and 145 ( 10.2% ) , respectively . those medicines which had no pediatric information ( category 5 ) were 76 ( 5.3% ) . use of ipratropium , salbutamol , and dextromethorphan was common for different dose and age limits . lorazepam ( seizures ) and ondansetron ( nausea and vomiting ) were frequently used for off - label indication . the study also attempted to distribute the receipt of off - label medicines in different age groups as shown in table 2 . the extent off - label prescribing was highest ( 76% ) in age group of more than 1 to 2 years , followed by age group of more than 1 to 12 months which accounted for 69% of off - label use . off - label use in dose ( category 1 ) was consistent among the patients in age of 0 to 6 years . the use of medicines in patients for restricted age limits ( category 2 ) was highest in 112-month age group . indication ( category 3 ) and absence of pediatric information ( category 5 ) were most prominent in 612-year patients . highest proportion of off - label medicines were prescribed in anti - infectives for systemic use 389 ( 73% ) and respiratory system 378 ( 82% ) as shown in table 3 . the amount of off - label prescribing in nervous system and alimentary tract and metabolism system was 220 ( 53% ) and 85 ( 86% ) , respectively . majority of off - label medicines prescribed were ceftriaxone , amikacin , amoxicillin , and vancomycin in antibiotics class and inhaled corticosteroids , ipratropium , salbutamol , chlorpheniramine , phenylephrine corresponding to respiratory system . blood and blood forming agents 16 ( 89% ) , hormonal preparation 32 ( 80% ) , and cardiovascular medicines 24 ( 71% ) had substantial high amount of off - label use . adrenaline , nifedipine , prednisolone , and dexamethasone were also used in off - label manner . antiparasitic products 8 ( 16% ) had minimum off - label use . antibiotics ( 75% ) and inhaled corticosteroids ( 79% ) were mostly prescribed in higher doses ( category 1 ) than recommended . in respiratory system , many medicines ( 39.5% ) were prescribed below age limits ( category 2 ) as indicated in the formulary . medicines used for unapproved indication ( category 3 ) largely confined to alimentary tract and metabolism system and blood and blood forming agents . medicines which had no pediatric information were predominantly in antihypertensive drug class . on multivariate regression analysis as shown in table 5 , we found that pediatric patients in age of 0 to 2 years ( or 1.68 , 95% ci , 1.262.24 , ) were more likely to receive off - label medicines than any other age group . female patients ( or 1.41 , 95% ci , 1.131.77 ) received substantially high amount of off - label medicines compared to male . hospital stay of six to 10 days ( or 1.91 , 95% ci , 1.332.75 ) also carried higher risk of off - label prescription .", "using the data of the pediatric ward of a tertiary care hospital , we found that 70% of medicines were prescribed in off - label manner . the magnitude off - label prescribing is substantial higher than reported in the recent studies [ 1416 ] . cuzzolin et al . performed a literature review of published studies on off - label and unlicensed drug use in children . seven studies involved neonatal intensive care units ( nicus ) , fifteen studies included pediatric wards , and twelve studies were conducted in community setting . cuzzolin et al . found off - label prescribing in pediatric ward ranging between 18 and 60% . various reasons for different rates of off - label use are off - label classification methods , sample sizes , pediatrician 's prescribing habits , in - house treatment protocols , and diseases characteristics most importantly pediatric drug regulation . patients in ages between 0 and 2 years are most likely to receive off - label medicines and had highest representation in study sample . previous studies also established that age group of 0 to 2 years is the highest recipient of off - label prescriptions [ 16 , 17 ] . this is mainly due to absence of specific dosing guidelines and route administration in 0-to-2-year age group in nfi . of the medicines prescribed during the period , it was observed that antibiotics , respiratory medicines , and nervous system medicines were frequently prescribed in off - label manner . several studies had shown high rate of off - label prescribing in respiratory , antibiotics , analgesics , and antiepileptics . about 82% of medicines in respiratory system were off - label which is more than what is reported in studies in us ( n = 312 million , 70% ) and portugal ( n = 500 , 77% ) . if asthma therapies are considered , inhaled corticosteroids are frequently prescribed ( 30.7% of all prescriptions ) . the mainstay therapy for asthma is inhaled corticosteroids ( ics ) , but guidelines often do not give specific recommendations for upper doses limits specially in children . various combinations of antihistaminics , decongestants , and/or analgesics were prescribed to patients in off - label doses for common cold . still , the off - label use of paracetamol is substantial , mainly due to off - label classification for dose or age . although paracetamol is normally considered safe in pediatrics care , a previous cochrane review pointed out that there is limited evidence regarding the efficacy and safety for paracetamol in the treatment of fever in children . lorazepam and ondansetron were widely prescribed for off - label indication but are supported by well conducted clinical studies [ 27 , 28 ] . better medicines for children to improve monitoring medicine safety in the pediatrics and highlighted its concern on off - label medicines . the strict drug approval procedure is the way to ensure quality data on quality , safety , and efficacy for different pediatric age groups . despite many regulatory amendments and policies , we still have apathetic outlook to pediatric clinical trials . the pharmaceutical companies should be convinced to have appropriate pediatric information in the label and they are not being permitted to market drugs likely to be used in children without suitable pediatric labeling . indian drug regulatory authorities should also develop pediatric specific drug development regulation so that the tendency to market medicines without pediatric specific data is discouraged . this might ensure pediatric labeling for new medicines yet to be introduced in the market ; but it is unlikely that drug companies will carry out trials to confirm pediatric use for drugs already marketed and used in children , although in an off - label manner . alternatively , the situation can be improved when prescribers report their pediatric experiences with different off - label medicines in form research articles or discussion at scientific platforms . when medicines are used as off - label , each patient is unique and risk - benefit pertaining to him should be assessed by high quality evidence . the doctor needs to be updated with latest evidence which could be accomplished by using several useful drug compendia like drugdex , clinical pharmacology , and so forth . only such focused and coordinated actions would make sure that children 's right to safe , cost - effective , and quality medicines would be realized .", "based on national formulary of india , our data suggest that magnitude of off - label prescribing in pediatric inpatients is considerable higher than reported in some of the countries . dose discrepancy and use in restricted age limits were identified as main contributor to off - label prescribing . there is need for strict drug regulation for pediatric population to ensure safety and effectiveness of pharmacotherapy . further studies are needed to examine why there are inadequate dosing guidelines and generation of more clinical data especially in respiratory medicines . understanding various risk factors and spectrum of off - label medicine use can assist developing prevention strategies ." ]

[ "the role of the thyroid gland in pregnancy and the impact of thyroid disorders on the course of pregnancy and development of the offspring have drawn a considerable interest in the recent years , both in the medical and in the general society . about 2 and 4% a growing body of evidence suggests that subclinical hypothyroidism may be associated with in vitro fertilization failure , subfertility , infertility , spontaneous abortion , placental abruption , gestational hypertension , preeclampsia , preterm delivery , postpartum thyroid dysfunction , depression ( including postpartum depression ) , conversion to overt hypothyroidism , and impaired cognitive and psychomotor child development . american thyroid association in its recently published guidelines have stated against universal screening of pregnant women for hypothyroidism . it seems that prevalence of hypothyroidism is more in asian countries compared to the west . in a recent study by dhanwal et al . looking at these data the purpose of the study was to know whether routine screening would prove to be beneficial in our country .", "the study was an out - patient department ( opd ) based prospective cohort , observational study in which 305 women were randomly selected and screened on opd basis by thyroid - stimulating hormone ( tsh ) levels ( cutoff level 0.10 - 2.50 miu / ml ) as per recent guidelines . these women were followed till term and subsequent delivery to study the effect on maternal and perinatal outcome . known cases of other medical disorders and women who did not give consent for tsh estimation were excluded from the study . 0.10mu / l , the reference values for tsh were 0.1 - 2.5miu / l , 0.2 - 3.0 miu / l and 0.3 - 3.0 miu / l in the first , second , and third trimesters of pregnancy respectively , considering the recent literature . the statistical difference between variables", "in the study following are the observations made : the mean age of women was 24.46 years ( sd = 2.00 ) . the mean gestational age at time of screening 9.09 weeks . ( sd = 4.09 ) 38.68% of women were of gestational age less than 9 weeks and 61.31% were with gestational age 913 weeks . cut off of 9 weeks was taken to identify those who presented early in first trimester , 55.08% women were nullipara , 31.14% were primipara , 11.47% were para 2 , 2.2% women were para 3 and more . it was seen that 4.9% women were already having symptoms of thyroid diseases ( main symptoms seen were weakness , lethargy , loss of appetite , weight gain ) , 4.2% had history of previous thyroid diseases ( which is either hypo or hyperthyroidism ) , 0.65% women had history of other autoimmune diseases ( apla syndrome ) 4.9% women had history of previous caesarean section , 1.6% women had family history of thyroid diseases , 0.3% had history of irradiation , 1.6% had history of medication ( thyroxine for hypothyroidism ) . on this screening . however , the incidence of hypothyroidism in high risk population was 20.58% and in normal population was 6.7% which shows a significant association of thyroid disorders with high risk factors ( p < 0.001 ) . in the euthyroid women 7.2% had an adverse perinatal outcome , 92.7% had normal outcomes . this shows statistically significant association abnormal tsh values with adverse pregnancy outcomes ( p < 0.001 ) . considering the route of delivery , 88.85% women had normal delivery , out of them 0.36% were hyperthyroid , 5.5% were hypothyroid rest were euthyroid . in abnormal perinatal outcomes 6.2% women had lower segment caesarean section ( lscs ) out of them 73.68% were euthyroid and 26.31% were hypothyroid . the main indications for lscs in these cases were fetal distress , maternal cephalopelvic disproportion ( cpd ) , contracted pelvis , and failed induction . 1.9% had preterm labour , out of them 50% were euthyroid , 50% were hypothyroid . in all , there was only one preterm fresh still birth in a euthyroid woman . out of 2.2% spontaneous abortions 28.5% were in euthyroid group while 71.4% were in hypothyroid group . this study shows significant association between abnormal tsh values and adverse perinatal outcomes ( p < 0.001 ) .", "this prospective screening of thyroid function in a cohort of unselected pregnant women shows that high - risk women ( with a personal or family history of thyroid disorders or a personal history of other autoimmune diseases ) have more significant ( p < 0.001 ) increased risk of hypothyroidism ( subclinical or overt ) during early pregnancy . however , testing only the high - risk pregnant women , as the consensus guidelines recommend , would miss about one- of women with hypothyroidism . therefore with the growing evidence for an association between maternal subclinical hypothyroidism and adverse pregnancy outcomes but lack of intervention trials showing beneficial effect of thyroxine ( t4 ) in preventing these adverse outcomes , the controversy between targeted high - risk case finding and universal screening continues . the consensus guidelines recommend the use of t4 in pregnant women with subclinical hypothyroidism , justified on the basis of potential benefit to risk ratio . our study shows that , without universal screening , a significant number of such pregnant women with thyroid dysfunction will not be picked up . free thyroxine ( ft4 ) increases with suppression of tsh in response to placental human chorionic gonadotrophin during the first trimester , whereas ft4 tends to decrease in late gestation . this is likely to be the cause for the high prevalence of suppressed tsh in this cohort . furthermore increased serum thyroid - binding globulin and decreased albumin during pregnancy result in assay - dependent variations in ft4 levels . these observations have led to the call for using trimester and assay - specific reference ranges for thyroid function tests in pregnancy . if the trimester specific reference range is used , 9.8% pregnant women in this cohort will be considered to have hypothyroidism . whereas there will be less of a controversy to use the trimester - specific reference range in titrating the dose of t4 in pregnant women on t4 replacement , further studies are needed to determine the threshold level of tsh at which initiation of t4 replacement should be considered . clinical studies have confirmed that the increased requirement for t4 ( or exogenous lt4 ) occurs as early as 4 - 6 weeks of pregnancy . such requirements gradually increase through 16 - 20 weeks of pregnancy , and thereafter plateau until time of delivery . these data provide the basis for recommending adjustments to thyroid hormone in affected women once pregnant and for the timing of follow - up intervals for tsh in treated patients . the levothyroxine ( lt4 ) adjustment , when necessary , should be made as soon as possible after pregnancy is confirmed to reduce the probability of hypothyroidism . a prospective , randomized study has recently provided evidence in support of one dose adjustment strategy for women receiving lt4 who are newly pregnant . for women who are euthyroid while receiving once - daily dosing of lt4 ( regardless of amount ) , a recommendation to increase by two additional tablets weekly ( nine tablets per week instead of seven tablets per week ; 29% increase ) can effectively prevent maternal hypothyroidism during the first trimester and mimic gestational physiology . this augmented dose should occur immediately after a missed menstrual cycle or suspected pregnancy occurs . a separate option is to increase the dosage of daily lt4 by approximately 25 - 30% . there is also an uncertainty regarding the most appropriate initial screening test for thyroid dysfunction in pregnancy . the consensus guidelines recommend using tsh as the initial test , whereas others have stressed the importance of testing ft4 by highlighting the fact that ft4 ( and ft3 ) is responsible for thyroid hormone action and that maternal hypothyroxinemia ( normal tsh but low ft4 ) is associated with neuropsychological deficit in the offspring . in our study , the cause of maternal hypothyroxemia is not fully understood , but iodine deficiency is thought to be a major factor although urinary iodine was not analyzed in the present cohort , a previous study in this same population has shown that 7 and 40% pregnant women have urinary iodine excretion of less than 50 g / l ( suggestive of dietary iodine deficiency ) and 50 - 100 nearly one - quarter of hypothyroid women on t4 replacement in this study had raised tsh at their first antenatal visit . given the fact that the fetus relies entirely on maternal thyroid hormones for its development until about 13 week of gestation , it is critical to ensure adequate t4 replacement in pregnant women during the first trimester . hypothyroid pregnant women on t4 require an increased dose from as early as the fifth week of gestation to maintain optimum t4 replacement . some recommend a 30% increase in the t4 dose as soon as the pregnancy is confirmed , with further dose adjustments based on tsh measurements . in addition , through education of all hypothyroid women in the reproductive age , every attempt should be made to ensure an adequate t4 replacement before a planned pregnancy .", "so screening of thyroid disorders should be done in early pregnancy . it will help to diagnose the cases at the earliest and to carry out timely intervention to prevent adverse perinatal outcomes . but still there is a controversy regarding universal thyroid function screening or high - risk screening in early pregnancy . but if we screen only high risk population we would miss 4.6% cases which could have been diagnosed and treated earlier . so this study emphasizes high risk screening in early pregnancy but also supports that universal screening should be a part of our screening protocols so that all thyroid disorders are screened and treated at the earliest . so in our country we must follow indian thyroid society guidelines which clearly recommend that all pregnant women should be screened at 1 antenatal visit by measuring tsh levels , and highlight that ideally screening should be carried out during prepregnancy evaluation or as soon as pregnancy is confirmed . " ]

[ "esophageal cancer is a devastating disease with rapidly increasing incidence in western . despite important advances in therapy , > 50% of patients have incurable disease at diagnosis and only 510% of these patients have life expectancy > 5 years . dysphagia is the most common symptom that afflicts these patients , causing 70% of complaints , and leading to severe malnutrition and reduced quality of life [ 1 , 2 ] . this factor prevents curative treatment in the majority of them , thus making palliative care a more realistic option [ 1 , 3 ] . although surgical resection remains the treatment of choice for early cancers , palliative esophagectomy is not recommended due to high mortality rates . however , surgical procedures in order to bypass the dietary route with relief of dysphagia have been reported in the literature but have fallen into disuse because of the morbidity and mortality of the procedure itself and advances in endoscopic treatment . this paper demonstrates the use of surgical treatment using the laparoscopic approach in the palliative care of a patient with advanced esophageal cancer .", "a 69-year - old male presented with progressive dysphagia , retrosternal pain and weight loss of 10 kg in 2 months . the finding was a circumferential lesion from 19 to 25 cm of the incisors , with biopsy diagnosing squamous cell carcinoma . radiological examinations showed lymphadenopathy in the celiac trunk and in the mediastinal area . a bronchoscopy diagnosed tracheal infiltration by neoplasia . the patient was treated with external radiotherapy ( 13 250 cgy ) with symptom relief and regained performance status ( from 3 to 1 ) . however , after re - staging exams , the persistence of the disease was diagnosed , with dysphagia worsening . the technique , as described by lacerda et al . in a previous report , involves the creation of a gastric tube close to 3 cm in width and with an average length of 30 cm ( fig . 1 ) and preservation of the right gastroepiploic vessels by laparoscopy . \n figure 1:gastric tube . the tube is then passed along a retrosternal path and end - to - side anastomosis using a circular stapler is performed with the cervical esophagus prepared earlier by left cervicotomy . a laminar drain is applied in the cervical incision ( fig . 2 ) . \n the patient was discharged from the hospital on the fifth post - operative day with oral intake . no leakage or other complication the patient survived for 4 months , gained 10 kg in this period and did not refer any dysphagia after the procedure .", "currently , there are several methods for this purpose , including the esophageal stent , endoscopic dilation , radiotherapy ( both external and endoluminal brachytherapy ) , chemotherapy and laser recanalization ( yag ) . the choice of procedure and the response to treatment should be properly related to life expectancy , which has also been related to performance status , weight loss , tumor extension , clinical stage , sex and age . dysphagia from inoperable esophageal cancer is a common and complex management problem , and there is no consensus on the ideal treatment approach . all methods have their own advantages and disadvantages in rapid or late onset effect in symptom relief as in recurrence . no single intervention palliates dysphagia at all time for every patient ; therefore , healthcare providers must assess the risks and benefits of each palliative intervention for individual patients . surgical resection is still cited in the literature as a way to palliate esophageal cancer but is restricted to patients with severe risk of complications ( e.g. perforation or incontrollable tumor bleeding ) due to high morbidity and mortality in relation to non - surgical palliative options . that there are no randomized controlled studies to compare the addition of surgery to palliative chemotherapy with chemotherapy alone . they also state that such studies may become possible and worthwhile if minimal access surgery can be achieved that has reduced complications and better recovery of health - related quality of life than standard open surgery . in 1979 , postlethwait proposed a technique for esophageal bypass surgery with an isoperistaltic gastric tube , and this method is still used despite its morbidity . this report demonstrates that an update in the technique proposed by postlethwait for palliation of esophageal cancer with the use of minimal access surgery is feasible . according to the current literature , the bypass procedure in order to palliate dysphagia could be reserved for patients in which the stent has failed or contraindicated . high costs can sometimes make the lesser invasive procedure more prohibitive to the patient than surgery itself ." ]

[ "a 35-year - old female presented with a painless , slowly growing \n mass in the right inferior orbit for the past four years . she did \n not complain of diminution of visual acuity , diplopia or field \n defect . on examination , visual acuity in both eyes the right side demonstrated a solid , non - tender , \n freely mobile mass in the inferior orbit , which became more \n prominent on applying pressure on the upper part of the globe . \n the mass measured approximately 20 mm 15 mm and the \n size did not vary with valsalva maneuver , ocular movements \n or posture . slit - lamp \n and fundus examination of the eye showed normal anterior \n and posterior segments . b - scan ultrasonography revealed an extraconal , \n homogenous lesion in the inferior part of the right orbit . \n computed tomography revealed a non - enhancing well- \n defined homogenous mass measuring 20 mm 12 mm in the \n right inferior orbit which was displacing the inferior rectus \n and inferior oblique muscle upwards . the mass was separate \n from the above - mentioned muscles and produced no globe \n indentation or displacement [ figure 1a ] . a provisional diagnosis of orbital dermoid was made and \n the patient was taken up for an excision biopsy . peroperative findings were of a smooth , well - encapsulated \n mass with no attachments to the surrounding muscles . on histopathological examination , the gross specimen \n consisted of a smooth well - encapsulated solid mass measuring \n 25 mm in the greatest diameter [ figure 1b ] . microscopically , a \n biphasic pattern of tumor cells was seen with areas of closely \n packed spindle cells having fusiform nuclei and eosinophilic \n cytoplasm ( antoni a ) admixed with looser myxoid tissue \n having ovoid cells ( antoni b ) . at places , these tumors cells \n were arranged in palisades and this arrangement of cells \n is referred to as verocay bodies .", "orbital \n schwannoma is a tumor of adulthood usually presenting \n between 20 to 70 years of age . schwannomas are usually \n asymptomatic when small and may produce progressive , \n painless proptosis on enlargement . a variable combination \n of signs and symptoms may be present due to the variable \n origin and location of the tumor in the orbit.2 displacement \n of the globe is related to the site of the tumor mass . most \n schwannomas arise from branches of either the supraorbital \n or supratrochlear nerves and hence produce downward \n displacement of the globe . less commonly , the tumor may arise \n from the infraorbital nerve and produce upward displacement \n of globe . larger tumors may produce diplopia , particularly \n when they arise from the orbital portion of the third , fourth \n or sixth nerve . the growth of the tumor may \n cause compression of the optic nerve with papilledema or \n optic atrophy . surgical excision is the treatment of choice and \n the tumor should be removed intact at the earliest to prevent \n compression of the optic nerve.3 incomplete excision can lead \n to recurrence or even intracranial extension . highly cellular \n tumors have greater chance of recurrence and malignant \n transformation . therefore an early treatment is indicated \n to avoid the complications related to progressive growth of \n the tumor . in our patient , we were successful in achieving \n the above objectives with timely and complete excision of \n the tumor . orbital schwannoma arising from the infraorbital nerve \n is rare and clinical diagnosis is often difficult . extensive \n literature search revealed only a few case reports of an orbital \n schwannoma arising from the infraorbital nerve.4 - 10 our \n patient presented with the tumor in this uncommon location . \n a solitary schwannoma , though rare , should be considered \n as a preoperative differential diagnosis of a unilateral slow- \n growing orbital mass in an adult and prompt management \n is warranted to prevent development of vision - threatening \n complications ." ]

[ "risperidone has been reported to be effective in management of disruptive behaviors , including hyperactivity , irritability , aggression , and temper tantrums . increased appetite , weight gain , headache , and sedation literature search revealed only four published reports of risperidone - related bleeding , including hemorrhagic cystitis,1 ) nasal bleeding,2,3 ) and gastrointestinal bleeding.4 ) we hereby describe the first pediatric case of gingival bleeding during risperidone treatment .", "an 11-year - old - girl was referred to our out - patient clinic for her hyperactivity , temper tantrums , sleep problems , and self - injurious behaviors . according to her psychiatric assessment and psychometric evaluation , she was started on risperidone 0.25 mg / day treatment for her disruptive behaviors and two weeks later the dose was increased to 0.5 mg / day . one - week after the dose increase , she experienced gingival bleeding when she brushed her teeth . risperidone was considered to be the reason for bleeding , therefore we decided to reduce the dose to 0.25 mg / day . gingival bleeding ceased within a week . because worsening of her behavioral problems , her mother increased the dose to 0.33 mg / day . she experienced gingival bleeding rarely ( twice a month ) and mildly during this dose regime , therefore we stopped the medication . we decided to change risperidone to methylphenidate ; however , her parents refused to continue to the treatment because of their worries about the potential side effects . she had no history of any bleeding disorder or any other medical condition including current allergies . she was not taking any other medication other than risperidone at the time of the development of bleeding .", "there are several case reports about risperidone - related bleeding ; however , to our knowledge , there is no report of gingival bleeding associated with risperidone in the literature . we presented a case who experienced gingival bleeding when risperidone dose was increased to 0.5 mg / day , and subsided after decreasing the dose to 0.25 mg / day , suggesting a dose - dependent side - effect . however , the chronological relationship between the time of risperidone 0.5 mg / day administration and emergence of bleeding in the absence of an identifiable medical condition suggests risperidone to be the causative agent . there was no other agent likely to be the cause of bleeding , except risperidone , and bleeding ceased when the dose was decreased . although an etiological relationship between risperidone use and gingival bleeding can not be drawn from a single case , the naranjo probability scale score ( 8) reveals a probable relationship.5 ) the bleeding side effect of risperidone might be caused by several mechanisms , including thrombocytopenia and 5-hydroxytryptamine 2a ( 5-ht2a ) receptor antagonism.3 ) thrombocytopenia is a known adverse effect of atypical antipsychotics and has also been reported during risperidone.6 ) in our reported case platelet count was normal , therefore , gingival bleeding could not be a consequence of thrombocytopenia . antagonism of 5-ht2a receptor was suggested to cause bleeding by inhibiting the release of vasoconstrictors from platelets and reducing the platelet aggregation.4 ) therefore , we may speculate that risperidone s high affinity to 5-ht2a receptors might have probably resulted gingival bleeding . this case suggests that bleeding associated with risperidone may be a dose - dependent side effect . however , these potential explanations may not describe the entire mechanism of this adverse reaction . it is also possible that she might have some undetermined predisposing factors for bleeding that is triggered by risperidone . there are several reports on gingival bleeding during anti - depressants;7 ) however , this is the first case on gingival bleeding associated with risperidone . although bleeding is a rare side effect , clinicians should be aware that risperidone may cause bleeding . risperidone may also increase the risk of bleeding in susceptible patients with a history of coagulation disorders , and with concomitant use of other drugs , including non - steroidal anti - inflammatory drugs , aspirin , or other medications that affect coagulation ." ]

[ "intestinal obstruction can be a result of mechanical or functional obstruction of the intestines , thereby preventing the normal transit of the products of digestion . intestinal pseudo - obstruction ( adynamic ) , characterized by abdominal pain , nausea , vomiting , constipation , and severe abdominal distension , is a clinical syndrome caused by severe impairment in the ability of the intestines to push the food through , in the absence of any lesion in the intestinal lumen . secondary pseudo - obstruction is more common than the primary and is commonly associated with neuroleptics , opiates , diabetes mellitus , and severe metabolic illnesses . intrathecal baclofen has been reported to cause intestinal pseudo - obstruction and life - threatening constipation . though baclofen might sometimes cause constipation , there are only very few reports on intestinal pseudo - obstruction complicating oral baclofen therapy .", "a 50-year - old male , post cervical discectomy ( c3 - 4 ) for prolapsed intervertebral disc with quadriparesis , neurogenic bladder , and spasticity , was on baclofen at a dose of 50 mg / day for 6 months . he presented to the emergency department with acute onset of bilious projectile vomiting , abdominal distension , and constipation since 3 days . one and half months back , he had a traumatic urethral injury for which open suprapubic cystostomy was performed . he had no history of other co - morbidities or drug intake other than baclofen . on examination , his vitals were stable but he was dehydrated . plain radiograph of the abdomen revealed dilated large and small bowel loops without any air fluid levels . the possibility of adhesive intestinal obstruction was considered and the patient was kept nil per oral with nasogastric aspiration . a diagnosis of pseudo - obstruction was considered secondary to long - term baclofen intake , as he had gradually improved over 1 week without any active intervention except for the discontinuation of baclofen since admission . the patient was able to tolerate oral diet after 7 days of admission with no recurrence of symptoms . currently , at 1 month of follow - up , he is asymptomatic with no recurrences .", "colonic pseudo - obstruction is characterized by distension of the colon with features of colonic obstruction , in the absence of mechanical obstruction . primary pseudo - obstruction is rare and is a motility disorder involving the autonomic innervation of the intestinal wall . secondary pseudo - obstruction is more common and it has been associated with conditions like severe metabolic illness , diabetes mellitus , myxedema , scleroderma , parkinson 's disease , hyperparathyroidism , and drugs like neuroleptics and opiates . baclofen , a derivative of gamma - aminobutyric acid ( gaba ) , is an agonist for the gaba b receptors , and is used to treat spasticity following spinal cord injury , multiple sclerosis , and cerebral palsy . tolerance to baclofen mainly develops after many years to intrathecal route , but this beneficial property can be potentially harmful necessitating baclofen withdrawal in patients developing adynamic intestinal obstruction . intestinal pseudo - obstruction has been reported after intrathecal baclofen , but till date , only a single case has been reported in literature describing adynamic intestinal obstruction caused by therapeutic dose of oral baclofen at 20 mg / day for 2 years in a 75-year - old male . animal studies have shown that gaba - ergic mechanisms are involved in synaptosomal nitric oxide synthesis resulting in relaxation of rat ileum . in human preparations obtained from patients with malignant tumors , baclofen suppressed both amplitude and frequency of spontaneous and pharmacologically induced contractions in the longitudinal muscle of jejunum , eventually causing a complete block at higher concentrations while not affecting spontaneous motility of circular or longitudinal colon muscles . gabaergic neurons , which are predominantly inhibitory interneurons , are distributed throughout the central nervous system and the enteric nervous system in humans . hence , baclofen being a competitive gaba b agonist , affects the gastrointestinal function by acting both peripherally in the intestinal tract by inhibiting the myenteric plexus and centrally on brainstem nuclei which coordinate afferent input from and efferent output to the intestine by crossing the blood brain barrier . in our case , we considered the possibilities of baclofen - induced pseudo - obstruction of the intestine and adhesive intestinal obstruction . hence , baclofen was discontinued and patient was put on nasogastric decompression . considering the remote possibility of adhesive obstruction , water - soluble contrast enema , colonoscopy , or neostigmine was not tried . colonoscopic decompression was planned in case of deterioration , but the patient recovered completely with prompt discontinuation of baclofen , nasogastric decompression , and maintenance of electrolytes . considering the temporal relationship of the occurrence of symptoms after 6 months of baclofen therapy , improvement after withdrawal of the drug , and presence of pharmacological explanation for the occurrence of obstruction and evidence of similar reports earlier , we considered the possibility of baclofen - induced pseudo - obstruction . on causality assessment , baclofen - induced pseudo - obstruction in our case belongs to the probable / likely category as per the world health organization - uppsala monitoring centre ( who - umc ) system and to the objective evidence in the form of blood levels of baclofen was not available , and re - challenging was not attempted because intestinal pseudo - obstruction could be fatal . the remote possibility of adhesive obstruction is mostly unlikely as the patient recovered with withdrawal of baclofen .", "oral baclofen used for spasticity can cause constipation , but intestinal pseudo - obstruction is a rare possibility and in such cases , prompt discontinuation of the drug can be therapeutic . this rare cause of intestinal pseudo - obstruction needs to be borne in mind to avoid potentially morbid investigations like gastrograffin enema or colonoscopy , which are associated with complications like perforation ." ]

[ "the incidences were getting higher and higher . increased intramyocellular lipid accumulation plays a very important role in obesity and diabetes , as well as their complications [ 2 , 3 ] . this attracted great interest in the effect of accumulated lipid intermediates on insulin resistance [ 4 , 5 ] . lipotoxicity was regarded as the link of high levels of lipids with impaired insulin signaling [ 6 , 7 ] . this sparked the interest in how excessive lipid affects -oxidation and mitochondrial biogenesis , which may have a great impact on glucose utilization and insulin resistance [ 710 ] . carnitine palmitoyl transferase 1 ( cpt1 ) is an important rate - limiting enzyme of mitochondrial -oxidation , by controlling the mitochondrial uptake of long - chain acyl - coas . its muscle isoform , cpt1b , is the predominant isoform rich in the heart and skeletal muscles . it was suggested that inhibiting cpt1 activity by specific cpt1 inhibitors alleviates insulin resistance in diet - induced obese mice . however , there is no study investigating if specific cpt1b deficiency in skeletal muscles had significant impact on lipids and insulin sensitivity . therefore , in this study , by establishing a mouse model , we directly explored this issue . with specific knockout of carnitine palmitoyl transferase-1b ( cpt1b ) in skeletal muscles of mice ,", "cpt1b m/ mouse model was established as per previously described [ 12 , 16 , 17 ] by using male c57/bl6 mice ( 12 weeks old ; 2025 g ) with cre - lox technology [ 17 , 18 ] . mice were genotyped by standard pcr of tail dna with pcr master mix ( applied biosystems inc . ) . twenty mice from each group ( cpt1band cpt1b m/ ) were kept on a 12 h/12 h light / dark cycle , in temperature - steady rooms , and had ad libitum access to water and chow diet . all experimental procedures were conducted according to the care and use guide of laboratory animals and were approved by the iaec of the huzhou central hospital . general and metabolic profiles were measured at 12 , 18 , 24 , and 30 weeks of age , including the following : body weight , lipids in serum , food intake , body mass , and fat mass , as per related protocols [ 19 , 20 ] . skeletal muscle mrna and protein were extracted and purified with standard protocols as per our previous protocols [ 7 , 21 ] . rt - pcr was performed for mrna quantization per standard protocols with the reagents from abi system inc . quantitative real - time rt - pcr analyses were carried out by using step one real - time pcr system ( applied biosystems inc . ) . cycles were 50c for 2 min , a 2 min 95c denaturing step , followed by 50 cycles of 95c denaturation , incubated at 60c for 2 min , and denatured at 95c for 1 sec for the final step . the sequences of the primers are as follows : for cpt1b : forward : gac cat agaggc act tct cagcat gg , reverse : gcagca gcttca ggg tttgt ; -actin : forward : gtc ctc tcc caa gtc cac ac , reverse : ggg aga cca aaa gcc ttc at ; pakt forward : taa tac gac tca cta tag ggc caa ggagatcatgc , reverse : gatttaggtgacactatagctccaagctatcgtcc ; glut4 forward : accgtggtccttigctgtgtt , reverse : acc cca atg ttg tac cca aac t. as described previously [ 16 , 22 , 23 ] , a modified mitochondrial cpt1 assay was performed to measure cpt1 activity . briefly , quantified mitochondria ( 100 g protein ) from skeletal muscles were incubated with reaction buffer ( 117 mm tris - hcl , 0.28 mm reduced glutathione , 4.4 mm atp , 4.4 mm mgcl2 , 16.7 mm kcl , 2.2 mm kcn , 40 mg / l rotenone , 0.1% bsa , and 50 mm palmitoylcoa ) at 37c for 5 min . initiate the reaction by adding 2 mm [ c]-carnitine ( 0.1 ci ) and queued it 10 min later with 50 l 1.2 mm ice cold hcl . [ c]-palmitoyl carnitine was extracted with water saturated butanol and measured via liquid scintillation counting . as previously described [ 24 , 25 ] , fao was examined with radiolabeled palmitate fao assay . skeletal muscle tissues were homogenized , and mitochondria were isolated and quantified ( 100 g proteins ) . palmitate oxidation assay was performed with reaction buffer ( 75.5 mm sucrose , 12.5 mm k2hpo4 , 100 mm kcl , 1.75 mm mgcl2 - 6h2o , 1.75 mm l - carnitine , 0.125 mm l(- ) malic acid , 1.75 mm dtt , 0.07 mm nad+ , 2 mm atp , 10 mm tris - hcl , and 0.07 mm coenzyme a ) . the reaction started when 200m [ c]-palmitate-15% bsa ( 1 : 6 ) complex ( 0.04 ci / reaction mixture ) was added and stopped by 3.5 m perchloric acid after incubation at 37c for 30 min . co2-trapping medium ( naoh , 0.1 m ) for c radioactivity was measured by liquid scintillation to calculate palmitate oxidation rate . after incubation , co2 and c - asps were measured ( ls 6500 ; beckman coulter ) . calculations were then performed accordingly . as previously reported [ 2628 ] , tags , dags , and ceramides were tested with kc - esi - ms and gas chromatography ( applied biosystems inc . ) . after the solution was evaporated dry and reconstituted , the samples were analyzed with mass spectrometry ( ms ) . the analysis was performed in positive ion mode electrospray ion ( esi - ms ) source and precursor ion scans m / z 264 and 282 ( ceramides ) . ceramides were quantified by taking the ratios of the integrated intensity for each subspecies to the intensity of c17:0 . as described [ 2931 ] , an intraperitoneal glucose tolerance test ( igtt ) and insulin tolerance test ( itt ) were performed on nonanaesthetized mice after 8 hours ' fasting . blood glucose was measured with lancet glucometer ( johnson and johnson ) . for igtt , 20% glucose ( 2.0 blood samples were collected from tail vein at 30 , 60 , 90 , and 120 min for glucose levels . for itt , glucose blood levels were sampled at 5 , 10 , 15 , 20 , 25 , and 30 min following intraperitoneal injection of human insulin ( 0.75 u 4.5 nmol / kg ; novolin r , novo nordisk ) . as described previously [ 32 , 33 ] , skeletal muscles were homogenized in ice - cold buffer ( 250 mm sucrose , 10 mm tris - hcl , 2 mm edta , and 1 mm atp ( ph 7.4 ) ) . for glucose oxidation , fresh skeletal muscle tissues were homogenized in ice - cold buffer ( 5 mm kcl , 2 mm tris - hcl , 0.5 mm tris base , 0.25 mm mgcl2 - 6h2o , 0.05 mm edta , and 0.05 mm atp ( ph 7.4 ) ) , 400 l homogenate was used and the reaction started when 200 m [ c]-glucose ( 0.1 ci / reaction mixture ) was added . co2-trapping medium ( naoh , 0.1 m ) for c radioactivity was measured by liquid scintillation to calculate glucose oxidation and quantified by weight of the skeletal muscle tissue homogenate . student 's t - test was used to evaluate the statistical significance of differences between knockout and controls .", "as shown in figure 1(a ) , the mrna expression of cpt1b decreased specifically in skeletal muscles ( rt - pcr ) but not in the heart muscle in cpt1b m/ mice . cpt1 activity is barely detectable ( dtnb assay at 412 nm ) in mitochondria ( figure 1(b ) ) for the knockout mice , even up to 10 minutes . compared to the mice in cpt1b group , those mice in cpt1b m/ group had similar daily food intake . however , as shown in table 1 , their body weights were lower , starting about 12 weeks of age , along with lower fat mass ( p < 0.05 , resp . ) . their lipids levels were higher ( p < 0.05 ) , but their glucose and insulin levels were similar . as shown in figure 2(a ) , fao was decreased in isolated mitochondria ( radiolabeled palmitate ) in skeletal muscles of cpt1b m/ mice . this was accompanied by elevation of ceramides , tags , and dags ( figures 2(b ) and 2(c ) ) . interestingly , for the ceramides , c16 , c18 , and c18:1 had significant increases for cpt1b m/ , but not for c24 or c24:1 . both dags and tags are dramatically elevated in cpt1b m/ mice . as shown in figure 3(a ) , cpt1b m/ mice maintain insulin sensitivity ( insulin tolerance test ) . compared with wild type , glucose tolerance test of cpt1b m/ mice had improved significantly ( as shown in figure 3(b ) ) . pyruvate oxidation went up ( figure 3(c ) ) and so did insulin - stimulated pakt and glut4 ( figure 4 ) .", "the relationship of fatty acid oxidation , lipids accumulation , and insulin sensitivity in skeletal muscles has been quite interesting . imbalanced fatty acid uptake and fatty acid oxidation ( fao ) have been linked to insulin resistance in muscles , which in turn worsens and complicates obesity and diabetes , as well as their complications [ 7 , 34 , 35 ] . our study demonstrated that in mice with conditional knockout cpt1b in skeletal muscles , mitochondrial fatty acid oxidation was depressed dramatically . this was accompanied by increased accumulation of lipids in skeletal muscles , such as dags , tags , and ceramides . regardless of these changes , insulin tolerance test , glucose tolerance test , and pyruvate oxidation all proved better insulin sensitivity for the knockout mice . this is partially consistent with the recent results in high - fat diet - induced obese mice , when given cpt1 inhibitor oxfenicine , as far as the major findings are concerned . another study done with different cpt1 inhibitor , etomoxir , suggested that lipids intermediates increased . 70% of total insulin - induced glucose disposal occurs in skeletal muscles , this may indicate that increased fatty acid intermediates in skeletal muscles could damage insulin sensitivity . our study showed that regardless of the characteristics of lipids accumulation , the mice are still insulin sensitive . first , due to the knockout of cpt1b in skeletal muscles , the major fuel sources were in deficit . this may suggest that signaling pathways related to energy were impaired or injured such as ampk or mtor . second , abnormal mitochondrial biogenesis and mitochondrial dysfunction may contribute to insulin resistance and diabetes [ 39 , 40 ] . we explored from these aspects the enzymes involved in mitochondrial activity such as -had and citrate synthase , genes related to transcriptions such as nrf ( nuclear respiratory factor ) , and the major nuclear receptor activator pgc1 . thirdly , considering the correlation of adaptation of peroxisomal and amino acid to mitochondria , we further explored these changes . we will report these results in our next paper and further discuss the mechanism involved . in summary , it suggested that with specific knockout of cpt1b in skeletal muscles , although there were lipids accumulations in skeletal muscles , the insulin sensitivity still remains ." ]

[ "pelvic organ prolapse ( pop ) is a major healthcare problem in middle - aged and elderly women and is usually accompanied by pelvic floor dysfunction ( pfd ) . the introduction of mesh repair in vaginal prolapse surgery showed possible advantageous results in early reports . however , pelvic floor structures progressively weaken in the elderly women , contributing to the high rate of recurrence . it has been reported that more than 30% of patients undergoing prolapse repair need reoperation . recent announcements from the us food and drug administration ( fda ) describe increasing concern for complications after transvaginal mesh ( tvm ) surgery . the risk factors for mesh exposure have been explored for decades , but it remains unclear what leads to the mesh exposure and operation failure . we analyzed clinical data to identify possible risk factors for mesh exposure to reduce the tvm complication rate and to improve patients quality of life .", "a retrospective study of patients undergoing tvm surgery between january 2004 and december 2012 was conducted in the department of obstetrics and gynecology at the first affiliated hospital of chinese pla general hospital . the operative methods included prosima anterior leaf fixation , prolift anterior leaf fixation , small mesh fixation , prosima posterior leaf fixation , prolift total pelvic fixation , tension - free vaginal tape ( tvt ) , and tvt - obturator . clinical data were collected including age , menopause status , body mass index ( bmi ) , gravidity and parity , stage of the pop , tvm types , concomitant procedures , operation time , blood loss , postoperative morbidity , and postoperative mesh exposure . only patients with at least 3 months of follow - up time the study was approved by the institutional review board of first affiliated hospital of chinese pla general hospital . quantitative data were expressed as mean standard deviation ( minimum , maximum ) while categorical data were expressed as absolute number and rate . statistical analysis was performed to analyze the risk factors for mesh exposure using the spss 10.0 software ( spss inc . independent sample 's t - test was used for comparisons between the two groups while binary logistic regression was adopted to explore the risk factors for mesh exposure .", "a retrospective study of patients undergoing tvm surgery between january 2004 and december 2012 was conducted in the department of obstetrics and gynecology at the first affiliated hospital of chinese pla general hospital . the operative methods included prosima anterior leaf fixation , prolift anterior leaf fixation , small mesh fixation , prosima posterior leaf fixation , prolift total pelvic fixation , tension - free vaginal tape ( tvt ) , and tvt - obturator . clinical data were collected including age , menopause status , body mass index ( bmi ) , gravidity and parity , stage of the pop , tvm types , concomitant procedures , operation time , blood loss , postoperative morbidity , and postoperative mesh exposure . only patients with at least 3 months of follow - up time the study was approved by the institutional review board of first affiliated hospital of chinese pla general hospital .", "quantitative data were expressed as mean standard deviation ( minimum , maximum ) while categorical data were expressed as absolute number and rate . statistical analysis was performed to analyze the risk factors for mesh exposure using the spss 10.0 software ( spss inc . independent sample 's t - test was used for comparisons between the two groups while binary logistic regression was adopted to explore the risk factors for mesh exposure . a value of p < 0.05 was considered statistically significant .", "data from 218 patients who had received reconstruction pelvic surgery ( rps ) due to pfd from january 2004 to december 2012 data were collected . a total of 195 ( 89.4% ) subjects were enrolled and 150 ( 68.8% ) subjects were followed up for more than 2 years . the median follow - up time was 35.1 23.6 months ( range : 2.0104.0 months ) . the average age was 63.9 11.2 years ( 43.089.0 years , mean age 65.0 years ) . the median duration of menopause was 14.8 10.7 years ( range : 035.0 years ) . the average gravidity was 3.6 1.6 times ( range : 111 times ) and the average parity was 2.6 1.5 times ( range : 19 times ) . seven patients had a history of pelvic surgery , including 3 with hysterectomy plus anterior wall colporrhaphy , 1 with posterior wall colporrhaphy , and 1 with hysterectomy . a total of 195 patients underwent transvaginal rps with polypropylene ( pp ) mesh ; 180 ( 92.3% ) received anterior prolapse surgery , 1 ( 0.5% ) received posterior prolapse surgery , and 14 ( 7.2% ) received combined anterior and posterior prolapse surgery . a total of 209 transvaginal pp meshes were placed ; 194 in the anterior wall and 15 in the posterior wall . concomitantly , transvaginal hysterectomy was performed in 189 ( 96.9% ) cases , high uterosacral ligament suspension in 176 ( 90.2% ) , sacrospinous ligament fixation in 5 ( 2.5% ) , posterior wall colporrhaphy in 130 ( 66.7% ) , perineal repair in 160 ( 82.1% ) , and tvt in 61 ( 31.3% ) . the mean operative time was 2.4 1.1 h ( range : 1.04.0 h ) . the mean body temperature in the first 3 days after the operation was 37.1 0.3c ( range : 36.838.2c ) . the average follow - up time was 35.1 23.6 months ( range : 2104 months ) . a successful operation was defined as stage 2 or less by pop quantification ( pop - q ) examination . all other patients were found by pop - q to be stage 2 or less up to half a year after the surgery . the objective success rate was 98.9% , and no patient was reoperated because of recurrence . mesh exposure was defined by criteria established by the international urogynecological association and the international continence society [ figure 1a and 1b ] . mesh exposure was found in 32 patients , whose age ranged from 43 to 81 years . the mean exposure diameter was 0.6 0.3 cm ( range : 0.31.5 cm ) [ table 1 ] . the management of vaginal mesh exposure included regular observation , local application of estrogen ointment and metronidazole suppositories , and removal of exposed mesh . most cases gradually healed in half a year . no mesh exposure progression was detected . there were eight patients who were admitted for removal of exposed mesh and after mesh resection the vaginal mucosa healed completely . ( a and b ) mesh exposure was found in the follow - up checkup , as the black arrows show . demography of patients with mesh exposure ( n = 32 ) bmi : body mass index ; ci : confidence interval ; sd : standard deviation . thirty - two patients with mesh exposure were recruited into the exposed group and the other 163 patients were recruited into the nonexposed group . as shown in table 2 , the median age , the operative time , and the blood loss were comparable in the nonexposed and exposed groups . statistical analysis revealed no significant difference for menopausal status , gravidity and parity , bmi , blood loss , age , or postoperative morbidity . however , the number of concomitant procedures in the nonexposed group was significantly lower than those in the exposed group . sslf : sacrospinous ligament fixation ; hus : high uterosacral ligament suspension ; tvt : tension - free vaginal tape ; tvt - o : tension - free vaginal tape obturator technique ; pop - q : pelvic organ prolapse quantification . logistic regression analysis of the risk factors for mesh exposure was performed in 195 patients [ table 3 ] . risk factors for mesh exposure in our analysis included operative duration and the concomitant procedures ( p = 0.043 , p = 0.001 ) . the relative risk was 1.899 and 0.376 , respectively , for operative time and number of operations . other factors such as age , menopausal status , gravidity , parity , bmi , and blood loss were not related to mesh exposure . risk factors for mesh exposure bmi : body mass index ; ci : confidence interval ; or : odds ratio .", "data from 218 patients who had received reconstruction pelvic surgery ( rps ) due to pfd from january 2004 to december 2012 data were collected . a total of 195 ( 89.4% ) subjects were enrolled and 150 ( 68.8% ) subjects were followed up for more than 2 years . the median follow - up time was 35.1 23.6 months ( range : 2.0104.0 months ) . the average age was 63.9 11.2 years ( 43.089.0 years , mean age 65.0 years ) . the median duration of menopause was 14.8 10.7 years ( range : 035.0 years ) . the average gravidity was 3.6 1.6 times ( range : 111 times ) and the average parity was 2.6 1.5 times ( range : 19 times ) . seven patients had a history of pelvic surgery , including 3 with hysterectomy plus anterior wall colporrhaphy , 1 with posterior wall colporrhaphy , and 1 with hysterectomy .", "a total of 195 patients underwent transvaginal rps with polypropylene ( pp ) mesh ; 180 ( 92.3% ) received anterior prolapse surgery , 1 ( 0.5% ) received posterior prolapse surgery , and 14 ( 7.2% ) received combined anterior and posterior prolapse surgery . a total of 209 transvaginal pp meshes were placed ; 194 in the anterior wall and 15 in the posterior wall . concomitantly , transvaginal hysterectomy was performed in 189 ( 96.9% ) cases , high uterosacral ligament suspension in 176 ( 90.2% ) , sacrospinous ligament fixation in 5 ( 2.5% ) , posterior wall colporrhaphy in 130 ( 66.7% ) , perineal repair in 160 ( 82.1% ) , and tvt in 61 ( 31.3% ) . the mean operative time was 2.4 1.1 h ( range : 1.04.0 h ) . the mean body temperature in the first 3 days after the operation was 37.1 0.3c ( range : 36.838.2c ) .", "the average follow - up time was 35.1 23.6 months ( range : 2104 months ) . a successful operation was defined as stage 2 or less by pop quantification ( pop - q ) examination . all other patients were found by pop - q to be stage 2 or less up to half a year after the surgery . the objective success rate was 98.9% , and no patient was reoperated because of recurrence . mesh exposure was defined by criteria established by the international urogynecological association and the international continence society [ figure 1a and 1b ] . mesh exposure was found in 32 patients , whose age ranged from 43 to 81 years . the mean exposure diameter was 0.6 0.3 cm ( range : 0.31.5 cm ) [ table 1 ] . the management of vaginal mesh exposure included regular observation , local application of estrogen ointment and metronidazole suppositories , and removal of exposed mesh . most cases gradually healed in half a year . no mesh exposure progression was detected . there were eight patients who were admitted for removal of exposed mesh and after mesh resection the vaginal mucosa healed completely . ( a and b ) mesh exposure was found in the follow - up checkup , as the black arrows show . demography of patients with mesh exposure ( n = 32 ) bmi : body mass index ; ci : confidence interval ; sd : standard deviation .", "thirty - two patients with mesh exposure were recruited into the exposed group and the other 163 patients were recruited into the nonexposed group . as shown in table 2 , the median age , the operative time , and the blood loss were comparable in the nonexposed and exposed groups . statistical analysis revealed no significant difference for menopausal status , gravidity and parity , bmi , blood loss , age , or postoperative morbidity . however , the number of concomitant procedures in the nonexposed group was significantly lower than those in the exposed group . sslf : sacrospinous ligament fixation ; hus : high uterosacral ligament suspension ; tvt : tension - free vaginal tape ; tvt - o : tension - free vaginal tape obturator technique ; pop - q : pelvic organ prolapse quantification .", "logistic regression analysis of the risk factors for mesh exposure was performed in 195 patients [ table 3 ] . risk factors for mesh exposure in our analysis included operative duration and the concomitant procedures ( p = 0.043 , p = 0.001 ) . the relative risk was 1.899 and 0.376 , respectively , for operative time and number of operations . other factors such as age , menopausal status , gravidity , parity , bmi , and blood loss were not related to mesh exposure . risk factors for mesh exposure bmi : body mass index ; ci : confidence interval ; or : odds ratio .", "epidemiological studies have shown that 29.2% of the pop patients need to be reoperated after traditional operation , especially in advanced pop . the synthetic pp mesh has been used more widely in pelvic reconstructive surgery for the past 1020 years . however , the related complications of pp mesh have been reported occasionally and some of them are serious and life - threatening . , falagas reported that the incidence of mesh exposure rate ranged from 0% to 33% . recently , a meta - analysis of 110 studies comprising 11,785 patients reported 10.3% overall rate of mesh exposure . in this study , we have found a higher mesh exposure rate in tvm of 15.8% . in this study , we identified risk factors for pp mesh exposure . we analyzed the onset of the exposure and found that 59% occurred within 1 year after the operation and 41% beyond 1 year . it was also found that 72.7% ( 24/33 ) of mesh exposure occurred within half a year . among them , 39.4% ( 13/33 ) happened within 2 months . one year after the operation the onset of exposure was rather low ( 1/31 ) . according to the literature , mesh exposure is more likely to occur in patients older than 70 years due to thinner vaginal mucosa caused by the low estrogen level . in 2005 , achtari et al . reported that patient age was a risk factor for mesh exposure . kim et al . reported that the rate of mesh erosion was not related to patient age when comparing a group > 70 years of age to a group < 70 . in two recent retrospective cohort studies , which included patients over 80 with pop , no mesh exposure was found after the operation . in our study , mesh exposure was found to occur mainly in patients between 50 and 75 years old . the subsequent regression analysis has also not revealed any effect of age for mesh exposure . first , we tried to reserve the vaginal mucosa as much as possible during our operation . the number of concomitant operation procedures is another contributing factor for mesh exposure . in 2004 , thompson et al . . believed that risk factors for mesh exposure were concomitant hysterectomy and inverted t colpotomy while ganj et al . thought the most important factor was the length of the incisions in vagina mucosa and the tension on the incision line controversially , stepanian et al . found that concomitant hysterectomy would not increase the risk of mesh exposure . in our experience , exposure was significantly higher in patients who received posterior vaginal wall colporrhaphy , perineorrhaphy , and vaginal tape . binary logistic regression analysis showed that the number of concomitant procedures and operative time were risk factors for mesh exposure . as the number of concomitant procedures increased , the rate of mesh exposure increased , possibly due to a longer operative time . in this study , we used 3 different types of meshes . prosima was smaller and can be adjusted by clipping but is not as evenly placed as prolift . ventricular septal defect is maintained for 28 days after prosima placement , which may arouse a local inflammation reaction . our results showed that prosima , prolift , and mesh had an exposure rate of 19.1% , 15.9% , and 12.3% , respectively . although prosima showed a higher exposure occurrence , statistical analysis did not reveal any difference among them , indicating they share similar exposure hazards . it was reported that surgeon 's experience is also related with mesh exposure . in our hospital , the rate of mesh exposure was 14.6% in the first 5 years and 17% in the following 3 years . this indicated that the surgeon 's experience might not be a strong protective factor for mesh exposure . in addition , it was found that the exposure rate of vaginal tape was only 1.6% , which indicated vaginal tape was safer and less likely to have mesh exposure . the warning from us fda regarding tvm indicates improper use of mesh may cause serious safety problems . candidates should be carefully chosen , usually patients with advanced pop . furthermore , alternative nonsurgical treatment or autologous tissue reconstructive surgery should be explored . access system should be implemented to select eligible surgeons , and a standardized management system should be established for pelvic surgery . in general although exposure may occur after surgery , exposure rate was low and easy to manage .", "epidemiological studies have shown that 29.2% of the pop patients need to be reoperated after traditional operation , especially in advanced pop . the synthetic pp mesh has been used more widely in pelvic reconstructive surgery for the past 1020 years . however , the related complications of pp mesh have been reported occasionally and some of them are serious and life - threatening . , falagas reported that the incidence of mesh exposure rate ranged from 0% to 33% . recently , a meta - analysis of 110 studies comprising 11,785 patients reported 10.3% overall rate of mesh exposure . in this study , we have found a higher mesh exposure rate in tvm of 15.8% . in this study , we identified risk factors for pp mesh exposure . we analyzed the onset of the exposure and found that 59% occurred within 1 year after the operation and 41% beyond 1 year . it was also found that 72.7% ( 24/33 ) of mesh exposure occurred within half a year . among them , 39.4% ( 13/33 ) happened within 2 months . one year after the operation the onset of exposure was rather low ( 1/31 ) .", "according to the literature , mesh exposure is more likely to occur in patients older than 70 years due to thinner vaginal mucosa caused by the low estrogen level . in 2005 , achtari et al . reported that patient age was a risk factor for mesh exposure . kim et al . reported that the rate of mesh erosion was not related to patient age when comparing a group > 70 years of age to a group < 70 . in two recent retrospective cohort studies , which included patients over 80 with pop , no mesh exposure was found after the operation . in our study , mesh exposure was found to occur mainly in patients between 50 and 75 years old . the subsequent regression analysis has also not revealed any effect of age for mesh exposure . first , we tried to reserve the vaginal mucosa as much as possible during our operation .", "the number of concomitant operation procedures is another contributing factor for mesh exposure . in 2004 , thompson et al . believed that risk factors for mesh exposure were concomitant hysterectomy and inverted t colpotomy while ganj et al . thought the most important factor was the length of the incisions in vagina mucosa and the tension on the incision line controversially , stepanian et al . found that concomitant hysterectomy would not increase the risk of mesh exposure . in our experience , exposure was significantly higher in patients who received posterior vaginal wall colporrhaphy , perineorrhaphy , and vaginal tape . binary logistic regression analysis showed that the number of concomitant procedures and operative time were risk factors for mesh exposure . as the number of concomitant procedures increased , the rate of mesh exposure increased , possibly due to a longer operative time . in this study , we used 3 different types of meshes . prosima was smaller and can be adjusted by clipping but is not as evenly placed as prolift . ventricular septal defect is maintained for 28 days after prosima placement , which may arouse a local inflammation reaction . our results showed that prosima , prolift , and mesh had an exposure rate of 19.1% , 15.9% , and 12.3% , respectively . although prosima showed a higher exposure occurrence , statistical analysis did not reveal any difference among them , indicating they share similar exposure hazards . it was reported that surgeon 's experience is also related with mesh exposure . in our hospital , the rate of mesh exposure was 14.6% in the first 5 years and 17% in the following 3 years . this indicated that the surgeon 's experience might not be a strong protective factor for mesh exposure . in addition , it was found that the exposure rate of vaginal tape was only 1.6% , which indicated vaginal tape was safer and less likely to have mesh exposure . the warning from us fda regarding tvm indicates improper use of mesh may cause serious safety problems . candidates should be carefully chosen , usually patients with advanced pop . furthermore , alternative nonsurgical treatment or autologous tissue reconstructive surgery should be explored . access system should be implemented to select eligible surgeons , and a standardized management system should be established for pelvic surgery . in general , our results showed that tvm surgery is beneficial for patients with advanced pop . although exposure may occur after surgery , exposure rate was low and easy to manage .", "", "" ]

[ "5-fluorouracil ( 5-fu ) is a widely used chemotherapeutic drug and cardiac complications are not rare . however myocardial infarction , tako - tsubo - like syndrome and cardiogenic shock are also described .", "a 50-year - old man ( weight 70 kg , height 180 cm ) was admitted to a primary care hospital following an episode of syncope . he reported acute orthopnea and an attack of sweating at night accompanied by nausea and vomiting before loss of consciousness for 1 min . in the emergency room , patient developed asystole and was immediately and successfully resuscitated for 2 min . afterwards , he was fully oriented without any neurological dysfunction . consequently , he was transferred to our heart center for further diagnostic work - up and therapy . importantly , patient had no previous history of cardiovascular disease or risk factors , but was diagnosed with colorectal cancer ( ct3 n1 m0 ) and underwent recent neoadjuvant chemotherapy with 5-fu ( 9500 mg by continuous infusion over a period of 120 h ) until 1 day before his acute presentation . his physical examination revealed hypotensive blood pressures ( 89/58 mmhg ) and heart rate at rest of 95 bpm . the electrocardiogram documented sinus rhythm at 95 bpm with non - significant st - elevation in leads ii , iii , avf . high - sensitive troponin t ( 60 ng / l ; upper reference value 14 ng / l ) and creatine kinase - mb fraction ( 0.74 mol / l*s ; upper reference value 0.41 mol / l*s ) were slightly elevated . creatinine kinase showed a normal value of 0.93 mol / l*s ( upper reference value 3.17 mol / l*s ) . initial transthoracic echocardiography ( tte ) showed a normal sized left ventricle ( left - ventricular end - diastolic diameter : 48 mm , left - ventricular end - diastolic volume : 103 ml ) with global hypokinesia and severely decreased left - ventricular systolic function [ left - ventricular ejection fraction : 16% ; [ figure 1a and b ] . transthoracic echocardiography on day 1 ( a ) apical four - chamber view during diastole , ( b ) apical four - chamber view during systole ( there is global hypokinesia with severely impaired thickening of the left ventricular wall in systole ) one day after admission , patient had persistent hypotension with increasing lactate levels as a sign of peripheral malperfusion . on repeat echocardiographic examination , left - ventricular systolic function was found to have further decreased with a left - ventricular ejection fraction of < 10% . due to the progressive cardiogenic shock , we decided to treat this condition by the use of an extracorporeal membrane oxygenation ( ecmo ) support by percutaneous implantation . on ecmo support , hemodynamic stabilization was evident and medical heart failure treatment including angiotensin - converting enzyme - inhibitor , diuretics and spironolactone was commenced . after 4 days with ecmo therapy , left - ventricular ejection fraction improved to 45% and lactate levels were in normal ranges ( < 2 therefore , ecmo - flow was reduced slowly up to 1.5 l / min . due to the stable lactate levels ( < 2 the following course was uncomplicated with normalization of blood pressures and no signs of heart failure . eight days after admission , he was transferred to the normal ward . left - ventricular ejection fraction was now recovered to a normal value of 60% [ figure 2a and b ] . for confirmation and further differential diagnosis cardiac , magnetic resonance imaging ( mri ) the mri showed a normal sized left ventricle ( left ventricular end - diastolic volume : 149 ml ; normal value 102 - 235 ml ) with normal ejection fraction of 57% and without any specific wall motion abnormality . furthermore , t1-weighted imaging showed pronounced early contrast enhancement , indicating some degree of myocardial hyperemia . patient was discharged from hospital in a stable cardiac condition without symptoms of heart failure 11 days after admission . transthoracic echocardiography on day 10 ( a ) apical four - chamber view during diastole , ( b ) apical four - chamber view during systole .", "this report describes a patient with no history of cardiovascular disease who experienced acute left - ventricular failure after administration of 5-fu . cardiac complications ranging from angina pectoris to cardiogenic shock after chemotherapy with 5-fu are not rare . coronary vasospasm , endothelial damage with consequent thrombus formation , increased myocardial oxygen demand , block of myocardial cell metabolism and tako - tsubo - like syndrome with supraphysiologic levels of plasma catecholamines are discussed as potential pathogenetic mechanisms . our patient did not report any angina and obstructive coronary lesions were excluded by angiography . echocardiography did not reveal an apical ballooning as common in tako - tsubo - like syndrome . the cardiac mri of our patient strengthens the concept of an additional temporary myocardial inflammation . increased global myocardial edema and evidence of myocardial hyperemia are compatible with a regressive inflammation . unfortunately , the mri could not be performed in the acute setting with severely decreased left - ventricular function due to ecmo - therapy and therefore , the extent of myocardial edema and hyperemia might be underestimated . treatment of cardiogenic shock is still a therapeutic challenge , especially if coronary artery disease was excluded . usually , sympathomimetics are used as first line therapeutics , but several disadvantages in their use have to be taken into account . sympathomimetics induced vasoconstriction can lead to perfusion mismatch or even deficit within the microcirculation and metabolic acidosis due to an increased oxygen demand can be observed regularly . in addition , some studies give evidence that use of sympathomimetics is directly linked to enhanced systemic inflammatory response due to an increased interleukin-6 expression . in our case with unclear pathogenesis of cardiogenic shock , we decided to use a mechanical hemodynamic support ( intraaortic balloon counterpulsation or ecmo ) to avoid above mentioned disadvantages with the use of sympathomimetics , especially with the knowledge about inflammation as a possible cause of 5-fu induced left - ventricular dysfunction . recently , intraaortic balloon counterpulsation was shown not to reduce 30-day mortality in patients with cardiogenic shock complicating myocardial infarction . in our case with progressive cardiogenic shock , therefore , we decided to use ecmo - the most potent form of acute cardiorespiratory support , which enables complete relief of cardiac workload and prevents high - dose usage of sympathomimetics .", "cardiogenic shock should be taken into consideration as a possible complication secondary to chemotherapy with 5-fu , even in patients without a history of cardiovascular disease . to the best of our knowledge , this is the first report of an ecmo support in this kind of chemotherapeutic induced cardiogenic shock . ecmo support enabled complete relief of cardiac workload and together with medical therapy for heart failure , complete recovery of cardiac function was possible ." ]

[ "a summary of methods is provided below and a detailed description of methods is included in the supplementary information . the toxin nanosponges were prepared by fusing rbc membrane vesicles on preformed poly(lactic - co - glycolic acid ) ( plga ) nanoparticles through an established extrusion process . the size of the nanosponges was obtained from three dynamic light scattering ( dls ) measurements using a malvern zen 3600 zetasizer . the morphology of the nanosponges after absorbing toxins was measured by transmission electron microscopy ( tem ) . for preparation of human rbc nanosponges , the rbcs were collected from whole human blood ( bioreclamation ) and the characterization results were shown in fig . reconstitution of the lyophilized samples was performed by solubilizing the samples in water and the characterization results were included in fig . the in vitro toxin neutralization ability of the nanosponges was examined by mixing 3 g of -toxin with 200 l of 1 mg / ml nanosponges for 30 min , followed by adding into 1.8 ml of 5% purified mouse rbcs . the in vitro toxin absorption capacity of the nanosponges was determined through titrating -toxin to a fixed amount of nanosponges . the interaction of the nanosponges with cells was examined by a scanning fluorescence microscopy by incubating fluorescent nanosponges and rbc membrane vesicles with human umbilical vein endothelial cells ( huvec ) . the in vitro cellular cytotoxicity of nanosponge - sequestered toxins was examined by incubating nanosponges of different concentrations with varied amounts of -toxin , streptolysin - o , and melittin for 30 min , followed by adding to huvecs for 24 hr . the in vivo toxin neutralization ability of the nanosponges was tested through subcutaneous injection of the nanosponge / toxin mixture to the flank region of nude mice , followed by histological analyses . on - site neutralization of -toxin by the nanosponges was conducted by subcutaneously injecting 50 l of 36 g / ml of -toxin solution , immediately followed by a 100 l injection of 2 mg / ml nanosponges . the mice were imaged 3 days later for visualization of skin lesion formation ( fig s11 ) . the in vivo detoxification efficacy was tested through intravenous injection of nanosponges before or after administration of a lethal dose of -toxin to icr mice , followed by monitoring the survival rate of the mice . for the in vivo hepatotoxicity study , one group of mice was sacrificed on day 3 following the injection of the toxin - bound nanosponges and another group was sacrificed on day 7 .", "" ]

[ "hand , foot , and mouth disease ( hfmd ) is a common , acute , and mostly self - limiting enteroviral infection that presents with fever and vesicular lesions on the hands , feet , mouth , and frequently buttocks as characteristic features1,2,3,4 ) . although patients with hfmd recover without any sequelae within about 1 week , severe complications occur in a few cases , some of which are life threatening . severe complications accompanying hfmd include encephalitis , pulmonary edema / hemorrhage , cardiopulmonary collapse , and myocarditis1,2 ) . enterovirus 71 can often lead to a more severe clinical course accompanied by neurologic and cardiopulmonary complications and may rapidly lead to death1,2,3 ) . enterovirus 71-induced hfmd developed in korea in 2000 but it was not an epidemic and fatal until 20081,4,5 ) . in the spring of 2009 , a large nationwide outbreak of hfmd caused by enterovirus 71 occurred in korea , and a few cases with encephalitis were fatal1,4,6 ) . a multicenter study in korea performed by the enterovirus complication working group revealed that encephalitis with cardiopulmonary complications of hfmd occurred in 2.4% of patients , including 2 patients ( 1.2% ) who expired1 ) . pulmonary hemorrhage in enterovirus 71-infected hfmd patients has been reported in taiwan , china , and malaysia2,7,8,9 ) . however , to our knowledge , no cases of hfmd with sudden - onset massive pulmonary hemorrhage have been reported in korea . here , we report a fatal case of enterovirus 71-induced hfmd that progressed rapidly with massive pulmonary hemorrhage and convulsion .", "a 12-month - old , previously healthy boy with hfmd was referred to inje university ilsan paik hospital because of 3 episodes febrile convulsions . he was born at full term weighing 3.87 kg through normal vaginal delivery by a vietnamese mother . he was admitted to a primary hospital with high fever ( up to 39 ) , throat vesicles , and vesicular rashes on his hands and feet for 2 days . on the second hospital day , he had 3 generalized tonic - clonic and atonic convulsions with vertical eyeball deviation within 5 minutes of each other . his chest radiography was normal . within 5 hours after admission , he vomited 3 times after meals . besides a body temperature of 38.3 , his other vital signs were stable and he remained conscious . desaturation to 76% percutaneous blood oxygen saturation ( spo2 ) and tachycardia to 176 beats / min accompanied by perioral cyanosis occurred suddenly 6 hours after admission . his respiration rate was 34 breaths / min , and auscultation disclosed rales on the whole lung field . an endotracheal tube was inserted immediately , and a large amount of blood from a pulmonary hemorrhage came out through it . comparison of laboratory test results between his initial and pulmonary hemorrhagic status revealed that his hemoglobin decreased from 9.6 to 8.3 mg / dl and his white blood cell count increased from 13,090 to 17,450 cells/l . erythrocyte sedimentation rate was slightly increased from 15 to 32 mm / hr , but c - reactive protein level decreased from 1.06 to 0.2 mg / dl . prothrombin time ( pt ) and pt international normalized ratio were slightly prolonged ( 16.5 and 1.39 seconds , respectively ) . meanwhile , d - dimer ( 2,375.91 ng / ml ) and fibrin degradation product ( 5 - 20 g / ml ) were elevated . eight hours after admission , his blood pressure decreased to 82/41 mmhg and heart rate increased to 220 beats / min . his body temperature ranged from 38.8 to 40.2. the patient was diagnosed as fatal hfmd with massive pulmonary hemorrhage . intravenous immunoglobulin ( ivig , 1 g / kg / dose ) , dexamethasone ( 0.3 mg / kg / day in divided doses every 6 hours ) , and cefotaxime ( 150 mg / kg / day in divided doses every 6 hours ) were administered immediately . in addition , leukocyte - depleted red blood cells and fresh frozen plasma were transfused , and intravenous vitamin k and endotracheal epinephrine were administered . lumbar puncture was scheduled but was ultimately not performed because of the patient 's unstable vital signs . the patient expired 15 hours after admission , and it was within 3 days of fever onset and within 9 hours after intubation . we reported it to the korea centers for disease control and prevention ( kcdc ) , sending his urine , serum , nasopharyngeal swab , and endotracheal aspirate . enterovirus genome detection was attempted by realtime reverse transcription - polymerase chain reaction ( rt - pcr ) using a taqman system ( applied biosystems , foster city , ca , usa ) . for genotyping , seminested rt - pcr was used to amplify part of the viral protein 1 ( vp1 ) gene of enteroviruses according to the kcdc protocol , and sequencing analysis for the vp1 amplicon was performed by an automatic sequencer and the dnastar software package ( dnastar inc . , madison , wi , usa ) . the kcdc isolated enterovirus 71 with subgenotype c4a from the patient 's serum and nasopharyngeal swab . bocavirus was also isolated from his nasopharyngeal swab by real - time rt - pcr at our hospital .", "to our knowledge , this is the first reported case of hfmd with sudden - onset massive pulmonary hemorrhage in korea . pulmonary edema / hemorrhage is the mysterious hallmark symptom of enteroviral hfmd and can kill a child within 1 day2 ) . an epidemic study conducted in taiwan from 1998 to 2005 reported that pulmonary edema / hemorrhage occurred in 43% of patients with severe culture - proven enteroviral hfmd / herpangina2 ) . this discrepancy maybe due to different enterovirus virulence or subgenotypes , or differences in susceptibility with respect to ethnicity . pulmonary edema / hemorrhage is characterized by respiratory distress , tachypnea , tachycardia , hemoptysis , and rapidly progressing diffuse infiltration or congestion on a chest film2 ) . a study on the outbreak in taiwan in 1998 reported that enterovirus 71-infected hfmd patients with pulmonary edema had suddenonset tachypnea , tachycardia , and cyanosis within 1 - 3 days after disease onset , and pulmonary edema led to a rapid death within 12 hours after intubation10 ) . the present patient exhibited a change in consciousness , respiratory distress , tachypnea , tachycardia , hemoptysis , rapidly progressing infiltration on a chest film , hypoxemia , and hypotension . this patient ultimately expired within 3 days of fever onset and within 9 hours after intubation . in this report , we had applied pulse oxymetry from the beginning , so we could find his desaturation immediately after pulmonary hemorrhage . we suggest saturation monitoring for hfmd patients with central nervous system ( cns ) involvements for early detection . it may be caused by increased pulmonary vascular permeability as a result of either brainstem encephalitis or a systemic inflammatory response caused by excessive cytokine release2,6 ) . cns involvement of enterovirus 71-induced hfmd may also trigger a sympathetic storm , resulting in vasoconstriction with high systemic vascular resistance , passive pulmonary volume loading , and pulmonary edema / hemorrhage8 ) . the present patient had several episodes of convulsions , lethargy , and loss of consciousness . therefore , we suspected encephalitis , although we were unable to perform a cerebrospinal fluid study because of his unstable vital signs . his suspected encephalitis may be a possible cause of the pulmonary hemorrhage . however , pulmonary edema / hemorrhage without cns involvement occurred in 11% of patients with severe culture - proven enteroviral hfmd / herpangina in an epidemic study in taiwan from 1998 to 20052 ) . another possible explanation for the pathogenesis is coinfection with a second virus2 ) , as bocavirus coinfection was detected in the patient . however , the presence of both viruses would not result in increased mortality due to hfmd , according to a previous study2 ) . a multicenter study performed by the enterovirus complication working group investigating enterovirus 71-induced hfmd in korea in 2009 reported that an hfmd rash pattern , fever longer than 4 days , peak body temperature > 39 , vomiting , headache , neurologic signs , leukocytosis , serum glucose > 100 mg / dl , and isolated enterovirus 71 may be indicative of poor prognosis during hfmd epidemic periods1,10 ) . in addition , young age at disease onset and a history of lethargy are associated with an increased risk of severe hfmd11 ) . the present patient was young and presented with hfmd rashes and vesicles , fever up to 39 , vomiting , lethargy , and convulsions as neurologic signs as well as leukocytosis , high serum glucose level , and isolated enterovirus 71 as poor prognostic factors . hfmd patients are very frequently approximately 1 year of age , and deaths were reported to occur at around 1 year of age in other studies12,13,14,15 ) . in the 2009 outbreak , 2 patients around 1 year of age expired , and the present patient was a 12-month - old baby . the gold standard for the diagnosis of enteroviral infection is viral culture and isolation in 2 or more specimens of cerebrospinal fluid , blood , nasopharyngeal swab or secretion , vesicular fluid , or stool to increased diagnostic sensitivity1,4,6,11 ) . in the present report , enterovirus 71 was isolated from both the patient 's serum and nasopharyngeal swab . in the 2009 korean outbreak , the subgenotype of enterovirus 71 was c4a , which was prevalent in china in 2008 . in the present case , the subgenotype of enterovirus 71 was also c4a . the administration of high - dose ivig is recommended for severe hfmd as optional treatment , because ivig therapy was effective in many reports4,5,6,7,11 ) . ivig neutralizes the virus and has nonspecific antiinflammatory properties11 ) ; this would significantly reduce mortality by attenuating sympathetic activity and cytokine production5 ) . furthermore , fluid restriction , inotropic agents , and early intubation with positive - pressure mechanical ventilation are recommended for severe hfmd with pulmonary edema or hemorrhage8 ) . pulmonary hemorrhage in enterovirus 71-infected hfmd is very rare ; the present case is likely the first to have occurred in korea . the present case of fatal hfmd was rapidly aggravated and the patient expired within 3 days from fever onset . therefore , all physicians should pay special attention to infants and young children with hfmd , particularly in enterovirus 71 epidemic areas such as korea , to enable early detection and management of severe hfmd . above all , keeping the infected child at home until full recovery and controlling the preschool with infected child are very important for reducing infection6 ) . in addition , the development of antiviral agents and vaccines is necessary especially for the control of severe hfmd with complication ." ]

[ "since the increase in adiposity is related to general poor health factors such as an increase in type ii diabetes and increased incidence of coronary heart disease , exercise to reduce adiposity is recommended for the ageing population . a further consequence of the ageing process is that elderly individuals have an impaired ability to oxidise fatty acids , particularly after a meal . since most individuals eat a meal prior to exercise in order to provide some form of sustenance , what should the meal contain if the exercise priority is to burn fat ? generally , a high - fat , low - cho meal increases fat oxidation during subsequent exercise [ 46 ] , whereas the ingestion of cho before exercise depresses the rate of fat oxidation due to hyperinsulinemia in the postprandial period . altering the type of cho consumed has been shown to have an effect on the magnitude of hyperinsulinemia and depression of fat oxidation [ 8 , 9 ] postprandial increases in glucose and insulin concentration promote cho oxidation , resulting in decreased fatty acid oxidation . wu et al . found that the amount of fat oxidised was significantly higher during exercise commencing 3 h after consuming a low glycemic index ( lgi ) meal compared with a high glycemic index ( hgi ) meal . they also demonstrated that the hgi meal resulted in a greater glycemic and insulinemic response during the postprandial period compared with lgi meal . this is supported by stevenson et al . who investigated the metabolic responses to hgi and lgi mixed meals after 60-minute exercise at 70% vo2max and found that significant differences in hyperglycemia and hyperinsulinemia can be achieved repeatedly by changing the glycemic index ( gi ) of the cho in a mixed meal . they observed that the amount of fat oxidised during the postprandial period following lunch was significantly higher in the lgi than the hgi trial . thus , at least for several hours postprandial , both at rest and during exercise , fat utilisation is depressed after hgi compared with lgi meals . the effects of different meals ( high fat , hgi , and lgi ) on fat and cho metabolism at rest and during exercise in young subjects have been extensively studied , although this is not the case for elderly individuals . as mentioned previously , it is an important health benefit for the elderly to engage in some form of aerobic exercise for improvements in the cardiovascular system and to reduce body fat . therefore , the present study was designed to investigate the effects of four different types of meals ( normal , high - fat , hgi , and lgi ) on fat and cho metabolism during exercise in elderly male subjects .", "eight healthy males ( mean sd , age 63.3 5.2 years , height 168 0.05 cm , body mass 78.1 14.0 kg , body fat 21 5.3% , and vo2 max 36.9 10.4 mlkgmin ) gave informed written consent to participate in the study after gaining approval from the human ethics committee of liverpool john moores university . blood pressure ( dinamap pro series , ge medical systems , florida ) was determined prior to performing any exercise as a screening for hypertension . participants reported to the laboratory on five separate occasions . in the first session they were familiarised with the laboratory environment and physiological testing equipment . height , body mass , and percent of body fat using dxa were also determined during this session . after familiarisation , vo2 max was determined on a cycle ergometer as described previously . after initial physiological measurements , participants reported to the physiology laboratory on four separate occasions , each of which was allocated for the performance of a 30-minutes exercise on a cycle ergometer at 60% vo2 max after having a high fat ( hf ) , high carbohydrate hgi ( hgi ) , high carbohydrate low lgi ( lgi ) , and normal ( n ) meal . the rationale for 30-minutes exercise reflects a typical aerobic bout of exercise undertaken by such persons in a gym session and is recommended for health purposes . the four meals were given to subjects in a counterbalanced design and sessions were separated by at least 3 days . to avoid circadian variation , experiments were always performed at the same time of day ( 08:00 am ) after an overnight fast . participants completed a 2-day food diary on the day before their first test and were asked to repeat this diet before all subsequent trials . in addition , subjects were requested to refrain from drinking alcohol , nor to engage in any kind of strenuous exercise 24 hours before trials . participants reported to the physiology laboratory after an overnight fast and remained seated for 20 minutes . after this rest period , blood pressure was checked and a blood sample ( 10 ml ) was taken . they then consumed one of the meals which were provided in a random , counterbalanced order within 2030 minutes . at 3 h 20 min after the meal , subjects started the exercise protocol that included a 30-minutes cycling at 60% vo2 max . two more venous blood samples were taken , immediately before exercise ( 3 hours after the meal ) , and immediately after exercise in each session . oxygen consumption ( vo2 ) , carbon dioxide output ( vco2 ) , and respiratory exchange ratio ( rer ) were measured breath by breath throughout the exercise . participants were provided with one of the four following isoenergetic test meals : ( 1 ) and ( 2 ) hgi and lgi : 65% carbohydrate , 20% fat , and 15% protein , ( 3 ) hf : 65% fat , 20% carbohydrate and 15% protein , or ( 4 ) n : 50% carbohydrate , 35% fat , and 15% protein . the glycaemic index values for hgi and lgi were 74.32 and 29.26 , respectively . before the meal , immediately before exercise and immediately after exercise venous blood samples were drawn in a seated position in each session . two microhaematocrit tubes ( l. i. p. shipley , england ) and two -haemoglobin microcuvettes ( hemocue ab , ngleholm , sweden ) were filled with whole blood for determination of haematocrit and haemoglobin , respectively . plasma was obtained by collecting the blood sample into tubes that had been pretreated with an anti - coagulant ( lithium heparin ) . these samples were mixed and immediately centrifuged at 4c for 15 minutes at 1900 g. after centrifugation , plasma was separated and stored at 70c for the subsequent analysis of glucose , glycerol , nonesterified fatty acids ( nefas ) , and b - hydroxybutyrate ( 3-ohb ) . the blood was stored at room temperature for 30 minutes before centrifuged at 20c for 15 minutes at 2000 g. serum was stored at 70c for subsequent analysis of insulin . nefa , glucose , glycerol , and 3-ohb were analysed using appropriate kits on ilab 300 analyser ( il instrumentation laboratories , warrington , uk ) . insulin was assayed by elisa ( drg instruments gmbh , germany ) using a fully automated system ( triturus , grifols , cambridge , uk ) . insulin resistance ( homa2-ir ) and -cell function ( homa2 % b ) in fasting state were determined using a homeostasis model assessment ( homa - ir ) and were calculated from fasting insulin and fasting glucose . all statistical analyses were performed using the software statistical package spss version 12 ( chicago , usa ) . one - way anova was employed to evaluate differences in the resting mean values of all the variables measured over the four testing occasions . in addition , fat and cho oxidations values during exercise for four trials were compared using one - way anova . a two - way anova ( 4 3 ) with repeated measures across meals ( 4 levels ) and conditions ( 3 levels ) was employed to examine the differences in mean values for blood parameters . when anova indicated the presence of a significant difference , post hoc comparisons using the bonferroni method were applied to determine pairwise differences .", "no significant main effect of the meals was observed for rates of fat oxidation ( f3,21 = 1.8 ; p = .177 ) , although fat oxidation was demonstrably , but nonsignificantly , higher after hf ( 0.26 0.04 g / min ) than n ( 0.21 0.04 g / min ) , hgi ( 0.22 0.03 g / min ) , and lgi ( 0.19 0.03 g / min ) . the rates of carbohydrate oxidation during exercise were 1.79 0.28 , 1.58 0.22 , and 1.68 0.22 , 1.77 0.21 g / min for n , hf , hgi , and lgi , respectively . statistical analysis revealed no significant effect of meal on the rate of carbohydrate oxidation during exercise . statistical analysis showed a significant main effect of the meal on nefa concentration ( f3,21 = 39.2 ; p = .001 ) . pairwise comparisons revealed a significant difference between nefa responses to n and hf ( p = .02 ) as well as between hgi and lgi meals ( p = .003 ) . pre - exercise nefa concentration increased significantly following hf ( from 0.39 0.08 to 0.61 0.08 mmol / l ) and decreased significantly after eating hgi ( from 0.44 0.09 to 0.13 0.02 mmol / l ) and lgi ( from 0.55 0.08 to 0.27 0.07 however , nefa concentration increased significantly in response to exercise only after hgi ( from 0.12 0.02 to 0.36 0.09 mmol / l ) and lgi ( from 0.27 0.06 to 0.64 0.18 figure 1 highlights data from nefa . a significant effect of meal was found for glycerol concentration ( f3,21 = 9.7 ; p = .001 ) . pairwise comparisons revealed a significant difference between hf and hgi ( p = .01 ) . resting glycerol values were increased significantly after all meals except for hgi ( figure 2 ) . moreover , glycerol concentration increased significantly during exercise after all types of meals ( figure 2 ) . the statistical analysis revealed a significant effect of the meal on 3-ohb ( f3,21 = 3.6 ; p = .03 ) . however , pairwise comparisons did not show any significant difference among the four meals . resting 3-ohb concentration a significant effect of meals on glucose concentration was found ( f3,21 = 39.2 ; p = .001 ) . postprandial glucose concentration increased following all meals , though the changes were not statistically significant ( figure 4 ) . however , glucose concentration decreased significantly ( p < .05 ) from 5.36 0.25 to 4.65 0.08 mmol / l during 30 minutes of exercise after hf and lgi , respectively . although anova did not show a main significant effect of either meal or time on insulin concentration , the pre - exercise insulin concentration ( 18.9 1.7 u / ml ) in hgi trial was significantly ( p < .05 ) higher than resting values ( 15.2 1.1 u / ml ) . in addition , insulin concentration decreased significantly during exercise after n , hf and hgi ( figure 5 ) . the mean ( se ) resting value of homa2-ir ( insulin resistance ) for all subjects was 0.76 0.06 and that for homa2- ( -cell function ) was 78.5 69 . these resting values are indicators of normal insulin resistance and -cell function in our elderly subjects .", "the present study is the first study designed to investigate the effects of pre - exercise mixed meals on fat and carbohydrate metabolism during exercise in elderly individuals , and its principle finding was that in spite of some changes in fat metabolites , the composition of the meal did not result in differences in cho and fat oxidation . these results are in contrast to the data reported by previous studies in young subjects that observed a rise in fat oxidation after hf due to increases in fatty acid ( fa ) availability and mobilization [ 4 , 6 , 15 , 16 ] . moreover , a depression in the rate of fat oxidation following cho ingestion , attributed to hyperinsulinaemia , has also been observed in the postprandial period [ 79 ] . availability and utilisation of plasma fa decreases after a cho meal partly because the cho - induced rise in insulin inhibits the mobilisation and availability of circulating fa , which reduces fat oxidation possibly by inhibiting the rate of long - chain fatty acids entry into the mitochondria for -oxidation [ 17 , 18 ] . despite cho - induced hyperinsulinemia and suppression of fa after cho ingestion , our results show that the cho oxidation was resistant to alteration during exercise in elderly males . several mechanisms , including impaired insulin - stimulated glucose uptake , may have contributed to these results . having said that , it should be noted that the homa scores indicate normal insulin resistance and -cell function for these elderly participants . the increased release of fas in older individuals , in excess of the energy needs and/or oxidative capacity of respiring tissues , increases the amount of non - oxidised fas . excess non - oxidised fas with age may have several adverse metabolic effects including increased glucose production and impaired insulin - stimulated glucose uptake . fas exert their effects through inhibition of pdh with subsequent increased intracellular concentration of glucose-6-phosphate and inhibition of hexokinase , which decreases glucose uptake . another factor that may contribute to impaired glucose uptake with ageing is inhibition of glucose transport either due to less availability of the glut-4 transporters or , to the signalling processes for glut-4 vesicle translocation to the plasma membrane . these considerations need further exploration . although after the hf meal , nefa , and glycerol concentrations were higher than for the other meals , the fat oxidation rates during exercise were not different . evaluation of skeletal muscle samples has revealed that maximal mitochondrial oxidative enzyme activity is lower in older than in young subjects because of both decreased mitochondrial volume density and mitochondrial function . lower activity of enzymes such as ampk , camp , and protein kinase c in elderly individuals results in activation of acc ( acetyl - coa carboxylase ) . activation of acc leads to an increase in concentration of malonyl - coa which has an inhibitory effect on cpt - i , thereby inhibiting the entry of long chain fatty acids into mitochondria and resulting in lower fa oxidation . lack of changes in fat oxidation after hf was found in spite of increased lipolysis . it has been demonstrated that relative to the energy needs of the body , fa release is not impaired in the elderly . in fact , fas are released in excess of energy needs in older individuals when compared to younger controls . thus , when considered relative to the energy demands of the body or the metabolically active tissue mass , ageing is not associated with impaired fa release which supports our findings for lipolysis . a higher rate of fat oxidation during submaximal exercise after ingesting lgi foods has been reported in young healthy males when compared to hgi [ 9 , 11 ] . in terms of the effect of gi , the results of the present study were somewhat unexpected since the calculated amount of fat oxidation during 30 minutes of cycling commencing 3 hour after consuming hgi and lgi meals was not significantly different . one possible explanation for this discrepancy might be the impaired glucose uptake associated with ageing as previously discussed . in the present study , postprandial nefa concentration was increased after hf , which is in agreement with previous studies on young participants [ 6 , 9 ] . the increase in plasma nefa concentration which occurred might be a result of tag hydrolysis by endothelial lipoprotein lipase ( lpl ) . both hgi and lgi resulted in suppression of nefa concentrations 3 hours after the meal consumption . however , nefa concentrations at the end of 30-minutes cycling in both hgi and lgi trials were raised to pre - meal levels . higher post - exercise nefa is typical response to exercise - induced decrease in insulin and increase in catecholamines . the lack of a significant increase in glycerol after hgi might be due to the enhanced secretion of insulin following the hgi meal which would activate the enzyme lpl in adipose tissue . the insulin activation of lpl serves to increase tag uptake and storage after a single meal which eventually results in lower glycerol concentration . studies in young subjects during low and moderate intensity exercise have demonstrated that increased blood glucose availability suppresses fat utilisation by inhibition of both fat mobilisation and fat oxidation within muscle [ 7 , 18 ] . postprandial glycerol concentration was significantly higher after hf than hgi and lgi in elderly subjects which reflects the lack of insulin response to hf in comparison to the other meals . these findings are in agreement with those of whitley et al . and murphy et al . who reported increases in glycerol after hf in young participants . the present study demonstrated that in elderly individuals feeding isoenergetic meals containing different proportions of carbohydrate and fat alters the metabolic variables at rest and during subsequent exercise . energy regulation during 30 min of cycling in elderly individuals following isoenergetic meals is associated with a relative increase in fat oxidation and a decrease in carbohydrate oxidation following hf and a corresponding increase in cho oxidation and a decrease following high carbohydrate ( low fat ) meals . therefore , based on these finding , it could be concluded that fat and carbohydrate metabolism in elderly individuals in response to different meals at rest and during subsequent exercise are to some extent different from those of young individuals and further studies are warranted to investigate the mechanism / s responsible especially in relation to insulin action and sensitivity . what we can state is that , on balance , eating any type of meal 3 hours prior to a 30-minutes bout of exercise is unlikely to significantly impact on so - called fat burning in healthy elderly males ." ]

[ "physical fitness is the ability that helps people to adapt with their environmental conditions and plays an important role in daily activities . it is highly associated to one 's health status and has a striking effect on the quality of life , learning and working efficiency , and physical activity contributions . physical fitness is composed of performance - related physical fitness and health - related physical fitness . indeed , genetic somehow determines physical fitness , but environmental factors including physical activity levels , socioeconomic status , television viewing , and anthropometric factors highly modify it . since fitness level drops with aging , physical involvement should be highly suggested . however , inactive life affects body muscle and functioning ability negatively , and people are vulnerable to chronic diseases as consequences . a higher quality of life can be obtained through moderate exercises to develop or maintain physical fitness . lamb declared that individuals can successfully cope with challenges in their life via optimal physical fitness . physical training program can be effective for athletes and nonathletes in different ages to improve aerobic power , muscle strength , anaerobic power , jumping ability , and local muscle endurance . additional strength training and plyometric training in 912-year - old soccer players for 2 years showed a significant improvement of motor performance factors . mini - trampoline exercises may need higher levels of involvement in the muscles of lower extremities . since mini - trampoline exercises comprise a multicomponent approach , numerous physical factors including strength , body stability , muscle coordinative responses , joint movement amplitudes , and spatial integration can be affected positively . . indicated not only balance and strength improvement but also muscular imbalances equalization of the two limbs due to mini - trampoline training . . showed improvement in motor performance of participants with intellectual disabilities after applying trampoline training intervention . however , rebounding exercise for 11 weeks revealed minimal cardiorespiratory fitness improvement and no significant body composition changes in 17 sedentary women . very few studies were conducted to detect specific contributions derived from trampoline exercise as a different training model approach . therefore , the purpose of this study was to examine the effect of trampoline training intervention on anthropometric variables and physical fitness components of 1114-year - old male students , iran .", "thirty - eight healthy school - aged male students ( mean age : 12.6 years , standard deviation : 2.1 ) were selected randomly from the junior high schools of ardabil , iran . they were divided into two groups of 19 students based on gender , residential school , and no trampoline training experience . the first five students were omitted as they had prior experience , and the second five students were excluded because they had failed to attend the exercise sessions consistently [ figure 1 ] . the study protocol received approval from the ethics committee of the university of urmia , and it was in accordance with the declaration of helsinki ( last modified in 2000 ) . flow chart of the progress through the phases of the study according to the consort statements evaluation process of participants was conducted within a 2-day period by the same researcher . the 1 day was assigned to anthropometric measurement and the 2 day for motor ability tests . anthropometry and motor ability of the participants were measured before and after the 20 weeks trampoline training intervention . , crymych , dyfed , uk ) and weight ( model ds-410 , seiko , tokyo , japan ) were assessed to the nearest 10 mm and 0.1 kg respectively , and body mass index was calculated using following formula : weight ( kg)/(height [ m ] ) . moreover , lower extremity girths including thigh and calf were measured on the right side of each participant . skinfolds thickness was measured at three body sites ( triceps , subscapula , and suprailiac ) with a harpenden skinfold caliper . participants in experimental group trained 20-week , 1.5 h / session with 10 min rest , in 4 times trampoline training programs per week . although none of the students had balance problems , some important safety guidelines were considered to prevent the possibility of injury . all participants were instructed to perform variety of movements with eyes opened including one foot and two - foot jump , hop with rotation in different directions , hand and toe contacts in the air , and alternate sit and stand movement . the instructor started to teach forward and backward somersault when participants were familiar with spatial awareness , spatial orientation , and body control after performing all of the mentioned movements . finally , students were asked to combine individual movements and execute them as a routine throughout the training sessions . however , participants in the control group only participated in school physical education classes 2 times / week for 45 min . motor ability of all participants was assessed after a short period of warm up using standing long jump and vertical jump based on eurofit test battery . each participant standing reach height , tip of middle finger in the hand closest to the wall while participant stood side on to the wall , was marked . then , participant used both arms and legs contributions to project the body as high as possible while standing away from the wall . the standing reach height and the jump height difference were the score . each participant stood behind the marked line on the ground with swinging arms and bending knees . the take - off was done when the arms reached forward to lead participant as far as possible . a two - way repeated measures analysis of variance ( anova ) ( condition trial ) with repeated measures on both factors was used . to further analyze the responses of the groups", "thirty - eight healthy school - aged male students ( mean age : 12.6 years , standard deviation : 2.1 ) were selected randomly from the junior high schools of ardabil , iran . they were divided into two groups of 19 students based on gender , residential school , and no trampoline training experience . the first five students were omitted as they had prior experience , and the second five students were excluded because they had failed to attend the exercise sessions consistently [ figure 1 ] . the study protocol received approval from the ethics committee of the university of urmia , and it was in accordance with the declaration of helsinki ( last modified in 2000 ) . flow chart of the progress through the phases of the study according to the consort statements", "the 1 day was assigned to anthropometric measurement and the 2 day for motor ability tests . anthropometry and motor ability of the participants were measured before and after the 20 weeks trampoline training intervention . , crymych , dyfed , uk ) and weight ( model ds-410 , seiko , tokyo , japan ) were assessed to the nearest 10 mm and 0.1 kg respectively , and body mass index was calculated using following formula : weight ( kg)/(height [ m ] ) . moreover , lower extremity girths including thigh and calf were measured on the right side of each participant . skinfolds thickness was measured at three body sites ( triceps , subscapula , and suprailiac ) with a harpenden skinfold caliper .", "participants in experimental group trained 20-week , 1.5 h / session with 10 min rest , in 4 times trampoline training programs per week . although none of the students had balance problems , some important safety guidelines were considered to prevent the possibility of injury . all participants were instructed to perform variety of movements with eyes opened including one foot and two - foot jump , hop with rotation in different directions , hand and toe contacts in the air , and alternate sit and stand movement . the instructor started to teach forward and backward somersault when participants were familiar with spatial awareness , spatial orientation , and body control after performing all of the mentioned movements . finally , students were asked to combine individual movements and execute them as a routine throughout the training sessions . however , participants in the control group only participated in school physical education classes 2 times / week for 45 min .", "motor ability of all participants was assessed after a short period of warm up using standing long jump and vertical jump based on eurofit test battery .", "each participant standing reach height , tip of middle finger in the hand closest to the wall while participant stood side on to the wall , was marked . then , participant used both arms and legs contributions to project the body as high as possible while standing away from the wall . the standing reach height and the jump height difference were the score .", "each participant stood behind the marked line on the ground with swinging arms and bending knees . the take - off was done when the arms reached forward to lead participant as far as possible .", ". a two - way repeated measures analysis of variance ( anova ) ( condition trial ) with repeated measures on both factors was used . to further analyze the responses of the groups", "anthropometric and physical fitness variables of the two groups are reported in tables 1 and 2 . the anova repeated measurement test showed a statistically significant main effect of time in calf girth p = 0.001 , fat% p = 0.01 , vertical jump p = 0.001 , and long jump p = 0.001 . the anova repeated measurement test revealed a statistically significant main effect of group in fat% p = 0.001 . characteristics of the study participants differences between pre- and post - training of anthropometric and physical fitness indicators in the trampoline and control groups post hoc paired t - tests indicated statistical significant differences in trampoline group between the two measurements about calf girth ( t = 4.35 , p = 0.001 ) , fat% ( t = 5.87 , p = 0.001 ) , vertical jump ( t = 5.53 , p = 0.001 ) , and long jump ( t = 10.00 , p = 0.001 ) . post hoc paired t - tests showed statistical significant differences in control group between the two measurements concerning calf girth ( t = 5.67 , p = 0.001 ) , vertical jump ( t = 3.88 , p = 0.002 ) , and long jump ( t = 4.22 , p = 0.001 ) . the analysis of independent t - test ( pre- to post - subtraction between two groups ) indicated significant differences in fat% p = 0.001 , high jump p = 0.02 , and long jump p = 0.02 .", "this study investigated whether anthropometric measures and motor performance components are changed via trampoline training considering that this is the first study in a relatively longer period . since athletes increase metabolism through practice , our finding indicated significant changes of body fat% as a result of trampoline training that is not consistent with the findings of edin et al . indeed , no significance changes of body composition variables in the study of edin et al ( 1990 ) may be attributed to the 11 weeks exercise that is limited in terms of training period compared to our study . although trampoline exercises are not basically aerobic , long - term training program made significant changes in body fat% between the two groups . lower limb characteristics such as thigh girth and calf girth were improved considering pre - test and post - test differences . however , we found no significant difference between experimental and control group in this regard . the improved lower limb muscle sizes are related to participant 's growth process , and trampoline training has no significant effect on the hypertrophy of lower limb muscles . ( 2011 ) reported balance improvement due to mini - trampoline exercises in elderly participants . ( 2013 ) indicated improvement in motor performance of participants with intellectual disabilities after applying trampoline training intervention . our findings are in agreement with those studies in this regard and showed significant improvement of jumping ability in healthy trampoline participants compared to control group . this improvement can be attributed to the higher amount of biomechanical stimuli with jumping on a trampoline compared to other forms of activity like running . furthermore , body segments coordination due to training programs can help participants to use the ideal motor patterns for performing jumping tests . trampoline training stimulates proprioceptive sense that can facilitate motor performance and prevent musculoskeletal injuries as a result of sudden fall in life . since the nature of this training intervention is recreational , people in different ages can be involved to promote the quality of their life .", "based on these finding , we can conclude that a 20-week trampoline training with four physical activity sessions / week in 1114-year - old students seem to have a significant effect on body fat% reduction and effective results in terms of anaerobic physical fitness . therefore , it is suggested that different training model approach such as trampoline exercises can help students to promote the level of health and motor performance .", "", "" ]

[ "optical buffers are recognized as essential components in wavelength routers , in which the packets of data can be stored for resolving packet contention problems and also delay the outgoing packets.1,2 in practice , the optical router patents have been proposed and recorded,35 which can be useful for various applications . recently , the promising techniques of microscopic volume trapping and transportation within the add / drop multiplexer have been reported in both theory6 and experiment,7 respectively , in which the transporter is known as an optical tweezer . here , the optical tweezer generation technique has become a powerful tool for the manipulation of micrometer - sized particles . to date moreover , the use of dynamic tweezers is now also understood in practical works.810 schulz et al11 have shown that the transfer of trapped atoms between two optical potentials can be performed . in principle , optical tweezers use forces exerted by intensity gradients in the strongly focused beams of light to trap and move the microscopic volumes of matters , in which the other combination of force is induced by the interaction between photons , which is caused by photon scattering effects . in application , the field intensity can be adjusted and tuned , in which the desired gradient field and scattering force can form the suitable trapping force . hence , the appropriate force can be configured for the transmitter / receiver , which can perform the long distance microscopic transportation . in this paper , dynamic optical tweezers / vortices are generated using a dark soliton , bright soliton , and gaussian pulse propagating within an add / drop optical multiplexer incorporating two nanoring resonators ( panda ring resonator ) . the dynamic behaviors of solitons and gaussian pulses are well described by tasakorn et al.12 by using the proposed system , the transceiver can be integrated and performed by using a single device . here , the use of the transceiver to form the transportation of microscopic volumes of matter , especially13 for molecule transportation in liquid core waveguide,14,15 drug delivery , and dna transportation , in which the buffer is needed before reaching the required destination .", "in operation , the trapping forces are exerted by the intensity gradients in the strongly focused beams of light to trap and move the microscopic volumes of matters , in which the optical forces are customarily defined by the relationship:16 \n ( 1)f = qnmpc here q is a dimensionless efficiency , nm is the refractive index of the suspending medium , c is the speed of light , and p is the incident laser power , measured at the specimen . q represents the fraction of power utilized to exert force . for plane wave incidences on a perfectly absorbing particle because biological specimens are usually contained in aqueous media , the dependence of f on nm can rarely be exploited to achieve higher trapping forces . increasing the laser power is possible , but only over a limited range due to the possibility of optical damage . it depends upon the numerical aperture ( na ) , laser wavelength , light polarization state , laser mode structure , relative index of refraction , and the geometry of the particle . furthermore , in the rayleigh regime , trapping forces decompose naturally into two components . since , in this limit , the electromagnetic field is uniform across the dielectric , particles can be treated as induced point dipoles . the scattering force is given by:16 \n ( 2)fscatt = nmsc , \n ( 3)=83(kr)4r2(m21m2 + 2)2 here is the scattering cross section of a rayleigh sphere with radius r. s is the time averaged poynting vector , n is the index of refraction of the particle , m = n / nm is the relative index , and k = 2nm/ is the wave number of the light . the scattering force is proportional to the energy flux and points along the direction of the propagation of the incident light . the gradient field ( fgrad ) is the lorentz force acting on the dipole induced by the light field . it is given by:16 \n ( 4)fgrad=2e2,where \n ( 5)=nm2r3(m21m2 + 2)is the polarizability of the particle . the gradient force is proportional and parallel to the gradient in energy density ( for m > 1 ) . the stable trapping requires that the gradient force is in the direction , which is against the direction of incident light ( dark soliton valley ) . it is greater than the scattering force . by increasing the na , when the focal spot size is decreased , the gradient strength is increased,16,17 which happens within a tiny system , for instance , a nanoscale device such as the nanoring resonator . in our proposal , the trapping force is formed by using a dark soliton , in which the valley of the dark soliton is generated and controlled within the panda ring resonator by the control port signals . in this paper , we used the same theory of optical trapping and ring resonator , in which the simulation results and applications are differed from the previous work.18 from figure 1 , the output field ( et1 ) at the through port is given by:19 \n ( 6)et1=aei1bei2el2jknl2 [cet1(el2jknl2)2+dei2(el2jknl2)31f(e2ljknl2)2]where \n a \n ( 11)(12),b \n ( 11)(12)1(12)e0l , c \n 1(11)(12)2e0e0l , d \n ( 11)(12)1(11)2(12)e0e0l2 , andf \n ( 11)(12)(11)(12)e0e0l . \n ( 11)(12)1(12)e0l , \n 1(11)(12)2e0e0l , \n ( 11)(12)1(11)2(12)e0e0l2 , and \n ( 11)(12)(11)(12)e0e0l . here , et and ed represent the optical fields of the through port and drop ports , respectively . = kneff is the propagation constant , neff is the effective refractive index of the waveguide , and the circumference of the ring is l = 2r , where r is the radius of the ring . 1 and 2 are the coupling coefficients of the add / drop filters , kn = 2/ is the wave propagation number for in a vacuum , and the waveguide ( ring resonator ) loss is = 0.5 dbmm . the fractional coupler intensity loss is = 0.1 . in the case of the add / drop device , the nonlinear refractive index does not affect the system , therefore , it is neglected . the electric fields e0 and e0l are the field circulated within the nanoring at the right and left side of add / drop optical filter . the power output ( pt1 ) at through port is written as : \n ( 7)pt1=|et1|2 . the output field ( et2)at drop port is expressed as:19 \n ( 8)et2=(12)(12)ei2 [(11)(12)12e0ei1el2jknl2+xe0e0lle2i(el2jknl2)21ye0e0l(e2ljknl2)2],where \n x \n ( 12)(11)(11)2(12),y = \n ( 11)(12)(11)(12 ) \n ( 12)(11)(11)2(12 ) , \n ( 11)(12)(11)(12 ) the power output ( pt2 ) at drop port is : \n ( 9)pt2=|et2|2 . in operation , the optical tweezers can be trapped , transported , and stored within the panda ring resonator and wavelength router , which can be used to form the microscopic volume ( molecule ) transportation and drug delivery via the waveguide,18 in which the manipulation of trapped microscopic volumes within the optical tweezers has been reported .", "molecular buffers are devices that can be used to store or delay atoms / molecules for a period of time ( see figure 2 ) , where light intensity and velocity can also be controlled , which was described by rosenberry et al20 and lignie and woerdman,21 available for medical application . molecular buffers are a new device , which are operated in the same way as gas buffers.22 the polarizability of the particle is calculated by using equation ( 5 ) , in this case , we assume that the sphere particle is polystyrene ( n = 1.5894 ) and the liquid medium is water ( n = 1.33 ) , and the optical power which is required to trap particles of a certain size / polarizibility is 9.1w , which is the slope as shown in figure 3a . in simulation , the bright soliton with center wavelength at 1.50 m , peak power 2w , pulse 35fs is input into the system via the input port , and the coupling coefficients are given as 0 = 0.5 , 1 = 0.35 , 2 = 0.1 , and 3 = 0.35 , respectively . the ring radii are radd = 10 and 30 m , rr = 50 and 100 nm , and rl = 50 and 100 nm , respectively . to date , the evidence of a practical device with a radius of 30 nm has been reported by piyatamrong et al.19 aeff are 0.50 , 0.25 , and 0.25 m . in this case , the dynamic tweezers ( gradient fields ) can be in the form of bright solitons , gaussian pulses , and dark solitons , which can be used to trap the required microscopic volume . there are four different center wavelengths of tweezers generated ; the dynamical movements are seen in figure 4 , where ( a ) |e1| , ( b ) |e2| , ( c ) |e3| , ( d ) |e4| , ( e ) through port , and ( f ) drop port signals , where in this case all microscopic volumes are received by the drop port . in practice , the fabrication parameters which can be easily controlled are the ring resonator radii instead of the coupling constants . the important aspect of the result is that the tunable tweezers can be obtained by tuning ( controlling ) the add ( control ) port input signal , in which the required amount of microscopic volume ( atom / photon / molecule ) can be obtained and seen at the drop / through ports , otherwise they propagate within a panda ring before collapsing / decaying into the waveguide . more results of the optical tweezers generated within the panda ring are shown in figure 5 , where in this case , the bright soliton is used as the control port signal to obtain the tunable results . the output optical tweezers of the through and drop ports with different coupling constants are as shown in figure 5a , while the different wavelength results are as shown in figure 5b , which can be performed by the selected targets . in application , the trapped microscopic volumes ( molecules ) can move into the wavelength router via the through port , while the retrieved microscopic volumes are received via the drop port ( connecting target ) . the advantage of the proposed system is that the transmitter and receiver can be fabricated on - chip and alternatively operated by a single device . the magnitude of the optical trapping force is the pico newton , which depends upon the relative refractive index of particle , which was given by kumar et al.23 the particle radius was given by hu et al,24 fischer and srensen,25 and nieminen et al,26 which is located in the cavity .", "we have proposed a new system that can be used to trap ( delay ) and transport molecules into an optical waveguide by using optical tweezers , which can be used for drug storage and as a delivery system . by utilizing the reasonable dark soliton input power , the dynamic tweezers can be controlled and stored ( delayed ) within the system before reaching the final destination . tweezer amplification is also available by using the nanoring resonators , in which the signals can be modulated via the control port as shown in figures 4b and 5a . in conclusion , we have shown that the use of a transceiver for long distance microscopic volume by using the proposed system , in which the drug delivery or molecular communication can be performed via the wavelength router to the required ( connecting ) targets . however , the problems of large microscopic volume and neutral matter may cause a problem , in which the pursuit of new guide pipes and media,27 for instance , nano tubes and specific gases , will be the issue of investigation ." ]

[ "assessment of effects of different assisted reproductive techniques ( art ) like in vitro fertilization ( ivf ) and intra cytoplasmic sperm injection ( icsi ) on speech and language development needs comprehensive studies . some studies showed that they are more susceptible to cerebral palsy which causes speech and language defects . development of speech and language consists of four periods : prelinguistic , linguistic , school and adolescence period . defects in prelinguistic behavior , i.e. physical defect like cleft palate , neurological defect like cerebral palsy or developmental defect like down syndrome produce speech defects . in two studies in belgium and finland in infants of art there was no difference between development of these children with infants of normal conception[5 , 6 ] . in another study no differences in mental , motor , social and expressive language development were found , and while receptive language development was in the normal range , ivf infants scored lower than control infants . one study did not report any excess of neurodevelopmental disorders in ivf / icsi children . the majority of studies followed the children during infancy , thereby precluding pertinent conclusion on the risk of neurodevelopmental disorders which express at older ages such as fine manipulation disability or dyslexia . one study shows that a large proportions of preterm deliveries in ivf children have increased risk of cerebral palsy . regarding the importance of this subject and the lack of a comprehensive study on the prelinguistic behavior of infants of art in iran , this study was designed . the aim of this study is to evaluate prelinguistic behavior of 9 month old art infants of royan institute .", "in this descriptive , cross sectional study , 151 term infants of art from royan institute have been evaluated in children 's health and development research center of tehran from august 2007 until august 2009 . the research ethics committee of the academic center of education , culture and research ( acecr ) and royan institute approved the study . the sampling method was non random sequential with the inclusion criteria of infants conceived through one of the art methods ( ivf / icsi ) , born in term and being resident in tehran . preterm born infants were excluded . after signing of research consents by parents , prelinguistic behavior of 151 infants who were born full term ( > 37 weeks ) are assessed . this scale is used for assessment of development of speech and language in children from birth to 3 years old . it has sensitivity of 90 - 95% for primary detection of speech , language and cognition defects . the method of art , sex of infants , age of mother at pregnancy , time and speech and language defect of parents at present and past time also were mentioned in questionnaire . the prelinguistic behavior of infants include : crying at birth , different cries , smiling , cooing , babbling , reduplicated babbling and echolalia , which are assessed in this study .", "one - hundred one term infants of art were evaluated . in this study , 76 ( 50.5% ) were male and 75 ( 49.5% ) female . there was 129 ( 85.4% ) of infants conceived by icsi and 22 ( 14.5% ) by ivf . prelinguistic behavior delay which had been assessed according to elm-2 is shown in table 1 . number of infants with delay in reduplicated babbling in icsi method was more than un ivf . \n prevalence of prelinguistic behavior delay in assisted reproductive techniques methods ivf : invitro fertilization ; icsi : intra cytoplasmic sperm injection the prelinguistic behavior delays in different sex and mothers age is shown in table 2 . there was a significant difference only in echolalia delay in the two sexes . prevalence of prelinguistic behavior delay in different sexes and mothers age mothers of 118 infants were younger than 35 years and 33 ones were older .", "two studies showed that art infants had normal cognition development [ 11 , 12 ] . zhu jl in showed that infertility treatment , especially icsi , may be associated with a slightly delayed cognitive language development . another study showed that there was no difference between cognitive development of infants of art and normal infants . in this study infants showed delay in reduplicated babbling and echolalia . in a study by sutcliffe children were assessed with the griffiths mental development scales . icsi children were around the midpoint for the griffiths scales and did not differ significantly for griffiths quotients and suhquotients . one study reported significantly lower mental scores in 1 year old infants born after icsi than in age matched infants born after ivf and naturally conceived infants . stratification for gender revealed that lower mental development index scores were only found in boys , not in girls . in our study delay of reduplicated babbling and echolalia were more in boys . there is no study about effect of mother 's age on speech and language development in infants . bonduelle and his collegues in their study , by selection of infants of mothers with the same age exclude affect of this variable . in our study delay of reduplicated there was no relation between speech and language defect of parents and prelinguistic behavior of infants . limited sample size , difficult access to this group of infants and unwillingness of parents to complete the questionnaires render less reliable results .", "this study was a new study in our country which shows differences between art infants in some prelinguistic behavior such as reduplicated babbling and echolalia . this study showed that prelinguistic behavior of art infants are affected by art method , infants sex and mother 's age at the time of pregnancy . detection and correction of any defect or delay in this period prevent major speech and language problems . more studies with larger sample size to compare art infants with infants of normal conception would be desirable .", "" ]

[ "a number of drugs are currently available to treat malaria ; however , treatment is becoming complicated by drug resistance , toxicity , and high cost . recently , drug resistance against the new effective drug , artemisinin , is also emerging [ 4 , 5 ] , and we need new effective drugs to treat malaria . therefore , the development of other classes of effective antimalarials , especially compounds that act against novel biochemical targets , is required . to develop such compounds , it is very important to characterize the structural and biochemical features of new drug targets . among potential new targets for antimalarial chemotherapy proteases are druggable targets , and at present protease inhibitors are now licensed as well as in clinical development to treat different diseases for example osteoporosis , diabetes , cancer , hypertension , and infectious diseases [ 69 ] . recent advances , including the sequencing of plasmodium genomes ( http://www.plasmodb.org/ ) and development of new tools for manipulating plasmodium genes , have improved our understanding of the cysteine proteases of parasites . therefore , given the importance of the cysteine proteases , this paper will focus on structural - functional relationship of falcipains , major cysteine proteases of p. falciparum . in cases of malaria , the parasite relies on human hemoglobin hydrolysis to supply amino acids for protein synthesis and to maintain osmotic stability [ 11 , 12 ] . cysteine proteases are involved in hemoglobin hydrolysis and have been validated as promising drug targets [ 13 , 14 ] . in a recent report , ch'ng et al . , using cysteine protease inhibitors , demonstrate that clan ca cysteine proteases of p. falciparum are also involved in chloroquine - mediated programmed cell death . the best characterized plasmodium cysteine proteases are the falcipains , papain family ( clan ca ) enzymes ( figure 1 ) . among the four p. falciparum cysteine proteases , falcipain-2 and falcipain-3 appear to be the principal food vacuolar hemoglobinases [ 1618 ] . when the falcipain-2 gene is disrupted , undegraded hemoglobin accumulates in the food vacuole , confirming that this enzyme participates in haemoglobin hydrolysis . however , disruption of falcipain-3 could not be achieved , but the gene was readily replaced with a tagged functional copy , indicating that falcipain-3 is essential for erythrocytic parasites . falcipain-2 and falcipain-3 share 67% sequence identity and contribute more or less equally to the digestion of hemoglobin in the food vacuole . comparing with other papain family proteases , specifically , this paper will survey available information on structure and function of different domains of falcipain-2 and falcipain-3 and their interaction with inhibitors .", "falcipains are major cysteine protease , named due to the function of a catalytic cysteine , which mediates protein hydrolysis via nucleophilic attack on the carbonyl carbon of a susceptible peptide bond . falcipains have two main domains , the prodomain and the mature domain . the prodomain is further divided into different small domains . at the n - terminus of the prodomain , the first 35 amino acids are cytosolic , followed by a 20 amino acid transmembrane domain and a 188 amino acid lumenal domain . the inhibitory domain is present in the c - terminal part of the prodomain ( figure 2 ) . cysteine proteases of the parasite hydrolyze hemoglobin in the acidic food vacuole [ 20 , 21 ] . recently , it has been demonstrated that prodomain has unique motifs which are responsible for targeting the falcipains . using transfection technology and constructing different chimeras with portions of the n - terminal part of prodomain fused to green fluorescent protein , it has been shown that the prodomains of falcipain-2 and falcipain-3 were sufficient to target green fluorescent protein to the food vacuole . once enzymes are in the er , using the signal from transmembrane domain , the proteins appear to traffic to the plasma membrane . at the plasma membrane falcipain-2 and falcipain-3 appear to be endocytosed in a process requiring the presence of both cytoplasmic and luminal prodomain trafficking motifs , followed by vesicular transport to the food vacuole . in summary , serial truncation and deletion studies showed that both a 20-amino acid stretch of the lumenal portion and a 10-amino acid stretch of the cytoplasmic portion of the enzymes were essential for food vacuolar trafficking ( figure 3 ) . like many other proteases , falcipains are synthesized as a zymogen , and the prodomain inhibits the activity of the mature enzyme . to investigate how the prodomain regulates the activity of falcipain-2 , pandey et al . expressed constructs encoding different portions of the prodomain and tested their ability to inhibit recombinant mature falcipain-2 . it has been found that a c - terminal segment ( leu asp ) of the prodomain , including two motifs ( erfnin and gnfd ) that are also conserved in cathepsin l subfamily proteases , mediates prodomain inhibitory activity . earlier work with other cathepsin l subfamily proteases suggests key roles for conserved hydrophobic amino acids ( phenylalanine and tryptophan ) as well as the erfnin and gnfd motifs in maintaining prodomain structure . later , pandey et al . explored the roles of conserved motifs in maintaining prodomain structure by circular dichroism analysis . secondary structure was seen in a fragment with potent inhibitory activity ( leu asp ) , but not in two larger constructs that lacked any sequence downstream of the erfnin and gnfd motifs or in a peptide spanning the erfnin and gnfd motifs . these results indicate that , together with erfnin and gnfd motifs , an upstream region including two conserved phe * residues is required for proper folding or maintenance of secondary structure of the prodomain ( figure 2 ) . the 3d structures of the mature domain of falcipain-2 and falcipain-3 have been solved [ 25 , 26 ] , and the profalcipain-2 model suggests that conserved residues provide stability to the inhibitory domain ( figure 4(a ) ) . modeling , based on the solved structure of procathepsin b and procathepsin l [ 27 , 28 ] , shows that the charged pair arg and glu of the prodomain appear to form a salt bridge ( figure 4(b ) ) . further , glu from the gnfd motif may form a separate salt bridge with lys in the mature domain . phe may participate in nonpolar interactions and possibly pi stacking interactions , with two tryptophan residues in the mature domain , trp and trp . the model also suggests that the prodomain of falcipain-2 binds the mature domain in a manner similar to that of procathepsin k and l , inhibiting catalytic activity by blocking substrate access to the active site ( figure 4(a ) ) . they encode short n - terminal extensions of the mature domain , which is unique among described papain family proteases [ 13 , 14 ] . looking at the family of c1a cysteine protease sequences on the merops database ( http://merops.sanger.ac.uk/ ) have identified more than 40 members with an n - terminus extension of 12 amino acids at this location . notably , 18 of these sequences were those of falcipains and homologues from other plasmodial species to better characterize the determinants of folding for falcipain-2 , pandey and sijwali et al . expressed multiple prodomain and mature constructs of the enzyme in e. coli and assessed their abilities to refold by checking their activity [ 23 , 29 ] this folding study showed that refolding of the mature domain could be achieved when the mature domain was covalently joined with the n - terminus extension ( figure 5 ) . only 12 amino acids of the n - terminus extension ( refolding domain ) are necessary for refolding . deletion of 12 amino acids from n - terminus segment of the mature domain yielded a construct incapable of correct folding , but inclusion of this segment in trans allowed folding to active falcipain-2 . correct folding also occurred when the catalytic domain was refolded with a separate prodomain - folding domain construct but not with an isolated folding domain peptide [ 23 , 29 ] ( figure 5 ) . these results indicated that the prodomain mediates the interaction between the mature and folding domain when they were not covalently bound . however , it was not clear from these studies , whether the amino - terminal extension is required only for folding or whether it also plays an essential role in mediating enzyme activity . to determine whether the folding domain was required for activity , pandey et al after refolding and purification of the mature domain by anion exchange chromatography , the purified refolded mature domain still showed activity . together , these results suggest that the refolding domain is only required for refolding , and once refolding is accomplished , the refolding domain is not required for activity . the n - terminus extensions of different falcipain subfamily enzymes have limited ( 2045% ) sequence identity but are functionally conserved . chimeras of the falcipain-2 catalytic domain with the refolding domain of six other plasmodial proteases folded normally and had similar kinetic parameters to those of recombinant falcipain-2 . these results showed that refolding domain can be swapped between the plasmodial proteases that harbor the same function . the above - mentioned experiment also indicates that all plasmodial cysteine proteases including falcipain-3 also use n - terminus extension as a refolding domain . structural analysis further reveals that the folding domain , in fact , has a short but significant element of secondary structure . glutamate of the mature domain forms a buried hydrogen bond with tyrosine and a salt bridge with arginine of the refolding domain . this suggests that the small folding domain , though shorter than the standard papain family prodomain , still plays a very important role in folding by stabilizing the mature domain by a hydrogen bond and a salt bridge . this is analogous to a similar interaction in falcipain-2 , where tryosine of the refolding domain of falcipain-3 provides hydrogen bonding anchor to glutamate of the mature domain of falcipain-3 . these results indicate that the folding domains of falcipain-2 and falcipain-3 stabilize the mature domain in a similar fashion . falcipain-2 and 3 efficiently hydrolyze human hemoglobin in the acidic food vacuole of parasite [ 17 , 18 ] . it has recently been suggested that hemoglobin hydrolysis is not a highly ordered process but rather proceeds with rapid cleavage by falcipains at multiple sites . falcipain subfamily proteases contain an unusual motif near the c - terminus , which is present between the highly conserved active site histidine and asparagine residues ( figure 2 ) . a motif of identical size ( 14 aa ) is found in all studied proteases of this subfamily of falcipain , although sequence identity is modest . in case of falcipain-2 and falcipain-3 , motifs smaller motifs are present in the sequences encoding p. falciparum serine repeat antigens ( 10 aa ) and dipeptidyl peptidase i ( 8 aa ) , and larger ( 20 aa ) motifs are present in two other putative p. falciparum dipeptidyl peptidase genes [ 14 , 33 ] . to evaluate the function of the unusual c - terminal motif in falcipains , a mutant enzyme was made by deleting that motif lacking 10 amino acids from falcipain-2 , and the biochemical properties of wild and mutant enzymes were compared . native page , biacore , and gel filtration studies indicated that the motif mediates specific interactions with hemoglobin . in fact , falcipain-2 has relatively higher affinity for methemoglobin ( kd is 0.8 m ) than hemoglobin ( kda is 3.3 m ) . it had been demonstrated that several factors contribute to the formation of methemoglobin during malarial infection , including acidic ph of plasmodial food vacuole , oxidative damage in rbc [ 35 , 36 ] , which causes an increase in methemoglobin content to up to 2042% in the plasmodial food vacuole . thus , the higher affinity of falcipain-2 for methemoglobin looks like an adaptation to the specific conditions in the infected rbc . the enzyme without this motif showed negligible activity against hemoglobin or globin . further , a peptide encoding the motif blocked hemoglobin hydrolysis but not the hydrolysis of casein , indicating that the motif specifically interacts with hemoglobin . thus , this study suggests that the motif mediates the most biologically relevant activity of falcipain , the hydrolysis of hemoglobin during trophozoite stage . falcipains may also have other functions in erythrocytic malaria parasites , and it would be interesting to explore the role of the motif in hydrolysis of other proteins of potential biological relevance . in the case of other members of the falcipain subfamily , it is likely that the encoded motifs share the same functions as the falcipain motif , because a number of members of this subfamily have been also shown to be hemoglobinases . the sequence conservation among the motifs of falcipain subfamily proteases is not high , but , as in the case of the n - terminal extension that mediates protein folding , the presence of these unusual motifs in all related proteases probably indicates a conserved function . for genes encoding more distantly related enzymes , including falcipain-1 , dipeptidyl peptidases , and serine repeat antigens , c - terminal motifs vary greatly in sequence and size , and specific functions of predicted motifs are undefined . data indicates that falcipain-2 captures hemoglobin via its c - terminal motif before subsequently cleaving the substrate at multiple sites . further , the structure of falcipain indicates a protruding configuration for the motif , surrounded by a predominant negative charge , and it may be that charged residues are crucial for interaction with hemoglobin . it is proposed that hemoglobin , which has many charged surface residues , first binds at the motif through charge - charge interaction and brings hemoglobin closer to the active site before hydrolysis . the function of the motif in mediating catalysis despite its separation from the active site somewhat resembles that of the hemopexin domain of matrix metalloproteases . the hemopexin domain is required for both the efficient cleavage of collagen and the formation of complexes with both inhibitors and proteases to mediate biological activities . thus , as is the case for the falcipain-2 motif , the hemopexin domain serves to facilitate biologically relevant protein - substrate and protein - inhibitor interactions . however , the hemopexin domain is approximately 20 times larger than the falcipain motif and , unlike the motif , is separated from the catalytic domain by a hinge region . therefore , it appears that falcipains and matrix metalloproteases use similar means of biological control , but the specific mechanisms by which the proteases mediate interactions with substrates and inhibitors are different . another papain family protease , cathepsin k , forms a pentameric complex with chondroitin sulfate to facilitate hydrolysis of collagen . having analogy to falcipain-2-hemoglobin interaction , structural requirements for complex formation between cathepsin k and chondroitin sulfate it is interesting to raise a question , why do falcipains contain a unique motif that mediates the hydrolysis of hemoglobin ? this mechanism might not have evolved simply to facilitate hemoglobin hydrolysis , because other papain family enzymes without c - terminus motifs still can hydrolyze hemoglobin . it looks like that the utilization of a specific motif at this region to mediate enzyme - substrate interaction is an unusual but conserved feature of plasmodial cysteine proteases . it may be possible that an evolutionary bottleneck occurred in ancestral plasmodial cysteine proteases , and those enzymes might not be that efficient in hemoglobin hydrolysis . in addition , plasmodial cysteine proteases might have evolved with introduction of specific motif for efficient hemoglobin hydrolysis . the interaction of a major hemoglobinase , falcipain-2 , with most biologically relevant substrate , hemoglobin , could be an interesting starting point for the development of an effective drug . the structure of falcipain-2 hemoglobin binding domain will guide the design of inhibitors that should interfere with hemoglobin binding .", "there are two major classes of cysteine protease inhibitor , small inhibitors like leupeptin , vinyl sulfones , e64 , and another class known as macromolecular inhibitor . these endogenous cysteine protease inhibitors have been described in a number of eukaryotic systems . here , we will discuss three major cysteine protease inhibitors , cystatin , chagasin , and falstatin . excluding the two unique motifs discussed earlier , the rest of the falcipains are structurally similar to homologous proteases in the papain family . cystatin was used as a falcipain inhibitor with the expectation that protein - protein interaction over large surfaces would enhance crystal quality and thus facilitate structural determination . cystatins inhibit a wide range of papain family cysteine proteases with high affinity making them ideal candidates for cocrystallization with falcipain . falcipain and chicken egg white cystatin formed 1 : 1 complex ( figure 6(a ) ) . the inhibitory constants ( ki ) of cystatin for falcipain-2 and falcipain-3 are 6.5 nm and 100 nm , respectively . it is interesting that cystatin is a more potent inhibitor of falcipain-2 than falcipain-3 , which suggests that cystatin regulates both the falcipains with different rates . the falcipain - cystatin complex shares many features with two known cysteine protease - cystatin structures : cathepsin h - stefin a and papain - stefin b ( the stefins are a subclass within the cystatin superfamily [ 41 , 42 ] ) . these cystatins bind to target proteases in similar orientations , resulting in extensive interactions with the target proteases ( figure 6(b ) ) . cystatin largely interacts with falcipain-2 at prime sites where substrate - binding pockets are relatively shallow and less defined , but falcipains also have binding specificity at nonprimed sites . although , the binding preference is not as pronounced as that found at the s2 pocket ( figure 6(b ) ) . cystatin is only able to access the solvent exposed periphery of the nonprime site of falcipain-2 and majority of its binding occurs at the prime end of the active site . unlike most other cathepsin l - like cysteine proteases , crystal structures indicate that this preference may be due to ile in falcipains , because it creates a small protrusion in the otherwise flat base of the s2 pocket , which restricts aromatic side - chain binding ( figure 6(b ) ) . the falcipain cystatin complex can be exploited to design potent inhibitors of the malaria parasite . a recent study indicates that a peptide based on cystatin binding residues blocked the activity of falcipain-2 and led to accumulation of undegraded hemoglobin in the food vacuole . chagasin is a cysteine protease inhibitor that was first identified in trypanosoma cruzi as the physiological regulator of cruzain , the major cysteine protease [ 45 , 46 ] . cruzain is also a papain - like ( clan ca ) cysteine protease that is expressed in all stages of t. cruzi life cycle . it is a key virulence factor of t. cruzi , the infectious agent responsible for the leading cause of heart disease in latin america , called the chagas disease . chagasin is associated with cruzain during its trafficking to specific compartments of the parasite cell , and accumulated evidence suggests that the primary role of chagasin is in posttranslational regulation of protease activity . 1 binding with falcipain-2 ( figure 7 ) . the protease - binding loops ( bc , de , and fg ) in chagasin form a well - aligned wedge that fills the active site groove of falcipain-2 to obstruct substrate binding ( figure 7 ) . the bc loop is one of the three signature motifs that contribute to the inhibition of the cysteine protease . this is confirmed by a synthetic peptide corresponding to the bc loop of the chagasin like protein from e. histolytica , which specifically blocked the activity of cysteine proteases . it is noteworthy that thr 31 in the bc loop of chagasin binds to the catalytic cys at the falcipain-2 active site by water - mediated hydrogen bonds ( figure 7 ) . it is likely that the highly conserved thr serves as a key functional residue among chagasin - like inhibitors . another interesting feature of the falcipain-2-chagasin interaction is the highly mobile de loop like in e64 , a strong irreversible inhibitor of cysteine protease , which occupies the nonprime site . in summary , the bc loop , mobile de loop , and the rpw / f motif in the fg loop are the key elements for binding with falcipain-2 . disturbance of the equilibrium between cysteine proteases and natural inhibitors is a key event in the pathogenesis of cancer , rheumatoid arthritis , osteoporosis , and emphysema . in case of malaria , falciparum parasites express falstatin , a potent inhibitor of falcipains and many other cysteine proteases . the stage - specificity of falstatin expression and the effects of anti - falstatin antibodies on parasite development suggest that this inhibitor facilitates a process that also requires proteolytic activity , the invasion of erythrocytes by p. falciparum merozoites . falstatin is a competitive and reversible inhibitor of falcipains , as demonstrated by increasing calculated km values but similar vmax values with increasing concentrations of falstatin . to evaluate the mechanism of inhibition of cysteine proteases by falstatin , pandey et al . tested the ability of active site - inhibited falcipain-2 to compete with active falcipain-2 for binding with falstatin . in contrast to results with the prodomain , the inhibitory effect of falstatin was not affected by the presence of active site inhibited falcipain-2 . thus , the binding of falstatin to falcipain-2 appears to be via interaction with the enzyme active site . leupeptin , e-64 , and vinyl sulfones are major cysteine protease inhibitors that bind to the active site [ 26 , 48 ] . the active sites of both enzymes are located in a cleft between the structurally distinct domain of the papain - like fold . the structures of falcipain-2 and falcipain-3 have been determined in complex with these small inhibitors . e-64 , and leupeptin interact with residues in the s1 , s2 , and s3 subsites of falcipain-2 and falcipain-3 , corresponding to the p1 , and p2 , and p3 position of the inhibitors ( figure 8) . the conserved catalytic residues of falcipain-2 and falcipain-3 ( gln , cys , his , asn , resp . ) inhibitors display binding modes with their partner enzymes similar to those found in other papain family enzymes . the inhibitors bind to the main chain of falcipain-2 and falcipain-3 by glycine ( gly in falcipain-2 and gly in falcipain-3 ) residue that is highly conserved in the s3 subsite of clan ca cysteine proteases ( figure 9 ) . in cocrystallization , these residues form hydrogen bonds with the o and n atoms of the inhibitor backbone . in the case of the falcipain-2 complex with e-64 , enzyme active sites gln , ser , cys , asn , and his are involved in the formation of additional hydrogen bonds with e-64 . in the falcipain-3-leupeptin complex , gln , cys , and asn also act as hydrogen bonding partners to the inhibitor . the enzyme - inhibitor complex stabilize by a series of possible hydrophobic interaction using nonpolar region of gly , tyr , gly , leu , ser , leu , asn , and ala in falcipain-2 , and tyro , gly , tyr , ile , and ser in case of falcipain-3 . the active site cysteine of falcipain-2 forms a covalent , irreversible hemithioketal with the e-64 epoxy carbon ( figure 9 ) . the active site cysteine of falcipain-3 forms a covalent , reversible hemithioacetal with the asymmetric carbonyl carbon of leupeptin ( figure 10 ) . the interaction pattern of e-64 and leupeptin with all papain family enzymes is conserved . the carboxyl group of e-64 and carbonyl group of leupeptin occupy the oxyanion hole formed by the conserved catalytic residues . falcipain-2 and falcipain-3 have a clear preference for substrates / inhibitors that contains a leucine at p2 position , and both leupeptin and e64 contain a leu at p2 . surprisingly , falcipain-3 has been shown to be much less efficient at hydrolyzing peptide substrates and more difficult to inhibit with small peptidyl - based inhibitors compared with falcipain-2 [ 16 , 51 ] . the structure that forms the active site is highly conserved between falcipain-2 and falcipain-3 , and there is no notable movement in the peptide backbone or loop region . however , superimposition of falcipain-2 and falcipain-3 structures highlights two important substitutions in the s2 subsite . this position of the s2 subsite is known to be a key determiner of the specificity ( figures 9 and 10 ) . in comparison to asp in falcipain-2 , the additional side chain carbon in glu of falcipain-3 , this increased the size as well as flexibility at this position . in case of falcipain-3leupeptin complex , the larger and more flexible residue ( glu ) at the bottom of s2 subsite and bulkier residue ( try ) create a narrow wall of the s2 subsite , as compared to the falcipain e-64 complex ( figure 10 ) . the overall structures of falcipain-3leupeptin and falcipain-2e-64 complexes show a similar mode of binding and inhibition compared with macromolecule inhibitors like chagasin and cystatin . like e64 and leupeptin , vinyl sulphones ( mu - leu - hph - vsph ) have been shown to be effective inhibitors of a number of papain - family - like cysteine proteases . mu - leu - hph - vsph is a potent irreversible inhibitor of falcipain-2 and falcipain-3 . the cocrystallization of falcipain-3 with mu - leu - hph - vsph indicates that inhibitor binds the respective s1 and s3 subsites to form an irreversible , covalent bond with the sulfur of the active site cysteine thiol in enzyme ( figure 11 ) . given the hydrophobic nature of the p1 and p2 substituents in mu - leu - hph - vsph , the active site of falcipain-3 is lined with a number of residues that are able to make nonpolar contacts with their respective inhibitor ( figure 11 ) . as seen in the crystal structures of falcipain-3 with the above inhibitor , the residue at the bottom of the s2 subsite ( glu ) points out of the pocket to avoid a potentially unfavorable interaction with the bulky phe residue at the p2 position of inhibitor . cysteine proteases of the malaria parasite may be targeted for inhibition by vinyl sulphones . indeed , vinyl sulphones - based cysteine protease inhibitors are already being used in preclinical trials for the chagas disease .", "the understanding of the cysteine proteases of malaria parasites has increased markedly in recent years . since cysteine proteases that play an important role in the parasite life cycle by degrading erythrocyte proteins , most notably hemoglobin , are attractive targets for antimalarial chemotherapy . falcipain-2 and falcipain-3 are the best characterized cysteine proteases of malaria parasite , the structure and function of different domains and their interaction with small and macromolecular inhibitors are studied . the structure - function study of falcipains and interaction with inhibitors will provide detail insights to develop rational design of inhibitor against falcipains . structure - guided approaches should have great role in the design of potent and highly selective inhibitor . efforts to optimize current inhibitors based on the structure - function of falcipains are currently underway ." ]

[ "alzheimer 's disease ( ad ) is the most common cause of dementia in the aging population . this disease develops over time and leads to significant cognitive deficits affecting memory , insight , judgment , abstraction , and language functions . ad affects more than 5 million people in the united states and this number is projected to rise to 35 million by 2050 [ 2 , 3 ] . this estimate underscores both the scope of this health care issue for the society as a whole and the need for the development of therapeutic options for these patients . the diagnosis of this neurodegenerative disease relies on the presence of senile plaques and neurofibrillary tangles in affected brain areas at autopsy . these ad hallmark lesions are the results of the pathological deposition of proteins normally present throughout the brain . senile plaques are composed of extracellular deposits of beta - amyloid ( a ) derived by proteolytic cleavage from the amyloid precursor protein ( app ) [ 410 ] . neurofibrillary tangles , on the other hand , are intracellular bundles of self - assembled tau proteins [ 1138 ] . the formation of both senile plaques and neurofibrillary tangles is associated with progressive and irreversible degeneration of neuronal processes and the loss of synaptic connections [ 3950 ] . initially , multiple studies focused on defining the characteristics of ad and on the analysis of the composition of senile plaques and neurofibrillary tangles . more recently , data have been obtained on the molecular mechanisms that link the formation of these lesions and underlie neurodegeneration and cell death in ad and related disorders . calpains are ca - dependent proteases in which activity is dysregulated in ad and other neurodegenerative diseases [ 5154 ] . a growing body of evidence suggests that the abnormal activation of calpains might modulate not only the formation of senile plaques and neurofibrillary tangles but also the development of synaptic pathology in ad . these data reviewed below position calpains at the crossroads of the mechanisms involved in the formation of the main pathological alterations associated with ad . furthermore , these findings underscore the importance of calpains as potential targets to block the activation of the signaling cascades leading to degeneration in ad . in turn , this information could be applied to the design of therapeutic options and prevention strategies for this devastating disease . in this review , we first summarized data on the properties of calpains and the mechanisms underlying their activation . then , we reviewed findings on the dysregulation of calpain in the context of ad and its deleterious consequences for the morphology and function of affected brain areas .", " calpains constitute a family of ca - dependent cysteine proteases involved in multiple and very diverse cell functions including cell development , proliferation , and differentiation , cell motility , growth cone motility and guidance , apoptosis , learning , and memory , among others [ 51 , 52 ] . originally , two members of this family were identified : calpain 1 ( -calpain ) and calpain 2 ( m - calpain ) , also known as conventional or classical calpains . more recently , the other 14 members of the calpain family have been identified in mammals [ 51 , 55 ] . in contrast to classical calpains that are ubiquitously distributed , the expression of some of these unconventional or nonclassical calpains is tissue specific . for example , calpain 3a and calpain 8 are mainly present in skeletal and smooth muscle cells , respectively . calpain 11 , on the other hand , is highly expressed in testes , while calpain 13 is concentrated in the lung and skin . others , like calpains 5 , 7 , 9 , and 10 have more widespread distributions . none of these new members of the calpain family are highly expressed in the central nervous system ( cns ) . both calpain 1 and calpain 2 are heterodimers composed of a large catalytic subunit ( ~80 kda ) and a small regulatory subunit ( ~30 kda ) . based on this sequence , the catalytic subunit has been divided into four distinct domains ( reviewed in ) . domain 1 corresponds to the n - terminal region of this subunit and undergoes autolysis upon ca binding . domain 2 contains a catalytic unit formed by cys , his , and asn residues . domain 4 has partial homology with calmodulin and contains several ef - hand calcium - binding motifs . the regulatory subunit can be divided into two domains , a calmodulin - like domain and a glycine - rich domain . while both proteases are present in neurons and glial cells , their relative abundance differs . calpain 1 is more abundant in neurons , and calpain 2 is prominent in glial cells . analysis of the subcellular localization of these enzymes demonstrated that calpain 1 is concentrated in the cell bodies and is also detected in the processes extended by central neurons , although at lower levels . calpain 1 immunoreactivity has been also detected in postsynaptic densities as well as in dendritic spines . astrocytic processes are also enriched in calpain 2 [ 62 , 63 ] . calpains cleave proteins generating large fragments . initially , it was thought that these proteases ' cleavage sites have a leu or a val residue in the p2 position . more recently , it has been shown that the cleavage site specificity is determined by conformation rather than amino acid sequence [ 6568 ] . the specificities of the substrates for both calpains are very similar but not identical . in vitro studies calpain substrates include cytoskeletal proteins ( cadherin , catenin , desmin , dystrophin , gelsolin , filamin , fodrin , microtubule - associated proteins map 1 and map 2 , neurofilament proteins , spectrin , tau , talin , troponin , tubulin , vimentin , and vinculin ) , signal transduction proteins ( calcium / calmodulin - dependent protein kinase , epidermal growth factor ( egf ) kinase , pp60 , protein kinase c , calcineurin , and caspases 3 , 7 , 8 , 9 , 12 , and 14 ) , synaptic proteins ( dynamin 1 , postsynaptic density ( psd ) 95 , n - methyl - d - aspartic acid ( nmda ) glutamate receptors , and metabotropic glutamate receptor glur1 ) , and transcription factors ( p53 ) , among others [ 51 , 53 ] . calpain activation is tightly regulated to prevent massive proteolytic activity in the cell . the binding of ca to either calpain results in conformational changes that initiate their proteolytic activity . while calpain 1 is activated in the presence of micromolar concentrations of ca , calpain 2 requires millimolar concentrations . the ca requirement for either calpain is significantly higher than the concentration of this ion in living cells . this fact has prompted a series of studies on potential mechanisms that could lead to a decrease in the ca requirement for the activation of these proteases in living cells . in vitro studies have shown that the interaction of calpains with a series of activator molecules lowers the concentration of ca required to initiate the activation of these proteases . among them , phospholipids ( i.e. , phosphatidylinositol ) are the most studied . however , the phospholipid to calpain molar ratio required for lowering the ca requirement for either calpain activation is not likely to be achieved in the cellular context [ 6971 ] . nevertheless , it can not be ruled out that higher concentrations of ca are achieved in limited cellular areas where ca is not easily detectable by available methods . in turn , these local micromolar or millimolar ca concentrations could trigger calpain activation in distinct subcellular domains . in addition to ca , calpastatin has a key role in the regulation of calpain . calpastatin , a heat - stable protein ranging from ~70 to ~140 kda of apparent molecular weight depending on the cell type , is considered a specific endogenous inhibitor of calpains . immunocytochemical analysis showed calpastatin immunoreactivity throughout the dendritic tree in pyramidal neurons and purkinje cells . therefore , the ratio calpain / calpastatin plays a key role in the regulation of calpain activity [ 7880 ] . the inhibitory effect of calpastatin requires ca - dependent high - affinity binding to three sites of calpain . the kinases responsible for the phosphorylation of some of these sites have already been identified . thus , two of those sites seem to be phosphorylated by protein kinase c ( pkc ) , two by protein kinase a ( pka ) , two by calmodulin kinase ii , one site by casein kinase i , and another by protein kinase g . although the role of the phosphorylation of each site in calpain activation has not been completely elucidated , data suggest that phosphorylation mediated by mitogen - activated kinases ( erk / map kinases ) activates these proteases . on the other hand , phosphorylation by pka may decrease their activity [ 82 , 83 ] .", "as briefly reviewed above , calpain activation is a tightly regulated process to prevent deleterious consequences of massive proteolytic activity . these regulatory mechanisms seem to decline with aging resulting in an increased calpain activity [ 8487 ] . thus , several studies have reported significantly increased activation of calpains in ad brains [ 8894 ] . the hyperactivation of calpain in the context of ad is the result of several factors including enhanced intracellular ca concentration and decreased calpastatin levels . experiments performed using an ad culture model system showed that oligomeric a induced a significant ( 5-fold ) and instantaneous rise in ca in hippocampal neurons [ 9597 ] . these studies also addressed the source of the ca influx leading to calpain activation in the context of ad taking advantage of specific blockers of ca release from the endoplasmic reticulum , the major source of intracellular ca , and bapta , a chelator of extracellular ca . the data obtained showed that a induces calpain activation by enhancing extracellular ca influx [ 9597 ] . the mechanisms underlying the regulation of the enhanced ca influx and calpain activation in ad have also been studied . both nmda receptors and voltage - gated calcium channels ( vgcc ) have been implicated in such regulation in central neurons [ 99101 ] . specific nmda receptor inhibitors , mk801 , and the fda approved nmda receptor antagonist memantine significantly attenuated the initial a-induced increase of ca and blocked a-induced calpain activation in cultured hippocampal neurons [ 9597 ] . in contrast , nimodipine , an l - type vsccs blocker , did not decrease the a-induced activation of calpain [ 9597 ] . these data suggest that nmda receptors play an important role in mediating the sustained ca influx and enhanced calpain activity induced by aggregated a. furthermore , these studies suggested that factors that affect nmda receptor - mediated ca influx could modulate calpain activation and its deleterious effects in central neurons . recently , it has been shown that cholesterol regulates calpain activity in the context of ad . a population - based study demonstrated that not only high cholesterol levels but also moderately elevated cholesterol levels in midlife represent a significant risk factor for ad [ 106 , 107 ] . interestingly , cholesterol has been implicated in the susceptibility of cells to ca influx [ 108111 ] . thus , elevated membrane cholesterol actually increased the susceptibility of cells to a-induced elevation in ca influx leading to cell death via a calpain - dependent mechanism [ 111 , 112 ] . by regulating the nmda receptor content and changing their localization in membrane microdomains at the synaptic sites , cholesterol modulates the ability of a to induce ca influx , leading to calpain activation in hippocampal neurons [ 111 , 112 ] . calpastatin also seems to play an important role in the regulation of calpain activation in ad . thus , it has been shown that calpastatin is markedly depleted in the cortex of ad brains at late stages of the disease as compared to age - matched controls . focal areas of calpastatin depletion have been also detected along dystrophic neurites at early stages of ad . on the other hand , no changes in calpastatin levels were detected in neurons less susceptible to neurodegeneration in ad like purkinje cells . this decrease in calpastatin levels is the result of the proteolytic activity of caspases and calpain . in turn , the decrease in the ratio calpastatin to calpain causes calpain hyperactivation perpetuating this cellular deleterious effect [ 79 , 113115 ] .", "these findings have been complemented with immunocytochemical studies on the distribution of calpain in ad . these studies have shown intense calpain immunoreactivity in dystrophic neurites associated with neurofibrillary tangles , neuritic plaques , and neuropil threads in the hippocampal region and entorhinal cortex of subjects suffering from ad and other tauopathies [ 116118 ] . based on this information , it was hypothesized that the enhanced calpain activity observed in ad brains plays an important role in the formation of senile plaques , neurofibrillary tangles , and synaptic dysfunction in the context of ad ( figure 1 ) . these peptides are the result of the sequential proteolytic cleavage of app by two proteases . first , -secretase ( -site app - cleaving enzyme ( bace 1 ) ) cuts app at the n - terminus of the a domain leaving a 99-amino - acid - long c - terminal fragment . then , the -secretase complex ( presenilin 1 , presenilin 2 , nicastrin , aph1 , and pen2 ) cuts the c - terminus to generate a peptides of 38 to 43 amino acids in length [ 5 , 119121 ] . of these peptides , therefore , increased levels of bace 1 could lead to enhanced production of a , its aggregation , and consequently the activation of signaling pathways associated with the neurodegenerative process . thus , a 2-fold increase in bace1 levels has been detected in ad brains [ 127129 ] . recently , it has been shown that the calpain / calpastatin system can modulate the pathological deposition of a. calpain activation increases the levels of bace1 in a transgenic mouse model of ad . in addition , the bidirectional regulation of the activation of the calpain / calpastatin system and a metabolism has been established . using transgenic mice overexpressing app , these authors showed that calpastatin deficiency enhanced calpain activation , a production , and increased mortality . in turn , the increased levels of a lead to enhanced ca influx and increased calpain activation . senile plaques are often surrounded by dystrophic neurons that contain tau aggregates known as neurofibrillary tangles . many studies have focused on the composition and the mechanisms underlying the formation of tau aggregates . those studies have identified two types of tau filaments in the neurofibrillary tangles : straight and paired helical filaments . tau hyperphosphorylation has been attributed to the increased activity of several kinases , including cyclin - dependent kinase 5 ( cdk5 ) , glycogen synthase kinase ( gsk ) , and the mitogen - activated protein kinase ( mapk ) in hippocampal neurons [ 138 , 143145 ] . thus , it has been shown that calpain cleaves the inhibitory domain of gsk3 generating two fragments of 40 and 30 kda . the latter has a longer half life than p35 and therefore it is a more potent activator of cdk5 . experiments using calpeptin , a cell permeable calpain inhibitor , blocked both erk 1 and erk 2 activation . conditions that blocked the activation of these kinases induced a decreased in tau phosphorylation and resulted in enhanced neuronal survival in the presence of a . besides tau phosphorylation , calpain activation might play a role in tau - mediated neurodegeneration by inducing tau cleavage . in vitro studies have shown that both fetal and adult tau isoforms are rapidly proteolyzed by calpains [ 151153 ] . on the other hand , tau present in paired - helical filaments is considerably more resistant to proteolysis by these proteases [ 153156 ] . these findings suggest that phosphorylation might regulate the susceptibility of tau to calpain - mediated cleavage . tau obtained from cultured neurons incubated in the presence of this phosphatase inhibitor was more resistant to calpain cleavage than tau extracted from nontreated control neurons . nevertheless , the effect of phosphorylation on calpain - mediated tau cleavage seems to be complex . this effect might depend on the site phosphorylated and/or the extent of phosphorylation under pathological conditions since highly phosphorylated fetal isoforms are readily cleaved by calpain . calpain - mediated tau cleavage seems to play an important role under neurodegenerative conditions [ 157164 ] . it has been shown that calpain activation results in the generation of several n - terminal tau fragments . one of such tau fragments , of ~20 kda of apparent molecular weight , has been detected in mitochondria present in synaptosomal fractions obtained from ad brains . the levels of this tau fragment are partially reduced when cultured neurons are treated with a calpain inhibitor . it has been shown that tau fragments containing the 2644 tau amino acids affect mitochondria oxidative phosphorylation acting at the level of the adenine nucleotides translocator contributing to synapse dysfunction . a smaller tau fragment generated by calpain cleavage has been detected in mature hippocampal neurons treated with aggregated a oligomers [ 160 , 161 ] . a-induced tau cleavage mediated by calpain 1 leads to the generation of a neurotoxic 17 kda tau fragment ( tau 45230 ) in cultured hippocampal neurons [ 160 , 161 ] . this fragment has also been detected in the neocortex of ad brains as well as in brain areas affected by other tauopathies . furthermore , when expressed in neuronal and nonneuronal cell types or in an in vivo drosophila model system , the 17 kda tau fragment produced cell death in the absence of a oligomers [ 160 , 161 , 163 ] . these data provided strong evidence for an important role of calpain 1 and the generation of the 17 kda tau fragment in the progression of a-mediated neurodegeneration . it is worth noting that calpain 2 activation cleaves tau generating a smaller tau fragment that lacks neurotoxic effects in central neurons . in addition to the presence of senile plaques and neurofibrillary tangles , ad brains are characterized by a decrease in synaptic contacts . this synaptic loss seems to be the best morphological correlate of the functional deficits observed in the mid to late stages of ad [ 39 , 40 ] . although no significant decline in synapse number has been detected in the earliest stages of the disease , a stage of synaptic dysfunction seems to precede frank synapse loss [ 41 , 46 , 165 ] . by cleaving proteins in the presynaptic terminals and/or the postsynaptic elements changes in proteins involved in synaptic vesicle biogenesis and/or recycling at synaptic terminals are responsible , at least in part , for the synaptic dysfunction detected in ad . recently , data obtained using culture and animal models of ad showed that a induced a significant reduction in dynamin 1 levels that preceded synapse loss . dynamin 1 pinches off synaptic vesicles , freeing them from the membrane and allowing them to reenter the synaptic vesicle pool to be refilled for future release [ 167 , 168 ] . decreased levels of this protein lead to the depletion of synaptic vesicles and the accumulations of invaginated pits at presynaptic membranes adjacent to the synaptic clefts [ 9597 , 169 , 170 ] . the a-induced decrease in dynamin 1 is a result , at least partially , of calpain - mediated proteolysis [ 9597 , 171 ] . thus , it has been shown that calpain activation results in the breakdown of several proteins leading to changes in the ultrastructure of the postsynaptic density ( psd ) . these changes in the psd are accompanied by the rapid cleavage of psd-95 and the nmda receptor subunits nr1 and nr2a and 2b [ 172175 ] . calpain has been shown to truncate also mglur1 exacerbating nmda - mediated neurotoxicity [ 176178 ] . an additional mechanism by which calpain activation can result in synaptic dysfunction involved the cleavage of pka leading to a decrease in both the regulatory and the catalytic subunits of this kinase . the decrease in pka activity attenuates creb activation impairing memory [ 179 , 180 ] .", "taken together , the data reviewed above strongly suggest that calpains play an important role in the neurodegeneration mechanisms underlying ad in the aging population . based on these data , it has been tempting to speculate that calpain inhibition could be a useful tool to prevent neurodegeneration in this disease . to obtain further insights into the beneficial effects of blocking calpain activation , several studies have been conducted using experimental approaches to either suppress the expression of these proteases or prevent their abnormal activation . early studies using gene deletion of the calpain regulatory subunit by homologous recombinant techniques showed that the depletion of these proteases is embryonic lethal . the data obtained showed that indeed the suppression of calpain 1 expression by means of these specific probes prevented oxidative stress - induced cell injury in human hepatic cancer cell lines . other studies have assessed the effects of calpain inhibitors on cell death in culture model systems of ad . leupeptin and e64 calpain inhibitors had protective effects in those cultures [ 160 , 183186 ] . the idea that calpain could be a potential therapeutic target in neurodegenerative diseases has been reinforced by studies performed in vitro and in culture using the calpain inhibitor mdl 28170 . those studies suggested a protective effect of calpain inhibitors against excitotoxicity [ 178 , 187 , 188 ] . unfortunately , the potential use of known calpain inhibitors as therapeutic tools in ad is limited due to their low cellular penetration , poor selectivity , and kinetics . recently , this benzoylalanine - derived ketoamide is capable of inhibiting calpain in nanomolar concentrations and has improved oral bioavailability , water solubility , and metabolic stability . this calpain inhibitor is highly effective in preventing calpain - mediated cleavage of dynamin 1 and tau in cultured hippocampal neurons . this inhibitor is effective not only when added prior to the a treatment but also when added simultaneously with a and even when added after a has triggered the neurodegeneration process . the calpain inhibitor a-705253 also prevents a oligomer - induced neurodegeneration of the nucleus basalis magnocellularis . these experiments raised the possibility that more potent calpain inhibitors could have beneficial effects even at late stages of ad . moreover , initial studies using calpain inhibitors in mouse and rat models of ad showed an encouraging recovery of cognitive function in these animals when they were treated with calpain inhibitors at an early age [ 186 , 190 ] . together , these data underscore the potential importance of calpain inhibitors as promising therapeutic tools in ad and related neurodegenerative diseases . in summary , the data briefly reviewed above provide strong support for the role of calpains in ad . they also highlight the tantalizing possibility that these proteases could serve as targets for the development of therapeutic interventions for this disease , one of the main challenges for decades to come in ad research ." ]

[ "for many years , the global community has observed the calamitous effects of the human immunodeficiency virus ( hiv ) on the human population . hiv was historically viewed as an incurable disease that gradually progressed into acquired immune deficiency syndrome ( aids ) and led to one s untimely death . during his tenure ( 20012008 ) , united states president george w. bush recognized the devastating impact of hiv as a global health crisis that required immediate action . through bipartisan efforts between president bush and the 108 us congress , the passage of hr 1298 ( public law 10825 ) led to the creation of the president s emergency plan for aids relief , commonly referred to as pepfar . the objective of pepfar was to provide $ 15 billion in aid , targeting 12 focus countries in sub - saharan africa : botswana , cote divoire , ethiopia , kenya , mozambique , namibia , nigeria , rwanda , south africa , tanzania , uganda , and zambia . in an empirical research that was conducted on the impact of international humanitarian assistance on combating hiv / aids , azuine et al . discovered that the increase of donor assistance in developing countries led to an overall reduction of hiv infection rates . pepfar has illustrated the pertinence of an interconnected world and the urgency to embrace those connections during stages of global stress . according to the united nations , the united states has contributed more funding to the fight against hiv / aids than any other country . the research presented here provides a better understanding of how well pepfar advanced that fight and whether the allocation of a large amount of dollars for pepfar was crucial in saving lives and decreasing hiv infection rates in sub - saharan africa . the general policy research question for this research was to determine whether the pepfar funding allocated to the 12 resource - scarce countries in sub - saharan africa had any relevant effect in reducing the hiv infection rates of males and females between the ages of 15 and 49 . an analysis to determine whether the pepfar policy was effective and efficient may influence future global humanitarian assistance provided to other countries by the united states . researchers agree that the continent of africa is the focal point of the hiv pandemic and that hiv / aids is a detrimental problem for the global community . even though other countries such as guyana , haiti , and vietnam were also recipients of pepfar funding , the majority of the crisis , population affected , and funding allocated for pepfar was concentrated in the above - mentioned 12 african countries . the specific focus addressed herein is whether the pepfar funding allocation was effective in meeting its intended purpose of reducing hiv infection rates in the 12 african countries that received funding . to this day , africa prevails as the most hiv / aids affected continent in the world , in particular the sub - saharan areas . africans account for approximately two thirds of hiv infections and three quarters of deaths associated with hiv from around the world . the joint united nations programme on hiv / aids ( unaids ) , united nations children s fund ( unicef ) , and world health organization ( who ) determined that approximately 75% of people in sub - saharan africa between the ages of 15 and 49 are unaware of their hiv status . together , hiv and aids have devastating effects on society and the economy . together , hiv and aids create reproductive concerns , reduced revenues , increased healthcare expenses , decreased school enrollment , increased rates of absence at work , disruptions in the family environment , decreased human capital , increases in poverty rates , a lower gross domestic product ( gdp ) , and more orphaned children.[9 - 14 ] due to high levels of poverty , many developing countries in sub - saharan africa do not have the necessary resources or funding to combat the hiv / aids pandemic occurring in their nations . the methods that were used to treat and prevent further growth in cases of hiv / aids were education , counseling , hiv testing , antiretroviral medication , and building health care infrastructure . the treatment category of funding from pepfar focused on the amount of monetary support given to an african country for hiv treatment , the purchase of antiretroviral ( arv ) drugs , and the building of health infrastructure . one of the most essential components of the pepfar program was the increased access to generic arv medication and therapy . the purpose of the arv medication is to reduce the plasma level of hiv viral load.[19 , 20 ] the reduced viral load resulting from arv therapy not only improves the health of the infected individual , but also lowers the risk of passing the disease on to someone else . the availability of arv was critical in prolonging the lives of hiv infected individuals and reducing transmission rates . the prevention category of pepfar focused on the foundational strategy of preventing the proliferation of hiv . this foundation was known as the abc approach : ( a ) abstain , ( b ) be faithful , and ( c ) use condoms . there was strong emphasis on the abstinence from sex before marriage and be faithful aspects , which sometimes generated controversy because of the religious component in the program . safe - sex education was also a pertinent program in the fight against hiv / aids . the care category of pepfar focused on counseling , testing people for hiv / aids , taking care of orphan children , and palliative care for individuals with hiv / aids . since the majority of people in sub - saharan africa are unaware of their hiv status , this negligence could well lead to the rapid spread of the disease through sexual intercourse . the final category of pepfar efforts focused on training in health management , increasing health care staffing levels , and strengthening the healthcare management system . health management and effective management systems are important because one of the common theories is that the spread of hiv / aids in africa is worsened by high corruption rates and lack of accountability among government officials . the rampant level of government corruption may prevent government officials from being effective leaders in addressing the hiv / aids pandemic .", "to this day , africa prevails as the most hiv / aids affected continent in the world , in particular the sub - saharan areas . africans account for approximately two thirds of hiv infections and three quarters of deaths associated with hiv from around the world . the joint united nations programme on hiv / aids ( unaids ) , united nations children s fund ( unicef ) , and world health organization ( who ) determined that approximately 75% of people in sub - saharan africa between the ages of 15 and 49 are unaware of their hiv status . together , hiv and aids create reproductive concerns , reduced revenues , increased healthcare expenses , decreased school enrollment , increased rates of absence at work , disruptions in the family environment , decreased human capital , increases in poverty rates , a lower gross domestic product ( gdp ) , and more orphaned children.[9 - 14 ] due to high levels of poverty , many developing countries in sub - saharan africa do not have the necessary resources or funding to combat the hiv / aids pandemic occurring in their nations . the methods that were used to treat and prevent further growth in cases of hiv / aids were education , counseling , hiv testing , antiretroviral medication , and building health care infrastructure . the treatment category of funding from pepfar focused on the amount of monetary support given to an african country for hiv treatment , the purchase of antiretroviral ( arv ) drugs , and the building of health infrastructure . one of the most essential components of the pepfar program was the increased access to generic arv medication and therapy . the purpose of the arv medication is to reduce the plasma level of hiv viral load.[19 , 20 ] the reduced viral load resulting from arv therapy not only improves the health of the infected individual , but also lowers the risk of passing the disease on to someone else . the availability of arv was critical in prolonging the lives of hiv infected individuals and reducing transmission rates . the prevention category of pepfar focused on the foundational strategy of preventing the proliferation of hiv . this foundation was known as the abc approach : ( a ) abstain , ( b ) be faithful , and ( c ) use condoms . there was strong emphasis on the abstinence from sex before marriage and be faithful aspects , which sometimes generated controversy because of the religious component in the program . safe - sex education was also a pertinent program in the fight against hiv / aids . the care category of pepfar focused on counseling , testing people for hiv / aids , taking care of orphan children , and palliative care for individuals with hiv / aids . since the majority of people in sub - saharan africa are unaware of their hiv status , this negligence could well lead to the rapid spread of the disease through sexual intercourse . the final category of pepfar efforts focused on training in health management , increasing health care staffing levels , and strengthening the healthcare management system . health management and effective management systems are important because one of the common theories is that the spread of hiv / aids in africa is worsened by high corruption rates and lack of accountability among government officials . the rampant level of government corruption may prevent government officials from being effective leaders in addressing the hiv / aids pandemic .", "based on theoretical evidence , this study expected that the 12 focus countries in africa that received pepfar funding would see a decrease in the hiv infection rates . even though arv medications are able to prolong the lives of hiv infected individuals , the hiv infection rates that are calculated by the world bank take into consideration individuals who are taking the arv medication . the software used for the collection of hiv infection rates reduced the infectivity rates among people receiving arv treatments . table 1 lists the 12 countries in africa that received pepfar funding and table 2 provides the amount of pepfar funding that was received from 2004 through 2008 in millions of us dollars . table 3 shows the hiv infection rates of males and females between the ages of 15 and 49 in the 12 countries in africa that received pepfar funding from 2004 through 2008 . pepfar focus countries in sub - saharan africa source : united states president s emergency plan for aids relief countries that received pepfar funding ( millions of us dollars ) , 20042008 source : united states president s emergency plan for aids relief hiv infection rates ( % ) of males and females ages 1549 , 20042008 source : united states president s emergency plan for aids relief the following theoretical models were applied to this research : hivrateit= 1 + 2%pepfar per gdpit+ it hivrateit= 1 + 2%pepfar per gdpit + 3%health per gdpit + 4corruptionit + 5gdppcit+ it the dependent variable was hiv infection rates in africa . the control independent variables were healthcare expenditure per gdp , corruption rate of a country , and gdp per capita . where : \n 1 is the intercept of the models and it is the stochastic error term of the models.hivrateit was the hiv infection rates of males and females between the ages of 15 and 49 measured in percentage ( world bank).%health per gdpit was the percent of total public and private healthcare expenditures per gdp in us dollars ( world bank).gdppcit was the gdp per capita of each country in us dollars ( world bank).%pepfar per gdpit was the percent of pepfar funding received per gdp in us dollars ( pepfar).corruptionit was the score of perceptions on the level of corruption in the public sector , based on the corruption perceptions index , where 0=very corrupt and 10=not corrupt ( transparency international ) . \n 1 is the intercept of the models and it is the stochastic error term of the models . hivrateit was the hiv infection rates of males and females between the ages of 15 and 49 measured in percentage ( world bank ) . % health per gdpit was the percent of total public and private healthcare expenditures per gdp in us dollars ( world bank ) . gdppcit was the gdp per capita of each country in us dollars ( world bank ) . % pepfar per gdpit was the percent of pepfar funding received per gdp in us dollars ( pepfar ) . corruptionit was the score of perceptions on the level of corruption in the public sector , based on the corruption perceptions index , where 0=very corrupt and 10=not corrupt ( transparency international ) . this study used panel data from 2002 through 2010 covering the 12 countries that received pepfar funding in the continent of africa . even though pepfar was active from 2004 through 2008 , this research includes two years before ( 2002 and 2003 ) and two years after ( 2009 and 2010 ) in order to increase the ability to estimate the actual effect of receiving pepfar funding . in order to analyze the correlation between pepfar funding and hiv infection rates in africa , this research used stata software version 13 and conducted a fixed - effects panel regression analysis . the fixed - effects technique was chosen based on results from the hausman and sargan - hansen tests , which were performed through stata . there was the possibilities of both heteroskedasticity and autocorrelation in this study because this analysis included a combination of cross - sectional and time - series data . the use of panel data for this research required statistical tests to determine if the regression model did indeed encounter a problem with heteroskedasticity and autocorrelation . as expected , the results of the tests indicated the presence of these problems in the regression model . in order to correct for the heteroskedasticity and autocorrelation problems , this research used the robust standard errors for panel regression with cross - sectional dependence model .", "", "hivrateit= 1 + 2%pepfar per gdpit + 3%health per gdpit + 4corruptionit + 5gdppcit+ it the dependent variable was hiv infection rates in africa . the control independent variables were healthcare expenditure per gdp , corruption rate of a country , and gdp per capita . where : \n 1 is the intercept of the models and it is the stochastic error term of the models.hivrateit was the hiv infection rates of males and females between the ages of 15 and 49 measured in percentage ( world bank).%health per gdpit was the percent of total public and private healthcare expenditures per gdp in us dollars ( world bank).gdppcit was the gdp per capita of each country in us dollars ( world bank).%pepfar per gdpit was the percent of pepfar funding received per gdp in us dollars ( pepfar).corruptionit was the score of perceptions on the level of corruption in the public sector , based on the corruption perceptions index , where 0=very corrupt and 10=not corrupt ( transparency international ) . \n 1 is the intercept of the models and it is the stochastic error term of the models . hivrateit was the hiv infection rates of males and females between the ages of 15 and 49 measured in percentage ( world bank ) . % health per gdpit was the percent of total public and private healthcare expenditures per gdp in us dollars ( world bank ) . gdppcit was the gdp per capita of each country in us dollars ( world bank ) . % pepfar per gdpit was the percent of pepfar funding received per gdp in us dollars ( pepfar ) . corruptionit was the score of perceptions on the level of corruption in the public sector , based on the corruption perceptions index , where 0=very corrupt and 10=not corrupt ( transparency international ) . this study used panel data from 2002 through 2010 covering the 12 countries that received pepfar funding in the continent of africa . even though pepfar was active from 2004 through 2008 , this research includes two years before ( 2002 and 2003 ) and two years after ( 2009 and 2010 ) in order to increase the ability to estimate the actual effect of receiving pepfar funding . in order to analyze the correlation between pepfar funding and hiv infection rates in africa , this research used stata software version 13 and conducted a fixed - effects panel regression analysis . the fixed - effects technique was chosen based on results from the hausman and sargan - hansen tests , which were performed through stata . there was the possibilities of both heteroskedasticity and autocorrelation in this study because this analysis included a combination of cross - sectional and time - series data . the use of panel data for this research required statistical tests to determine if the regression model did indeed encounter a problem with heteroskedasticity and autocorrelation . as expected , the results of the tests indicated the presence of these problems in the regression model . in order to correct for the heteroskedasticity and autocorrelation problems , this research used the robust standard errors for panel regression with cross - sectional dependence model .", "although several components have likely contributed to the declining hiv rates in the pepfar focus countries , the main objective of this research was to determine whether pepfar was an effective factor in lowering the hiv / aids infection rates , and , if so , by how much . table 4 provides the results from the fixed - effects panel regression analysis for models 1 and 2 . in model 1 , pepfar funding per gdp was statistically significant at the 0.01 level . in model 2 , pepfar funding per gdp and gdp per capita were statistically significant at the 0.01 level . even though this research found correlation between hiv infection rates and pepfar funding , as the adage goes , correlation does not imply causation . thus , the results must be considered in light of this caveat , as is the case with all empirical analyses . in model 1 , the results illustrate that on average , ceteris paribus , for every 1 percentage point increase in pepfar funding per gdp a country received , the country s hiv infection rate decreased by 0.41 percentage points . the within r value for this model was 0.1684 , indicating that 16.84% of the variability in the dependent variable was explained by the independent variables . in model 2 , the results illustrated that on average , ceteris paribus , for every 1 percentage point increase in pepfar funding per gdp a country received , the country s hiv infection rate decreased by 0.355 percentage points . for every $ 1,000 increase in gdp per capita a country received , the hiv infection rate decreased by 0.37 percentage points . for every 1 percentage point increase in healthcare expenditure per gdp , the hiv infection rate decreased by 0.10 percentage points . the within r value for this model was 0.3733 , indicating that 37.33% of the variability in the dependent variable was explained by the independent variables . figure 1 provides graphs depicting a comparison between the amounts of pepfar funding received by the 12 countries in sub - saharan africa and the hiv rates from 2002 through 2010 . even though pepfar funding had steadily increased for each of the countries , most of the hiv infection rates decreased slightly , but remained relatively steady overall . comparison of hiv infection rates and pepfar funding the united states provided large monetary support toward the pepfar program . even though the results indicated that pepfar was statistically significant , the evaluation of whether pepfar was politically and economically significant remains subjective . some may argue that any decrease in hiv infection rates highlights the relevance of the continued efforts of pepfar , while others could argue that the large amount of money invested in pepfar should have generated larger decreases in the hiv infection rates in africa than the rates found in this study . based on this research , the overall hiv rate decreased , but the large amount of money invested to combat hiv infections did not drastically lower the hiv infection rates . the success of combating hiv / aids involves the collaboration of many public and humanitarian organizations . future research should include analysis on the impact of public sector agencies , universities , faith - based organizations , private contractors , and non - governmental organizations in this philanthropic mission . the center for global development released data that provided specific dollar amounts on how much pepfar funding was allocated to the different organizations from 2004 through 2006 in the categories of treatment , prevention , care , and other . although the data is sparse , analyzing the data supplied by the center for global development would provide a better indication of the role and impact each sector had in the pepfar program .", "a clear understanding of the global impact with the struggle against hiv / aids and the role that pepfar has played in that struggle is appropriate for future public policies , legislation , and programs . to the degree that it succeeded , the objectives and intentions of pepfar were met through an embrace of global connections and cooperation in order to reduce the increasing spread of hiv / aids in sub - saharan africa . the global community is becoming more interconnected and societies are becoming mutually dependent on one another to combat health crises . the increase of social , economic , and political globalization broadens the realization that hiv / aids does not recognize race , gender , ethnicity , sexual orientation , or geographic borders . pepfar had some impact on the hiv pandemic in the 12 focus countries in sub - saharan africa through increasing humanitarian funding , providing access to cost - effective arv medication , developing improved healthcare infrastructures , and implementing a number of prevention programs . even though hiv / aids can not be cured as of yet , there is intrinsic value in preventing the rapid spread of this malady . although the programs and allocated funding of pepfar accomplished most of the stated objectives , there remains even more that needs to be accomplished , for hiv / aids continues to persist as a global pandemic presenting significant challenges . despite a few limitations , this study was able to analyze and illustrate the relative effectiveness of pepfar funding in lowering the hiv infection rates on the continent of africa , and has hopefully provided valuable insight for future policy considerations . \n the objectives and intentions of pepfar were met through an embrace of global connections and cooperation in order to reduce the increasing spread of hiv / aids in sub - saharan africa.on average , ceteris paribus , for every 1 percentage point increase in pepfar funding per gdp a country received , the country s hiv infection rate decreased by 0.36 percentage points.for every $ 1,000 increase in gdp per capita a country received , the hiv infection rate decreased by 0.37 percentage points.for every 1 percentage point increase in healthcare expenditure per gdp , the hiv infection rate decreased by 0.10 percentage points . \n the objectives and intentions of pepfar were met through an embrace of global connections and cooperation in order to reduce the increasing spread of hiv / aids in sub - saharan africa . on average , ceteris paribus , for every 1 percentage point increase in pepfar funding per gdp a country received , for every $ 1,000 increase in gdp per capita a country received , the hiv infection rate decreased by 0.37 percentage points . for every 1 percentage point increase in healthcare expenditure per gdp , the hiv infection rate decreased by 0.10 percentage points ." ]

[ "descriptive investigation of a cluster of 5 sfts cases following exposure to an index patient who died from the disease was performed . a 77-year - old male farmer who died from sfts five other cases in the cluster included a 32-year - old male intensive care unit ( icu ) physician ( case 1 ) , a 48-year - old male icu consultation physician ( case 2 ) , a 42-year - old younger son of the index patient ( case 3 ) , and a 45-year - old older son of the index patient ( case 4 ) , as well as a 43-year - old male mortuary beautician ( case 5 ) . the investigation included a review of circumstances and medical records , specimen collection , virus isolation , real - time polymerase chain reaction for viral rna detection , and sequencing and serological tests ( capture enzyme - linked immunosorbent assay [ elisa ] for immunoglobin [ ig ] m antibody , antigen sandwich elisa for igg antibody , and microneutralization tests [ mnt ] ) . as for risk assessment of transmission factors , all contactors of the index patient during the period from the beginning ( 25 september 2010 ) to the end ( 8 october 2010 ) were classified through 3 types of contacts , including blood , droplet , and possible airborne contacts . the investigation was reviewed and approved by the ethics committee of china center for disease control and prevention ( cdc ) , which uses international guidelines to ensure confidentiality , anonymity , and informed consent .", "the index patient was from an sfts - endemic region and first had onset of illness on 25 september 2010 ; was admitted to a local hospital on 28 september with a high fever of 39.5c and vomiting ; and the infection was identified through initial laboratory testing of thrombocytopenia , leukocytopenia , and elevated aspartate aminotransferase level . the patient was diagnosed as a suspected sfts case , and transferred to the intensive care unit the next day , where he received ribavirin , dexamethasone , omeprazole , and cryoprecipitation for therapy . on 2 october 2010 , his condition deteriorated with hypersomnia , shortness of breath , and mouth mucosal bleeding . on 3 october , he appeared confused and showed dyspnea , then was intubated and mechanical ventilated . on 4 october , the patient was in shock and comatose , developed disseminated intravascular coagulation and multiple organ dysfunction syndrome , and died the next day . an important observation was that the index patient had unique hemorrhagic symptoms , including bleeding from mouth mucosa , gastrointestinal lumen , and lungs , which was rare in previously identified sfts patients . the patient s fever remained high ( 39c40c ) until death , although lowered somewhat by giving dexamethasone . clinical laboratory values ( table 1 ) showed unusually high level of tissue enzymes , blood urea nitrogen , and creatinine , which might indicate impaired liver , heart , and kidney functions . consistent with the largely reduced platelet count , the index patient had a significantly elongated activated partial thromboplastin time , which represented a largely impaired coagulation function . immediately after death , the corpse was transferred to the patient s home in a local village for a funeral ceremony , then transferred to a crematorium 3 days later . laboratory analysis of a cluster of severe fever with thrombocytopenia syndrome patients in china alt , alanine aminotransferase ; ast , aspartate aminotransferase ; ldh , lactate dehydrogenase ; aptt , activated partial thromboplastin time . , negative ; + , weak positive ; + + + , strong positive . viral rna copies were calculated according to standard reaction curves , which were established using serially diluted in vitro rna transcripts as standard samples . virus load was determined based on an average conversion coefficient between virus copies and virus titer presented as 50% tissue culture infective dose ( tcid50/ml ) . serum samples collected in the acute phase were subjected to immunoglobin ( ig ) m detection with igm antibody capture enzyme - linked immunosorbent assay ( elisa ) , with horseradish peroxidase conjugated recombinant severe fever with thrombocytopenia syndrome bunyavirus ( sftsv ) nucleoprotein as the detection agent . serum samples collected in the convalescent phase were subjected to igg detection with sandwich elisa by using recombinant sftsv nucleoprotein as the detection agent . values for igm antibodies , igg antibodies , and mnt are the reciprocals of the serum dilution . risk factors were assessed using logistic regression analysis ; p < .05 was considered to be statistically different . epidemiologic investigations began with interviews with 5 secondary sfts patients and 58 other individuals who had exposure to the index patient from onset of the illness until cremation . we found that all 5 secondary cases had possible blood contact through skin or mucosa . case 1 , the local icu doctor , performed the intubation for the index patient , resuscitating the patient before his death . case 2 , the consultant doctor , traveled from a nonendemic area to the local hospital for a medical consult with the patient , and the patient s blood dropped on his hand when he was helping an icu nurse draw blood without wearing gloves . case 3 , the younger son of the index patient , was a long - distance truck driver not living in the same village , and directly touched the blood flowing from the deceased patient s mouth and nose when he cried on the corpse . case 4 , the older son of the index patient , was also a long - distance truck driver , and took care of the dead body and was wiping off the blood from the face of the corpse . case 5 , a local mortuary beautician , did the make - up for the corpse with gloves and mask , but took them off twice during the procedure . the above 5 cases all developed the disease 715 days after exposure , with only 3 of them having contact with blood after death . in comparison with the index patient , all 5 secondary cases had minor clinical features ( table 1 ) , without obvious hemorrhagic manifestations , so they did not receive dexamethasone therapy . except for the major risk factor of blood contact , droplet contact ( n = 4 ) , which included 3 medical staff who were involved in the intubation and the index patient s daughter who cared for him before death , in addition , the risk factor of possible airborne transmission ( being in the icu room or funeral room without mask protection ) was also assessed among all 63 exposed individuals . of them , the medical doctors and nurses ( n = 16 ) were with protection ; and the others were without ( n = 47 ) , including icu patients who were staying in the same room ( n = 8) , family members ( n = 3 ) , and visitors to the funeral room where the corpse was kept ( n = 35 ) . the multivariate analysis ( logistic regression analysis ) showed that blood contact was the most likely mode of transmission ( p < .001 ; table 1 ) . it is noticeable that the serum collected from the index patient on the day he died contained a relatively high amount of sftsv , which reached about 3.55 10 viral rna copies / ml ( calculated as 9.67 10 50% tissue culture infective dose [ tcid50]/ml ) . this number was about 100 000-fold higher than viral copies detected in the serum samples of the 5 secondary patients , which ranged from 10 to 10 copies / ml ( table 1 ) . all 5 patients had virus - specific igm antibodies in the acute phase , and elevated virus - specific immunoglobin g ( igg ) antibodies in the convalescent phase . the index patient , however , had minimal or undetectable levels of virus specific igm antibodies on day 11 after onset of fever ( table 1 ) . compared with the entire genomic sequence of the virus strain isolated from the index patient , cases 2 and 3 were nearly 100% identical , and provided genetic evidence for the epidemic findings on the possible transmission of sftsv from the index patient to secondary patients .", "here , we reported the person - to - person transmission of sftsv with a cluster of 6 sfts patients that occurred in shandong province of eastern china . investigation studies revealed that all 5 secondary infected patients had possible contact with the index patient s blood . of them , only case 1 ( icu doctor ) had evidence of droplet contact contamination ( during intubation ) but not blood contact , but we included him also as a blood contactor because he performed intubation without protective face shield and goggles , therefore he had an extremely high risk of blood contact through unprotected skin and mucosa . the risk assessment revealed that blood contact was the major risk factor for the human - to - human transmission of sftsv . additionally , 3 secondary patients who only had contact with the index patient after death were still infected , which indicated that sftsv - infected blood may remain infectious for a long time , even after patient death . it is notable that the level of virus copies in the index patient s serum was extremely high , but with no detectable igm or igg antibodies , which suggested that his immune responses to limit the replication of sftsv were severely impaired . the patient had no immune system disease , thus the minimal immune responses might be due to the early and sustained application of glucocorticoid , which has a side effect of repressing immune functions ; clinical physicians should take note of this finding . clinically , sfts is easily confused with hemorrhagic fever with renal syndrome caused by hantavirus and human anaplasmosis . the hantavirus - specific igm antibodies were not detected in the sfts patients serum samples ( data not show ) . due to the limitation of our study , we were not able to detect rickettsia infection , which was previously reported in outbreaks of nosocomial infections . however , the methods we used for diagnosis of sfts patients were well validated , and the human - to - human transmission of sftsv we described in this study could not simply be classified as being nosocomial transmission ; specially , 3 of the 5 secondary cases that occurred in the household . additionally , the lessons of person - to - person transmission of sftsv we learned from this study highlighted the necessity of establishing standard precautions for avoiding direct contact and blood - based transmission .", "this work was supported by the china mega - project for infectious diseases ( 2008zx10004 - 001 , 2009zx10004 ) from the ministry of science and technology and ministry of health of the people s republic of china .", "conflicts that the editors consider relevant to the content of the manuscript have been disclosed ." ]

[ "therefore , the mother 's knowledge about child care influences the nature and quality of care that is given to the child . several studies have revealed that the mothers level of education has a positive impact on her knowledge and how she deals with child health care issues.[213 ] our experience in pediatric practice has revealed significant gaps pertaining to child health issues in the mothers knowledge . there seems to have been very little improvement in the knowledge of mothers on common child health matters over the years inspite of the many years of girls education in the country . this descriptive cross - sectional survey aimed to answer the following questions : ( 1 ) what is the level of mothers knowledge of certain aspects of child health matters ? ( 2 ) what are the main sources of health information and which ones are the most useful ? ( 3 ) is there a correlation between mothers level of knowledge and the number of years spent in formal education ? ( 4 ) in the mother 's view , does the current formal education of girls in schools / colleges have a significant impact on mothers knowledge of child health matters .", "it was reviewed and refined by two other colleagues who have a lot of experience in pediatrics . the first part comprised information about mothers nationality , age , work , level of education and the number of children she has in addition to sources of health information and the role of formal school education in child health matters . the second part contained 40 statements about different aspects of child health issues including nutrition , immunization , development , accident prevention , certain neonatal and infants problems or behaviors and some common childhood illnesses . mothers who attended with their children at the pediatric outpatient clinic of king khalid university hospital in riyadh during the months of july and august , in 2007 , were invited to participate in the study . those who agreed were interviewed by a trained non - medical research assistant using the items and statements of the questionnaire as a basis for the structured interview . it was indicated clearly to the mothers that participation was voluntary and their non- contribution would have no adverse effect on the quality of care given to their child in the hospital . they scored one point for each knowledge question answered correctly and zero for wrong and do not know answers . the first 20 questionnaires completed were used as a pilot test to evaluate the clarity of language and level of information in the questionnaire . data was entered in ms excel and analyzed using spss pc 11.5 version statistical software . descriptive statistics , mean and standard deviation and proportion were used to quantify the study and outcome variables .", "demographic data regarding nationality , age , work , education , and number of children are represented in table 1 . as the main source of health information , 295 ( 80% ) cited family members ( grandmothers , mothers , sisters , relatives etc . ) , 30 ( 8.2% ) cited schools , 68 ( 17.2% ) cited tv and radio , 60 ( 16% ) cited journals and magazines , 52 ( 14.2% ) cited friends , colleagues and other members of society , 101 ( 27.1% ) cited books and only 25 ( 7.1% ) cited health care professionals . demographic data of the mothers two hundred twenty - five ( 60.6% ) of the mothers believe that formal girls education in schools and colleges does not provide sufficient child health education . on the question of where to obtain useful information of child health , 287 ( 77.6% ) of the mothers supported the increase in instruction on child health in the curriculum in schools , 284 ( 77% ) supported specific courses on child health targeting girls and women , 321 ( 86.8% ) supported the use of the mass media , and 311 ( 84.1% ) supported programs run by health care professionals . the mean knowledge score of the total sample was 25 ( out of 40 ) , the minimum score obtained was 14 and the maximum was 36 . we found no statistically significant correlation between the total score on mothers knowledge or any of the items on the knowledge questionnaire and mothers level of education . table 2 indicates total knowledge score in relation to mothers education , age and number of children . the results of mothers responses to individual items on the knowledge questionnaire are indicated in table 3 . association between the scores of mother 's knowledge and mother 's age , educational status and number of children mother 's response to the knowledge questionnaire incorrect knowledge on certain specific items of the questionnaire included 131 ( 35.1% ) who believed that on most occasions , fever in children was a symptom of serious disease , 313 ( 83.9% ) believed that the best method to treat a child with a fever was to bathe him / her with cold water or wipe with cold or iced cloth . questions on diseases covered by the national vaccination program revealed that 285 ( 76.4% ) believed that mumps was not targeted , 245 ( 65.7% ) believed that tetanus was not targeted , 203 ( 54.4% ) believed that whooping cough ( pertussis ) was not targeted and 241(64.6% ) believed that diphtheria was not targeted by the national vaccination program . three - hundred and five ( 81.8% ) of the mothers believed that the best course of action for parents of a child who was due for a scheduled vaccination but has a fever , cough and runny nose ( symptoms of upper respiratory infection ) was to defer the vaccination until he was completely symptom free . on the question of conditions which were regarded as serious and warranted urgent attention by a doctor , 176 ( 47.2% ) did not see the need for the newborn baby who was sleeping all the time and was not interested in feeding to be seen by a doctor . another 82 ( 22% ) disagreed with seeking medical help for a child who cries continuously , does not sleep and who has pain with every movement . three - hundred and one ( 80.7% ) of mothers believed that the appearance of jaundice on the first day of the life of a newborn was physiological ( natural ) and so nothing other than more frequent feeding and exposure to sunlight was required . it is noteworthy that more than 30% of the mothers believed that a newborn baby who passes stools after each feed , or a newborn who is otherwise healthy but has repetitive movements of the chin , or one who strains and becomes red in the face during defecation , or a breast fed baby who passes stools only once every 5 days , may have a serious illness and needed urgent medical attention . on feeding practices , 200 ( 53.6% ) of the mothers believed that there was no harm in giving a child a bottle of milk at bedtime in bed or whenever he cried during sleep ; 90 ( 24.1% ) did not agree that the most acceptable time to start solid food for children was at 6 months of age , 225 ( 60.3% ) agreed with force - feeding when children refused to eat . results on the items on safety practices revealed that only 84 ( 22.5% ) of the mothers believed that it was harmless to let babies sleep by their mothers in the same bed . one - hundred and ninety ( 50.9% ) thought that it was not harmful to let babies sleep on their tummy in bed ( prone sleep position ) . two hundred two ( 59.5% ) believed that putting a baby who crawls in a walker protected him from household accidents . two - hundred and five ( 55% ) believed that the best place for a baby / an infant to sit or be carried in a car was the mother 's lap .", "our results revealed that the mean score of the sample which was just above the cut - off score , was an indication of a satisfactory knowledge level . if it had been fixed at 20 , the knowledge of more than 90% would have been satisfactory , on the other hand , if it had been raised to 30 the knowledge of only 12% would have been satisfactory . a closer look at some items revealed significant and sometimes serious gaps in the mothers knowledge . similar gaps have been reported from different societies.[71521 ] our results indicated that a majority of mothers believed that the best method to treat a child with a fever was to bathe him with cold water or rub him with ice cold cloth . this was worse than that reported by al eissa et al where 50% of the parents would use cold water and 7% ice water for the treatment of fever . impicciatore et al reported that 9% of the mothers used iced packing to reduce fever . knowledge of the diseases covered by the national vaccination program revealed that a high proportion of mothers were not fully informed about certain diseases targeted by the program . impicciatore et al reported that only 26% of italian mothers were able to state the vaccinations which were compulsory . our results revealed no statistically significant correlation between mother s knowledge score and their level of education , age or number of children . this is similar to the results of jan et al ( jeddah , ksa , 2000 ) who found no correlation between parents level of education and safety practices , but contrary to the finding of moawed et al ( riyadh , ksa , 2000 ) who found a statistically significant correlation between mothers knowledge and their practices during infants diarrheal episodes and mothers age , education and birth order . it is also not in accord with shawky et al ( jeddah , ksa , 2001 ) who reported on the effect of maternal education on the rate of childhood handicap and found that the risk of having a handicapped child declined sharply with the increase in the level of maternal education . one possible explanation of this difference in the results could be the use of different research methodology ( sample selection , data gathering and others ) . it is worrying to find that the majority of mothers believed that jaundice on the first day of life of a newborn was physiological ( natural ) and required no more than frequent feeding and exposure to sun light . also disturbing is the fact that nearly half did not realize that a newborn baby who slept all the time and was not interested in feeding could be seriously sick and needed to be seen urgently by a doctor ; another quarter did not realize that a child who cried continuously , who did not sleep and was in pain with every movement was sick enough to require urgent medical attention . dongre et al from rural india reported that 23% of mothers were not aware of any danger signs in a newborn such as , poor sucking , low birth weight , lethargy/ unconsciousness , rapid / difficult breathing . these were indicated as danger signs by 34.4% , 25.8% , 25.5% , 10.3% mothers respectively , while hypothermia and convulsions were referred to as danger signs by 10.3% and 8.6% mothers respectively . the majority of mothers cited family members as their main source of health information , which is higher than what was reported by al eissa et al , where some 35% of the parents mentioned friends and relatives as their main source of information . only few mothers cited health care professionals as their main source of health information . in the report by impecciatore et al from italy , only 42% of the mothers said that the pediatricians had spontaneously spoken to them about vaccination during consultation with a child . al eissa et al reported that only a group of 37% of parents cited medical personnel as their source of information . these findings reflect a lack of active educational intervention by professionals . it is encouraging to find that more than three - fourths of the mothers believed that it was harmful to let babies sleep with them in the same bed . this is contrary to the finding of jan et al on which 75% of the mothers reported sleeping next to their infants in the same bed , though it is difficult to discern whether mothers were compelled to do so by social circumstances or they believed it was safer for their infant . around two - thirds believed that schools did not provide sufficient information on child health and more than two - thirds supported the increase of education of child health in the curriculum of schools . according to kolbe , behaviors and attitudes about health that began during childhood were responsible for most of the deaths , illnesses and disability . comprehensive health education programs in schools represent one effective way of providing students with the knowledge and skills to prevent health - impairing behavior . several previous studies stressed that health education in school curricula was not adequate , and that the knowledge of high school girls and university students on health matters was deficient.[2730 ] furthermore , studies have shown that school teachers were not trained to give health education in schools . their college curriculum did not equip them for such a role and so the teachers refrained from teaching health subjects . according to summerfield and others hundreds of studies have evaluated health education and concluded that it was effective , but its effectiveness depended upon factors such as teacher training , comprehensiveness of the health program , time available for instruction , family involvement and community support.[253234 ] the responsibility for health education was not to be left solely to schools . in addition to all other sectors of the community , health care personnel and other health care institutions should play a major role in health education . milaat et al , agble et al and kari et al , reported successful involvement of health care personnel and medical students in targeted health education classes for school children and university students . such efforts may prove more effective than formal general health education classes taught by uninterested , unenthusiastic , untrained school teachers . every visit to a health care professional or every health care facility or institution by patients / parents should be an opportunity for the delivery of a short course in health education . possible limitations of the study are that the sample of mothers selected may not have been representative of the community ; mothers who volunteered to participate in the survey may prove to be different from the non - participants . whether the respondents were serious in completing the questionnaire and whether research assistant had influenced the responses of the mothers to the questionnaires is not known .", "it also revealed that health education in schools was deficient and it also exposed the limited involvement of health care personnel and institutions in health care education . there is a need for health education programs that target high school girls , university students , mothers and other caregivers ( e.g. fathers ) . these should be delivered by trained personnel in classes , courses , and special sessions . in addition , health care facilities should be reformed to make health education an essential and compulsory part of health care delivery . involvement in these educational activities should be a mandatory requirement for the issue of a license to practice ." ]

[ "indications for covered self - expandable metallic airway stent removal include recurrent mucous plugging of the stent , excessive or recurrent granuloma formation , migration of the stent , stent infection , recurrence of stenosis , stent failure , stent fractures and accomplishment of treatment . usually , it is tedious to remove a stent because of their embedding in the bronchial mucosa and epithelization of the inner surface . granuloma formation at the extremities is a relative common occurrence in covered metallic stents possibly resulting from the radial force applied against the airway wall and the friction exerted . we report a case of covered self expandable metallic stent removal with a rigid bronchoscope under general anesthesia . the case is unique because it had almost all the common complications associated with the stent placement but it was successfully removed without much ado . to the best of our knowledge this is the first case of successful removal of a complete stent reported from india .", "a 21 year old female presented with complaints of increasing dyspnoea and cough with pain chest for last two weeks . patient had a past history of benign tracheal stenosis which was opened up by endobronchial electro surgery followed by placement of a self expandable metallic airway covered stent . x - ray chest done one and a half year back showed stent well in place [ figure 1 ] . x - ray chest done one and a half year back showing stent well in place bronchoscopy was done under local anesthesia and a stenosis was observed well above the level of the stent [ figure 2 ] with granulation tissue inside the stent [ figure 3 ] , lower end of the stent was fractured , carina was not visualized and stent was seen entering upper part of right main bronchus [ figure 4 ] . the beveled edge of the rigid scope was advanced between the stent wall and the airway mucosa thus creating a space between them . the circular extraction loop at the upper end of the metallic stent was grasped with a rigid optical alligator forceps and pulled in the lumen of rigid bronchoscope with continuous winding movements gradually separating the stent from the tracheal wall . immediately after that this is one of the rare cases of successful removal of self expandable metallic airway covered stent in benign tracheal stenosis . stenosis above the level of the stent granulation tissue inside the stent and at the margins fracture of stent at its lower end ( stent is seen at upper part of right main bronchus , carina is not visualized ) the stent after removal", "the management of patients with tracheal / bronchial strictures of benign etiology can be quite challenging . though surgical tracheal sleeve resection and reconstruction remains the gold standard for most benign airway strictures , non - surgical modalities such as laser photocoagulation and resection , balloon dilatation , electrocautery and stenting of the airway have been developed to deal with airway stenosis . various inoperable benign airway disorders are considered for airway stenting , like post intubation tracheal stenosis , tracheal burn or trauma , tracheo - broncho - malacia and extrinsic compression of trachea . though silicone prostheses are considered to be first choice in benign diseases their use is less suited , especially in airway wall malacia or distal and angular stenosis where sems are preferred . the disadvantages of the silicone stents are high migration rate , small lumen to wall thickness ratio and difficulty in clearing the secretions . on the other hand , the major drawback for placement of sems in benign situations is their difficult repositioning and removal in situations like excessive granulation tissue , stent fractures and stent migration . the complications of stent removal include significant oozing , tracheal mucosal dehiscence , tracheal puncture requiring thoracotomy , retained stent pieces , need for restenting , respiratory failure , tracheotomy , and even death . in our case , various authors have come up with different methods of removal of the stent , like the technique of nashef et al . , which was similar to that of rolling spaghetti on a fork , but much more difficult and at least equally messy . they further observed that there may be several fractures of the stent , which have to be removed piece by piece . in our case filler et al . , used a metal suction catheter to dissect the stent from the airway wall before extraction with the forceps . zakaluzny et al . , employed a rigid suspension laryngotracheoscope and used optical forceps to dissect the stent from the airway wall . alligator forceps were then employed to grasp and extract the stent through the rigid scope while the scope was advanced further into the airway . we first separated the stent from the tracheal wall and then removed all the works ( scope , forceps and the stent ) in one piece . to conclude , this case is unique for many reasons , firstly , it had almost all of the complications that can be associated with stent placement ( stenosis of trachea at the upper end of the stent , extensive granuloma formation , migration of the stent downwards and fracture of the stent at its lower end ) , secondly , we were able to remove the stent in toto [ figure 5 ] and lastly , there were no complications after removal of the stent . further studies are needed to re evaluate their removal successfully and safely and to produce better designed and technically superior stents like bio - absorbable stents which may not have to be removed at all ." ]

[ "takayasu 's arteritis ( ta ) is a chronic idiopathic occlusive inflammation of aorta and its major branches predominantly affecting females in over 85% of cases . the major clinical finding is loss of palpable pulses in the upper limbs and neck . the unsuspected ischemia of vital regional vascular beds may render these patients at risk for inappropriate management . this case report describes the management of a trauma patient in whom the diagnosis of ta was established by specific investigations done for the same . the role of meticulous monitoring and importance of anticipation of such disease for prompt diagnosis and management is emphasized .", "a 26-year - old female was brought to the emergency room ( er ) with history of motor vehicle accident . on initial evaluation her physical examination revealed unrecordable upper limb peripheral pulses and blood pressure , although lower limb pulses were easily palpated . the radiological investigations revealed multiple left - sided rib fractures with bilateral pleural collections and small lung contusions . after infusion of two liters of lactated ringer 's solution , her blood pressure ( bp measured in right upper limb ) increased to 80/50 mmhg and heart rate ( hr ) was 140/min . she also had shaft and inter - trochanteric femur fractures on the right and left side , respectively . focused assessment sonography in trauma ( fast ) was negative and x - ray of the pelvis was normal . bilateral chest tubes were inserted and the patient was transferred to the intensive care unit ( icu ) with ongoing resuscitation with fluids , blood products and dopamine infusion ( 7 g / kg / min ) . fluid resuscitation was continued to maintain a central venous pressure ( cvp ) of around 10 mmhg . invasive arterial blood pressure monitoring was established via the right femoral artery and the bp recorded was 140/90 mmhg . dopamine infusion was then discontinued and thereafter the patient was subjected to arterial doppler and computed tomography ( ct ) angiography studies to rule out traumatic aortic rupture as a differential diagnosis . arterial doppler showed low - velocity monophasic flow in bilateral axillary , brachial and ulnar arteries . the erythrocyte sedimentation rate ( esr ) and c - reactive protein ( crp ) were normal . electrocardiography ( ecg ) , 2d echocardiography ( 2d echo ) and funduscopy were normal . thoracic epidural catheter was inserted for pain relief with continuous infusion of 0.125% bupivacaine and fentanyl ( 2 mcg / ml ) . epidural catheter was removed on 5 day of hospitalization and patient was moved to the ward in a stable condition with advice for regular follow - up and advised to check bp measurements in the lower limb if ever required .", "the occlusive thromboaortopathy ( ta ) is a group of diseases in which there is no or feeble pulses in upper half of body . the natural course of disease often gives rise to four main complications : takayasu 's hypertensive ischemic retinopathy , secondary hypertension , aortic regurgitation and aortic or arterial aneurysm . most patients with ta present during their child - bearing age , and a high index of suspicion is required to make an early diagnosis . patient may be entirely asymptomatic and the incidental finding of unequal pulse and blood pressure in upper and lower limb , bruit and hypertension may prompt further evaluation . stroke , congestive heart failure , and rarely ruptured aneurysm may be the heralding events . hemorrhagic shock is the commonest type of shock in trauma patients . any hypotensive trauma patient is presumed to be hypovolemic and resuscitative attempts are made with fluid infusion as was with our patient . there was no contributory past history of symptoms or signs suggestive of ta in our patient . a cvp of around 10 mmhg suggested a normovolemia status unlike the impression got by the low blood pressure ( as recorded in upper limbs ) . the presence of tachycardia in our patient could be attributed to pain and anxiety associated with trauma . there was no fall in hematocrit from the baseline ( perhaps due to hemo - concentration ) . dopamine infusion was started in our patient in an attempt to maintain perfusion and restore blood pressure but was discontinued when invasive monitoring revealed a normal bp . normal value of esr and c - reactive protein suggested that the disease was not active at that moment . our patient was perhaps asymptomatic for the disease and was incidentally diagnosed during workup after trauma . but ta as a differential diagnosis of exclusion may be considered for a pulseless trauma patient . normocytic normochromic anemia , hyper - gammaglobulin , and elevated esr may occur , but are not pathognomonic . medical treatment includes corticosteroids , anticoagulants and symptomatic therapy for which anti - hypertensive agents , digitalis and antibiotics are frequently used . follow - up in cases of ta includes monitoring for disease activity and its complications like hypertension , organ failure , seizures etc . long - term complications of corticosteroid use are also to be considered in the follow - up . anesthesiologists may encounter these patients in operation theater for anesthesia or in icus or emergency units after trauma or after one of its complications like a ruptured aneurysm .", "tas may be considered as a differential diagnosis in trauma patients , if examination reveals hypotension or unequal peripheral pulses in upper and lower limb in a young adult , provided hypovolemic shock is excluded . a thorough detailed physical examination with palpation of all the peripheral pulses as stressed in atls guidelines is reemphasized . following the basic atls guidelines would assist clinicians in picking up this discrepancy as part of their routine evaluation for all trauma patients . then , the clinician may suspect an atypical cause for hypotension if a blood pressure cuff on an upper extremity is reading a hypotensive measurement but the patient has strong , 2 + pulses in the lower extremities . these patients may be issued a special identification card containing the details of the disease and treatment course for future reference ." ]

[ "neurotransmitters ( nts ) are signaling molecules , which play pivotal roles in neuronal communications in the central nervous system [ 1 , 2 ] . it is reported that changes in nts quantitation in several brain regions involve the development of many psychiatric diseases and neurodegenerative diseases [ 3 , 4 ] . generally , neurotransmitters are classified into two categories based on their chemical styles : ( i ) the small molecules ( dopamine ( da ) , serotonin ( 5-ht ) , norepinephrine ( ne ) , epinephrine ( ep ) , glutamate ( glu ) , -aminobutyric acid ( gaba ) , histamine , and endocannabinoids and ( ii ) the neuropeptides ( enkephalin , endorphin , and substance p ) . the quantitation of various nts as a small molecule in the brain , especially the aromatic monoamines , should be measured by using high - pressure liquid chromatography ( hplc ) separation coupled with amperometric electrochemical detection ( ecd ) . this method has been applied in nts analysis over the last three decades [ 68 ] . however , it is still rather difficult to determine different types of nts simultaneously in one sample owing to the limited capability of accommodating changes in the mobile phase composition . another difficulty of incorporating this method is that the analytes can only be identified by a stable retention time matching . nevertheless , tandem mass spectrometry ( ms / ms ) can provide high specificity due to additional structure information and high sensitivity . therefore , it has been commonly used for the quantification of nts in the brain by coupling with both gas chromatography ( gc ) and liquid chromatography ( lc ) [ 5 , 11 , 12 ] . owing to various efficiencies and time consumption of derivatization , a simplified sample preparation using liquid chromatography coupled with electrospray tandem mass spectrometry ( esi - ms / ms ) is widely employed to quantify the nts and their metabolites in the brains without derivatization [ 5 , 9 , 13 ] . the use of isotope labeled internal standards is vital to the enhanced method performance because the isotope ratio measurements provide a measure of quality control for each analyte by compensating for changes in analyte , retention time , recovery , degradation , and changes in detector responses caused by coeluting contaminants . in this study , we developed a sensitive , simple , and simultaneous method to quantify the six major nts such as da , 5-ht , ne , ep , glu , and gaba in mouse brains [ 14 , 15 ] . in addition , a tetrahydrobiopterin ( bh4 ) , a vital cofactor for the biosynthesis of the da , 5-ht , and ne , was also measured in the same sample . to establish a novel method for the direct measurement of biologically active levels of bh4 , da , 5-ht , ne , ep , glu , and gaba in the brain samples , the present study was performed using a high efficiency hilic column for bh4 and da , a luna 3 c18 ( 3.0 mm 150 mm , i.d . , 3 m ) column for 5-ht , ne , ep , glu , and gaba with reversed - phase hplc separation and an esi - ms / ms , which could minimize the sample interferences . at the same time , the multiple reactions monitoring ( mrm ) scan mode was sensitive enough to identify and quantify the bh4 and nts in this new method .", "the ( 6r)-5,6,7,8-tetrahydrobiopterin dihydrochloride , dopamine hydrochloride , serotonin hydrochloride , ( )-norepinephrine , ( )-epinephrine , d - glutamic acid , and -aminobutyric acid were purchased from sigma - aldrich corporation ( st . louis , mo , usa ) . internal standards ( is ) with isotope labeling were 2-(3,4-dihydorxyphenyl ) ethyl-1,1,2,2-d4-amine hcl ( dopamine - d4 , 98% at % d ) ; serotonin- , ,,-d4 creatinine sulfate complex ( serotonin - d4 , 98% at % d ) ; ( )-norepinephrine-2,5,6,,,-d6 hcl ( norepinepherine - d6 , 98% at % d ) ; ( )-epinephrine - d3 ( n - methyl - d3 ) ( epinephrine - d3 , 98% at % d ) ; l - glutamic-2,3,3,4,4-d5 acid ( glutamate - d5 , 98% at % d ) ; 4-aminobutyric-2,2,3,3,4,4-d6 acid ( -aminobutyric acid - d6 , 98% at % d ) . epsilon - acetamidocaproic acid ( aaca ) was donated by kuhnil pharmaceuticals ( seoul , korea ) . water was purified with a milli - q water purification system ( millipore , bedford , ma , usa ) . full - scan positive mass spectra of bh4 and the is ( aaca ) reveal the protonated molecules , [ m + h ] , of m / z 242.1 and 174 , respectively . the mass - to - charge ratios of fragments of bh4 after fragmentation were 166 , 107 , and 149 and fragments of is were 114 , 156 , and 79 . the most abundant ion in the product ion spectra was 114 for is ( figure 1(a ) ) and 166 for bh4 ( figure 1(b ) ) . in parallel , full - scan positive mass spectra of bh2 and the biopterin showed the protonated molecules , [ m + h ] , of m / z 240.0 and 238.0 , respectively . the mass - to - charge ratios of fragments were 196.0 , 164.9 , and 168.0 in bh2 and of 177.9 , 193.9 , and 192.0 in biopterin . the most abundant ion in the product ion spectra was 196.0 for bh2 ( figure 1(c ) ) and 177.9 for biopterin ( figure 1(d ) ) . full - scan positive mass spectra of da and the is ( dopamine - d4 ) showed that m / z of protonated molecules [ m + h ] are 154.1 and 158.1 , respectively . the mass - to - charge ratios of fragments of da after fragmentation were 137.0 , 90.9 , and 64.9 and of da - d4 141.0 , 95.0 , and 67.9 . the most abundant ion in the product ion spectra was 137.0 for da ( figure 2(a ) ) and 141.0 for is ( figure 2(b ) ) . but da mrm had 154.1 to 90.9 due to matrix effects , which increased the mass - to - charge ratio level . full - scan positive mass spectra of 5-ht and the iss ( serotonin - d4 ) showed that the mass - to - charge ratios of protonated molecules [ m + h ] were 177.0 and 181.0 , respectively . after fragmentation , fragments of 5-ht seen were m / z 160.0 , 114.9 , and 132.0 and fragments of 5-ht - d4 m / z were 164.0 , 118.0 , and 136.0 . the most abundant ion in the product ion spectra was at 160.0 for 5-ht ( figure 2(c ) ) and at 164.0 for is ( figure 2(d ) ) . full - scan positive mass spectra of ne and the is ( norepinephrine - d6 ) showed that the mass - to - charge ratios of protonated molecules [ m + h ] were 170.1 and 176.1 , respectively . after fragmentation , fragments of ne were m / z 152.0 , 107.0 , and 76.9 and fragments of ne - d6 m / z were 158.0 , 111.0 , and 112.0 . the most abundant ion in the product ion spectra was at 152.0 for ne ( figure 2(e ) ) and at 158.0 for is ( figure 2(f ) ) . but m / z 170.1 to 107.0 and 176.1 to 111.0 was selected for ne and is ( ne - d6 ) mrm due to matrix effects , which increased the mass - to - charge ratio level . full - scan positive mass spectra of ep and the is ( epinephrine - d3 ) showed that the mass - to - charge ratios of protonated molecules [ m + h ] were 184.1 and 187.1 , respectively . the m / z of fragments of ep after fragmentation were 166.0 , 76.9 , and 107.0 and of ep - d3 169.0 , 76.9 , and 107.0 , respectively . the most abundant ion in the product ion spectra was at 166.0 for ep ( figure 3(a ) ) and at 169.0 for is ( figure 3(b ) ) . full - scan positive mass spectra of glu and the is ( glutamate - d5 ) showed that the mass - to - charge ratios of protonated molecules [ m + h ] were 148.0 and 153.0 , respectively . the mass - to - charge ratios of fragments of glu after fragmentation were 129.0 , 83.9 , and 55.9 and of glu - d5 were 135.0 , 84.8 , and 88.0 , respectively . the most abundant ion in the product ion spectra was at 129.0 for glutamate ( figure 3(c ) ) and at 135.0 for is ( figure 3(d ) ) . but m / z 148.0 to 84.0 and m / z 153.0 to 88.0 for glutamate and is ( glutamate - d5 ) mrm were selected due to matrix effects , which increased the mass - to - charge ratio level . full - scan positive mass spectra of gaba and the is ( gaba - d6 ) showed the protonated molecules , [ m + h ] , of m / z 104.0 and 110.1 , respectively . the mass - to - charge ratios of fragments of gaba after fragmentation were 87.0 , 44.9 , and 85.0 and of gaba - d6 were 93.0 , 49.0 , and 91.9 , respectively . the most abundant ion in the product ion spectra was at 87.0 for gaba ( figure 3(e ) ) and at 93.0 for is ( figure 3(f ) ) . individual stock solution of each nt and isotope - labeled standard was prepared by accurate weighing of each compound ( 1 mg / ml methanol as the stock solution ) . the solution of bh4 , da , 5-ht , ne , ep , glu , and gaba was prepared as a stock ( 1 mg / ml of each ) with pure acetonitrile and then diluted with acetonitrile ( 50% ) for each experiment . standard solutions of bh4 , da , 5-ht , ne , ep , glu , and gaba for calibration curves were prepared by spiking the blank solution prepared to the appropriate amounts , but added volumes were less than 10% of total dw volume . the final yielding concentrations for the standard curve were 10 , 20 , 50 , 100 , 200 , 500 , 1000 , 2000 , 5000 , and 10000 ng / g for bh4 and dopamine . in parallel , the final concentrations for the standard curve were 20 , 50 , 100 , 200 , 500 , 1000 , 2000 , 5000 , and 10000 ng / g for 5-ht , ne , and ep . likewise , the final concentrations for the standard curve were 0.2 , 0.5 , 1 , 2 , 5 , 10 , 20 , 50 , 100 , and 200 g / g for glu and gaba . the tolerance for reliable detection was 10 ng / g for bh4 and dopamine , 20 ng / g for 5-ht , ne and ep , and 0.2 g / g for glu and gaba . the linear ranges and correlation coefficient of the calibration curve were summarized in table 1 . icr mice ( male , body weight 2030 g , n = 24 ) , ( daehanbiolink inc . , chungju , south korea ) , were used . the mice were kept under a controlled condition ( ambient temperature of 20 to 25c , 12-h light / dark cycle ) . nih 's guidelines for animal research were followed for all animal procedures and were approved by institutional animal care and use committee ( iacuc ; dku-12 - 018 ) which adheres to the guidelines issued by the institution of laboratory of animal resources ( ilar ) . the specific brain regions of mouse were quickly dissected on an ice bath and , subsequently , isolated brain tissues were homogenized with acetonitrile ( 1 mg/10 l ) according to the internal standard ( aaca : 100 ng / ml ; dopamine - d4 , serotonin - d4 , norepinephrine - d6 , epinephrine - d3 , glutamate - d5 , and gaba - d6 : 1 g / ml ) . after a thorough homogenization , the bh4 and nts ( da , 5-ht , ne , ep , glu , and gaba ) from brain tissues were extracted by sonication for 60s . the homogenates of brain tissue were centrifuged at 12,000 rpm for 10 min at 4c . supernatants were carefully transferred to 96-well plates and then injected onto the lc - ms / ms system by an autosampler for subsequent analysis . for determination of bh4 and nts in mouse brain tissues , d - water was used as blank matrix . the liquid chromatographic system used was the accela system ( thermo fisher scientific inc . , waltham , ma , usa ) , equipped with a nanospace si-2 3133 solvent delivery module as an autosampler ( shiseido inc . , japan ) and connected to discovery max ( thermo fisher scientific , inc . ) quadrupole tandem mass spectrometer coupled with electrospray ionization ( esi - ms / ms ) . system control and data analysis were performed using the xcalibur software ( thermo fisher scientific , inc . ) . chromatographic separation was achieved using hydrophilic interaction chromatography ( hilic ) sepax polar - imidazole ( 2.1 mm 100 mm , i.d . , 3 m particle size ) hplc column ( sepax technologies , delaware , usa ) to assay bh4 and dopamine , and luna 3 c18 ( 3.0 mm 150 mm , i.d . , 3 m particle size ) to assay serotonin , norepinepherine , epinephrine , glautamte , and gaba with a phenomenex c18 guard column ( 4 mm 2 mm , phenomenex ) . a nanospace si-2 3004 column oven ( shiseido , japan ) was used online . to assay bh4 and dopamine , the mobile phase consisted of 10 mm ammonium formate ( ph 3 ) in an acetonitrile / water ( 75 : 25 , v / v ) mixture . the flow rate was 300 l / min and the injection volume was 5 l . to assay 5-ht , ne , ep , glu , and gaba , the mobile phase consisted of an acetonitrile / water ( 20 : 80 , v / v ) mixture . the flow rate was run at 350 l / min and the injection volume was 5 l . the electrospray ionization ( esi ) mass spectrometer was operated in the positive ion mode . the optimal condition was as follows : the esi needle spray voltage was 4000 v , the sheath gas pressure 35 unit , the auxiliary gas pressure 20 unit , the capillary temperature 206c , the collision gas ( ar ) pressure 1.5 mtorr , the skimmer offset 5 v , and the chrome filter peak width 10 s. scanning was performed in profile mode with the sim width 0.700 fwhm , scan time 0.200 s , and scan width 0.5 da . it was successful to qualify bh4 using hydrophilic interaction chromatography ( hilic ) sepax polar - imidazole ( 2.1 mm 100 mm , i.d . , 3 m particle size ) hplc column ( sepax technologies , delaware , usa ) . moreover , the peaks had a symmetric shape , and we confirmed the lc - ms / ms chromatogram of bh4 , aaca , da , and da - d4 ( figure 4 ) . following the same strategy , we analyzed successfully for 5-ht , ne , ep , glu , and gaba by using luna 3u c18 ( 3.0 mm 150 mm , i.d . , 3 m particle size ) . the whole validation experiments followed the guideline of fda ( us ) [ guidance for industry ; handling and retention of ba and be testing samples ] , may 2004 . linear regression of the ratio of peak area of bh4 or nts to that of is was done with weighting of 1/x ( least - squares linear regression analysis , where x is the concentration of the analyte ) . precision and accuracy were evaluated by three different concentrations of qc solutions : interday precision was evaluated for 5 replicates per a single concentration . the value of accuracy was expressed as the mean of 25 replicates of determined concentration from 5 different analytical tests to the qc concentration ( table 2 ) . all the values , tables , and figures given in the text are expressed as mean sd . statistical differences between means were evaluated with two - tailed student 's t - test .", "for simple sample preparation , protein precipitation was attempted using acetonitrile . to prevent sample degradation and oxidation , an ascorbic acid with 0.01% ( w / v ) the peaks of bh4 , dopamine , and is were best when acetonitrile was used for protein precipitation and as an organic solvent of the mobile phase when using the hilic column ( polar - imidazole , 2.0 mm 150 mm ; i.d . , 3 m ) ( figure 4 ) . because bh4 and dopamine are easily dissolved in water , they are difficult to match the reverse column ( c18 ) in chromatography analysis the other nts ( 5-ht , ne , ep , glu , and gaba ) were matched with a c18 column ( luna 3 c18 ( 3.0 mm 150 mm , i.d . , 3 m particle size ) ) ( figure 5 ) , but the hilic column could not separate peak of nts clearly . the optimized electrospray ionization condition should be sensitive enough to detect bh4 , da , is , bh2 , and biopterin in positive ion detection mode . the most abundant protonated ion peaks ( [ m + h ] ) in the q1 mass spectra of bh4 , da , is , bh2 , and biopterin were at 242.1 , 154.1 , 174.0 , 240.0 , and 238.0 , respectively ( figures 1 and 2 ) . the product ions in q3 mass spectra and proposed fragmentation patterns were bh4 , which becomes at 2-amino-7,8-dihydropteridin-4(1h)-one of m / z 166.0 by losing propane-1,2-diol . da becomes butane-1,2-diol of m / z 90.9 by losing ( e)-3-methylpent-3-en-1-amine ; is , ( e)-n - ethylidenepentan-1-amine of m / z 114.0 by losing both carboxyl and hydroxyl groups ; bh2 , 2-amino-7,8-dihydro-6-(hydroxymethyl)pteridin-4(1h)-one ) of m / z 196.0 by losing propan-2-ol ; biopterin , 2-amino-6-(hydroxymethyl)pteridin-4(1h)-one ) of m / z 196.0 by losing propan-2-ol . also , to confirm separation between bh4 and other biopterins in biological samples , experiments were previously conducted to quantify biopterin , bh2 , and bh4 in a mixed matrix . the optimized electrospray ionization condition should be sensitive enough to detect bh4 , da , 5-ht , ne , ep , glu , gaba , and iss with positive ion detection mode . the most abundant protonated ion peaks ( [ m + h ] ) in the q1 mass spectra of bh4 , da , 5-ht , ne , ep , glu , gaba , and iss are listed in table 3 . the product ions and collision energy in q3 mass spectra of bh4 , da , 5-ht , ne , ep , glu , gaba , and iss were listed in table 3 . previously , our lab reported bh4 and dopamine levels in rat brain region . to extend this method to mouse brain regions , we applied it the bh4 and nts in the mouse brain . the peak areas of the spiked standard were constructed by subtracting the corresponding areas derived from the matrix . meanwhile , calibration using internal standardization with deuterated analogues was performed . in biological specimen analysis , the isotope - labeled analogues of the targeted analyte are often recommended . due to their similar physicochemical properties , compared to deuterated analogues , the variability during sample preparation and ionization efficiency in the transfer of analytes from liquid to gas could be compensated for , and they could be differentiated ideally by their distinct mass - to - charge ( m / z ) ratios . all analytes were subjected to hplc - ms / ms analysis , and their distinct mass - to - charge ( m / z ) ratios were determined . there are representative lc - ms / ms chromatograms of bh4 , da , and iss ( aaca and dopamine - d6 ) in the dw matrix ( figure 4 ) . also , there are 5-ht , ne , ep , glu , gaba , and iss lc - ms / ms chromatograms in the dw matrix ( figure 5 ) . we tested the newly developed method using olfactory bulb ( ob ) , frontal cortex ( fc ) , hippocampus ( hp ) , striatum ( st ) , hypothalamus ( ht ) , pituitary gland ( pt ) , midbrain ( mb ) , cerebellum ( cb ) , and brainstem ( bs ) from the mice and subsequently confirmed that the quantity of bh4 and nts ( table 4 ) . eight different concentrations from 10 to 2000 ng / g of bh4 , from 10 to 5000 ng / g of da , from 20 to 10000 ng / g of 5-ht , ne , and ep , and from 0.2 to 200 g / g of glu , gaba is plotted against is for the standard curves . the correlation coefficients ( r ) , lod , and loq of the standard curve are shown in table 1 . the lc - ms / ms methodology was used to measure the levels of bh4 and nts in nine brain regions including ob , fc , hp , st , ht , pt , mb , cb , and bs from mice . the newly - developed lc - ms / ms method was used to analyze the quantity of bh4 and nts in mice brain regions ( table 4 ) . the endogenous levels of bh4 , da , 5-ht , ne , ep , glu , and gaba were successfully detected and measured in mice brain regions .", "the present study was undertaken in order to describe a sensitive and specific lc - ms / ms method for simultaneous detection of bh4 , da , 5-ht , ne , ep , glu , and gaba from mouse brain tissue . the principal advantages of using lc - ms / ms method include a simple purification procedure and a simple chromatographic condition using the mrm scan mode . the use of a hilic column overcame the limitations of separating hydrophilic materials . therefore , hilic column could separate bh4 and da from matrix effect with an appropriate retention time . the other nts ( 5-ht , ne , ep , glu , and gaba ) were matched well with a luna 3 c18 column . so , the current developed method should be very useful for brain tissue works of research , regarding the analysis of the alternation of the levels of bh4 , da , 5-ht , ne , ep , glu , and gaba . this new method can enable measurement of bh4 and nts rapidly and accurately in brain tissues . previously , bh4 levels have been indirectly calculated by measuring the concentrations of biopterin in biological samples . however the limitation of this indirect method is that it is unable to measure the exact bh4 levels owing to rapid oxidation and degradation . to avoid the problem , we tested several experimental conditions and found that a low temperature is a critical factor to prevent decomposition of bh4 in the brain tissues extract . but the addition of antioxidant ( dte ) and/or acid ( hcl ) to the samples does not affect dramatically the stability of bh4 . keeping the treated extracts at 4c is necessary and enough to maintain bh4 stable for 4 hours , which is long enough to finish the analysis of the targets in samples . by using hilic column , bh4 and da were separated into single peaks . under other methods , many unknown materials in the biological matrix interfered with the analysis of bh4 and da in the biological samples . but the use of a hilic column could overcome the limitation to separating hydrophilic materials . so , hilic column could separate successfully the bh4 and da from matrix effect with an appropriate retention time ( figure 4 ) . in addition , it could increase the sensitivity , selectivity , and accuracy of bh4 and da in brain samples using mrm scan mode . using luna 3 c18 column , 3 m particle size ) , 5-ht , ne , ep , glu , and gaba were separated into single peaks . also , the luna 3 c18 column could separate nts from matrix effect with an appropriate retention time , and the usage of mrm scan mode could increase the sensitivity , selectivity , and accuracy of nts detection in brain samples ( figure 5 ) . the levels of bh4 and nts were measured in several brain sections by using the newly - developed experimental method ( table 4 ) . the bh4 is an essential cofactor for the aromatic acid hydroxylases , which are essential in the formation of nts ( da , 5-ht , and ne ) , as well as for nitric oxide synthase ( nos ) , a vital enzyme for normal vascular and cardiac nitric oxide . therefore , it is necessary to reliably measure the biological concentration of bh4 for the evaluation of various diseases and for screening potential therapeutic candidates in neurological diseases . these results showed that the bh4 level was at its highest in olfactory bulb , followed by cerebellum , frontal cortex , striatum , midbrain , pituitary gland , hypothalamus , brainstem , and hippocampus in a decreasing order . however , the da level was at its highest in striatum , followed by hypothalamus , midbrain , pituitary gland , and olfactory bulb in a decreasing order . interestingly , there were no detectable da in hippocampus , frontal cortex , cerebellum , and brainstem . however , the lower limit of quantification in our method is 10 ng / g in samples . therefore , even though there are some da transmissions in these regions , the amount of da in hippocampus , brain cortex , and brainstem could be below 10 ng / g . these data indicate that the level of bh4 could be distinctly correlated with the level of da in the mouse brain tissue . the 5-ht levels were at their highest in midbrain and brainstem , followed by hypothalamus , striatum , hippocampus , frontal cortex , occipital lobe , and cerebellum in a decreasing order . the ne level was at its highest in hypothalamus and pituitary gland , followed by brainstem , midbrain , olfactory blub , cerebellum , striatum , and frontal cortex in a decreasing order . the ep level was at its highest in hippocampus , followed by hypothalamus , brainstem , midbrain , olfactory blub , frontal cortex , and pituitary gland in a decreasing order . however , there was no detectable ep in cerebellum ; the levels of ne and ep have similar order in mouse brain sections . the glu level was at its highest in hippocampus , followed by frontal cortex , striatum , hypothalamus , cerebellum , midbrain , brainstem , olfactory blub , and pituitary gland in a decreasing order . the gaba level was at its highest in hypothalamus , olfactory bulb , and hippocampus , followed by midbrain , frontal cortex , striatum , cerebellum , striatum , and brainstem in a decreasing order . interestingly , the levels of glu and gaba were detected as microgram based units , but others were detected as nanogram based units . these results suggested that the neurotransmitters in mouse brain were differentially released to do their function in brain sections . however , a simple and rapid liquid chromatography tandem mass spectrometry ( lc - ms / ms ) method has been developed for the determination of bh4 , da , 5-ht , ne , ep , glu , and gaba in mouse brain ; the quantitative determination of endogenous neurotransmitters in brain regions by chromatographic coupled mass spectrometry presented here still has a limitation because of the typical lack of analyte - free matrix . there is no analyte - free sample of the authentic matrix ; therefore , we have to use a surrogate matrix containing the authentic analyte .", "a simple and rapid liquid chromatography tandem mass spectrometry ( lc - ms / ms ) method has been developed for the determination of bh4 , da , 5-ht , ne , ep , glu , and gaba in mouse brain using epsilon - acetamidocaproic acid ( aaca ) and isotopically labeled neurotransmitters as an internal standard . although it is clear that further studies are necessary to understand the physiological meaning of the different levels of bh4 and nts , this new method could be applied for tracking the changes of the endogenous bh4 and nts which are affected significantly by various stimuli or in neurodegenerative diseases [ 10 , 23 ] ." ]

[ "it plays several important physiological and pathological roles in not only reproductive system but also other systems . estrogen disorder results in various diseases , such as endometrial diseases , skeletal diseases , and reproductive system tumors . increasing attention has been paid to revealing of the functions of estrogen in physiological and pathological conditions . estrogen receptors ( er ) and , the two well established nuclear estrogen receptors , have different physiological functions depending upon their various distributions . lots of evidences show that estrogen induces the proliferation of cancer cells in breast , uterus , and ovarian cancer through er. on the contrary , activation of er can reverse this effect . notably , a novel transmembrane estrogen receptor , known as g - couple estrogen receptor ( gper ) , was found . er are involved in the initiation , migration , and progression of estrogen - related multiorgan cancers , such as breast cancer , ovarian cancer , prostate cancer , testicular cancer , liver cancer , and lung cancer as well . although increasing studied are focused on the roles of gper-1 in different types of cancers , the functions of gper-1 in cancers remain unclear yet . characteristics and functions of reproductive system cancer will be summarized and discussed in the present review .", "g - protein - coupled estrogen receptor-1 ( gper-1 ) , a seven - transmembrane - domain receptor localized in cell surface , was first identified in 1996 . gper-1 is detected broadly in numerous human tissues , such as breast , prostate , ovary , placenta , subcutaneous adipose , visceral adipose , arteries , vessels , heart , liver , lung and intestine tissues . gper-1 is a member of gpcr superfamily , which is structurally unrelated to the classical er and er. there are four transcriptional variants encoding 375 amino acids composing seven transmembrane proteins . but gper-1 binding domain exists inside the plasma membranes and the endoplasmic reticulum [ 58 ] . estradiol , the major type of estrogen , binds to gper-1 with a high affinity to gper-1 while the other two isoforms , estrone and estriol , have very low binding affinities [ 5 , 9 ] . furthermore , numbers of environmental estrogen bind to gper-1 and activate the downstream signaling pathways , such as bisphenol a , genistein , and nonylphenol . gper-1-specific compound 1 ( g-1 ) is a specific agonist of gper-1 , which has no function of er and er and was identified using virtual and biomolecular screening in 2006 . g-1 has been widely used as a target tool to evaluate the function of gper-1 in different cells and disease models . gper-1 mediates both genomic and nongenomic response with its ligands . to date , gper-1 signaling pathways have not been fully elucidated yet . the binding ligands of gper-1 , such as estrogen , g-1 , tamoxifen , and ici182,780 , cross the plasma membrane and bind to the gper-1 on endoplasmic reticulum where they activate its and subunits and subsequently activate both src and adenylyl cyclase ( ac ) leading to the intracellular camp production . the phosphorylation of src induces matrix metalloproteinase ( mmp ) production , which cleaves pro - heparan - bound epidermal growth factor ( pro - hb - egf ) releasing free hb - egf . hb - egf binds to the egfr leading to activation of multiple molecules such as ras , pi3k , akt , and erk1/2 . the downstream signal of pi3k and akt results in several nuclear receptors activation which is closely related the proliferation and migration of cancer cell . gper-1 also binds to the g - couple protein subunit and activates the phospholipase c ( plc ) , ac , and camp . activated plc results in inositol triphosphate ( ip3 ) production , which further binds to its receptor and leads to intracellular calcium mobilization .", "breast cancer is generally classified into estrogen receptor positive ( er+ ) and er negative ( er ) . in clinical practices , the endocrine treatments such as tamoxifen and aromatase are recommended in the er positive breast cancers , while there is no benefit in the er negative cancers . gper-1 is widely expressed in both of these breast cancer types and the primary breast cancers . recent clinical study results showed that the expression of gper-1 might correlate with clinical and pathological poor outcome biomarkers . other results also showed that the expression of gper-1 was inversely correlated with the er expression . coexpression of gper-1 and er was found in almost 24% patients with inflammatory breast cancer , while 19% only express er and 46% only express gper-1 . the gper-1 mrna levels were significant higher in er positive breast cancer cells compared to er negative cancer cells , and the expression of gper-1 depends on er mrna level . interestingly , gper-1 preformed a different proliferation manner in er positive mcf-7 breast cancer cell line . g-1 enhanced migration of mcf-7 breast cancer cells by activating erk1/2 and egfr signaling pathway , which is tremendously attenuated by g15 . the other evidences also approved that gper-1 is an initiator of tamoxifen resistance in breast cancers [ 1921 ] . the promotion roles of gper-1 in cancer cells proliferation and migration may be correlated with the autolysis of calpain 1 , cleavage of cyclin e , or the expression of target gene . there are also some studies which found that gper-1 inhibits the growth of er positive mcf-7 cells , which is probably through g - couple and subunits activating without camp signal activation [ 2124 ] . however , combination treatment with g-1 and her2 antibody trastuzumab exerted an additive growth inhibitory effect on breast cancer cells . thus , gper-1 inhibits er positive breast cancers proliferation which is a potential target for er positive breast cancers and drug - resistant breast cancer . deficiency of er in breast cancer is correlated with poor response to endocrine therapy . in er negative breast cancers , gper-1 stimulates the erk1/2 through the egfr / mapk signal cascade , inducing target gene like c - fos expression , which is involved in the progressing of breast malignancies [ 2729 ] . estrogen and antiestrogens can also promote the production of the early growth response-1 ( egr-1 ) , connective tissue growth factor ( ctgf ) , and insulin - like growth factor 1 ( igf-1 ) through the gper-1 [ 28 , 30 , 31 ] . grp30 activation stimulated breast cancer cells migration through ctgh , cxc receptor ( cxcr1 ) , and notch pathways . furthermore , gper-1 agonist g-1 promoted inflammation in breast cancers . gper-1 was reported to affect the deformation of breast glandular structure inducing the malignant transformation of breast tissue . gper-1 can also induce expression of cancer - associated fibroblasts ( cafs ) in tumor microenvironment [ 34 , 35 ] . on the contrary , a recent study showed that activation of gper-1 by g-1 resulted in g2/m - phase arrest and induction of mitochondrial - related apoptosis . the other studies also proved that g-1 treatment suppressed the growth of skbr3 cancer cells and increased the survival rate by inducing the erk1/2 signal activation [ 36 , 37 ] . 1520% of breast cancers are included in triple negative breast cancers ( tnbc ) , characterized by lack of er , progesterone receptor ( pr ) , and egfr2 ( her-2 ) . a higher rate of recurrence and aggressive biological features were found in younger females [ 38 , 39 ] . gper-1 expression was found in majority of tnbcs patients . in the gper knockdown mice model , the proliferation of tnbcs , these findings suggest that gper plays a key role in putative mechanism for tnbcs and gper might be a therapeutic target for tnbcs . snps of gper-1 , histone acetylation , and transcription factor recruitment were significantly associated with tumor size and histological grading [ 42 , 43 ] . gper rna as well as gper-1 protein presents in both primary and malignant ovarian tumor tissues . the expression of gper-1 was significantly increased in ovarian carcinomas compared to pericarcinomatous tissues impendent with the expression of egfr , er , and er . estrogen and g-1 induce ovarian cancer cell growth responses via egfr - mapk signaling pathways . furthermore , gper-1 promoted the migration and invasion of ovarian cancer cells ovcar5 which is characterized by negative er and positive gper by increasing the expression mmp-9 [ 48 , 49 ] . atrazine , one of the most common pesticide contaminants , promoted ovarian cancer cells proliferation via induction of erk and expression of estrogen target gene through gper-1 pathway . but other studies results showed that g-1 suppressed proliferation and induced apoptosis of human ovarian cancer cells probably through inhibition of cell cycle progression in g2/m - phase in ovarian carcinomas [ 51 , 52 ] . \n gper-1 has been shown to be involved in a variety of hormone - dependent cancers . it is well understood that estrogens play a critical role in pathological germ cell proliferation in testicular germ cell tumors . gper-1 seems to be involved in modulating the growth of estrogen dependent testicular cancer cells . estrogen induces the high expression of gper-1 correlated with low levels of er in human testicular carcinoma in situ and seminomas [ 53 , 54 ] . bisphenol a , a common environmental estrogen , can also promote the proliferation of testicular seminomas cells through gper-1 . the above findings suggested that gper-1 may be a potential therapeutic target [ 56 , 57 ] . estrogen has an efficacy for advanced prostate cancer ( pc ) via the mediation of the classical estrogen receptors . the effects of er on pc growth and metastases have different mechanisms in different cellular microenvironments . the expression of gper-1 is higher in the preneoplastic lesions and normal areas of benign prostate than the basal epithelial cells . g-1 , the selectively activating gper-1 , inhibited the growth of multiple pc cells in vitro and in vivo through erk1/2 and c - jun / c - fos signaling pathways , which indicates that the g-1 may be a new option for pc through targeting gper-1 . g-1 inhibited castration - resistant phase but had no effect on androgen - sensitive tumors . the antitumor effect of g-1 on cr tumors was related to necrosis ( approximately 65% ) accompanied with neutrophils infiltration . g-1 can also upregulate neutrophil - related chemokines and inflammation - mediated cytokines in the cr tumors . in one word", "there are other studies which proved that gper-1 induced proliferation , differentiation , and drug resistance of lung cancers [ 63 , 64 ] , thyroid cancers , bladder cancers , and oral squamous carcinomas . more studies to reveal the functions and mechanisms of gper-1 in the other system cancers are warranted .", "majority of the study results addressed that activation of gper-1 by estrogen and g-1 results in the downstream signals and target genes activation , which promotes the proliferation , migration , and invasion of cancer cells . and this effect is in nonclassical er expression dependent manner in most cancers except for ovarian cancers . it is interesting that several other studies showed that g-1 , the special agonist of gper-1 , promoted the expression of gper-1 and inhibited the proliferation of er negative breast cancer cells , ovarian cancer cells , and prostate cancer cells . the opposite effects of gper-1 in cancer cells may be associated with the epigenetic of gper-1 , such as the snps and histone acetylation . the different cell types , tumor microenvironment , and hormonal level may also affect the functions of gper-1 . controversies still exist on the gper-1 localization and related signaling pathways , in particular the potential action as proapoptotic mediator . since the function and mechanisms of gper-1 are still unclear , more researches and clinical studies are strongly warranted to clarify the different function and mechanisms in different cancer types and conditions ." ]

[ "ensemble hi - c protocol to create a method to determine the contacts in an individual nucleus ( fig . 1a , supplementary information ) . we used male , mouse , spleenic cd4 t cells , differentiated in vitro to t helper ( th1 ) cells to produce a population of cells ( > 95% cd4 ) , of which 69% have 2n genome content , reflecting mature cell withdrawal from the cell cycle . chromatin cross - linking , restriction enzyme ( bgl ii or dpn ii ) digestion , biotin fill - in and ligation were performed in nuclei ( fig . 1a ) as opposed to ensemble hi - c where ligation is performed after nuclear lysis and dilution of chromatin complexes . we then selected individual nuclei under the microscope , placed them in individual tubes , reversed cross - links , and purified biotinylated hi - c ligation junctions on streptavidin - coated beads . the captured ligation junctions were then digested with a second restiction enzyme ( alu i ) to fragment the dna , and ligated to customized illumina adapters with unique 3 bp identification tags . single cell hi - c libraries were then pcr amplified , size selected and characterized by multiplexed , paired - end sequencing . de - multiplexed single cell hi - c libraries were next filtered thoroughly to systematically remove several sources of noise ( extended data fig . hi - c in male diploid cells can theoretically give rise to at most two ligation products per autosomal restriction fragment end , and one product per fragment end from the single x chromosome . using bgl ii , the total number of distinct mappable fragment - end pairs per single cell can not therefore exceed 1,201,870 ( extended data fig . deep sequencing of the single cell hi - c libraries demonstrated that following stringent filtering our current scheme allows recovery of up to 2.5% of this theoretical potential , and has identified at least 1000 distinct hi - c pairings in half ( 37/74 ) of the cells . deep sequencing confirmed saturation of the libraries complexity , and allowed elimination of spurious flow cell read pairings and additional biases ( extended data tables 1 - 3 ) . based on additional quality metrics we selected ten single cell datasets , containing 11,159 - 30,671 distinct fragment - end pairs for subsequent in - depth analysis ( extended data fig . visualization of the single cell maps suggested that despite their inherent sparseness , they clearly reflect hallmarks of chromosomal organization , including frequent cis - contacts along the matrix diagonal and notably , highly clustered trans - chromosomal contacts between specific chromosomes ( fig .", "we used the same population of cd4 th1 cells to generate an ensemble hi - c library . sequencing and analysis of 190 million read pairs produced a contact map representing the mean contact enrichments within approximately 10 million nuclei . the probability of observing a contact between two chromosomal elements decays with linear distance following a power law regime for distances larger than 100 kb . we found similar regimes for the ensemble , individual cells and a pool of 60 single cells ( fig . 1c ) . moreover , after normalizing the matrices given this canonical trend , comparison of intra - chromosomal interaction intensities for the pool and ensemble , by global correlation analysis of contact enrichment values at 1 mb resolution generates a highly significant correspondence ( fig . this is emphasized by the high similarity observed in comparisons of individual chromosomes from ensemble and pooled hi - c maps ( fig . despite different experimental procedures and sparse nature of the single cell matrices , the pooled matrix retains the most prominent properties of the ensemble map , confirming the validity of the approach and prompting us to further explore the similarities and differences among the individual cell chromosomal conformations .", "a key architectural feature of ensemble hi - c datasets is their topological domain structure . as expected 1403 domains were identified in the th1 cell ensemble hi - c map ( supplementary information table 1 , and supplementary information ) . we used the ensemble domains to ask whether the same domain structure can be observed at the single cell level . visual inspection of the domain structure overlaid on individual intra - chromosomal contact maps ( fig . 2a ) , and global statistical analysis of the ratios between intra- and inter - domain contact intensities in individual cells ( approximately 2-fold enrichment on scales of 100 kb to 1 mb , fig . 2a ) , both supported the idea that domains are observed consistently in the single cell maps . to test whether domain structures are variable between individual cells , we estimated the distributions of intra - domain contact enrichments across cells and compared it to the distributions derived from reshuffled maps . we reasoned that cell - to - cell variation in intra - domain contact intensities would result in an increase of the variance of this distribution compared to the expected variance resulting from sampling contacts in uniformly ( shuffled ) intra - domain contacts . 2c ) , showed that the distributions for the intra - domain enrichments in real cells are not more varied than expected ( kolmogorov - smirnov p < 0.52 ) . a similar observation was derived by comparison of the correlations between intra - domain contact enrichments for pairs of real and pairs of reshuffled maps ( extended data fig . while this analysis can not quantify variability in the high - resolution internal structure of domains , the data suggests that domain intactness is generally conserved at the single cell level . visual comparison of whole chromosome contact maps ( fig . 2d ) suggested that unlike intra - domain interactions , inter - domain contacts within single cell chromosomes are structured non - uniformly . the maps showed large - scale structures as indicated , for example , by specific insulation points separating chromosomes into two or more mega - domains in a cell - specific fashion . to rule out the possibility that this can be explained by sparse sampling of contacts in each single cell map real or randomized ) we quantified the frequency of loci that strongly polarize the matrix into two weakly connected submatrices ( using an insulation score ; supplementary methods ) . we confirmed that single cell maps indeed show many more such loci than reshuffled maps ( fig . the reshuffled controls made by mixing contacts from different single cell maps , are in fact similar to sparse versions of the ensemble map , which do not show specific structure at the intra - domain level . along similar lines , the correlation in contact intensities between domains on the same chromosome in pairs of single cell maps is lower compared to reshuffled controls ( fig 2f ) . taken together , these data show that domains form a robust and recurrent conformational basis that is evident in each of the single cells . however , inter - domain contacts are highly variable between individual cells , suggesting large - scale differences in higher - order chromosome folding that are obscured in ensemble maps , averaged over millions of such structures .", "to determine whether the single cell hi - c data is consistent with unique chromosome conformations we developed a modeling approach to reconstruct the conformations of the single - copy , male x chromosome . we used intra - chromosomal contacts as distance restraints and calculated structural models using a simulated annealing protocol to condense a particle - on - a - string representation of individual chromosomes from random initial conformations ( supplementary information ) , to produce both fine - scale and low - resolution models , with backbone particles representing either 50 or 500 kb of the chromosome , respectively . for fine - scale calculations , each intra - chromosomal contact restrained its precise position on the chromosome , while low - resolution calculations combined contacts into larger bins . tests of our simulation protocol demonstrated that restraint density was the most important parameter for modeling ( extended data fig . hence , from the ten high - quality single cell datasets , we selected six with the largest numbers of intra - chromosomal x contacts , plus one with a lower number of contacts ( cell-9 ) for contrast . repeat calculations starting from random positions generated 200 x chromosome models for each cell at both scales . the fine - scale models displayed very low numbers of restraint violations ( extended data fig . we introduced an estimated average unit dna distance length to approximate packaging of chromatin fibers ( ~0.15 m/50 kb ) ( supplementary information ) . this resulted in models with a mean x chromosome territory diameter of 4.3 m ( range 3.3 - 5.9 m ) , in good agreement with x chromosome paint fish in th1 cells ( fig . we confirmed that the restrained points in a single cell are indeed close in the structures calculated from them ( extended data fig . interestingly , the single cell distance matrix demonstrates how the network of contacts in a model imparts further structural information beyond the directly observed contacts ( extended data fig . comparison of the low - resolution models demonstrated convergence toward a single conformation for each single cell dataset ( fig . hierarchical clustering revealed 4 - 5 that were most representative of the data ( fig . 4a , b ) . highlighting four regions of the x chromosome showed large - scale conformational differences between cells ( fig . models created by shuffling hi - c contacts , or combining contacts from two cells resulted in structures smaller and more compact than observed chromosome territories ( extended data fig . 4c , d ) with many restraints stretched toward or exceeding their upper bounds ( extended data fig . these results reaffirm that the variation in single cell contacts is not the result of partial sampling of a single underlying structure . we next asked whether despite their cell - to - cell variability , x chromosome structures share common folding properties that could be tested in real cells . one such important property , which is often consistent within a cell population , and with multiple potential functional implications , is localisation within the chromosomal territory relative to its surface . to predict loci with consistent positions within their chromosome territory we calculated the structural density along the x chromosome ( supplementary information ) and identified regions with consistently high or low structural density ( fig . we chose five such regions ( p1-p5 ) with predicted positions near the surface ( p1 , p2 , p5 ; low structural density ) or inside ( p3 , p4 ; high structural density ) the model x chromosome territories using the 1200 models from the six cells ( extended data fig . we then performed double label dna fish with x chromosome paints and p1-p5 bac probes ( fig . the distances between dna fish signals and edge of the chromosome territory in over one hundred th1 cells showed that probes p1 , p2 and p5 were indeed found predominantly outside or toward the edge of the chromosome territory , whereas signals for probes p3 and p4 were found at internal positions ( fig . these data show that despite highly variable inter - domain structure of the x chromosomal territory , some of its key organisational properties are robustly observed across the cell population .", "overlaying data from trans - chromosomal contacts on the x chromosome models demonstrates that trans - chromosomal contacting regions are strongly enriched toward the inferred surface of the models ( fig . these observations prompted us to further explore the structural characteristics of interfaces between chromosomal territories , and the relationships between such interfaces and the domain structure of the territory itself . we found that trans - chromosomal contact enrichments of domains vary across cells ( fig . 4a ) , showing a significant difference between the mean contact enrichment per domain in the real and reshuffled maps ( p < 1.2e-9 , kolmogorov - smirnov test ) . the higher variance of the distribution for the real data suggests some domains are more likely to contact elements on other chromosomes . previous work has suggested that active genomic regions on the sub - domain scale often loop out of their chromosome territories , which might imply less defined local domain structures and disassociation from their chromosome territory . however , our analysis shows that trans - contacting domains retain domain organisation , as demonstrated by the intra - domain contact probabilities within them ( fig . trans - contacting domains show slightly reduced contact intensity to other domains on the same chromosome ( fig . 5c , d ) , consistent with localisation on the interfaces of their territories rather than dissociation from them . analyses of ensemble hi - c data have previously shown that active marks correlate with enrichment of trans - chromosomal contacts . using the single cell maps combined with annotation of domains based on their enrichment for histone h3 lysine 4 tri - methylation ( h3k4me3 ) hotspots ( fig . 4d ) , we tested whether this correlation is the result of low frequency re - localisation of active domains to other chromosome territories ( looping out ) , or from frequent localisation of active domains on territory interfaces . as shown in fig . 4e , domains with high trans- to cis - chromosomal contact ratios ( excluding intra - domain ) are highly correlated with h3k4me3 enrichment in all cells . however , the data show that domains ( including active ones ) retain their association with the territory in almost all cases . very few domains with strong trans - contacts were found to lack association with their own territory ( i.e. , upper left points in graphs in fig . 4e ) . some of this lack of perfect territory re - localisation can be explained by having two copies of each autosomal domain , but the overall reduction with territory association for trans - contacting domains is much smaller than the 50% expected by this explanation ( reduction estimated at 15 - 20% and 10% for contacts across 1 - 5 mb and 10 mb , respectively , fig . 4c ) . comparison of active domain localization shows that different active domains are highly trans - contacting in each cell ( extended data fig . 5e ) . together , these data show that preferential localisation of active domains to territory interfaces is a hallmark of chromosome organisation in all cells . active domains maintain their intra - domain organisation , and only partially lose intra - chromosomal contacts with other domains . our data are consistent with the concept that chromosomal territories are maintained robustly despite the trans - chromosomal contacts between active domains . interestingly , domains associated with lamin - b1 , which are thought to be primarily inactive regions , are also found toward the surface of the models ( fig . 3h ) . however , these domains are highly anti - correlated with h3k4me3 domains ( spearman s correlation = 0.73 ) and typically depleted of trans - chromosomal contacts ( extended data fig . superposition of h3k4me3 , lamin - b1 enriched domains and trans - chromosomal contacts on the x chromosome models illustrates spatial partitioning of the active , trans - contacting regions from those that are lamin - associated , although both types of domains tend toward the surface of the chromosome territory , supporting the above descriptions of differential positioning of domains ( extended data fig . ensemble hi - c maps generate a highly complex view of chromosomal contacts , including low intensity contacts between all possible chromosomal pairings . in contrast , years of single cell analyses by microscopy have suggested that individual cells have much simpler and discrete chromosome structures involving a limited number of interfaces between spatially constrained chromosomal territories . our single cell maps bridge the gap between the genomic and imaging techniques , showing cell - specific clusters of trans - chromosomal contacts associating some pairs of chromosomes , and a lack of contacts between other chromosome pairs ( fig . 5a , red ) confirming it is not a consequence of sparse contact sampling ( extended data fig . trans - chromosomal contact clusters bring pairs of domains together , as shown by comparing the enrichment in trans - contacts between pairs of elements connecting the same two domains and pairs connecting one domain with two different domains ( fig . such synergistic contacting preferentially brings together pairs of active domains , with interaction between active and inactive domains being underrepresented ( fig . although inactive domains are depleted as a group from trans - chromosomal interactions ( fig . 4e ) , inactive domains that engage in trans - contacts are more likely to interact with other inactive domains . interestingly , analysis of interacting pairs of domains suggests that the number of chromosomes contacted by each chromosome is relatively constant ( less than 30% difference ) despite the > 3-fold change in chromosome size , the total number of trans - chromosomal contacts in the map , or a number of other factors ( fig . we note that even though the total number of chromosome - chromosome interfaces per single cell is bounded , the detailed interface between chromosome pairs can involve multiple domain - domain contacts reflecting higher order organization ( extended data fig . overall , these results indicate that each chromosome contacts a discrete and fairly constant number of other chromosomes in a single cell , with little dependency on the chromosome size . at the single cell level both the microscopic and genomic observations therefore indicate highly defined territory structures , which can be hypothesised to harbor much of the chromosome within the territory , and expose a limited , relatively constant surface area engaged in chromosome - to - chromosome interfaces . since these interfaces are highly variable among different cells , their averaging by ensemble hi - c contributes toward the relatively uniform trans - chromosomal contact matrices previously reported . we have presented a new experimental strategy to create hi - c contact maps from single cells . the approach allows for characterization of thousands of simultaneous contacts occurring in individual cells , and provides unique insights into hi - c technology and 3d chromosomal architecture ( supplementary videos 3 and 4 ) . single cell contact maps reflect conservation of domain structure that was recently characterized , but show that inter - domain and trans - chromosomal contact structure is highly variable between individual cells . genome - wide statistical analysis and reconstruction of the single copy x chromosome models gave us the opportunity to quantify key features of chromosomal architecture . for example , active domains tend to locate on the boundaries of their chromosomal territories in the majority of nuclei , while maintaining associations with other domains on the same chromosome . our results do not exclude chromosome territory intermingling , but argue against domains becoming completely immersed in other territories . coupled with previous observations of small and large - scale chromatin mobility a highly dynamic view of chromosomal organization ermerges , where territories are continuously being remodeled , while maintaining some key local ( domain ) and global ( depth from surface ) organisational features .", "male th1 cells were fixed and subjected to modified hi - c , in which nuclei were maintained through restriction enzyme digestion , biotin fill - in labelling and ligation . single nuclei were isolated and processed to prepare single cell hi - c libraries for paired - end sequencing . sequences were mapped to the mouse genome , and abnormal read pairs were discarded . read pairs that occurred only once ( without duplication ) in the library sequencing were removed . we chose 10 single cell datasets for further in - depth analyses based on several quality criteria ( see supplementary information ) . to validate the single cell hi - c procedure , we pooled the single cell hi - c datasets and compared them to ensemble hi - c dataset prepared from approximately 10 million cells essentially as described . we created reshuffled datasets by randomly redistributing contacts of the analyzed single cells to create the same number of cells with the same number of contacts in each cell as a control to statistically analyse the variation among single cell datasets . we reconstructed three - dimensional x chromosome structure models using restrained molecular dynamics calculations employing a simulated annealing protocol . a combination of unambiguous distance restraints from the x intra - chromosomal contacts in the single cell hi - c dataset and anti - distance restraints between regions that were found not to contact each other in the ensemble hi - c dataset was used . to assess the precision and accuracy of the structure generation process we used the protocol to generate synthetic hilbert curve structures , and explored the impact of varying the number of restraints . for pair - wise comparison of the structures , we calculated the root - mean - square deviation ( rmsd ) . to compare the x chromosome models to x chromosome structure in vivo , we selected five loci with consistently high or low structural density in the models , and compared distances between the loci and the x chromosome territory surface in cells ( dna fish ) .", ". a , shown are the numbers of read - pairs in the original and re - sequenced runs , the number of fend - pairs in the original one , the number of fend - pairs when combining the sequences of the two runs , and the addition to fend - pairs the re - sequencing contributed . % valid non - amplified are the percentages of singly covered fend - pairs in the original sample that were supported by more read - pairs in the re - sequenced one . these fend - pairs were discarded as potential spurious pairs in the original run , but proved by the re - sequencing to be valid pairs . this gives a sense of the fraction of valid pairs we discard when removing the read - pairs suspected to be sequencing pairing errors . b , shown are fend - pair coverage contingency tables of the original and the re - sequenced runs for the five single - cells . mouse and human nuclei or single cell hi - c samples were mixed in different stages of the experiment ( group a , before fixation ; group b , before library construction [ so all the mouse and human samples in each library have the same identification tag ] ; group c , before library amplification [ so mouse and human samples in each library have different identification tags ] ) . we created single cell ( for group a ) or human / mouse two cell ( for groups b and c ) hi - c libraries and analysed them . the table shows the percentages of the three possible read - pairs : mouse - mouse ( mm9-mm9 ) , human - human ( hg18-hg18 ) and human - mouse ( hg18-mm9 ) . for group a , we selected mouse cells based on morphology . in group a , all six libraries contain almost exclusively mouse - mouse read - pairs with insignificant human - human or mouse - human pairs . each group b library has both human - human and mouse - mouse read - pairs as expected , and the number of spurious human - mouse read - pairs is extremely low . in each group c library , which was created by amplifying the distinctly tagged human ( c1-c6 ) and mouse ( c7-c12 ) single cell samples in the same tube ( e.g. , c1 and c7 , c2 and c8 , etc . ) , the fractions of foreign pairs ( human reads with a mouse tag and vice versa ) and of spurious pairs ( human - mouse ) were consistently extremely low . to estimate the fraction of foreign and spurious pairs that could have originated simply from mapping a truly pure mouse library to a concatenated human - mouse genome , libraries from pure mouse cells ( group d ) were mapped to such a genome . the mean percentages of both foreign and spurious fend - pairs in this lane are the same as those found in the different human - mouse mixed lanes , suggesting there is no inter - cellular contamination . phix174 dna library was added to four lanes of single cell hi - c multiplexed libraries . in theory , no mixed mouse - phix174 read - pair is expected , but in fact a small number were detected . shown are the fraction of phix174 dna loaded to each lane capacity , the percentage of phix174 read - ends in the lane , and the observed number of read - pairs by type . the pairing probability was crudely estimated from these figures , and from it the number of expected spurious mouse - mouse read - pairs was calculated . most of these spurious pairs are discarded when the unique identification tags at the beginning of each read - end are matched . shown is the estimated number of spurious mouse pairs that coincidently have matching identification tag and are therefore not detected and removed . a , efficiency of biotin labelling at hi - c ligation junctions for two hi - c ligation products , showing 90 - 95% efficiency ( supplementary information ) . c , discarding the missed re2 read - pairs removes a uniform blanket of non - specific contacts from the map . shown is the dependency between the number of fend - pairs in a sample and the estimated number of autosomal fends covered by more than two fend - pairs under different models . the binomial model ( grey line ) distributes fend - pairs to fends randomly without any constraint , as if sampling fend - pairs from an infinite number of chromosomes . number of fends in each 250 kb genomic bin for bgl ii or dpn ii as re1 . tail of bins with few fends is for bins of low mappability and near the chromosomes edges . f , median fend length ( distance from re1 to the first upstream re2 ) in each 250 kb genomic bin for bgl ii or dpn ii as re1 . g , information on the two restriction enzymes we used for re1 , bgl ii ( 6 cutter , which we used predominantly ) and dpn ii ( 4 cutter , only used for cell-8 ) . fends in which their first re2 site starts a non - unique 36 bp sequence are marked as non - unique fends . we discarded both blind and non - unique fends and used only the unique fends . the number of actual fends in a male mouse genome , which have two copies of each autosome and a single x chromosome are shown as well as the median fragment length ( chromosomes y and mitochondrial genome were ignored throughout the analysis ) . h , information on the ten single - cell datasets that successfully passed the quality control filters . p - value of the number of autosomal fends with more than two covering fend - pairs was calculated from the binomial model ( panel d and supplementary information ) . k , distribution of fend - pair coverage ( number of read - pairs that support each fend - pair ) in the ten single - cell datasets . l , distribution of mean contacts per fend calculated for each mappable 1 mbp , normalized by the mean value in each cell , and averaged across autosomal or x chromosomes from the ten single - cells . a , ratios between intra - domain and inter - domain contact enrichments over genomic distance . chromosomes are grouped into four groups : group 1 ( chromosomes 1 , 8 , 15 , 16 and x ) , group 2 ( chromosomes 2 , 6 , 10 , 13 and 18 ) , group 3 ( chromosomes 3 , 5 , 11 , 14 and 17 ) and group 4 ( chromosomes 4 , 7 , 9 , 12 , 19 ) . the intra- over inter- domain enrichment is persistent in all chromosome groups and does not seem to stem from peculiar chromosomes . b , distribution of correlations between intra - domain contact numbers of all domains from pairs of real and reshuffled controls . c , distribution of the insulation score at each fend in nine single cell hi - c datasets ( where re1 is bgl ii ; real cells ) is shown in red . fifty sets of reshuffled cells were produced ( see supplementary methods ) and their insulation score distribution is shown in black . real cells have a heavier tail of highly insulating loci , which is indicative of non - uniform and cell - specific inter - domain contact structure . a , results of structure calculations using restraints from a space - filling hilbert curve test structure with 4096 particles and four typical results of structure modelling using different numbers of restraints are shown ( upper panels ) . structure calculations of the hilbert curve from random positions using different sets of 1024 restraints ( lower panel ) . b , comparison of rmsd values from hilbert curve and single cell x chromosome models . structure calculations for hilbert curves were repeated 100 times with variable numbers of restraints as shown . the root mean square deviation ( rmsd ) values between 100 models ( precision ) using the indicated number of restrains ( mean + / sd ) are plotted in blue . the rmsd values between the original hilbert curve and each of the 100 models ( accuracy ) for the same numbers of restraints are plotted in green ( mean + / sd ) . rmsd values from 100 repeated calculations of fine - scale ( 50 kb backbone ) x chromosome structure from the seven single cell datasets are also plotted ( red ; mean + / sd ) . the distances between directly restrained positions in fine - scale ( 50 kb backbone ) x chromosome models are shown . models for the six single cell datasets ( cell-1 to cell-6 ; red ) show no values exceeding the upper bound ( dashed line ) . calculations with six shuffled interaction maps ( created from cell-1 dataset ; blue ) show significant violations . structure calculations performed on merged pairs of datasets ( yellow ; all possible combination of cell-1 to cell-4 ) have a few violations and are significantly closer to the upper limit . d , comparison of structure - derived distance matrix from 200 fine - scale x chromosome models from cell-1 ( orange ) and its single cell hi - c contacts ( black crosses ) . the orange colour indicates the minimum distance between backbone particles . e , comparison or x chromosome structural models for six cells computed using low - resolution ( 500 kb binned ) single - cell hi - c interaction data . the bundles shown represent minimised structural alignments of five models from repeat calculations for each cell . a , pair - wise comparison of fine - scale x chromosome structural models by rmsd analysis . each pixel represents an rmsd value for a pair - wise comparison of two models . the order of 200 models in each panel was determined by hierarchical clustering of the rmsd values . numbers shown are the mean rmsd values and the standard deviations for all the comparisons for each cell calculated by comparing the hi - c contact particles . b , cell - to - cell comparison of 200 fine - scale x chromosome structural models by rmsd analysis . each pixel represents an rmsd value for a pair - wise comparison of two models . c , fine - scale x chromosome structures calculated from cell-1 and cell-3 datasets , and a structure from the combined dataset . d , typical structure calculated using a randomised dataset , where the interacting points for cell-1 have been shuffled with a pairing probability proportional to one over the square root of the sequence separation . colours and scale as shown in c. e , distribution of measurements of depth from the surface for five loci p1 - p5 ( fig . 3e ) in 1200 x chromosome models ( 200 fine - scale models for each of the six cells ) . whiskers on box plots define 10th and 90th percentiles and the outliers are shown as individual dots . a , intra - domain contact enrichment for each quartile of trans - chromosomal contacting domains . b , same as a but subtracting the mean quartile enrichment in each genomic distance emphasizing the differences shown in a. c , using the same sets as in a but plotting the enrichment of inter - domain contacts within the same chromosome . d , same as c but subtracting the mean quartile enrichment in each genomic distance . e , percentage of cells in which high and low h3k4me3 enriched domains are trans - interacting . for each cell the domains with top 10th percentile trans intensity were defined as trans - interacting in that cell . we then counted for each domain the fraction of cells in which that domain was trans - interacting . shown are the distributions of these fractions for h3k4me3 enriched and non - enriched domains ( the top and bottom 25th percentiles , respectively ) . f , distribution of the average laminb1-damid enrichment in chromosomal domains , color coded according to the enrichment value . g , domains plotted according to their number of trans- and cis - chromosomal ( but excluding intra - domain ) contacts , color - coded as in f. the domain laminb1-damid enrichment and h3k4me3 peak density are highly anti - correlated ( spearman s correlation = 0.73 ) . h , intra - domain contact enrichment for high vs. low quartile of domains stratified by their mean laminb1-damid enrichment . error bars indicate 95% confidence intervals . i , using the same sets as in h but plotting the enrichment of inter - domain contacts within the same chromosome error bars as in h. j , lamin - b1 domains show a minor decrease in intra - domain contact intensities that might suggest less compacted domains , and significantly increased cis inter - domain contact , maybe due to lack of trans - chromosomal contacts . topology of lamin b1 , h3k4me3 and trans - contacts on five - model bundles of low - resolution x chromosome models . scale bar , 1 m . a , comparison of observed coverage of the trans - chromosomal 1 mb square bins of each cell ( red lines ) , versus predicted coverage assuming a binomial model ( random uniform distribution of contacts to bins ; black dashed line ) . observed coverage is consistently higher than the uniform model , indicating the highly non - random distribution of trans - chromosomal contacts to genomic bins . b , trans - chromosomal contact enrichment around observed trans contacts as a function of the contacts total distance on both chromosomes ( manhattan distance in the contact map ) . observed and expected ( by random uniform contact distribution ) number of contacts are counted around each trans contact , and their ratio is shown for the 9 real cells ( blue ; where re1 is bgl ii ) and reshuffled cells ( red ) , at two different scales . c , left panel , trans contacts were classified according to h3k4me3 density of the domains they associate : high and low for top and bottom 25th percentiles , respectively , mid for 25th-75th percentiles . shown is the log ratio of the contingency table counts with the expected counts generated by multiplying the corresponding marginal probabilities for each group ( chi - square test ; p = 5.8e-18 ) . to make sure this phenomena is not caused by the trans enrichment of active domains and depletion of non - active ones , only the top 15th percentile trans enriched domains from each cell were used . middle panel , similar to left panel but contacts are classified by their associated domain gene density ( chi - square test ; p = 2.3e-12 ) . right panel , similar to left panel but using domains in the top 40th percentile of gene density , classifying by their h3k4me3 density , to test h3k4me3 enrichment beyond gene density ( chi - square test ; p = 3.6e-06 ) . in all cases active / gene - rich domains preferentially interact with each other , although active domains ( high h3k4me3 density ) interact beyond that expected by their gene density . a , the number of interacting chromosomes per chromosome is depicted in circles sized according to the number of single cells the value was observed in , while ordering chromosomes by the number of transcription start sites ( tsss ) in each chromosome which is shown by blue bars . spearman correlation between the number of tsss and the mean value of the number of interacting chromosomes per chromosome is 0.18 . two chromosomes were defined as interacting when they had at least one domain - domain interaction ( see main text ) supported by two or more contacts . however , the change is small , and the number of interacting autosomal chromosomes per chromosome ( the plotted value divided by two ) remains between 4 and 6 . b , same as a except that chromosomes ordered by the number of active h3k4me3 domains ( the top 25th percentile h3k4me3 peak density domains ) . c , same as a except that chromosomes are ordered by the number of non - lad basepairs in the chromosome . the fraction of a chromosome covered by lads ranges from 31% to 53% and is correlated with chromosome size ( 0.52 spearman ) . thus , chromosome lengths span a range of 3.2 fold change , while their non - lad fraction spans a smaller range of 2.8 fold change . the mean number of contacts of each chromosome with others it interacts with is shown for the ten single cells , ordering chromosomes by their size . chromosome size is correlated with the number of contacts it has , but the dynamic range of this number is small . e , the number of interacting chromosomes per chromosome is depicted in circles sized as the number of single cells the value was observed in , while ordering the ten single cell datasets by the number of trans contacts in each dataset , shown by blue bars . only autosomes are displayed . spearman correlations between the number of trans contacts in each dataset and the mean value of the number of interacting chromosomes per chromosome is 0.73 . however , the change is small , and the number of interacting autosomal chromosomes per chromosome ( the plotted value divided by two ) remains between 4 and 6 . top and bottom 30th percentiles of h3k4me3 peak density domains are marked in light pink and light grey , respectively . note the grid - like trans contacts arrangement , and the correspondence between the two large trans contact clusters and the organisation of cis contacts in both chromosomes to large mega domains ." ]

[ "oligonucleotides were synthesized on an expedite automated dna / rna synthesizer ( applied biosystems , foster city , ca ) using nucleoside phosphoramidites purchased from glen research ( sterling , va ) . all oligonucleotides were purified by denaturing polyacrylamide gel electrophoresis ( page ) and desalted using a c18 sep - pak cartridge ( waters , milford , ma ) . histidine - tagged t7 rna polymerase was purified from e. coli strain bl21 containing plasmid pbh161 ( kindly provided by william mcallister , state university of new york , brooklyn ) . thermus aquaticus dna polymerase was cloned from total genomic dna and purified as described previously30 . m1 rna , the catalytic subunit of rnase p , was obtained from e. coli genomic dna ( sigma - aldrich , st . louis , mo ) by pcr amplification and subsequent in vitro transcription , as described previously1 . calf intestine phosphatase and t4 polynucleotide kinase were purchased from new england biolabs ( ipswich , ma ) , yeast inorganic pyrophosphatase was from sigma - aldrich , and bovine pancreatic dnase i was from roche applied science ( indianapolis , in ) . nucleoside and deoxynucleoside 5-triphosphates , theophylline , and fmn were purchased from sigma - aldrich , [ -p]atp ( 7 ci / pmol ) was from perkin elmer ( waltham , ma ) , and caffeine was from mp biomedicals ( solon , oh ) . photinus pyralis ( firefly ) luciferase , saccharomyces cerevisiae adenosine-5-triphosphate sulfurylase , adenosine 5-phosphosulfate , and d - luciferin were from sigma - aldrich . bovine calf serum was from omega scientific ( tarzana , ca ) and superasin ( rnase inhibitor ) was from ambion ( austin , tx ) . all rna enzymes and substrates were prepared by in vitro transcription in a reaction mixture containing 0.4 m dna template , 0.8 m synthetic oligodeoxynucleotide having the sequence 5-ggactaatacgactcactata-3 ( t7 rna polymerase promoter sequence underlined ) , 2 mm each of the four ntps , 15 u/l t7 rna polymerase , 0.001 u/l inorganic pyrophosphatase , 15 mm mgcl2 , 2 mm spermidine , 5 mm dithiothreitol , and 50 mm tris - hcl ( ph 7.5 ) . the mixture was incubated at 37 c for 2 h , quenched by adding an equal volume of 15 mm na2edta , treated with 1 u/l dnase i , and extracted with a 1:1 mixture of phenol : chloroform . transcription of m1 rna was performed similarly , except employing a double - stranded dna template that was generated by pcr . the a and a substrates could not be obtained reliably by in vitro transcription due to heterogeneity at the 3 end of the transcripts . instead , these substrates were prepared from the corresponding e or e molecules by cleaving off the b or b portion using e. coli m1 rna , as described previously1 . the external guide sequence rna for cleavage of etheo and efmn had the sequence 5-cguaaguugcggucucacca-3 , and for etheo and efmn had the sequence 5-auauucaugcggucucacca-3 ( nucleotides complementary to the target rna underlined ) . for the second pair of etheo and etheo molecules used in the multiplex experiments , the external guide sequence rnas had the sequence 5-cguaguaugcggucuacca-3 and 5-gaauaucauugcggucucacca-3 , respectively . the a and a substrates were [ 5-p]-labeled by first dephosphorylating using calf intestine alkaline phosphatase , then phosphorylating using t4 polynucleotide kinase and [ -p]atp . the labeled substrates were purified by page and desalted using a nensorb 20 cartridge ( nen life sciences , waltham , ma ) . rna - catalyzed rna ligation was performed in a reaction mixture containing 5 m e or e , 0.1 m [ 5-p]-labeled a or a , 6 m b or b , 25 mm mgcl2 , and 50 mm epps ( ph 8.5 ) , which was incubated at 42 c . aliquots were taken at various times and quenched by adding an equal volume of gel - loading buffer containing 50 mm na2edta and 18 m urea . the products were separated by page and quantitated using a pharosfx molecular imager ( bio - rad , hercules , ca ) . the data were fit to the equation : ft = fmax(a1ek1t)(a2ek2t ) , where ft is the fraction reacted at time t , fmax is the overall maximum extent of the reaction , a1 and k1 are the amplitude and rate of the initial fast phase , and a2 and k2 are the amplitude and rate of the subsequent slow phase , respectively . in the presence of 5 mm theophylline , the reaction catalyzed by etheo exhibited a fast phase with an amplitude of 0.57 and rate constant of 1.4 min , followed by a slow phase with an amplitude of 0.24 and rate constant of 0.044 min ; the reaction catalyzed by etheo had an amplitude of 0.52 and rate constant of 0.59 min in the fast phase , and an amplitude of 0.26 and rate constant of 0.045 min in the slow phase . cross - catalytic exponential amplification was performed in a reaction mixture containing 0.02 m each of e and e , 5 m each of [ 5-p]-labeled a and a , 5 m each of b and b , 25 mm mgcl2 , and 50 mm epps ( ph 8.5 ) , which was incubated at 42 c . the reaction was initiated by mixing equal volumes of two solutions , one containing the enzymes and substrates , and the other containing the mgcl2 and epps buffer . aliquots were taken at various times , quenched , and the amounts of newly - synthesized e and e were quantitated as described above . the data were fit to the logistic growth equation , as described in the main text . known concentrations of inorganic pyrophosphate or samples taken from the cross - replication reaction were diluted 10-fold into a reaction mixture containing 0.15 g/l luciferase , 0.00045 u/l atp sulfurylase , 10 m adenosine 5-phosphosulfate , 0.5 mm d - luciferin , 25 mm magnesium acetate , 0.1% bovine serum albumin , 1 mm dithiothreitol , 0.4 g/l polyvinylpyrrolidone ( mw 360,000 ) , and 100 mm tris - acetate ( ph 7.75 ) . the pyrophosphate standards were prepared in a solution identical to that employed in cross - replication , but lacking the rna enzymes and substrates . luminescence was detected using a perkin elmer ls55 luminescence spectrometer operating in bioluminescence mode , with a pmt voltage of 900 v , cycle time of 200 ms , gate time of 180 ms , and delay time of 0 . the flash count was set to 1 , the emission filter was fully open , and the emission slit width was 12 nm . following addition of the sample to the luciferase mixture , luminescence was monitored for 5 min with a 0.1 s integration time . the amount of light generated was linear over a pyrophosphate concentration range of 0.110 m .", "oligonucleotides were synthesized on an expedite automated dna / rna synthesizer ( applied biosystems , foster city , ca ) using nucleoside phosphoramidites purchased from glen research ( sterling , va ) . all oligonucleotides were purified by denaturing polyacrylamide gel electrophoresis ( page ) and desalted using a c18 sep - pak cartridge ( waters , milford , ma ) . histidine - tagged t7 rna polymerase was purified from e. coli strain bl21 containing plasmid pbh161 ( kindly provided by william mcallister , state university of new york , brooklyn ) . thermus aquaticus dna polymerase was cloned from total genomic dna and purified as described previously30 . m1 rna , the catalytic subunit of rnase p , was obtained from e. coli genomic dna ( sigma - aldrich , st . louis , mo ) by pcr amplification and subsequent in vitro transcription , as described previously1 . calf intestine phosphatase and t4 polynucleotide kinase were purchased from new england biolabs ( ipswich , ma ) , yeast inorganic pyrophosphatase was from sigma - aldrich , and bovine pancreatic dnase i was from roche applied science ( indianapolis , in ) . nucleoside and deoxynucleoside 5-triphosphates , theophylline , and fmn were purchased from sigma - aldrich , [ -p]atp ( 7 ci / pmol ) was from perkin elmer ( waltham , ma ) , and caffeine was from mp biomedicals ( solon , oh ) . photinus pyralis ( firefly ) luciferase , saccharomyces cerevisiae adenosine-5-triphosphate sulfurylase , adenosine 5-phosphosulfate , and d - luciferin were from sigma - aldrich . bovine calf serum was from omega scientific ( tarzana , ca ) and superasin ( rnase inhibitor ) was from ambion ( austin , tx ) .", "all rna enzymes and substrates were prepared by in vitro transcription in a reaction mixture containing 0.4 m dna template , 0.8 m synthetic oligodeoxynucleotide having the sequence 5-ggactaatacgactcactata-3 ( t7 rna polymerase promoter sequence underlined ) , 2 mm each of the four ntps , 15 u/l t7 rna polymerase , 0.001 u/l inorganic pyrophosphatase , 15 mm mgcl2 , 2 mm spermidine , 5 mm dithiothreitol , and 50 mm tris - hcl ( ph 7.5 ) . the mixture was incubated at 37 c for 2 h , quenched by adding an equal volume of 15 mm na2edta , treated with 1 u/l dnase i , and extracted with a 1:1 mixture of phenol : chloroform . transcription of m1 rna was performed similarly , except employing a double - stranded dna template that was generated by pcr . the a and a substrates could not be obtained reliably by in vitro transcription due to heterogeneity at the 3 end of the transcripts . instead , these substrates were prepared from the corresponding e or e molecules by cleaving off the b or b portion using e. coli m1 rna , as described previously1 . the external guide sequence rna for cleavage of etheo and efmn had the sequence 5-cguaaguugcggucucacca-3 , and for etheo and efmn had the sequence 5-auauucaugcggucucacca-3 ( nucleotides complementary to the target rna underlined ) . for the second pair of etheo and etheo molecules used in the multiplex experiments , the external guide sequence rnas had the sequence 5-cguaguaugcggucuacca-3 and 5-gaauaucauugcggucucacca-3 , respectively . the a and a substrates were [ 5-p]-labeled by first dephosphorylating using calf intestine alkaline phosphatase , then phosphorylating using t4 polynucleotide kinase and [ -p]atp . the labeled substrates were purified by page and desalted using a nensorb 20 cartridge ( nen life sciences , waltham , ma ) .", "rna - catalyzed rna ligation was performed in a reaction mixture containing 5 m e or e , 0.1 m [ 5-p]-labeled a or a , 6 m b or b , 25 mm mgcl2 , and 50 mm epps ( ph 8.5 ) , which was incubated at 42 c . aliquots were taken at various times and quenched by adding an equal volume of gel - loading buffer containing 50 mm na2edta and 18 m urea . the products were separated by page and quantitated using a pharosfx molecular imager ( bio - rad , hercules , ca ) . the data were fit to the equation : ft = fmax(a1ek1t)(a2ek2t ) , where ft is the fraction reacted at time t , fmax is the overall maximum extent of the reaction , a1 and k1 are the amplitude and rate of the initial fast phase , and a2 and k2 are the amplitude and rate of the subsequent slow phase , respectively . in the presence of 5 mm theophylline , the reaction catalyzed by etheo exhibited a fast phase with an amplitude of 0.57 and rate constant of 1.4 min , followed by a slow phase with an amplitude of 0.24 and rate constant of 0.044 min ; the reaction catalyzed by etheo had an amplitude of 0.52 and rate constant of 0.59 min in the fast phase , and an amplitude of 0.26 and rate constant of 0.045 min in the slow phase .", "cross - catalytic exponential amplification was performed in a reaction mixture containing 0.02 m each of e and e , 5 m each of [ 5-p]-labeled a and a , 5 m each of b and b , 25 mm mgcl2 , and 50 mm epps ( ph 8.5 ) , which was incubated at 42 c . the reaction was initiated by mixing equal volumes of two solutions , one containing the enzymes and substrates , and the other containing the mgcl2 and epps buffer . aliquots were taken at various times , quenched , and the amounts of newly - synthesized e and e were quantitated as described above . the data were fit to the logistic growth equation , as described in the main text .", "known concentrations of inorganic pyrophosphate or samples taken from the cross - replication reaction were diluted 10-fold into a reaction mixture containing 0.15 g/l luciferase , 0.00045 u/l atp sulfurylase , 10 m adenosine 5-phosphosulfate , 0.5 mm d - luciferin , 25 mm magnesium acetate , 0.1% bovine serum albumin , 1 mm dithiothreitol , 0.4 g/l polyvinylpyrrolidone ( mw 360,000 ) , and 100 mm tris - acetate ( ph 7.75 ) . the pyrophosphate standards were prepared in a solution identical to that employed in cross - replication , but lacking the rna enzymes and substrates . luminescence was detected using a perkin elmer ls55 luminescence spectrometer operating in bioluminescence mode , with a pmt voltage of 900 v , cycle time of 200 ms , gate time of 180 ms , and delay time of 0 . the flash count was set to 1 , the emission filter was fully open , and the emission slit width was 12 nm . following addition of the sample to the luciferase mixture , luminescence was monitored for 5 min with a 0.1 s integration time . the amount of light generated was linear over a pyrophosphate concentration range of 0.110 m .", "" ]

[ "neoadjuvant chemotherapy actually takes an important place in treatment of operable breast cancer in the hope of improving conservative surgery rate of female patients . neoadjuvant chemotherapy includes today on target therapies involving the research on expression of specific molecules by tumoral cells . in routine practice , estrogen receptors ( er ) , progesterone receptors ( pr ) , and human epidermal growth factor receptor 2 ( her2 ) are the common used biomarkers . new pharmaceutical molecules , other than er / pr or her2 , are now already evaluated in clinical research as new biomarkers and new target for neoadjuvant therapy . fine - needle aspiration cytology ( fnac ) of the breast is wellknown as a safe , effective , economical , and accurate technique for diagnosing palpable breast lesion [ 24 ] . this last decade , fnac technique is improved by the development of new cytological methods allowing standardization of fixation and assuring constant results with ancillary tests such as immunocytochemistry and in situ molecular biology . also , one of the advantages of fnac is the management of small tissue fragments permitting a repetitive evaluation of the chronological evolution in expression of tumoral biomarkers .", "previously , the role of fnac has been challenged by results obtained with cnb that seems more robust than fnac . in general , nevertheless , cnb carries disadvantage in terms of a long tissue processing time and patient discomfort such as pain ( 1.7% to 3.7% ) , hematoma ( 0.72% ) , and very rarely pneumothorax [ 6 , 7 ] . fnac includes more advantages than cnb such as minimal invasiveness and minimal discomfort ( more painless ) that could be interesting for aged or frailty patients with comorbidities . in palpable lesions , fnac could perform repetitively and is a serious candidate for the chronological followup of neoadjuvant chemotherapy response . an important quality of fnac is its ability to give rapid diagnostic information equivalent to that of frozen sections . in our experience , the result of rapid fnac prior to cnb improves the quality of cnb and gives an immediate diagnosis decreasing anxiety of patient . other indications of fnac are staging of multiple tumors or suspicious zones and apparition of a new suspicious lesion during neoadjuvant chemotherapy . finally , fnac could be an excellent alternative when radiographic screening of breast is not available . table 1 compares the main advantages and disadvantages of fnac versus cnb . \n other clinical fnac indications . \n palpable breast lesion.rapid diagnosis to decrease anxiety of patient.patient with morbidity ( senile , cardiac , diabetic etc.).clinical staging : multiple lesions , suspicious lymph node , and so on . apparition of new lesion in patient treated for breast cancer.evaluation of biomarkers.evaluation of biomarker changes following time or metastasis . when cnb technique is not available . \n evaluation of biomarker changes following time or metastasis . when cnb technique is not available .", "it is well known that the combination of clinical evaluation , mammography , and fnac , called triple diagnosis , gives a precise diagnosis [ 10 , 11 ] . yu et al . recently demonstrated in meta - analysis of 46 studies that fnac had a sensitivity of 92.7% and a specificity of 94.8% except the unsatisfactory samples . the roc curve showed an excellent area under the curve of 0.986 , presenting a high level of accuracy . on the other hand , if the fnac result was negative , the probability of breast cancer is approximately 8% . these authors concluded that fnac was an accurate material for evaluation on breast malignancy if rigorous criteria are used . also , they said that fnac may provide a favourable screening method and permit an improvement of treatment planning . therefore , when fnac is unsatisfactory , cnb is required to minimize the probability of a missed malignant diagnosis . in a study of fnac and immediate diagnosis performed in 408 palpable breast lesions , liew et al . in 2010 reached the same conclusions : 98.1% sensitivity , 89.5% specificity , and 95.8% accuracy . in 508 cnb followed by jackman et al . , the rate of false negative for all lesions was 4.4% , for microcalcifications alone 1.2% , and for tumoral mass 0.8% . these results of cnb are quasi - identical to those obtained with the satisfactory fnac . most of false negative fnac results of sampling error or discordance between clinical and histological observations [ 6 , 14 ] . in a comparison between cnb and repeat fnac after an indeterminate diagnosis with fnac , kooistra et al . suggested that cnb should be performed after an indeterminate fnac to obtain a reliable preoperative diagnosis . other authors concluded that , although the fnac is easier to perform , this technique was not efficient for small and nonpalpable lesions or diagnosis of microcalcifications as those for in situ carcinoma . these comments are likely true because some preneoplastic lesions are associated with slight cell atypia . however , bilous emphasized that cnb shows also problems with similar lesions such as atypical proliferative lesions ( atypical ductal hyperplasia , in situ lobular neoplasia , etc . ) , cellular fibroepithelial lesions , papillary tumors , mucinous carcinoma , radial scar , spindle cell lesions . moreover , fnac interpretation requires serious experience of the cytopathologist and they think that this is one of the main reasons that overall cnb is to be preferred . a recent japanese study of 5693 fnac and 7 different laboratories illustrated a great variability between the institutions suggesting likely difference between education of cytologists and the lack of clinical or radiological information ( triple diagnosis ) .", "these last years a new cytological technique , called liquid - based cytology ( lbc ) , has been developed and approved by the food and drug administration . briefly , lbc standardises the cell fixation , concentrates epithelial cells , and discards blood cells and/or cell debris that obscure the smear . the efficiency of lbc in the breast cytology has been demonstrated by numerous publications . the main advantage of lbc is surely to adjunct ancillary tests such as immunocytochemistry , flow cytometry , or molecular biology [ 1820 ] . compared the er and pr statuses from fnac ( immunocytochemistry ) and cnb ( immunohistochemistry ) , both performed on surgical breast tumors . they found that both methods give similar results with a concordance between the 2 tests of 98% for er ( with kappa correlation score = 0.93 ) and 96% for pr ( kappa = 0.91 ) . . demonstrated similar data in a comparative study between primary breast tumours and their metastasis . interestingly , the concordance between these both localisations was 81% for er , 65% for pr , and 71% for her2 , suggesting a possibility of biological difference between primary tumors and their metastasis . other publications showed a long - time storage at 20c and 80c at least 6 months without significant loss of immunoreactivity of pr and ep from breast fnac . the cell block cytology is an attractive cytological method for ancillary techniques or long - time cell conservations and consists in putting cells of fnac directly in formol fixative fluid identically at a classical histology ( figures 1 and 2 : er , her2 and fish on cell block cytology ) . briefly , after centrifugation to concentrate cells , the pellet was embedded in a synthetic polymer gel that is then processed in paraffin block that could be cut at 4 m , as classical biopsy slides . with this technique , ferguson et al . found a concordance rate of 95% for er , 90% for pr , and 88% for her2 . similar results were observed by shabaik et al . with high specificity ( 100% for both ) and lower sensibility ( 85% and 80% resp . for er and pr ) . finally , in fnac , false negative er or pr immunostaining exists but false positive tests are very unlikely . false negative immunohistochemical results are also observed in cnb : in a retrospective study , seferina et al . calculated a rate of false negative of 26.5% and a rate of false positive of 63.8% for both er and pr . for her2 , they showed 5.4% for false negative rate and 50% for false positive rate . nevertheless , in our experience , this discordance is often associated with the manipulation of cnb before the fixation ( crush artefacts ) or with a defect of fixation as desiccation . fortunately the concordance with molecular biology by hybridisation in situ using fish , cish , and sish is very good and can help when her2 is uncertain [ 6 , 25 , 27 ] . the fish is accurate for lbc cytology [ 22 , 25 , 28 , 29 ] . the extraction of mrna or dna is also feasible from lbc and fnac , allowing all gene expression analyses [ 2932 ] . in our experience ,", "the clinical staging and preoperative lymph node status are important for the evaluation of eligible patient to neoadjuvant therapy . in the axillary lymph node fnac , chang et al . fnac in lymph node is a cost effective and safe method , false positive is virtually non - existent , and false negative can occur when lymph node is partially involved such as by micrometastase , or isolated tumor cells . in our experience , we improve axillary lymph node fnac / lbc by immunocytochemistry using cytokeratin antibody . thus , axillary fnac plays a role in staging of advanced cases for systemic and neoadjuvant therapy and in evaluating candidates for sentinel lymph node surgical procedure or axillary lymph node dissection .", "despite the fact that cnb has been progressively replaced by fnac in the investigation of nonpalpable lesions or microcalcifications without a clinical or radiological mass lesion , fnac has yet a role in palpable lesions in the triple diagnosis association and performed by experienced cytologists . in these conditions , fnac is a safe , effective , economical , and accurate technique for breast cancer evaluation . recently , cytological methods using lbc technology , associated or not with the cellblock cytological technique , improve immunocytological and molecular tests with the same efficiency as classical histology . if the limits of its indications are well known , fnac still plays a role in the modern oncological practice ." ]

[ "understanding how and why vector - borne diseases like malaria remain a persistent problem despite being tools for diagnosis and treatment is essential for developing effective control measures for sub - saharan africa . temperature is one of the key climatic variables that determine the range of malaria transmission and hence global warming is likely to result in an increase in malaria prone areas especially where temperatures have generally been lower than the optimal range of 2527c for mosquito development . furthermore degradation of the environment and social and economic pressures due to population growth may boost the expansion of malaria prone areas . population migrations , drug and pesticide resistance , and deterioration of health service delivery systems will also influence the level of malaria transmission . the epidemiology of malaria is very complex , involving factors pertaining to the malaria parasites , the insect vectors , the human hosts , and the environment . an understanding of the link between malaria transmission , climatic variables , and other human related factors is therefore necessary for developing appropriate measures that will significantly reduce transmission and perhaps eliminate malaria in endemic areas . in most cases these human related risk factors the level of risk to human populations living in malaria endemic areas varies markedly across continents and also within countries and different areas within the same countries . several studies have shown that malaria vector distribution , transmission rates , and incidence can vary widely over short distances , between neighbouring villages and even within a single settlement , as a result of small area variations in risk factors [ 5 , 6 ] . identification and understanding of this variation are important in the detection of high risk groups and for selective targeting of intervention . many studies have attempted to identify household and individual level factors associated with malaria . some of the factors studied include access to health facilities , type of housing that people live in , proximity of human settlements to vector breeding sites [ 1012 ] , vector abundance , socioeconomic status , gender , occupation , residential mobility , travel , presence of domestic animals near homesteads , and use of preventive methods such as bed nets . information on how these factors interact to expose communities and individuals to malaria infections needs to be investigated systematically in each geographical setting , in conjunction with climate related factors . documented information about individual and household risk factors associated with malaria transmission is lacking in botswana . in order to address this paucity of information we assessed household and individual risk factors that may be contributing to malaria transmission in tubu village community in the okavango subdistrict in northern botswana . the study was conducted in the context of a larger project , botswana ecohealth project ( bep ) , which is investigating the impacts of hydroclimate change on population health . apart from contributing towards the objectives of bep , the results of this study are relevant to an initiative by the ministry of health in botswana to eliminate malaria by year 2016 .", "the study was conducted in tubu village on the banks of the thaoge river , one of the distributaries of the okavango delta . tubu village is located in the okavango subdistrict at an altitude of about 950 m above sea level and between latitude 1935s and longitude 2227e . according to the national central statistics office report of 2011 the area is subjected to annual flooding but the extent of flooding varies from year to year . the community practices flood recession farming locally known as molapo farming . they plough their fields along the banks of the river as the flood recedes and in some instances they plant crops taking advantage of a raised water table caused by flooding . community development and everyday governance issues pertaining to law and order in the area are conducted at a central place ( locally known as the kgotla ) within the village . tubu has a village development committee ( vdc ) established as a local government structure to guide development planning and implementation in the village . the village also has a primary school , a resident social worker , and a health post staffed with a nurse , nurse aid , and a health education assistant . gumare hospital , located 10 km east of the village , offers an array of general health services to the local community . the hospital also serves as the district health centre for critically ill patients referred from all district health posts including tubu . malaria cases in the okavango subdistrict have been fluctuating since 2005 with unconfirmed cases ranging between 4,686 in 2005 and 10,993 in 2006 and confirmed cases ranging between five ( in 2012 ) and 791 ( in 2006 ) ( ministry of health annual report , 2012 ) . the maximum number of deaths between 2005 and 2012 was 16 , recorded in 2006 . data from clinic records for the period of 2005 to 2010 indicated that 2009 had the highest with 131 unconfirmed cases and 2005 the lowest with 50 cases . however during the same period information on rapid diagnostic tests ( rdts ) was inconsistent and available only for years 2006 , 2008 , and 2010 with 9 , 4 , and 5 cases , respectively . pretesting of the questionnaire involved trained field research assistants with higher secondary education qualifications and field supervisors with degree qualifications who eventually administered the final questionnaire . the questionnaire had four thematic sections ; first part focused on sociodemographic characteristics such as gender , age , marital status , education level , farming practice , household income , ethnicity , respondent 's relationship to household head , employment status , and occupation and the second part included aspects on how the community or individuals got exposed to mosquito bites due to late night activities , location of homesteads in relation to animal shelters and mosquito breeding sites , visits made to other areas outside tubu village in the last 8 months , and history of malaria episodes in the last 8 months . a short period of 8 months was chosen so as to minimise on - recall bias as the time frame included the previous malaria transmission season which fell between the months of october 2011 and june 2012 . the third part of the questionnaire focused on malaria prevention methods being practiced and health delivery services for the study area . the last part involved general observations made at each homestead during the interview with regard to house structure and use , type of eaves , and vegetation cover surrounding the homesteads . to ensure accuracy and good quality data , pretesting of questionnaires was carried out two weeks prior to the actual data collection exercise in etsha 1 , a village with similar environmental and sociodemographic patterns to tubu village . following the pretest survey the questionnaire was revised , on the basis of responses given , for improvement of clarity and addition of essential questions that had been omitted in the original questionnaire . vague questions in the original questionnaire were either omitted from the final questionnaire or improved . the pretest exercise was also used to standardize the manner in which the interviewers would conduct the interviews and to ensure that they had a common understanding of each question . from the household listing compiled for the bep project the target sample size , as determined by raosoft inc . however , due to the fact that tubu is a relatively small village a census survey was done consisting of individuals representing all the 71 households . the questionnaire was administered at the household level to any person who is 18 years and above with preference being given to the heads of the household if they were present . only one person per household was interviewed . during the interviews the respondents answered some of the questions pertaining to children and other members of the same household such as visits outside study area and possession and use of nets . numbers 1 to 4 were assigned to individuals from the community who had come to attend the pras for the major bep project . all individuals assigned a similar number were grouped together to participate in the malaria risk survey . pra technique , using the closed scoring / ranking approach , was used to cross - check on some of the responses from the questionnaire interviews . the maximum number of individuals at any one given time during the pra discussions was 16 , thus providing a total ranking capacity ( n ) of 160 . the respondents were asked whether they had suffered from malaria within the past 8 months ( the period between october 2011 and june 2012 ) , which included the traditional peak malaria transmission season in botswana . mosquito sampling was conducted in houses , in pit traps , and in larval breeding sites located within the study area . adult mosquitoes were sampled from pyrethrum space spray knockdowns in 6 selected huts used as bedrooms and from 4 pit traps . the physiological conditions of the adult mosquitoes collected from indoors and pit traps were scored as non - blood - fed , blood - fed , half gravid , and full gravid . all adult mosquito specimens , from both adult and larval sampling , were identified to species level by the polymerase chain reaction ( pcr ) technique . a geographic positioning system instrument ( gps ) was used to determine straight line distances of study homesteads from the nearest mosquito breeding habitats . permission to carry out the study was obtained from the ministry of health , republic of botswana ( permit number : ppme 13/18/1 vol . meetings with the community leadership and other interested community members were held to introduce the study , clearly explaining its objectives . on the day of the interview verbal consent respect for privacy was maintained during adult mosquito sampling in selected rooms used as bedrooms . participants were informed that they could refuse to participate in the study and not be prejudiced . respondents were assured that all the information captured on the data sheets would be treated with confidentiality and that no answers would be linked to individuals in the final analysis and presentation of findings . descriptive statistics were carried out to determine relative frequencies of all the survey variables . some of the variables had provisions for multiple responses . appropriate graphs and tables were generated to show differences in the relative frequencies of various variables . levels of association between various variables were determined by the pearson test and fisher 's exact test in situations where the expected frequencies were less than five . where appropriate , p values and confidence intervals ( ci ) for odds ratios ( or ) are shown . the level of association between various factors and history of malaria was calculated based on the respondents ' views .", "the maximum number of people residing in a single homestead was 20 and the minimum was one . a total of 483 individuals resided in all the 71 study homesteads , thus giving an average household size of seven people . about two - thirds of the respondents had some years of schooling ( table 1 ) . the majority of households earned an income of less than us$63 per month ( figure 1 ) . only 7% of the respondents earned more than us$250 per month . eighty - one point seven percent ( 58 ) of the respondents resided within 1 km from the nearest health facility . eighteen - point three percent ( 13 ) resided 1 km to 2 km from the clinic . all the 71 respondents indicated that it took them less than an hour to get service at the clinic from the time they joined the queue . at the time of the study ( june 2012 ) 53.5% ( 38 ) of the respondents said that they had suffered from malaria within the past 8 months whilst 46.5% ( 33 ) did not remember ever suffering from malaria in their entire life . forty - seven point nine percent ( 34 ) mentioned that at least one member of their family had suffered from malaria within the past 8 months . among family members who had suffered from malaria , 73.5% ( 25 ) were above five years old and 26.5% were below the age of five years . there was an association between household income and history of a malaria episode ( table 2 ) . almost all of those who had experienced a malaria attack were in the lowest bracket for household monthly income . in the whole village only two house roof types were observed . these were either of grass or iron sheet . a general observation noted that houses in the village were either grass thatched , built of reeds , pole , and mud or home - made bricks ( referred to as traditional hut / house ) or built of bricks and roofed with iron sheets ( referred to as modern hut / house ) . among those structures used as bedrooms by the respondents , 52.1% ( 37 ) were traditional and 47.9% ( 34 ) were modern houses / huts . in traditional houses / huts large eave openings were observed in 89.2% ( 33 ) and the rest ( 10.8% ( 4 ) ) had small eave openings . in modern houses 2.9% ( 1 ) had large eave openings and the rest ( 97.1% ( 33 ) ) had virtually no eave openings . there was an association between history of malaria episode and use of traditional huts / houses as bedrooms ( table 3 ) . majority of individuals who experienced a malaria attack used traditional houses / huts as bedrooms . low vegetation cover surrounding homesteads was observed at 81.7% ( 58 ) of the homesteads . moderate vegetation cover was observed at 14.1% ( 10 ) of the homesteads whilst only 4.2% ( 3 ) of the homesteads were surrounded by dense vegetation cover . individual contact with mosquito bites was categorized into always , sometimes , often , and rarely . out of 98.6% ( 70 ) who experienced mosquito bites , 54.9% ( 39 ) mentioned that they seven percent ( 5 ) and 8.5% ( 6 ) often and rarely got bitten by mosquitoes , respectively . no association was found between house eave size and getting bitten by mosquitoes and between house eave size and frequency of bites ( table 2 ) . out of the 70 individuals who experienced mosquito bites 84.5% ( 60 ) indicated that they received the bites in the evening . the rest got mosquito bites during daytime ( 1.4% ( 1 ) ) , after dawn ( 1.4% ( 1 ) ) , or throughout the day ( 1.4% ( 1 ) ) . no association was found between house eave size and time of mosquito bites ( table 2 ) . about 93% ( 66 ) of respondents reported that they opened doors in the morning whilst 7% ( 5 ) during the day . ninety - seven point two percent ( 69 ) reported that they closed doors in the evening whilst only 1.4% ( 1 ) indicated that they closed doors after dawn and 1.4% ( 1 ) before dusk . eighty - eight point seven percent ( 63 ) mentioned that they were involved in late outdoor activities that included social gatherings ( 28.2% ( 20 ) ) , relaxing outdoors ( 74.6% ( 53 ) ) , preparing meals ( 50.7% ( 36 ) ) , and doing other things ( 8.5% ( 6 ) ) . a strong relationship was established between late outdoor activities and history of malaria episode ( table 3 ) . most of the outdoor activities were said to be done between 2000 hrs and 2200 hrs by 63.4% ( 45 ) of the respondents . a borderline association between the period spent outdoors and history of malaria episodes was established ( table 2 ) . ninety - three percent ( 93% ( 66 ) ( of the respondents mentioned that they prepared meals outdoors using firewood . only 2.8% ( 2 ) said they used gas for cooking and the remainder ( 4.2% ( 3 ) ) used both gas and firewood . eighty - five point nine percent ( 61 ) of the respondents mentioned that they were fulltime farmers . among them 60.7% ( 37 ) had field structures erected on the farm and these were in the form of mud houses ( 28.2% ( 20 ) ) , brick houses ( 2.8% ( 2 ) ) , or other form of materials ( 21.1% ( 15 ) ) such as the grass - made temporary shelters locally known as the mathibelo . there was no evidence of association between history of malaria episode and being a full time farmer ( table 2 ) . seventy - six point one percent ( 54 ) of the respondents indicated that they had other residential homesteads elsewhere outside tubu village . seventy - three point two percent ( 52 ) had other homesteads in gumare village , 1.4% ( 1 ) in the cattle post areas , and another 1.4% ( 1 ) in shakawe village , about 150 km from tubu village . it is defined as an area designated solely for keeping domestic animals , mainly cattle , goats , and a few donkeys and horses . cattle posts are usually located away from defined residential areas . majority ( 69.1% ( 49 ) ) of respondents fifty - nine point two percent ( 42 ) of respondents mentioned that they had travelled outside tubu village in the last 8 months . ninety - five point two percent ( 40 ) of them had travelled to malaria endemic areas in the north of the village whilst 4.8% ( 2 ) had travelled to non - malaria - endemic areas . there was a significant association between travel outside tubu village and history of malaria disease ( table 3 ) . twenty - six point eight percent ( 19 ) of respondents mentioned that 8 months prior to the date of the interview they had received visitors who stayed overnight . they reported that 94.7% ( 18 ) of the visitors were coming from malaria endemic areas . ninety - four point four percent ( 67 ) of the respondents indicated that they owned mosquito nets ( insecticide treated or untreated mosquito nets ) . more than half of the respondents who possessed mosquito nets had not experienced any malaria attack indicating an association between previous malaria episode and possession of mosquito nets ( table 3 ) . number of nets per household were reported to range from zero ( 2.8% ( 2 ) ) to more than six ( 5.6% ( 4 ) ) , with 39.4% ( 28 ) possessing one or two nets , 33.8% ( 24 ) possessing three or four nets , and 18.3% ( 13 ) possessing five or six nets . however , there was no association between history of malaria attack and the number of mosquito nets owned by a household ( table 2 ) . insecticide treated mosquito nets ( itns ) were possessed by 78.9% ( 56 ) of the responses whilst 50.7% ( 36 ) also possessed untreated mosquito nets . it was not unusual to find some households with a mixture of insecticide treated and untreated mosquito nets at the same time . two point eight percent ( 2 ) of the respondents were not sure of the status ( treated or not treated ) of their mosquito nets indicating poor knowledge on mosquito nets . ninety - one point five percent ( 65 ) of the respondents indicated that they always used mosquito nets . only 1.4% ( 1 ) mentioned that they used mosquito nets more often whilst 5.6% ( 4 ) sometimes used them and 1.4% ( 1 ) never used mosquito nets . usage of mosquito nets , among those who always used them , was reported to be relatively high ( 46.2% ( 30 ) ) during summer and very low ( 3.1% ( 2 ) ) in winter . most of the respondents were aware of government 's efforts to control malaria through indoor residual spraying ( irs ) ( 97.2% ( 69 ) ) and distribution of itns [ 97.2% ( 69 ) ] . only 2.8% ( 2 ) of the respondents were not aware of what the government did to control malaria in tubu village . twenty nine respondents got their mosquito nets from the town council ( figure 2 ) . other respondents acquired their mosquito nets from the shops ( 14 ) , both shops and town council ( 14 ) , both clinic and council ( 5 ) , clinic ( 4 ) , and both clinic and shops ( 3 ) . other personal malaria prevention methods reported as commonly practiced by the community included taking antimalarial drugs ( 1.4% ( 1 ) ) , clearing of surrounding vegetation ( 12.7% ( 9 ) ) , avoiding stagnant water ( 12.7% ( 9 ) ) , wearing long sleeved clothes ( 2.8% ( 2 ) ) , and use of aerosols ( 2.8% ( 2 ) ) and repellents [ 8.5% ( 6 ) ] . a total of 13 individuals ( 4 males and 9 females ) participated in the pra discussions . during the discussions this shortage resulted in some household members using emptied maize meal bags to construct mosquito nets . however these self - made nets had disadvantages in that they did not kill mosquitoes since they were not treated with an insecticide . furthermore they were deemed uncomfortable as they tended to retain heat and could not fit well around modern beds . in winter ( june - july ) , most households did not use the nets so often since mosquitoes were not a major problem during that time . the group was satisfied with the spraying exercise but expressed concern regarding coverage of areas inaccessible to the spraying teams due to flooding and also the fact that some households refused to have their homes sprayed claiming that the insecticide caused allergic reactions . mosquitoes were obtained from larval breeding ( 22 ) and adult sampling ( 64 ) . using the pcr species identification technique all the 86 specimens in addition other nonvector mosquitoes , namely , two an , demeilloni and one an . apart from anopheles species , more than 200 culicine mosquitoes were also caught resting either indoors or outdoors and breeding in the sites where the vector mosquitoes were found . forty - eight point four percent ( 31/64 ) of the anopheles arabiensis mosquitoes caught resting indoors in selected huts were blood - fed and at different stages of their gonotrophic cycle . mosquitoes were also observed resting outdoors in animal burrow pits located within the village and close to breeding sites . \n these included vegetated areas at periphery of water bodies , animal hoof prints , open sunlit puddles created by receding floods , and man - made temporary puddles within farming fields . six homesteads were located within 100 m from mosquito breeding habitats , 17 were between 100 m and 500 m , 38 were between 500 m and 1000 m , and 10 were between 1000 m and 3000 m ( figure 3 ) . previous malaria episode was significantly associated with distance from water bodies ( table 2 ) .", "majority of our study population earned income far less than the botswana national poverty datum line pegged at us$81.94 ( bwp611.30 ) by the ministry of finance and development planning as of 22 april 2013 . this is consistent with the country statistics that show that about 44.8% of rural people ( 30.6% in towns ) in botswana are classified as poor . such communities have been found to be at greater risk of malaria disease because they are poorer and face higher transmission rates than their urban counterparts . malaria parasiteamia was associated with a reduced household socioeconomic status in a rural area in tanzania . social and economic factors aggravate the contribution of climate related factors in influencing the malaria burden . for many social and economic reasons the community in tubu village according to the world health organisation such sedentary communities living in malaria prone areas and who can not afford to move out of flood - affected areas due to low economic status have an increased chance of acquiring infection . this is particularly true for children , pregnant women , and older people , who form the high risk groups . other important factors that contributed to individual exposure to mosquito bites were the limited use of personal protection methods such as taking antimalaria tablets and use of aerosols and repellents . cost of these prevention tools may have been the limiting factor especially in a community regarded as leaving below the national poverty datum line . similar observations were made in nouma , burkina faso , where the use of aerosols was not a popular method perhaps because of the costs associated with such measures . minimum use of these simple measures not only affect individual exposure to mosquito bites but is also an indicator of very low socioeconomic status , which in itself has been proposed as an important factor associated with malaria . residential house status or structure has some implications in malaria transmission as poorly constructed houses expose individuals to mosquitoes that may find the dwelling more comfortable as a resting place . traditional huts / houses with large eave gaps present in tubu village played a role in allowing free movement in and out of the huts / houses and providing suitable shelter for mosquitoes that eventually attacked the bedroom occupants . previous studies have shown that traditional grass thatched houses with open eaves and lacking ceilings provided more favourable resting places for mosquitoes and put the occupants at risk of contracting malaria than houses with closed eaves , iron corrugated / asbestos covered roofs , and having ceilings . nevertheless , in poorly constructed houses where cooking and sleeping take place in the same room , smoke could repel mosquitoes through the eaves at the time that cooking is taking place [ 9 , 25 ] . however the community in tubu village did not benefit from the protective effects of smoke since most of the respondents prepared their meals outdoors . our findings indicated that the community was equally exposed to mosquito bites anytime of the night regardless of the size of eaves . therefore closing doors early in the evening did not provide any protection since mosquitoes could still freely enter the dwellings through the eaves as was evident from the anopheles and culicinemosquitoes caught resting indoors . arabiensis mosquitoes in the village verified that the community was at risk of being bitten by an infected vector mosquito . the fact that some study participants spent time in other homesteads away from tubu village did not make any difference since the structure of the dwellings there was the same and most of the alternative homesteads were in the same geographical area with similar climatic and environmental characteristics . most of the respondents who reported history of malaria attack also reported that they spent much of their night time outdoors during the peak biting period and therefore could have picked the infection during that period when they are not yet sleeping under a mosquito net . arabiensis could also expose individuals in the community who may not necessarily be involved in late outdoor activities . arabiensis has been shown to have early biting activities , which peak between 1900 hrs and 2000 hrs , with over 70% of biting activity occurring before 2200 hrs . the documented peak biting period coincided very well with the time that most of the individuals in tubu village would be involved in late outdoor activities since the vector mosquito is also known to bite humans both outdoors and indoors . \n arabiensis is an opportunistic species that feeds preferentially on humans in many parts of africa but can be diverted to domestic animals as their density increases . in tubu village the presence and number of livestock near or within 3000 m from the homesteads could have some influence on the degree of malaria transmission at community and household levels . it is most likely that the risk of getting mosquito bites could have been reduced due to zooprophylaxis especially in situations where the species predominantly displays zoophagic foraging tendencies . however , the benefit of keeping livestock close to human dwellings has been refuted by many authors from studies conducted in the gambia and the ethiopian highlands . it is clear that the association between the presence of livestock as a risk factor and malaria transmission is a complex issue that needs further investigations in botswana , where the ratio of cattle to humans is very high . more than half of the respondents had travelled outside tubu village in the last 8 months , to other more intense malaria endemic areas . although active screening for malaria parasites was not done among the respondents , the responses to questions crafted to determine malaria risk implications of travel outside the study area indicated that travel to more intense malaria transmission areas exposed individuals to malaria . reported visitors from malaria endemic areas could also have played an important role in importing malaria parasites to the village . in a study conducted in urban kisumu , kenya , children who reported spending at least one night per month in a rural area endemic to malaria were found to be at risk of contracting infections , indicating that exposure during rural travel was an important element of risk . the risks of acquiring malaria through travel were also observed in an urban area situated in the largest port of the pacific coast in columbia . insecticide treated nets ( itns ) have become quite significant as the most practical method of mosquito control by protecting at - risk individuals from mosquito bites and hence malaria infections . in this study participation of different organisations such as the council , clinic ( ministry of health ) , and shops in supplying mosquito nets and the promotion done by the government could have resulted in overwhelming possession and use of mosquito nets by the community . similar findings were reported in nouma , burkina faso , and also in an urban area of burkina faso where it was attributed to regional promotion . reported mosquito net use in tubu village was very high regardless of whether it is treated or not . the use of untreated mosquito nets has also been found to have some protective measures against mosquito bites [ 19 , 33 ] . in burkina faso mosquito net use was relatively more frequent in summer than winter , thereby conferring protection from mosquito bites during the peak malaria transmission period [ 22 , 32 ] . for an average family size of 6.8 , with some homesteads possessing as many as 6 nets , it is most likely that each individual in the community had the opportunity to use a mosquito net . however , actual mosquito net use was not investigated and overreporting by the respondents was possible since ownership does not necessarily translate to actual use . innovativeness by the community in mosquito net making using waste maize - meal sacks has also been reported by the doane college which implemented the doane nets project in kenya whereby recycled plastic bags were converted into mosquito nets . since the quality of material used to make maize - bag mosquito nets was of major concern there is need for the ministry of health to promote the initiative and provide the community with the proper netting material for making more comfortable mosquito nets . , it shows that the community was aware of the protection given by nets and willing to contribute towards this initiative , thereby rendering the nets intervention more sustainable and not just waiting for handouts . irs , in addition to itns , is a mainstay of all national malaria control programmes in southern africa . irs is based on the assumption that mosquitoes feed and rest indoors , thereby coming in contact with the sprayed surfaces . mosquito survey conducted in tubu village showed that almost half of the vector mosquitoes caught resting indoors were blood - fed , an indication that the community was at risk of potentially infective mosquito bites . therefore , more should be done in terms of indoor residual spraying , to deter mosquitoes from seeking indoor shelter . in addition the ministry of health should devise strategies to cover those high risk areas for malaria transmission that are considered inaccessible due to flooding . although blood - meal analysis was not done , there is a high likelihood that some of the malaria vector mosquitoes might have fed from human beings , thus making the community vulnerable to potentially infective mosquitoes . this facilitated prompt treatment of malaria and other diseases . from similar observations made in ghana it was suggested that in such situations a higher health education standard could have an additional effect in reducing malaria disease . most of the homesteads were surrounded by low vegetation cover not ideal as resting places for mosquitoes . in general , the area does not support thick vegetation and probably this resulted in daytime resting mosquitoes taking shelter in animal burrow pits . incidentally , during the pra discussions , the community lamented increased activities of pests such as squirrels and porcupine which create burrow pits that have become convenient resting places for mosquitoes . the location of homesteads relative to mosquito breeding habitats was one of the major risk factors for malaria transmission . arabiensis infested water bodies , a distance considered to be within the general flight range of most mosquito species . such closeness of homesteads from breeding sites , in addition to the presence of animal burrow pits within the village , made the human population vulnerable to mosquito bites . year - round sampling through the major bep project established that larval breeding in tubu village took place throughout the year in a variety of habitats created interchangeably by either rainfall or floods ( bep fifth report , 2012 ) , thus exposing the community to year - round mosquito bites . the presence of culicine mosquitoes breeding in the same habitats exacerbated the problem of mosquito biting , though the species were of no medical importance in botswana . abundance of larvae and larval habitats and proximity of humans to larval habitats have been found to correlate very well with vector mosquito biting rates . close proximity of homesteads to vector mosquito breeding sites increased the risk of malaria in many countries including uganda and ethiopia .", "the ministry of health changed its policy on malaria case management and recording in botswana . as from october 2010 to date all suspected malaria cases are not handled at any clinic , tubu included , but promptly referred to gumare district hospital . all recordings are done at central / district hospital . retrieving information from the district attendance register of patients originating from tubu village was not possible because cases were pooled together onto one district register , with other patients presenting with other diseases . furthermore the outcome on malaria patients referred to gumare district hospital is never conveyed back to the clinic of origin . as a result of these anomalies , there is a possibility of both over- or underreporting of malaria episodes by the respondents . however a previous study among the same community / individuals showed that the community was well aware of the disease ( 95.6% ) in terms of signs and symptoms ( 88.7% ) and prevention measures ( 98.6% ) and 100% of the respondents who had suspected a malaria attack sought medical treatment at the clinic . because of the small sample and population sizes of the study area , the results can only be extrapolated to other villages with similar demographic , ecological , and environmental characteristics and can not be generalized to all malaria prone villages in botswana . similar case studies in different malaria prone settings in botswana should be undertaken for comparative purposes .", "in conclusion , socioeconomic status , exposure to mosquito bites through individual nocturnal outdoor activities , and mobility of the community were identified as high risk factors for malaria transmission in tubu village . limited use of malaria protective measures such as insecticide treated nets , house structure ( traditional or modern ) , and close location of homesteads in relation to breeding sites exposed individuals to mosquito bites . however the number of mosquito nets possessed in each household and the farming status were not considered as risk factors for malaria . hut / house eaves used as bedrooms by the respondents did not have any influence on the level , time , and frequency of mosquito bites . the overwhelming use of mosquito nets treated , untreated , or home - made proved to be a viable tool for malaria control in the village . satisfactory service provided at and the close proximity of the health facility were added advantages to the community . furthermore the community benefited from the low vegetation cover surrounding their homesteads , which did not provide enough shelter for even nuisance mosquitoes . it is recommended that the ministry of health should develop a health education package encompassing some of the risk factors identified in this study and other indicated similar studies to be conducted in different settings . from our findings the most important issues to be addressed through the health education package include behavioural changes during nocturnal outdoor activities , ways of protecting oneself during visits to other malaria endemic areas , advice on the ideal location of homesteads in relation to mosquito sources , and promoting the use of insecticide treated eave curtains . ways of promoting household based control methods , based on these specific risk factors , should be devised . the ministry of health should support community initiatives in mosquito net making , in addition to strengthening irs activities in inaccessible flood prone areas of the delta . future research should comprehensively look at the role of other potential risk factors , such as zooprophylaxis and firewood smoke , in malaria transmission and on the possibility of incorporating the benefits derived , if any , into community based malaria control initiatives ." ]

[ "the prevalence of pancreatic cystic neoplasms ( pcns ) is around 2.5%.1,2 pancreatic cysts are increasingly discovered probably because of the ubiquitous presence of multi - detector computed tomography ( ct ) scans and their increased use to evaluate patients with abdominal complaints . endoscopic ultrasound ( eus ) plays a pivotal role in the evaluation of patients with pancreatic cysts but eus and cross - sectional imaging alone have proven to be inaccurate in identifying the exact nature of the cysts . there is inadequate information on the natural history of pancreatic cysts but our knowledge base can not be expanded without being able to determine the exact nature of the cyst noninvasively . toward this end , eus with fine needle aspiration ( fna ) along with cyst fluid analysis has been advocated to improve the utility of eus in the diagnosis of pancreatic cysts . size > 3 cm and/or the presence of mural nodules appear to be the best indicators of malignant change in patients with the side branch form of intraductal papillary mucinous neoplasm ( sb - ipmn ) and mucinous cystic neoplasms ( mcn).3 eus with cyst fluid aspiration and/or fna can play a role in differentiating pcns . this paper will review the role of eus - fna in the evaluation of pcns .", "if the cysts are incidental ( the patient has no symptoms referable to the pancreas ) , the great majority are determined to be neoplastic.4 in one study , the majority of incidentally detected pancreatic cysts ( 58% ) were mucinous and therefore had some malignant potential.4 these data suggest that all incidentally found pancreatic cysts should undergo further evaluation . serous cyst adenomas consist of multiple \" micro cysts \" with thin septae coursing through the lesion . however , 20% have a dominant macrocystic or even solid component which can result in confusion with mucinous cysts.5,6 mcns are almost exclusively located in the tail of the pancreas and are either unilocular or have only a small number of discrete compartments . rarely they will have peripheral ( eggshell ) calcification which is highly predictive of cancer.7 mcn almost never communicate with the pancreatic ductal system . the cystic component of the side branch form of ipmn is essentially a dilated side branch(s ) and by definition , is part of the pancreatic duct . magnetic resonance imaging ( mri ) is superior in imaging sb - ipmn by virtue of its ability to visualize the pancreatic ductal system . secretin stimulated mri / magnetic resonance cholangiopancreatography can be used to highlight the ductal anatomy8 and is commonly used in pancreatic centers but its superiority to non - secretin studies in the evaluation of ipmn has not been proven . identification of sb - ipmn with eus can be made by visualizing a dilated side branch(s ) with connection to the main pancreatic duct . depending on the plane of imaging , they may appear as a chain of lakes - separate cysts that become confluent when scanning back and forth across the cyst . the primary problem with imaging alone in the evaluation of pancreatic cysts is that there are no clearly differentiating features that allow a high degree of diagnostic accuracy . studies have shown that imaging alone is inaccurate in differentiating each of the types of cystic neoplasms.9 in a recent study from the group at the academic medical center in amsterdam , the accuracy in identifying the nature of a pancreatic cyst using eus imaging alone was only 23% to 46% amongst a group of expert endosonographers.10 this study used 4 criteria to differentiate cysts : 1 ) septations , 2 ) mural nodules , 3 ) a solid component , and 4 ) communication with the pancreatic duct . as a result of these discouraging reports , eus - guided cyst aspiration and analysis along with cytology have been used to improve diagnostic accuracy ; especially the differentiation between macrocystic serous cyst adenoma , sb - ipmn and mcn .", "difficulties in establishing an accurate diagnosis with imaging alone have prompted investigators to pursue adjunctive measures . the idea of using analysis of cyst aspirates to diagnose pcn dates back to 1991.11 the massachusetts general hospital surgical group is credited with advancing the clinical application of this concept12 and brugge13 then applied eus - fna techniques to obtain cyst fluid noninvasively . 1 to 2 ml of fluid is needed to perform carcinoembryonic antigen ( cea ) analysis . as a result , the cyst should be 1 to 2 cm in size to obtain sufficient fluid for cea analysis . recently , it has been possible to perform cea on as little as 500 l of fluid ( redpath integrated pathology , pittsburgh , pa , usa ) . because the fluid may be quite viscous , a 19 or 22 gauge needle is preferred . intravenous antibiotics are recommended during the procedure with oral antibiotics given for 3 to 5 days afterwards . it is recommended that the fluid be sent for cea , amylase and/or lipase , and cytology . the rationale for analyzing for amylase or lipase is to aid in determining if there is ductal communication . the cooperative pancreatic cyst study group then reported that cyst fluid analysis for cea was the best test to differentiate a mucinous from a nonmucinous cyst.14 however , the sensitivity and specificity for cea is 73% and 84% , respectively , and 25% of mucinous cysts will have a cea level less than 192 ng / ml.14 it may be possible to improve the analysis of cyst fluid by combining cea and molecular analysis ( dna quantity , k - ras mutations and allelic imbalance mutations ) . sawhney et al.15 reported a 100% sensitivity of discrimination between mucinous and nonmucinous cysts using a combination of cea and molecular analysis . it has also been reported that combining an extracellular mucin stain with cea analysis can provide an accurate discrimination between mucinous and nonmucinous cyst.16 problems with eus - guided cyst aspiration were delineated in a paper by de jong.17 one hundred forty - three consecutive patients with indeterminate pancreatic cysts underwent eus - guided cyst aspiration and the fluid was sent for cea , ca19 - 9 , amylase and cytology . only 90% could be punctured ( cyst in inaccessible location or too small ) . of the remaining 128 patients , only 31% had adequate cellularity for analysis and there was sufficient fluid for cea in only 68 ( 49% ) . fluid specimens from pancreatic cysts seldom yield cells because few viable cells are shed from the lining . the lining epithelium can be patchy which also contributes to the difficulty in obtaining adequate samples . the lining of serous cyst adenomas is a glycogen - rich cuboidal epithelium whereas mucinous cysts have a mucin containing columnar epithelium ( mcn is differentiated from ipmn by having ovariantype stroma ) . a cytology brush within a 19 gauge needle has been developed in an attempt to improve cytologic yield during eus - guided cyst aspiration ( echobrush ; cook endoscopy , winston - salem , nc , usa ) . the needle is passed into the cyst and then the brush is advanced against the inner wall of the cyst . the 1st report of using the cytology brush for pancreatic cyst cytology came from al - haddad et al.18 they studied 10 patients with pancreatic cysts and compared the cellular yield for standard fna compared to brush cytology of the cyst wall . in 7 of 10 patients , the cellular yield and detection of diagnostic cells was superior for the echobrush . sendino et al.19 reported results in 30 patients with pancreatic cysts evaluated with the echobrush ( cook endoscopy ) . in 8/30 patients ( 27% ) however , the brush cytology provided a specific diagnosis in 20/22 ( 91% ) patients in which the technique succeeded . the brush technique was superior to fluid aspiration ( 73% vs. 36% ; p=0.08 ) . three patients experienced complications ( 10% ) : 1 self limited pancreatitis , 1 self limited bleed , and 1 retroperitoneal bleed resulting in patient death at 30 days . a recent report presents better results in obtaining cytology by performing cyst wall puncture ( cwp).20 the technique reported was to advance a 22 gauge needle into the cyst and aspirate all the fluid contents . then , without withdrawing the needle , the needle tip is moved back and forth across the residual hypoechoic cyst wall . if the cyst wall was not visualized , the needle was moved 2 to 3 mm from the needle tip location where the aspiration was completed . using this technique , the authors reported obtaining material adequate for cytologic assessment in 81% of cysts ( 60/66 ) . thirty percent of cysts with cea < 192 ng / ml were proven to be mucinous by cytology . in 67% of cases where the cyst fluid volume was insufficient for cea analysis , cytology demonstrated mucinous epithelium the complication rate was 1.45% ( 1 episode of pancreatitis which was graded as mild and self - limited ) . an alternative or adjunct to cyst wall cytology might be to directly examine the cyst wall . there have been recent reports of using a small confocal microscopy probe ( mauna kea technologies , paris , france ) . the cellvizio system is a probe based confocal microscopy system and a very small probe has been developed which can be passed down a 19 gauge needle . like any other optical biopsy system , konda et al.21 reported use of this technology on 18 patients ; 12 of whom had pancreatic cysts . imaging succeeded in 17/18 patients and in 10/17 , the images were considered to be high quality . future studies will need to address safety issues and determine if a specific diagnosis can be made easily and safely . there have also been reports using the optical catheter used in the spyglass system ( boston scientific , natick , ma , usa ) to directly visualize the cyst lining . direct visualization of both cysts revealed smooth lining and biopsies revealed a mucinous cystadenoma in both cases . there were no immediate complications in either case but one developed severe pancreatitis 1 month after the procedure .", "identification of masses or nodules emanating from the cyst wall can indicate the presence of cancer or high grade dysplasia.3 however , it is important to make a differentiation between a mural nodule and an aggregate of mucin . this distinction was studied by zhong et al.23 who reviewed pathology , eus and ct examinations from 57 patients who had undergone surgical resection of mucinous cysts . cancer or high grade dysplasia was found in 23% of cysts with mural nodules verses 3% without nodules ( p=0.02 ) . mucin balls accounted for 65% of the intracystic lesions detected by eus and were characterized by being round , having smooth edges and being anechoic in the center with an echogenic rim . eus had sensitivity of 75% for the detection of mural nodules compared to 24% for ct . aspiration of cyst contents is indicated if identification of the cyst can not be made with imaging alone . however , if there is an associated mass or mural nodule , then the mass itself should be targeted for cytologic examination . while mucinous cysts are the most common indication , cystic degeneration of neuroendocrine tumors and adenocarcinoma as well as solid pseudopapillary neoplasm and acinar - cell cystadenocarcinoma represent cystic neoplasms of the pancreas that present with a solid component . in these cases any of the 3 gauges of needles ( 25 , 22 , or 19 ) could be used . in the instance of a mass multiple punctures into a cyst is the main risk factor for infection . in the case of a mural nodule , it is best if the cyst fluid can be removed 1st leaving a solid mass to target . our practice is to combine fluid aspiration ( performed 1st ) and then the needle is re - directed to the mass . we prefer to have the 1st pass stained and interpreted before considering a 2nd pass to minimize the number of passes needed to establish the diagnosis and decrease the rate of complications . there has been concern in performing eus - fna of a cyst in the body or tail of the pancreas if malignant transformation is suspected . our japanese colleagues have been most vocal in expressing concerns about the potential of needle tract seeding of cancer cells.24,25 a resectable cystic mass in the body of the pancreas should be considered for surgical resection without fna in most circumstances .", "pancreatic cysts are being increasingly recognized and when detected incidentally , they are likely neoplastic and should undergo further evaluation which should include eus . the cyst fluid should be sent for cea , amylase and cytology . in the future , safe techniques should be developed to improve the cytologic yield because it appears that the exact nature of the lining in mucinous cysts is predictive of their malignant potential.26,27" ]

[ "brucellosis is a zoonotic disease mostly transmitted to humans through consumption of unpasteurized dairy products and can lead to a systemic disease with any organ involvement . in this report , we describe a case of brucellosis - induced avascular necrosis of the hip . brucellosis was diagnosed through serological tests , and avascular necrosis of the femoral head was confirmed by pelvic mri . the patient was treated with a combination of antimicrobial treatments and referred to the orthopedic service for total hip arthroplasty . brucellosis may present with unusual manifestations and should be always taken into consideration , particularly in endemic areas .", "brucellosis is a zoonotic disease mostly transmitted to humans through consumption of unpasteurized dairy products of infected animals ( 1 ) . it is a serious public health problem particularly in endemic areas , and is accompanied by . the disease is endemic in iran and has a high prevalence in lorestan province , central iran ( 3 ) . brucellosis is a systemic disease that may involve any organ in the body ( 4 ) . osteoarticular involvements including arthritis , spondylitis , osteomyelitis , tendonitis , and bursitis occur frequently and are reported in 3085% of patients with brucellosis ( 5 ) . the involvement of the large peripheral joints is usually manifested as monoarthritis ( 1 ) . although the hip joints involvement may happen in brucellosis , brucellosis - induced avascular necrosis of the hip , we describe a case of brucellosis that complicated by avascular necrosis of the femoral head .", "the patient was a 50-year - old rural farmer and rancher who presented with groin pain for six months before admission . he reported no history of trauma , underlying diseases , and steroids and alcohol use . over the previous six months , he had experienced symptoms including .fever , night sweats , weakness , fatigue , anorexia , and weight loss of 10 kg . the patient was visited by a local therapist ; in addition there was a delay in timely referral due to his addiction to opium . the groin pain was his most severe complaint on admission so that he could not bear his weight on the right leg . the physical examinations on admission showed stable vital signs , there was no organomegaly , and the right hip was in flexion and external rotation position so that any active and passive motion increased the pain . the results of laboratory study were as follows : complete blood count ( cbc ) : nl , liver function test ( lft ) : nl , rheamatic factor ( rf ) : neg , antinuclear antibody ( ana ) : neg , blood culture : neg , elevated erythrocyte sedimentation rate ( esr ) , c - reactive protein ( crp ) : positive , and standard agglutination test for brucellosis : positive ( table 1 ) . pelvic radiography and magnetic resonance imaging ( mri ) were administered showing avascular necrosis of right femoral head ( fig . 1 , 2 ) . the patient was subsequently treated with standard antibrucellosis regimen : streptomycine 1gr / d i m for three weeks , doxycycline 100mg / bid po , and rifampin 600mg / d po . .despite the improvement in the patient s general condition and laboratory evidence showing infection control , the patient was suffered from right groin pain and limitation of motion in the hip joint .", "although osteoarticular involvements , especially arthritis in the large peripheral joints , are among the most common manifestations of brucellosis , no joint destruction has been reported in many studies ( 5 ) . despite few reports on the permanent joint complications of brucellosis - induced peripheral joint arthritis , hip joints pyogenic infection has a poor prognosis , particularly if treatment is delayed ( 6 ) . delays in diagnosis and treatment of brucellosis - induced hip arthritis could lead to complications including dislocation and avascular necrosis of the femoral head ( 4 ) . although aspiration and examination of the joint fluid were not performed due to lack of synovial effusion on admission , considering the positive serological tests for brucellosis and concurrent avascular necrosis of the femoral head on mri , it seems that the delay in diagnosis and treatment of brucellosis in this patient had led to avascular necrosis of the femoral head . finally , the following questions arise : was avascular necrosis caused by increased intra - articular pressure related to the infection or due to direct involvement of the femoral head by the organism ?", "since brucellosis is a systemic infection with a broad clinical spectrum ranging from asymptomatic forms to deaths in severe cases , this disease should be taken into considerations when dealing with any patient with various and nonspecific symptoms in endemic areas with extension of the clinical signs of brucellosis . moreover , early diagnosis and long - term treatment and follow - up are of great importance in brucellosis .", "" ]

[ "since the framingham heart study first reported risk factors for atherosclerotic cardiovascular disease , numerous efforts have aimed at improving risk assessment in the asymptomatic population . over time , these efforts have resulted in the introduction of framingham risk score ( frs ) and other biomarkers including the use of noninvasive imaging modalities such as coronary calcium scoring with ct scan and carotid imt and plaque measurement . while these methods have shown prognostic values independent of risk factors , mainstream medicine is still relying on the frs , which tends to be inaccurate for individualized risk assessment and fails to assess the current status of vascular health . moreover , frs and risk factor - based scoring systems are neither designed nor used to monitor response to therapeutic interventions . a comprehensive cardiovascular risk assessment requires measurement of risk factors as well as structural and functional markers of the arterial system . for the widespread acceptance and clinical adoption of a new test , it must be ( 1 ) incrementally predictive over risk factors , ( 2 ) responsive to therapy , ( 3 ) operator - independent and reproducible , ( 4 ) low - cost and widely accessible in primary care settings , and ( 5 ) posing no significant side effects . in recent years , endothelial function measurement has emerged as a reasonable candidate that could fit the above criteria . barometer of cardiovascular risk , and endothelial dysfunction is the gateway to atherosclerotic cardiovascular diseases [ 3 , 4 ] . over the past 20 years , a number of noninvasive methods of assessing peripheral endothelial function have been introduced , including ultrasound imaging of brachial flow - mediated dilatation ( fmd ) , fingertip arterial tonometry , fingertip photoplethysmography , and laser doppler flowmetry [ 512 ] . a new technique named digital thermal monitoring ( dtm ) has been developed to evaluate endothelial function by measuring vascular reactivity during a 5-minute arm - cuff reactive hyperemia test . dtm is the newest addition to the field and monitors fingertip temperature changes to measure vascular reactivity . dtm is a noninvasive , automated , and operator - independent test that can be performed both at physicians ' offices and in patients ' homes . we and other researchers have previously reported the relationships between dtm and cvd risk factors , coronary calcium score , myocardial perfusion defects , and coronary angiographic findings [ 1320 ] . therefore , the present study was conducted on a large registry of 6,084 patients from 18 different clinics to better characterize dtm index of vascular reactivity ( vri ) in relation to patients ' phenotypes .", "the methodology for measuring endothelial function and vascular reactivity using dtm has been previously described [ 2125 ] . all dtm tests were performed using a vendys 6000 portable system ( endothelix , houston , tx ) , a pc - based system that fully automates the cuff reactive hyperemia protocol . the general test setup and a sample vendys test report blood pressure cuffs were placed on both of the subject 's upper arms , and vendys skin temperature sensors were affixed to both of the subject 's index fingers . the software - driven dtm test began with an automated measurement of blood pressure and heart rate obtained from the left arm cuff . following a 5-minute period of patient and temperature stabilization , a 5-minute cuff occlusion ( cuff inflated to 30 mmhg above systolic bp ) of the right arm fingertip temperature in the right hand decreased because of the absence of warm circulating blood . when the cuff was released after the 5-minute occlusion , hyperemic blood flow to the forearm and hand was restored , and this resulted in a temperature rebound in the fingertip that is directly related to the subject 's hyperemic blood flow response , endothelial function , and vascular reactivity [ 21 , 22 ] . using the recorded fingertip temperatures , the ambient temperature of the testing room , the observed slope of temperature decline , and a multivariate bioheat formula , the vendys software calculated and plotted a zero reactivity curve ( zrc ) . the zrc served as an internal control and showed the expected temperature rebound curve , if zero vascular reactivity was present and the other variables remained the same . in other words , the zrc is the expected temperature curve , if no vasodilatation and subsequent reactive hyperemia had occurred . vascular reactivity index ( vri ) was determined by taking the maximum difference between the observed temperature rebound curve and the zrc during the reactive hyperemia period . vri ranged from 0.0 to 3.5 and was classified as being indicative of poor ( 0.0 to < 1.0 ) , intermediate ( 1.0 to < 2.0 ) , or good ( 2.0 ) vascular reactivity . the vendys dtm test registry includes age , sex , blood pressure , heart rate , vri , and fingertip temperature measurements recorded during dtm tests . this study includes a total of 6,084 patients from 18 clinics that volunteered to submit their data to the registry . the number of each type of medical practice is as follows : cardiology = 9 , general / family practice = 4 , antiaging = 3 , and internal medicine = 2 . vri scores in men and women were compared using unpaired student 's t - test . comparisons of categorical data ( e.g. , proportion of subjects with good vri in men versus women ) were performed using fisher 's exact test . pairwise correlations were examined using pearson 's correlation coefficient , and correlations between vri and multiple patient characteristics ( i.e. , age , sex , blood pressure , and heart rate ) were evaluated using multiple linear regression analysis . p value < 0.05 was considered significant . when performing statistical comparisons , tests with missing data cold finger flag was defined as the condition in which the right finger temperature at start of cuff occlusion ( time 300 s ) is 27c . temperatures < 27c often resulted in technically poor results . sympathetic response flag was defined as the condition in which left finger temperature continuously declines ( > 0.5c temperature drop over a 5-minute time period ) after right arm - cuff occlusion . when evaluating vri , tests that exhibited cold finger flag in addition to monitoring temperature at the index finger of the right arm , we studied temperature changes at the index finger of the left ( nonoccluded ) arm and observed interesting signals that are currently under further investigations and not included in the results below .", "overall , the study population had the typical age and sex distribution seen in internal medicine and cardiology clinics . , 54% men , 46% women , systolic blood pressure ( sbp ) 138 20 mmhg , diastolic blood pressure ( dbp ) 77 12 mmhg , and heart rate ( hr ) 70 13 bpm . the vri distribution with cumulative percentages overall , the vri values exhibited the appearance of a normal distribution , with the exception of a small clustering of vri values at or above zero . thirteen percent of vri tests were categorized as poor vascular reactivity ( vri < 1.0 ) , 70% as intermediate ( 1.0 vri < 2.0 ) , and 17% as good ( vri 2.0 ) . vri was slightly higher in women than in men ( 1.56 0.58 versus 1.50 0.49 ; p = 0.0001 ) . the distribution of poor , intermediate , and good vri in men and women is shown in figure 2(b ) . the percentage of good vri was higher in women than in men ( 21% versus 13% ; p < 0.0001 ) . in contrast , men were slightly less likely to have poor vri than women ( 12% versus 14% ; p = 0.03 ) . vri was mildly and inversely correlated with age ( r = 0.21 , p < 0.01 ) as illustrated in figure 3 . as shown in figure 4(a ) , poor vri ( < 1.0 ) was most frequent in the oldest age group ( > 70 yrs . , 18% ) compared with middle age ( 5070 yrs . , 10% ) and younger ( < 50 yrs . , 6% however , the distribution of poor , intermediate , and good vri values in this elderly age group ( figure 4(b ) ) was similar to that of the overall study population ( 13% poor , 70% intermediate , and 17% good ) . vri was not significantly correlated with sbp , dbp , pulse pressure ( pp ) , or heart rate . a trend was seen of higher vri scores in subjects with higher diastolic blood pressure ( r = 0.10 ; p = ns ) . however , none of the blood pressure variables were significantly correlated with vri . multiple regression models were built using vri as the dependent variable and age , sex , sbp , dbp , and hr as independent variables . as shown in table 2 , age , sex , and diastolic blood pressure were significant but weak predictors of vri .", "this is the largest report to date on any fingertip - based measurement of vascular reactivity and endothelial function [ 7 , 26 ] . our analyses showed that vri values derived from dtm followed a near - normal distribution and the reasonable distribution conformed to previously established cutoff values for categorizing vri scores as indicative of poor ( 0.0 to < 1.0 ) , intermediate ( 1.0 to < 2.0 ) , or good ( 2.0 ) vascular reactivity . vri was weakly and inversely correlated with age . however , as shown in figure 4(a ) , the frequency of poor vri was three times higher in > 70 y versus < 50 y. this finding was in line with the findings of framingham heart study reported by hamburg et al . . nonetheless , as reported by schnabel et al . in a community based study of 5,000 individuals , classical risk factors only accounted for 15.4% of fmd and 13.9% of pat variability . this clearly indicates that endothelial function provides a new angle into the status of vascular risk . the distribution of weak association between vri and age is in sharp contrast to other vascular tests , including coronary artery calcium , carotid intimal - media thickness , and arterial stiffness , that are strongly and positively associated with age and , therefore , require age specific cutoffs . although the highest prevalence of poor vri was found in patients older than 70 y , the distribution of vri values in this elderly population ( figure 4(b ) ) clearly shows a sizable number of good and intermediate scores . these findings support the clinical utility of dtm as a test that can differentiate good vascular function from poor vascular function , regardless of patient 's age . this is consistent with the sex differences of endothelial function measured by flow - mediated dilation in healthy adults . however , the magnitude of the sex difference for vri is not felt to be large enough to warrant establishing sex - specific cutoff values for good , intermediate , and poor vascular reactivity . we also observed a trend of higher vri values with higher diastolic bp but no association with systolic bp or pulse pressure . it is possible that the subjects with high bp would have been on multiple antihypertensive medications that could have increased their vri scores . the results of multivariable analyses showed that sbp and dbp were found to have minimal correlations with age . because blood pressure is known to correlate strongly with age in untreated population , bp - lowering medications may have played a significant role in modifying ( leveling ) the relationships in our study population . because our data set was limited by the unknown status of bp medication many investigators of peripheral vascular endothelial function refer to fmd as the method of choice and consider it to be a reference standard , but it has several physiological and technical issues , including operator - dependency , which may result in excessively high inter- and intraobserver variability , effect of the baseline diameter , low flow - mediated constriction , and reduced arterial wall compliance [ 3234 ] . the correlation between fmd and finger - based measurements has been less than strong [ 7 , 26 , 3538 ] . the weak or inconsistent correlations between fmd and the finger - based measurements have been explained by the notion that fmd mainly reflects macrovascular reactivity , whereas the finger - based measurements mostly reflect microvascular reactivity . currently , there is no evidence regarding superiority of macrovascular over microvascular reactivity . more studies are needed to evaluate the predictive value of each for risk assessment and monitoring response to therapies . previous studies showed a significant relationship between poor vri and high framingham risk score as well as high coronary calcium score [ 14 , 18 , 19 ] . moreover , one study found that individuals with both poor vri and high framingham risk score had the highest coronary calcium scores . although more work is needed to develop clear clinical guidelines to incorporate such physiologic measurements into patient care , there is no doubt that these physiologic data offer a new window to an individualized assessment . the fact is that risk factors are population - based factors and do not speak for individual 's susceptibility to the risk factors , nor can they evaluate the current status or activity level of the disease . on the other hand , structural markers such as coronary calcium and carotid imt - plaque are good indicators of susceptibility to risk factors and show the effects of past exposure , but they do not show the current status or the activity level of the disease . in fact , calcification will not go away with treatments , making it not suitable for monitoring progression and regression . measurement of endothelial function and vascular reactivity provides an instant status of the vascular physiology . therefore , for a comprehensive assessment of vascular health , one must pay attention to risk factors , structural markers , and functional markers of the disease . although almost all cvd patients receive medications and other therapeutic interventions , not all respond to the treatments or respond similarly . identifying who responds well and who responds poorly is a major challenge and currently classified as residual risk . budoff et al . reported that vri was significantly higher in patients who received statins and aged garlic extract , compared with those who received statin alone , and that patients who showed a significant improvement in vri had less progression of coronary calcium . showed an independent and significant predictive value for endothelial function measurement in patients at high risk for cardiovascular events . similarly , rubinshtein et al . showed that poor fingertip - based vascular reactivity measurement with pat significantly predicted poor outcomes . together , these data clearly point to the clinical utility of endothelial function in primary and secondary prevention . a detailed comparison of fmd , pat , dtm , and other noninvasive cvd risk assessment methods is shown in table 3 .", "the primary limitation was that the vendys registry data do not include information about patients ' clinical conditions or medication use . we also did not know when the dtm tests were performed in relation to each individual 's medical history and use of medications that might have affected vascular reactivity . strengths of our study include a large sample size and a mixed population of males and females , geographically dispersed and from various outpatient clinics .", "the present study using the largest database of finger - based assessment of endothelial function shows that digital thermal monitoring of vascular reactivity provides meaningful and reproducible physiological variables . it also suggests independent roles for vri as new indices of vascular reactivity and endothelial function . it is essentially a combination of a blood pressure and a thermometer empowered by intelligent software that can be used both at clinics and at home . however , further studies are needed to incorporate these functional measurements into clinical practice guidelines for primary and secondary prevention ." ]

[ "a sandwich or laminate technique is one of the methods proposed for composite resin restorations , which was introduced for the first time by mclean , et al . in 1985 . the basic idea behind this technique is to use two different restorative materials for a single restorative procedure so that the maximum physico - mechanical and esthetic properties of these two materials can be exploited simultaneously . generally , the first component is a layer of conventional or resin - modified glass - ionomer cement which has drawn attention due to its capacity to form an inherent bond with tooth structures and the resultant better seal and decrease in microleakage ( particularly in dentinal walls ) ; it can also release fluoride and decrease the odds of carious lesions . the second component is a layer of composite materials ( including composite resin , compomer , and ormocer ) , which is used to compensate for the limitations and disadvantages of glass - ionomer cements , including weak mechanical properties and inappropriate esthetic appearance . it has been reported that the combination of these two materials have different property results in the clinical success of restorations . the success of the laminate technique depends on the strength of the bond between the glass - ionomer and the resin composite materials in addition to the strength of the bond between the glass - ionomer cement and dentin . however , there is a relatively weak bond strength between conventional glass - ionomers and composite resin materials , mainly because of the lack of a chemical bond between these two materials and the low cohesive strength of glass - ionomer.[35 ] several studies have evaluated different surface preparation techniques for glass - ionomers , such as the use of different bonding systems and surface etching procedures in order to increase the bond strength between these two materials in the laminate technique . etching the surface with phosphoric acid has yielded different results . in a study carried out by sheth , et al . etching the surface of glass - ionomer had no effect on bond strength increase ; however , an increase in bond strength after acid etching has been reported in another study . it has also been reported that premature etching of glass - ionomer cement ( before its initial setting reaction ) and failure to use an adhesive resin between the glass - ionomer cement and composite resin increases the odds of restoration failure . in another study , it was demonstrated that the use of a self - etch adhesive system on half - set glass - ionomer cement ( before its initial setting ) increases the bond strength between the glass - ionomer cement and composite resin more than that observed with the use of total - etch systems ( its application after the initial setting of the cement ) . it has also been reported that the use of a glass - ionomer - based adhesive system applied after the cement 's initial setting improves the bond strength between the glass - ionomer cement and composite resin compared to that with the use of total - etch adhesive systems under similar conditions . a new group of composite resin materials , giomers , have been introduced in less than a decade , which consist of reacted glass - ionomer fillers in a resin matrix ; they are used in cavities in a manner similar to composite resins with the application of an adhesive system . in addition to appropriate esthetic results , easy polishing , fluoride recharging potential and strength , these materials release fluoride which may enhance their antibacterial effects . however , no studies to date have evaluated the bond strength between glass - ionomers and giomers ; therefore , the aim of the present study was to evaluate the effect of three surface preparation methods on the shear bond strength of giomer to different surface treated conventional glass - ionomer .", "sixty cylindrical specimens were used in the present in vitro study . in order to prepare the samples , a plastic mold ( with an inner diameter of 6 mm and a height of 4 mm ) was placed on a glass slab . then conventional glass - ionomer ( gc fuji ii , gc corporation , tokyo , japan ) was packed into the plastic mold after mixing according to the manufacturer 's instructions . another glass slide was used on the other side of the mold to make the free surface of the conventional glass - ionomer smooth . then the samples were randomly divided into three groups of 20 . according to the manufacturer , the initial setting of gc fuji ii conventional glass - ionomer lasts in 5 minutes and a half , and the net setting time is 2 minutes and a half . three groups were compared ; a total - etch adhesive resin or a self - etch giomer - based adhesive resin on set glass - ionomer ; or the self - etch giomer - based adhesive resin on the unset glass - ionomer ( before completion of the initial setting ) . in group 1 the surfaces of the specimens were etched with 37% phosphoric acid ( 3 m espe dental products , st . paul , mn , usa ) for 15 seconds after 5 minutes and 30 seconds from the mixing procedure ; the initial setting reaction was confirmed with the use of a sharp dental explorer . it should be pointed out that a complete setting of conventional glass - ionomer takes 24 - 72 hours . after surface etching , a single bond total - etch adhesive system ( 3 m espe dental products , st . paul , mn , usa ) was applied according to the manufacturer 's instructions and light cured [ table 1 ] . a second transparent mold , with a diameter of 3 mm and a height of 2 mm , was placed on the conventional glass - ionomer specimen and a giomer restorative , beautifil ii a3-shade ( shofu dental corporation , osaka , japan ) , was packed into the transparent mold and cured using a halogen light - curing unit ( astralis 7 ; ivoclar vivadent , fl-9494 schaan , liechtenstein ) . the light - directing probe had a diameter of 8 mm and directed a light ray at an intensity of 700 mw / cm perpendicular to the surface , barely touching the surface , for 40 seconds . a light intensity of 700 mw / cm was confirmed using a radiometer before the start of each experimental session . after transparent mold removal , the specimens were cured for another 20 seconds from each direction . then the samples were kept in humidity chamber at 37c for 1 hour before being immersed in distilled water at 37c for the next 23 hours . in the next stage , a 500-cycle thermocycling procedure was carried out at 5c/55c 5c with a dwell time of 30 seconds and a transfer time of 10 seconds . chemical composition and application mode of adhesives used in group 2 , the procedures were similar to those in group 1 except that fl - bond ii ( shofu dental corporation , osaka , japan ) self - etch adhesive resin was used on set glass - ionomer surface according to the manufacturer 's instructions and light cured [ table 1 ] , without acid etching . in group 3 , all the procedures were similar to those in group 2 except that fl - bond ii adhesive was applied according to the manufacturer 's instructions right after the initial setting and before hardening of glass - ionomer ( 2 minutes and a half after the initiation of mixing , which is equal to the cement 's net setting time ) . it should be pointed out that during that time the surface hardness of the cement was sufficient to place the second mold without damaging the cement . in order to measure the shear bond strength , the samples were mounted in cold - cured acrylic resin from the glass - ionomer side and the shear bond strength values of the samples were measured in newton using a universal testing machine ( h5k - s model , hounsfield test equipment , surrey , uk ) at a crosshead speed of 1 mm / min using a 0.5 mm - wide chisel . then the shear bond strength values were calculated in mpa by dividing the force ( in newton ) by the surface area ( mm ) of the samples . data were analyzed by one - way analysis of variance ( anova ) and pairwise comparisons were made by a tukey test using spss/ win.15 . the failure modes were determined under a stereomicroscope ( smz1500 , nikon , tokyo , japan ) at 20 . the failure modes were classified as follows : adhesive failure : failure at giomer glass ionomer cement interface . in addition , to evaluate the interface between the conventional glass - ionomer and giomer in the groups under study , two additional specimens were prepared in each group and subsequent to longitudinal sectioning , they were evaluated under an scanning electron microscope [ sem ] ( tescan , vega ii xmu , brno , czech republic ) [ figure 1 ] . scanning electron micrographs of conventional glass - ionomer and giomer interface in the study groups ( mag 500 ) . arrows indicate margins of adhesive resin between glass - ionomer and giomer . in the three scanning electron micrographs , the materials which are placed on the right and left sides of the adhesive resin indicate glass - ionomer and giomer , respectively", "shear bond strengths in mpa ( means and standard deviations ) for the study groups are represented in table 2 . there were statistically significant differences in shear bond strength values between the study groups ( p < 0.0005 ) . pairwise comparisons by a tukey test revealed that there were statistically significant differences in shear bond strengths between group 2 and the two other groups ( p < 0.0005 ) , whereas the bond strength difference between groups 1 and 3 was not statistically significant ( p = 0.609 ) . means and standard deviations ( sd ) of the shear bond strengths ( mpa ) measured in study groups moreover , all the cohesive failures were within glass - ionomer cement and there were no cohesive failures inside the giomer . failure modes of the study groups sem photomicrographs of the glass - ionomer and giomer interface in the study groups are represented in figure 1 . in the sem photomicrograph in group 1 [ figure 1a ] the hybrid zone ( the area of adhesive resin penetration into glass - ionomer ) is almost homogeneous but has irregular borders on the glass - ionomer cement side . in the sem photomicrograph in group 2 [ figure 1b ] the hybrid zone is regular and homogenous and in the sem photomicrograph in group 3 [ figure 1c ] the hybrid zone is irregular and non - homogenous . moreover , the use of self - etch adhesive resin ( fl - bond ii ) in groups 2 and 3 resulted in the thicker hybrid zone than total - etch adhesive resin ( single bond ) in group 1 .", "an appropriate bond between glass - ionomer and the superficial resin materials is very important for the success of the sandwich technique . in the present study shear bond strength of conventional glass - ionomer to giomer was evaluated using three different surface preparations for glass - ionomer ( use of self - etch adhesive on glass - ionomer with or without complete initial setting reaction and use of total - etch adhesive on glass - ionomer after completion of the initial setting reaction ) . in designing the present study , the use of total - etch adhesive on glass - ionomer without the completion of the initial setting reaction was not considered , because in total - etch adhesives , rinsing after etching and contamination with moisture before completion of the initial setting reaction of glass - ionomer influences the surface integrity of the cement . the results of the present study showed that shear bond strength of glass - ionomer to giomer depends on surface preparation . in this context , in the group in which glass - ionomer was set and self - etch adhesive was used , the highest shear bond strength was recorded compared to two other groups , which is consistent with the results of a study carried out by gopikrishna , et al . on glass - ionomer - based adhesives ; in the case of complete setting reaction the bond strength was higher than that in incomplete setting reaction . contrary to the results of the present study , knight , et al . reported no statistically significant differences in the bond strength before and after initial setting of glass - ionomer in the co - cure technique , where conventional glass - ionomer , resin - modified glass - ionomer ( rmgi ) , and composite resin were placed in consecutive layers before light - curing procedure . the differences in the results of that study and the present study might be attributed to different etching times in the two studies . the etching time was 15 seconds in the present study , while in the study done by knight , et al . it appears that longer etching time paves the way for greater destruction of glass - ionomer surface by the acid and decreases the bond strength . in addition , a different technique was used in the above - mentioned study , i.e. , a layer of rmgi was used over conventional glass - ionomer before placement of composite resin and the curing process was carried out for rmgi and composite resin simultaneously . it is well - known that the ph of glass ionomer cements is strongly acidic upon mixing , and it will increase with time , with the most rapid increase during the first 5 - 10 minutes of setting , regardless of the composition of the glass ionomer material . in comparison of groups 2 and 3 , it appears that the acidic ph of unset glass - ionomer prevented complete polymerization of the giomer - based self - etch adhesive and therefore decrease the bond strength . in addition , this acidic ph might have an adverse effect on the polymerization of giomer itself . in a study carried out by mohamed - tahir , et al . another study has shown that surface hardness of composite resin placed on polyalkenoate glass ( set for 4 minutes ) significantly decreased . moreover , sem observation of the interface in group 3 revealed an inhomogeneous structure and occasionally breakdown of the glass - ionomer surface , which may have affected the bond strength . polyacrylic acid prevents polymerization of composite resin and results in composite resin softening ; apparently this effect was intensified in incompletely set glass - ionomer . in comparison of groups 1 and 2 , it appears that etching the glass - ionomer surface immediately after the initial setting in group 1 in the total - etch system resulted in the destruction of cement surface , crack formation and decrease in bond strength . this speculation was confirmed by the sem micrographs of the interface . the irregular interface in group 1 may be an indication of damage and weakening of the glass ionomer surface rather than improved micromechanical interlocking , when compared to group 2 which was treated by a comparatively mild acid , i.e. , the self - etching primer . several studies have demonstrated a decrease in bond strength of glass - ionomer to composite resin as a result of etching the glass - ionomer surface . it has been reported that etching during the initial setting reaction of glass - ionomer leads to dissolution of weak calcium - polyacrylate rings , with the resultant deterioration of its physical properties . in the total - etch procedure however , another reason for a higher bond strength in the self - etch group compared to the total - etch group is the fact that the acidic monomers in the self - etch primer can chemically bond to the calcium in glass - ionomer and increase bond strength . in addition , a more appropriate compatibility of giomer with the giomer - based self - etch adhesive might be another reason for a higher bond strength in group 2 ; it has been suggested that the use of adhesives compatible with resin - based restorative materials can decrease deleterious chemical interferences . moreover in the self - etch adhesive group , resin penetration occurs simultaneous with the etching process and it is probable that the discrepancy between these two processes is eliminated or minimized . another factor that needs to be taken into account is the difference in composition and mechanical properties of the two adhesives ; fl - bond ii is a two - step self - etching adhesive with filler particles while single bond is a mixture of hydrophilic monomers and solvents that contains no fillers . it has been suggested that the two - step self - etching adhesives that incorporate a hydrophobic resin as a separate bonding agent may have enhance mechanical properties compared to simplified adhesives . moreover , apart from the composition of resin matrix , addition of filler particles enhances the mechanical strength of the bonding layer and contributes to bond strength . in the present study , no differences were observed in bond strength between groups 1 and 3 , and bond strength in both groups was significantly less than that in group 2 . regarding failure mode in the present study , the majority of failures were of the cohesive type in glass - ionomer , which is consistent with previous studies . this phenomenon might be attributed to lower mechanical properties of glass ionomer cements when compared to resin - based materials and the presence of numerous air inclusion bodies inside glass - ionomer , which act as stress concentration points and probably increase the odds of cohesive failure . a disadvantage of sandwich technique is the absence of a chemical bond between conventional glass - ionomer and superficial resin materials ; therefore , researchers have focused on the establishment of a chemical bond between them . considering the results of the present study , use of giomer - based self - etch systems not only decreases the time needed for the clinical application but also can result in the establishment of a chemical bond between giomer and conventional glass - ionomer .", "taking into account the limitation of this in vitro study , etching the surface of set glass - ionomer with a total - etch system or placement of self - etch adhesive on the surface of glass - ionomer with incomplete initial setting compromised bonding of giomer to glass - ionomer ." ]

[ "planning , evaluating , and budget allocation for prevention programs are contingent upon estimating the size of their target groups . population size estimation of the target groups in some context , such as hiv / aids , always entail numerous challenges in countries where such diseases are concentrated in specific sub - populations with stigmatized behaviors & characteristics ( e.g. : injecting drug users ) ( 15 ) . traditional sampling methods that are used to estimate the size of these high risk populations , including multiplier , capture - recapture , etc . , are very complicated , if not impossible , since locating people with high risk behaviors is difficult , and approaching them directly can greatly reduce response reliability ( 510 ) . estimating social network size of a representative sample , through a general population survey , and asking participants questions about specific high - risk behaviors among their acquaintances ( 1113 ) is one of the best means of gathering information on the sizes of such populations , also called hidden or hard - to - count populations due to the fact that it is not possible to calculate their sizes through regular , direct methods ( 14 ) one such method that has held the interest of researchers for the past decade is network scale - up ( nsu ) ( 6 ) . in this method , the average social network size of the respondents ( shown by c ) is used as a prerequisite for estimating the size of a high risk population in the society ( shown by e ) based on the mean number of persons with high risk behavior known by respondents ( shown by m ) ( 15 ) . in the past two decades , several studies in different countries including the united states , ukraine , brazil , moldova , rwanda , japan , china , and thailand have used this method to determine social network sizes as a pre - requisite for estimating high risk population sizes . this difference points to the need for local studies to determine this value and its determinants ( 1421 ) . in iran , the estimated social network size on a national scale is between 308 and 380 . however , tehran , as a megacity and the capital of iran , has unique demographic , cultural , and social features , special inter - individual relationship patterns , and different subpopulation proportions . in addition , due to the migration of different ethnic groups to this city , various ethnic networks have been formed ( 22 ) . therefore to observe these different characteristics and the technical considerations which are recommended in the nsu method , the present study was designed to examine the social network size of the tehran province residents and the demographic factors affecting it in order to prepare the grounds for estimating the size of hidden populations .", "the social network size was estimated using an indirect approach , that is , respondents were asked how many persons they knew in a certain sub - population within the society , and estimations were made based on the respondents answers . the term knowing a person has a specific definition in this study , and involves a certain time span and space ( 23 , 24 ) ; therefore by saying a knows b , it is understood that a knows b by name and face ; a can visit , call or email b whenever he / she wants , and vice versa . moreover , a has contacted b by phone , email or in person at least once within the past 2 years , and b is a resident of tehran province ( 2527 ) . for the total sample size 1029 , we selected 829 persons from tehran and 200 from robat karim , the capital of robat karim county in tehran provincein 2012 . the city of tehran was divided into 5 geographical zones : north , south , east , west , and center and the sample size were divided proportional to the population size of these five zones . sampling was done in crowded areas , such as streets and parks ; individuals were selected through convenience sampling , and questions were asked in the form of street interviews . all participants were 18 or older , and had been residents of tehran province for the past five years . upon entering the survey , participants were briefed on the study objectives , and their informed consent was obtained . in order to determine the social network size , participants were asked questions regarding the number of people in their personal networks using the indirect method , that is , they were asked how many people they each knew in specific subpopulations . after coordination with the ministry of health and the statistical center of iran , twenty - three known populations with clear and available provincial level statistics were selected to be used in this study . in order to improve estimation accuracy , and in view of the findings of similar studies ( 20 , 28 ) , several considerations were taken into account in preparing the final list of the known populations to be used in the present study ; for instance , the size of all selected populations was between 0.1% and 4% of the total population of tehran province . moreover , we excluded populations that could potentially induce a transmission error in the estimations for which there was no practical correction method . popularity of names in the past three decades was observed in assigning names , and more popular names were used at an almost even distribution . out of the twenty - three initial subpopulations , thirteen were eventually used in the study : first graders , high school graduates , university applicants , university students , married people , divorced people , those who had had normal vaginal deliveries ( nvd ) , those who had had cesarean sections ( c / s ) , primary school staff , people with the first names hamed , abulfazl , sara and marjan . in this study , social network size was estimated using the maximum likelihood estimation ( mle ) method and the equation below : \n c^i = j mijj ej.t where c^i is the social network size of the respondent i , mij is the number of people that i knows in the known population j , ej is the real size of the known population j , the statistical information for which is available through previous censuses or surveys , and t is the total size of the general population in the survey area ( 11 , 13 ) . to compute the 95% confidence intervals of the social network size , standard error c was calculated through the formula below : ( 29 ) \n se ci = tcijej this simple model will only work if the following strong assumptions exist ( 11 , 24 ) : \n all respondents have equal opportunity to know each member of the subpopulations under study.all respondents are fully informed about their own social network.all respondents can recall the number of their acquaintances in the subpopulations under study quickly and clearly . all respondents can recall the number of their acquaintances in the subpopulations under study quickly and clearly . violation of each of these assumptions brings about errors in the results achieved through the network scale - up method . one thing that can violate assumption a is the barrier effect , which pertains to barriers causing some respondents to know the subpopulations in the study with stronger or weaker possibility . transmission error , on the other hand , can violate assumption b , and that is when all people in a given person s network are similarly likely not to be aware of him / her belonging in a subpopulation . estimation effect is another factor that can violate assumption c , and it is due to a lack of precise knowledge of certain details about the people in a high risk social network . in order to control various effects and errors that can bias estimations , the following methods were employed to investigate the sources for these potential errors : 1 ) back estimation of each of the known populations to determine the best groups for estimating the ultimate social network size , and 2 ) variable stratification of the study samples , carrying out all analyses independently in each subgroup , and comparing results with that for the total sample . moreover , acquaintances who were among the respondents social network but were not residents of tehran province were eliminated from all estimations . in order to perform the first correction , a preliminary calculation of the social network size was done , the size of each known population was assumed unknown ( e ) , and then the size of each subpopulation was estimated through the formula below : at this point , the estimate / real ratio ( e / r ratio ) for each population was calculated by dividing the estimated population sizes by the real sizes throughout the province . the next step was to eliminate the first known population in which this ratio was not between 0.5 and 2 . after removing the population in which this ratio was the farthest away from the above - mentioned range of 0.5 and 2 , the whole process was repeated one more time . the procedure was repeated for each of the populations , starting with the farthest outlier , until none of the calculated ratios was outside of this range . the final social network size was computed from the average social network size calculated for people in this stage ( ci ) ( 14 , 24 , 30 ) . in the end , the effect of various demographic and background factors on the social network size of the residents of tehran province was analyzed using a linear regression model .", "a total of 1029 people were interviewed in this study ; 46.7% participants were male . the majority ( 42.3% ) was in the 18 25 year age group ; the last educational degree of most participants was high school graduate or bachelor s degree , and they were mostly university students ( table 1 ) . demographics of study participants using the thirteen known populations , the social network size was estimated at 200.4 ( ci95% : 188.3 , 212.5 ) , which was used for the back estimation of the known populations in this study . the pearson correlation coefficient between the real and estimated sizes of these known populations was 0.44 ( p value = 0.12 ) . the e / r ratio was approximately 1 in all but three of the subpopulations ; exceptions were first graders , and nvd , c / s where e / r ratios were 0.40 , 0.43 , and 0.3 respectively , and therefore the social network size of tehran province was estimated by eliminating the subpopulations c / s , first graders and nvds in that order . table 2 represents the estimated social network size after excluding each of the above subpopulations , as well as the e / r ratio for populations whose sizes have been calculated based on the estimated network sizes that continue to be out of the desired range . having eliminated c / s , primary school and nvd groups , the estimated cs were 220.8 , 243.4 and 259.1 respectively . in addition , the correlation between the real and estimated sizes of remaining groupwas improved significantly in every steps ( r= 0.32 based on groups , 0.51 , 0.72 and 0.82 by dropping c / s , primary school and nvd groups respectively ) . estimate / real ( e / r ) ratio & estimate - real correlation changes after stepwise excluding the known populations with out of range e / r ratio table 3 demonstrates results of applying the back estimation method to subpopulations with estimated sizes within the acceptable range that were used in the final network size estimations . back estimations and e / r ratios of all populations are presented in table 4 . known populations , source of data , back estimation of their population sizes , and the e / r ratio e / r ratio in separate estimations of social network size for men and women ( before and after excluding the three out of range e / r ratio known groups ) figure 1 represents the scatter plot of the real against estimated sizes of the thirteen known populations , and the same measures after excluding the three abovementioned subpopulations . the final network size estimated by using the remaining ten subpopulations was 259.1 ( ci95% : 242.2 , 276 ) . real estimate scatter plot of known population sizes ( before and after excluding the three out of range e / r ratio known groups ) in the univariate analysis , social network size was significantly associated with gender ( p=0.01 ) , age ( p<0.001 ) , and occupation ( p<0.001 ) . men had larger networks comparing to women ( 291.8 versus 230.4 ) , and c in younger people was larger than that in older ones ( 328.5 versus 201.1 ) . multivariate analysis showed that variables of gender and age impacted social network size ( table 5 ) . age was also proved to have a significant impact on the respondents knowing the studied subpopulations ( p < 0.001 ) . comparison of social network size in different sub groups based on different background variables the possibility of knowing a person who had graduated from high school , participated in the university entrance exam , or been admitted into university in the past year was higher in the younger age group ( 56.6% , 63.4% and 39.3% respectively ) ( table 6 ) .", "based on the findings of this study and by using the mle method , the social network size of the residents of tehran province was estimated at 259.1 which were calculated using 10 known populations with an e / r ratio between 0.5 and 2 . age and gender were determinants of peoples network sizes . estimated network sizes were different in male and female respondents , and appropriate known populations used for c estimation in these two groups were not equal . our experience showed that all subpopulations with known size were not appropriate to be used in the estimation of c. we dropped three sub - populations to improve the internal validity of our size estimations , which also used in other comparable studies ( 11 , 14 , 20 , 22 ) . by eliminating these 3 subpopulations , the social network size the national study was primarily biased in a similar manner as well ( 22 ) . therefore , estimation of c based on the size of some known subpopulations is a stepwise technique and has to be applied with some considerations ; otherwise the estimated c might have big bias . the estimated sizes for known subpopulations c / s , nvd , and first graders were less than half the real sizes , and for the subpopulation of people with the first name marjan the estimated size was more than twice the actual size . after all three subpopulations were eventually eliminated , the correlation coefficient was more than double ( 0.82 as opposed to 0.32 ) , and became statistically significant . moreover , the estimations for the subpopulation marjan a persian female first name- fit within the acceptable range , and was closer to 1 . this indicated that the social network size estimated by using the ten remaining known populations would yield a more reliable estimate of hidden subpopulations too . similar studies confirm likewise that elimination of populations with estimations outside of the range 0.5 1.5increases the correlation coefficient between back estimations and real sizes . conducted a research in ukraine to estimate the number of idu s fsw s and msm . of the 22 known populations used in this study , 13 fell within the acceptable e / r ratio range , and were used in the final network scale - up calculations . the estimated sizes of known populations had a high correlation coefficient with the real sizes using the back estimation technique ( r = 0.912 ) , and this number reached 0.94 after nine of the known populations were eliminated ( 14 ) . in another study conducted on 1554 individuals in the u.s . after elimination of two populations with a discrepancy between their real and estimated sizes , the correlation rose to 0.94 ( 11 ) . in the present study , the average e / r ratio using thirteen known populations was calculated to be 1.17 . removing each of the outliers brought this ratio closer to 1 , and after eliminating the 3 sub - populations mentioned earlier , the e / r ratio reached 1.09 . this figure indicated an average overestimation of about 9% in the calculations . in the ukrainian study , the e / r ratio was 1.65 , which denotes an overestimation of 65% in population size estimations ( 14 ) . overestimation seems to be one of the common limitations of the network scale - up method with small subpopulations ( 11 , 30 ) . in the present study , this problem occurred with the subpopulation of people with the first name marjan , which was the smallest subpopulation with only 0.12% of the total population of tehran province . since nicknames are common in iran , this overestimation may be because the respondents network includes people called marjan who are registered in the census with a different name ; this can be true with several names . after eliminating the c / s subpopulation , the e / r ratio for the subpopulation marjan fell within the acceptable range ( e / r = 2 ) , and after the two subpopulations nvd and first graders were removed , this ratio decreased even further ( e / r = 1.7 ) . another common calculation error in the network scale - up method is underestimation of the size of large subpopulations ( 11 , 30 ) . the largest subpopulations used in this study were c / s , first graders , married people , and university applicants . the first two were underestimated as expected , while the other two had more accurate estimations , probably on account of a more satisfactory transmission and the respondents being more informed on these properties due to the significance that iranians attribute to marriage and university education . study on se - roprevalence in the united states , it is difficult for respondents to estimate the number of acquaintances they have in large subpopulations ( 11 ) . in addition to the estimation error in the c / s subpopulation , another explanation for this group having the lowest e / r ratio ( 0.34 ) and an e / r ratio lower than 0.5 for the nvd group is transmission error . the similar natures of these two subpopulations as well as their connection to gender suggested that respondents gender impacts their awareness of nvd or c / s occurring within their social networks . in order to assess the validity of this theory , network size estimations and back estimations for populations were performed based on the respondents gender . based on our findings , the e / r ratios for known populations were different in male and female res pondents ( table 4 ) . the e / r ratios were out of range for the subpopulations c / s , nvd , and first graders when estimated through the networks of male respondents , but this limitation did not exist in case of female respondents . the difference seems to be understandable considering the nature of these subpopulations and the iranian culture : an iranian male respondent would be less likely to be aware of childbirth conditions or first graders in his social network compared to a female respondent in a similar situation . in the ukrainian study , similar circumstances were encountered when estimating the number of militiamen , since there was a higher likelihood for male respondents to know someone in this subpopulation on account of their cultural status and social relations compared to women ( 77% vs. 68% ) . therefore , using the militiamen subpopulation to estimate the social network size leads to different results in male and female respondents ( 14 ) . barrier effect is another significant factor that can compromise the estimation of population sizes in the network scale - up method . one common barrier , which could be a concern in the present study , is the respondents age . those in the 18 25 year group were more likely than others to know someone in the subpopulations high school graduates , university applicants , and university students , considering how these categories are age - related . based on the results shown in table6 however , barrier effect did not affect the results of this study . this is probably because the 18 - 25 year old group is relatively larger in the general population , and our 18 - 25 year old group was proportionately larger too . in the ukrainian study , the two subpopulations polish and moldavian were removed due to the risk of barrier effect and consequent estimation errors . in the final stage of the present study , the remaining ten subpopulations were used to estimate the social network size at 259.1 , and this was used as the base for estimating the known population sizes with the most suitable e / r ratio and the highest correlation with their true sizes . this number was smaller compared to similar study in the country , carried out by shokoohi et al . in kerman province in 2010 ( c = 303 ) . their study was performed on 500 men between 18 and 45 years of age , and the data were collected through interviews . the difference between the social network sizes of the two provinces of tehran and kerman seems to be due to the lifestyle specific to metropolitan areas and capital cities that somehow limits social relationships ; one other reason may be that the kerman study was restricted to male samples , who are expected to have more social contacts and consequently larger networks than females in a city like kerman ( 27 ) . two estimates were computed by entering 23 known groups in the study using regression - based ( c=308 ) and ratio - based ( c=380 ) methods . according to their results , the ratio - based method , which is also used in the present study , is the recommended approach because of higher internal validity and prediction validity ( 22 ) . the ratio of the population size to the total tehran population was beyond the range of 0.1% to 4.0% for 10 of the 23 known groups in the national study ; differences in population compositions and their effect on results can partly explain the different estimates in these two studies . moreover , unique social , cultural , political , and economic processes in tehran have created a different pattern of social interactions that restricts inter - individual relationships and limits the social network size . social science studies also confirm that in recent years , the nature of urban development in megaci - ties such as tehran has entailed loosening in social ties . this is due to concentration of population in metropolitan areas and absence of alternative social practices ( 31 ) . in the ukrainian study , the social network size was estimated at 202 using a network scale - up approach and the mle method , which was also employed by the present study ( 27 ) . in a 2012 study conducted in japan by ezoe et al . with the purpose of estimating the msm population , the network size was estimated to be 363.5 regardless of gender , with 174 being male . out of the initial ten known populations used in this study , only three were eventually used to estimate the social network size in the pilot stage : male fire fighter , policemen , and military personnel . of the seven eliminated populations , five were removed on account of estimation error , that is , their estimated sizes were not consistent with their real sizes , and two were removed due to transmission error ( 20 ) . the social network size was estimated at approximately 291 in the united states , as shown in the 2001 study by mccarty et al . , using four separate national sets of samples . the study used the network scale - up method on 29 known populations , three of which were similar to the subpopulations in the present study and those were : first names , people who gave birth within the last year , and victims of car accidents ( 24 ) . the social network size estimated by killworth et al . was 286 , which is larger than the present study , and this may be due to the numerous cultural and social differences between iran and the united states ( 11 ) . although in the kerman study , there was no significant relationship between the social network size and any of the demographic factors ( age , education , marital status , and occupation ) ( 27 ) ; the results of the present study showed that men comparing to women and younger people comparing older ones had a significantly larger social network , which seems understandable on account of cultural and social considerations . in the national study and the chinese study , the social network sizes of men and younger people was larger compared to those of women and other age groups , and this is due to men and young people having wider social circles ( 21 , 22 ) . married people had smaller social networks compared to single people in the two studies mentioned above ; this difference was found to exist in the present study as well , although the difference between these two groups was statistically not significant in tehran province ( 248.8 versus 270.1 ) . in this study , there were limitations associated with the network scale - up method . firstly , it is unrealistic to expect accurate and flawless estimations , because although there is a precise and specific definition for the term knowing a person , data collected on social networks is self - reported . in minimize this limitation , the present study attempted to use known populations that were easily recognizable by all respondents , and had clear and uniform definitions for all members of the society . furthermore , the time span for the questions was the past year so that respondents could remember the details with fewer errors . another issue , which is quite unavoidable , is lack of definite boundaries separating many subpopulations in the respondents points of view . researchers are limited to subpopulations for which official statistics exist , and these subpopulations have been assigned specific definitions that are not necessarily consistent with those of various members of the society . we intended to select a representative sample of general population in order to minimize different types of selection and information biases . although it was not a fully random sample of whole community and there are some methodological considerations , based on the existing experiences in iran and the result of a methodological study that was performed for comparing three popular sampling method in this type of studies ( street - based , telephone - based and home - based interviews ) in this regard , it seems street - based sampling from deferent geographical zones would be a feasible sampling scheme which was used in the national study as well .", "based on the above explanation , it seems that the social network size of tehran s residents is different not only with similar studies in other countries but also with the results of national survey in iran , which might be mainly because of the special social and cultural pattern of communications among different communities . we also showed that the c varies considerably in males and females , in young and old people . therefore , local estimations for c in different sub - populations are needed to improve the accuracy of nsu estimations .", "ethical issues ( including plagiarism , informed consent , misconduct , data fabrication and/or fal sification , double publication and/or submission , redundancy , etc . ) have been completely observed by the authors ." ]

[ "", "benign prostatic hyperplasia ( bph ) is a highly prevalent disease affecting middle aged and elderly men ( 1 ) . in the united states , bph is the most common benign tumor in men and is the most typically the disorder that reduces the quality of life ( qol ) in men , causing lower urinary tract symptoms ( luts ) ( 2 ) . bph could be accepted as one of the processes of aging , rather than a life threatening disease , however , and as korea is rapidly becoming an aging society , the qol becomes a major issue among koreans . it seems certain that , before long , bph will emerge as one of the main priorities of concern for health care service authorities , as well as the government . according to the report in the united states , approximately 4.5 million visits were made to physicians ' offices for a primary diagnosis of bph , and almost 8 million visits were made with a primary or secondary diagnosis of bph in the year 2000 ( 3 ) . the direct cost of bph treatment was estimated to be 1.1 billion usd , excluding outpatient pharmaceuticals and nutritional supplements or herbal medications . there have been some population surveys on the prevalence of bph in korea ( 4 , 5 , 6 ) , but the scale of those studies was small , and the issue of cost for bph treatment was not investigated . therefore , in the present study , the authors aimed to estimate the amount of health care utilization due to bph by surveying the records of patients who visited the designated medical institutions by the health insurance review and assessment service ( hira ) of korea . the hira monitors and analyzes reimbursement records from the korean national health insurance ( nhi ) and medical aid . because almost the entire nation is required to join the nhi ( approximately 96.6% of the population ) and medical aid ( approximately 3.4% ) , hira records cover all citizens ( approximately 49 million people ) in korea . we also aimed to find any seasonal or regional variation in the cost of health care utilization due to bph , as well as to examine economic burdens on the health insurance system and the pattern of practice in the management of bph . lastly , this nationwide , large - scale survey was conducted to offer the most reliable and objective epidemiological data in order to provide fundamental information for authorities formulating health care policy to improve the national health - related qol .", "we evaluated data from the hira from a span of 5 yr ( 2004 to 2008 ) . data consisted of the patient 's age , residence at diagnosis , treatment cost for bph ( medical and surgical ) , time to surgery from medication , emergency visits , etc . the hira is a non - profit governmental organization established to review medical fees and to evaluate the appropriateness of health care benefits that beneficiaries receive . the hira database contains reimbursement records from all medical facilities ( ~5 - 6 million inpatient - visits per year in about 1,100 hospitals and 25,000 private clinics ) in korea ( 7 ) . the criteria to divide the residence at diagnosis into rural and urban depended on the locations of the clinics or hospitals which were visited by patients . in hira database , small and medium sized cities and farm villages are equivalent to the rural area , while large cities more than megalopolis correspond to the urban area ( 8) . we used all claims records of outpatient visits or hospital admissions of patients aged 20 yr or older , diagnosed with bph ( international classification of diseases [ icd]-10 diagnostic code : n40 ) as the primary diagnosis . we then assessed the seasonal and annualpatterns of hospital visits and duration of treatment due to bph , as well as the changes in the amount of insurance payment for the diagnosis and treatment of bph , during the research period . hospital visit ( hv ) meant the number of days that the patients visited the hospital due to bph and duration of treatment ( dt ) indicated the period of prescription if the patients received medications due to bph . total amount of insurance payment ( taip ) gave the information of the total cost of national insurance payment for bph within one year , and per capitainsurance payment ( pcip ) signified calculated values using this total amount of insurance payment and national population data ( 9 , 10 ) . age - specific number of hv and dt were presented , and differences over the years were analyzed with a poisson analysis and the relative risk ( rr ) was estimated . rr was the calculated specific value which indicated the age - specific relative difference of hv , dt , and pcip based on the value of 1 . a time series analysis was performed to explore the seasonal and annual variation of the amount of hv , dt , taip , and pcip . the durbin - watson test was used to evaluate self - correlations of error . to remove the self - correlations of error a poisson regression analysis was done to estimate the rr of annual variation , age difference , number of hv , and dt for the pcip . age - specific pcip was analyzed after age - standardization using data from the 2005 census ( 9 , 10 ) , obtained from the korean national statistical office . all hypotheses were evaluated in a 2-sided manner , and p value of < 0.05 was considered significant . this study was exempted from review and evaluation by the institutional review board of the boramae medical center , seoul .", "this study was exempted from review and evaluation by the institutional review board of the boramae medical center , seoul .", "the total number of hv from 2004 to 2008 was 12,088,995 . the number of visits increased with time and reached the almost 1.7 fold in 2008 compared to 2004 ( table 1 ) . after a logarithmic transformation to remove an increasing tendency of the range of fluctuation , the linear pattern persisted . the total dt almost doubled from 3,463,520 days in 2004 to 6,598,787 days in 2008 ( table 1 ) . 1c ) . in the time series analysis using the stepwise autoregressive process , the amount of hvincreased every winter which demonstrated seasonality , repetition of a variation of patterns in a 12-month cycle ( fig . 2a , p=0.005 ) . patients in the 20s showed a decrease in hv from year to year , those in the 30s showed an increase until 2006 and then a decrease , those in the 40s showed an increase throughout the study period . after a poisson regression analysis , we found that hv were different depending on the age groups , years , and type of visit ( inpatient or outpatient ) ( p<0.001 ) . the interaction between age groups and years was significant ( p<0.001 ) , which meant that the variation of hv by year was significantly different depending on the age groups . estimated rr is presented in table 2 . for patients in the 20s and 30s , hv significantly decreased 0.78 and 0.96 times , respectively , compared with that of the previous year . on the other hand , in patients in the 40s and above , hv significantly increased 1.10 , 1.13 , 1.17 , and 1.16 times compared to the previous year . there was 11.45 times more outpatient hv than inpatient hv in the same age group and year.dt markedly increased in patients in the 60s and 80s ( fig . the variation of dt by years was significantly different according to the age groups . per capita insurance payment ( pcip ) increased with increasing age and with times ( table 3 and fig . the rate of increase was steeper in the age groups older than the 50s compared to the other age groups . in a significance test for the regression coefficient , we found that the pcip were different depending on the age groups and years ( p<0.001 ) . the interaction between age groups and years was significant ( p<0.001 ) , which implied that the variation of pcip by years was significantly different across the age groups . estimated rr from the poisson regression analysis is presented in the table 3 . in patients in the 20s , , in patients in the 30s or older , pcip significantly increased 1.05 , 1.20 , 1.21 , 1.21 , and 1.20 times compared with the previous year . there was 2.93 times more outpatient pcip than inpatient pcip in the same age group and year . there was no regional difference between urban and rural areas in terms of hv count , dt , and taip due to bph .", "there is not a single developed country in which the importance of care due to bph is not growing . the main contributors of the rising prevalence of bph in korea are suspected to be the elevated standard of living , westernized diet with increased consumption of animal fat , and aging population ( 11 ) . although the fact that the prevalence of bph increases with age is widely accepted and presumed to apply to the korean society , the rate of increase in this study is noteworthy and greater than expected . in the us , the total rate of bph procedures increased significantly after 2002 and was driven by a marked increase of new minimally invasive surgical technologies ( mist ) ( 12 , 13 ) . our data also shows a remarkable elevation in medical costs over a relatively short period of time , which is suspected to be due to not only a sharp upsurge of disease prevalence but also an increase in physicians ' interests , along with the expanded release of new bph drugs and the increase in patients ' treatment - seeking behaviors ( 13 ) . in this study , we demonstrated that the demand for bph treatment nearly doubled throughout the 5 yr of study period . the dt was 3462273 days in 2004 and increased by 1.9-fold , to 6598787 days , in 2008 . the hv was 1827996 days in 2004 and increased by 1.7-fold , to 3057111 days , in 2008 . this rapid growth happened irrespective of regional differences such as whether the area is urban or rural , and regardless of practice patterns by urologists or non - urologists , whether inpatient or outpatient . that was the reason why potentially bph patients in the elderly were more diagnosed and treated after recent large - scale public advertisements and medical education about bph . in other words , in the past , elderly patients suffering from voiding problem due to bph did not know the cause of the problem and the solving methods . but these days , awareness of bph was wide spread and people could easily access the medical knowledge , elderly bph patients had more chance to receive the proper medical care ( 14 ) . by analyzing the hospital visits , we found that the frequency of hospital visits started to increase in the autumn and peaked in december in a similar pattern every year from 2004 to 2008 . from february to april , when the temperature was warmer , the number of hospital visits was fewer . the difference between the number of hospital visits in the colder season and the warmer season reached 1.2 fold . in korea , the annual mean temperature ranges from 10 to 16 degrees celsius except in the high mountain areas and islands . the warmest month is august , whereas january is the coldest one . the monthly mean temperature ranges from 23 to 27 in august and from -6 to + 7 degrees celsius in january ( 15 ) . a majority of urologists have experienced the seasonal variation and rising tendency of bph incidence in the winter , and such a phenomenon has been confirmed with solid evidence based on a large population data ( 16 , 17 ) . it is presumed that our body is too slow to adapt to the sudden change in temperature in the winter ( 18 , 19 ) . in addition , alcohol consumption rapidly increases at the end of the year in korea , deteriorating luts in bph patients and occasionally leading to the most serious complication of bph : acute urinary retention ( aur ) ( 20 ) . higher rates of cold medicine intake could be another explanation for worsening bph symptoms in the winter . alpha - adrenergic agonists , which are a common component of over - the - counter cold medicines , may precipitate urinary retention by enhancing bladder outlet resistance ( 21 , 22 ) . the reports are inconsistent and controversy persists on the seasonal variation of testosterone , but in the largest cross - sectional study , that analyzed archival data from 4,462 us veterans aged 32 - 44 yr , there was a report of a seasonal peak of total testosterone in december ( 24 ) . the amount of hvincreased every winter which demonstrated statically significant seasonality , but the dt and taip were not showed significant pattern.the reasons were suggested that hv was directly influenced and changed by seasonality , but dt and taip were not . for example , even though a patient visited hospital due to aggravating voiding symptoms in winter , the diagnostic procedures or medications were not changed because of season of winter , rather influenced by physician or medical costs . until recently , studies on the health care costs of bph were reported mostly in western societies ( 25 , 26 ) . in the pharmacy and medical claims data obtained from 61 us healthcare plans , 77,040 patients aged over 45 yr were examined , and the overall average annual cost of diagnosis and management for bph was 31.4 million usd . based on us census estimates ( july 2003 ) , the direct cost estimate was approximately 3 billion usd for the year after bph diagnosis . through this study , we figured out that korean taip in 2008 was 66 million usd ( 1 usd=1,103.36 korean won [ krw ] in 2008 ) which were relatively small expenditure of bph costs compared to the united states . however , it is not possible to describe briefly the gap between the two countries , because the medical system of korea and the united states was totally different . to explain the discrepancy of medical costs between korea and other countries would be an interesting subject in future research . the present study has several limitations that require consideration because of the methodological modality using the insurance claim data , as was the case for several studies reported in similar manner ( 4 , 5 , 26 , 27 ) . the insurance claims records might have underestimated the entire bph population if many patients with bph were not diagnosed or treated in health care institutions . additionally , only a single claim with a bph diagnosis was used to identify patients with the condition , so the incidence of this condition might be overestimated in the database because a single patient may have visited clinics several times a year . this study reflects data only for the 5 yr from 2004 to 2005 , which is a relatively short period of time . in addition , we did not have detailed clinical information for each patient , including symptom severity , duration , prostate size , and other medical or surgical history . using the hira data , we did not demonstrated cost of each treatment modalities . however , as was shown in the us ( 12 ) , mist has gained enormous attention from the urologists and the number of mist performed is also increasing in korea . additional researches are warranted . despite these limitations , however , this study has important implications . this is the first nation - wide , population - based study demonstrating not only seasonal and age - specific variation in the incidence of bph , but also the amount of the economic costs for bph patients in korea . therefore , our large - scale data could provide the most reliable information about the incidence of bph and its cost for researchers and authorities formulating health care policy . health care utilization due to bph is rapidly increasing in korea and is more remarkable in the elderly population . our study is the largest scale population study , as well as the most objective clinical data in korea , so it could provide fundamental epidemiological information on bph ." ]

[ "primary retroperitoneal tumors ( prts ) of vascular origin are a diverse group of rare abdominal neoplasms , both benign and malignant . the most frequent malignant tumors are liposarcoma and leiomyosarcoma , while the most often found benign tumors are lipoma , leiomyoma and cavernous hemangioma [ 25 ] . hemangiomas are a group of neoplasms originating from vascular tissue where benign tumors prevail . among these capillary hemangioma , cavernous hemangiomas most frequently occur in the liver . other described localizations are skin , muscles , bones , central nervous system and retroperitoneal organs ( intestines , kidneys , adrenal glands , urinary bladder , uterus ) [ 616 ] . an interventional staged therapy is becoming more popular with the aim of reducing the diameter of the main hemangioma , especially that surrounded with diffuse hemangiomatosis . successful combination of transcatheter arterial embolization ( tae ) prior to the surgery of cavernous hemangioma of the liver was reported recently . nevertheless , the treatment of choice for primary retroperitoneal tumors is still radical surgical resection that leads to recovery . surgical techniques used for treatment of prts are : open procedures , laparoscopy , surgical endoscopy and percutaneous radiofrequency ablation [ 8 , 19 ] . the present case is a patient with giant retroperitoneal cavernous hemangioma originating from the ilium with atypical clinical course who was referred for surgical treatment .", "a 71-year - old female patient was referred to the department of surgical oncology with a giant retroperitoneal tumor located in the left iliac fossa . the patient discovered the abdominal tumor 15 years earlier , but as it did not cause any problems she refused to seek medical help . several months prior to admission to the department the first symptoms appeared : left lower limb edema , exertional dyspnea , abdominal distension and anemia with pallor and lowered hemoglobin level . physical examination revealed a large , skin modeling , nonpulsatile mass in the left iliac fossa ( fig . b computed tomography scan revealing a large , left - sided retroperitoneal mass when abdominal contrast - enhanced computed tomography ( ct ) was performed , a tumor 20 17 18 cm in diameter lying on the iliac ala was found ( fig . an ultrasonography - guided fine needle biopsy was performed , revealing blood cells with necrotic masses and connective tissue which prevented precise diagnosis . blood laboratory findings were : anemia ( hb 8.8 g / dl ) , elevated white blood cell count ( 21.81 g / l ) and high c - reactive protein level ( 100.8 mg / l ) . because of uncertainties regarding the histological type of the tumor , escalation of abdominal pain and left lower limb edema in recent weeks and the patient s strong willingness to remove the tumor , the decision to perform laparotomy was made ( figs . 2 a , b ) . \n a giant tumor with sigmoid colon tight on it . c the tumor after resection ( arrow peduncle connecting the tumor to the ala ) during the surgery a large mass on the ala was found . there were no signs of infiltration of neighboring organs , and the sigmoid colon was tight on the tumor . after separating the sigmoid and identification of the left ureter and iliac vessels massive damage to the internal surface of the ala was found in the place where the tumor grew . pathologic examination showed a tumor 20 19 16 cm in diameter , weighing 3000 g ( fig . histochemically the cells lining the lacunae were stained positively by markers for cd34 ( figs . 3 a , b ) . \n a microscopic image with h&e ( enlargement 10 ) . diag . staining with markers for cd34 confirm an endothelial origin of the cells lining the lacunae the postoperative follow - up is 3 years . within this time limb edema and", "this is caused by its initially symptomless course and therefore delayed presentation to a physician . the most frequent symptoms of retroperitoneal tumors are non - specific abdominal pain ( 51.8% ) and abdominal distension ( 18.7% ) . less frequent symptoms include constipation ( 8% ) , fever ( 8% ) , dysuria ( 4.3% ) , lower limb edema ( 6.5% ) , weight loss and cachexia ( 5% ) . the time of these symptoms occurrence varies from several months for sarcomas to years for benign tumors . patients usually visit a physician when they discover a pathological mass in the abdomen ( 60.4% ) . in the present case her first symptoms ( abdominal distension and limb edema ) occurred 15 years after discovering the tumor . on ct images retroperitoneal tumors present as heterogeneous pathological masses with hypoechogenic areas corresponding to necrotic zones in the tumor . we considered an interventional staged therapy with tae for its possible advantage of reduction of the diameter of the main tumor mass , and surrounding diffuse hemangiomatosis , which was reported in the case of cavernous hemangioma of the liver . the age of the patient with possible diffuse arteriosclerosis and the necessity to resect the symptomatic tumor were the arguments to abandon the percutaneous option . however , one can find publications on treatment of hepatic cavernous hemangioma with percutaneous radiofrequency ablation . in the present case the size and localization of the tumor and urgent necessity made the operation a high - risk procedure with possibility of resecting vital structures , such as the sigmoid colon or ureter . in the present case the long - term history of abdominal tumor indicated a benign tumor , while radiological and clinical findings suggested malignant disease . the literature review shows that in differential diagnosis of giant abdominal tumors , rare benign neoplasms should be considered in every case . radical surgical resection resulted in full recovery in our patient , which corresponds to commonly found conclusions despite the huge diameters and the origin of retroperitoneal tumors [ 20 , 21 ] . in the literature reports we found only 15 cases of retroperitoneal cavernous hemangiomas in kidneys , adrenal glands , urinary bladder , uterus and the retroperitoneal part of the rectum [ 615 ] . however , no description of cavernous hemangioma of the ilium was found ; therefore our report seems to be a unique contribution to contemporary knowledge ( tab .", "because of their initially symptomless course , primary retroperitoneal tumors are usually diagnosed in an advanced stage of the disease , which is the reason for many uncertainties regarding safe surgical resection . radical surgical resection remains the treatment of choice for primary retroperitoneal cavernous hemangiomas , although the decision of performing such operations should be taken after thorough analysis of indications ( escalation of symptoms ) and contraindications ( risk of damaging vital retroperitoneal organs with massive bleeding ) ." ]

[ "the pathogenesis of gmd in pd patients is related to factors such as weight gain and insulin resistance evoked by peritoneal glucose load [ 13 ] . the periodical evaluation of pd patients for gmd is of clinical relevance and should be an element of the surveillance protocol . the gold standard method used for the diagnosis of gmd defined by the world health organization ( who ) in 1998 uses the level of 2-h post - challenge plasma glucose ( 2-hpg ) in the oral glucose tolerance test ( 75-g ogtt ) . criteria for the diagnosis are the following : fasting plasma glucose ( fpg ) 100 mg / dl ( 5.6 mmol / l ) to 125 mg / dl ( 6.9 mmol / l ) ( impaired fasting glucose , ifg ) ; 2-h pg in the 75-g ogtt 140 mg / dl ( 7.8 mmol / l ) to 199 mg / dl ( 11.0 mmol / l ) ( impaired glucose tolerance , igt ) ; 2-h pg in the 75-g ogtt or random 200 mg / dl ( 11.1 mmol / l ) ( dm ) . the utility of the recently recommended use of hba1c in terms of diabetes diagnosis ( diagnostic threshold of 6.5 % ) still remains to be validated . the population at a particular risk of glucose metabolism disorders includes renal transplant recipients , pregnant women , and patients treated with peritoneal dialysis . for each of these groups , there is a lack of clear guidelines for the detection and diagnosis of gmd . therefore , alternative methods for detecting all glucose metabolism disorders ( ifg , igt , and dm ) in the population of high risk of hyperglycemia have been investigated . the issue of glucose metabolism disorders ( gmd ) in pd patients has regained interest in recent years . this increase in clinical relevance was caused by new evidence that even mild hyperglycemia in the dialysis period can be harmful in the long term , being associated with worse survival and elevated risk of post - transplant diabetes mellitus [ 68 ] . treatment with peritoneal dialysis is inherently associated with an additional load of glucose adsorbed from dialysis fluid . the effect of glucose deriving from the peritoneal cavity on the incidence of glucose intolerance still evokes some ambiguity , and published data are equivocal [ 13 , 911 ] . the recent data suggest that high glucose exposure from dialysis solution may be a risk factor for vascular calcification in non - diabetic pd patients . there seem to be some analogies between the occurrence of de novo gmd in patients treated with pd and gestational diabetes ( gdm ) , in which a combination of increased maternal adiposity and naturally occurring human placental hormones produces insulin resistance [ 13 , 14 ] . in both cases , gestational diabetes mellitus is defined as any degree of glucose intolerance with onset or first recognition during pregnancy . the mechanisms that lead to chronic insulin resistance in gdm are varied as they are in the general population . up to 2012 gdm was diagnosed by a two - step approach using a sequential model of universal screening with a 1-h 50-g glucose challenge test ( 50-g gct ) followed by a diagnostic 75-g oral glucose tolerance test ( 75-g ogtt ) for women with a positive screening test [ threshold value 140 mg / dl ( 7.8 mmol / l ) ] . the gdm was recognized in 75-g ogtt when the plasma glucose value was 140 mg / dl . ada recommendations for 2011 adopted new , stricter criteria for the diagnosis of gestational diabetes and confirmed them for 2012 . according to the current recommendations for all pregnant women between 24 and 28 weeks of pregnancy , gestational diabetes is diagnosed if the fasting plasma glucose is at least 92 mg / dl ( 5.1 mmol / l ) , after 1 h 180 mg / dl ( 10.0 mmol / l ) , and after 2 h 153 mg / dl ( 8.5 mmol / l ) . these criteria were based on the results of the hapo study and recommendations of the research group of the international association of the diabetes and pregnancy study groups ( iadpsg ) . there is also a critical discussion concerning the methods and criteria for the new ada 2012 diagnosis of gestational diabetes [ 2023 ] . currently , there are no clear recommendations for diagnosis and classification of glucose disturbances occurring de novo in a population of patients on pd . in our opinion , the who gold standard is not appropriate for pd patients because gmd differ from those in the general population , and other screening strategies should be explored . considering the mentioned similarities , we aimed to examine the utility of the oral glucose tolerance screening test ( 50-g gct ) for pd patients , which is used in a two - step approach to evaluate gestational diabetes . the first step the 50-g gct is performed at any time of the day ( the fasting state is not required ) , using 50 g of glucose , and the plasma glucose was measured at 1 h after administration . in the current study , we aimed to evaluate the applicability of the 50-g gct for the detection of gmd in non - diabetic continuous ambulatory pd patients with normal fasting glucose levels .", "the study was performed in 20 prevalent patients without history of diabetes before pd treatment onset who had been on a pd program at our institution as their first dialysis modality . the median age of patients was 44.19 years [ interquartile range ( iqr ) 34.1556.25 ] , 9 being males and 11 being females , all caucasian with cause of end - stage renal disease ( esrd ) being glomerular disease in 12 patients ( 60 % ) , hypertensive nephropathy in four patients ( 20 % ) , interstitial nephropathy in three patients ( 15 % ) , and polycystic kidney disease in one patient ( 5 % ) . the median duration of pd treatment before inclusion in the study was 15.34 months ( iqr 10.821.34 ) . \n patients were assessed at the study onset ( on the day of the 50-g gct ) and at the end of pd treatment ( 13 patients ) or at end of the observation period ( december 2012 ) for continuing the pd program ( seven patients ) . at the study onset , all patients underwent 50-g gct with a glucose dose of 50 g. the test is performed at any time of the day ( the fasting state is not required ) , using 50 g of glucose , and the glucose is measured at 1 h after the administration . interpretation of our 50-g gct results was as follows : glucose < 140 mg / dl normal value ; 140199 mg / dl impaired glucose tolerance ( igt ) , 200 mg / dl diabetes . \n in case of a fasting glucose value 100125 mg / dl , and normal value in 50-g gct impaired fasting glucose ( ifg ) was diagnosed . the 50-g gct was performed in patients with an empty abdomen after the night dwell draining . during the night , all patients used 1.36 % glucose containing dialysis solution . the glucose was measured at 1 h after administration ; the fasting state was not required . in addition , the following parameters of glucose metabolism were measured : c - peptide , fasting insulin serum concentration , and the glycated hemoglobin level ( hba1c ) . the concentrations of c - peptide and insulin were evaluated in serum samples , and hba1c in whole blood using a chemiluminescent microparticle immunoassay ( cmia ) on the architect system ( abbott , usa ) . based on fasting insulin and glucose values , insulin resistance ( ir ) was determined according to the homeostasis model assessment insulin resistance ( homa - ir ) . they encompassed blood pressure ( bp ) , serum albumin , lipid profiles , hb , crp , liver tests , mean daily peritoneal glucose load , ultrafiltration volume , residual diuresis , weekly dialytic creatinine clearance ( ccr ) , weekly dialytic kt / v , and other laboratory parameters ( uric acid , pth , tsh , fe , tsat , and electrolytes ) . systolic and diastolic bp , residual gfr , weekly dialytic ccr , and kt / v were measured by standard methods . the estimated peritoneal glucose load was calculated by the product of the volume and the glucose concentration of each exchange . the glucose load did not differ between the patients and was similar in all study patients during the follow - up . the patients were prospectively followed for a median time of 25.8 months ( iqr 18.9933.57 ) , and 50-g gct was repeated at the end of the observation period . the statistical analysis was performed with r for windows , version 2.15.1 , and medcalc for windows , version 12.3.1.0 .", "clinical characteristics at the study onset are shown in table 1.table 1clinical characteristics at the study onsetvariable \n n \n medianiqr ( interquartile range)fasting glucose level ( mg / dl)2091.583.596glucose level1 h after gct ( mg / dl)20165137.5195hba1c ( % ) 205.55.45.7c - peptide ( ng / ml)207.245.1210.95fasting insulin serum concentration ( u / ml)2010.347.7916.05homa - ir202.131.573.53systolic bp ( mmhg)20135120155.5diastolic bp ( mmhg)2087.58090serum albumin ( g / dl)203.83.653.95total cholesterol ( mg / dl)20196179231hdl cholesterol ( mg / dl)20433852ldl cholesterol ( mg / dl)20128.5105.5143triglycerides ( mg / dl)20164.5130226.5hb ( g / dl)2010.610.111.85crp ( mg / l)202.091.116.69aspat ( iu / l)2017.51421alat ( iu / l)20171225uric acid ( mg / dl)206.35.557.3pth20817490.51,221.5tsh202.191.054.11fe207451.588tsat ( % ) 2025.41933.9ca ( mmol / l)2098.259.2p ( mg / dl)206.44.857.25mean daily peritoneal glucose load ( g/24 h)20120120120ultrafiltration volume ( ml/24 h)201,3007251,500residual diuresis ( ml/24 h)201,1505001,500weekly dialytic ccr200.690.620.75weekly dialytic kt / v202.192.112.7bmi total ( kg / m)2025.1423.8327.63 clinical characteristics at the study onset 50-g gct revealed gmd in 15 investigated patients ( 75 % ) . the most frequent abnormality was igt ( plasma glucose between 140 and 199 mg / dl ) , which occurred in 11 patients ( 55 % ) . however , despite normal fasting glucose , in four patients ( 20 % ) , the glucose concentrations at 1 h after oral load were above 200 mg / dl , suggesting a preliminary diabetes diagnosis . the other glucose metabolism indicators exhibited little clinical utility for the detection of abnormal glucose tolerance in pd patients . the median percentage of hba1c was in the normal range ( 5.5 % ) , exceeding the upper limit only in two patients ( 10 % ) . median value of homa - ir was 2.13 , being above 2.6 ( the cutoff for ir ) only in seven patients ( 35 % ) . c - peptide concentrations were significantly higher than in non - diabetic healthy individuals ( p = 0.03 ) . a significant correlation was found between homa - ir and c - peptide measurements ( p = 0.001 , 0.677 ) . homa - ir and c - peptide determinations did not correlate with other investigated parameters , i.e. , serum albumin , crp , lipid profile , glucose load in the dialysis fluid , dialysis dose , ultrafiltration , and residual diuresis . patients with gmd were recommended a low - carbohydrate diet , lifestyle modification to promote weight loss , and increased physical activity . the adherence was checked at a monthly interval during patients visit to the pd clinic . four patients , in whom diabetes was recognized after the first 50-g gct , additionally received short - acting sulphonylurea compounds ( glipizide ) for a few months ( 35 ) , and then , a diet satisfactorily corrected the glucose value . the patients were prospectively observed , and after a median time of 25.8 months , the glucose metabolism evaluation was repeated . during the second 50-g gct , igt persisted in eight patients ( 40 % ) , and of particular note , ifg ( 100125 mg / dl ) occurred in four patients ( 20 % ) despite 50-g gct being in the normal range . all patients who exhibited the highest abnormalities suggesting diabetes in the first gct when retested at the end of the observation achieved a normal range . \n glucose metabolism disorders at study onset and at the end of observation are shown in table 2.table 2glucose metabolism disorders at study onset and at the end of observationgct 50 ggmdstudy onsetend of observationifg0 pts4 ptsfasting glucose level ( mg / dl ) median / iqr124/112153glucose level1 h after gct ( mg / dl ) median / iqr176/152189igt11 pts8 ptsfasting glucose level ( mg / dl ) median / iqr93/839587/78.2590.25glucose level1 h after gct ( mg / dl ) median / iqr167/149184150/146167dm4 pts0 ptsfasting glucose level ( mg / dl ) median / iqr93/83.399.8glucose level1 h after gct ( mg / dl ) median / iq207/204236 glucose metabolism disorders at study onset and at the end of observation", "the occurrence of gmd in 75 % of the study subjects representing a small single - center cohort of prevalent pd patients gives a good illustration of the epidemiological dimension of the problem . after the first oral glucose load of 50 g , igt was revealed in 11 subjects ( 55 % ) , and a glucose rise suggesting diabetes appeared in four patients ( 20 % ) . the 50-g gct was performed in prevalent continuous ambulatory peritoneal dialysis ( capd ) patients , who had been on dialysis for a median time of 15.34 months . surprisingly , the literature on gmd in the pd population is very scanty . in two works published in the 1980s , lindholm et al . [ 25 , 26 ] based on their own modification of ogtt ( using 1 g glucose per kg body weight ) carried out in 15 patients concluded that pd treatment up to 1 year does not deteriorate glucose metabolism . . published results of ogtt diminished from standard 7550 g glucose load accomplished in six patients being on pd for at least 6 months . the test was applied exclusively to detect insulin resistance , and the data on increased glycemic and insulinemic responses were presented . more informative and extensive investigation was done by cheng et al . in 35 nondiabetic patients treated by pd for more than 1 year . they challenged patients by standard 75 ogtt and found igt in 31 % . in a larger - scale epidemiological study , insulin resistance was significantly more frequent in pd patients than in hemodialysis and pre - dialysis subjects ( 47 vs. 21 and 26 % , respectively ) . in a study by tatar et al . , insulin resistance was an independent risk factor for arterial stiffness in nondiabetic pd patients older than 50 years . in our present single - center study , we found homa - ir values indicating insulin resistance ( > 2.6 ) in seven patients ( 35 % ) . the c - peptide levels were significantly higher in the pd group than in healthy individuals and correlated closely with homa - ir . it should be mentioned that the elevated c - peptide concentrations in pd patients are mainly a consequence of the fact that 70 % of this peptide is eliminated by the kidney route . however , the strong correlation with homa - ir can be treated as a sign of preserved excretory pancreatic cells capacity . commenting on the results of our study , it is worth emphasizing that the study group encompasses low - risk , middle - aged , non - obese subjects , with normal fasting glucose , normal hba1c , and slightly elevated cholesterol level . the only more pronounced abnormality which is associated with glucose intolerance in epidemiological investigation was hypertriglyceridemia . discovery of gmd in 75 % of patients with such clinical characteristics highlights the clinical significance of this issue . we are conscious that 50-g gct was not validated in the pd population , but it seems to be well suited for a person on pd treatment due to its simplicity and convenience . a plasma glucose value 140 mg / dl , we gave up on performing the second step 75-g ogtt , because the aim of our study was not to recognize diabetes by who criteria , but reveal a group with special risk of hyperglycemia . we treated our test as a screening , not diagnostic method , also taking into account the cost benefit relationship . the 50-g gct allows quick verification of glucose disturbances in patients with an additional daily dose of glucose in the dialysis fluids . in contradistinction to standard 75-g ogtt , it does not require patients to keep coming to the pd clinic at different appointment hours without eating . it obviously does not provide a definitive diagnosis . in the next project following these preliminary data however , we believe that abnormalities revealed by 50-g gct are already of clinical value alerting the patient and physician . it provides a stimulus for preventive measures , which as shown by our experience can be effective , i.e. , the normalization of the test in four patients with the worst results at the onset . the other positive aspect of the current study is supplying evidence that gmd are not inexorably progressive under pd treatment . the maintenance of normal glucose metabolism in pd patients is in the context of obtained results a feasible goal . its achievement could bring benefits in terms of longer patient survival and lower risk of post - transplant diabetes development .", "the oral glucose challenge screening gct test appears to be a sensitive instrument for the detection of glucose metabolism disorders in pd patients with normal fasting glucose .", "" ]

[ "proteomics has emerged as a valuable tool \n for the identification \n of biomarkers associated with human disease including those resulting from very subtle changes in normal cell \n functions and signaling pathways . proteomic technology has advanced \n to a state where thousands of proteins can be identified within complex \n samples , yet disease - based studies using fresh or frozen tissues are limited \n by a lack of available specimens for longitudinal clinical investigations . \n in contrast , there are millions of archival formalin - fixed , paraffin - embedded \n ( ffpe ) tissues for which the clinical course of disease and response \n to therapy has been established . ffpe tissue studies are affected \n greatly by sample collection , tissue processing , and archival time . though these factors are difficult to control \n in archival samples , improvements in techniques such as mtraq have \n made relative quantitation of disease biomarkers in ffpe tissue possible . improving protein extraction and detection of less abundant protein \n biomarkers is also of critical importance in proteomic analysis . protein \n modifications by formaldehyde treatment and histological processing significantly limit the use ffpe tissues for proteomic analyses . \n this has prevented proteomic studies of the clinical course of diseases , \n such as prostate and breast cancer , that evolve slowly or where the \n time between treatment and recurrence is long . coupling proteomic \n investigations with the retrospective pathology information available \n from archival ffpe tissues would produce a wealth of practical information \n on human diseases . some are practical for slide - mounted ffpe tissue , such as \n quantitative fluorescence imaging analysis ( qfia ) , which is reproducible \n and sensitive for specific standardized proteins , or maldi - imaging \n mass spectrometry ( ms ) . other encouraging mass spectrometry \n ( ms)-based proteomic studies of ffpe tissues have appeared in the \n recent literature ; however , these investigations have typically been \n restricted to minute tissue specimens , such as those obtained by laser \n capture microdissection . further , some studies report high rates of \n false - positive protein identification and are limited to the analysis \n of tryptic digests of ffpe tissues by liquid chromatography ms \n ( lc ms ) . our laboratory has been studying the reactions \n of formaldehyde \n with proteins and ways to reverse these reactions . using proteins in aqueous solution , we demonstrated that \n the majority of protein formaldehyde adducts and cross - links were \n consistently reversed with mild heating following the removal of excess \n formaldehyde by dialysis . we then developed \n a tissue surrogate , which consists of one or more proteins that form \n a gel - like plug when treated with formaldehyde at protein concentrations \n exceeding 75 mg / ml . these tissue surrogates have sufficient physical \n integrity to be processed using normal histological methods . a variety of extraction buffers and heating \n protocols were examined for their ability to recover proteins from \n tissue surrogates . protein recovery was generally modest , and studies \n with multiprotein tissue surrogates revealed extraction bias , meaning \n that the composition of the solubilized proteins did not match that \n of the corresponding tissue surrogate . subsequent studies showed that \n the ethanol dehydration step of histology caused most formaldehyde - treated \n proteins to adopt conformations enriched in -sheets , leading \n to the formation of protein aggregates where the -sheets form \n a dense network of intermolecular formaldehyde cross - links . we proposed that the difficulty of rehydrating \n these stabilized protein aggregates was the primary impediment to \n recovering proteins from ffpe tissue . pressure promotes water \n penetration into the inner core of proteins , \n causing denaturation , whereas heat alone causes protein unfolding \n followed by aggregation . consequently , \n we hypothesized that the combined effects of heat and elevated pressure \n would facilitate the rehydration of the highly cross - linked protein \n aggregates in ffpe tissues . the increased exposure to water should \n greatly improve protein solubilization while simultaneously promoting \n the reversal of protein formaldehyde adducts and cross - links . \n initial physical studies on tissue surrogates supported this hypothesis and suggested that the effect of pressure was \n to reduce the size of protein aggregates through increased water penetration , \n rather than to increase the rate of reversal of protein formaldehyde \n adducts and cross - links directly . encouraged by these results , we extracted ffpe mouse liver tissues \n with heat augmented by elevated hydrostatic pressure , with the goal \n of reducing extraction bias , improving the recovery of intact proteins , \n and obtaining tryptic digests that more closely resemble those from \n matched fresh - frozen tissue .", "tissue tek oct compound was purchased from \n sakura , usa , amicon ultra 3k centrifugal filters were purchased from \n millipore , and 37% formaldehyde and pierce detergent removal columns \n were obtained from thermo fisher . precast nupage bis - tris 412% \n gels , 2-(n - morpholino)ethanesulfonic acid sds \n running buffer , and the silverquest staining kit were purchased from \n life technologies . tissue extracts were \n heated under a pressure of 40,000 psi ( 276 mpa ) using both home - built \n and commercial instruments . the home - built instrument consisted of \n a 2-ml capacity ms-1 stainless steel reaction vessel coupled to a \n manually operated high pressure piston screw pump available from high \n pressure equipment company ( erie , pa ) . the temperature of the pressure \n vessel was regulated by a eurotherm 2132 temperature controller ( leesburg , \n va ) connected to an aluminum heating collar surrounding the reaction \n vessel . the tissue extract ( 2 ml ) was added directly to the reaction \n vessel using a syringe . the construction and operation of this pressure \n system has been described in detail previously . the commercial instrument was a model nep 2320 barocycler ( pressure \n biosciences ) modified by the manufacturer to hold isobaric pressure \n and to provide temperature control up to 95 c . the tissue extract \n ( 2 ml ) was added to a ft500 sample tube , which was capped and placed \n in the pressure vessel of the barocycler . the liver from a female balb / c \n mouse was obtained under the secondary use provision from the department \n of laboratory animal medicine of the armed forces institute of pathology \n ( usa ) . half of the liver was immediately frozen in tissue - tek oct \n compound , divided into several equal - sized pieces , and stored at 80 \n c . the other half was fixed for 48 h at 4 c in 10% formalin . \n the fixed liver tissue was washed for 30 min with distilled water \n and dehydrated through a graded series of alcohols ( 70 , 85 , and 100% \n by volume ) and two changes of xylene , 30 min each . recovery experiments , 10 m sections of ffpe mouse liver were \n cleared of paraffin by incubating the sections through two changes \n of xylene for 10 min each . the sections were rehydrated through a \n series of graded alcohols for 10 min each2 changes each of \n 100% ethanol , 85% ethanol , and 70% ethanol and then incubated \n in distilled water for a minimum of 30 min , as described previously . matched fresh - frozen and ffpe liver tissue sections \n were analyzed after 30 days , and again after 1 year , of storage . the ability \n of elevated hydrostatic pressure combined with heat to improve the \n recovery of proteins from ffpe mouse liver tissue was evaluated using \n two heat - based ffpe proteomic protocols recently reported in the literature . for each protocol , the experimental procedure was followed exactly \n as published , but with the heating step divided into two arms , or \n variations . in the first arm , the ffpe tissue extract was heated at \n the temperature and for the length of time reported in the original \n method . in the second experimental arm , the temperature and length \n of time was identical , but the experiment was performed under a pressure \n of 40,000 psi . the two experimental arms were then analyzed using \n identical gel electrophoresis and lc / ms conditions . the protein content \n of the tissue extracts was determined using a bca protein assay kit \n ( pierce ) . following deparaffinization and \n rehydration , the tissue was cut into small pieces and suspended in \n 36 ml of 50 mm tris - hcl , ph 7 , 2% sds ( extraction buffer 1 , \n eb1 ) as described by shi et al . the tissue \n suspension was homogenized with three 5-s cycles of sonication on \n ice using a probe - tip sonicator , and the resulting homogenate was \n split into two equal fractions . one fraction ( protocol-1a ) was incubated \n at 100 c for 30 min followed by 80 c for 2 h at atmospheric \n pressure ( 14.7 psi ) in a sand bath . the second fraction ( protocol-1p ) \n was incubated at 100 c for 30 min followed by 80 c for \n 2 h at 40,000 psi using our hand - built pressure instrument . a 750 \n m section ( approximate thickness ) of matched fresh - frozen liver \n was cut with a razor blade and homogenized in 22.5 ml of eb1 by sonication \n as described above . proteins were extracted using two methods : incubation \n of the homogenate in an ice bath for 2.5 h ( protocol-1fi ) or incubation \n at 100 c for 30 min followed by 80 c for 2 h at atmospheric \n pressure using a sand bath ( protocol-1fh ) . following deparaffinization and rehydration , the \n tissue was cut into small pieces and suspended in 36 ml of \n 100 mm tris - hcl , ph 8 , 100 mm dtt , 4% sds ( extraction buffer 2 , eb2 ) \n as described by ostasiewicz et al . and \n homogenized with three 5-s cycles of sonication on ice using a probe - tip \n sonicator . one fraction ( protocol-2a ) was incubated at 95 c \n for 1 h at atmospheric pressure in a sand bath . the second fraction \n ( protocol-2p ) was incubated at 95 c for 1 h at 40,000 psi using \n the barocycler instrument . a 750 m section of matched fresh - frozen \n liver was cut with a razor blade and homogenized in 22.5 ml of eb2 \n by sonication as described above . proteins were extracted by incubating \n the homogenate at 95 c for 3 min at atmospheric pressure using \n a sand bath ( protocol-2fh ) . all ffpe and matched \n fresh - frozen mouse liver tissue extracts ( 40 g each ) were separated \n by sds - page on precast nupage bis - tris 412% gels using 2-(n - morpholino)ethanesulfonic acid the gels were stained using the silverquest silver staining kit and \n documented using an epson v500 photoscanner and annotated in adobe \n photoshop , version 7.1 . each gel lane was then divided into 10 bands \n and placed into microcentrifuge tubes . in - gel tryptic digestion was \n carried out as previously described . separation of the \n digested peptides was performed using nanocolumns prepared in - house \n ( 75 m i.d . packed with jupiter c18 particles , 5 m , 300 \n ) connected to an agilent 1100 nanoflow lc system , which \n was used to deliver binary gradient solvents a ( 0.1% formic acid ( fa ) \n in water ) and b ( 0.1% fa in acetonitrile ) . reversed - phase chromatography \n was performed by solubilizing the lyophilized tryptic peptides in \n 10 l of 0.1% trifluoroacetic acid and injecting 7 l \n of sample per analysis . after sample injection , a 20-min wash with \n 98% mobile phase a was used to remove any remaining salts from the \n sample . peptide elution was accomplished using a linear gradient of \n 2% solvent b to 42% solvent b over 45 min at a constant flow rate \n of 250 nl / min . the nanoflow reversed - phase lc column was coupled \n online to a linear ion trap mass spectrometer ( ltq , thermoelectron ) \n using the manufacturer s nanoelectrospray source with an applied \n electrospray potential of 1.75 kv and a capillary transfer tube temperature \n of 185 c . the ltq - ms was operated in a data - dependent mode where \n each full ms scan was followed by seven tandem ms scans in which the \n seven most abundant peptide molecular ions detected were dynamically \n selected for ms / ms analysis using a normalized cid energy of 35% . \n a dynamic exclusion of 60-s was applied to reduce redundant selection \n of peptides . the ms / ms spectra were analyzed using sequest ( thermoelectron ) \n against a combined uniprot nonredundant mouse proteome database containing \n 36,799 protein sequences . only peptides with conventional tryptic \n termini ( allowing for up to two internal missed cleavages ) possessing \n delta - correlation scores ( cn ) > 0.08 and charge state - dependent cross - correlation ( xcorr ) criteria as follows were considered as \n legitimate identifications : > 1.9 for + 1 charged peptides , > 2.2 \n for \n + 2 charged peptides , and > 3.1 for + 3 charged peptides . a reverse - database \n search , performed using the respective databases , resulted in a calculated \n false - positive rate of < 2% for all samples analyzed .", "ffpe \n and matched fresh - frozen mouse liver tissue stored for 30 days were \n extracted using protocol-1 . the fresh liver tissue was completely \n solubilized in the extraction buffer ( eb1 ) using extraction either \n on ice ( protocol-1fi ) or at elevated temperature ( protocol-1fh ) . the \n quantity of protein solubilized in the buffer was designated as 100% \n protein recovery in table 1 . ffpe mouse liver \n tissue extracted at atmospheric pressure ( protocol-1a ) resulted in \n a protein recovery of only 17% , and a large plug of remaining tissue \n was observed in the extraction vial . in contrast , when the extraction \n was performed at 40,000 psi ( protocol-1p ) , the solubilized protein \n increased to 77% and only a small amount of tissue residue remained \n in the vial . ffpe and matching fresh - frozen liver tissue stored for \n 1 year were extracted using protocol-2 . the fresh liver tissue was \n completely solubilized in the extraction buffer ( eb2 ) when extracted \n at elevated temperature ( protocol-2fh ) . the quantity of protein solubilized \n in the buffer was designated as 100% protein recovery in table 1 . the advantage of using elevated pressure was again \n evident , as 79% of the ffpe liver protein was solubilized at elevated \n hydrostatic pressure ( protocol-2p ) while only 18% was recovered at \n ambient pressure ( protocol-2a ) . ffpe mouse liver was homogenized \n in extraction buffer and heated with or without elevated pressure . \n fresh - frozen tissue was extracted either at atmospheric pressure using \n the indicated extraction condition or on ice for 2.5 h. protocol used for protein extraction \n ( see materials and methods ) . tissue was heated at 100 c \n for 30 min ; then the temperature was lowered to 80 c for 2 h. the amount of protein extracted \n from fresh frozen tissue was set to 100% . previous studies using ffpe tissue surrogates containing \n several \n proteins indicated that failure to completely \n solubilize the tissue surrogate led to extraction bias , such that \n the composition of the solubilized protein solution differed significantly \n from that of the original surrogate . the extraction bias became less \n significant as the percentage of total protein solubilized from the \n tissue surrogate increased . thus , the \n 4-fold improvement in protein solubilization realized when the extraction \n was performed at elevated pressure is likely to lead to a protein \n extract that more accurately represents the composition of the original \n ffpe tissue . further , the increased amount of recovered protein allows \n a greater number of analytical techniques to be performed . while most \n published proteomic studies of ffpe tissue analyze only a few thousand \n cells from microdissected tissue , the use of elevated pressure has the advantage of improving protein \n extraction from whole tissue sections . this ability is particularly \n useful in instances where tissue microdissection is not practical \n or when a more global proteomic analysis is desired . unbiased protein \n extraction and standardized protocols are particularly important with \n techniques such as reverse phase protein arrays ( rppas ) , where the \n protein components of cell signaling pathways are quantified to direct \n clinical treatment of cancer . the \n 30-day - old ffpe mouse liver extracted at 40,000 psi ( protocol-1p ) \n exhibited a number of well resolved high and low molecular weight \n protein bands by sds - page , corresponding to 87% of those seen \n in the matched fresh - frozen tissue extracted on ice ( figure 1 , lanes 2 and 1 , respectively ) . the ffpe samples \n extracted at ambient pressure ( protocol-1a ) contained relatively few \n well - resolved protein bands equivalent to 25% of those seen \n in frozen mouse liver ( figure 1 , lane 3 ) . similar \n results were seen with 1-year - old ffpe mouse liver extracted at 40,000 \n psi ( protocol-2p ) with well resolved high and low molecular weight \n protein bands corresponding to 74% of those seen in the matched fresh - frozen \n tissue ( not shown ) . when the extraction was performed ambient pressure \n ( protocol-2a ) this value 1d sds - page of fresh - frozen \n and ffpe mouse liver extracts : lane \n 1 , fresh - frozen tissue ( protocol-1fi ) ; lane m , molecular weight marker ; \n lane 2 , ffpe tissue extracted with heat at 40,000 psi ( protocol-1p ) ; \n lane 3 , ffpe tissue extracted with heat alone ( protocol-1a ) . as top - down ms sequencing technology improves , \n the ability to extract \n and analyze intact proteins from ffpe tissue will become more important . \n top - down sequencing facilitates the measurement of combinations of \n modifications , such as phosphorylation and glycosylation , and the \n direct quantitation of specific protein isoforms and splice variants . \n few of these measurements are directly obtainable using bottom - up \n proteomic approaches in which proteins are digested into peptides . \n the ability to extract intact proteins from the seemingly inexhaustible \n source of ffpe tissues will increase the diagnostic and prognostic \n efficacy of proteomic - based biomarker discovery by allowing biomarker \n validation using orthogonal methods such as western blotting , immunohistochemistry , \n immunoassays , and structural and interaction proteomics . in this context , \n the > 3-fold increase in the recovery of intact proteins from ffpe \n tissue achieved by using elevated pressure represents a significant \n breakthrough . ffpe \n and matched fresh - frozen liver tissue stored for 30 days were extracted \n using protocol-1 . ffpe tissue was extracted at ambient pressure ( protocol-1a ) \n or 40,000 psi ( protocol-1p ) , while the matched fresh - frozen liver \n tissue was extracted using protocol-1fi and protocol-1fh . the solubilized \n proteins were separated by 1d - page , and each gel lane was excised , \n digested with trypsin , desalted , and analyzed by lc - ms / ms . the total \n unique peptide and protein identifications for each tissue type and \n extraction condition are shown in table 1 . \n ffpe tissue extracted with heat alone resulted in the identification \n of 5565 unique peptides and 3449 unique proteins . the addition of \n elevated hydrostatic pressure significantly improved both the number \n of unique peptides ( 9621 ) and proteins ( 5192 ) identified . the number \n of proteins identified from the high pressure - extracted sample was \n comparable to the number of unique proteins identified from fresh - frozen \n tissue , which ranged from 4932 for tissue extracted on ice to 4451 \n for frozen tissue extracted with heat ( table 1 ) . the ms results for the 30-day - old ffpe mouse liver extracted \n under elevated pressure ( protocol-1p ) and the matched fresh - frozen \n tissue extracted on ice ( protocol-1fi ) were searched using gominer , \n a gene ontology program . the percentages of nuclear , membrane , intracellular , \n and extracellular proteins identified in fresh - frozen and ffpe liver \n were virtually identical ( figure 2a ) , as were \n the results for classification by biological function ( figure 2b ) . gene ontology analysis of proteins identified by lc - ms / ms . \n proteins \n identified using fresh - frozen mouse liver ( protocol-1fi ) or ffpe liver \n extracted with heat and elevated pressure ( protocol-1p ) were categorized \n by subcellular localization ( a ) or biological process ( b ) , using gominer \n gene ontology software . to address the effect of long - term storage of the \n ffpe specimens , \n the mouse liver samples were investigated after an additional 11 months \n of storage ( 1-year - old sample ) . ffpe tissue was extracted at ambient \n pressure ( protocol-2a ) or 40,000 psi ( protocol-2p ) , while the matched \n fresh - frozen liver tissue was extracted at high temperature ( protocol-2fh ) . \n the solubilized proteins were separated by 1d - page , and each gel lane \n was excised , digested with trypsin , desalted , and analyzed by lc - ms / ms . \n from the 1-d gel , we were able to identify 3492 nonredundant proteins \n in the 1-year - old ffpe liver extracted under elevated pressure , which \n was comparable to the 3415 nonredundant proteins identified in the \n matched fresh - frozen mouse liver extracted at high temperature . in \n contrast , only 107 unique proteins were identified in the ffpe tissue \n extracted at ambient pressure . figure 3 shows venn diagrams of the unique \n and common ( overlapping ) proteins identified in mouse liver tissue \n extracts prepared by different methods . figure 3a compares 30-day - old fresh - frozen liver tissue extracted on ice \n ( protocol-1fi ) versus 100 c for 30 min followed by 80 c \n for 2 h ( protocol-1fh ) . figure 3b compares \n 30-day - old ffpe liver tissue extracted under pressure ( protocol-1p ) \n figure 3c compares 1-year - old \n ffpe liver tissue extracted under pressure ( protocol-2p ) versus matched \n fresh - frozen liver extracted at elevated temperature ( protocol-2fh ) . \n notably , the common proteins , expressed as a percentage of either \n the ffpe or matched fresh - frozen mouse liver tissue , were 50% \n for all three tissue pairs . venn diagrams showing the number of unique and \n common proteins \n identified using lc ms / ms analysis : panel a , fresh - frozen tissue extracted \n on ice ( protocol-1fi ) or with heat ( protocol-1fh ) ; panel b , fresh - frozen \n tissue extracted with heat ( protocol-1fh ) and ffpe mouse liver extracted \n with elevated pressure ( protocol-1p ) ; panel c , fresh - frozen tissue \n extracted with heat ( protocol-2fh ) and ffpe mouse liver extracted \n with elevated pressure ( protocol-2p ) . figure 4a is a pie chart \n showing the number \n of unique proteins identified by two or more fully tryptic peptides \n for 30-day - old ffpe mouse liver extracted under pressure ( protocol-1p ) . \n the results reveal that 49% of the proteins were identified by two \n peptides , 51% were identified by three or more peptides , and 21% of \n the proteins were identified by five or more peptides . figure 4b shows similar results for 1-year - old ffpe mouse \n liver extracted under pressure ( protocol-2p ) , with 57% of the proteins \n identified by two peptides , 41% by three or more peptides , and 15% \n identified by five or more peptides . these results are similar to \n those for the matched fresh - frozen mouse liver tissue ( not shown ) . \n the complete list of peptides identified in the fresh - frozen and high - pressure - recovered \n ffpe tissue , with their corresponding xcorr values , can be found online \n ( supporting information table 1 ) . total number \n of unique proteins identified using lc - ms / ms by two \n or more unique , fully tryptic peptides in ffpe mouse tissue extracted \n with heat and elevated pressure ( 40,000 psi ) : a , 30-day - old ffpe mouse \n liver ( protocol-1p ) ; b , 1-year - old ffpe mouse liver ( protocol-2p ) .", "virtually all protocols reported in the \n literature for the extraction \n of proteins from ffpe tissue use a variation of the heat - induced antigen \n retrieval technique developed by shi and taylor for the recovery of antigenicity in immunohistochemical \n studies . this method involves exposing ffpe tissue sections to a buffer \n solution containing a detergent and/or protein denaturant and elevated \n temperatures of 90120 c for a period of 1030 \n min . optimal antigen recovery varies \n with the host ffpe tissue , with each type requiring different buffers , \n ph values , buffer additives , and incubation temperatures . although the ffpe proteomic literature is still quite limited , it \n is not unreasonable to propose that the same situation applies to \n the proteomic analysis of ffpe tissues . elevated hydrostatic pressure \n is not a technique unto itself but rather an adjuvant method that \n can be applied to existing or future ffpe protein extraction protocols . \n while it remains to be shown that this method is useful with every \n tissue fixation and protein extraction protocol , elevated pressure \n acts through purely physical means and \n should be compatible with ffpe protein extraction buffers of any ph \n and containing any detergent , protein denaturant , or other additive . this should allow its integration into a wide \n range of protein extraction protocols for ms - based proteomics with \n little to no alteration to downstream sample preparation and analysis . \n this was demonstrated in this report by the successful application \n of elevated pressure to two very different published ffpe protein \n extraction protocols . an increase in pressure to 40,000 psi , to augment \n heat treatment , improved protein extraction efficiency from ffpe mouse \n liver tissue by approximately 4-fold and increased the number of unique \n proteins identified by up to 30-fold over the published methods used \n at ambient pressure . further , the tryptic digests of these pressure - extracted \n tissues resulted in protein profiles that more closely resembled those \n from matched fresh - frozen tissue when analyzed by lc / ms than did those \n extracted with heat alone , while maintaining a false - identification \n rate of < 2% . the ability of elevated pressure to significantly \n improve the recovery of intact proteins from ffpe tissues over the \n use of heat alone has great potential for broad application to top - down \n proteomic studies for the identification of disease biomarkers ." ]

[ "type 2 diabetes mellitus ( t2 dm ) is considered a major epidemic of this century . it is estimated that its prevalence will increase worldwide from 371 million people in 2013 to 552 million people in 2030 . t2 dm is associated with accelerated progression of atherosclerosis , the major cause of vascular complications leading to increased morbidity and mortality . chronic , low - grade inflammation has been demonstrated to be involved in the pathogenesis of atherosclerosis in subjects at high risk to develop cardiovascular disease [ 37 ] . among immune cells infiltrating atherosclerotic lesions , polymorphonuclear neutrophil leukocytes with their products were reported to have an important role in the development and progression of atherosclerosis [ 811 ] . marino and coworkers have recently reported that both circulating and intraplaque polymorphonuclear neutrophil leukocytes from subjects with carotid atherosclerosis are active producers of different inflammatory mediators including the vascular endothelial growth factor ( vegf ) . several environmental and genetic factors ( i.e. , hypoxia , hyperglycemia , oxidative stress , ischemia , and gene polymorphisms of vegf ) influence plasma vegf levels [ 1216 ] . among several polymorphisms of the vegf gene , the rs2010963 ( 634c / g polymorphism of the vegf gene ) and few others were reported to affect serum vegf levels [ 1315 ] . moreover , rs2010963 was demonstrated to be associated with several disorders , such as diabetic retinopathy , diabetic nephropathy , myocardial infarction , and impaired prognosis in patients with chronic heart failure [ 1315 , 17 ] . despite these findings , however , data about vegf polymorphisms and their possible association with carotid atherosclerosis in patients with diabetes mellitus are limited [ 1820 ] . additionally , cimt is highly heritable and associated with stroke and myocardial infarction , making it a promising quantitative intermediate phenotype for genetic studies of vascular disease . the present study was thus designed to investigate the association between polymorphisms of the vegf gene ( rs2010963 ) and the kdr gene ( rs2071559 ) and markers of carotid atherosclerosis ( such as carotid intima - media thickness ( cimt ) , the number of affected segments of carotid arteries , and the sum of plaques thickness ) in patients with t2 dm .", "the study protocol was approved by the slovene medical ethics committee in september 2010 ( protocol number 128/09/2010 ) . after an informed consent for the participation in the study this cross - sectional study included 595 subjects with t2 dm and 200 subjects without t2 dm ( control group ) . they were selected among patients admitted to the diabetes outpatient clinics of the general hospitals murska sobota and slovenj gradec , slovenia . subjects in the control group were not allowed to have t2 dm , and they were the staff of the general hospital murska sobota . subjects with t2 dm and control subjects were excluded if they had homozygous familial hypercholesterolaemia or a previous cardiovascular event such as myocardial infarction or a cerebral stroke . all ultrasound examinations were performed by two experienced doctors blinded to the participants ' diabetes status . the cimt , defined as the distance from the leading edge of the lumen - intima interface to the leading edge of the media - adventitia interface , was measured , as described previously . plaques were defined as a focal intima - media thickening and divided into 5 types according to their echogenic / echolucent characteristics , as previously described . the interobserver reliability for carotid plaque characterization the genomic dna was extracted from 100 l of whole blood using a flexigene dna isolation kit , in accordance with the recommended protocol ( qiagene gmbh , hilden , germany ) . for vegf rs2010963 polymorphism competitive allele specific pcr ( kasp ) was conducted on an abi step - one system ( applied biosystems , foster city , ca ) . the reaction mixture ( 5 l ) contained 2.5 l 2x kaspar reaction mix ( v3 ) , 0.07 l assay mix , 1.43 l of distilled water dnase / rnase - free ( gibco , invitrogen life technologies ) , and 10 ng of extracted genomic dna ( 1 l ) . thermal cycling employed the following conditions : hot - start enzyme activation ( 15 min at 94c ) , denaturation ( 20 sec at 94c ) followed by 10 cycles of touchdown over 6557c for 60 sec ( dropping 0.8c per cycle ) , and final 26 cycles ( 20 sec at 94c and 60 sec at annealing temperature 57c ) . for rs2071559 ( kdr ) everything was the same with the exception of thermal conditions . hot - start enzyme activation ( 15 min at 94c ) and denaturation ( 20 sec at 94c ) were followed by 15 cycles of touchdown over 5565c for 60 sec ( dropping 0.8c per cycle ) and final 26 cycles ( 20 sec at 93c and 60 sec at annealing temperature 58c ) . in addition , the fasting serum vegf levels were analyzed in 70 subjects with t2 dm and in 33 subjects with t2 dm . for the determination of the fasting serum vegf concentration ( isoform vegf 165 ) , a solid phase sandwich elisa using two kinds of high specific antibodies ( hvegf assay kit , ibl co. , ltd . the respective cv ( % ) were between 3 and 5.5 for interassay measurements and between 2.6 and 5.3 for intra - assay measurements . continuous clinical data were compared using unpaired student 's t - test or analysis of variance ( anova ) . a statistical analysis was performed using the spss program for windows version 21 ( spss inc . ,", "patients with t2 dm were older , had a greater waist circumference , and had higher fasting glucose and hba1c levels compared to controls , whereas there were no differences in bmi and systolic and diastolic blood pressure between patients with t2 dm and control subjects ( table 1 ) . patients with t2 dm had lower total , hdl , and ldl cholesterol levels and a higher triglyceride level compared to controls ( table 1 ) . plasma levels of inflammatory markers ( i.e. , hs - crp and fibrinogen ) were higher in patients with t2 dm compared to controls ( table 1 ) . additionally , there was higher percentage of men , statin therapy , and antihypertensive therapy and lower percentage of smokers in t2 dm group compared to control group ( table 1 ) . the genotype distributions in both patients with t2 dm and controls were in hardy - weinberg equilibrium for both vegf gene polymorphisms [ rs2010963 : t2 dm ( genotype frequencies : cc genotype 8.7% , cg genotype 47.1% , and gg genotype 44.2% ; = 3.48 ; p = 0.06 ) and controls ( genotype frequencies : cc genotype 9% , cg genotype 48% , and gg genotype 43% ; = 1.46 ; p = 0.22 ) ] . the genotype distributions in both patients with t2 dm and controls were in hardy - weinberg equilibrium for the kdr gene polymorphism [ rs2071559 : t2 dm ( genotype frequencies : cc genotype 22.0% , ct genotype 51.9% , and tt genotype 26.1% ; = 0.97 ; p = 0.33 ) and controls ( genotype frequencies : cc genotype 30.0% , ct genotype 48.0% , and tt genotype 22.0% ; = 0.63 ; p = 0.23 ) ] . no statistically significant differences in the vegf rs2010963 and kdr rs2071559 genotype distribution frequencies were observed between t2 dm patients and controls . the observed minor allele frequency ( maf ) distributions were mostly in agreement with the 1000 genomes project data in the european population . the c allele frequency of the vegf rs2010963 showed no significant difference ( p = 0.79 ) between patients with t2 dm and controls ( 32.3% versus 33% ) . however , the c allele frequency of the kdr rs2071559 polymorphism was significantly lower ( p = 0.04 ) in t2 dm subjects as compared to the controls ( 49% versus 54% ) . higher vegf serum levels were demonstrated in subjects with t2 dm with the cc genotype ( rs2010963 ) compared to those with other ( cg + gg ) genotypes ( table 2 ) . moreover , higher vegf serum levels were found in subjects with the cc genotype ( rs2071559 ) compared to those with other ( ct + tt ) genotypes ( table 2 ) . the comparison of atherosclerosis parameters was performed with regard to different genotypes of the vegf polymorphism ( rs2010963 ) upon enrolment . in our study , we did not demonstrate any association between the rs2010963 and either cimt , the sum of plaque thickness , the number of involved segments , hscrp or the presence of carotid plaques , or the presence of unstable carotid plaques ( tables 3 and 4 ) . we did , however , demonstrate an association between the rs2071559 and either cimt or the sum of plaque thickness in subjects with t2 dm ( table 3 ) .", "in our study , we demonstrated an association between the rs2071559 of kdr and cimt in subjects with t2 dm , whereas we did not demonstrate an association between tested polymorphism of vegf ( rs2010963 ) and cimt . variations in the vegf gene were reported to be weakly associated with cimt . none of the single genotyped polymorphisms ( 2578a > c rs699947 , 634c > g rs2010963 , and + 936c > t rs3025039 ) were significantly associated with overall imt in the study reported by kangas - kontio and coworkers . the haplotype ccc , however , was associated with higher overall cimt in women and the haplotype cct with higher cimt in the internal carotid artery in men . additionally , we also demonstrated an association between the rs2071559 of kdr and the sum of plaque thickness in subjects with t2 dm , whereas no association between tested polymorphism of vegf ( rs2010963 ) and markers of carotid atherosclerosis was demonstrated . the rs2010963 polymorphism of the vegf gene was not demonstrated to exert a significant influence on the risk of subclinical atherosclerosis manifested by the presence of endothelial dysfunction by brachial artery reactivity and increased cimt in a series of patients with rheumatoid arthritis . contrary , the importance of vegf and its receptor ( vegfr1 ) was reported by russell and coworkers . in unstable plaques ( cap rupture / thinning ) increased vegf and receptor ( vegfr1 ) staining as well as increased microvessel density was demonstrated in comparison with stable carotid plaques . additionally , marino and coworkers have recently reported that both circulating and intraplaque polymorphonuclear neutrophils ( pmn ) from subjects with carotid atherosclerosis are active producers of vegf , il-8 , and elastase . moreover , an evidence is provided that these pmn have an increased ability to produce vegf ( at mrna levels ) in comparison to cells from healthy subjects . additionally , increased vegf mrna occurs in both intraplaque and circulating pmn , at rest as well as after stimulation , suggesting that such functional changes are systemic and not limited to cells infiltrating the vascular wall . in contrast to these findings , we did not demonstrate an effect of vegf / kdr polymorphisms on the presence of either plaques or unstable plaques , since no difference in genotype distribution was present . in our study , the effect of either rs2071559 of kdr or rs2010963 on vegf serum levels was demonstrated . these findings are in accordance with our previous studies in which subjects with recent mi history ( up to 9 months after mi ) were enrolled [ 13 , 16 , 25 ] . moreover , increased plasma vegf levels demonstrated in the stable phase after mi correlated with inflammation cytokines ( il-8 and il-6 ) , but not with atherosclerotic burden . in contrast to the minor effect of the rs2071559 of kdr and the absence of the rs2010963 of the vegf , an association of either rs2071559 or rs2010963 with mi has recently been reported in caucasians with t2 dm [ 13 , 16 , 24 ] . our present findings and previous reports are additional evidence that markers of carotid atherosclerosis and atherothrombotic events ( i.e. , mi ) are most probably not regulated via similar genetical / biological mechanisms . to conclude , in our study we demonstrated a minor effect of the rs2071559 of kdr on markers of carotid atherosclerosis ( cimt , sum of plaque thickness ) in subjects with t2 dm , whereas we failed to demonstrate an effect of tested polymorphism of the vegf gene ( rs2010963 ) on markers of carotid atherosclerosis" ]

[ "hidradenomas are benign cutaneous tumors of sweat gland origin , with the clear cell type constituting the most frequent histologic variety . usually , they are diagnosed in the elderly population , the peak incidence being the fifth to sixth decade . we describe a young girl , in whom nodular hidradenoma developed at the age of 6 years . hence , our case demonstrates that nodular hidradenoma is a rare differential diagnosis of skin tumors , even in the pediatric age group .", "a 10-year - old girl presented to us with a swelling on the left thigh , which had been progressively enlarging over the preceding 4 years . cutaneous examination revealed a solitary erythematous dome - shaped , well - circumscribed tumor , measuring approximately 6 cm 4.5 cm . there was spontaneous dripping of straw - colored serous fluid at the rate of 2030 drops / min , the discharge accentuating on pressure . biochemical analysis of the serous fluid revealed glucose 25 mg / dl , protein 4 g / dl , sodium 131 mmol / l , and potassium 4.3 mmol / l , almost similar to that of serum , the low concentration of glucose compelling us to think of something else . the mass was excised . the solid portion was largely composed of a cell type having finely granular , faintly eosinophilic cytoplasm with a dark - colored round to oval nucleus . the cyst was lined by a single layer of cuboidal epithelium without evidence of decapitation secretion [ figure 5 ] . solitary dome - shaped , well - circumscribed tumor over the left thigh photomicrograph showing a well - encapsulated mass composed of solid and cystic portions ( h and e , 40 ) photomicrograph showing a well - encapsulated mass with large cystic spaces within it . ductal luminal structures can be appreciated ( h and e , 100 ) photomicrograph showing clear cells in the center along with cystic spaces ( h and e , 400 ) note the large cystic cavity within the mass .", "clear cell hidradenoma or eccrine acrospiroma of the skin was first described by liu , in 1949 , as clear cell papillary carcinoma of the skin . it was reported under various designations such as nodular hidradenoma , eccrine acrospiroma , solid - cystic hidradenoma , clear cell acrospiroma , clear cell myoepithelioma , and eccrine sweat gland adenoma . clinically , nodular hidradenoma presents as a slow - growing , red- , blue- , or brown - colored solitary , 530 mm in size , freely mobile and firm nodule , with an occasional cystic appearance . these are most commonly found on the scalp , face , thorax , abdomen , and gluteal region . this tumor is found mainly in adults and is excised more commonly in women than in men . our patient was a young girl who presented with a gradually increasing swelling on the lower limb , a site that is unusual for the development of nodular hidradenoma . literature search showed very few cases of nodular hidradenoma on the lower limb , that too in the pediatric age group . however , a case of nodular hidradenoma masquerading as umbilical polyp has been reported in a 1-year - old male child our patient complained of serous discharge from the lesion , for the preceding 3 months . clinical differential diagnoses for our case were cutaneous lymphoma , dermatofibrosarcoma protuberans , epidermoid cyst , and sweat gland tumor . however , histology reliably excluded all the possibilities . it was predominantly composed of a cell type having finely granular , faintly eosinophilic cytoplasm with a dark - colored round to oval nucleus . the chronically discharging nature of the tumor in our patient was attributable to the fluid - filled cavity within the lesion . biochemical analysis of the fluid was almost consistent with that of serum , however , the low concentration of glucose hinted that it might be normal sweat . recently , nuclear grooving has been described as a useful morphological feature to aid in its diagnosis . immunohistochemical staining of the tumor cells demonstrates positive staining with antibodies against ck - cam 5.2 , ber - ep4 , p63 , epithelial membrane antigen , s-100 protein , smooth muscle actin , and vimentin . however , due to unavailability of resources and financial constraints , the immunohistochemical analysis could not be performed in our case . the high rate of local recurrence ( 10% ) and potential for malignant transformation make surgical removal with wide margins as the widely accepted modality of treatment . the high recurrence is attributable to incomplete resection and to tumor tissue located between the dermis and subcutaneous tissue . these are characterized by increased mitotic activity , angiolymphatic invasion , local extension into deeper tissues , and a dispersed pattern of growth . nodular hidradenoma in the pediatric age group is extremely rareit is usually located over the head , neck , and trunk . in our case , the lesion was present in the lower limbthe presence of an unusually large cystic cavity within the tumoral mass , leading to serous discharge , makes our case even more interesting . \n nodular hidradenoma in the pediatric age group is extremely rare it is usually located over the head , neck , and trunk . in our case , the lesion was present in the lower limb the presence of an unusually large cystic cavity within the tumoral mass , leading to serous discharge , makes our case even more interesting .", "nodular hidradenoma in the pediatric age group is extremely rareit is usually located over the head , neck , and trunk . in our case , the lesion was present in the lower limbthe presence of an unusually large cystic cavity within the tumoral mass , leading to serous discharge , makes our case even more interesting . \n nodular hidradenoma in the pediatric age group is extremely rare it is usually located over the head , neck , and trunk . in our case , the lesion was present in the lower limb the presence of an unusually large cystic cavity within the tumoral mass , leading to serous discharge , makes our case even more interesting .", "", "nodular hidradenoma in the pediatric age group is extremely rareit is usually located over the head , neck , and trunk . in our case , the lesion was present in the lower limbthe presence of an unusually large cystic cavity within the tumoral mass , leading to serous discharge , makes our case even more interesting . \n nodular hidradenoma in the pediatric age group is extremely rare it is usually located over the head , neck , and trunk . in our case , the lesion was present in the lower limb the presence of an unusually large cystic cavity within the tumoral mass , leading to serous discharge , makes our case even more interesting ." ]

[ "the gothenburg osteoporosis and obesity determinants ( good ) study was initiated with the aim to determine both environmental and genetic factors involved in the regulation of fat mass as previously described ( 23 ) . to be included in the good study , subjects had to be male , 18 to 20 years of age , and willing to participate in the study a total of 1,068 subjects , representative of the general young male population of gothenburg ( 23 ) ( data not shown ) , were enrolled in the study . of the 1,068 subjects , complete growth and weight charts for determination of bmi between 1 and 10 years of age were available for 612 subjects ( growth chart subsample ) . dual - energy x - ray absorptiometry analyses were performed on 610 subjects of the growth chart subsample , whereas abdominal ct scans were performed on 201 ( the ct subsample ) of the 612 study subjects in the growth chart subsample . the growth chart subsample is representative of the entire good cohort in terms of age ( good 18.9 0.6 years , growth chart subsample 18.9 0.5 years , nonsignificant ) , weight ( good 73.9 11.9 kg , growth chart subsample 73.3 11.5 kg , nonsignificant ) , height ( good 181.4 6.8 cm , growth chart subsample 182.0 6.8 cm , nonsignificant ) , and bmi ( good 22.4 3.2 kg / m , growth chart subsample 22.1 3.1 kg / m , nonsignificant ) . the ct subsample is representative of both the growth chart subsample and the entire good cohort in terms of weight , height , and bmi ( ct subsample weight 72.7 11.2 kg , height 181.9 7.0 cm , bmi 21.9 3.0 kg / m , nonsignificant versus both the entire good cohort and the growth chart subsample ) . however , the subjects of the ct subsample were slightly younger ( ct subsample 18.7 0.5 years ) than both the subjects of the entire good cohort and the subjects of the growth chart subsample ( p < 0.05 ) . the good study was approved by the local ethics committee at gothenburg university . written and oral informed consent was obtained from all the study participants . height was measured using a wall - mounted stadiometer and weight was measured to the nearest 0.1 kg as previously described ( 16,23 ) . total body fat mass , percentage body fat , total body lean mass , and fat mass of the trunk were assessed using the lunar prodigy dxa ( ge lunar , madison , wi ) . a previously described ct technique was used to measure the cross - sectional adipose area of the abdomen ( 16,24,25 ) . a single slice at the level of the fourth lumbar vertebra was acquired with a general electric high speed advantage ct system ( version rp2 ; ge medical systems , milwaukee , wi ) . subcutaneous and visceral adipose tissue areas were measured , and then the visceral adipose tissue area was divided into an intraperitoneal and a retroperitoneal adipose tissue area . growth and weight charts were collected for the subjects of the good study and longitudinal growth was curve fitted according to the infancy - childhood puberty ( icp ) model ( 26 ) as previously described ( 16,27 ) . the icp model represents a widely used model for fitting of human growth data to mathematical functions ( 26 ) . the infancy part is represented by an exponential function , the childhood part by a quadratic function , and the pubertal part by a logistic function . the model also includes the transformations between the different phases . by using this model , we computed values of height at exact ages . body composition , including bmi , is greatly influenced by pubertal stage and thereby pubertal timing ( 28 ) . complete growth charts with enough data to determine pubertal timing , requiring several height and weight measurements around the pubertal growth spurt , were not available for the complete growth chart subsample used in the present study . we have therefore chosen to use measurements of bmi before and after , but not during , puberty . body weights between 1 and 10 years of age were estimated through fitting of the weight curve for each child using smooth splines ( smooth.spline in the r package statistics , the r foundation for statistic computing , vienna , austria ; http://www.r-project.org ) . bmi values between 1 and 10 years of age were then calculated from the estimated values of weight and height . the z score , the standardization of a variable relative to the investigated population expressed in sds , was calculated using the software spss 15.0 ( spss , chicago , il ) . for each subject ( n = 612 ) in this cohort and for each age , the height was calculated using the icp model . these values were then used to calculate the z score for each subject at each age based on the variation ( sd ) in calculated height within the presently investigated population at that specific age . the variance of young adult body composition parameters ( r ) explained by bmi or bmi z score changes and the corresponding coefficients during childhood and adolescence was calculated using linear regression analyses with age - adjusted adult body composition variables as the dependent variable . age adjustments were performed because the subjects differed somewhat in age at body composition analysis ( 1820 years of age , mean sd 18.9 0.5 years ) and were performed between age at fat analysis and the body composition variables . all subsequent statistical calculations were performed using the age - adjusted body composition variables . for the calculations in fig . for all the statistical analyses , the software spss ( version 15.0 ) was used .", "height was measured using a wall - mounted stadiometer and weight was measured to the nearest 0.1 kg as previously described ( 16,23 ) .", "total body fat mass , percentage body fat , total body lean mass , and fat mass of the trunk were assessed using the lunar prodigy dxa ( ge lunar , madison , wi ) .", "a previously described ct technique was used to measure the cross - sectional adipose area of the abdomen ( 16,24,25 ) . a single slice at the level of the fourth lumbar vertebra was acquired with a general electric high speed advantage ct system ( version rp2 ; ge medical systems , milwaukee , wi ) . subcutaneous and visceral adipose tissue areas were measured , and then the visceral adipose tissue area was divided into an intraperitoneal and a retroperitoneal adipose tissue area .", "growth and weight charts were collected for the subjects of the good study and longitudinal growth was curve fitted according to the infancy - childhood puberty ( icp ) model ( 26 ) as previously described ( 16,27 ) . the icp model represents a widely used model for fitting of human growth data to mathematical functions ( 26 ) . the infancy part is represented by an exponential function , the childhood part by a quadratic function , and the pubertal part by a logistic function . the model also includes the transformations between the different phases . by using this model , we computed values of height at exact ages . body composition , including bmi , is greatly influenced by pubertal stage and thereby pubertal timing ( 28 ) . complete growth charts with enough data to determine pubertal timing , requiring several height and weight measurements around the pubertal growth spurt , were not available for the complete growth chart subsample used in the present study . we have therefore chosen to use measurements of bmi before and after , but not during , puberty . body weights between 1 and 10 years of age were estimated through fitting of the weight curve for each child using smooth splines ( smooth.spline in the r package statistics , the r foundation for statistic computing , vienna , austria ; http://www.r-project.org ) . bmi values between 1 and 10 years of age were then calculated from the estimated values of weight and height . the z score , the standardization of a variable relative to the investigated population expressed in sds , was calculated using the software spss 15.0 ( spss , chicago , il ) . for each subject ( n = 612 ) in this cohort and for each age these values were then used to calculate the z score for each subject at each age based on the variation ( sd ) in calculated height within the presently investigated population at that specific age . the variance of young adult body composition parameters ( r ) explained by bmi or bmi z score changes and the corresponding coefficients during childhood and adolescence was calculated using linear regression analyses with age - adjusted adult body composition variables as the dependent variable . age adjustments were performed because the subjects differed somewhat in age at body composition analysis ( 1820 years of age , mean sd 18.9 0.5 years ) and were performed between age at fat analysis and the body composition variables . all subsequent statistical calculations were performed using the age - adjusted body composition variables . for the calculations in fig . for all the statistical analyses , the software spss ( version 15.0 ) was used .", "the present study represents a subsample ( n = 612 [ growth chart subsample ] ) of the original good cohort ( n = 1,068 ) in which subjects with available detailed growth charts from 1 to 10 years of age were included . anthropometrics and measurements of fat ( dxa)/adipose tissue areas ( abdominal ct ) of the subjects participating in the present study are presented in table 1 . average bmi in this cohort declined during early childhood years , and adiposity rebound ( the lowest bmi ) was reached slightly before 6 years of age , after which it began to increase ( fig . 2 ) during both early ( age 14 years ) and late ( age 410 years ) childhood were , as expected , clear positive predictors of adult bmi . during adolescence , pubertal stage influences body composition ( 29 ) . because interindividual variations in pubertal onset will confound the calculations during adolescence , the predictive role of bmi for each individual year during adolescence for adult bmi and body composition is not shown . instead , the coefficient for the correlation of the entire adolescence ( age 1019 years ) is shown in fig . 2 , demonstrating that , as expected , bmi changes during adolescence also predicted adult bmi . childhood bmi and variance in body composition and fat variables ( bmi [ a ] and bmi change [ b ] ) during early and late childhood . association between childhood bmi between 1 and 10 years of age and young - adult body composition parameters is expressed as accumulated r ( % , c and d ) or coefficients ( sd in adult body composition parameter per sd in bmi at that age , e and f ) . variables of adult body composition and fat distribution have been age adjusted . at , adipose tissue ; ip , intraperitoneal ; sc , subcutaneous . correlation between change in standardized bmi during different developmental time periods and adult body composition and fat distribution parameters ( early childhood defined as 14 years , late childhood defined as 410 years , and adolescence defined as 10 years to young adult ) . bars indicate coefficient ( 95% cis ) expressed as sd in investigated adult body composition parameter per sd change in bmi during that growth period . variables of adult body composition and fat distribution have been age adjusted . * * * p < 0.01 , * p < 0.05 significant association between the developmental time period and the investigated body composition parameter . 95% cis are given for the coefficients , making it possible to evaluate the differences in relative contribution of the three time periods for each dependent parameter . at , adipose tissue ; ip , intraperitoneal ; ns , not significant ; sc , subcutaneous . bmi alterations during development reflect changes in fat mass , lean mass , or both . to study the role of childhood bmi and bmi changes for the prediction of different adult body compartments , the associations between bmi during development and age - adjusted adult body composition variables were analyzed . the variance ( r ) in adult total body lean mass explained by bmi as well as the corresponding coefficients for the correlations increased during early childhood , leveled off during late childhood , and increased again during adolescence ( figs . the variance in adult bmi and the variance in adult lean mass explained by childhood bmi and the corresponding coefficients for the correlations were similar until 4 years of age , when they separated distinctly ( fig . 1c and e ) . the coefficient for the correlation between change in bmi and adult lean mass was higher during adolescence than during late childhood ( fig . 2 ) . thus , bmi changes during early childhood and adolescence but not during late childhood were major determinants of young adult lean mass . the prediction of young - adult total body fat mass from bmi and bmi changes during different developmental periods followed a different pattern from that of lean mass . the variances in total body fat mass and percentage total body fat explained by childhood bmi and the corresponding coefficients for the correlation were low before 4 years of age , but after 4 years of age , the plotted cumulated variance ( r ) and the corresponding coefficients for the correlation for young- adult total body fat mass and percentage body fat tightly followed the curve displaying the variance of adult bmi explained ( fig . the predictive value of childhood bmi for young - adult percentage total body fat increased substantially during late childhood years , as demonstrated by the fact that the variance in percentage total body fat explained by bmi at 4 years of age was only 1.7% , whereas it was 20.8% at 10 years of age ( fig . to analyze fat distribution in detail , we performed abdominal ct scans ( on a subset of the present good sample [ ct subsample ] , n = 201 ) for measurements of abdominal subcutaneous and visceral adipose tissue areas . the abdominal ct measurements revealed that the contribution of bmi during development for the explanation of the variance in young - adult subcutaneous adipose tissue area and the corresponding coefficients for the correlations followed a pattern similar to that of total body fat mass and percentage total body fat , with a distinct increase after 4 years of age ( fig . 1d and f ) . for both young - adult percentage fat mass and subcutaneous adipose tissue area , the coefficients for the correlations were of similar magnitude during late childhood and adolescence but clearly higher than seen during early childhood ( fig . bmi changes during late childhood and adolescence , but not during early childhood , clearly predicted young - adult total fat mass and the amount of subcutaneous adipose tissue . the contribution of bmi during the different developmental periods for the explanation of the variance in amount of young - adult visceral adipose tissue ( intraperitoneal + retroperitoneal adipose tissue areas ) and the corresponding coefficients for the correlations followed a pattern different and clearly distinct from that of total body fat mass and subcutaneous adipose tissue area . bmi and bmi changes during early and late childhood contributed only marginally to the explanation of the variance in intraperitoneal adipose tissue area , and the corresponding coefficient for the correlation between change in bmi and amount of young - adult intraperitoneal adipose tissue was low ( figs . 1d and f and 2 ) . instead , adolescence was the developmental period when bmi changes started to contribute substantially to the explanation of the variance in amount of adult intraperitoneal adipose tissue , and the corresponding coefficients for the correlations between change in bmi and amount of young - adult intraperitoneal adipose tissue were then higher than seen during early and late childhood ( fig . the results for retroperitoneal adipose tissue were similar as seen for intraperitoneal adipose tissue ( data not shown ) . analyses using weight for age during childhood and adolescence showed , in a manner similar to that seen for bmi for age , clear age - dependent associations with adult fat parameters ( data not shown ) . in contrast , analyses of height for age did not show any obvious age - dependent association with fat parameters ( data not shown ) . changes in bmi during adolescence , but not during early or late childhood , predicted the amount of adult visceral adipose tissue . to further describe the association between developmental changes in bmi and adult fat mass / adipose tissue areas , subjects were divided into groups based on change in bmi z score ( > 1 sd , less than 1 sd , and average bmi z score change ) during the three different developmental time periods ( fig . subjects with more than 1 sd increase in bmi z score during late childhood and during adolescence had a clearly higher percentage total body fat mass ( late childhood , + 44% , p < 0.001 ; adolescence , + 60% , p < 0.001 , fig . 3a ) and larger subcutaneous adipose tissue area ( late childhood + 83% , p < 3b ) than subjects with average change in bmi . in contrast , subjects with more than 1 sd increase in bmi z score during late childhood had unaffected intraperitoneal adipose tissue area compared with subjects with average change in bmi ( fig . 3c ) . however , for adolescence , subjects with more than 1 sd increase in bmi z score had larger intraperitoneal adipose tissue area ( + 91% , p < 0.001 ) than subjects with unchanged bmi z score ( fig . a specific association between high young - adult subcutaneous , but not visceral ( intraperitoneal + retroperitoneal ) , adipose tissue area and increased bmi z score during late childhood is supported by the finding that young - adult visceral adipose tissue area adjusted for total adipose tissue area was clearly reduced in subjects with more than 1 sd increase in bmi z score during late childhood ( fig . 3d ) . in contrast , an increase in bmi z score of more than 1 sd during adolescence was associated with an increased visceral adipose tissue area adjusted for total adipose tissue area ( fig . 3d ) . subjects who decreased their bmi with more than 1 sd did not differ from those with no change in bmi z score for any of the investigated fat parameters ( fig . thus , the amount of visceral adipose tissue was predicted by large increases in standardized bmi specifically during adolescence , whereas a high amount of subcutaneous adipose tissue area was predicted by increases in bmi during both late childhood and adolescence . the impact of developmental bmi changes for percentage total body fat ( a ) , subcutaneous adipose tissue area ( b ) , intraperitoneal adipose tissue area ( c ) , and visceral ( intraperitoneal + retroperitoneal ) adipose tissue adjusted for total abdominal ( visceral + subcutaneous ) adipose tissue area ( d ) . subjects with more than 1 sd increase were compared with subjects with average change or less than 1 sd decrease in standardized bmi during early childhood ( 14 years of age ) , late childhood ( 410 years of age ) , and adolescence ( 1019 years of age ) . variables of adult body composition and fat distribution have been age adjusted and are expressed as means sem and were analyzed using anova followed by tukey 's post hoc analysis . * * * p < 0.001 versus average , * * p < 0.01 versus average , # # # p < 0.001 versus less than 1 sd decrease , and # p < 0.05 versus less than 1 sd . a : early childhood less than 1 sd , n = 72 , average n = 471 ; more than 1 sd , n = 67 ; late childhood less than 1 sd , n = 75 , average n = 462 ; more than 1 sd , n = 73 ; adolescence less than 1 sd , n = 55 , average n = 500 ; more than 1 sd , n = 55 . d : early childhood less than 1 sd , n = 21 , average n = 160 ; more than 1 sd , n = 20 ; late childhood less than 1 sd , n = 22 , average n = 154 ; more than 1 sd , n = 25 ; adolescence less than 1 sd , n = 22 , average n = 164 ; more than 1 sd , n = 15 . we next investigated if bmi increases in subjects with low prepubertal bmi had a similar impact on the amount of adult visceral adipose tissue as seen in subjects with a high prepubertal bmi . subjects were divided into tertiles according to prepubertal ( 10 years of age ) bmi ( low 15.2 0.8 kg / m , average 16.7 0.4 kg / m , and high 19.3 1.5 kg / m ) and tertiles of bmi z score change ( low 1.0 0.6 sd , average 0.1 0.2 sd , and high 0.7 0.6 sd ) during adolescence ( fig . subjects with greater increase in adolescence bmi had significantly larger visceral adipose tissue areas ( low prepubertal bmi + 56% , average prepubertal bmi + 53% , and high prepubertal bmi + 57% ; p < 0.05 for all ) than subjects with average adolescence bmi increase ( fig . bmi increases during adolescence predicted the amount of adult visceral adipose tissue independently of prepubertal bmi . bmi increases during adolescence are associated with high adult visceral fat mass in subjects with low , average , and high prepubertal bmi . intraperitoneal fat area ( y - axis ) in subjects divided into tertiles according to ( i ) prepubertal bmi ( x - axis ; low , average , and high ) and ( ii ) bmi - z score increase during adolescence ( z - axis ; low , average , and high ) . data are expressed as means and were analyzed using anova followed by tukey 's post hoc analysis . * p < 0.05 , * * p < 0.01 versus average bmi z score change during adolescence ( ) ; # # p < 0.01 versus low ( ) . n for lowest bmi during adolescence ( ) from low prepubertal bmi to high ( left to right ) 9 , 19 , and 39 ; for average bmi during adolescence ( ) low prepubertal bmi to high ( left to right ) 26 , 25 , and 16 ; and for high bmi during adolescence ( ) from low prepubertal bmi to high ( left to right ) 32 , 23 , and 12 .", "average bmi in this cohort declined during early childhood years , and adiposity rebound ( the lowest bmi ) was reached slightly before 6 years of age , after which it began to increase ( fig . 2 ) during both early ( age 14 years ) and late ( age 410 years ) childhood were , as expected , clear positive predictors of adult bmi . during adolescence , because interindividual variations in pubertal onset will confound the calculations during adolescence , the predictive role of bmi for each individual year during adolescence for adult bmi and body composition is not shown . instead , the coefficient for the correlation of the entire adolescence ( age 1019 years ) is shown in fig . 2 , demonstrating that , as expected , bmi changes during adolescence also predicted adult bmi . childhood bmi and variance in body composition and fat variables ( bmi [ a ] and bmi change [ b ] ) during early and late childhood . association between childhood bmi between 1 and 10 years of age and young - adult body composition parameters is expressed as accumulated r ( % , c and d ) or coefficients ( sd in adult body composition parameter per sd in bmi at that age , e and f ) . variables of adult body composition and fat distribution have been age adjusted . at , adipose tissue ; ip , intraperitoneal ; sc , subcutaneous . correlation between change in standardized bmi during different developmental time periods and adult body composition and fat distribution parameters ( early childhood defined as 14 years , late childhood defined as 410 years , and adolescence defined as 10 years to young adult ) . bars indicate coefficient ( 95% cis ) expressed as sd in investigated adult body composition parameter per sd change in bmi during that growth period . variables of adult body composition and fat distribution have been age adjusted . * * * p < 0.01 , * p < 0.05 significant association between the developmental time period and the investigated body composition parameter . 95% cis are given for the coefficients , making it possible to evaluate the differences in relative contribution of the three time periods for each dependent parameter . at , adipose tissue ; ip , intraperitoneal ; ns , not significant ; sc , subcutaneous .", "bmi alterations during development reflect changes in fat mass , lean mass , or both . to study the role of childhood bmi and bmi changes for the prediction of different adult body compartments , the associations between bmi during development and age - adjusted adult body composition variables were analyzed . the variance ( r ) in adult total body lean mass explained by bmi as well as the corresponding coefficients for the correlations increased during early childhood , leveled off during late childhood , and increased again during adolescence ( figs . the variance in adult bmi and the variance in adult lean mass explained by childhood bmi and the corresponding coefficients for the correlations were similar until 4 years of age , when they separated distinctly ( fig . the coefficient for the correlation between change in bmi and adult lean mass was higher during adolescence than during late childhood ( fig . , bmi changes during early childhood and adolescence but not during late childhood were major determinants of young adult lean mass .", "the prediction of young - adult total body fat mass from bmi and bmi changes during different developmental periods followed a different pattern from that of lean mass . the variances in total body fat mass and percentage total body fat explained by childhood bmi and the corresponding coefficients for the correlation were low before 4 years of age , but after 4 years of age , the plotted cumulated variance ( r ) and the corresponding coefficients for the correlation for young- adult total body fat mass and percentage body fat tightly followed the curve displaying the variance of adult bmi explained ( fig . the predictive value of childhood bmi for young - adult percentage total body fat increased substantially during late childhood years , as demonstrated by the fact that the variance in percentage total body fat explained by bmi at 4 years of age was only 1.7% , whereas it was 20.8% at 10 years of age ( fig . to analyze fat distribution in detail , we performed abdominal ct scans ( on a subset of the present good sample [ ct subsample ] , n = 201 ) for measurements of abdominal subcutaneous and visceral adipose tissue areas . the abdominal ct measurements revealed that the contribution of bmi during development for the explanation of the variance in young - adult subcutaneous adipose tissue area and the corresponding coefficients for the correlations followed a pattern similar to that of total body fat mass and percentage total body fat , with a distinct increase after 4 years of age ( fig . 1d and f ) . for both young - adult percentage fat mass and subcutaneous adipose tissue area , the coefficients for the correlations were of similar magnitude during late childhood and adolescence but clearly higher than seen during early childhood ( fig . bmi changes during late childhood and adolescence , but not during early childhood , clearly predicted young - adult total fat mass and the amount of subcutaneous adipose tissue .", "the contribution of bmi during the different developmental periods for the explanation of the variance in amount of young - adult visceral adipose tissue ( intraperitoneal + retroperitoneal adipose tissue areas ) and the corresponding coefficients for the correlations followed a pattern different and clearly distinct from that of total body fat mass and subcutaneous adipose tissue area . bmi and bmi changes during early and late childhood contributed only marginally to the explanation of the variance in intraperitoneal adipose tissue area , and the corresponding coefficient for the correlation between change in bmi and amount of young - adult intraperitoneal adipose tissue was low ( figs . , adolescence was the developmental period when bmi changes started to contribute substantially to the explanation of the variance in amount of adult intraperitoneal adipose tissue , and the corresponding coefficients for the correlations between change in bmi and amount of young - adult intraperitoneal adipose tissue were then higher than seen during early and late childhood ( fig . the results for retroperitoneal adipose tissue were similar as seen for intraperitoneal adipose tissue ( data not shown ) . analyses using weight for age during childhood and adolescence showed , in a manner similar to that seen for bmi for age , clear age - dependent associations with adult fat parameters ( data not shown ) . in contrast , analyses of height for age did not show any obvious age - dependent association with fat parameters ( data not shown ) . changes in bmi during adolescence , but not during early or late childhood , predicted the amount of adult visceral adipose tissue .", "to further describe the association between developmental changes in bmi and adult fat mass / adipose tissue areas , subjects were divided into groups based on change in bmi z score ( > 1 sd , less than 1 sd , and average bmi z score change ) during the three different developmental time periods ( fig . subjects with more than 1 sd increase in bmi z score during late childhood and during adolescence had a clearly higher percentage total body fat mass ( late childhood , + 44% , p < 0.001 ; adolescence , + 60% , p < 0.001 , fig . 3a ) and larger subcutaneous adipose tissue area ( late childhood + 83% , p < 0.001 ; adolescence , + 138% , p < 0.001 , fig . 3b ) than subjects with average change in bmi . in contrast , subjects with more than 1 sd increase in bmi z score during late childhood had unaffected intraperitoneal adipose tissue area compared with subjects with average change in bmi ( fig . 3c ) . however , for adolescence , subjects with more than 1 sd increase in bmi z score had larger intraperitoneal adipose tissue area ( + 91% , p < 0.001 ) than subjects with unchanged bmi z score ( fig . a specific association between high young - adult subcutaneous , but not visceral ( intraperitoneal + retroperitoneal ) , adipose tissue area and increased bmi z score during late childhood is supported by the finding that young - adult visceral adipose tissue area adjusted for total adipose tissue area was clearly reduced in subjects with more than 1 sd increase in bmi z score during late childhood ( fig . 3d ) . in contrast , an increase in bmi z score of more than 1 sd during adolescence was associated with an increased visceral adipose tissue area adjusted for total adipose tissue area ( fig . 3d ) . subjects who decreased their bmi with more than 1 sd did not differ from those with no change in bmi z score for any of the investigated fat parameters ( fig . thus , the amount of visceral adipose tissue was predicted by large increases in standardized bmi specifically during adolescence , whereas a high amount of subcutaneous adipose tissue area was predicted by increases in bmi during both late childhood and adolescence . the impact of developmental bmi changes for percentage total body fat ( a ) , subcutaneous adipose tissue area ( b ) , intraperitoneal adipose tissue area ( c ) , and visceral ( intraperitoneal + retroperitoneal ) adipose tissue adjusted for total abdominal ( visceral + subcutaneous ) adipose tissue area ( d ) . subjects with more than 1 sd increase were compared with subjects with average change or less than 1 sd decrease in standardized bmi during early childhood ( 14 years of age ) , late childhood ( 410 years of age ) , and adolescence ( 1019 years of age ) . variables of adult body composition and fat distribution have been age adjusted and are expressed as means sem and were analyzed using anova followed by tukey 's post hoc analysis . * * * p < 0.001 versus average , * * p < 0.01 versus average , # # # p < 0.001 versus less than 1 sd decrease , and # p < 0.05 versus less than 1 sd . a : early childhood less than 1 sd , n = 72 , average n = 471 ; more than 1 sd , n = 67 ; late childhood less than 1 sd , n = 75 , average n = 462 ; more than 1 sd , n = 73 ; adolescence less than 1 sd , n = 55 , average n = 500 ; more than 1 sd , n = 55 . d : early childhood less than 1 sd , n = 21 , average n = 160 ; more than 1 sd , n = 20 ; late childhood less than 1 sd , n = 22 , average n = 154 ; more than 1 sd , n = 25 ; adolescence less than 1 sd , n = 22 , average n = 164 ; more than 1 sd , n = 15 .", "we next investigated if bmi increases in subjects with low prepubertal bmi had a similar impact on the amount of adult visceral adipose tissue as seen in subjects with a high prepubertal bmi . subjects were divided into tertiles according to prepubertal ( 10 years of age ) bmi ( low 15.2 0.8 kg / m , average 16.7 0.4 kg / m , and high 19.3 1.5 kg / m ) and tertiles of bmi z score change ( low 1.0 0.6 sd , average 0.1 0.2 sd , and high 0.7 0.6 sd ) during adolescence ( fig . 4 ) . for all three prepubertal bmi groups , subjects with greater increase in adolescence bmi had significantly larger visceral adipose tissue areas ( low prepubertal bmi + 56% , average prepubertal bmi + 53% , and high prepubertal bmi + 57% ; p < 0.05 for all ) than subjects with average adolescence bmi increase ( fig . bmi increases during adolescence predicted the amount of adult visceral adipose tissue independently of prepubertal bmi . bmi increases during adolescence are associated with high adult visceral fat mass in subjects with low , average , and high prepubertal bmi . intraperitoneal fat area ( y - axis ) in subjects divided into tertiles according to ( i ) prepubertal bmi ( x - axis ; low , average , and high ) and ( ii ) bmi - z score increase during adolescence ( z - axis ; low , average , and high ) . data are expressed as means and were analyzed using anova followed by tukey 's post hoc analysis . * p < 0.05 , * * p < 0.01 versus average bmi z score change during adolescence ( ) ; # # p < 0.01 versus low ( ) . n for lowest bmi during adolescence ( ) from low prepubertal bmi to high ( left to right ) 9 , 19 , and 39 ; for average bmi during adolescence ( ) low prepubertal bmi to high ( left to right ) 26 , 25 , and 16 ; and for high bmi during adolescence ( ) from low prepubertal bmi to high ( left to right ) 32 , 23 , and 12 .", "both bmi and obesity track strongly from childhood to adulthood ( 79,30,31 ) , but the role for bmi changes during development as predictors of adult body composition and fat distribution is unclear . the main objective of the present study was to investigate the association between bmi changes during different developmental periods and young - adult fat distribution in a well - characterized cohort of young - adult men . we demonstrate that the amount of adult subcutaneous adipose tissue and visceral adipose tissue was associated with bmi changes during distinct developmental periods . we also identified the childhood age after which bmi increases had a clear impact on adult total body fat mass . our main finding was that the amount of adult visceral adipose tissue was associated with bmi changes specifically during adolescence , whereas the amount of subcutaneous adipose tissue was associated with bmi changes during both late childhood and adolescence . subjects with more than 1 sd increase in bmi z score during adolescence had > 90% greater visceral adipose tissue areas than subjects with average change in bmi z score . these data , hence , demonstrate that bmi increases during adolescence were associated with a larger amount of visceral adipose tissue at young adult age . a large amount of visceral fat is a well - known risk factor for cardiovascular disease . a recent study demonstrated that although the amount of subcutaneous adipose tissue is associated with the metabolic syndrome , the amount of visceral adipose tissue remains more strongly related and is therefore regarded as an independent risk factor ( 5 ) . increased understanding of how and when subcutaneous and visceral fat compartments are predicted might , therefore , add important knowledge for the prevention of cardiovascular disease . in the present study , bmi increases during adolescence in subjects with a low prepubertal bmi had a similar impact on the amount of adult visceral adipose tissue as in subjects with a high prepubertal bmi . bmi increases during adolescence predicted the amount of adult visceral adipose tissue independently of prepubertal bmi . an increase by more than 1 sd in standardized bmi both during late childhood and during adolescence was , in the present study , associated with 50% more adult percentage total body fat . the new delhi birth cohort study also demonstrated that bmi changes during late childhood were associated with anthropometric measures of adult fat mass ( 13 ) . the new delhi study represents a large longitudinally followed cohort , but indicators of fat mass and lean mass were only derived from anthropometric measurements and , consequently , the visceral fat could not be determined in that study . the differences both in height and weight for age and in nutritional status between the indian children in the new delhi birth cohort and children in the western world ( 13,3234 ) might also limit the interpretations of the data from the new delhi birth cohort into the western world . a major strength of the present study is that both the subcutaneous and the visceral adipose tissue areas were measured using abdominal ct scans , giving us the opportunity to determine the predictive value of developmental bmi changes for these two fat depots separately . in a danish study , including men born between 1930 and 1956 , it was shown that subjects with both increases and decreases in bmi between 7 and 13 years of age had a higher risk of obesity in adulthood compared with those who maintained their bmi level ( 35 ) . in contrast , in the present cohort of boys born between 1983 and 1985 , increases but not decreases in bmi during growth were associated with increased adult fat mass and bmi . because the subjects in the danish study were born between 1930 and 1956 , it is possible that the decline in bmi during growth is related to environmental factors such as temporary undernourishment among certain subjects during this period ( including world war ii ) . although we in the present study have characterized the associations between childhood bmi and adult obesity , it is clear that a substantial part of adult obesity can not be explained by childhood obesity ( 6 ) . bmi changes during early childhood and adolescence were , in the present study , predicting adult lean mass , whereas bmi changes during late childhood and adolescence were predicting adult total body fat mass . these findings are in accordance with the findings in the new delhi birth cohort study , demonstrating that bmi during early childhood predicts anthropometric measures of adult lean mass more strongly than anthropometric measures of adult fat mass in indian children ( 13 ) . both the present study and the new delhi birth cohort study thus support the notion that bmi changes during early childhood are indicators of adult lean mass , whereas bmi changes during late childhood and adolescence are indicators of adult total body fat mass . our data demonstrate that 4 years of age was the threshold age for swedish boys after which bmi increases were clearly associated with increased adult total body fat mass . it should be emphasized that the present findings are based on association studies and , therefore , should be interpreted with caution . the present study demonstrates that the amount of young - adult subcutaneous adipose tissue was associated with bmi changes both during late childhood and adolescence , although young - adult visceral adipose tissue areas were associated with bmi changes specifically during adolescence . these findings suggest that avoiding substantial bmi increases during adolescence might , independent of prepubertal bmi , result in lower adult visceral fat mass ." ]

[ "it is estimated that around 50% of the population has one or more sites with 1 mm or more of such root exposure . this prevalence rate increases to > 88% in individuals who are 65 years or older . key factors in the treatment of gingival recession are to prevent the progressive marginal tissue recession and to facilitate plaque control in the affected area . various treatment modalities have been put forth for the correction of gingival recession . these include free gingival autograft , sub - epithelial connective tissue graft ( sctg ) , coronally advanced flap ( caf ) . it is seen that the incidence of adverse effects , such as discomfort with or without pain , was directly related to the donor sites of sctg . hence despite sctg being the gold standard for root coverage research is always aimed at finding a suitable alternative to this procedure to reduce patient morbidity . this procedure has been modified by many others with an intention to improve the stability and predictability of this technique . in a recent 14 year follow - up study pini prato et al . hence this procedure is now generally employed with adjuncts such as guided tissue regeneration membrane , emdogain , acellular dermal matrix and platelet rich plasma to enhance its long term stability . however , evidence regarding the beneficial impact of these procedures on the stability of root coverage is inconclusive . hyaluronic acid ( ha ) is a linear polysaccharide found in extracellular matrices of skin . hyaluronan has many structural and physiological functions within tissues , including extracellular and cellular interactions , growth factor interaction and the regulation of osmotic pressure and tissue lubrication , which helps in the maintenance of the structural and homeostatic integrity of tissues . one gram of ha can bind up to 6 l of water . as a physical background material , it has functions in space filling , lubrication , shock absorption , and protein exclusion . according to various clinical studies hyaluronan undergoes degradation in chronically inflamed gingival tissues , whereas the proteoglycan associated sulfated glycosaminoglycans , such as chondroitin 4-sulphate and dermatan sulfate , remain relatively intact . ha is a potent anti - inflammatory agent and modulates wound healing due to its ability to scavenge the inflammatory cells - derived reactive oxygen species . this study is aimed at testing the efficacy of hyaluronan gel as an adjunct to caf in root coverage .", "this was a randomized clinical trial with split mouth study design , carried out in the postgraduate clinic of department of periodontics , coorg institute of dental sciences , virajpet . the study sample included 10 subjects of which seven are male , and three female ( at least 20 sites ) having miller 's class i gingival recession on the canine and premolar region were recruited from department of periodontics , coorg institute of dental sciences . the sample size was calculated adjusting the minimum acceptable power of study at 80% and maximum allowable alpha error at 5% . the recession defects were designated as experimental and control sites randomly prior to surgery by spin of a coin . experimental group includes hyaluronan gel ( gengigel 0.2% gel which is 0.2% hyaluronan gel marketed by ricerfarma pharmaceuticals , milan , italy ) with caf and control group with caf alone . this self - funded study was approved by institutional ethical committee , and the procedure and the procedure was explained to all the subjects who provided signed informed consent before participation . medical and dental examination was obtained from all the individuals who were followed by complete periodontal examination . patients with malaligned teeth , teeth in trauma from occlusion , cervical abrasion and restorations were also excluded . subjects were included who are systemically healthy with two or more sites of miller 's class i recession and those who can understand and follow oral hygiene instructions properly . at baseline group allocation and sampling site selection were performed by one examiner moogala srinivas ( ms ) with a unc 15 probe and rounded off to the nearest 0.5 mm . the rd was assessed at baseline , 1 , 3 , 6 , 12 and 24 weeks , and the pd and cal were recorded at 12 and 24 weeks with the patients consent . the patients who were selected and gave their approval for the surgical intervention were educated and motivated with more emphasis on proper oral hygiene maintenance . all the patients underwent the initial phase of treatment of thorough scaling and root planning . the sites were randomly assigned to the control group or the test group using a flip coin technique immediately before surgery . the surgical area was prepared with adequate anesthesia using 2% lignocaine hcl containing 1:80,000 epinephrine . after local anesthesia and before the elevation of the flap , both the exposed root surfaces were gently planned with a sharp gracey no . this incision was horizontally extended to the adjacent papillae avoiding the gingival margin of the adjacent teeth . two oblique releasing incisions were carried out from the mesial , and distal extremities of the horizontal incision beyond the mucogingival junction [ figure 1a ] . a trapezoidal full - thickness flap was raised with a periosteal elevator , until the mucogingival junction . then a partial - thickness dissection was carried out apically leaving the underlying periosteum in place . in addition a mesiodistal and apical dissection parallel to the vestibular lining mucosa was performed with a blade to release residual muscle tension and to facilitate the passive coronal displacement of the flap . ( a ) horizontal and vertical incisions given in relation to 23 ; ( b ) hyaluronan gel applied on the root surface of experimental site ; ( c ) suturing done . ( d ) postoperative 1-week in the control site ; ( e ) postoperative 24 weeks in the experimental site ; ( f ) postoperative 24 weeks in the control site in the experimental group , hyaluronan gel ( gengigel 0.2% ) applied on the root surface using a sterile instrument prior to flap advancement and suturing [ figure 1b ] whereas in the control group the flap was advanced coronally without application of ha gel . suturing of oblique releasing incisions was performed , with 5 - 0 ethicon nonresorbable sutures , while the coronal mesial and distal extremities of the flap were secured by two single sutures placed in the interdental areas [ figure 1c ] . additional interrupted sutures were applied , when necessary , to close the oblique releasing incisions in the alveolar mucosa . immediately following surgery , use of ice packs was recommended for 3 h. all patients were instructed to discontinue tooth brushing , avoid trauma around the surgical site . in the event of pain , the use of ibuprophen + paracetamol ( thrice daily ) was recommended . a 0.2% chlorhexidine digluconate solution rinse was prescribed 2 times ( 60 s ) daily for the first 10 days . the patients were instructed to clean the surgical sites with a cotton pellet soaked in a 0.2% chlorhexidine digluconate solution twice daily for 10 days . three weeks after surgery , the patients were instructed to resume mechanical tooth cleaning of the treated areas using a soft toothbrush with a careful roll technique . adverse effects such as inflammation , bleeding on probing , pain and abscess formation were assessed postsurgically by first examiner ( ms ) . the patients were recalled for collection of data at 1 , 3 , 6 , 12 and 24 weeks using prefabricated acrylic stent . both experimental group and control group sites were evaluated postoperatively at 1 , 3 , 6 , 12 , and 24 weeks after surgery [ figure 1e and f ] . stent made of acrylic was used to standardize the direction and position of the probe . on each visit , the area was checked for meticulous plaque control , but no subgingival instrumentation was performed until the 6 week . a total of 20 buccal gingival recession sites in 10 patients were considered for the study . the values obtained were tabulated and statistically analyzed using student 's t - test and repeated measure anova tests . all the statistical methods were carried out through the statistical package for the social sciences ( spss ) for windows ( version 16.0 ) . the descriptive procedure displays univariate summary statistics for several variables in a single table and calculates standardized values ( z scores ) . using the general linear model procedure , null hypotheses about the effects of both within and between the subject factors in addition , the effects of constant covariates and covariate interactions between - subjects factors can be included .", "the patients who were selected and gave their approval for the surgical intervention were educated and motivated with more emphasis on proper oral hygiene maintenance . all the patients underwent the initial phase of treatment of thorough scaling and root planning .", "all the surgical procedures were carried out by one operator . the sites were randomly assigned to the control group or the test group using a flip coin technique immediately before surgery . the surgical area was prepared with adequate anesthesia using 2% lignocaine hcl containing 1:80,000 epinephrine . after local anesthesia and before the elevation of the flap , both the exposed root surfaces were gently planned with a sharp gracey no . this incision was horizontally extended to the adjacent papillae avoiding the gingival margin of the adjacent teeth . two oblique releasing incisions were carried out from the mesial , and distal extremities of the horizontal incision beyond the mucogingival junction [ figure 1a ] . a trapezoidal full - thickness flap was raised with a periosteal elevator , until the mucogingival junction . then a partial - thickness dissection was carried out apically leaving the underlying periosteum in place . in addition a mesiodistal and apical dissection parallel to the vestibular lining mucosa was performed with a blade to release residual muscle tension and to facilitate the passive coronal displacement of the flap . ( a ) horizontal and vertical incisions given in relation to 23 ; ( b ) hyaluronan gel applied on the root surface of experimental site ; ( c ) suturing done . ( d ) postoperative 1-week in the control site ; ( e ) postoperative 24 weeks in the experimental site ; ( f ) postoperative 24 weeks in the control site in the experimental group , hyaluronan gel ( gengigel 0.2% ) applied on the root surface using a sterile instrument prior to flap advancement and suturing [ figure 1b ] whereas in the control group the flap was advanced coronally without application of ha gel . suturing of oblique releasing incisions was performed , with 5 - 0 ethicon nonresorbable sutures , while the coronal mesial and distal extremities of the flap were secured by two single sutures placed in the interdental areas [ figure 1c ] . additional interrupted sutures were applied , when necessary , to close the oblique releasing incisions in the alveolar mucosa .", "immediately following surgery , use of ice packs was recommended for 3 h. all patients were instructed to discontinue tooth brushing , avoid trauma around the surgical site . in the event of pain , a 0.2% chlorhexidine digluconate solution rinse was prescribed 2 times ( 60 s ) daily for the first 10 days . the patients were instructed to clean the surgical sites with a cotton pellet soaked in a 0.2% chlorhexidine digluconate solution twice daily for 10 days . three weeks after surgery , the patients were instructed to resume mechanical tooth cleaning of the treated areas using a soft toothbrush with a careful roll technique . adverse effects such as inflammation , bleeding on probing , pain and abscess formation were assessed postsurgically by first examiner ( ms ) .", "the patients were recalled for collection of data at 1 , 3 , 6 , 12 and 24 weeks using prefabricated acrylic stent . both experimental group and control group sites were evaluated postoperatively at 1 , 3 , 6 , 12 , and 24 weeks after surgery [ figure 1e and f ] . stent made of acrylic was used to standardize the direction and position of the probe . on each visit , the area was checked for meticulous plaque control , but no subgingival instrumentation was performed until the 6 week .", "a total of 20 buccal gingival recession sites in 10 patients were considered for the study . the values obtained were tabulated and statistically analyzed using student 's t - test and repeated measure anova tests . all the statistical methods were carried out through the statistical package for the social sciences ( spss ) for windows ( version 16.0 ) . the descriptive procedure displays univariate summary statistics for several variables in a single table and calculates standardized values ( z scores ) . using the general linear model procedure , null hypotheses about the effects of both within and between the subject factors in addition , the effects of constant covariates and covariate interactions between - subjects factors can be included .", "mean probing pocket depth ( ppd ) in experimental sites at baseline was 1.8 0.42 mm , and in control sites it was 2.0 0.47 mm . at the end of 24 weeks , mean pd was 1.7 mm 0.82 in experimental sites and 2.0 mm 0.81 mm in control sites [ table 1 and figure 2 ] . the overall comparisons between the two groups were not statistically significant ( p = 0.917 ) [ table 2 ] . descriptive analysis of two groups mean probing pocket depth values plotted against time for experimental and control groups results of repeated measure anova for ppd for between experimental and control groups clinical attachment level had a significant gain and stability , at 24 weeks follow - up both groups . cal gain was significant for both groups , but no intergroup difference was reported at 12 months [ table 3 and figure 3 ] . comparison of mean clinical attachment level values between experimental and control groups student 's t - test showing the cal difference between control and experimental groups on an average , experimental site showed initial rd of approximately 3.2 mm 0.78 mm and control sites 2.9 mm 0.73 mm . after 24 weeks , mean rd was 1.1 mm 0.99 mm in experimental sites and 1.0 mm 0.66 mm in control sites [ table 4 and figure 4 ] . the percentage of root coverage for experimental and control group was 68.33% 28% and 61.67% 30.22% , respectively [ table 5 and figure 5 ] . descriptive analysis of two groups mean recession depth values plotted against time for experimental and control groups percentage of root coverage comparison of mean percentage of root coverage between control ( c ) and experimental ( e ) group at 24 weeks , the change in rd was statistically significant ( p = 0.00 ) in both groups [ tables 6 and 7 ] . results of repeated measure anova for rd for experimental group results of repeated measure anova for rd for control group", "there are many factors that determine success of root coverage procedures namely , gingival biotype , amount of keratinized tissue , location of the tooth in the arch , prominence of the root , rd and width . other than these local factors there are other factors like patient compliance , brushing technique , use of tobacco , etc . , that determine success and long term stability of root coverage procedures . it is a linear polysaccharide and one of the principle components of the extracellular matrix , which is biodegradable , biocompatible and nontoxic . ha is a macromolecule of several million daltons , consisting of repeating units of d - glucoronic acid ( 1--3 ) n - acetyl d- glucosamine ( 1-4 ) n. exogenous application of hyaluronan has shown to have anti edema , anti - inflammatory and good wound healing properties . it has been used extensively in the field of dentistry for its various beneficial applications . in periodontics it has been used to treat gingivitis and periodontitis and more recently in the treatment of periodontal intra bony defects . the present study was conceived in an effort to merge two simple and cost effective techniques to achieve better root coverage . a split mouth study design was considered appropriate to minimize the bias that would arise due to variations in healing pattern among individuals . complete root coverage was achieved immediately following the surgical procedures in all cases except one in the experimental group . during the study , after 24 weeks , 100% root coverage was seen in six sites out of which only two were control sites . that is , at the end of 24 weeks , 40% of experimental sites demonstrated 100% root coverage [ figure 1e ] , whereas only 20% of the control sites showed complete root coverage [ figure 1f ] . this suggests that clinically the root coverage achieved with the use of hyaluronan gel is more predictable at the end of 24 weeks . percentage of root coverage in the experimental sites was 68.3% and control sites were 61.6% . this is in accordance with the systematic review by chambrone et al . which said that that the mean root coverage for caf alone was ranging from 55.9% to 86.7% . the biological properties of hyaluronan as reported by studies by ballini et al . suggests that it promotes regeneration . the clinical stability of the root coverage achieved after 24 weeks in this study supports this aspect of previous studies . it has been suggested from previous animal studies that there is an increase in hard tissue component of the periodontium following treatment with hyaluronan . it promotes wound healing by cell migration and proliferation , facilitating white blood cell infiltration and improving tissue hydration . this could contribute to better stability of the root coverage procedures that is seen with the use of hyaluronan . hyaluronan as previously mentioned has been extensively studied in the field of dentistry , but to the best of our knowledge , there is no published data on the usage of ha in the treatment of root coverage procedures . hence , it is premature at this point to make a comparison of the results of this study with previous studies . a longer follow - up is required to know the long - term stability of the treatment procedures . it is entirely based on clinical parameters , where in the exact nature of periodontal regeneration achieved could be made only by histological evaluation , studies with large sample size and higher statistical power are needed in the future to explore and establish use of hyaluronan as an adjunct in periodontal surgeries .", "this study shows that hyaluronan affects treatment outcome when used as an adjunct to caf procedure . although results are not statistically significant , clinically experimental group shows better results as compared to the control group . though caf gives 100% coverage immediately following the surgery only 61 - 64% can be expected 24 weeks after surgery . hyaluronan can be easily combined with caf procedure in compromised cases and situations where more stable results are desired ." ]

[ "ulcerative colitis ( uc ) is characterized by chronic and relapsing inflammation of the intestines , resulting in diarrhea , abdominal pain , and a variety of other symptoms ( 1 ) , and impacts negatively on the quality of life . huangqing - tang decoction , described by zhang zhongjing ( 150 to 219 a.d . , in chinese eastern han dynasty ) , has been used for the treatment of uc disease for thousands of years . radix scutellariae and radix paeoniae alba are the key ingredient herbs present in this decoction , the combination of radix scutellariae and radix paeoniae alba ( 3:2 g / g ) renders its features , such as the heat - clearing , antiinflammatory , antidiarrheic and antinociceptive effects . apparently , it is essential to study the synergistic interaction of radix scutellariae and radix paeoniae alba for elucidating the substantial foundation of huangqing - tang . \n radix scutellariae has been widely used in traditional chinese medicine ( tcm ) for the treatment of inflammation , fever , hepatitis , allergic diseases and hypertension , and is comprised of the flavonoids , baicalin ( bg ) , wogonoside ( wg ) , baicalein ( b ) and wogonin ( w ) as the active ingredients ( figure 1 ) ( 24 ) . to date , the pharmacokinetic ( pk ) profiles of bg and wg in plasma , brain and eyes of rats and rabbits have been reported ( 511 ) . it is generally assumed that baicalin is poorly absorbed from the gastrointestinal tract in its native form and must be hydrolyzed by microflora enzymes ( bacterial - glucuronidase ) in gut to its aglycone - baicalein , then reconverted back to baicalin . similar to baicalin , wogonoside is also firstly metabolized by microflora enzymes and reconverted , and is subsequently excreted mainly in conjugated form following administration of radix scutellariae extract in rat and human . baicalin and wogonoside demonstrated bimodal phenomenon in the plasma profile ( 12 , 13 ) . after oral administration of baicalein , levels of baicalein were negligible , whereas the glucuronides / sulfates conjugates of baicalein were predominant in the plasma ( 14 , 15 ) . various case reports on herb drug interactions or herb herb interactions in - vivo have been published in recent years , in addition to some reports on the influence of disease condition on the pharmacokinetic characteristics of drug ( 1619 ) . . a better understanding of the pharmacokinetics of herbal interactions and herbs in diseased rats would be helpful in formulating rational dosage regimens ( 20 ) . however , to the best of our knowledge , there are no published studies reporting the pharmacokinetics of bg , wg , b , and w after oral administration of pure baicalin , radix scutellariae and scutellariae - paeoniae couple extracts to normal rats , let alone to uc rats . the syndrome of the trinitro - benzene - sulfonic acid)tnbs(-induced colonitis model is similar to the spontaneous uc . this animal model has been used extensively in studies of colonitis and its complications , including the altered drug pharmacokinetics under the colonitis conditions ( 2126 ) . the aim of this study is to explore the pharmacokinetic differences of the four flavonoids after oral administration of pure baicalin , radix scutellariae extract and scutellariae - paeoniae couple extract to rats and to compare the pharmacokinetic parameters of uc rats with those of normal rats .", "\n materials and chemicals \n \n radix scutellariae , radix paeoniae alba were purchased from bozhou medicine company ( anhui , china ) and authenticated by prof . feng li from the college of pharmacy , university of traditional chinese medicine ( liaoning , china ) . the voucher specimens ( no.20081205 , 20081211 ) have been deposited in liaoning university of tcm . zhenqiu zhang ( dept . of chemistry in our institute , liaoning university of tcm ) . baicalin and wogonin were purchased from the national institute for the control of pharmaceutical and biological products ( beijing , china ) . the solvents used for chromatographic analysis were hplc grade and were purchased from fisher company inc . deionized water was prepared in a mill - q academic water purification system ( millipore , bedford , ma , usa ) . all the other reagents were of analytical grade and provided by kermel chemical co. ( tianjin , china ) . \n apparatus and chromatographic conditions \n the concentrations of the four flavonoids in plasma were assayed using reverse - phase high performance liquid chromatography ( agilent 1100 series ) equipped with a variable wave length uv detector and pump ( agilent model g1314a vwd ) . separation was accomplished on a eclipsel xdb - c18 column ( 250 mm 4.6 mm , 5 m particle size ) . the mobile phase was composed of acetonitrile ( a ) : 0.1% phosphoric acid water ( b ) ( 0 10 min , 16 : 84 ; 10 15 min , 22 : 78 ; 15 25 min , 25 : 75 ; 25 30 min , 34 : 64 ; 30 50 min , 42 : 58 , v / v ) at a flow rate of 1.0 ml / min with gradient elution . preparation of radix scutellariae and scutellariae - paeoniae couple extracts \n \n radix scutellariae and radix paeoniae alba were mixed in the ratio of 1.5 : 1 g / g and the total weight was 200 g. the mixture was decocted twice by refluxing with 70% ethanol ( 1 : 10 and then 1 : 8 w / v ) for 1 h , and the solution obtained was concentrated to give an extract of 60.5 g. radix scutellariae ( 200 g ) was treated as above to provide an extract of 43.3 g. the dried powder was stored at 4 c before use . for estimation of the administered dose , the concentrations of baicalin , wogonoside , baicalein and wogonin in the extracts and pure baicalin the extract powder ( 0.10 g ) was ultrasound with 100 ml 60% methanol for 30 min . the contents of bg , b , wg and w were determined to be 17.3 , 7.6 , 2.4 and 1.7 % in scutellariae - paeoniae couple extract and 43.6 , 19.1 , 6.2 and 4.5% in radix scutellariae extract , respectively . male sprague dawley rats , weighing 250 - 280 g , were obtained from the experimental animal department of dalian university ( dalian , china ) . animal welfare and experimental procedures were strictly in accordance with the guide for the care and use of laboratory animals ( us national research council , 1996 ) and the related ethics regulations of liaoning university of tcm . rats were housed in an air - conditioned animal quarter at a temperature of 22 2 c and a relative humidity of 50 2% . the animals were acclimatized to the facilities for five days , and then fasted with free access to water for 24 h prior to each experiment . colitis was induced in rats according to the model and method described by morris et al . briefly , rats were lightly anesthetized with 10% chloral hydrate solution , and then a medical - grade polyurethane cannula for enteral feeding ( external diameter 2 mm ) was inserted into the anus and the tip was advanced to 8 cm proximal to the anal verge . shanghai , china . ) dissolved in 100% ethanol was instilled into the colon through the cannula ( at a dose 80 mg / kg ) . following the instillation of the hapten , the rats were maintained in a head - down position for an additional 30 sec to prevent leakage of the intra colonic instillation . successful replication of the model of uc was characterized by reduction in activities , apathy and occult blood in stool . biosample collection \n the uc rats were divided into three subgroups randomly , the pure baicalin , radix scutellariae extract and scutellariae - paeoniae couple extract subgroup . each group was respectively administrated an oral dose of 200 mg / kg baicalin ( in the form of pure compound or co - administrated mixture , 0.21 g / kg pure baicalin , 0.46 g / kg radix scutellariae extract and 1.16 g / kg scutellariae - paeoniae couple extract ) , all of the compounds were suspended in water and homogenized using ultrasonic technology just prior to dosing . blood samples ( 0.5 ml ) were collected into a heparinized tube via the oculi chorioideae vein before drug administration and at 0.083 , 0.25 , 0.5 , 0.75 , 1.0 , 2.0 , 4.0 , 8.0 , 12.0 and 24.0 h after drug administration , and were centrifuged at 4000 rpm for 10 min for the separation of plasma from the red blood cells . the supernatant was decanted carefully and was stored at 40 c until analysis . \n biosample preparation \n an aliquot of 15 l arctigenin ( 32.0 m in methanol ) and 10 l hcl solution ( 0.1 mm ) were added into 100 l plasma , and then spiked with methanol 75 l and acetonitrile 100 l by vortex mixing for 5 min . an aliquot of 50 l of the supernatant was injected into the hplc system . known amounts of baicalin , baicalein wogonoside , wogonin and is were added into 100 l of blank plasma to prepare the following series of standards . the calibration curves showed good linearity in the range of 0.12331.6 m for baicalin , 0.28873.6 m for wogonoside , 0.1338.50 m for baicalein , 0.0627.9 m for wogonin . the extraction recoveries and matrix effects at three quality control ( qc ) concentrations were assayed in sets of six replicates . the cvs of the recoveries were less than 20% at low concentration , and less than 15% at medium and high concentrations . accuracy and precision of the method were investigated by intra - day and inter - day data via comparing the mean of five replicates of each qc sample . the stabilities of baicalin , wogonoside , baicalein and wogonin were determined by analyzing qc samples at three concentrations exposed to encounter during sample storage . the corresponding relative errors were less than 6% for samples at three concentrations for each reference standard , respectively . results of the stability test showed that under the experimental conditions the samples were stable throughout the testing process . the plasma concentration vs. time data of baicalin and wogonoside were analyzed by non - compartmental model using the nonlinear least squares regression program winnonlin ( scientific consulting inc . , shanghai , china ) were used to calculate the pharmacokinetic parameters , such as the area under curve ( auc ) , the maximum plasma concentration ( cmax ) and the corresponding time ( tmax ) , the half - life of absorption ( t1/2 ) , etc . statistical analysis of pharmacokinetic parameter estimates was performed using a two - tailed nonparametric t - test . chemical structures of arctigenin ( a ) , baicalin ( b ) , baicalein ( c ) , wogonoside ( d ) and wogonin ( e ) .", "the selectivity of the method was evaluated by analyzing blank plasma samples prior to administration . the chromatograms were free of interfering peaks at the retention times of is ( 34.5 min ) and baicalin ( 20.6 min ) , wogonoside ( 25.9 min ) , baicalein ( 31.9 min ) and wogonin ( 40.8 min ) . figure 2 showed the representative chromatograms of blank plasma sample ( a ) , blank plasma sample spiked with baicalin , wogonoside , baicalein , wogonin and is ( b ) , blank plasma sample spiked with is ( c ) , plasma sample ( 1.5 h ) after oral administration of scutellariae - paeoniae couple extract ( d ) . under the established chromatographic condition , no interfering peaks were observed at the elution times of baicalin , wogonoside , baicalein , wogonin and the internal standard . chromatograms of blank plasma sample ( a ) , plasma sample spiked with baicalin , wogonoside , baicalein , wogonin and is ( b ) , plasma sample spiked with is ( c ) , plasma samples 1.5 h after oral administration of scutellariae - paeoniae couple extracts ( d ) . \n pharmacokinetics of baicalin and wogonoside after oral administration of pure baicalin , radix scutellariae and scutellariae - paeoniae couple extracts to rats . \n the mean plasma concentration - time profiles and standard deviation in normal rats and uc rats following the administration of pure baicalin , radix scutellariae or scutellariae - paeoniae couple extracts are depicted in figure 3 ( a ) and 3 ( b ) . pharmacokinetic parameters resulting from non - compartmental analysis are listed in tables 1 and 2 . the plasma concentration time profile of baicalin ( bg ) and wogonoside ( wg ) after oral administration of pure baicalin ( 0.21 g / kg ) , radix scutellariae extract ( 0.46 g / kg ) and scutellariae - paeoniae couple extract ( 1.16 g / kg ) to normal ( a ) and ulcerative colitis ( uc ) ( b ) rats pharmacokinetic differences of baicalin after oral administration of pure baicalin ( 0.21 g / kg ) , radix scutellariae extract ( 0.46 g / kg ) and scutellariae - paeoniae couple extract ( 1.16 g / kg of baicalin ) to normal and uc rats mean sd , n=10;*p < 0.05 vs. normal - rats pharmacokinetic differences of wogonoside after oral administration of pure baicalin ( 0.21 g / kg ) , radix scutellariae extract ( 0.46 g / kg ) and scutellariae - paeoniae couple ( 1.16 g / kg ) to normal and uc rats mean s.d . , n=10 ; * p<0.05 vs. normal - rats following oral administration of pure baicalin ( purity > 95.5% ) to rats , wogonoside was detected in all rats plasma in addition to baicalin , the plasma concentration was almost equal to that of baicalin . the same result was observed after oral administration of radix scutellariae extract ( 200 mg / kg of baicalin , 28 mg / kg wogonoside ) or scutellariae - paeoniae couple extract ( 200 mg / kg of baicalin , 27 mg / kg of wogonoside ) to rats . the present result suggested that baicalin might convert to wogonoside in the rat body . zhenyu zhu et al . ( 4 ) reported that they found a peak ( named m ) with a retention time of about 5 min at m / z 461 was similar to wogonoside ( m / z 461 ) after oral administration of xiaochaihu tang and radix scutellariae extract to rats , which was possibly a methylated product of baicalin . methylation generally existed during the drug metabolism in - vivo , and due to the multiple hydroxyl groups on the baicalin benzene ring , the combination of a methyl group with a hydroxyl group was easy . so , we tentatively concluded that absorbed baicalin could be methylated to wogonoside in - vivo . following oral administration of radix scutellariae or scutellariae - paeoniae couple extracts to rats , baicalein and wogonin with very high concentrations were presented in rat tissues ( 28 ) , however , in the present study , it was below the detection limit in all plasma samples collected for all rats . these results appeared to be consistent with previous reports ( 14 , 15 , 29 , 30 ) . as described in previous studies , baicalin firstly must be hydrolyzed to baicalein by -glucuronidase in - vivo , which was produced by both intestinal bacteria and intestinal epithelial cells ( 3134 ) . thus , baicalin can first enter the intestinal wall as baicalein and is then reconverted to baicalin within the intestinal mucosa and thereby is absorbed into the blood . therefore , baicalin in plasma may be derived from both baicalin and baicalein in radix scutellariae or scutellariae - paeoniae . the doses of baicalin and baicalein in the extracts were summed to produce the sum dose of baicalin and baicalin which was used to calculate dose - normalized cmax and auc0-t . based on the similar chemical structure between wogonoside and baicalin , it is proposed that the transformation between wogonoside and wogonin are similar to that between baicalin and baicalein in the intestinal wall , the sum dose of wogonoside and wogonin was calculated in the same way . consequently , we could only detect baicalin and wogonoside , not baicalein and wogonin in plasma . as shown in figure 3 and table 1 - 2 , the absorption speed of baicalin and wogonoside in the normal pure baicalin group was quicker than those in the normal radix scutellariae and scutellariae - paeoniae couple groups , tmax for baicalin were : ( 0.087 0.02 ) h , ( 0.27 0.03 ) h and ( 0.28 0.03 ) h ; tmax for wogonoside were ( 0.11 0.02 ) h , ( 0.22 0.09 ) h , ( 0.21 0.08 ) h , respectively . but tmax of baicalin and wogonoside were little different among the three groups of uc rats . the pharmacokinetic profiles differences of baicalin and wogonoside were reflected in auc(0t ) and cmax . following oral adminstration scutellariae - paeoniae couple extract to rats , cmax and auc(0t ) of baicalin and wogonoside were higher than the other two forms ( p 0.05 ) . compared to the radix scutellariae groups , cmax and auc(0t ) of baicalin and wogonoside in the pure baicalin groups were significantly lower ( p 0.05 ) . these chemical components might produce certain pharmacological effects and have impact on the pharmacokinetic profiles of baicalin and wogonoside . under the guidance of the theory of tcm , radix paeoniae alba , used as messenger herb and hematinic herb , could guide the bioactive ingredients of radix scutellariae to the proper tissues and exert a harmonizing effect , including the increase of absorption and bioavailability . radix paeoniae alba also could increase the absorption of baicalin and wogonoside through increasing the function of spleen and improving the patients digestive system vitality and immune system . thus , compared to pure baicalin and radix scutellariae extract , the cmax and auc(0t ) of baicalin and wogonoside increased remarkably ( p < 0.05 ) when radix scutellariae was mix - decocted with radix paeoniae alba , in contrast , the absorption of pure baicalin was the least . the present study demonstrated that herb extract could enhance the bioavailability of baicalin and wogonoside in rat plasma , a significant drug - drug interaction may occur and improve the absorption of baicalin and wogonoside when radix paeoniae alba is administered in combination with radix scutellariae ( 35 ) . either in uc or in normal rats , baicalin and wogonoside demonstrated bimodal phenomenon in rat plasma after oral administration of pure baicalin , radix scutellariae or scutellariae - paeoniae couple extracts ( figure 3 ) . the first absorption peaks occurred at about 0.15 - 0.27 h and the second was at about 8 12 h. the concentrations of the second peak ( cmax ) and the values of auc(0t ) dose were lower than which of the first peak . the ability of rapid absorption of baicalin and wogonoside may result in the rapid appearance of the first peak . baicalin and wogonoside had double - site absorption kinetics , and baicalin and wogonoside undergo enteric circulation and enterohepatic circulation in rats after oral dosing , which may be responsible for the second peak . but they were always detected and kept their concentration at a certain range in plasma . free drug might bind with plasma protein when it reaches a certain concentration ( 19 ) . wang et al . ( 36 ) reported that the binding rate of free baicalin with plasma protein could reach 80% . it was not able to maintain a high concentration for a long time because the baicalin would enter into the plasma and then bind with plasma protein . when the concentration of free baicalin decreased to a certain concentration , the bound baicalin would dissociate . \n comparative pharmacokinetics of baicalin and wogonoside after oral administration of pure baicalin , radix scutellariae and scutellariae - paeoniae couple extracts between uc and normal rats \n from figure 4 and table 1 - 2 , it was noteworthy that uc rats showed better absorption than normal rats , regardless of oral administration of pure baicalin , radix scutellariae or scutellariae - paeoniae couple extracts . the absorption speeds of baicalin and wogonoside were very rapid , tmax were approximately 0.13 h. tmax showed no statistically significant difference among the three groups of uc rats . cmax and auc(0t ) of baicalin and wogonoside in uc rats were greatly higher than those in normal rats ( p < 0.05 ) . after oral administration of pure baicalin , radix scutellariae or scutellariae - paeoniae couple extracts to rats , auc(0t ) of baicalin were : ( 41.46 0.62 ) , ( 59.12 6.42 ) and ( 104.87 0.86 ) ( g / ml)h in uc groups vs ( 17.77 0.66 ) , ( 28.04 4.06 ) and ( 49.01 4.61 ) ( g / ml)h in normal groups ; auc(0t ) of wogonoside were : ( 40.86 5.31 ) , ( 57.95 1.91 ) and ( 101.31 3.05 ) ( g / ml)h in the uc groups vs ( 14.67 1.93 ) , ( 22.89 3.17 ) and ( 40.35 4.96 ) g / ml / h in the normal groups , respectively . plasma concentration - time profiles of baicalin ( bg ) ( a ) and wogonoside ( wg ) ( b ) after oral administration of scutellariae - paeoniae couple extract ( 1.16 g / kg ) to ulcerative colitis ( uc ) and normal rats the significantly higher cmax and auc(0t ) of baicalin and wogonoside in uc rats indicated that ulcerative colitis had an influence on the pharmacokinetic characteristics of baicalin and wogonoside in pure baicalin , radix scutellariae or scutellariae - paeoniae couple extracts . several factors were likely to be involved in the alteration of the pharmacokinetic behavior of baicalin and wogonoside under the colitis condition , including -glucuronidase , udp - glucuronosyltransferase , mrp2 , intestinal or hepatic metabolic enzymes and bile flow rate , etc . trinitrobenzene sulfonic acid ( tnbs)-induced uc condition might alter the formation of glucuronide , glutathione , and sulfate conjugates which played an important role in the metabolism of compounds in rats ( 40 - 43 ) . these factors may result in a higher exposure of baicalin and wogonoside after oral doses . as known that intestinal flora plays an important role in the absorption and reabsorption of baicalin and wogonoside , we hypothesized that intestinal bacteria in uc rats would be very rich which lead to increased -glucuronidase activity . thus , profound intestinal -glucuronidase activity due to the ulcerative colitis condition may have enabled the rapid conversion of baicalin and wogonoside to baicalein and wogonin which have the propensity to be absorbed more completely leading to higher baicalin and wogonoside exposure after oral administration relative to normal rats . the findings of this study demonstrated that the pharmacokinetic behaviors of baicalin and wogonoside were remarkably altered in uc rats . scutellariae - paeoniae couple extract may exert more effectiveness than pure baicalin or radix scutellariae extract . it proves the rationality of using scutellariae - paeoniae couple for the treatment of ulcerative colonitis disease .", "in summary , the results of the present study highlighted that drug drug interactions , herb drug interactions and herb herb interactions always existed and affected the pharmacokinetic behavior of herbal ingredients . statistically significant differences ( p < 0.05 ) in pharmacokinetic parameters of baicalin and wogonoside including cmax and auc(0t ) were obtained among the rats orally administered pure baicalin , radix scutellariae or scutellariae - paeoniae couple extracts . the huge number of active ingredients in tcm made them suitable for multi - target actions . baicalin and wogonoside had a better absorption effect , which would improve the therapeutic efficacy . we need to take caution when extrapolating pk and exposure data from healthy animals to diseased animals in designing pharmacological studies ." ]

[ "weekly creatinine clearance ( wccr ) and kt / v are well - known parameters reflecting dialysis \n dose and adequacy , and are applied to adjustment of the dialysis menu in each patient who \n undergoes peritoneal dialysis ( pd ) . however , the limitations of these parameters in \n predicting survival and morbidity have been reported . moreover , the collection of urine and peritoneal effluent \n is cumbersome work not only for patients , but also for medical staff . estimated ccr ( eccr ) was proposed as an alternative marker for measured total ccr ( tccr ) , \n because it is less expensive and time - consuming . but it was also reported that eccr calculated by the \n cockcroft - gault formula substantially overestimated the effect of age on creatinine \n excretion in pd patients . estimated glomerular filtration rate ( egfr ) is an alternative marker for measured gfr \n ( mgfr ) , and it might be a possible indicator for prognosis in the general population without \n known cardiovascular disease , diabetes or kidney disease and in ckd patients included in the modification of diet in \n renal disease ( mdrd ) study . \n moreover , these prognostic features of egfr might be partially independent of mgfr . we reported that egfr was well correlated with tccr in pd patients by cross - sectional \n analysis . similar \n correlation of egfr with ccr was reported by khosla , et al . , although the analyzed patients were \n restricted to the population with a difference between two measurements of ccr of less than \n 25% . to clarify the actual utility of egfr in peritoneal dialysis practice , we retrospectively \n collected the data from 21 pd patients at ja toride medical center for the period of one \n year .", "patients who underwent pd at ja toride medical center for one year or longer were enrolled \n in the study after their informed consent was obtained . pd patients with a treatment period \n of less than a year , and patients who underwent combined pd and hemodialysis ( hd ) therapy \n were excluded . to measure renal ccr , urine was collected for 24 hours ( from the second voiding of the day \n before visiting the hospital to the first voiding on the day of visiting the hospital ) . pd \n effluent was also collected for 24 hours on the day before visiting the hospital to measure \n peritoneal ccr . the sum of the peritoneal and renal ccr was defined as the measured tccr . \n the serum , urine , and effluent cr were measured by the established enzyme method . the formula proposed by the japanese society of nephrology was applied for calculation of egfr as follows : egfr ( ml / min/1.73 m ) = 194 serum cr age \n ( 0.739 in females ) protein catabolic rate ( pcr ) was calculated by the formula proposed by teehan as follows : pcr ( g / day ) = 6.25 ( urinary urea excretion + peritoneal urea excretion + 1.39 + 0.15 + \n 0.031 body weight in kg ) . pcr was normalized ( divided ) by the measured body weight ( bw ) and described as npcr \n ( g / kg / day ) . according to the guidelines of the japanese ministry of health , labour , and welfare , \n informed consent of the patients the study protocol was approved by the ethics \n committee of ja toride medical center . the data are shown as means sd , unless otherwise specified . to observe the correlation of \n two sets of data , the pearson s correlation coefficients were calculated using excel 2007 \n ( microsoft , redmond , wa , u.s.a . ) .", "as table 1table 1characteristics of the studied patientsmen / women16 / 5age ( years)66.6 12.6 ( 4695)capd / apd13 / 8cause of ckddm7cgn7ns4others3treatment period of pd in months45.1 32.4 ( 14118)samples in the data analysis1145.4 1.5 ( 27 ) per patient shows , 21 patients met the inclusion criteria and were included in this study . \n the patients comprised 15 men and 6 women with an average age of 66.6 12.6 years ( 4695 \n years old ) , and their average pd period was 45.1 32.4 months ( 14118 months ) . their causes \n of ckd were diabetes mellitus ( dm ) in seven patients , chronic glomerulonephritis ( cgn ) in \n seven patients , nephrosclerosis ( ns ) in four patients , and others in three patients . \n continuous ambulatory pd ( capd ) was undertaken in 13 patients , and the other eight patients \n received automated pd ( apd ) . during the period of one year from november 2010 to october \n 2011 , 114 data sets of egfr and tccr from the 21 patients were suitable for data analysis . \n according to the analysis , egfr and tccr were correlated ( r. = 0.435 in figure 1figure 1egfr and tccr . the open circles in the plotted data were obtained from one patient \n who denied the habitual intake of creatine supplements , such as creatine \n monophosphate , but poorly complied with the diet therapy . ) . however , their correlation was less than that of a previous cross - sectional study \n ( r. = 0.836 ) . unexpectedly \n lower egfr levels were observed in one patient ( shown as open circles in figure 1 ) . repeated counseling of the patient revealed \n that his diet fluctuated . as figure 2figure 2tccr - egfr difference and npcr ( a ) and total cr excretion and npcr ( b ) in one \n patient who showed fluctuating diet intake . more detailed data from the patient , \n exhibited as open circles in figure 1 are \n shown . variations in the difference between egfr and tccr were correlated with both \n total cr excretion and npcr . shows , tccr - egfr difference and total cr excretion were actually correlated with \n npcr in this patient . similar correlations were observed for the difference between egfr and \n tccr with total cr excretion ( r. = 0.821 in figure \n 3figure 3tccr - egfr difference and total cr excretion . differences between egfr and tccr were \n well correlated with total cr excretion in total samples . ) and npcr ( r. = 0.636 in figure 4figure 4tccr - egfr and npcr . differences between egfr and tccr were correlated with npcr in \n total samples . ) in all the data . total cr excretion and npcr were also correlated with each other \n ( r. = 0.516 in figure 5figure 5total cr excretion and npcr . total cr excretion and npcr were also correlated with \n each other in total samples . ) . the open circles in the plotted data were obtained from one patient \n who denied the habitual intake of creatine supplements , such as creatine \n monophosphate , but poorly complied with the diet therapy . tccr - egfr difference and npcr ( a ) and total cr excretion and npcr ( b ) in one \n patient who showed fluctuating diet intake . more detailed data from the patient , \n exhibited as open circles in figure 1 are \n shown . variations in the difference between egfr and tccr were correlated with both \n total cr excretion and npcr . tccr - egfr difference and total cr excretion . differences between egfr and tccr were \n well correlated with total cr excretion in total samples . total cr excretion and npcr were also correlated with \n each other in total samples .", "this retrospective study with the data collected for a year from 21 pd patients showed that \n the correlation of egfr with tccr was less than that of a previous cross - sectional \n study . the difference \n between tccr and egfr was mostly dependent on total cr excretion , as reported in \n pre - dialysis patients , but \n this has never been reported in pd patients . moreover , total cr excretion fluctuated \n according to the npcr . consequently , protein intake estimated by npcr may affect the \n difference between tccr and egfr . because creatinine is homogeneously distributed in the body water , serum creatinine level \n is determined by the balance of several factors , such as oral intake , generation in the \n muscle , intrinsic degradation ( metabolic clearance ) and clearance by peritoneal dialysis and \n the kidney ( figure 6figure 6considerable factors determining serum cr levels . meats ( per 100 g ) generally contain \n 400460 mg of creatine and creatinine ( see discussion for details ) . ) . the amount of creatinine obtained by oral intake is mainly dependent on the amount \n of meat , which generally contains 400450 mg of creatinine and creatine per 100 g , or more \n precisely , 1 mg of creatinine and 23 mg of creatine per 1 g of meat protein . actually , total cr excretion was \n well correlated with npcr in this study ( figure \n 5 ) . meanwhile , the cr generation rate in the muscle is relatively stable , because it \n is thought to be related to the muscle mass and activity . mainly \n affects the variance in urinary creatinine excretion , especially in the case of preserved \n residual renal function , which has a wider ranging capacity for compensation . consequently , \n the serum cr concentration and its calculation product , egfr , are supposed to be more stable \n parameters than ccr by diminishing the preserved capacity in small solutes clearance of the \n kidney . the increased difference between tccr and egfr in the higher pcr population could be \n explained by a similar reason , because pcr was positively correlated with total cr \n excretion . hence , serum cr and its calculation product , egfr , may be superior to ccr because \n they are less dependent on diet , unlike ccr . ( per 100 g ) generally contain \n 400460 mg of creatine and creatinine ( see discussion for details ) . recently , it has been reported that egfr had a prognostic value for ckd - related \n complications , kidney failure , cardiovascular risk \n factors and \n mortality . it is possible \n that egfr has a similar independency and distinct feature as a predictive indicator even in \n pd patients . hence , the obtained value can fluctuate \n as a result of several factors , such as patient condition , diet and drugs , which means that \n mgfr should not always be considered a representative value or gold standard of renal \n function , or rather the \n preserved capacity of the kidney to maintain the serum level of creatinine within a certain \n range under conditions of fluctuating intake may be a more reasonable index for actual \n kidney function . although the peritoneal clearance of small solutes represented by \n creatinine should be taken into consideration in pd patients , egfr derived from serum creatinine , age and \n gender may diminish the compensatory fluctuation of small solute clearance in the kidney , \n and provide a more stable level in each pd patient . this feature may be valuable in routine \n clinical practice , and it is worth investigating the significance of egfr as a possible \n prognostic factor in pd patients , as reported in pre - dialysis patients , \n . this study has some limitations . because the study design was a retrospective analysis at a \n single center , the patient characteristics were divergent with respect to pd modalities , \n exposure periods , residual renal function and adherence to diet therapy . in addition , the \n study population was small , and equal amounts of data were not collected for each patient . \n therefore , differences between individual patients and the entire study population could not \n be distinguished from the obtained data . however , fluctuating cr excretion was certainly \n observed not only in data from individual patient but in all collected data , as shown in \n figures 2 , 3 , 4 , 5 .", "this study revealed the practical profile of egfr , distinct from tccr , as a more stable \n marker for small solutes clearance by dialysis and the kidney . a more extended and \n longitudinal study will be needed to verify the actual value of egfr in pd practice ." ]

[ "mesenchymal stem cells ( mscs ) , also referred to as multipotent mesenchymal stromal cells , have been a focus of recent research , partially because they are an extraordinary model for investigating the biological mechanisms that allow a cellular population to generate diverse cell types and because they are a potential tool in cellular therapies for several clinical applications . mscs can differentiate into mesenchymal lineages and secrete cytokines and growth factors with paracrine effects that favor the regeneration of damaged tissues [ 1 , 2 ] . several studies have demonstrated that mscs possess an immunoregulatory function in vitro and in vivo and that this property suggests clinical applications in the regulation of immunocompetent cell responses [ 2 , 3 ] . this review addresses current knowledge of the biological aspects involved in msc immunoregulatory capacity and the clinical focus of these characteristics that allows these cells to be used in the treatment of several diseases with an immune component involved . this review culminates with a clinical description of the diseases treated with mscs as a component of cell therapy procedures .", "mscs are adult stem cells that are initially isolated from bone marrow ( bm ) and can generate stromal bm components , such as adipocytes , reticular cells , and osteoblasts , whereas in conjunction with additional cellular components , mscs maintain hematopoiesis . mscs proliferate in vitro as adherent , colony - forming cells with a high capacity for self - renewal and proliferation [ 4 , 5 ] . because there is no definite marker of mscs , the international society for cellular therapy has established minimum criteria that these in vitro cell populations must fulfill and certain characteristics to be considered mscs . the cells must be positive for cd105 , cd73 , and cd90 , express low levels of mhc - i , and be negative for mhc - ii , cd11b , cd14 , cd34 , cd45 , and cd31 . additionally , these cells must be capable of differentiation into osteoblasts , adipocytes , and chondroblasts in vitro [ 5 , 6 ] . mscs have been isolated from multiple tissues : skeletal muscle , adipose tissue ( at ) , synovial membranes , dental pulp , periodontal ligaments , cervical tissue , menstrual blood , wharton 's jelly ( wj ) , umbilical cord ( uc ) , umbilical cord blood ( ucb ) , amniotic fluid , placenta ( pl ) , and fetal tissues such as blood , liver , and bm [ 710 ] . in most cases , isolated mscs are heterogeneous in proliferation and differentiation , although all express the characteristic msc marker profile . mscs cultivated in vitro possess three biological properties that qualify them for use in cellular therapy : ( a ) broad potential of differentiation , ( b ) secretion of trophic factors that favor tissue remodeling , and ( c ) immunoregulatory properties . furthermore , mscs differentiate into different mesodermal lineages ( adipocytes , chondrocytes , osteocytes , fibroblasts , and myocytes ) . because of this potential for differentiation , mscs were initially used in the treatment of imperfect osteogenesis and myocardial damage . the benefits observed in these initial cell therapy protocols were thought to be the result of osteogenic and myogenic differentiation . the current understanding is that , in addition to diverse mesodermal differentiation capacity , msc benefits arise primarily from the secretion of trophic factors and immunoregulatory capacity [ 13 ] .", "mscs profoundly affect immune response through their interactions with the cellular components of the innate ( natural killer cells ( nk ) ) and adaptive ( dendritic cells ( dcs ) , b lymphocytes , and t lymphocytes ) immune system . msc immunoregulation can occur through cellular contact and/or the secretion of diverse factors [ 1317 ] . because of these properties , mscs can prevent the inappropriate activation of t lymphocytes and generate a tolerogenic environment during wound repair or stop an immune response during healing , thus contributing to the maintenance of immune homeostasis [ 2 , 3 ] . below , we describe the immunoregulatory effects of mscs on specific immune cells with special emphasis on the effect of mscs on t lymphocytes because of their role as effector cells in many diseases with an immune component . the phases in which t cells are vulnerable to msc immunoregulation , recognizing from a biological perspective that there are no obvious limits between phases , are described below . \n t lymphocytes express and secrete molecules characteristic of this phase , such as cd25 , cd69 , cd38 , cytotoxic t lymphocyte antigen-4 ( ctla-4 ) , and human leukocyte antigen - dr ( hla - dr ) and in addition the cytokines interferon- ( ifn ) , tumor necrosis factor ( tnf ) , and il-2 , among others . currently , there are contradictory results regarding the effect of mscs on t lymphocyte activation . some studies have observed that bm - mscs prevent the expression of the early activation markers cd25 and cd69 in t cells stimulated with phytohemagglutinin ( pha ) [ 19 , 20 ] , whereas other studies describe no effect by bm - mscs on the expression of these molecules [ 16 , 21 ] . such contradictory results may be because of differences in the population of t lymphocytes studied . with this understanding , the activation of peripheral blood mononuclear cells ( pbmc ) with pha in the presence of bm - mscs results in lower numbers of cd4 and cd8 that express cd25 , cd38 , and cd69 . employing the identical model , contradictory results report that the activation of pbmc with antibodies in the presence of bm - mscs does not modify the expression of cd25 or cd69 in cd4 and cd8 populations . similarly , no change was reported in the expression of cd25 , cd69 , or ctla-4 in studies of populations enriched with cd4 and cd8 lymphocytes activated by alloantigens . however , a recent study using populations enriched with cd3 t lymphocytes activated with anti - cd2/cd3/cd28 in the presence of bm - mscs showed an increase in the expression of cd69 in cd4 and cd8 t lymphocyte populations . the effects of mscs on the secretion of cytokines by activated t lymphocytes are also described by contradictory results . some studies have demonstrated that the presence of mscs diminishes [ 14 , 21 ] or increases [ 23 , 24 ] significantly the secretion of ifn by activated t lymphocytes . nonetheless , it has been described that the effects of mscs on ifn secretion depend on the source of the lymphocyte population studied . in this study , the authors demonstrated that the activation of cd3 t lymphocytes with anti - cd3/cd28 in the presence of mscs from adipose tissue resulted in an increase in ifn , which was an effect that was not observed when pbmc were activated with the identical stimulus . our laboratory recently demonstrated that the activation of cd3 t cells with antibodies in the presence of bm - mscs , ucb - mscs , and pl - mscs also resulted in an increase in ifn in cocultures . this observed effect might be related to the generation of ifn-producing t regulatory cells ( tregs ) . \n the effect of mscs on the proliferation of t lymphocytes is independent of the activation method . the first studies to analyze the effects of bm - mscs on the proliferation of t lymphocytes used irradiated mscs that were cocultivated with alloantigen - stimulated pbmc . these studies reported that mscs inhibited t - cell proliferation in a dose - dependent fashion [ 13 , 16 , 17 , 19 ] . however , in addition to inhibiting alloantigen - induced proliferation , mscs can inhibit proliferation induced by polyclonal activators such as pha [ 14 , 26 ] or anti - cd3/cd28 [ 21 , 23 , 24 ] . the immunosuppressive effects of mscs have been analyzed using total populations of pbmc and populations enriched in cd3 , cd4 , or cd8 lymphocytes . every case has demonstrated the capacity of mscs to diminish proliferation [ 13 , 16 , 17 , 19 , 21 , 23 , 24 ] . immunoregulation has been shown to be independent of the induction of apoptosis [ 16 , 27 ] and is performed through mechanisms dependent and independent of cellular contact . among the secreted factors identified are transforming growth factor beta 1 ( tgf1 ) , hepatocyte growth factor ( hgf ) , indoleamine-2,3-dioxygenase ( ido ) , prostaglandin e2 ( pge2 ) , il-10 , and hla - g5 [ 13 , 17 , 28 ] , whereas programmed death - ligand 1 ( pd - l1 ) and hla - g1 are involved in contact - dependent mechanisms ( figure 1 ) [ 2830 ] . whether direct contact between mscs and t lymphocytes is necessary for the inhibition of t - cell proliferation remains controversial . some authors have suggested that mscs act via an immunosuppressive mechanism independent of cell - to - cell contact [ 31 , 32 ] , whereas others have indicated that contact is required for efficient immunoregulation [ 24 , 2830 , 33 , 34 ] . however , the mechanism of msc immunoregulation appears to depend on cellular populations , mode of activation , and the presence or absence of cell - to - cell contact [ 23 , 32 ] . \n ( 3 ) differentiation and effector function . upon activation by the presence of pathogens or signs of damage , helper t cells cd4 ( th0 ) differentiate into one of the following subtypes , depending on the t - cell microenvironment : th1 , th2 , th17 , or tregs . each population is characterized by the secretion of a set of cytokines whose function is essential to eliminate pathogens within the organism , resolve inflammation , and maintain immune homeostasis . several studies have suggested that mscs modulate the differentiation , function , and balance of these subpopulations and foster the development of an anti - inflammatory immune response ( figure 1 ) [ 14 , 28 , 35 , 36 ] . the activation of nave t cells ( cd45ra ) in favorable conditions for the induction of th1 or th2 and in the presence of mscs results in the inhibition of ifn secretion by th1 cells and the increase of il-4 secretion by th2 cells . furthermore , mscs inhibit the production of proinflammatory cytokines il-17 , il-22 , ifn , and tnf and the differentiation of nave cd4 lymphocytes to th17 . additionally , mscs promote the secretion of il-10 and the expression of the foxp3 transcription factor , thus suggesting differentiation toward tregs ( figure 1 ) . similarly , in a murine model , the presence of mscs in the th1 and th17 differentiation processes favors differentiation to cd4cd25foxp3 tregs . this effect was not observed when mscs were added to cultures of mature th1 or th17 populations . these results indicate that mscs affect the differentiation and function of inflammatory t lymphocyte populations in their capacity to produce proinflammatory cytokines and also in the induction of a tregs phenotype . several studies have described the role of mscs in the induction of distinct tregs populations [ 14 , 28 , 3740 ] . in an initial study analyzing the participation of bm - mscs in the differentiation of tregs populations , maccario et al . observed that the presence of allogeneic and autologous mscs , with respect to the responder t lymphocyte population in mixed lymphocyte culture ( cml ) , induced a significant increase in the cd4cd25 t lymphocyte population . however , only allogeneic mscs favored an increase in cd4cd25ctla-4 populations . in the same year , a different study observed that pbmc activation by il-2 in the presence of mscs increased the proportion of cd4cd25 t lymphocytes . subsequently , prevosto et al . showed that pbmc in coculture with bm - mscs generated a population of cells that could inhibit t lymphocyte proliferation induced by alloantigens or polyclonal activators ( anti - cd3 or pha ) , and this effect required cell - to - cell contact . the authors observed that the increase in foxp3 mrna expression occurred only in the tregs populations derived from cd4 lymphocytes . mscs can induce and maintain the function and phenotype of tregs derived from cd3 , cd3cd45ro , or cd3cd45ra t lymphocyte populations . beginning with a cd3 population , the authors also demonstrated that the presence of bm - mscs maintained foxp3 expression in tregs . furthermore , mscs can induce regulatory t type 1- ( tr1- ) like cells characterized by ifn and il-10 secretion . through an in vivo transplant - induced arteriosclerosis model ( obstructed arteries ) , jui et al . demonstrated that the local administration of bm - mscs could prevent this pathology through a local increase in ifn and il-10 . in a subsequent in vitro study , the identical laboratory demonstrated that bm - mscs favored the generation of tr1 lymphocytes with an il-10ifncd4 phenotype mediated by pge2 and ido ( figure 1 ) . msc participation in t lymphocyte subpopulation equilibrium has also been observed in human in vivo studies . patients who have received mscs for the treatment of gvhd show subsequent increases of cd4cd25foxp3 and tr1 populations and decreases of th17 . similarly , the administration of mscs to patients with systemic lupus erythematous induced an increase in cd4cd25foxp3 tregs in the peripheral blood . increases in this tregs population have also been observed in kidney transplant patients , which were transplanted with autologous mscs . these cells are derived from bm - cd34 cells in vivo and from monocytes stimulated with il-4 and granulocyte macrophage colony - stimulating factor ( gm - csf ) in vitro . the primary function of dcs is to process and present antigens to virgin and memory t cells , although they also interact with other immune components such as b lymphocytes and nk cells . the individual dcs must mature to initiate an appropriate immune response , and during the maturation process , dcs increase the membrane expression of mhc - ii and t - cell costimulatory molecules cd80 and cd86 . mscs can significantly reduce monocyte differentiation into dcs , affecting the upregulation of cd1a , cd40 , cd80 , cd86 , and hla - dr ( figure 2 ) [ 15 , 37 , 4648 ] . this reduction is performed through the secretion of factors [ 15 , 46 ] and is a reversible process because these monocytes then differentiate normally at the removal of mscs . when immature dcs ( idcs ) derived from monocytes - msc cocultures were activated with lipopolysaccharide ( lps ) to induce their final differentiation , they expressed lower levels of the maturation marker cd83 and costimulatory molecules cd80 and cd86 . however , spaggiari et al . showed that mscs do not affect direct lps - induced maturation of dcs in cocultures , because there was no change in cd80 , cd83 , and cd86 expression . these results suggest that mscs exert a strong inhibitory effect on the differentiation process from monocytes to idcs but not on the lps - induced maturation of idcs to mature dcs ( mdcs ) . in addition , mdcs cocultured with mscs show a diminished expression of hla - dr , cd1a , cd80 , and cd86 , thus suggesting that mscs may push mdcs toward an immature state with a reduced stimulatory capacity ( figure 2 ) . additionally , mscs affect the secretion of several cytokines that are key to dcs maturation . aggarwal and pittenger observed that mscs inhibit the secretion of tnf by dcs activated by lps . the inhibition of tnf secretion by dcs inhibits their maturation , migration to the lymph nodes , and their capacity to stimulate alloreactive t lymphocytes , because of the alteration in the expression of several receptors that are necessary to capture and process antigens . mscs also inhibit the dcs secretion of il-12 [ 15 , 47 , 48 ] . the insufficient production of il-12 is associated with the induction of t cell anergy and tolerance [ 15 , 26 , 47 ] . human bm - mscs that act through notch can induce the differentiation of cd34 hematopoietic progenitors into a population of regulatory dcs with specific properties : ( 1 ) the expression of high levels of il-10 mrna and low expression of il-2 mrna ; ( 2 ) the capacity to inhibit alloreactive t - cell proliferation and function ; and ( 3 ) the capacity to induce tregs differentiation characterized by expression of foxp3 and tgf1 mrna ( figure 2 ) . nk cells are important in innate immunity and participate in the body 's defenses against infections and cancer . nk cells perform their effector function through the secretion of cytokines , such as ifn , tnf , and gm - csf , and possess cytotoxic activity both spontaneous and antibody - dependent . nk function is regulated by the equilibrium of signals transmitted by activator and inhibitor receptors that interact with specific hla molecules on target cells . thus , hla - class i negative or hla - class i - mismatched cells represent potential targets of nk cells [ 27 , 50 ] . mscs affect the phenotype , proliferation , cytotoxic potential , and cytokine secretion of nk cells ( figure 2 ) . when activated by il-2 , nk cells secrete ifn , but when activated in the presence of mscs , ifn secretion significantly decreases . furthermore , nk cells activated by il-2 and alloantigens in the presence of mscs show diminished proliferation and lytic activity [ 16 , 51 ] . il-15 is another cytokine that promotes the proliferation , survival , and effector function of nk cells , but through factor secretion , mscs can inhibit il-15 induced proliferation . however , mscs and nk cell contact are necessary to inhibit nk cytotoxicity in tumor cell lineages . few studies have analyzed the effects of mscs on b lymphocytes ; however , mscs diminish b - cell proliferation by cell cycle arrest in the g0/g1 phase and not by inducing apoptosis . a recent study demonstrated that effect of msc on b lymphocytes proliferation with cpg is not direct and requires presence of cd3 t cells . mscs can also affect b - cell differentiation because igm , igg , and iga production are diminished [ 5356 ] . furthermore , mscs modify the chemotactic properties of b lymphocytes , because expression changes in their chemokine receptors including cxcr4 , cxcr5 , and ccr7 were induced by mscs . the first molecules described in the msc - mediated immunoregulation of alloantigen - activated t lymphocytes were tgf1 and hgf . both cytokines can independently diminish alloantigen - activated t lymphocyte proliferation , although proliferation can be partially reestablished through blocking with antibodies [ 20 , 31 ] . tgf1 is involved in the msc - mediated generation of cd4cd25foxp3 tregs ( figure 1 ) and in the decreased proliferation of nk cells . these results suggest that tgf1 and hgf , in addition to other mechanisms , participate in the suppression of msc - mediated proliferation in mixed lymphocyte culture ( mlc ) . ido is an enzyme that catalyzes the conversion of the amino acid tryptophan to kynurenine . the inhibition of t lymphocyte proliferation is because of the exhaustion of tryptophan or the build - up of kynurenine . thus , the addition of exogenous tryptophan has been shown to reestablish alloantigen - activated t - cell proliferation in the presence of mscs . similarly , the addition of kynurenine to mlc inhibits proliferation without mscs , however such inhibition is lower when compared with that observed in cultures in the presence of mscs . the use of competitive inhibitors of ido reduces msc immunosuppressive effects on alloantigen - activated cd4 t lymphocytes . notably , the reestablished proliferation does not reach the levels observed in mlc without mscs , thus suggesting the presence and participation of additional mechanisms . the exhaustion of tryptophan by ido participates in the inhibition of th17 differentiation ; however , this mechanism and the build - up of kynurenine are involved in the ido generation of foxp3 tregs . furthermore , ido is involved in the decrease of proliferation and cytotoxic activity of nk cells activated by il-2 in the presence of mscs and also in the inhibition of maturation and functional activity of dcs ( figure 2 ) . pge2 is a lipid mediator derived from the conversion of arachidonic acid to prostaglandin through cox1 and cox2 enzyme action . these enzymes , with pge2 , are constitutively expressed by mscs , although their expression increases in an inflammatory environment [ 14 , 17 ] . pge2 has been shown to diminish proliferation , stimulate the secretion of il-4 and il-10 , and promote cd4cd25foxp3 and il-10ifncd4 tregs differentiation ( figure 1 ) [ 25 , 59 ] . several studies have shown that pge2 is a msc effector molecule ; synthesis can be blocked with indomethacin or ns-398 , and activated t - cell proliferation increases , but not similar to levels observed of t - cell proliferation in absence of mscs [ 14 , 17 , 32 , 60 ] . pge2 is involved in the decrease of differentiation of monocytes into dcs and the decrease of proliferation and cytotoxic activity of nk cells activated by il-2 in the presence of mscs ( figure 2 ) . it has been reported that il-10 is expressed by human and murine mscs and that tlr3 ligand increases the il-10 secretion by human mscs . however , other authors have showed that murine [ 16 , 63 ] and human mscs do not express il-10 . despite these conflicting results , some studies have reported a high concentration of il-10 in the supernatant from cocultures of fetal or adult mscs and immune cells and their participation in the immunosuppression by mscs in such cocultures have been well demonstrated . in that regard , some authors have showed that cell - to - cell contact between bm - mscs and t cells appears vital in the concentration increase of il-10 in the supernatant [ 24 , 38 , 64 ] . participation of il-10 in bm - msc - mediated immunoregulation and in tregs generation has been demonstrated through the use of antibodies [ 17 , 20 ] . il-10 downregulates th1 cytokine expression and can stimulate the expression and secretion of hla - g5 , which is another important molecule in mcs - mediated immunoregulation . a recent study reported an increase in immunosuppressive capacity of cd4cd25 tregs cocultured with bm - mscs , which is due to a high expression of pd-1 on tregs stimulated by il-10 present in the coculture supernatant ( figure 1 ) . furthermore , il-10 is also involved in the decrease of maturation and function of dcs , inhibiting the ability of dcs to produce il-12 ( figure 2 ) . hla - g molecules are nonclassic hla molecules characterized by a limited allelic polymorphism and a tissue - specific expression pattern . there are membrane - bound isoforms ( hla - g1 , g2 , g3 , and g4 ) and soluble isoforms ( hla - g5 , g6 , and g7 ) . bm - mscs express the membrane - bound isoform hla - g1 and the soluble isoform hla - g5 [ 28 , 30 ] ; expression of both molecules is promoted by il-10 . similarly , hla - g5 stimulates the secretion of il-10 in a positive feedback loop . the simultaneous use of antibodies against both molecules nearly reestablishes proliferation of alloantigen - activated pbmc in the presence of mscs [ 28 , 67 ] . direct contact between mscs and t cells is required to establish the positive feedback loop and subsequent generation of an immunosuppressive environment , which is further exacerbated by the generation of the cd4cd25foxp3 tregs induced by both molecules ( figure 1 ) . galectins participate in the regulation of cellular homeostasis in both adaptive and innate immunity as immunostimulators or immunosuppressors . the silencing of galectin-1 expression using sirna or antibodies reestablishes proliferation of pbmc activated by mitogens or alloantigen , thus indicating that galectin-1 participates in msc immunoregulation . similarly , mscs express galectin-3 , a molecule known to regulate t - cell proliferation , adhesion , and migration . the inhibition of galectin-3 expression in mscs with sirna reduces immunosuppressive capacity on alloantigen - activated t lymphocytes . the authors observed that mscs express higher levels of galectin-9 in an inflammatory environment , and through the use of antibodies , the authors described the participation of galectin-9 in the msc - mediated proliferation reduction of stimulated t and b lymphocytes [ 73 , 74 ] . the following membrane molecules participate in msc - mediated immunoregulation : the pd-1/pd - l1 pathway , hla - g1 , jagged-1 , and adhesion molecules , such as intercellular adhesion molecule 1 ( icma - i ) and vascular cell adhesion molecule 1 ( vcam - i ) ( figure 1 ) . pd - l1 ( b7-h1/cd274 ) and its receptor ( pd-1/cd279 ) are components of a t lymphocyte costimulatory pathway that releases inhibitory and regulatory signals upon activation . the pd-1/pd - l1 pathway is activated in the event of a persistent antigenic stimulus , as occurs with self - antigens , chronic viral infection , or tumors . the activation of this pathway prevents autoimmunity and directly contributes to the immunosuppressive microenvironment observed in tumors through t - lymphocyte regulation . in murine models and human msc from pl , uc , and bm [ 34 , 65 , 77 ] , it has been observed that ifn induce an increase of pd - l1 expression and has been demonstrated the participation of pd - l1 in msc - mediated immunosuppression of t cell proliferation through the use of monoclonal antibodies [ 29 , 75 , 76 ] . future studies will be necessary to determine the participation of pd - l1 expressed on mscs in the expression of foxp-3 in t cells . interestingly , an increase in the expression of pd - l1 receptor ( pd-1 ) has been observed in activated cd4cd25 tregs cocultured with bm - mscs , which is associated with a high immunosuppressive capacity . the same increase in pd-1 was observed in cd4cd25 t cells , but in contrast with tregs , it is associated with apoptosis [ 65 , 77 ] . demonstrated that the reduced proliferation in anti - cd3/cd28-activated t lymphocytes in the presence of mscs derived from bm or fetal liver was primarily driven by cell - to - cell contact and that mscs expressed higher levels of hla - g1 in coculture . furthermore , the use of antibodies specific to this molecule nearly reestablished t lymphocyte proliferation and reduced concentration of il-10 in cocultures , which shows the relevance of cell - to - cell contact . similar studies have reported the importance of cell - to - cell contact between mscs and t cells in such mechanisms [ 24 , 38 , 64 ] . it appears that cell - to - cell contact in cocultures promotes expansion of cd4 t cells which produce il-10 and increase the expression of cd210 ( il-10 receptor , subunit a ) on cd4 t cells but not on cd8 t cells and mscs . these results suggest that through cell - to - cell contact between mscs and t cells a population of t cells whose secreted products contribute to the immunoregulatory environment generated by mscs is formed ( figure 1 ) . the participation of the adhesion molecules icam - i and vcam - i has been demonstrated using antibodies against both adhesion molecules , which are expressed by mscs during t - cell immunoregulation . when icam - i and vcam - i were blocked in a mouse model , anti - cd3-activated splenocyte proliferation was partially reestablished . additionally , the expression of icam - i and vcam - i increased when mscs were exposed to ifn . these results suggest that mscs increase the capacity to recruit inflammatory t - lymphocyte populations and modulate its own function toward a regulatory phenotype as was demonstrated in the th17 population . furthermore , adhesion molecules could be involved in t - cells immunoregulation through induction of ctla-4 expression on t cells , which has been previously demonstrated [ 79 , 80 ] . our laboratory recently demonstrated that cell - to - cell contact between activated cd3 lymphocytes and mscs from bm or ucb increased the expression of ctla-4 ( figure 1 ) . through different mechanisms it has been demonstrated that interaction between ctla-4 with cd80/b7 - 1 and cd86/b7 - 2 expressed in dc induces ido upregulation by dc . it is likely that a similar mechanism is present in cd4ctla-4 t cells generated in cocultures with msc [ 24 , 37 , 38 ] . this idea is supported by several evidences ; activated t cells express cd80 and cd86 , in particular the presence of msc induces increased expression of cd86 on cd4 t cells , and it has been shown that the interaction of these molecules with ctla-4 induced ido expression in cd4 t cells . the cell - to - cell contact between mscs and cd3 t cells is important in the immunosuppresion of b cells by mscs . this evidence suggest that inhibition of b - cell proliferation observed in cocultures with msc is dependent of soluble factors produced during cell - to - cell contact between t cells and mscs . another molecule involved in the inhibition of t lymphocyte proliferation is jagged-1 , a notch ligand . because jagged-1 is expressed in mscs suggests that notch signaling is involved in msc immunosuppressive functions . showed that when jagged-1 was blocked by antibodies , the mscs inhibitory effects were decreased on a population of alloantigen - activated cd4 lymphocytes .", "many studies suggest that mscs and immune cells have established two - way regulatory mechanisms ; thus , the activation of msc immunoregulatory properties requires the presence of derived proinflammatory cytokines from immune cells . similarly , as a result of this activation , factors secreted by mscs also regulate immune response . broad evidence demonstrates that this activation requires the presence of proinflammatory cytokines derived from t lymphocytes , macrophages , and nk cells , thus indicating that there are bidirectional regulatory mechanisms between mscs and immune cells . cytokines , such as ifn , are necessary in this process , either alone or in combination with tnf , il-1 , il-1 , or il-17 [ 14 , 17 , 85 ] ( figure 2 ) . the importance of an inflammatory environment for msc immunosuppressive capacity has been shown both in vitro and in vivo . the initial experiments indicated that when exposed to ifn , mscs induce the expression of ido [ 13 , 17 ] and pd - l1 and increase the secretion of pge2 [ 14 , 60 ] . similarly , the conditioned medium of msc- and il-15-activated nk cell cocultures can inhibit nk - cell proliferation , which indicates that this coculture activates msc immunoregulatory properties . other studies have shown that nk cells can produce ifn when they interact with mscs ( autologous or allogeneic ) , and msc exposure to ifn increases the expression of hla - i in mscs , which reduces the secretion of cytokines and cytotoxic activity of nk cells ( figure 2 ) . this evidence suggests that bidirectional regulatory mechanisms drive the interaction between mscs and nk cells . mscs express nk receptor ligands , such as pvr , nectin-2 ( nam-1 ligands ) , and ulpbs and mica ( nkg2d ligands ) . because of these receptor - ligand profiles , it is likely that the interaction of nk cells and mscs ( autologous or allogeneic ) results in ifn production by nk cells , whereas this exposure of mscs to ifn increases hla-1 expression in mscs and other immunoregulatory molecules , thereby reducing the secretion of cytokines and nk cytotoxic activity . in addition to the abovementioned cytokines , a recent study reported that il-17 together with ifn and tnf increased inhibition of t - cell proliferation mediated by mscs , apparently through a synergic effect of the three cytokines , leading to a high expression of inducible nitric oxide synthase ( inos ) . recently suggested that mscs are not fully immunoprivileged because of their capacity to activate cells of the immune system ( nk cells , macrophages , etc . ) and may even be rejected by such immune cells . thus , resting mscs are immunogenic and able to promote the secretion of inflammatory cytokines , which in turn induce msc to express and secret distinct immunoregulatory molecules , allowing them to evade the immune response . in this regard , it has been demonstrated that nave mscs or primed previously with inf plus tnf are able to decrease t - cells proliferation . however , nave mscs induce the secretion of inf and il-2 by activated t cells at two days of coculture and this is a cellular event prior to inhibition of proliferation . the authors suggested that unprimed msc transiently induce proinflammatory cytokines secretion , which promote the increase of their immunoregulatory capacity . \n in vivo studies in mouse models suggest that mscs are effective in the treatment , but not prevention of gvhd . the highest survival rates were obtained when mscs were administered when serum ifn concentrations peaked . the injection of mscs preactivated with high concentrations of ifn was effective in gvhd prevention and resulted in 100% survival . however , the injection of mscs with low concentrations of ifn did not increase survival . the administration of mscs to patients with steroid refractory gvhd significantly improved patient outcomes [ 89 , 90 ] . however , when mscs were administered simultaneously with hematopoietic stem cells ( hsc ) , there was no change in grade ii / iv gvhd incidence and a high incidence of relapse . toll - like receptors ( tlrs ) are expressed by many immune cells , and their principal function is to detect pathogens . the activation of tlrs is essential to initiate an innate immune response and supports the adaptive immune response . ten tlr types have been identified in humans and each recognize specific molecular patterns associated with bacterial , viral , or fungal pathogens . the signaling pathway common to all tlrs is the activation of nf- , which controls the expression of several inflammatory cytokines and the expression of maturation markers . mscs express tlr-2 , 3 , 4 , 5 , 6 , 7 , and 9 , which are all functional ( except tlr-9 ) because its activation results in receptor internalization and the activation of the nf- , mapk , and akt pathways [ 62 , 84 , 94 ] . an in vitro population enriched with alloantigen - activated cd4 lymphocytes cultured in the presence of poly(i : c ) or lps - treated mscs , activated tlr-3 and tlr-4 in the mscs , thus inhibiting their immunosuppressive capacity . contradictory results by opitz et al . showed an augmentation in immunosuppressive capacity after tlr-3 and tlr-4 activation in mscs , which continued to inhibit t - cell proliferation , even in low msc : t cells ratio in cocultures . these contradictory results can be explained with additional evidence from tomchuck et al . who observed that tlr-3 activation in mscs supports the activation of the anti - inflammatory cytokines il-10 and il-12 , whereas tlr-4 activation supports the secretion of proinflammatory cytokines . these results were corroborated by waterman et al . who reported that tlr-3 supported msc immunosuppressive effects , whereas tlr-4 supported proinflammatory effects . these authors proposed that mscs could be polarized to one of two phenotypes : proinflammatory or anti - inflammatory . each msc population may possess unique characteristics and differ in their secretion of cytokines , differentiation capacity , extracellular matrix deposits , tgf1-signaling pathways , and expression of jagged , ido , and pge2 . a recent study demonstrated the secretion of proinflammatory cytokines by mscs upon activation of tlr-3 or tlr-4 .", "similarly , most literature describing the molecules that participate in immunoregulatory mechanisms are specific to bm - mscs [ 8 , 13 , 14 , 16 , 17 , 20 , 28 , 31 , 32 , 38 ] . few studies have used other sources such as pl [ 24 , 76 , 9799 ] , ucb [ 24 , 60 , 98 ] , uc [ 34 , 98 , 100102 ] , at [ 8 , 99 , 101103 ] , and wj [ 8 , 98 , 99 , 101 , 104 ] ( table 1 ) . immune cell studies that have used mscs derived from pl , at , ucb , wj , placental villi , amnion , and chorion have focused principally on t lymphocytes , one of the most studied cell types in msc immunoregulation [ 8 , 24 , 76 , 97 , 101103 , 105111 ] ( table 2 ) . the search for alternative sources is particularly important not only because obtaining bm is expensive and invasive , but also because of reports that msc differentiation capacity diminishes as the individual ages [ 112 , 113 ] . some reports have compared the immunoregulatory properties of mscs from different sources to determine which is the most viable for bm replacement . in this regard , our research group has demonstrated that mscs from bm and ucb , have identical immunoregulatory capacity . however we have shown , in the same way as other groups , that in contrast to bm - mscs , pl - derived mscs have a lower capacity [ 24 , 107 ] . in fact , results relating to pl are contradictory between groups [ 76 , 97 , 99 , 108 ] . in this regard , results of a preclinical study for treatment of 9 patients with grades iii - iv acute gvhd with pl - mscs showed complete and partial recovery in two and four patients , respectively . the inconsistency of the results observed in clinical application of pl - mscs could be related to the inconsistent results obtained in vitro by various groups . a different study comparing uc- , ucb- , pl- , and wj - derived mscs observed differences in the capacity to express hla - g or tgf1 after activation with ifn. there were no differences observed in ido secretion . screening for immunosuppressive factors in wj- and bm - mscs activated with ifn or tnf has indicated differences in the postactivation secretion of ido , hgf , and pge2 , which may influence immunoregulatory properties . it is important to pursue comparative studies to determine whether mscs from alternative sources operate with the identical immunoregulatory mechanisms as bm - mscs , which are used in cellular therapy . these studies will be vital in determining alternative sources of mscs for their potential implementation at the clinical level .", "the use of stem cells to replace cells and tissues damaged by congenital or degenerative disease or trauma is called stem cell therapy . in such procedures , we previously outlined that mscs have three biological properties that make them potential candidates for this use : high differentiation potential , trophic factor secretion , and immunoregulatory capacity . mscs are potentially applicable to many diseases , such as gvhd , autoimmune diseases and bone , cartilage , and cardiovascular diseases . the beneficial effects of mscs administration regarding several of the aforementioned diseases have been analyzed in animal models and phases i , ii , and iii clinical studies have been initiated [ 115 , 116 ] . in the following sections , we focus on the use of mscs in the treatment of immune - associated diseases with special emphasis on the treatment of gvhd . because of their immunoregulatory properties , bm - mscs have been applied principally in hsc transplants because mscs are capable of treating and preventing gvhd [ 89 , 117119 ] . after hsc transplant , gvhd presents when donor t lymphocytes recognize patient hla molecules ( alloantigen ) as nonself and mount an immune response ( allogeneic immune response ) . gvhd can be acute or chronic depending on the time of onset and intensity of tissue damage . acute gvhd ( agvhd ) appears within the first 100 days of the transplant , whereas chronic gvhd ( cgvhd ) has a later onset . although the exact pathophysiology is unknown , three phases are believed to describe agvhd onset : ( 1 ) the activation of host antigen presenting cells ( apcs ) by the transplant conditioning regimen ( radiotherapy and/or chemotherapy ) ; ( 2 ) the activation of t lymphocytes , which proliferate and differentiate in response to histoincompatible antigens presented by apcs ; and ( 3 ) a cellular effector and inflammatory phase . the final phase is a combined effect of different sectors of the immune system ( cytotoxic t lymphocytes and nk cells ) and inflammatory cytokines ( ifn , tnf , il-1 , etc . ) , which together promote inflammation and tissue damage in various organs and can cause death . the first clinical trial evaluating the safety and effectiveness of mscs in the treatment of gvhd was performed by frassoni et al . who observed that the coinfusion of hsc and nonirradiated mscs from the identical donor reduced the incidence and severity of gvdh in recipients of an allograft from an hla - identical sibling . subsequently , le blanc et al . reported the case of a 9-year - old boy with steroid refractory agvhd grade iv who was treated with haploidentical mscs from his mother . approximately 70 days after treatment , the child had renewed symptoms of diarrhea and high levels of bilirubin . the administration of a second dose of mscs significantly improved the patient 's condition , and he remained stable throughout the following 100 days . after this case , the identical group reported another study with the administration of mscs to 8 steroids refractory gvhd grades iii - iv patients . no toxic effects were observed , and survival was significantly improved compared to the control . in a multicenter phase ii study of 55 steroid a response was observed in 39 patients treated with mscs , of which 30 recovered completely and 9 partially recovered . survival was significantly improved in patients experiencing full recovery , and the mortality rate was significantly lower than that generally associated with the transplant . the authors suggest that the effect of the mscs was independent of the donor because mscs of hla - identical , haploidentical , and incompatible siblings had similar results . von bonin et al . treated 13 patients with steroid - refractory agvhd with different doses of mscs ( 15 applications ) from unrelated donors that had been expanded in medium with platelet lysate . only 5 patients responded to treatment and only 4 were alive after 257 days of treatment . similarly , mller et al . reported the treatment of 5 children with acute or cgvhd . mscs doses were increased in accordance with cell availability from 0.4 10 to 3.0 10/kg . in addition , it has been suggested that the cotransplant of hsc and bm - mscs may prevent gvhd , but there is a high rate of relapse . however , a clinical trial with 37 children treated with multiple doses of bm - mscs for steroid - refractory grades iii - iv agvhd reported complete response in 24 children and partial response in 8 children . the contradictory results may be because of differences in the method of msc expansion , the number of cells administered , number of doses given , diagnosis of the recipient ( chronic or agvhd ) , stage of gvhd development , and administration of mscs , among others . in attempts to eliminate some these variables , clinical studies have been performed with a universal bm - msc preparation , such as prochymal , which has rendered positive results in the treatment of gvhd . additionally , the effects of using alternative sources of mscs , such as fetal membranes or uc , have been studied . reported that , in steroid - refractory gvhd patients after msc infusion , a high frequency of cd4cd25cd127foxp3 and tr1 populations was detected . a decrease of th17 cells and no changes in the number of nk or b cells were observed . furthermore , the authors suggest an induction and maintenance of tregs , because high levels of il-2 were detected . in another similar study an increment of cd8cd28 and cd5cd19 populations and decrease of cd8cd28 and cd5cd19 b cells after bm - msc infusion in the responsive group the first two populations of t and b cells are related with the maintaining of peripheral tolerance or the induction of differentiation of tregs . similar results were obtained recently in 23 refractory cgvhd patients treated with mscs in which it was detected an increment in the population of cd19cd5il-10 b cells and a high plasma concentration of il-10 . it is important to mention that it has been suggested that changes in the immune microenviroment in patients may promote the risk of infections . in this regard , a retrospective cohort study showed that treatment of gvhd with msc is a risk factor for pneumonia related death . furthermore , remberger and ringdn reported treatment with msc increment incidence of invasive fungal infections . finally , randomized phase iii trials are necessary to determine the effectiveness of mscs in gvhd . msc immunosuppressive capacity may be useful in the treatment of autoimmune diseases . in these pathologies , self - antigens are not tolerated , and the body mounts an immune response against its own tissues and organs . the resulting damage can be systemic ( systemic lupus erythematosus ) or targeted to a specific organ or tissue , such as the pancreas ( type i diabetes ) , central nervous system ( multiple sclerosis ) , or joints ( rheumatoid arthritis ) [ 131133 ] . animal models have demonstrated that msc treatment is effective in some of these conditions , several of which have also been clinical trials , as described below [ 132 , 133 ] . systemic lupus erythematosus ( sle ) is a chronic autoimmune disease that affects connective tissue . clinical studies using allogeneic bm - mscs and uc - mscs [ 135 , 136 ] to treat this disease have described positive outcomes and no severe side effect . in a multicenter study , 40 sle patients were intravenously transplanted with uc - mscs and total or partial clinical response was observed in 60% of patients . the beneficial effect of uc - msc administration is not permanent , because 29.2% of patients relapsed . although these results are interesting , it is important to mention that in the future a controlled and randomized study will be necessary to conclusively demonstrate the effectiveness of ucb - msc administration for sle treatment . although the mechanism through which msc improves patient condition is unknown , li et al . reported increase of cd4cd25foxp3 tregs in peripheral blood of refractory sle patients transplanted with uc - mscs , even after one month of treatment . additionally , a significant decrease of th17 cells since the first week and up to twelve months after transplant was observed . also , wang et al . detected an increase in ido activity after administration of uc - mscs in sle patients , evidenced by kynurenine concentrations . these results suggest participation of immunoregulatory mechanism regarding beneficial effects of msc administration in such patients . on the other hand , some reports have shown that bm - msc administration in murine model of sle do not decrease the levels of autoantibodies or the mortality rates . furthermore , using the same animal model , you d et al . reported that administration of allogeneic bm - mscs to prevent or treat sle enhances autoantibody production and even exacerbates the disease in both experimental conditions . also , a study carried out in two patients showed that administration of autologous bm - mscs increased peripheral blood cd4cd25foxp3 tregs cells , but no improvement was observed in patients . today , there are no clinical trials in progress to assess efficacy of msc transplantation in the treatment of lupus erythematosus [ http://www.clinicaltrials.gov/ ] . type i diabetes is a chronic metabolic disease characterized by an autoimmune reaction against insulin - producing pancreatic cells . in vitro studies using cocktail of growth factors or genetic manipulation have shown that bm - mscs can differentiate into insulin - producing cells . however , such transdifferentiation capacity of bm - mscs into endocrine pancreas cells in animal models has yielded contradictory results and still remains elusive . nevertheless , in animal models have been demonstrated that mscs can revert type i diabetes , enhances insulin secretion and sustain normoglycemia . it has been proposed that such beneficial effects are mainly due to trophic factors and immunoregulators secreted by mscs and not to their differentiation capacity . in a clinical trial , the administration of insulin - producing cells derived of mscs from adipose tissue in 11 patients reduced insulin requirements over the first 2 to 4 months after intraportal infusion . in another trail , wj - mscs were administrated to 15 patients and a decrease in insulin requirements and blood glucose levels was observed even after 24 months of follow - up . however , it is thought that msc immunoregulatory capacity prevents the destruction of the -pancreatic cells rather than their differentiation capacity to regenerate cells . in that regard , intravenous administration of bm - mscs in a murine model of type 1 diabetes reversed hyperglycemia and improved pancreatic regeneration , which is associated with an increase of cd4cd25foxp3 tregs cells in spleen and pancreatic lymph nodes . similar results were obtained by intraperitoneal administration of mscs from at - mscs in mouse models , during early development of induced type i diabetes . increased secretion of insulin and decreased glucose levels in peripheral blood were observed but also inflammatory infiltrate in pancreatic islets . furthermore , a low frequency of cd4ifn and cd4tnf t - cells was observed in pancreatic lymph nodes ( plns ) , and in contrast , a high frequency of cd4cd25foxp3 tregs , a decrease of ifn concentration and increase in tgf1 were observed in pancreatic tissue . additionally , cotransplantation with bm - mscs improves engraftment of pancreatic islets in humanized diabetic mouse model . normoglycemia was maintained during 4 weeks after transplant which show that mscs promote functionality of transplanted islets . the authors observed low infiltration by cd3 t cells in the transplanted tissue and increase of cd4cd25foxp3 tregs in peripheral blood . future clinical trials will be required to determine if such immunological mechanisms also occur in humans . currently , phases i , ii , and iii clinical trials are evaluating the efficacy of autologous bm - mscs [ clinicaltrials.gov identifier : nct02057211 , nct01068951 , nct01157403 ] and uc - mscs in the treatment of type i diabetes [ clinicaltrials.gov identifier : nct01374854 ] . two autoimmune diseases affect the central nervous system ( cns ) : multiple sclerosis ( ms ) and amyotrophic lateral sclerosis ( als ) . ms is a chronic inflammatory disease characterized by the loss of myelin and axon damage . several studies have demonstrated in murine models that msc has positive effects for prevention and treatment of both pathologies , but it is not known what mechanisms are involved in such process . although in vitro studies show that , in the appropriate culture medium , mscs differentiate into cell types with neuronal and glial characteristics , contribution of such mechanisms for in vivo tissue regeneration is controversial . in contrast , in vitro and in vivo studies have suggested that immunoregulation and trophic factor secretion are the main mechanisms used by mscs to improve the symptoms of ms and als [ 1 , 147 ] . studies in a murine model with experimental autoimmune encephalomyelitis ( eae ) as a model for multiple sclerosis have demonstrated that the intravenous administration of bm - mscs improved the symptoms of the disease by decreasing central nervous system inflammation and demyelination . other studies have reported that , in eae mice that had received mscs , less infiltration by cd3 t cells and macrophages in csn was observed after pathological analysis . also , it has been detected low levels of il-17 and tnf in serum . observed that intravenous or intrathecal administration of bm - msc promotes generation of cd4foxp3 in cns and also an increase of il-17 mrna . furthermore , after administration of huc - mscs in a murine eae model , the improvement of disease activity is accompanied by an increase of cd4cd25foxp3 tregs and decrease of th17 in spleen , while in the spinal cord increased il-4 and il-10 and decreased il-1 and il-6 levels were observed . taken together , these results suggest that immunoregulation by mscs has a neuroprotector effect that reduces demyelization and axonal loss and therefore results in the improvement of eae symptoms . it is important to mention that in a recent study it was reported that bm - mscs transplanted in a murine eae model , cd8 t cell infiltrate was increased in cns , which exacerbated eae . the difference between these results could be due to disease mechanisms that underlie various models of eae . similarly , allogeneic mscs administration in murine models of experimental als showed an improvement in survival and motor function , in the spinal cord from msc - treated mice . intrathecal infusion of bm - mscs in a murine model of als delayed disease progression and prolonged survival . activated microglia secrete inflammatory molecules including tnf and nitric oxide that play an important role in als and administration of hmscs decrease microglial activation ( cd11b cells ) and concentration of tnf in the spinal cord . based on the positive results obtained in murine models , clinical trials have been carried out to determine safety and efficacy of mscs for the treatment of these pathologies . a clinical trial in which 34 ms and als patients received intrathecal or intravenous autologous mscs reported that msc administration was safe and had an immediate immunosuppressive effect that diminished inflammation . a study by mazzini et al . studied the direct application of autologous mscs to the spinal cord in als patients and reported that msc administration generated no adverse side effects and was safe ; however there was no significant improvement in patients . currently , no study has shown an improvement in patient 's condition by msc treatment ; therefore , further clinical trials must be performed . several of such studies , analyzing the efficacy and safety of autologous or allogeneic mscs for the treatment of ms and als , are in progress [ http://www.clinicaltrials.gov/ ] . rheumatoid arthritis ( ra ) is a chronic , systemic inflammatory disorder that primarily affects joints and results in bone and cartilage destruction . collagen - induced arthritis ( cia ) initiated in susceptible strains of mice by immunization with native type ii collagen serves as a model of human rheumatoid arthritis . several authors have used this animal model to analyze msc efficacy to improve the symptoms of this disease ; however evidence remains equivocal as conflicting results have been reported . results in this animal model suggest that inflammatory microenvironment present in ra could reverse the immunosuppressive capacity of mscs . observed that msc administration does not improve the course of disease and in vitro experiments showed that tnf was responsible of reverse biological function of mscs . additionally , it has been reported that the intravenous administration of mscs has no effect on the progression of the disease or make ra worse . similar results were reported by papadopoulou et al . who observed immunoregulatory capacity of mscs in vitro , but in vivo , they lost this capacity when they are administrated in the inflammatory ra environment . in a recent study similar immunosuppressive capacity by synovium - derived mesenchymal stem cells ( s - msc ) from ar both mscs are capable of decrease proliferation of pbmc activated with pha or alloantigens from healthy donors and also of autologous synovial t cells activated with pha . however , when cocultures are added with exogenous il-17 and/or tnf , s - mscs from ar patients or healthy donors , they lost their immunoregulatory capacity . in addition , it has been reported that infusion of allogeneic - related hla matched or partially matched mscs does not affect ra development , while mhc mismatched mscs exacerbate the disease activity . in contrast to these results , other studies have shown that administration of syngeneic , allogeneic , or xenogeneic mscs improves ra in mice models . thus , gonzlez et al . showed that intraperitoneal administration of human at - mscs in mice with cia reduced the incidence and severity of disease . improvement of ra is accompanied by a decrease both in inflammation and proinflammatory cytokine secretion ( il-1 , il-12 , il-17 , tnf , ifn , etc . ) and reduction in th1 and th17 numbers . in addition , in a ra murine model induced by antigens , intra - articular infusion of bm - mscs prevented cartilage damage reduced the inflammation and also decreased serum concentration of tnf . a few studies have been done to determine safety and efficacy of mscs administration to humans for the treatment of ra . a study carried out in four patients with refractory ra and treated with allogeneic mscs from bm ( 1 patient ) or uc ( 3 patient ) administered intravenously showed no adverse effects ; however clinical remissions were not detected . in contrast , a clinical assay with 172 patients with active ra showed that uc - msc administration is safe and that the improvement in patients is accompanied by an increase of cd4cd25foxp3 tregs in peripheral blood and a decrease of tnf secretion . two phases i and ii clinical trials are currently performed to evaluate the efficacy of uc - mscs [ clinicaltrials.gov identifier : nct01547091 and nct01985464 ] .", "bm - derived mscs have an immunoregulatory capacity because they can regulate the function of multiple immune system components . to fulfill this role , mscs must be activated by proinflammatory cytokines such as ifn. mscs can inhibit dcs maturation and thus prevent the activation of t lymphocytes and even more and decrease the proliferation and cytotoxic activity of nk cells . as a result of these characteristics , mscs are a promising alternative treatment for immune - related diseases . currently , mscs have been used in the treatment of autoimmune diseases , including gvhd , and have rendered positive results . despite this encouraging debut in clinical application , it is necessary to perform more clinical trials that extend the current knowledge of the biology of msc immunoregulatory activity to optimize and control the patient 's immune response for maximum benefits . these studies will be relevant to clinical decisions in the treatment of gvhd , autoimmune diseases , and other illnesses with an immune component , such as cancer , in which mscs play an important role in the tumor microenvironment that favors growth as our group has previously demonstrated ." ]

[ "carpal instability is broad category consisting of various patterns of injury , with dissociative type more common .", "a 13 -year -old boy presented at 6 months following a fall with restriction of wrist movements . patient had sustained a closed distal one -third both bones fracture forearm fixed with k -wire , and volar lunate instability was found during sequential follow -up .", "posttraumatic carpal instability should be identified at the earliest to avoid poor hand function and morbidity associated with it .", "carpal instability and its biomechanics have always been evolving due to the advancement in the field of radiology and arthroscopy . lunate plays a pivotal role and acts like an intercalated segment in carpal stability , loss of anchorage of this key structure cause intercalated segment instability . volar intercalated segment instability ( visi ) is a less common manifestation of dissociative carpal instability .", "a 13-year - boy had sustained distal one - third radius and ulna fracture after fall on an outstretched hand . open reduction and k - wire fixation was performed for both bone fracture forearm ( fig . 2 ) . he noticed restriction of dorsiflexion of wrist , while other movements normal . serial x - rays showed a loss of normal alignment of radio - lunate in comparison with the opposite ( fig . 3 , 4 ) . serial radiographs during follow - up showed a volar facing lunate with alteration of scapholunate and lunatocapitate angle and was diagnosed with a volar intercalated lunate instability ( fig . the patient was put on strict rehabilitation protocol and the dorsiflexion improved from 0 - 10 to 0 - 40. at 1 year follow - up patient is still having restriction of dorsiflexion ( fig . ( a ) post - operative radiograph of right wrist posterior - anterior and ( b ) lateral view showing reduced distal one - third radius and ulna fracture with implants in situ . ( a ) radiograph of wrist posterior - anterior and ( b ) lateral view at 2 months with uniting distal one - third radius and ulna fracture . ( a ) radiograph of both wrist posterior - anterior view left and ( b ) right showing union of distal one - third of radius and ulna . loss of gilula arc with flexed scaphoid suggesting carpal instability at 6-month follow - up . ( a ) radiograph of both wrists lateral view left and ( b ) right at 6 month follow - up showing volar facing lunate with loss of carpal alignment . ( a ) radiograh of right wrist at 1 year follow - up , post - anterior view and ( b and c ) lateral views , ( a ) showing healed distal one - third radius and ulna fracture , signet ring sign of scaphoid and moon like appearance of lunate . ( b ) volar facing lunate with loss of alignment between radius , lunate and capitate . ( c ) reduction in the scapholunate angle ( 16 ) and increased capitolunate angle ( 40 ) . ( a ) clinical photograph at 1 year follow - up showing reduction of dorsiflexion ( 0 - 40 ) and ( b ) normal palmar flexion ( 0 - 80 ) of wrist .", "carpal instability should be considered as a differential in patients presenting with chronic wrist pain and restricted movements following trauma . classified carpal instability into four categories and lunato - triquetral ligament is involved in stage three which leads to volar lunate instability . visi is a condition in which there is pathologic volar flexion of the lunate , with or without a similar posture of the other proximal row carpal bones . posttraumatic volar lunate instability is an entity that can be missed during the initial traumatic event because of its subtle nature . posttraumatic carpal stability diagnosed at the earliest avoids advanced surgical procedures such as reconstruction and fusion of joint . lunate instability in plain radiograph can be diagnosed with the alteration of various angles namely the loss of scapholunate angle , loss of alignment between the lunate , capitate and radius and increase in the capitolunate angle . treatment options include from closed reduction and k - wire fixation , dorsal capsulodesis , tenodesis , arthroscopic or open repair with reconstruction and finally arthrodesis . this injury could be subtle in nature before reduction and fixation that led to delay in diagnosis or iatrogenic in nature after reduction of the fracture .", "wrist function is a complex interaction of various biomechanics involving the carpal bones , ligaments , and the distal radio - ulnar complex . awareness of carpal instability associated with fractures or injuries around the wrist is needed by the treating surgeon to avoid delay in diagnosis and treatment . to suspect visi following a wrist injury and also following reduction with k - wire fixation . follow - up of patient at regular intervals to prevent morbidity due to this deformity ." ]

[ "\n preeclampsia is a disorder affecting 5 to 10% of pregnancies and is clinically characterized by new - onset hypertension and proteinuria . despite significant progress in our understanding of preeclampsia , there is a need for a reliable diagnostic biomarker for use in clinical practice . in the search for a biologically plausible biomarker , there have been attempts to reconcile clinical findings with pathologic changes in renal biopsies of preeclampsia . for example , renal pathology of preeclampsia in the kidney is classically described as endotheliosis , or swelling of endothelial cells in the glomerulus . the podocyte , a specialized visceral epithelial cell that lines and forms the slit diaphragm of the glomerular basement membrane , has traditionally been thought to be unaffected . however , more recent microscopic studies demonstrate that podocytes are structurally changed and harbor protein resorption droplets . furthermore , there is evidence that selected podocyte - specific proteins such as nephrin , synaptopodin , and glepp-1 are downregulated in preeclampsia , while vegf and flt-1 are increased [ 2 , 3 ] . studied the use of podocytes in the urine ( podocyturia ) as diagnostic markers and found podocyturia to be highly sensitive and specific for preeclampsia . we sought to study the use of podocyturia to diagnose preeclampsia and differentiate it from other conditions that may have a similar presentation in a high risk pregnancy population . furthermore , podocyturia was found frequently in other high risk pregnancy states such as chronic hypertension and gestational diabetes .", "\n we recruited two groups of patients all 18 years of age : uncomplicated pregnant subjects ( control group ) and women at risk for pregnancy complications ( high - risk group ) as described below from the obstetric inpatient service at jacobi medical center , bronx , ny , usa . random urine samples inclusion criteria for high - risk group were diagnosis of preeclampsia , chronic hypertension ( htn ) , gestational htn , type i and type ii diabetes mellitus ( dm ) , gestational dm , mixed connective tissue disease , and pregnancies with fetal chromosomal abnormalities . exclusion criteria were patients under the age of 18 and absence of the above - mentioned diagnosis . inclusion criteria for the control group were uncomplicated pregnancies and deliveries and absence of the above - mentioned high risk pregnancy states . exclusion criteria for the control group were < 18 years of age , preexisting high risk pregnancy states or complicated deliveries . diagnosis of preeclampsia fulfilled the criteria of new onset of htn with blood pressure of 140/90 mmhg after 20 weeks of gestation and proteinuria of > 300 mg of protein in a 24-hour urine specimen or 1 + protein on a urinalysis sample without evidence of another cause , such as urinary tract infection or inflammation . chronic htn was defined as preexisting htn or blood pressure of 140/90 mmhg before 20 weeks of gestation . gestational dm was defined as any degree of glucose intolerance with onset of first recognition during pregnancy . this study was approved by the internal review board of albert einstein college of medicine . urinary protein was quantified either from a 24-hour urine sample collection or extrapolated from a random urine dipstick . for example , when only a dipstick urine protein was available , the value was extrapolated to a 24-hour value based on the following : negative protein corresponds to less than 150 mg/24 hours , trace protein corresponds to 150 mg/24 hours , 1 + corresponds to about 200500 mg/24 hours , 2 + to 0.51.5 g/24 hours , and 3 + to 25 g/24 hours . twenty ml of freshly voided urine was centrifuged at 700 g for 5 min . the sediment pellet was carefully recovered by aspirating the supernatant , washed twice with pbs and resuspended in 1 ml of pbs . aliquots of 100 l of the resuspended sediment were centrifuged onto slides using the shandon cytospin 4 cytocentrifuge ( thermo electron corporation , asheville , nc ) , air - dried and fixed with 1 : 1 acetone / methanol for 10 minutes . the slides were immersed with pbs/1% h2o2 for 15 minutes and washed with deionized water . subsequently , antigen retrieval was achieved by steam - heating in a solution of citrate buffer , ph 6.0 , for 15 minutes and blocked with 10% horse serum in pbs and 2% bsa . slides were incubated overnight with monoclonal mouse antihuman synaptopodin antibody at 1 : 1 dilution ( gift of dr . peter mundel , massachusetts general hospital , boston , ma ) followed by horse anti - mouse igg at 1 : 1000 dilution ( dako inc . sections were then incubated in avidin - biotin complex at 1 : 25 dilution ( vector labs , burlingame , ca ) and developed using diaminobenzidine ( dab ) as chromogen . difference in clinical variables between more than two groups was determined by kruskal - wallis method , differences between two groups were determined by mann whitney method . analyses were performed with stata version 8.2 and graphpad prism version 5.02 for windows software , and results were considered statistically significant if p < 0.05 . for test characteristics of podocyturia , sensitivity , specificity , positive predictive value , and negative predictive value were calculated for each high risk diagnosis .", "the diagnoses at time of urine collection were as follows : preeclampsia ( n = 28 ) , eclampsia ( n = 1 ) , chronic hypertension ( n = 3 ) , gestational hypertension ( n = 6 ) , type i dm ( n = 1 ) , type ii dm ( n = 1 ) , gestational dm ( n = 4 ) , connective tissue disorder ( n = 1 ) , marginal previa ( n = 1 ) , chromosomal anomaly ( n = 1 ) , and uncomplicated pregnancy ( n = 9 ) . the clinical characteristics of all subjects are described in table 1 . podocyturia ( figures 1(a ) and 1(b ) ) was present in 11 out of 29 ( 38% ) patients with preeclampsia / eclampsia , 3 out of 9 ( 33% ) with chronic and gestational htn , and 3 out of 6 ( 50% ) with gestational dm and type i / ii dm ( table 2 ) . among patients categorized as , 2 ( marginal previa and chromosomal anomaly ) out of 3 patients exhibited podocyturia ( 66% ) . in contrast , 0 out of 9 patients ( 0% ) with uncomplicated pregnancies demonstrated podocyturia . based on these findings , we calculated the sensitivity and specificity of podocyturia for preeclampsia to be 38% and 70% , as compared to women of htn of any type , in whom it was 33% and 66% , respectively ( table 3 ) . the sensitivity and specificity for dm of any type were 50% and 68% , respectively . the positive predictive value was 57% for preeclampsia , as compared with 15% for both htn of any type and dm of any type . the negative predictive value , however , was poor for preeclampsia at 51% , as compared with 83% and 91% for htn of any type and dm of any type , respectively .", "podocyturia is well described in many glomerular diseases such as type i dm , iga nephropathy , lupus nephritis , and membranous nephropathy [ 5 , 6 ] . though endothelial injury is thought to be the main lesion in preeclampsia , more recently , derangements of the podocyte with downregulation of selected podocyte - specific proteins in renal biopsies and presence of nephrin and podocalyxin ( podocyte specific proteins ) in the urine have been described [ 2 , 7 ] . in this study , we sought to describe the presence of podocyturia in preeclampsia and other high risk pregnancy states using the podocyte marker synaptopodin for identification . though the exact reason for this discrepancy is unclear , immunofluorescent staining of podocyte - specific proteins , in general , does not appear to be an accurate tool to identify podocytes , as these podocytes may be parietal in origin and may also be apoptotic . thus , the utility of urinary podocytes to detect ongoing glomerular damage in women with preeclampsia as previously suggested is unclear . furthermore , our study showed presence of podocyturia in other high - risk pregnancy states such as dm ( gestational or type this finding is not unexpected since podocyturia and urinary podocyte mrna have been described in nonpregnant diabetic patients and in nonpregnant hypertensive patients respectively . interestingly , the number of urinary podocytes has also shown a statistically significant correlation with blood pressure but not proteinuria in preeclampsia . though podocyturia might help shed light on the pathophysiology of preeclampsia , we feel that its clinical utility is limited . both cytospin methods ( as was performed in this study ) and cultivation of podocytes in culture are fraught with difficulties and are not cost - effective . it may not be easy to eliminate podocyte cell debris when counting podocytes from cytospin specimen of fresh sediment . growing urinary podocytes in cell culture , on the other hand , are frequently limited by bacterial or fungal contamination as the urine may not have been collected under sterile conditions . furthermore , these cells may proliferate , undergo apoptosis , or not attach to the culture dish , thereby falsely representing the true podocyte count . interobserver bias poses yet another obstacle as it requires a highly trained cytologist to correctly identify these cells . since clinical guidelines are available to diagnose preeclampsia , some have questioned whether the addition of a urinary marker is necessary . we feel that the utility of this marker becomes important when the diagnosis of preeclampsia is in question and when the clinical scenario is complicated by the presence of preexisting htn , dm , or other glomerular diseases such as lupus nephritis . in those cases , thus , a specific marker that is discovered through our understanding of the pathophysiology of preeclampsia remains crucial .", "our goal was to confirm the previously shown high sensitivity and specificity of podocyturia in preeclampsia . though a larger sample size would be ideal , we feel that of our total sample size of 56 with 29 patients diagnosed with preeclampsia / eclampsia , and 18 patients with other high - risk diagnoses , is an adequate sample size to demonstrate that podocyturia lacks sensitivity and specificity to be a diagnostic marker of preeclampsia .", "we discovered that podocyte loss is present not only in preeclampsia but in other high risk pregnancy states . in addition , podocyturia was not found in a majority of patients diagnosed with preeclampsia . however , our findings raise an important note of caution of relying on the limited findings in the literature regarding the predictive value of podocyturia in preeclampsia and encourage larger studies . given our current knowledge of the complex pathophysiology of the disease such as the significant role of vascular endothelial growth factor ( vegf ) signaling in maintaining a healthy endothelium and cross talk between the podocyte and vascular endothelial cell , it is unlikely that any single test or cell type will be able to predict preeclampsia ." ]

[ "illness is a challenge to our physical , psychological and spiritual wellbeing that has repercussions on our identity and our social context . in a pathogenetic approach , diagnostic tests are used to look for the underlying disease and treatments are aimed at removing it . a person is considered cured when the disease is no longer detectable and agreed parameters have normalised . however daily clinical practice is characterised by people who suffer from chronic illness where there is often a discrepancy between their biochemical results and the way they feel . good or even normal parameters do not necessarily correlate with a good perceived state of health , and vice versa . health is therefore a concept that goes beyond the absence of disease to include physical , mental and social wellbeing . salutogenesis , developed by antonovsky in the 1970s , looks at what generates health by exploring the reasons why some people stay healthy in the face of hazardous influences whilst others , faced with the same hardship fall ill . antonovsky s research shows how adverse events and stress can become the opportunity to generate health if certain personal characteristics are present . resilience to difficult situations depends on a person s sense of coherence ( soc ) , a global orientation towards life that is based on self - reliance in the face of challenges , self - confidence in one s ability to deal with demanding events and the trust that difficult events hold meaning for one s life [ 2 , 3 ] . there is a growing body of research on all age groups [ 46 ] , different socioeconomic backgrounds and across cultures that shows how a strong soc is related to better health , healthier ageing [ 812 ] and is a protective factor against alcohol addiction despite similar rates of recreational consumption in teenagers . conversely , a weak soc is related to poorer health and lower mood [ 4 , 5 ] . although soc develops naturally in the first 30 years of life it is not a static orientation . it can be strengthened through personal activity and care [ 4 , 14 ] . a dynamic , personally driven element that can change through activity and care it is not the absence of hardship or disease that determines health but our ability to deal with them positively and assign meaning to them . health is not a steady state , effortlessly maintained once it has been achieved , but an active process of continuous adjustment , a subtle equilibrium between our physiological , psychological and spiritual integrity and the outer or inner influences that can strengthen or undermine this . the concept of health as a state of complete well - being advocated by the declaration of alma ata , becomes health as the ability to adjust and self - manage in the face of physical , emotional or personal challenges . a salutogenetic healthcare system needs to be oriented in such a way that illness is considered an adverse event that can become the foundation for better future health . methods need to be adopted that allow the ill person to be treated in all their characteristics and in context . each medical intervention should aim to strengthen soc and a person s physiological , psychological and spiritual resilience . the increasing prevalence of chronic diseases , the very different but constant environmental challenges faced by people in the developing and developed world alike , provide us with constant salutogenetic opportunities .", "person - centred medicine ( pcm ) takes into account the physical , psychological and spiritual aspects of a person in health and illness in order to individualise health promotion practices , diagnosis and treatment . it broadens the technological advances of biomedicine with the epistemological approach , the relationship - based care and the salutogenetic treatments of non - conventional medicine . complementary and alternative medicine ( cam ) and traditional medicine ( tm ) are grouped together as cam / tm or non - conventional medicine ( ncm ) . the term includes a variety of different medical systems and healthcare methods whose roots lie in different philosophical backgrounds and cultural origins . although very different from one another , they all share a holistic view of the human being as a physical , psychological and spiritual entity . they value the complexity of natural phenomena and study the relationship between the human being and nature in health and illness . their treatment systems are based on knowledge , skills and practices that restore health and encourage the self - healing abilities of the human being . they advocate respect for the dignity of every person and promote responsibility for keeping healthy at individual and community levels . this holistic , person - centred , salutogenetic approach is the reason for the growing interest in all forms of ncm by patients and healthcare workers alike . salutogenetic healthcare practices are personalised using the principles and methods of person - centred medicine . in salutogenetic healthcare the caregiver - person relationship each professional role needs to be developed to provide salutogenetic care from as early as undergraduate training . in order to have a person - centred approach , technological proficiency , solid grounding in evidence - based medicine ( ebm ) and knowledge of international protocols need to be complemented by knowledge of the epistemological systems and practical tools of ncm . doctors and other healthcare workers are then encouraged to the use their clinical judgment as the final decision - making tool . clinical judgment is central to the role of the doctor and their professionalism and can be strengthened and developed to become an accurate decision - making tool . this complements the application of ebm and protocols , which are based on large numbers and therefore not always applicable to particular cases . following protocols ensures a basic standard of care that has lead to improvements in safety on a large scale . however following them automatically can lead to repetitive , monotonous practice which in turn can lead to errors as well as frustration and dissatisfaction both on the part of the healthcare worker , who feels like a generic cog in a smooth machine , and the patient who does not feel personally addressed . on the contrary , assessing and treating each person in their physical , psychological and spiritual uniqueness , encourages active personal involvement on the part of the both healthcare worker and the patient . the use of sound clinical judgment allows personalisation of guidelines and protocols to each case . moreover , learning and teaching about salutogenetic practices may mean that healthcare workers adopt healthier lifestyles for themselves . greater work satisfaction and active involvement strengthen a healthcare worker s resilience and soc , ultimately improving their health as well as that of their patients . with this person - centred method , any treatment is chosen as the result of an informed choice that takes all aspects of the person into consideration . for any therapeutic process to become a salutogenetic experience , physical as well as psychological , social and personal factors need to be addressed at the appropriate time with attentive care to the physical emotional and spiritual needs of the person . the patient needs to be able to rely on the doctor or the team who take responsibility for their treatment and recovery . during rehabilitation or at other times during the process there may be a chance to bring the experience to greater consciousness , to explore the reasons that led to the event and the things that could be changed in order to prevent similar episodes from happening again . all this works towards developing an awareness that overcoming this difficult experience was meaningful because it allowed the development of new life skills , new coping strategies , and new confidence in one s own healing abilities . this change needs to be sustained over time with appropriate follow - up as habits are difficult to change and may slip if they are not followed closely and encouraged over time . in order to evaluate the success of medical interventions broadened with a salutogenetic approach , parameters need to be developed and integrated into the current evaluation systems . they need to have a suitable epistemological basis , a methodological approach that considers the value of small numbers , individual cases and clinical judgement . salutogenetic parameters such as the quality of life of patients and caregivers , sustainable change , treatment satisfaction , job satisfaction and prevention of burn - out need to be assessed as well as cost - effectiveness and technological excellence .", "health education is both a therapeutic intervention and the key form of disease prevention in salutogenetic healthcare . it should take place at population levels , in primary care , in hospitals , as part of any rehabilitation process , in schools and families . environmental obstacles that prevent people from adopting healthy lifestyles should be removed as far as possible . the ottawa charter advocates the implementation of eight conditions that should underlie any change in health . these are peace , shelter , education , food , income , a stable eco - system , sustainable resources , social justice , and equity . at the same time , individuals need to be encouraged to actively increase control over their health in order to improve it . to reach a state of complete physical , mental and social well - being , an individual or group must be able to identify and to realize aspirations , to satisfy needs , and to change or cope with the environment . encouraging locally sourced , high quality foods , encouraging biodiversity and fair - trade , has positive effects on the sustainability of primary resources and the stability of the eco - system as well as people s health . in order to be adopted by individuals in their lifestyles , there should be variations between the diet of a child and that of an elderly person , of an office worker compared to that of a builder , the diet of someone who suffers from inflammatory illnesses compared to that of someone who suffers from cancer , the diet of the same person when they are well or ill . if diet were a better used resource in healthcare and people were taught its principles and practical applications , this may decrease the need to use medication in some cases . altered sleeping patterns , eating rhythms and patterns of physical activity are both a measure and a cause of pathology and health . variable shift workers have a higher degree of stress , of alcohol misuse and increased use of neuroleptic drugs compared to their colleagues with regular working patterns . many others have altered eating rhythms as they skip meals , or constantly pick at food during the day . it is important for people to become aware of their own biorhythms , which alter with age , gender , state of health , personal and constitutional characteristics . with the help of education , improved environmental conditions and appropriate care during illness , people can adjust or at least compensate for altered biorhythms and therefore actively improve their health . chronic stress can strengthen or weaken a person depending on how strong or weak their resilience and soc are . chronic stress has been shown to be greater risk factor for developing ischaemic heart disease than hypertension or hypercholesterolaemia . emotions can have adverse effects on the incidence of complication and prognosis during an acute event . apart from reducing known risk factors and encouraging positive emotions , we can strengthen emotional resilience and soc through artistic activity in the form of painting , music , dance , drama , creative writing . a study carried out in sweden showed how music therapy improved quality of life and soc in a group of elderly people . through artistic activities people learn new skills and their achievements have a positive effect on their self - esteem . this can be applied to overcome future challenges or unknown life - situations with strengthened soc .", "the initial steps towards a salutogenetic healthcare reform , are to broaden undergraduate training and to develop pilot projects in the fields of health promotion and salutogenetic rehabilitation . the person and the caregiver - person relationship needs to be placed at the centre of the therapeutic process through the principles of person - centred medicine both in education and in practice . caregivers need to be given the tools to consider the person in all their aspects and characteristics through the adoption of the epistemological basis of ncm that broadens the technological advances of biomedicine . medical interventions should not only be aimed at removing the disease but also at improving health by strengthening a person s soc and their resilience at physical , psychological and spiritual levels . reasons for illness can be explored during rehabilitation . through health promotion programmes , during rehabilitation , in education , people are taught how to take better care of themselves by adopting individually tailored , healthier lifestyles better suited to their own physiological , emotional and personal needs . active involvement needs to be encouraged both on the part of the to patient and healthcare giver , the use of clinical judgment needs to be taught . methods for the scientific investigation of effects on small numbers or single cases need to be included in the evaluation of a person - centred , salutogenetic healthcare system alongside ebm ." ]

[ "macroautophagy ( abbreviated as autophagy ) is a genetically regulated and evolutionarily conserved pathway for the degradation of subcellular components [ 15 ] . this process involves the de novo formation of cytoplasmic double membrane - bound vacuoles termed autophagosomes , which sequester cytosolic cargo for delivery to the lysosomes [ 5 , 6 ] . autophagic cargoes may include various subcellular targets typified by ubiquitin - modified or long - lived proteins and major cytosolic organelles ( e.g. , mitochondria and peroxisomes ) [ 79 ] . however , a number of other potential substrates have been identified , including lipids , nucleic acids , reticulocytes , and invading pathogens ( e.g. , intracellular bacteria , viruses , etc . ) [ 7 , 10 ] . the autophagic pathway proceeds through several defined steps : ( i ) the initiation phase involving the formation of an isolation membrane or phagophore , ( ii ) the elongation of the phagophore , ( iii ) the maturation of an autophagosome with assimilation of a cytosolic cargo , ( iv ) the fusion of the mature autophagosome to the lysosome , and finally ( v ) the degradation phase where the contents are digested by lysosomal proteases ( e.g. , cathepsins ) and other hydrolytic enzymes [ 15 ] ( figure 1 ) . autophagy has been recognized as an essential function for cell homeostasis and adaptation to environmental stress conditions including nutritional starvation , energy depletion , endoplasmic reticulum stress , oxidative stress , and hypoxia [ 1114 ] . furthermore , autophagy plays a vital role in innate and adaptive immune mechanisms , including resistance to pathogen infections [ 10 , 15 , 16 ] . the role of autophagy in diseases is an emerging area of investigation , with recent studies indicating that autophagy may exert multifunctional roles in specific diseases , with the potential for both adaptive and maladaptive outcomes . furthermore , deficiency or absence in autophagic function may also contribute to the pathogenesis of human diseases [ 2 , 12 , 1719 ] . the occurrence of autophagy in response to environmental stress , most notably starvation , is generally regarded as a cell survival mechanism [ 2022 ] . due to the often coincident appearance of morphological and biochemical markers of autophagy in cells that are dying , the relationship between autophagy and cell death has been both extensively studied and speculated upon [ 2326 ] . autophagic cell death to describe a form of caspase - independent necrosis - like cell death associated with accumulation of autophagosomes in cells . this classification is now controversial , and the casual relationship between autophagy and cell death remains unproven [ 25 , 26 ] . nevertheless , many studies have pointed to intimate relationships between autophagy and cellular death programs , which are not yet fully understood . recent studies have also examined potential cross - talk between the signaling pathways that regulate autophagy and those that regulate distinct forms of regulated cell death such as apoptosis . the major types of cell death which have been studied most extensively in the context of autophagy research include apoptosis , necrosis , necroptosis , and pyroptosis , as briefly summarized here . apoptosis denotes a regulated form of cell death that requires the coordinated action of proteases and nucleases within an intact plasma membrane . morphological characteristics of apoptosis include dna fragmentation , plasma membrane blebbing , cell shrinkage , and cellular decomposition into membrane - bound apoptotic bodies which are removed by phagocytosis [ 3033 ] . the cardinal biochemical features of apoptosis include mitochondrial dysfunction , respiratory chain inhibition , loss of inner mitochondrial membrane potential ( m ) , increased mitochondrial membrane permeability , and externalization of phosphatidylserine [ 3033 ] . apoptosis has a crucial function in the maintenance of tissue homeostasis under physiological conditions and also serves as a component of developmental programs and furthermore may also contribute to disease pathogenesis . ( mitochondria - dependent ) apoptotic pathway represents a major mechanism by which exposure to harmful extracellular stimuli triggers apoptosis . this pathway is dependent on a proteolytic activation cascade for both regulation and execution ( i.e. , caspases ) and subject to regulation by bcl-2 family proteins . the extrinsic apoptotic pathway , which shares common downstream features with the intrinsic pathway , is defined by its dependence on receptor - ligand ( e.g. , fas - fas ligand ) interactions for initiation . necrosis is a type of cell death that results from acute , accidental , or nonphysiological injury [ 3033 ] . this type of cell death is associated with cell lysis as the consequence of membrane damage and subsequent leakage of cell constituents into the extracellular space , which may lead to local inflammation and damage to the surrounding tissue . in certain cases , cell swelling or oncosis may precede necrosis . necrosis and apoptosis differ in morphological features , though the two processes are not necessarily mutually exclusive . both apoptosis and necrosis can occur in response to treatment with many injurious stimuli , usually in a dose - dependent fashion . many agents that cause apoptosis at low to moderate doses may ultimately cause necrosis at relatively higher doses . a number of endogenous events can determine the balance between apoptotic and necrotic death . cellular energy charge ( i.e. , atp levels ) whereas atp is required for certain steps of caspase activation , rapid decline of cellular atp levels typically leads to necrotic cell death . the existence of necrotic cell death pathways regulated by an intrinsic death program distinct from that of apoptosis has also been proposed . necroptosis , that resembles necrosis has been described [ 34 , 35 ] . in this form of regulated necrosis , the ligand binding of death receptors such as the tumor necrosis factor receptor 1 ( tnfr1 ) can promote the formation of a macromolecular complex ( necrosome ) , involving the receptor - interacting protein ( rip ) kinase-1 and kinase-3 that initiate necrosis [ 36 , 37 ] . increasing evidence affirms the relevance of this mode of cell death in the pathogenesis of various diseases [ 3842 ] . pyroptosis represents a form of cell death that is triggered by proinflammatory signals and which is associated with inflammation [ 32 , 43 , 44 ] . this type of cell death occurs primarily in inflammatory cells such as macrophages and may be triggered by bacterial or pathogen infections . caspase-1 is responsible for the maturation of proinflammatory cytokines such as il-1 and il-18 through inflammasome - dependent pathways cell death occurs as a result of membranous pore formation and cytoplasmic swelling and leakage of cytosolic contents . similar to apoptotic cells , pyroptotic cells may also display dna fragmentation and nuclear condensation . the molecular machinery of autophagic regulation is the subject of recent reviews [ 45 , 46 ] . subsequent to their identification in yeast , a number of critical autophagy - related genes ( atg ) have been identified whose gene products regulate distinct steps in the induction or progression of autophagy [ 45 , 46 ] . in brief , the autophagy pathway responds to regulation by nutrient status , including nutrient deficiency ( starvation ) and loss of energy charge . starvation induces autophagy through the inhibition of mammalian target of rapamycin ( mtor ) , which resides in a multiprotein complex , mtorc1 . in response to stimulation by nutrients or growth factors , mtorc1 negatively regulates a macromolecular substrate complex that includes ulk1 , atg13 , atg101 , and fip200 ( rb1cc1 ) , which results in autophagy suppression [ 4854 ] . energy depletion , which stimulates autophagy , inhibits mtorc1 , in part through activation of the amp - dependent protein kinase ( ampk ) , leading to the activation of ulk1 , an important initiating step in autophagy [ 47 , 55 , 56 ] . autophagy is also coregulated by a multiprotein complex consisting of beclin 1 ( homologue of yeast atg6 ) , which associates with class iii phosphatidylinositol-3-kinase ( vps34 ) and a number of additional stimulatory or inhibitory coregulatory proteins ( e.g. , atg14l , uvrag , ambra1 , and rubicon ) . in response to proautophagic stimuli , the increased production of phosphatidylinositol-3-phosphate ( pi3p ) by this complex regulates autophagosome formation [ 57 , 58 ] . the beclin 1 complex is subject to negative regulation by the pi3 k / akt pathway as well by binding interactions with antiapoptotic bcl-2 family proteins . following phagophore formation , the elongation of the autophagosome membrane requires the action of two ubiquitin - like conjugation systems : the atg5-atg12 conjugation system and the microtubule - associated protein-1 light chain 3 ( lc3 , atg8 ) conjugation system [ 61 , 62 ] . atg4b converts the proform of lc3b to its cytosolic free form ( lc3-i ) . in mammals , the conversion of lc3-i ( and other atg8 homologues ) to its phosphatidylethanolamine - conjugated and autophagosome - membrane associated form ( i.e. , lc3-ii ) is an initiating step in autophagy [ 6366 ] .", "once thought to be relatively nonspecific , it is now believed that autophagy is a highly selective process in which distinct cellular mechanisms are employed to identify and target cargo to autophagosomes . such selective autophagy pathways have been identified for the turnover of mitochondria ( mitophagy ) and other organelles and the turnover of denatured protein ( aggrephagy ) . during starvation ( e.g. , deprivation of glucose or growth factors or depletion of cellular energy charge ) autophagy prolongs cell survival through the degradation and recycling of cellular macromolecules . mice deficient in the autophagy protein atg5 are susceptible to the lethal effects of starvation . inhibition of autophagy by beclin 1 or atg5 knockdown , or by chemical inhibitors such as 3-methyladenine , can promote apoptosis and caspase-3 activation in starved hela cells . these studies have suggested a role for autophagy as a means for prolonging cell survival during starvation . autophagy performs a cardinal homeostatic function in the removal of damaged or dysfunctional mitochondria , in a selective process referred to as mitophagy . the increased turnover of mitochondria by mitophagy may occur as a result of chemical or physical stress ( e.g. , hypoxia ) . nix localizes in the outer mitochondrial membrane and directly interacts with mammalian atg8 homologs through its lir motif . damaged or dysfunctional mitochondria are recruited to the autophagosome for removal by mitophagy through a process regulated by the phosphatase and tensin homolog deleted in chromosome 10 ( pten)-induced putative kinase 1 ( pink1 ) and parkinson protein-2 ( parkin ) [ 9 , 69 , 70 ] . mutations in the corresponding pink1 and park2 genes are associated with recessive familial forms of parkinson 's disease . in mice , pink1 and park2 deletions loss of mitochondrial membrane potential and the increased production of mitochondrial reactive oxygen species ( ros ) may provide initiating signals for mitophagy . pink1 , a transmembrane protein , is stabilized on damaged or depolarized mitochondria . following the decline of mitochondrial membrane potential , which can be caused by chemical stress , pink1 recruits cytosolic parkin , an e3 ubiquitin protein ligase , to the mitochondria [ 69 , 70 , 73 ] . parkin ubiquitinates mitochondrial outer membrane proteins including porin , mitofusin , and miro [ 74 , 75 ] . ubiquitinated mitochondria are subsequently recognized and targeted to autophagosomes by the autophagic cargo adaptor protein p62 [ 9 , 69 , 70 ] . autophagy can maintain cellular protein homeostasis ( proteostasis ) by providing a mechanism for the removal of ubiquitinated protein aggregates , in a selective process termed aggrephagy . recent studies suggest that autophagy may provide an alternative pathway to proteolysis in addition to the ubiquitin proteasome system [ 7678 ] . aggrephagy requires the selective autophagy cargo adaptor p62/sqstm1 ( p62 ) which can interact with ubiquitinated proteins through a ubiquitin - associated ( uba ) domain . furthermore , p62 can interact with lc3 through its lir ( lc3-interacting region ) motif and thereby facilitate the targeting of ubiquitinated proteins to autophagosomes . the selective autophagy adaptor , nbr1 ( neighbor of brca1 gene 1 ) , promotes the formation of ubiquitin - positive protein aggregates , facilitating their sequestration and removal by aggrephagy . this process involves the 400 kda , pi3p - binding autophagy - linked fyve domain protein ( alfy ) , a p62-interacting protein . in addition to mitophagy , other forms of organelle - specific or substrate - specific autophagy have been identified and collectively may contribute to the maintenance of cellular integrity under stress . these include the selective autophagic degradation of peroxisomes , ribosomes , and endoplasmic reticulum fragments . in addition to protein , autophagic processes have been implicated in the degradation of diverse cellular biomolecules , including lipids and rna . furthermore , autophagy can degrade exogenously derived substrates , most notably bacteria , virus particles , and other parasites , in a selective process termed xenophagy [ 10 , 15 , 16 ] . although recent studies begin to unravel the role of mitochondrial selective autophagy in cell death pathways , the role of diverse selective autophagy pathways in the modulation of cell death programs remains largely uncharted territory .", "despite a widely accepted role for autophagy in cellular survival , autophagy has also been associated with the regulation of various cell death pathways , most notably apoptosis . thus , autophagy may represent a failed adaptive mechanism that may have prevented death under milder conditions . hypothetically , excess activation of autophagy may contribute to apoptotic cell death through unchecked degradative processes . cells undergoing autophagy display an increase in autophagic vesicles ( i.e. , autophagosomes and autophagolysosomes ) . the distinctions between autophagy and apoptosis remain incompletely delineated , as the two processes are not always mutually exclusive and may occur simultaneously in the same cell type . recent studies suggest that factors well known to regulate apoptosis pathways also have the potential to exert regulatory activity on factors that regulate autophagy and vice - versa ( figure 2 ) . how these regulatory events , termed cross - talk , are integrated into a mechanism for the determination of cell fate yet remains incompletely understood . antiapoptotic bcl-2 family proteins , which downregulate apoptosis ( i.e. , bcl-2 ) by antagonizing the activity of proapoptotic proteins , can downregulate autophagy . binding of these bcl-2 family proteins to beclin 1 inhibits autophagy by preventing the association of beclin 1 with the class iii pi3k complex [ 57 , 60 ] . bnip3 is a bh3-only protein that can trigger apoptosis by sequestering antiapoptotic bcl-2 family proteins and promoting bax / bad dependent mitochondrial release of proapoptotic mediators . these interactions suggest that autophagy and apoptosis may be coordinately regulated by bcl-2 family proteins . experimental evidence also suggests that , once activated , apoptosis effector molecules may suppress autophagy ; for example , beclin 1 may be cleaved and inactivated by caspases during activation of apoptosis . further studies suggest that certain atg proteins may play dual roles in autophagy / apoptosis regulation ; for example , the autophagic protein atg5 may affect extrinsic apoptosis pathways through interactions with the fas - associated death domain ( fadd ) protein . atg5 which regulates autophagy can be subject to calpain - dependent cleavage to generate a proapoptotic truncation product ( tatg5 ) . this cleavage product promotes apoptosis by binding to and inhibiting antiapoptotic proteins such as bcl - xl . recent studies also implicate atg12 , the binding partner for atg5 required for autophagosomal elongation , as an effector of the intrinsic apoptosis pathway . atg12 may bind to and inactivate antiapoptotic bcl2 family proteins ( e.g. , bcl-2 and mcl-1 ) , through an interaction involving a bh2 motif , and thereby act as a proapoptotic regulator . recent advances have identified other regulatory targets for caspase regulation among autophagy related molecules ; for example , atg4d , a member of the atg4 family of atg8 processing enzymes , has been identified as a substrate for proapoptotic caspase-3 . the autophagic protein atg3 has recently been identified as a caspase-8 substrate , which is cleaved during tnf-induced apoptosis . the antiapoptotic protein cellular flice - like inhibitory protein ( c - flip ) can act as a negative regulator of autophagy . the c - flip , an endogenous inhibitor of caspase-8 processing and the extrinsic apoptotic pathway , acts to prevent the binding of atg3 to lc3 , which impairs lc3 processing . on the basis of what is known about the molecular cross - talk between autophagy and apoptosis it currently remains unclear whether autophagy and apoptosis are coregulated or mutually exclusive processes . antiapoptotic ( e.g. , bcl-2 ) as well as proapoptotic ( e.g. , caspase-3 ) molecules can downregulate autophagy by interacting with beclin 1 . furthermore , other caspase - dependent events have been implicated in anti - autophagy or proautophagy events . for example caspase processing of atg4d is proautophagy , whereas caspase processing of beclin 1 is antiautophagy . the definitive cellular mechanisms that control the decision to embark on each one or both of these pathways in response to specific stimuli remain unclear . analysis of any single isolated regulatory component ( using sirna knockdown for example ) for its potential to cross - regulate autophagy and/or apoptosis will be unlikely to answer these questions . thus , an integrative approach is needed to understand how the entire molecular machinery of apoptosis and autophagy are coordinated to influence cell fate decisions . the p53 tumor suppressor protein is a well studied regulator of cell cycle progression and apoptosis . p53 modulates the expression of bcl-2 family proteins ( e.g. , bax , bid ) and other apoptosis - related gene targets ( e.g. , apaf1 ) . the nuclear form of p53 targets the expression of dram ( damage regulated autophagic modulator ) , which can stimulate both autophagy and apoptosis . alternatively , p53 can induce autophagy through the upregulation of ampk , which downregulates the mtor pathway . recent studies have shown that genetic or pharmacological inhibition of p53 can also activate autophagy and have led to the identification of the cytoplasmic form of p53 as an inhibitor of autophagy . chemical stimuli known to induce autophagy can promote the proteasomal degradation of p53 . cellular stimulation with interferon- ( ifn- ) induces the deacetylation of p53 , leading to suppressed bmf expression , reduced complex formation between beclin 1 and bcl2 , and enhanced autophagy . taken together these studies suggest a complex role of p53 in the regulation of autophagy , with opposing roles for the cytosolic and nuclear forms of p53 [ 98 , 99 ] . several recent studies , supported by genetic manipulation of the autophagy program , have revealed that in select toxicological models , autophagy may be associated with the promotion of apoptosis . in our recent studies we have found that epithelial cells subjected to cigarette smoke extract ( cse ) exposure die by activation of the extrinsic apoptosis pathway [ 100 , 101 ] . cse - induced cell death involved activation of the fas - dependent death - inducing signaling complex ( disc ) and downstream activation of caspases ( -8,-9,-3 ) . epithelial cells subjected to cse exposure concurrently responded with increased autophagosome formation and increased processing of lc3b - i to lc3b - ii in epithelial cells [ 100 , 101 ] . knockdown of autophagy proteins beclin 1 or lc3b inhibited apoptosis in response to cse exposure in vitro , suggesting that increased autophagy occurred in association with epithelial cell death [ 100 , 101 ] . further studies revealed that lc3b may act as a regulatory factor in extrinsic apoptosis in this model . lc3b was found to engage a complex with fas , the key component of the disc , in a fashion dependent on the lipid raft protein caveolin-1 . cse exposure caused the rapid dissociation of lc3b from fas , in association with the activation of apoptosis signaling . in conclusion , these results using genetic knockdown experiments have implicated a proapoptotic role for lc3b , in a specialized model of cse - induced toxicity , though the relative role of autophagic activity in promoting cell death in this model remains unclear [ 100 , 101 ] . it should be noted that cse - induced autophagy may differ from starvation - induced autophagy in that it occurs in the presence of a complex mixture of foreign matter , which may potentially alter the functionality of the autophagy response . thus , the concept of toxic autophagy may involve altered function , which may be dependent not only on whether its activation is physiological or excessive , but also on the nature of foreign substrates ( e.g. , complex xenobiotics such as tar or virus particles ) and their interactions with autophagosomes . further examples of coincident autophagy and apoptosis include p53-dependent autophagy through upregulation of dram , which is coincidental with upregulation of apoptosis . deletion of atg5 was also shown to protect cells from prodeath environmental stimuli ; however , the authors attributed this resistance to compensatory activation of chaperone - dependent autophagy , rather than inhibition of macroautophagy per se . these studies raise an important issue in that genetic knockdown of one specific autophagy - related factor can not establish whether autophagy was protective or not in any context , as downregulation of the target may potentially affect signaling pathways that are independent of autophagy , or alternatively , promote compensatory mechanisms , such as alternate forms of autophagy .", "the terms autophagic cell death or type ii programmed cell death have been previously used to refer to cell death distinct from apoptosis that occurs in association with increases in autophagosome formation and independently of caspases . many studies that have implicated autophagy as a cell death effector have been performed on apoptosis - compromised or caspase - deficient cells ; for example , cells treated with z - vad - fmk , a general inhibitor of caspases , or with caspase-8 and calpain inhibitors , die essentially by a nonapoptotic pathway characterized by dramatic accumulations of autophagic vacuoles [ 104107 ] . genetic knockdown experiments ( e.g. , beclin 1 ) suggest that autophagy contributes to cytotoxicity in these models ; however , contrasting studies , also using knockdown of autophagy proteins , have also suggested that autophagy can also protect in the context of nonapoptotic cell death induced by caspase inhibition . in baxbak mouse embryonic fibroblasts ( mefs ) , which can not activate intrinsic apoptosis , treatment with chemotherapeutic agents results in nonapoptotic necrosis - like cell death accompanied by excessive autophagosome formation . currently it remains unclear whether the process of autophagy acts as an effector or bystander of caspase - independent necrosis - like cell death , though autophagic proteins likely play an accessory role [ 25 , 26 ] . experiments in tumor cells have suggested the possibility of cross - talk between autophagy and necrosis in cells . autophagy provides a protective function to limit tumor necrosis and inflammation in response to metabolic stress . while autophagy acts to buffer metabolic stress , the combined impairment of apoptosis and autophagy promotes necrotic cell death in vitro and in vivo . although it remains to be determined what triggers necrosis in tumor cells , it is likely that insufficient atp production to maintain plasma - membrane integrity results in metabolic catastrophe and cell lysis [ 110 , 112 ] . autophagy integrates a metabolic feedback system to allow sufficient atp generation to maintain cell viability . enhanced autophagy by spermidine , a natural polyamine , inhibits loss of membrane integrity and release of chromatin protein high mobility group b1 ( hmgb1 ) , a biomarker of necrosis . however , recent consensus agrees that specific genes can regulate necrosis , which is termed necroptosis . the kinases receptor - interacting protein 1 ( rip1 ) and rip3 are key signaling molecules in necroptosis . published studies have suggested that the treatment with zvad , a caspase inhibitor with broad specificity , induced autophagy and the death of l929 cells ; and this death process required rip1 , suggesting that autophagy is involved in necroptosis . in several models , autophagy has been shown to regulate necroptosis [ 116 , 117 ] . in endothelial cells , inhibition of autophagy rescues palmitic acid - induced necroptosis . on the other hand , a recent study has demonstrated that necrostatin-1 ( nec-1 ) , a specific necroptosis inhibitor , suppressed not only necrosis but also autophagy . these observations suggest that autophagy may be induced by necroptosis , raising the possibility that cellular stress during cell death may lead to the induction of autophagy . it is tempting to speculate that so - called autophagic cell death may involve elements of necroptosis , though further research will be needed to clarify this relationship , as well as the signaling pathways linking autophagy to necroptosis .", "recent observations have revealed a relationship between autophagic proteins and inflammasome - associated proinflammatory cytokine maturation in macrophages [ 122124 ] . inflammasomes are cytosolic multiprotein complexes that constitute a novel inflammatory signaling mechanism and which govern the maturation and secretion of distinct proinflammatory cytokines , such as il-1 , il-18 , and il-33 . cytosolic receptors of the nod - like receptor ( nlr ) family ( i.e. , nlrp3 , nlrp1 ) interact with accessory proteins to form inflammasome complexes . nlrp3 interacts with an adaptor protein [ apoptosis - associated speck like protein containing card ( asc ) ] , which recruits and activates the procaspase-1 by proteolytic cleavage . proinflammatory cytokine secretion ( il-1 and il-18 ) was enhanced in atg16l1 or atg7 deleted macrophages in response to lps . in contrast , atg16l1 or atg7 deficiency did not affect tnf and ifn- production or nf-b pathway activation in macrophages stimulated with lps . furthermore , atg16l1 deleted mice displayed increased susceptibility to a murine model of colitis , which could be ameliorated by anti - il-18 therapy . increased activation of il-1 and il-18 has also been observed in macrophages and monocytes isolated from mice genetically deficient in beclin 1 and lc3b . cytokine activation in response to lps and atp in wild - type macrophages , as well as the amplification observed in lc3b or beclin 1 deficient macrophages , required the nlrp3 inflammasome pathway [ 123 , 124 ] . the mechanism by which autophagy deficiency enhanced nlrp3 inflammasome pathway activation involved mitochondrial dysfunction , including the enhanced production of mitochondrial ros and increased mitochondrial membrane permeability transition [ 122 , 123 ] . the pathway to caspase-1 dependent il-18 secretion in macrophages was inhibited by mitochondrial targeting antioxidants . these experiments suggest that autophagic proteins dampen inflammasome pathway activation by stabilizing mitochondria and/or maintaining mitochondrial quality control through autophagy . in contrast to negative regulation of autophagy by the inflammasome , a recent study demonstrates that autophagy induction by starvation enhances caspase-1 activation and secretion of il-1 and il-18 . it is possible that a distinct type of autophagy induction might differentially regulate the inflammasome pathway . taken together these studies suggest an important role for autophagic proteins in the dampening of proinflammatory responses , which warrants further investigation in models of inflammatory disease . in addition to confirmed negative regulatory roles of autophagy in inflammasome activation , it has been shown that stimulation of inflammasome pathways can promote autophagosome formation through activation of the gtpase ralb . furthermore , p62-dependent selective autophagy processes may regulate the turnover and degradation of ubiquitinated inflammasome complexes . further studies suggest that stimulation of plasminogen activator inhibitor-2 by toll like receptor activation suppresses nlrp3-dependent cytokines activation by promoting the autophagic degradation of nlrp3 . an important and unanswered question is related to whether inflammasome activation and the generation of inflammasome - associated cytokines exert downstream consequences on autophagic processing . pyroptosis is triggered in inflammatory cells in response to excessive inflammation by caspase-1-dependent processes , leading to release of proinflammatory cytokines ( e.g. , il-1 , il-18 , and il-33 ) from dying cells . recent studies suggest that macrophages activate autophagy in parallel with inflammasome activation , as a means to delay the onset of pyroptosis . chemical inhibition of autophagy using 3-methyladenine or inhibition of the atg4 protease resulted in increased incidence of pyroptotic cell death in activated macrophages . the impact of autophagy modulation on the regulation of pyroptosis , and the relevance of these interactions in in vivo models of inflammatory disease and sepsis , warrants further exploration .", "autophagy is generally defined as a cellular program that ensures survival under conditions of stress . the ability of autophagy to clear damaged or denatured subcellular constituents such as aggregated protein ( i.e. , aggrephagy ) as well as to maintain mitochondrial homeostasis ( i.e. , mitophagy ) appears to play important roles in the cytoprotective and homeostatic functions of autophagy . despite the homeostatic roles , autophagy is now recognized to play complex and incompletely understood roles in cell death programs ( figure 3 ) . furthermore , there is considerable cross - talk between the molecular regulation of autophagy and other regulated forms of cell death [ 2326 ] . the role of autophagy in diseases is an emerging area of investigation , with recent studies indicating that autophagy may exert multifunctional roles in specific diseases , with the potential for both adaptive and harmful outcomes . furthermore , deficiency or absence in autophagic function may play a pathogenic role in select human diseases [ 2 , 1719 ] . additional studies are needed to define the dynamic equilibrium between autophagy , apoptosis , regulated necrosis , and other modes of cell death in the context of human disease pathogenesis . furthermore , additional studies are needed to determine the relevance of autophagic regulation of pyroptosis in inflammatory diseases . an increased understanding of these relationships would be essential in the development of therapeutics targeting the autophagy pathway for the treatment of disease ." ]

[ "koreich in 1981 first reported the case of a 22 year old man diagnosed as hodgkin lymphoma ( hl ) who developed hypothermia and hypotension during the course of his admission , which resolved only after initiation of chemotherapy . systemic symptoms are present in a third of patients at presentation and among them fever is the most common followed by night sweats and weight loss . on review of literature , we found 18 case reports with similar finding of hypotension and hypothermia associated with hl . most of the patients in these case reports developed hypotension and hypothermia after initiation of chemotherapy . only 3 out of these 18 patients were found to have hypotension at the time of presentation prior to diagnosis . we report the case of a patient who presented with hypotension and hypothermia and was diagnosed initially with septic shock . he was found to have ill - defined liver lesions on the computed tomography ( ct ) scan which were new on comparison with a recent ct abdomen done for evaluation of nephrolithiasis . the pathophysiology of development of hypotension and hypothermia in patients during chemotherapy or prior to diagnosis remains unexplained . a complex interaction between cytokines , tumor and blood vessels has been proposed as the genesis of such a presentation .", "a 61 year old man presented to emergency room with history of flank pain on right side , dysuria , urgency and frequency with occasional hematuria for 3 days associated with fever , chills and rigors . 3 weeks before this presentation he was admitted for renal colic and was found to have a new staghorn calculus in the kidney which was managed conservatively with 7 days of oral antibiotics . review of systems noted a history of 40 pounds weight loss over 3 months , drenching night sweats and occasional low grade fevers for last 3 months . past medical history was significant for multiple episodes of renal colic secondary to nephrolithiasis treated with lithotripsy several years ago . social history was significant for 30 pack year history of smoking , occasional alcohol consumption and no substance abuse or high risk behavior . was noted to be hypotensive with a blood pressure ( bp ) of 78/49 mmhg and mean arterial pressure ( map ) of 59 mmhg . the hypotension was new compared with recent admission 3 weeks prior , where the bp readings were consistently above a map of 80 . the hypotension did not correct with bolus of 3 liters of 0.9% normal saline ( ns ) and in view of his history of dysuria and intermittent hematuria and recent diagnosis of staghorn calculus he was diagnosed with urinary tract infection ( uti ) leading to urosepsis and septic shock . he was admitted to medical intensive care unit ( micu ) where he was started on pressor support with norepinephrine and broad spectrum antibiotic coverage with vancomycin and piperacillin - tazobactam . vitals recorded at presentation were temperature of 97.3f , bp of 78/49 mmhg , map of 59 mmhg , heart rate 80/min , respiratory rate 18/min , spo2 of 98 - 99% on room air . general exam was significant for an averaged sized man in mild distress with mild pallor , no icterus , cyanosis or edema . labs were significant for hemoglobin ( hb ) of 9.2 g / dl , mean corpuscular volume ( mcv ) of 77.6 fl and leukocyte count ( wbc ) of 5.1 k/l with differential of 77% neutrophils . liver enzymes showed alkaline phosphatase of 212 u / l , alanine transaminase ( alt ) 80 u / l , aspartate tranaminase ( ast ) 96 u / l , total protein 3.6 g / dl and albumin 1.5 g / dl . urine dipstick was positive for blood ( 1 + ) , proteins ( 30 ) and glucose ( 50 ) and urine microscopy showed 109 rbc and 12 wbc . two sets of blood culture and urine culture were done prior to starting antibiotics which showed no growth after 5 days of incubation . ct scan abdomen done at presentation showed numerous ill defined lesions in the liver which were new from the ct scan done 3 weeks before for evaluation of renal colic ( figure 1 ) . the study redemonstrated the staghorn calculus with no evidence of obstruction , no radiographic evidence of pyelonephritis or renal abscess . patient received 2 days of pressor support with norepinephrine drip , following which his blood pressure improved to a map over 70 mmhg , however he continued to have intermittent episodes of hypotension which were managed with frequent boluses of 1000 to 500 ml of 0.9% ns . interestingly , on day 5 of admission , patient developed increased shortness of breath and became hypoxic . trans - thoracic echocardiogram done at bedside showed normal ejection fraction and normal inferior vena cava . patient was diagnosed with fluid overload secondary to frequent fluid boluses and was given one dose of 20 mg i.v . lasix which led to resolution of shortness of breath . during this entire stay , he continued to have intermittent episodes of hypotension with mean arterial pressure dropping to low 60 s . colonoscopy and esophago - gastro - duo - denoscopy ( egd ) done as part of malignancy workup , showed 2 polyps which were diagnosed as tubular adenoma and thick gastric folds with chronic gastritis on histopathology respectively . a liver biopsy was planned after improvement in his overall condition however on day 9 of the hospitalization patient declined the procedure and requested a break from the hospital . liver biopsy was deferred for a later date and patient was discharged in a stable condition . during this admission 4 blood cultures and 3 urine cultures did not show any growth after 5 days of incubation . he was discharged with oral levofloxacin to complete a course of 14 days of antibiotics for complicated uti . three days after being discharged from hospital , patient returned to emergency room with similar complaints of acute onset weakness and fatigue and a single episode of fever for which he received a single dose of ibuprofen at home . vitals at presentation showed rectal temperature of 94.1f , bp of 84/49 mmhg , mean arterial pressure of 60 mmhg , breathing at rate of 18/min , heart rate 59/min and saturating 97% on room air . patient was readmitted to micu with a provisional diagnosis of urosepsis and was given vancomycin and piperacillin - tazobactam . blood culture and urine culture done at this time again showed no growth which could support the diagnosis of sepsis . biopsy of the liver lesions showed extensive lymphocytic and histiocytic infiltrates with abnormally large cells and positive stains for cd15 and cd30 . bone marrow biopsy also showed areas of residual trilineage hematopoesis with 40% cellularity alongwith several para - trabecular infiltrates composed of large atypical cells including reed - sternberg ( rs ) cells , in a mixed inflammatory background consisting of small lymphocytes , histiocytes , eosinophils and plasma cells ( figure 2 ) . the immuno - histochemical stains were positive for cd15 and cd30 and negative for cd45 , cd3 and cd20 . a 100 cell count showed granulocytes ( 56% ) , monocytes ( 1% ) , eosinophils ( 6% ) , erythroid precursors ( 34% ) , lymphocytes ( 2% ) and plasma cells ( 1% ) . the presence of the characteristic rs cell in a mixed inflammatory background pointed towards a diagnosis of hl . the diagnosis was further confirmed by positive immune - histo - chemical ( ihc ) stain for cd15 and cd30 along - with negative ihc stain for cd45 , cd3 and cd20 . since no pan - t antigens were missing , the possibility of a t - cell lymphoma was very low . a ct chest for staging did not show any hilar lymphadenopathy . soon after the diagnosis patient was started on chemotherapy with doxorubicin , dacarbazine , vinblastine . bleomycin was initially withheld due to unknown pulmonary function in view of patient been active smoker and was added later after pulmonary function test turned out to be normal . after completion of the 1 cycle of chemotherapy the blood pressure started improving to a map of more than 80 mmhg ( figure 3 ) . at 6 month follow up the patient continues to be free of any episode of hypotension or hypothermia .", "reported the first patient with hl who developed hypothermia and hypotension during the course of admission , prior to initiation of chemotherapy . since then 18 more cases have been reported with hypothermia as presenting feature and in 8 out of 18 patients , hypotension has also been recorded ( table 2 ) . fifteen out of 18 patients reported in literature had developed these symptoms after initiation of chemotherapy with only 3 patients presenting with hypotension prior to diagnosis . interestingly , most of the patients described with hypothermia and hypotension have been reported to have liver metastases . to date , the mechanism behind hypotension and hypothermia as isolated manifestations of hl remains unexplained . in our patient though the presentation of the patient was highly suggestive of urosepsis , numerous blood and urine cultures did not grow any microbe which could have explained the cause of sepsis . moreover treatment with vancomycin and piperacillintazobactam did not lead to improvement in the condition of the patient , essentially ruling out infectious cause and sepsis as the primary cause of hypotension . an increased random and morning cortisol level and tsh / free t4 level ruled out adrenal insufficiency and thyroid involvement respectively . a normal transthoracic echocardiogram demonstrated a normal cardiac anatomy and clinically there were no signs of heart failure . though orthostatic maneuver was not done in our patient because of his general condition , the absence of correction of hypotension with volume repletion and fluid boluses makes hypovolemia less likely . blood pressure control is governed by a complex interaction between cardiac , renal , endocrine and nervous systems . hypotension in cancer patients has long being believed to be secondary to cytokine release from increased macrophage function . the cytokines implicated in causing hypotension are interleukin ( il)-1 and il-2 , tumor necrosis factor- ( tnf- ) and interferon- ( if- ) . although the exact mechanism of tnf- causing hypotension is not clear , it is well known that administration of tnf- leads to production of nitric oxide ( no ) which is a potent vasodilator and could lead to hypotension . in addition to this , cytokines also cause endothelial damage , a mechanism which is very well defined in patients with sepsis and septic shock . in patients with sepsis infection another important association implicated in this patient is the effect of psycho - neuroendocrine hormones in mediation of no , like melatonin , which has been shown to have counter - regulatory effect on action of free radicals , especially no . we postulate from the above , that the probable cause of hypotension in this patient could be release of cytokines from the tumor especially from liver metastasis , which is an extremely vascular organ . autonomic dysfunction is a know paraneoplastic syndrome associated with hl which raises the possibility of direct infiltration of hypothalamus or pineal gland by the tumor leading to alteration in neuroendocrine hormones . the loss of inhibition of counter - regulatory effects of these hormones on cytokine regulation could result in macrophage activation and no production resulting in hypotension . our patient never took any salicylates for his fever which rules this out as a possible cause . moreover , not all patients reported were taking nsaids before presentation , making this explanation less likely . in conclusion although , further studies are needed in support of this association , we can conclude from this case that the condition responds dramatically to aggressive chemotherapy ." ]