Datasets:

xNoper

/

pubmed-sections-test

like 0

[ "high resolution transmission electron microscopy and high angle annular dark - field scanning transmission electron microscopy were employed to investigate the microstructure and the epitaxial growth of the structures . room temperature ferroelectric and ferrimagnetic domains of the heterostructures were imaged by piezoresponse force microscopy ( pfm ) and magnetic force microscopy ( mfm ) , respectively .", "pfm and mfm investigations proved that the hybrid epitaxial nanostructures show ferroelectric and magnetic order at room temperature . dielectric effects occurring after repeated switching of the polarization in large planar capacitors , comprising ferrimagnetic nife2o4 dots embedded in ferroelectric pbzr0.52ti0.48o3 matrix , were studied .", "these hybrid multiferroic structures with clean and well defined epitaxial interfaces hold promise for reliable investigations of magnetoelectric coupling between the ferrimagnetic / magnetostrictive and ferroelectric / piezoelectric phases .", "there is no conflict of interest in the present study for any of the authors ." ]

[ "malnutrition is a common and serious problem among geriatric patients , particularly for those who are diagnosed with lung cancer caused by declined functional reserve of visceral organs , decreased stability of the internal environment , and effects of acute or chronic diseases . malnutrition can lead to increased risk of surgery , decreased quality of life , increased incidence of postoperative complications , increased fatality rate , and decreased survival rate among elderly lung cancer inpatients.1,2 nutrition support has also been reported to improve the perioperative nutritional status and reduce the severity of postoperative complications in lung cancer.3 in the people s republic of china , the number of elderly lung cancer inpatients is increasing at a rapid rate ; thus , there is a great need to develop a tool that can accurately and effectively assess the nutritional status of these patients . the mini - nutritional assessment ( mna ) is a tool that is widely used in the usa and europe to evaluate patients nutritional status . this study examines the use of the mna and short - form mna ( mna - sf ) ( with a revised scoring system to better suit the elderly chinese population5 ) in assessing the nutritional status of elderly chinese lung cancer inpatients prior to scheduled surgery .", "a total of 180 elderly chinese lung cancer inpatients ( 120 men and 60 women ) aged 60 and older were randomly selected from the tianjin medical university cancer institute and hospital between june 2010 and july 2011 . the original mna and mna - sf scoring systems developed by guigoz4 were revised to account for differences in height , weight , and dietary behaviors between asian and western populations . for the present study , guigoz s cutoff point of < 17 for malnutrition was changed to < 19 , thereby modifying the overall scoring system for assessing patients nutritional status ( maximum score = 30 ) , thus : a score 24 would indicate that a patient was well nourished , a score in the range 1923 would indicate that a patient was at risk of malnutrition , and a score < 19 would indicate that a patient was malnourished.5 in addition , the body mass index ( bmi ) ( kg / m2 ) ranges were adjusted to align with the following scores : < 18.50 kg / m = 0 ( vs < 19.00 kg / m = 0 ) , 18.5021.25 kg / m = 1 ( vs 19.0021.00 kg / m = 1 ) , 21.2524.00 kg / m = 2 ( vs 21.0023.00 kg / m = 2 ) , > 24.00 kg / m = 3 ( vs > 23.00 kg / m = 3 ) . finally , in assessing dietary behaviors , cheese , which is infrequently consumed by the chinese population , was replaced with soy and peanut milk . the maximum score for the mna - sf is 14 , where a score of 12 or more reflects a well - nourished nutritional status . patients demographic data , including age , sex , and smoking history ( eg , date started smoking , number of cigarettes smoked per day , date ceased smoking ) , were collected by clinically trained nurses . anthropometric parameters and biochemical markers were determined based on previous research.5 biochemical markers were provided by clinical laboratories at the tianjin medical university cancer institute and hospital , and reference values of biochemical markers were modified to assess the nutritional status of hospitalized patients . all protocols used in this study were approved by the tianjin cancer institute and hospital . all nurses and patients participating in this study were informed about the objectives of the study and signed an informed consent document prior to participating . spss ( v 17.0 ; ibm , armonk , new york , ny , usa ) software was used to conduct all statistical analyses . means , standard deviations , cross tabulation , and frequency tables were used as descriptive statistics . analysis of variance for normally distributed dates and nonparametric methods , such as the wilcoxon two - sample test and the kruskal - wallis test were used to make statistical comparisons .", "a total of 180 elderly chinese lung cancer inpatients ( 120 men and 60 women ) aged 60 and older were randomly selected from the tianjin medical university cancer institute and hospital between june 2010 and july 2011 .", "the original mna and mna - sf scoring systems developed by guigoz4 were revised to account for differences in height , weight , and dietary behaviors between asian and western populations . for the present study , guigoz s cutoff point of < 17 for malnutrition was changed to < 19 , thereby modifying the overall scoring system for assessing patients nutritional status ( maximum score = 30 ) , thus : a score 24 would indicate that a patient was well nourished , a score in the range 1923 would indicate that a patient was at risk of malnutrition , and a score < 19 would indicate that a patient was malnourished.5 in addition , the body mass index ( bmi ) ( kg / m2 ) ranges were adjusted to align with the following scores : < 18.50 kg / m = 0 ( vs < 19.00 kg / m = 0 ) , 18.5021.25 kg / m = 1 ( vs 19.0021.00 kg / m = 1 ) , 21.2524.00 kg / m = 2 ( vs 21.0023.00 kg / m = 2 ) , > 24.00 kg / m = 3 ( vs > 23.00 kg / m = 3 ) . finally , in assessing dietary behaviors , cheese , which is infrequently consumed by the chinese population , was replaced with soy and peanut milk . the maximum score for the mna - sf is 14 , where a score of 12 or more reflects a well - nourished nutritional status .", "patients demographic data , including age , sex , and smoking history ( eg , date started smoking , number of cigarettes smoked per day , date ceased smoking ) , were collected by clinically trained nurses . anthropometric parameters and biochemical markers were determined based on previous research.5 biochemical markers were provided by clinical laboratories at the tianjin medical university cancer institute and hospital , and reference values of biochemical markers were modified to assess the nutritional status of hospitalized patients .", "all protocols used in this study were approved by the tianjin cancer institute and hospital . all nurses and patients participating in this study were informed about the objectives of the study and signed an informed consent document prior to participating .", "spss ( v 17.0 ; ibm , armonk , new york , ny , usa ) software was used to conduct all statistical analyses . means , standard deviations , cross tabulation , and frequency tables were used as descriptive statistics . analysis of variance for normally distributed dates and nonparametric methods , such as the wilcoxon two - sample test and the kruskal - wallis test were used to make statistical comparisons .", "average age of the 180 sample patients was 67.3 5.0 years , with a range of 60~85 years . across all patients assessed 9% ( n = 17 ) were malnourished ( mna score < 19 ) , 33% ( n = 59 ) were at risk of malnutrition ( mna score 1923 ) , and 58% ( n = 104 ) were well nourished ( mna score 24 ) . average mna - sf score was 11.5 2.3 with a range of 4 to 15 . among all patients assessed 4% ( n = 7 ) had a bmi of greater than 30 kg / m and 7% ( n = 13 ) had a bmi of less than 20 kg / m . to measure the criterion - related validity of the mna , significant correlations were found between bmi and mna scores ( p = 0.000 ) ; mna scores of well - nourished at risk of malnutrition , and malnourished patients ( p < 0.001 ) ; the bmi of well - nourished and malnourished patients ( p < 0.05 ) ; and the calf circumference ( cc ) of well - nourished and at risk of malnutrition patients with malnourished patients ( p < 0.05 ) . reliability was measured as homogeneity using cronbach s coefficient and item - to - total score correlations . significant correlations between total mna score and mna questions were found for all questions with the exception of four related to neuropsychological problems , independence , skin problems , and number of meals eaten per day . for example , declined food intake was strongly correlated with weight loss during the last 3 months ( r = 0.538 ) , self - perceived nutritional status ( r = 0.485 ) , and self - perceived health status ( r = 0.482 ) . there was also a strong correlation between self - perceived nutritional status and self - perceived health status . in contrast , no significant correlations were linked to skin problems , number of meals eaten per day , and neuropsychological problems . mna questions that had a high number of an assigned score of 0 provided key insights : 99% ( n = 178 ) of patients could consume their food independently , 44% ( 80 ) suffered psychological stress , 26% ( 46 ) consumed low amounts of protein each day , 25% ( 45 ) had a cc < 31 cm , 15% ( 27 ) drank fewer than three cups of water per day , and 13% ( 24 ) consumed fewer than three different types of fruits and vegetables per day . patients who were well nourished , at risk of malnutrition , and malnourished differed significantly in their responses to anthropometrics , and global , diet , and subjective assessments ( table 3 ) . this suggests that all four aspects of the mna contribute to the total mna score and the nutritional status of the patients .", "average age of the 180 sample patients was 67.3 5.0 years , with a range of 60~85 years . across all patients assessed 9% ( n = 17 ) were malnourished ( mna score < 19 ) , 33% ( n = 59 ) were at risk of malnutrition ( mna score 1923 ) , and 58% ( n = 104 ) were well nourished ( mna score 24 ) . average mna - sf score was 11.5 2.3 with a range of 4 to 15 . among all patients assessed 4% ( n = 7 ) had a bmi of greater than 30 kg / m and 7% ( n = 13 ) had a bmi of less than 20 kg / m . to measure the criterion - related validity of the mna , significant correlations were found between bmi and mna scores ( p = 0.000 ) ; mna scores of well - nourished at risk of malnutrition , and malnourished patients ( p < 0.001 ) ; the bmi of well - nourished and malnourished patients ( p < 0.05 ) ; and the calf circumference ( cc ) of well - nourished and at risk of malnutrition patients with malnourished patients ( p < 0.05 ) .", "reliability was measured as homogeneity using cronbach s coefficient and item - to - total score correlations . significant correlations between total mna score and mna questions were found for all questions with the exception of four related to neuropsychological problems , independence , skin problems , and number of meals eaten per day .", "for example , declined food intake was strongly correlated with weight loss during the last 3 months ( r = 0.538 ) , self - perceived nutritional status ( r = 0.485 ) , and self - perceived health status ( r = 0.482 ) . there was also a strong correlation between self - perceived nutritional status and self - perceived health status . in contrast , no significant correlations were linked to skin problems , number of meals eaten per day , and neuropsychological problems .", "mna questions that had a high number of an assigned score of 0 provided key insights : 99% ( n = 178 ) of patients could consume their food independently , 44% ( 80 ) suffered psychological stress , 26% ( 46 ) consumed low amounts of protein each day , 25% ( 45 ) had a cc < 31 cm , 15% ( 27 ) drank fewer than three cups of water per day , and 13% ( 24 ) consumed fewer than three different types of fruits and vegetables per day .", "patients who were well nourished , at risk of malnutrition , and malnourished differed significantly in their responses to anthropometrics , and global , diet , and subjective assessments ( table 3 ) . this suggests that all four aspects of the mna contribute to the total mna score and the nutritional status of the patients .", "published findings on the nutritional status of lung cancer inpatients vary greatly in the medical literature . some studies conclude that there is a high incidence of malnutrition among lung cancer inpatients . for example , hollaus et al6 and chauhan et al7 found that 10%20% and 30% of patients suffered from malnutrition , respectively . in contrast , other studies have shown that malnutrition rates are overestimated in lung cancer patients . jagoe et al reported that severe malnutrition was uncommon among lung cancer patients who were referred for surgery.8 however , in the present study , the incidence rate of malnutrition was found to be 42% among 180 lung cancer inpatients who were referred for surgery . the malnutrition or cachexia in these patients may have been caused by a slowdown in metabolism due to decreased organic functions , or absorption of the body s nutrients by malignant tumors before metastasis.9 this study also showed that there were significant correlations between mna score and bmi ( p = 0.000 ) ; the mna scores of well - nourished , at risk of malnutrition , and malnourished patients ( p < 0.001 ) ; the bmi of well - nourished and malnourished patients ( p < 0.05 ) ; and the cc of well - nourished and at - risk of malnutrition patients with malnourished patients ( p < 0.05 ) . secondly , all but four mna questions ( neuropsychological problems , independence , skin problems , and number of meals eaten per day ) were significantly correlated to total mna score . this shows that the mna is a reliable instrument ( cronbach s coefficient = 0.698 ) for nutritional assessment . in addition , well - nourished , at risk of malnutrition , and malnourished patients differed significantly in their responses to mna subgroup questions related to anthropometrics , and global , diet , and subjective assessments ( table 3 ) . all these findings are supported by existing studies , suggesting that the mna ( with a revised scoring system to better suit the elderly chinese population ) is a valid and reliable diagnostic tool with which to assess the nutritional status of elderly chinese lung cancer inpatients.5,10 no significant correlations were found between total mna score and mna questions related to neuropsychological problems and independence ( table 2 ) . studies conducted by soini et al10 also found that independence was correlated with total mna score , as nurses or family members helped feed patients . however , neuropsychological problems were strongly correlated to total mna score in soini and murphy s studies.10,11 the differences between these findings and those of the present study may be due to the fact that , in our study , 99% ( n = 178 ) of patients could consume their food independently . additionally , in our study , preliminary evaluations were carried out before surgery , and some patients with neuropsychological problems may have been transferred to receive neuropsychological treatment instead of undergoing surgery . as such , the lack of cooperation from patients with neuropsychological problems may increase their risk of postoperative complications and death .", "the mna is a valid and reliable diagnostic tool that can be used to identify elderly lung cancer inpatients who are malnourished , as well as those who are at risk for malnutrition . the high incidence rates of preoperative malnutrition and risk of malnutrition among elderly chinese lung cancer inpatients highlights the need for further investigations to determine the relationship between nutritional status and prognosis of these patients ." ]

[ "population aging can be considered as the most evident and dynamic aspect of modern demography , influencing the economy and public health in a significant way . the world has experienced a modest increase in the population above 60 years of age over the last six decades from 8% to 10% . however , there were 204 million elderly in the world . in 1998 , this number more than doubled , totaling 579 million ; in 2011 , the figure reached was 893 million.1 over the next four decades , experts expect this age group to grow to 22% of the world population , which would correspond to 2.4 billion of elderly by the middle of this century.2 \n in this sense , many elders will likely face health problems inherent to aging , as well as challenges in maintaining their independence . however , the elderly can stay healthy and active in society in an independent and sustainable manner,3 and the work of professionals and researchers in the multidisciplinary health field that serve this group is fundamental in achieving this state . at the same time , it is essential that the government create and apply public policies that enable and sustain educational and awareness actions regarding people qualification and the fulfillment of the population basic needs . as for the health of the elderly , changes in body balance ( postural instability ) have received much attention , as it is one of the symptoms that most affect their lives . body balance is the result of a harmonious interaction among different systems in the human body : vestibular ( inner ear posterior labyrinth ) , visual , and somatic - sensorial ( cutaneous , muscular , and articular receptors ) systems . this interaction is accomplished through processes of the neural system , which organizes and executes a rapid response by means of the musculoskeletal system.4 \n the aging process is associated with a decrease in the ability to keep balance , especially in situations where responses of the balance keeping systems to unexpected disturbances during free moving and the avoidance of obstacles are necessary . sensorial , motor , and adaptive balance components become vulnerable as degenerative , infectious , or damaging processes accumulate . although small alterations in any of the systems that comprise balance keeping do not result in significant disturbances , the involvement of multiple components may lead to severe deficits in postural stability conservation.5 \n 6 \n the aging process may alter the dynamic posture keeping system . this condition is a contributing factor to falls among the elderly , albeit not the main cause.7 impairment of the vestibular system is also believed to be a factor that leads the elderly to lose balance , through the aging process of this systes organs.8 \n alterations to postural stability are also followed by dizziness . this can be defined as any sensation of change in the body balance and can be rotational ( vertigo ) or non - rotational ( unbalance , oscillation , vacillation , etc . ) . both types may or may not be caused by specific vestibular system disturbances.9 \n the presence of dizziness may cause falls , which are associated to the main cause of death in the elderly group . some authors also associate dizziness to partial or full inability to perform social , professional , family activities , in addition to causing physical and psychological damage , such as loss of self - confidence , depression , deficit in concentration , and performance , thus negatively interfering in the quality of life.10 \n 11 however , it is still difficult to know if psychological problems pre - exist or are a result of vestibular complications.11 \n balance disturbances and anxiety disorders share central neural circuits involving monoaminergic components , this being the reason why anxiety is often associated with balance alterations . these neural circuits concentrate in a parabrachial nucleus network ( vestibular system and visceral information processing convergence point ) , also involving avoidance , anxiety , and fear symptoms.12 physical insecurity triggered by dizziness and unbalance lead to psychological insecurity , irritability , loss of self - confidence , anxiety , depression or panic , a sense of being out of reality and depersonalization.13 \n depression which may be caused or made worse by body imbalance is a common condition in seniors . furthermore , it is associated to higher risk of morbidity and mortality , increase in health services usage , negligence in self - care , and higher risk of suicide.14 the main symptoms of depression are depressed mood and loss of interest or lack of pleasure in almost all activities , being characterized as a psychiatric syndrome . in the elderly , its manifestation occurs in a heterogeneous form regarding both the presentation aspects of its etiology and its treatment.15 \n studies relate the involvement in physical activities with a better general health condition and lesser occurrence of depression and falls in the elderly.16 \n 17 physical activity is capable of improving mental and clinical conditions of depressed elderly . this is because physical activity stimulates cognitive , memory , and concentration functions , in addition to raising self - esteem , improving quality of life,18 and helping decrease scores indicative of anxiety and depression,19 favoring daily activities and promoting functional independence.20 furthermore , the physically active elderly show improvement of dizziness and vertigo symptoms,21 \n 22 \n 23 decreasing , as a result , the risk of falls and associated comorbidities . thus , the objective of this work is to verify the correlation between physical exercise , dizziness , probability of falls , and symptoms of depression in a group of middle - aged and elderly group .", "this is a transversal and observational study with approval from the institutios ethical committee ( record n 216292011 ) . the sample comprised adult and elderly individuals of both sexes who took part in university extension projects . the inclusion factors for subjects were non - institutionalized elderly with no history of neurological or cognitive alterations , who voluntarily accepted to take part in the research and signed the informed consent form ( icf ) . assessment procedures included a medical history prepared for this study ; the abridged version of the geriatric depression scale ( gds ) ; and anterior functional reach test . the medical history assessment included questions on individuals socio - demographic and health ( age , gender , presence of diseases , treatment used ) , as well as questions about their practice of physical exercises ( frequency , time of practice , type of physical exercise ) . as for assessing the results of the geriatric depression scale , each answer indicating depression scored one point . scores below five points indicated lack of depressive symptoms ; 6 to 10 points indicated mild / moderate depressive symptoms ; and 11 to 15 points meant severe depressive symptoms.24 \n for the functional range test was initially placed a tape measure on the wall , parallel to the floor , at the height of the acromion of each individual . the following were instructed to position themselves parallel to the wall , without lean on to it , with the parallels and bare feet in a comfortable position . the upper limb was positioned with bent shoulders at 90 , extended elbows , wrists in a neutral , flat hand position . as a result , it was requested that incline forward as much as possible , hold for three seconds without taking the heels off the floor . taking as the third metacarpal of the individual parameter was recorded in centimeters anterior displacement on the tape . displacements smaller than 15.2 cm indicate the risk of falls four times higher compared to those who reached more than 25.4 cm , or is highly likely to falls . measures between 15.2 and 25.4 cm has an average probability of falls ( twice as likely to fall than those who reach values greater than 25.4 cm ) . values greater than 25.4 cm indicate low probability of falls.25 \n the authors analyzed the data using descriptive statistics through measures of central tendency ( mean and median ) and variability ( standard deviation and inner quartile ranges ) , as well as absolute and relative distribution ( n - % ) . the symmetric continuous distribution was evaluated by the kolmogorov - smirnov test . for the bivariate analysis between qualitative variables , the authors used the pearson qui - square test ( ) and continuity correction , which compares between observed ( real ) and expected frequencies . in contingency tables in which at least 25% of cell ( quads ) values presented expected frequency below five , they used fishes exact test . for continuous variables , when comparing two independent groups , the applied test was students t - test or , its non - parametric equivalent , the mann whitney test . multivariate analysis was accomplished through non - conditional binary logistic regression , by employing regressive procedures to test the hypotheses of association between cognitive decline and co - variables defined by the bivariate analysis ( p 0.250 ) , by obtaining the adjusted odds ratio ( or ) . data received statistical treatment via spss 17.0 software ( statistical package for social sciences for windows ) , adopting a significance level ( ) of 5% for the decision - making criteria .", "the sample comprised of 90 individuals , aged 69.3 ( 6.8 ) in average , with minimum age of 59 years and maximum age of 84 years . the majority of investigated individuals was in the age group between 65 and 74 years ( 38.9% ) . results presented as n ( % ) , with percentage obtained as based on total valid cases ; : nr = 5 ( 2.5% ) . the majority of individuals interviewed ( 65.8% ) did not show depressive symptoms . regarding the anterior functional reach test , the majority of evaluated individuals indeed showed low probability of fall occurrence , with an average score of 28.2 cm ( sd = 9.2 ) points , varying from 0 to 44.5 cm ( table 2 ) . results presented as n ( % ) , with percentage obtained as based on total valid cases , : nr = 11 ( 12.2% ) ; : nr = 8 ( 8.8% ) . in the analyses done on dizziness complaints , the authors verified a significant association with age group ( p < 0.05 ) , with the elderly aged 75 years or more presenting a higher probability of feeling dizziness , whereas the group aged between 65 and 74 years , this association was not verified ( table 3 ) . percentages obtained as based on total of each dizziness category ; : pearson chi - square test with continuity correction ; : t - student test for independent groups ; : pearson chi - square test ; : fisher 's exact test through monte carlo simulation ; * statistically significant test at 5% ; * * statistically significant test at 1% . moreover , it has been observed statistically significant association between the occurrence of dizziness and the presence of light / moderate depressive symptoms ( p < 0.01 ) , as well as between the occurrence of dizziness and the average probability of falls ( p < 0.001 ) . in terms of the association between the occurrence of dizziness and the results of the anterior functional reach test , the average in centimeters for the anterior reach ( 25.3 5.4 ) of elderly with dizziness showed to be significantly less when compared with the average of the group without dizziness complaints ( 30.1 10.6 ) ( p < 0.01 ) . when comparing the occurrence of dizziness with gender , age , practice of physical exercise , and time of practice , we identified an independent relation , evidencing that dizziness is unrelated to any of these factors in the studied group . in the group of individuals that did not practice physical exercise , there was an association between the occurrence of dizziness and light / moderate depressive symptoms ( p < 0.001 ) . however , in the same analysis done with the group that practiced some physical activity , the association between dizziness and depressive symptoms was not statistically significant ( p > 0.05 ) ( table 4 ) . another evaluation confirms the importance of physical exercise . keeping the remaining variation factors not considered in the analysis ( gender , age ) constant , the group that practices physical exercise was less prone to dizziness and depressive symptoms ( table 4 ) . we looked for and identified the variables that could respond in a more trustworthy form to the occurrence of dizziness . we performed the logistic regression analysis with an adjustment to minimize the number of explanatory variables employed and maximize model precision , through the backward model , to maximize the explanatory power of the study factor . through a model defined as saturated , we listed all variables with minimum significance level below 0.25 through bivariate analysis ( table 3 ) as possible preceding factors for the presence of dizziness . they are the following : gender , age , age group , physical activity , gds score , dislocation in the anterior functional reach test , and balance . in this model , the variables for gender and age pointed out an independent relation to the occurrence of dizziness . according to the adjusted logistic regression model , the following were significant predictive factors for the occurrence of dizziness : non - practice of physical exercise , classifications of light / moderate depressive symptoms , and dislocation in the anterior functional reach test . results described in table 5 show that the elderly who do not practice physical exercise have 2.2 times higher risk of presenting dizziness than the group that practices some physical exercise . in relation to depressive symptoms , the significant risk of presenting dizziness occurred in the light / moderate degree , indicating that the elderly included in this classification had 4.5 times more chance of presenting dizziness than the group with absence of depressive symptoms . model parameters : pseudo - r = 0.432 ; -2 log likelihood = 80.208 ; hosmer and lemeshow ( p = 0.998 ) ; pearson 's chi - square ( = 9272 ; p = 0.099 ) ; nagelkerke ( r : 0.460 ) ; correct classification : 74.4% ( dizziness : no = 78.7% ; yes = 67.7% ) . as the number of elderly with severe depressive symptoms was very low , the light / moderate and serious groups were merged , by classifying the answer for symptoms as presence or absence . over this new variable , we once more calculated the risk of presence of depressive symptoms associated to dizziness , estimated at 2.1 times that of the group with absence of this symptom . the results verified that the group with medium probability of falls as the result for the anterior functional reach test had 4.0 times more chances of occurrence of dizziness than the group with low probability of falls . when age was kept constant , results indicated that the non - practice of physical exercise , the presence of depressive symptoms , and the result of the anterior functional reach test ( indicating medium probability of falls ) are factors associated to the occurrence of dizziness in the investigated sample .", "in the sample of this study , more than 60% of the individuals affirmed to not practice physical exercise , confirming other similar studies . the ministry of health of brazil26 made a survey , and verified that 53.7% of elderly men and 58.3% of elderly women were inactive . similar results were found in other study concerning the level of physical activity and its relationship with the environment ( specifically , safety ) with 1,656 elderly from florianpolis.27 by using similar parameters , pucci , reis , rech and hallal28 classified the majority of the individuals of their study as insufficiently active in leisure or walking activities . in this study , current studies highlight the prevalence of dizziness reports among the elderly population.29 \n 30 \n 31 \n 32 approximately one in every five seniors currently presents dizziness or imbalance.29 in our research , 40% of the elderly reported sensation of dizziness . this finding is very similar to other studies done in brazil , in which the authors verified that the prevalence of dizziness in the elderly is substantial , having observed dizziness complaints from 45% of 391 elderly over 65 years of age interviewed.33 \n another study interviewed 516 elderly people , and confirmed self - reported dizziness in 42% of them.31 thus , dizziness is a common problem for the elderly population,11 \n 34 \n 35 as these individuals show a decrease in visual acuity during aging , and loss of balance due to the reduction of ciliated cells and vestibular neurons . this results in loss of functions from two important components responsible for keeping balance.36 furthermore , with age , the central nervous system capabilities become impaired , affecting the processing of vestibular , visual , and proprioceptive signals responsible for maintenance of body balance . age also reduces capacity of modifications of the adaptive reflexes , may be responsible for the occurrence of vertigo and/or dizziness in the geriatric population.35 \n the data from the studied sample evidenced that 33.7% of the elderly presented depressive symptoms . this prevalence is higher than that described by other authors,37 who report prevalence of 26.7% of depressive symptoms in a sample of elderly people residing in an urban zone . in turn , study reported depressive symptoms in 31% of the elderly evaluated , by also using the gds scale in active elderly who were part of a conviviality group , i.e. , a similar sample to the one evaluated in this study . additionally , the cited authors verified that 4% of the evaluated elderly presented severe depressive symptoms , which was also similar to the obtained data.38 \n regarding anterior functional reach results , the average obtained was 28.2 9.2 cm . results were higher than those observed by previous studies,39 \n 40 and lower than those obtained by another study.41 values found were similar to those observed in brazil,42 which also evaluated a sample of adult and elderly people . the sample of elderly people in the age group between 70 and 87 years of age presented functional reach values between 29.75 ( men ) and 27.13 ( women ) . variations in the results of these studies can be explained through different factors , such as fall history , freight , strength , and flexibility of upper and lower limbs.42 \n this research verified a stronger presence of dizziness in the age group above 75 years ( 41.7% ) , a significant association ( p = 0.028 ) when compared with remaining age groups . such a finding is similar to that of the research with 1,273 elderly between 60 and 96 years of age , which verified reports of dizziness in 23.6% of all elderly evaluated . in this study , 17.8% of them were under 80 and 31% were over 80 years old.30 another longitudinal research with 620 elderly people verified that dizziness was a factor that depended on age , with prevalence of 27% in the elderly under 70 , and over 54% in the group with 90 years of age or more . among the elderly that mentioned dizziness , 68.2% perceived this symptom daily or weekly.43 the bigger prevalence of dizziness in the age group above 75 years of age could be due to the generalized deterioration of health in older people44 or multifactor conditions , both medical and functional.43 \n it is worth mentioning that the presence of dizziness is directly related to the presence of falls in the elderly population;30 both conditions are considered geriatric syndromes that occur concomitantly to other harms to multiple systems of the body.5 this worsens with age . the elderly who suffer falls can have fractures as a consequence , which might require longer periods in bed . such condition is responsible for 70% of deaths resulting from accidents in individuals over 75 years in age.45 \n further to this , there was no significant difference when comparing the presence of dizziness complaints among the elderly who practiced physical exercise whith those who did not . these data were different from the expectations of the authors and the findings of ruwer et al,35 because , according to these authors , the complaint of dizziness is less prevalent in the elderly that practice physical exercise . nevertheless , with the adjusted logistic regression , it is possible to verify that the individuals who do not practice physical exercise are 2.2 times more likely of feeling dizzy than physically active individuals are . this result confirms studies that compared elderly people with and without dizziness and observed that those without complaints of dizziness were engaged in physical activity.46 these authors also verified that there was a relation between dizziness and depression , which attest to the data from our study . the research verified a significant association between light to moderate depressive symptoms and 4.5-fold increase in the risk of feeling dizziness . regarding the anterior functional reach test , this research verified a significant association between the probability of falls and reports of dizziness . the elderly with medium probability of falling are four times more likely to feel dizziness than the elderly with low probability of falls , as described in another study.47 \n the studies indicate that active elderly people are less prone to depression than the sedentary elderly.19 \n 48 \n 49 physical exercises help to reduce depression , aside from helping in its prevention . physical activity relates to less frequent mood disorders and may even help release some neurotransmitters , such as noradrenalin and serotonin.50 \n 51 \n studies indicate that elderly people who practice regular physical activity mention less depressive symptoms than non - active or sedentary elderly people . analysis of social skills , social support , life quality and depression of elderly people in an extension project , family contexts and asylums indicated that the depressive symptom was present in 0% of practicing elderly people compare to 30% of the elderly who did not participate in the project . in the asylum , in turn , this percentage increased 40%.52 in other study about the intensity and prevalence of depressive symptoms in elderly women participating in an extension project , it was verified an absence of depressive symptoms in 80.6% of the sample.53 another study evaluated the effect of a program of aerobic physical exercise in the intensity of the ventilator threshold over depression and anxiety and life quality of healthy elderly people divided into a control and a experimental group . the elderly in the experimental group had a reduction in the scores of depression and anxiety and an increase in life quality , while in the control group no changes were observed.51 \n in the research on the freight of falling and its relation with balance and mobility tests , there was a moderate correlation.40 authors state that balance and mobility enable the stability necessary to maintain a standing position , for instance . therefore , maintaining adequate levels of such capabilities reduces the risk of falls , which are directly related to level of physical activity . the american college of sports medicine54 mentions that the level of physical activity is inversely related to the number of limitations in the elderly . brazilian authors analyzed the relation between health conditions , incidence of falls , and level of physical activity in 256 elderly people . results indicated an association between the level of physical activity and the incidence of falls and health conditions . in other words , the more frequent the practice of physical activity the less the occurrence of falls . muscular weakness , reduction in articular mobility , degraded synergy , programming mechanisms , and motor control difficulties are the variables present in low levels of physical activity , predisposing to falls in the elderly.55 \n", "the results of this study indicated the existence of an association between the practice of physical exercise , dizziness , probability of falls , and depressive symptoms in a group of non - institutionalized middle aged adults and elderly people , evidencing that physical activity is a beneficial factor for the aging population ." ]

[ "we measured the differences in stiffness between extrafloral nectaries of v. faba and the tissue that surrounds them . we mounted 20 stipules from 20 , 18-day - old plants on adhesive tape that was attached ( sticky side up ) to the surface of a piece of flat styrofoam . we did a penetrometer test to measure the initial modulus of rigidity of the spot being tested , using a texture analyzer ( ta.xt2i , stable micro systems , surrey , uk ) fitted with a 10 stainless steel cone moving at 0.5 mm / s . in each stipule , one measurement was done in the center of the extrafloral nectary and 3 measurements were done in random locations on the stipule . for each stipule , an average stipule stiffness was calculated from these 3 measurements and this value was compared with the measured stiffness of the extrafloral nectary on that stipule .", "", "" ]

[ "health systems based on primary health care ( phc ) distribute health care more equitably , are more cost effective and have better overall health outcomes and impact than health systems based on specialist care ( 1 ) . this is the foundation of the health for all concept of alma - ata , adopted by the world health organization ( who ) in 1978 ( 2 ) and reiterated in the world health report 2008 ( 3 ) . worldwide , authorities have recognized that the health and well - being of a population is highly dependent on a quality phc system that is equitable , easily accessible and affordable for all members of the community ( 4 ) and that emphasizes universal coverage ( 5 ) . the concept of the postgraduate - trained family physician qualified to deliver equitable , high - quality phc closer to the community is now accepted in many countries around the world . however , in sub - saharan africa , family medicine is still a relatively new concept . in this article , we analyse the development of family medicine in anglophone sub - saharan africa in the recent years based on the experiences of the primafamed ( primary health care and family medicine education ) project ( 6 ) . lower - resource countries in sub - saharan africa face enormous health challenges and pervasive poverty . despite the work of governments and nongovernmental organizations ( ngos ) , the majority of people still do not have easy access to affordable quality health care . the inverse care law ( 7 ) , noting that the fewest health - care professionals are found where they are needed the most and vice versa , is still very much applicable in most african countries . the poor are not only more prone to illnesses but are also unable to cope with diseases because health care is hard to access . with continuous population growth and a rather slow economic development , the number of people living in poverty in sub - saharan africa has also increased , with 20.6% living on less than us$1.25 a day in 2008 ( 8) . it is the first level of contact of a continuing health - care process bringing health care as close as possible to where people live and work ( 9 ) . phc responds to the immense challenges that african countries are facing in their health systems by providing accessible , high - quality services that offer comprehensive and continuous care ( preventive , curative , rehabilitative and palliative ) at the local level , through interdisciplinary teams integrating vertical disease - oriented programmes . family physicians together with phc nurses ( and in some countries , mid - level care workers ) act as the clinical practitioners of the phc team . in 2009 , the 62nd world health assembly urged its member states to train and retain adequate numbers of health workers , including family physicians , and to encourage the implementation of vertical programmes in the context of integrated phc ( 10 ) . in 1968 , the university of pretoria was the first university in south africa to start training specialized phc physicians , now referred to as african family physicians ( 11 ) . this was followed by the other seven health science faculties in south africa . in 1997 , these eight departments of family medicine formed a network for communication and consultation , famec ( family medicine educational consortium ) , to share and exchange expertise , form a core curriculum and standardize examinations and develop appropriate assessment systems ( 12 ) . in august 2007 , the concept of the african family physician in other anglophone african countries is even more recent . only in the 21st century did universities in anglophone countries in sub - saharan africa start family medicine training programmes , and the recently graduated african family physicians are beginning to find their place in the health systems of their respective countries . family medicine departments are struggling for recognition as health systems are still dominated by centralized specialist services and vertical disease - oriented approaches . several countries , such as namibia and botswana , did not have medical schools until very recently ( 14 ) . furthermore , many countries , such as the democratic republic of congo ( dr congo ) , are emerging from conflict and need to rebuild both state and infrastructure . at the wonca ( world organisation of family doctors ) africa conference in 2009 , this consensus statement defined the contribution of family medicine to equity , quality and phc within an african context , as well as the role and training requirements of the african family physician ( 15 ) . due to the low number of trained doctors per capita and the high burden of disease , african family physicians work in their specific context , mainly in district hospitals with outreach to health centres , in phc teams that address the problems of the community in a comprehensive , holistic and patient - centred way whereby specific skills like surgery and district management often are essential due to the lack of other specialists . the consensus illustrates the ownership of the development of family medicine by african universities , one of the key points from the paris declaration ( 2005 ) and the accra agenda for action ( 2008 ) ( 16 ) .", "lower - resource countries in sub - saharan africa face enormous health challenges and pervasive poverty . despite the work of governments and nongovernmental organizations ( ngos ) , the majority of people still do not have easy access to affordable quality health care . the inverse care law ( 7 ) , noting that the fewest health - care professionals are found where they are needed the most and vice versa , is still very much applicable in most african countries . the poor are not only more prone to illnesses but are also unable to cope with diseases because health care is hard to access . with continuous population growth and a rather slow economic development , the number of people living in poverty in sub - saharan africa has also increased , with 20.6% living on less than us$1.25 a day in 2008 ( 8) . it is the first level of contact of a continuing health - care process bringing health care as close as possible to where people live and work ( 9 ) . phc responds to the immense challenges that african countries are facing in their health systems by providing accessible , high - quality services that offer comprehensive and continuous care ( preventive , curative , rehabilitative and palliative ) at the local level , through interdisciplinary teams integrating vertical disease - oriented programmes . family physicians together with phc nurses ( and in some countries , mid - level care workers ) act as the clinical practitioners of the phc team . in 2009 , the 62nd world health assembly urged its member states to train and retain adequate numbers of health workers , including family physicians , and to encourage the implementation of vertical programmes in the context of integrated phc ( 10 ) . in 1968 , the university of pretoria was the first university in south africa to start training specialized phc physicians , now referred to as african family physicians ( 11 ) . this was followed by the other seven health science faculties in south africa . in 1997 , these eight departments of family medicine formed a network for communication and consultation , famec ( family medicine educational consortium ) , to share and exchange expertise , form a core curriculum and standardize examinations and develop appropriate assessment systems ( 12 ) . in august 2007 , the concept of the african family physician in other anglophone african countries is even more recent . only in the 21st century did universities in anglophone countries in sub - saharan africa start family medicine training programmes , and the recently graduated african family physicians are beginning to find their place in the health systems of their respective countries . family medicine departments are struggling for recognition as health systems are still dominated by centralized specialist services and vertical disease - oriented approaches . several countries , such as namibia and botswana , did not have medical schools until very recently ( 14 ) . furthermore , many countries , such as the democratic republic of congo ( dr congo ) , are emerging from conflict and need to rebuild both state and infrastructure . at the wonca ( world organisation of family doctors ) africa conference in 2009 , this consensus statement defined the contribution of family medicine to equity , quality and phc within an african context , as well as the role and training requirements of the african family physician ( 15 ) . due to the low number of trained doctors per capita and the high burden of disease , african family physicians work in their specific context , mainly in district hospitals with outreach to health centres , in phc teams that address the problems of the community in a comprehensive , holistic and patient - centred way whereby specific skills like surgery and district management often are essential due to the lack of other specialists . the consensus illustrates the ownership of the development of family medicine by african universities , one of the key points from the paris declaration ( 2005 ) and the accra agenda for action ( 2008 ) ( 16 ) .", "the aim of this article is to explore the extent to which the primafamed south south cooperative project contributed to the development of family medicine in sub - saharan africa . the specific objectives are the following : the implementation of the primafamed project ; the outcomes of the primafamed project ; the development of family medicine training in sub - saharan africa from the viewpoint of the primafamed partners .", "a process analysis of the primafamed project between 2008 and 2011 is presented to discuss the implementation of the programme and the development of the network of 10 universities and associated partners in anglophone sub - saharan africa . finally , a swot analysis is detailed to explore the positive and negative dynamics that partners faced during the project . in 2007 , a call for proposals under the name edulink was launched by the secretariat of the african , caribbean and pacific ( acp ) group of states ( 17 ) . together with 10 universities in eight countries in sub - saharan africa ( sudan , ghana , nigeria , dr congo , rwanda , uganda , kenya and tanzania ) , figure 1 , the department of family medicine and phc at ghent university in belgium developed the primafamed project proposal with a focus on developing family medicine training in sub - saharan africa . the aim of the primafamed project was to establish an institutional network between new and established departments of family medicine in universities in sub - saharan africa , within a framework of south south cooperation ( 18 ) . the who world health report 2006 , working together for health , emphasized the need for phc training in the local community in order to deal with the brain drain from acp states ( 19 ) . training medical doctors in the field of family medicine , thus providing phc at the district level , responds to this call . the objectives of the primafamed project were formulated as follows : 1 . to contribute to the health of communities through accessible , responsive and quality health systems in sub - saharan countries by educating and training family physicians who provide interdisciplinary phc services , oriented towards the needs of individuals , their families and the communities in which they live develop and strengthen academic departments or units of family medicine that offer family medicine training at the undergraduate and postgraduate levels . the specific objectives were as follows : 1 . to develop a comprehensive vision and strategy , within the specific context of sub - saharan countries , that delineates the integral contribution of family medicine and the phc team to an equitable and quality phc system ; 2 . to establish a specific institutional network between departments and units of family medicine . the expected results of the primafamed project were the following : 1 . an improved institutional and administrative functioning in terms of policy , management , planning and administrative capacity building of the participating departments and units of family medicine . 2 . improved relevance of family medicine in undergraduate and postgraduate training in the regional context . the partnering universities in the primafamed project were university of goma ( dr congo ) , moi university ( kenya ) , national university of rwanda , aga khan university ( tanzania ) , university of lagos ( nigeria ) , makerere university ( uganda ) , mbarara university ( uganda ) , ahfad university for women ( sudan ) , gezira university ( sudan ) and university of ghana . the south south network connecting these 10 universities worked together with the eight departments of family medicine in south africa and accordingly formed a forum to share knowledge , experiences and resources . each of the 10 partner universities hired a local coordinator to oversee the implementation of the project , coordinate the activities and actively communicate with all partners . partners worked independently , integrating the primafamed objectives and the output for the project into the already existing structures and work plan at their universities . because african family physicians work mainly in district hospitals with outreach to the health centres , the primafamed project consequently stimulated all partners to develop training complexes ( mainly district hospitals , several of which are located in rural areas ) for family medicine residents and to support the supply of these training complexes with the needed equipment . to further strengthen family medicine residents education , training sessions by professors from south african universities and other associated primafamed partners were held . a yearly conference for partners , associates and stakeholders was organized with the goal of offering trainings , sharing ideas and experiences , and strengthening the network . at the 2008 conference in kampala , the african journal of primary health care and family medicine ( 20 ) this new open - access online journal has since published various articles related to the development of family medicine on the african continent , and researchers in the field of phc have written numerous articles on operational research and community - oriented primary care ( copc ) projects ( 21 ) . to monitor and evaluate our project , this four - level scale shows the progress that took place during the 2.5-year period in which primafamed supported the partners . the first level corresponds to the institution being at a preparatory stage in the development of a postgraduate family medicine training programme . the fourth level reflects that the institution has started a postgraduate family medicine training programme with an existing curriculum by an organized department at well - organized training complexes and , most importantly , that family medicine has been accepted by the ministry of health as a specialization and that graduated family physicians are integrated into the existing health system . undeniably , the fourth level is not the end stage because , in our opinion , the ultimate objective would be to have an equitable and high - quality phc system with a central role for family physicians . department / unit of family medicine exists or is part of other departments ( community medicine ) training complexes are under development family medicine is part of undergraduate training postgraduate training has started department / unit of family medicine exists training complexes are in place postgraduate training has started the ministry of health has accepted family medicine as a specialization and graduated family physicians are part of the health - care system adopted from the primafamed edulink acp eu project . all 10 primafamed partners made progress during the 2.5 years that the project provided funding and support ( table 1 ) . at the start of the project , all of them had a unit or department of family medicine under development or in place , yet only three had officially started postgraduate family medicine training . at the end of the project , eight had started postgraduate training , with family medicine residents located in properly equipped training hospitals . progress scale for development of the primafamed partners adopted from the primafamed edulink acp eu project . the integration of family medicine into the local health systems has been a slower process . in many countries , policymakers have adopted a somewhat conservative attitude , with health systems mainly based on hospital / specialist care and on vertical programmes , which are often stimulated by donor programmes . a critical mass of well - trained family physicians is needed to demonstrate the effectiveness of family medicine training programmes . because all but one partner universities train only a limited number of family medicine residents simultaneously due to limited capacity , reaching that critical mass takes time . however , as the example of gezira university ( sudan ) has shown , it is possible to create a large pool of well - trained family physicians who can make a difference , in a short time . in this particular situation , because there was a vital need , policymakers and local authorities worked closely together with gezira university in development of the training ( example 1 ) . in 2012 , african family physicians came together at the wonca africa conference and the primafamed network workshop in victoria falls , zimbabwe , and reaffirmed the importance of reaching that critical mass and therefore scaling up of family medicine , particularly in the african context , in which poverty is very prevalent , where rural urban gaps remain , and where many of the millennium development goals ( mdgs ) will not be reached , including those related to child survival , maternal death and accessibility to antiretroviral drugs ( 22 ) . in 2010 , all primafamed local coordinators contributed to a swot ( strengths , weaknesses , opportunities and threats ) analysis on the development of family medicine training programmes and of family medicine as a new discipline within the health systems of their countries ( box 3 ) . the main findings are presented and categorized into the following levels : local / university level , national level , regional / african level and international level . strong partnerships and collaboration with universities and professional bodies abroad is present the south african departments of family medicine have substantial experience in the family medicine training programmes : they can assist in training via south south cooperation and these cooperative steps can be seen as exemplary models and good practices the primafamed project and edulink acp - eu funding strengthens the development of family medicine training and is seen as the motor for the family medicine training development individuals working in the family medicine departments are very motivated , proactive and willing to advocate for the cause family physicians working as faculty are highly experienced and well qualified the chosen district hospitals and health centres are ready for the training programmes in several of the countries ( sudan , kenya and ghana ) , a high commitment from the ministry of health , the national council and leaders is existing family medicine is responsive to the needs of the communities , especially in the rural areas where the majority of africans live family medicine is not yet part of undergraduate medical training , therefore medical students are not exposed to the concept of family medicine and its principles poor quality of intake and recruitment of family medicine residents for the family medicine training the lack of family physicians and local teachers . many of the departments of family medicine depend on family physicians coming from non - african countries ( mainly , western europe and united states ) due to work overload , family medicine residents are continuously working in the hospital setting and have insufficient time to focus on the training in other aspects of family medicine , such as disease prevention and health promotion , community medicine , outpatient / continuity of care and research the existing health systems are still weak in several countries ; plagued by poor support , weak referral systems , poor communication , poor funding and poor coordination between health centres , district hospitals and referral hospitals dropping out of family medicine residents during the training sometimes happens in countries like dr congo because family medicine residents lose faith in their career opportunities there is a lack of didactic materials capacity is still too limited there is a lack of awareness and knowledge of family medicine by medical graduates , specialists and the community there is lack of adequate infrastructure in some countries , such as dr congo and ghana there is poor communication with policymakers and little support from the government in countries like tanzania and rwanda \n standardization of training and examinations between faculties and countries is presently not existing , although there is a strong need for accreditation and quality assurance there is insufficient financial support for the family medicine residents in postgraduate training the position of family physicians in the different health systems is unclear ( what is the career perspective of graduated family physicians ? ) there is international support for the concept of family medicine : in the world health report 2008 primary health care : now more than ever , the who advocated for the importance of moving health care out of tertiary hospitals into the community and from vertical to horizontal care , in order to respond to the needs of the community family medicine training is growing in the whole african continent , and there is support in the surrounding countries . the primafamed project has been linking these different countries , in order to fight for the cause together existing health systems in several countries are weak ( poor coordination , poor referral systems , poor communication and little funding ) . family medicine can be used as a technique to strengthen these health systems internet connection is present in several of the training centres ( and this is rapidly expanding ) ; e - learning is a very useful didactic tool for the family medicine residents a yearly conference is organized by the primafamed network to strengthen the network and to share ideas and exchange experiences wonca africa is organizing three yearly conferences and has been expanding in terms of number of members in the recent years there are many existing links with organizations and universities in the north for financial and didactic support iucea and wacp can assist in accreditation and quality assurance several very useful books on african family medicine have been published recently and can be used as training material the new african journal of primary health care and family medicine gives more opportunities for registrars to publish research health - care workers and policymakers are becoming increasingly aware of the importance of the basic principles of phc and family medicine such as patient - centred care , non - communicable diseases ( ncds ) , interdisciplinary care , and continuity of care many african ministries of health are working on health - system reforms research in the field of family medicine is done by the registrars during the training the primafamed network has been looking into expanding to francophone africa : mali and benin will participate in a vlir uos funded project starting 2012 , and the african journal of primary health care and family medicine will be published in english and french from 2012 onwards other specialities see family medicine as a threat family medicine is a new concept and not yet part of the health system in most of the partnering countries overload of work for doctors leads to little time for training lack of career opportunities for family medicine physicians in countries where family medicine is not supported by the government there is little or no funding for family medicine within the existing systems substantial decrease in funding for further development of the family medicine training after ending of the primafamed project funding from edulink acp - eu migration of graduates to private practice , ngos , management positions or public health ( internal brain drain ) or migration of graduates to other countries ( external brain drain ) \n war and political instability ( e.g. dr congo , sudan and nigeria ) ; in some countries , there is a high turnover of government and with this , there often is a change of policies increasing commercialization and privatization of health - care provision worldwide economic crisis , which is decreasing the funding for health care and is putting health systems under pressure fragmentation of care through vertical disease - oriented programmes , not only for infectious diseases , but increasingly for ncds ( 23 ) . i. when the swot analysis was done in 2010 , the rwandan ministry of health was supportive of the new discipline and family medicine was accepted by the government as one of the specialist mmed trainings from the national university of rwanda . however , at the time of writing this article , the ministry of health in rwanda has changed its vision and family medicine is not seen as a priority . recently west african college of physicians v. especially in sudan , this is a problem as a large percentage of medical graduates move to saudi arabia for more job opportunities , better salaries or family reasons adopted from the primafamed edulink acp eu project at the local / university level , the availability of resources plays an important role . from a human resources perspective , family physicians ( in most cases from abroad ) are needed to form the faculty , train family medicine residents and develop teaching materials . other local professors and specialists willing to train family medicine residents in the different disciplines are important to the strengthening of both the training and the interdisciplinary network ; however , several partners noted a low level of support from other specialists because family medicine is often not well understood and is often seen as a threat . adequate motivation of faculty and family medicine residents is important and is influenced by many other factors such as financial backing , career opportunities and support at the local , national and international levels . the availability of training sites , especially at district hospitals and health centres , is crucial , including having access to physicians to train and mentor the family medicine residents and stimulating teamwork with other health - care workers such as the local nurses . well - written curricula ( often developed based on sample curricula from family medicine training programmes in other african universities ) and training materials are essential to create a high - quality training atmosphere . access to the internet and to didactic materials and equipment ( such an ultrasound machines or health education materials ) are important to strengthen the actual training . lack of diagnostic or therapeutic equipments or insufficient availability of essential drugs in the training hospitals influences the way the doctors learn and hinders implementation of evidence - based medicine . ensuring that there is a place for family medicine training in undergraduate curricula plays a crucial role in raising awareness and recruiting newly trained medical doctors . at the national level , policymakers play a pivotal role . in several countries , decision - makers accept family medicine as an official specialization that is starting to take its place in the health - care system , with kenya , sudan and ghana as examples ( see examples 1 , 2 and 3 ) . several other countries have had more difficulties with the ministry of health accepting family medicine , including tanzania and rwanda . research on the positive outcomes of family medicine on health - care provision plays a significant role in advocating and strengthening awareness . a negative factor at the national level is political instability and war , as seen in eastern congo . at the regional / african level , the importance of strong partnerships and collaboration with universities and professional bodies abroad is noted . south african universities have excellent curricula and knowledgeable professors with extensive experience that can be leveraged via south south cooperation . moreover , conferences organized by primafamed and wonca africa support the development of african family medicine . the establishment of the african journal of primary health care and family medicine is a great opportunity for young researchers to learn from others work and to publish their own articles . at the international level , secondly , global recognition of the importance of training health - care workers in phc ( world health report 2006 and 2008 ) is vital to the development of african family medicine .", "in 2007 , a call for proposals under the name edulink was launched by the secretariat of the african , caribbean and pacific ( acp ) group of states ( 17 ) . together with 10 universities in eight countries in sub - saharan africa ( sudan , ghana , nigeria , dr congo , rwanda , uganda , kenya and tanzania ) , figure 1 , the department of family medicine and phc at ghent university in belgium developed the primafamed project proposal with a focus on developing family medicine training in sub - saharan africa . the aim of the primafamed project was to establish an institutional network between new and established departments of family medicine in universities in sub - saharan africa , within a framework of south south cooperation ( 18 ) . the who world health report 2006 , working together for health , emphasized the need for phc training in the local community in order to deal with the brain drain from acp states ( 19 ) . training medical doctors in the field of family medicine , thus providing phc at the district level , responds to this call . the objectives of the primafamed project were formulated as follows : 1 . to contribute to the health of communities through accessible , responsive and quality health systems in sub - saharan countries by educating and training family physicians who provide interdisciplinary phc services , oriented towards the needs of individuals , their families and the communities in which they live . develop and strengthen academic departments or units of family medicine that offer family medicine training at the undergraduate and postgraduate levels . the specific objectives were as follows : 1 . to develop a comprehensive vision and strategy , within the specific context of sub - saharan countries , that delineates the integral contribution of family medicine and the phc team to an equitable and quality phc system ; 2 . to establish a specific institutional network between departments and units of family medicine . an improved institutional and administrative functioning in terms of policy , management , planning and administrative capacity building of the participating departments and units of family medicine . 2 . improved relevance of family medicine in undergraduate and postgraduate training in the regional context .", "the partnering universities in the primafamed project were university of goma ( dr congo ) , moi university ( kenya ) , national university of rwanda , aga khan university ( tanzania ) , university of lagos ( nigeria ) , makerere university ( uganda ) , mbarara university ( uganda ) , ahfad university for women ( sudan ) , gezira university ( sudan ) and university of ghana . the south south network connecting these 10 universities worked together with the eight departments of family medicine in south africa and accordingly formed a forum to share knowledge , experiences and resources .", "each of the 10 partner universities hired a local coordinator to oversee the implementation of the project , coordinate the activities and actively communicate with all partners . partners worked independently , integrating the primafamed objectives and the output for the project into the already existing structures and work plan at their universities . because african family physicians work mainly in district hospitals with outreach to the health centres , the primafamed project consequently stimulated all partners to develop training complexes ( mainly district hospitals , several of which are located in rural areas ) for family medicine residents and to support the supply of these training complexes with the needed equipment . to further strengthen family medicine residents education , training sessions by professors from south african universities and other associated primafamed partners were held . a yearly conference for partners , associates and stakeholders was organized with the goal of offering trainings , sharing ideas and experiences , and strengthening the network . at the 2008 conference in kampala , the african journal of primary health care and family medicine ( 20 ) this new open - access online journal has since published various articles related to the development of family medicine on the african continent , and researchers in the field of phc have written numerous articles on operational research and community - oriented primary care ( copc ) projects ( 21 ) . to monitor and evaluate our project , this four - level scale shows the progress that took place during the 2.5-year period in which primafamed supported the partners . the first level corresponds to the institution being at a preparatory stage in the development of a postgraduate family medicine training programme . the fourth level reflects that the institution has started a postgraduate family medicine training programme with an existing curriculum by an organized department at well - organized training complexes and , most importantly , that family medicine has been accepted by the ministry of health as a specialization and that graduated family physicians are integrated into the existing health system . undeniably , the fourth level is not the end stage because , in our opinion , the ultimate objective would be to have an equitable and high - quality phc system with a central role for family physicians . department / unit of family medicine exists or is part of other departments ( community medicine ) training complexes are under development family medicine is part of undergraduate training department / unit of family medicine exists training complexes are in place postgraduate training has started department / unit of family medicine exists training complexes are in place postgraduate training has started the ministry of health has accepted family medicine as a specialization and graduated family physicians are part of the health - care system adopted from the primafamed edulink acp eu project . all 10 primafamed partners made progress during the 2.5 years that the project provided funding and support ( table 1 ) . at the start of the project , all of them had a unit or department of family medicine under development or in place , yet only three had officially started postgraduate family medicine training . at the end of the project , eight had started postgraduate training , with family medicine residents located in properly equipped training hospitals . progress scale for development of the primafamed partners adopted from the primafamed edulink acp eu project . the integration of family medicine into the local health systems has been a slower process . in many countries , policymakers have adopted a somewhat conservative attitude , with health systems mainly based on hospital / specialist care and on vertical programmes , which are often stimulated by donor programmes . a critical mass of well - trained family physicians is needed to demonstrate the effectiveness of family medicine training programmes . because all but one partner universities train only a limited number of family medicine residents simultaneously due to limited capacity , reaching that critical mass takes time . however , as the example of gezira university ( sudan ) has shown , it is possible to create a large pool of well - trained family physicians who can make a difference , in a short time . in this particular situation , because there was a vital need , policymakers and local authorities worked closely together with gezira university in development of the training ( example 1 ) . in 2012 , african family physicians came together at the wonca africa conference and the primafamed network workshop in victoria falls , zimbabwe , and reaffirmed the importance of reaching that critical mass and therefore scaling up of family medicine , particularly in the african context , in which poverty is very prevalent , where rural urban gaps remain , and where many of the millennium development goals ( mdgs ) will not be reached , including those related to child survival , maternal death and accessibility to antiretroviral drugs ( 22 ) .", "in 2010 , all primafamed local coordinators contributed to a swot ( strengths , weaknesses , opportunities and threats ) analysis on the development of family medicine training programmes and of family medicine as a new discipline within the health systems of their countries ( box 3 ) . the main findings are presented and categorized into the following levels : local / university level , national level , regional / african level and international level . strong partnerships and collaboration with universities and professional bodies abroad is present the south african departments of family medicine have substantial experience in the family medicine training programmes : they can assist in training via south south cooperation and these cooperative steps can be seen as exemplary models and good practices the primafamed project and edulink acp - eu funding strengthens the development of family medicine training and is seen as the motor for the family medicine training development individuals working in the family medicine departments are very motivated , proactive and willing to advocate for the cause family physicians working as faculty are highly experienced and well qualified the chosen district hospitals and health centres are ready for the training programmes in several of the countries ( sudan , kenya and ghana ) , a high commitment from the ministry of health , the national council and leaders is existing family medicine is responsive to the needs of the communities , especially in the rural areas where the majority of africans live family medicine is not yet part of undergraduate medical training , therefore medical students are not exposed to the concept of family medicine and its principles poor quality of intake and recruitment of family medicine residents for the family medicine training the lack of family physicians and local teachers . many of the departments of family medicine depend on family physicians coming from non - african countries ( mainly , western europe and united states ) due to work overload , family medicine residents are continuously working in the hospital setting and have insufficient time to focus on the training in other aspects of family medicine , such as disease prevention and health promotion , community medicine , outpatient / continuity of care and research the existing health systems are still weak in several countries ; plagued by poor support , weak referral systems , poor communication , poor funding and poor coordination between health centres , district hospitals and referral hospitals dropping out of family medicine residents during the training sometimes happens in countries like dr congo because family medicine residents lose faith in their career opportunities there is poor guidance for the present faculty there is a lack of awareness and knowledge of family medicine by medical graduates , specialists and the community there is lack of adequate infrastructure in some countries , such as dr congo and ghana there is poor communication with policymakers and little support from the government in countries like tanzania and rwanda \n standardization of training and examinations between faculties and countries is presently not existing , although there is a strong need for accreditation and quality assurance there is insufficient financial support for the family medicine residents in postgraduate training the position of family physicians in the different health systems is unclear ( what is the career perspective of graduated family physicians ? ) there is international support for the concept of family medicine : in the world health report 2008 primary health care : now more than ever , the who advocated for the importance of moving health care out of tertiary hospitals into the community and from vertical to horizontal care , in order to respond to the needs of the community family medicine training is growing in the whole african continent , and there is support in the surrounding countries . the primafamed project has been linking these different countries , in order to fight for the cause together existing health systems in several countries are weak ( poor coordination , poor referral systems , poor communication and little funding ) . family medicine can be used as a technique to strengthen these health systems internet connection is present in several of the training centres ( and this is rapidly expanding ) ; e - learning is a very useful didactic tool for the family medicine residents a yearly conference is organized by the primafamed network to strengthen the network and to share ideas and exchange experiences wonca africa is organizing three yearly conferences and has been expanding in terms of number of members in the recent years there are many existing links with organizations and universities in the north for financial and didactic support iucea and wacp can assist in accreditation and quality assurance several very useful books on african family medicine have been published recently and can be used as training material the new african journal of primary health care and family medicine gives more opportunities for registrars to publish research health - care workers and policymakers are becoming increasingly aware of the importance of the basic principles of phc and family medicine such as patient - centred care , non - communicable diseases ( ncds ) , interdisciplinary care , and continuity of care many african ministries of health are working on health - system reforms research in the field of family medicine is done by the registrars during the training the primafamed network has been looking into expanding to francophone africa : mali and benin will participate in a vlir uos funded project starting 2012 , and the african journal of primary health care and family medicine will be published in english and french from 2012 onwards other specialities see family medicine as a threat family medicine is a new concept and not yet part of the health system in most of the partnering countries overload of work for doctors leads to little time for training lack of career opportunities for family medicine physicians in countries where family medicine is not supported by the government there is little or no funding for family medicine within the existing systems substantial decrease in funding for further development of the family medicine training after ending of the primafamed project funding from edulink acp - eu migration of graduates to private practice , ngos , management positions or public health ( internal brain drain ) or migration of graduates to other countries ( external brain drain ) \n war and political instability ( e.g. dr congo , sudan and nigeria ) ; in some countries , there is a high turnover of government and with this , there often is a change of policies increasing commercialization and privatization of health - care provision worldwide economic crisis , which is decreasing the funding for health care and is putting health systems under pressure fragmentation of care through vertical disease - oriented programmes , not only for infectious diseases , but increasingly for ncds ( 23 ) . i. when the swot analysis was done in 2010 , the rwandan ministry of health was supportive of the new discipline and family medicine was accepted by the government as one of the specialist mmed trainings from the national university of rwanda . however , at the time of writing this article , the ministry of health in rwanda has changed its vision and family medicine is not seen as a priority . west african college of physicians v. especially in sudan , this is a problem as a large percentage of medical graduates move to saudi arabia for more job opportunities , better salaries or family reasons adopted from the primafamed edulink acp eu project at the local / university level , the availability of resources plays an important role . from a human resources perspective , family physicians ( in most cases from abroad ) are needed to form the faculty , train family medicine residents and develop teaching materials . other local professors and specialists willing to train family medicine residents in the different disciplines are important to the strengthening of both the training and the interdisciplinary network ; however , several partners noted a low level of support from other specialists because family medicine is often not well understood and is often seen as a threat . adequate motivation of faculty and family medicine residents is important and is influenced by many other factors such as financial backing , career opportunities and support at the local , national and international levels . the availability of training sites , especially at district hospitals and health centres , is crucial , including having access to physicians to train and mentor the family medicine residents and stimulating teamwork with other health - care workers such as the local nurses . well - written curricula ( often developed based on sample curricula from family medicine training programmes in other african universities ) and training materials are essential to create a high - quality training atmosphere . access to the internet and to didactic materials and equipment ( such an ultrasound machines or health education materials ) are important to strengthen the actual training . lack of diagnostic or therapeutic equipments or insufficient availability of essential drugs in the training hospitals influences the way the doctors learn and hinders implementation of evidence - based medicine . ensuring that there is a place for family medicine training in undergraduate curricula plays a crucial role in raising awareness and recruiting newly trained medical doctors . at the national level decision - makers accept family medicine as an official specialization that is starting to take its place in the health - care system , with kenya , sudan and ghana as examples ( see examples 1 , 2 and 3 ) . several other countries have had more difficulties with the ministry of health accepting family medicine , including tanzania and rwanda . research on the positive outcomes of family medicine on health - care provision plays a significant role in advocating and strengthening awareness . a negative factor at the national level is political instability and war , as seen in eastern congo . at the regional / african level , the importance of strong partnerships and collaboration with universities and professional bodies abroad is noted . south african universities have excellent curricula and knowledgeable professors with extensive experience that can be leveraged via south south cooperation . moreover , conferences organized by primafamed and wonca africa support the development of african family medicine . the establishment of the african journal of primary health care and family medicine is a great opportunity for young researchers to learn from others work and to publish their own articles . at the international level , secondly , global recognition of the importance of training health - care workers in phc ( world health report 2006 and 2008 ) is vital to the development of african family medicine .", "inverse care law through achieving universal coverage and by providing equitable and high - quality health care through well - trained health - care workers to every individual . training doctors who work closer to communities , where they are most needed , is an important step towards improving the health outcomes of the african population . however , developing a new discipline that has not yet been defined in the national health systems is a challenging task . the primafamed project showed that developing sustainable family medicine training programmes is a feasible but slow process with many obstacles . the south south cooperation between the primafamed partners and the south african family medicine departments strengthened confidence in the project and reinforced the principal need for well - trained african family physicians . local ownership is of utmost importance , although , with no local family physicians as role models , this can be a difficult task . support from key figures at the level of policymakers and academicians is necessary to create this new discipline and give it a place in health systems . without the integration of family medicine into national health policy , it is very difficult to recruit new doctors for the training programmes because the uncertainty in career prospects negatively influences a potential candidate s decision to join these programmes . continuous advocacy for the discipline and for strengthening the role of the african family physician are crucial . exposure to family medicine and community health in the undergraduate medical curriculum is required to create awareness among new medical doctors . action research , such as copc ( 24 ) , in the african setting is needed to demonstrate significant outcomes and the positive influence of the discipline at the individual , community and national levels . recruitment , training and retention of doctors in family medicine need to be adopted in the health system of each of the african countries . this requires increased investment of resources in phc , both from governments and from donor organizations . the primafamed network that was created during the 200810 project continues to endeavour to make these action points a reality . in november 2012 , during the wonca africa conference , representatives from many african family medicine departments came together and discussed steps forward in creating a strong family medicine and phc - oriented health - care system in various african countries . this led to the statement of the primafamed network : scaling up family medicine and primary health care in africa. concrete action for scaling up is needed , including convincing ministries and leadership of medical schools to integrate family medicine and phc into the undergraduate curriculum and to train a significant proportion of medical school graduates ( between 40% and 60% ) in family medicine and phc . essential conditions include having accredited under- and postgraduate curricula ; well - equipped training centres for transformative learning with well - trained trainers ; national and international support networks ; a sufficient number of funded posts for family medicine residents / registrars with appropriate remuneration ; and continuous advocacy at the population and government levels ( 25 ) . continuous interaction with key players at the policymaking level and support from the government are necessary to scale up family medicine and to develop it into an essential part of the health - care systems , in order to provide equitable , high - quality health care for communities and , ultimately , to improve overall health in sub - saharan africa .", "gezira university is a public university based in central sudan , in the city of wad madani . in many health centres , community physicians and medical officers were in charge of patient care . together with policymakers , district health officers and representatives from the ministry of health identified the need for further training for medical doctors in primary health care . gezira university decided to develop a 1-year diploma and a 2-year in - service master of science ( msc ) in family medicine . both are accepted by the sudan national medical specialisation board . with the help of the primafamed project , a coordinator for this development was financed , a curriculum was developed and training sites were identified and equipped with the needed material . in 200910 , the first 10 medical doctors were trained in the 1-year course . in 2010 , 120 candidates were selected for the 2-year in - service msc in family medicine . in the fall of 2012 , these 120 sudanese family physicians graduated with comprehensive knowledge in district primary health care . in 2013 , 200 new candidates were selected . the university of gezira can be seen as a perfect example of how working together with policymakers is essential for the development of family medicine .", "in 2005 , moi university started the first family medicine training programme in anglophone eastern africa , outside south africa , nigeria and ghana , leading to the degree of master of medicine in family health . the development of this residency programme was a triangular effort from moi university , infa - med ( institute of family medicine , a faith - based ngo , aiming to introduce family medicine in kenya ) and the kenyan ministry of health ( moh ) . infa - med contributed financial support , expatriate family medicine faculty and well - established training hospitals ; and the moh provided political support to the new specialty as well as scholarships to medical doctors entering the residency programme ( 26 ) . a national policy ( the kenyan family medicine policy ) was developed ( 27 ) and in august 2009 , this was adopted by the kenyan government . in 2008 , the first registrars finalized the family medicine programme at moi university . most of these registrars are now working in connection with the department to further develop the curriculum and the training sites . a study in 2011 on the challenges of family physicians after placement showed that the ministry s posting policy needs to be improved to ensure that family physicians have a chance to perform their intended roles ( 28 ) . in 2011 , one of the first - graduated kenyan family physicians , dr patrick chege , became the head of department . the department of family medicine has strongly been focussing on the development of research . in 2009 , a review of the present family medicine curriculum was started to improve the curriculum with a focus on the needs of the hospitals where the family physicians will be based . many external experts from primafamed partners and associates were consulted in this process . in january 2012 , the revised curriculum was approved by the moi university senate .", "the west african college of physicians ( wacp ) accepted family medicine in 1985 ( 29 ) and it extended to the subregion outside nigeria in 1991 ( 29 ) . in ghana , postgraduate training began in march 1999 with three family medicine residents under the auspices of the faculty of family medicine ( then general medical practice ) of the wacp . this was a hospital - based training programme with the initial group of trainers being private general practitioners who were elected into fellowship by the college in the early 1990s . it started as a 4-year programme leading to membership after the initial 2 years and fellowship after a further training for 2 years . that same year , the ghana college of physicians and surgeons also started another programme in family medicine to run alongside the one conducted by wacp . the ministry of health provides sponsorship for the programmes and accords graduates of family medicine equal status and remuneration as graduates from other specialties . in january 2008 , the undergraduate programme began in the university of ghana medical school with the first two fellowship graduates appointed as lecturers . these local efforts at promoting the specialty in ghana received a major boost with two significant collaborations : first with the primafamed edulink acp - eu project in 2007 , a north south south cooperation , and second , with the department of family medicine , university of michigan health systems in 2008 , a north south cooperation . these collaborations focussed on curriculum development , faculty development , teaching of students and family medicine residents , development of training complexes and research . currently , there are two well - established postgraduate training complexes in accra ( korle - bu teaching hospital ) and kumasi ( komfo - anokye teaching hospital ) with 35 family medicine residents at various levels of membership and fellowship training ( 30 ) .", "funding : the primafamed project was funded by the edulink acp eu ( european commission funded programmes in the africa , caribbean and pacific group of states ) . the vlir uos ( flemish interuniversity council ) supported the funding for the yearly primafamed conferences2008 in kampala , uganda ; 2009 in rustenburg , south africa ; 2010 in swaziland and 2011 in cape town , south africa ." ]

[ "of those deaths , an estimated 7.3 million were due to coronary heart disease and 6.2 million due to stroke . a disproportionate amount of those deaths , over 80% , take place in low- and middle - income countries and occur at similar rates among men and women . not surprisingly , elevated blood pressure levels are a major cause of these diseases and are found at higher rates among low- and middle - income countries . the relationship between blood pressure levels and risk of developing cardiovascular disease is strong and well supported . in 2008 , approximately one billion adults worldwide had uncontrolled hypertension ( defined as systolic blood pressure 140 mm hg systolic and/or diastolic blood pressure 90 mm hg ) . given the increasing prevalence of hypertension worldwide and the associated risk for developing cardiovascular disease , public health interventions aimed at reducing blood pressure are crucial . many national and international agencies have acknowledged the role of lifestyle and diet , in particular sodium intake , on blood pressure levels . diets high in salt are now recognized as one of the leading risks to cardiovascular health in the world as they increase blood pressure in both children and adults . furthermore , a recent meta - analysis of randomized trials has demonstrated that modest reductions in dietary sodium intake are associated with significant reductions in blood pressure in both normotensives and hypertensives and a 20% reduction in cardiovascular events [ 4 , 5 ] . a reduction in salt intake of 6 g / day lowered blood pressure by 7/4 mm hg diastolic in hypertensives and 4/2 mm hg in normotensives . this relationship has been empirically supported and is sufficiently strong to warrant recommendations for public health interventions aimed at substantially reducing dietary sodium intake . furthermore , sodium reduction is noted as one of the most cost effective and most easily implemented strategies to improve population health [ 513 ] . reducing dietary salt is recommended by the world health organization and many national governmental and nongovernmental health organizations . some agencies , however , do not promote a reduction in dietary sodium , namely , nongovernmental or commercial organizations such as the salt institute , as they are sponsored by either the food or salt industries [ 9 , 11 , 1417 ] . regardless , it is apparent that the risks associated with an increase in salt consumption , chiefly those related to an increase in blood pressure , are linear [ 3 , 18 ] . most health economic models input relatively small changes in blood pressure that occur in those with normal and high blood pressure as estimated by short - term modest reductions in dietary sodium [ 7 , 8 , 19 ] . some models also include the gastric cancers that are positively associated with , and probably caused by , high - salt intake . typically , the health economic models do not include the potential impact of longer term irreversible increases in blood pressure , age - related increases in blood pressure , the epigenetic phenomena , whereby exposure to excess salt in utero may increase blood pressure in offspring , or that sodium may increase vascular and cardiac disease in the absence of changes in blood pressure [ 7 , 8 , 12 , 1921 ] . the burden of disease studies also do not account for diseases that have a pathophysiological basis and close association with high sodium diets ( i.e. , increased severity and frequency of asthma attacks , increased calcium containing kidney stones , osteoporosis , or obesity related to the consumption of calorie containing beverages caused by sodium - induced thirst ) . hence the burden of disease associated with excess dietary salt is not only high , but may also be underestimated . the objective of this commentary is to review current sodium consumption worldwide , discuss cost - effective strategies to reduce dietary sodium , as well as briefly review the role of behavioural and policy - based environmental interventions in reducing dietary sodium on a population - based scale .", "humans evolved on diets consisting of natural plant and animal foods containing small amounts of sodium , typically less than 2 g / day [ 25 , 26 ] . today , nearly all populations consume far greater quantities of salt than those provided in natural , unprocessed food diets . the world health organization currently recommends a daily consumption of less than 5 grams of salt , although some agencies recommend that no more than 1500 mg of sodium should be consumed per day [ 2729 ] , calculated as 2/3 tsp of table salt . in most populations , sodium intake is 5.7 g or more / day after age 5 , with many populations consuming and average of over 10 g / day [ 3032 ] . furthermore , within high sodium consumption countries , only a small proportion of individuals consume the recommended levels of salt . for example , in canada , a country with average salt consumption of 8.5 gm / day , 85% of men and 60% of women aged 9 to 70 consume over the upper recommended limit for salt and the vast majority ( > 90% ) are above the level recommended for individuals to consume [ 33 , 34 ] . for example , one study found that in a population of overweight adults , a daily intake of sodium greater than 2300 mg / day was associated with a 61% increase in coronary heart disease mortality , an 89% increase in stroke mortality , and a 39% increase in all - cause mortality over a 19-year period . along with the other sodium - related illnesses discussed above ( i.e. , gastric cancers , kidney stones , etc . ) , it is clear that the economic costs associated with such illnesses can be substantial .", "in countries with developed economies , salt added during the processing of foods accounts for the vast majority of dietary salt ( 7580% ) . an additional 10% of dietary salt is accounted for by salt that is naturally occurring in foods , while the rest is accounted for by salt added at the table or during cooking . in low- to - middle income countries where populations may have limited access to processed foods , salt added at home , in cooking , or at the table , accounts for the majority of dietary salt . reducing dietary salt is estimated to save substantial health care costs [ 7 , 10 , 16 , 30 , 3741 ] . for example , reducing dietary salt by 3 g / day in the united states is estimated to save 194,000 to 392,000 quality adjusted life years and reduce health care costs $ 10 to $ 24 billion us dollars a year . in canada , reducing salt consumption to recommended levels is estimated to reduce the prevalence of hypertension by 30% and to save up to $ 430 million dollars per year just in direct hypertension management costs alone . in lower - income countries , programs aimed at reducing consumption of dietary salt through an intervention largely based on education are estimated to cost little ( less than $ 0.40 usd per person per year ) , reduce premature deaths by close to 14 million in 10 years , and to be slightly more cost effective than strategies to reduce tobacco use ( both highly advocated interventions ) [ 8 , 40 ] .", "although there is a general lack of awareness of salt as a health issue in many countries , some countries with established salt reduction programs show increasing awareness . for example , in canada , 80% of people diagnosed with hypertension are attempting to reduce dietary sodium . in addition , many food companies have developed low - salt options to their product lines for people to choose , with some companies reducing salt additives in their full product line . in developed economies , there are substantial barriers to free choice in those who chose to eat less salt [ 16 , 44 ] . in most countries , it is often the case that nutritional information is available only on the company 's website , by asking for and reviewing a binder on site , or only readily available after purchase . even in the united states and canada , countries with mandatory labelling of packaged foods , the labels are often difficult to interpret . also serving sizes may be variable and not comparable between products . in an unpublished study , we found that in a sample of over 100 people with diabetes who had received training on how to read a food label , not one could accurately answer how much of a processed food they could eat in a day when presented with the food label . in other countries , food labelling on packaged foods may not be mandatory and labelled foods may not be available . in remote regions and areas where populations vulnerable to the development of elevated blood pressure reside , low - salt alternative choices are typically not available . furthermore , these populations may not have the health literacy with which to make informed choices . food processors and manufacturers often use pervasive marketing techniques to create consumer demand for high - salt foods , which undermine efforts of public health and individual education interventions that attempt to reduce sodium intake . moreover , these marketing techniques are often directed towards children by making consumption of such foods seem fun . perhaps the greatest barrier to choosing and maintaining a low - sodium diet is that high - salt foods are ubiquitous and hence difficult for those who choose low - salt diets [ 16 , 46 ] . in canada , high - salt diets are by and large perceived as unhealthy by the general population . however , it is often the case that the same people who recognize that canadians in general consume too much salt , believe that their personal consumption of dietary sodium is within the recommended amount . this suggests that even a relatively affluent , well - educated population may have difficulty identifying and avoiding high - salt foods even if they perceive it is a health issue and have chosen to follow a low - salt diet . some of the challenges of individual choice in selecting low salt diets is perhaps best illustrated by clinical trials where highly motivated patients are carefully and repeatedly trained how to select low - salt foods but generally can only sustain small reductions in salt intake long term [ 44 , 48 ] .", "population - based approaches to reducing dietary salt may be effective in developed economies and have shown promising results for reducing blood pressure . in the late 1950s , the japanese government implemented a campaign to reduce salt intake given the high stroke mortality rates . ten years later , salt intake was reduced from an average of 13.5 to 12.1 g / day overall , and from 18 to 14 g / day in the northern regions . the reduction resulted in a decrease in average blood pressure and an 80% reduction in stroke mortality . in the 1970s , finland 's government began a public education campaign and enforced regulations on food processing companies through a warning label on high - salt foods in order to reduce salt consumption across the country [ 50 , 51 ] . more than 30 years later , the overall sodium intake in finland has decreased more than 40% , with a subsequent decrease in mean diastolic blood pressure of greater than 10 mm hg and an 80% decline in the mortality rate from heart disease and stroke . similar results were also seen on smaller scales in the dash ( dietary approached to stop hypertension ) trial conducted in the usa [ 3 , 53 ] . this trial assessed three levels of dietary sodium intake on two diets ( american diet versus dash diet ) and demonstrated that reducing sodium in either diet resulted in lower blood pressure [ 3 , 12 , 53 ] . more recently in the united kingdom , reductions in the amount of salt added to foods , in conjunction with a social marketing campaign , have been associated with reduction in population salt intake . in developing economies widespread replacement of salt with a partial salt replacement ( sodium , potassium magnesium combination ) holds great promise [ 54 , 55 ] . for example , a recent double - blind randomized controlled trial conducted in rural northern china found that replacing household salt with a reduced - sodium , high - potassium salt substitute for 1 year reduced systolic blood pressure by 5.4 mm hg . this low cost change in diet has shown promising outcomes for blood pressure reduction with little to no burden on the consumer .", "clearly both a mix of population approaches and behavioural approaches targeting individuals are required to reduce sodium intake to within recommended levels [ 10 , 11 , 15 , 16 , 33 , 56 ] . similar methods have been successfully employed in reducing tobacco use . with respect to individually targeted efforts , for example , a variety of behavioural interventions , including brief physician smoking cessation counselling , was found to meaningfully increase smoking quit rates . however , it has become increasingly clear that education targeted towards individuals may be necessary , but not sufficient , to motivate long - term health behaviour change [ 59 , 60 ] . for example , motivational interviewing , a directive patient - centred counselling approach focused on exploring and resolving ambivalence , which emerged as an effective therapeutic approach within the addictions field , has recently shown promise for other complex behaviour change problems such as weight loss in overweight and obese patients and adherence to antihypertensive medication . in contrast with recommendations for behaviour change delivered through education and advice giving , motivational interviewing differs in that motivation for change is elicited from individuals , rather than imparted by a healthcare provider . the mix of behavioural interventions and population interventions depends on the specific circumstances of both the individual and the population . in countries with developed economies , population - based approaches , and a reduction of salt additives to food , supplemented by public education campaigns , need to be the primary means of intervention to ensure that the healthy option that is low in salt is the easiest option a basic caveat of public health interventions . a universal reduction in salt additives during the manufacturing process has a strong potential to reduce health disparities in vulnerable populations while improving overall population health . behavioural interventions may be most important to ensure the population and especially policy makers understand and are supportive of the need to reduce dietary salt . however , for specific individuals with strong motivation or at a greater personal risk from consuming a diet high in sodium , intensive behavioural interventions may be efficacious . notably sole reliance on the individual behavioural approach is likely to have a smaller impact on a population basis , to be expensive , and to increase health disparity . in developing economies , where the majority of sodium intake comes from salt added at the table and in cooking , behavioural interventions are more likely to be effective in reducing overall intake than population - based means [ 8 , 32 ] . in this case , the individual needs to understand the consequences of excess sodium intake and change their behaviors ( i.e. , eating habits ) to reduce sodium intake . nevertheless , even in this partial replacement of table salt ( sodium chloride ) with various mineral salts ( mixtures of sodium , potassium , and/or magnesium and calcium ) has been shown to be highly effective to reduce overall sodium consumption and also reduce blood pressure [ 55 , 65 ] . efforts to reduce dietary salt are also likely to reduce dietary iodine , therefore monitoring dietary iodine adequacy and revising the iodine content of salt is essential to maintain population health in most settings , including developed countries . population interventions that ensure widespread replacement of salt with a partial salt substitute that contains iodine may be the dominant strategy to reduce sodium intake on a large - scale basis in combination with behaviour change interventions .", "given the promising outcomes observed in recent randomized controlled trials and population - based interventions , reducing dietary sodium intake to modest levels ( approximately 5 g / day ) worldwide would result in a major improvement in overall health and reduce the costs associated with diseases connected to excess sodium intake . however , it is apparent that relying solely on interventions that target individual behaviour is not the ideal approach for reducing sodium consumption . while it may contribute to behaviour change among highly motivated individuals and increase the acceptability of population - based interventions , the latter approach seems better suited for this particular health behaviour ." ]

[ "the associated edema which may develop within an hour is the leading cause of potential life - threatening airway compromise . the disease may show variation in terms of its presentation and clinical course , which needs to be addressed carefully before making any airway management plan . literature is convincing both for the active as well as conservative approach of airway management depending upon the patient 's clinical condition . the purpose of reporting this case is to highlight these issues in the management of adult patient with acute supraglottitis .", "a 52-year - old man presented in the emergency department with the complaints of sore throat for 1 day . the past medical history was unremarkable except the history of ischemic heart disease for which he was taking regular clopidogrel , losartan , and sublingual trinitrates as required . he was febrile with the temperature of 37.6c , respiratory rate was 22 per minute , while the oxygen saturation on room air was 95% . there were no signs of airway obstruction including stridor , change of voice , and dyspnea related to change in position or lying down . the initial management was started with humidified oxygen , intravenous dexamethasone , and adrenaline nebulization . the fiberoptic nasolaryngoscopy showed the significant edema and inflammation of supraglottic region more on the right side as compared to the left . he was quiet comfortable with the breathing and maintaining the oxygen saturation on hudson mask . the rest of the physical and systemic examination was normal . on the basis of initial assessment however , consideration was given to nasolaryngoscopy findings and the fact that we did not have overnight otorhinolaryngology cover in our district hospital . it was also decided that conservative airway management of patient , either in our hospital or during shifting to the specialized unit , would be very high risk . the three anesthetists , out of whom two had consultant grades , were present for the case . patient 's was kept on spontaneous ventilation with the help of nasopharyngeal airway connected to the main circuit via 15 mm outer diameter connector . a surgical tracheostomy was done after infiltration of local anesthesia while the patient was kept anesthetized on inhalational anesthetic on spontaneous breathing pattern . the patient remained stable throughout the procedure and shifted to the intensive care unit on completion of the procedure . the unanticipated rapidly progressive course of the disease was confirmed by the computerized tomography scan of the neck done after 24 h , which showed the marked swelling of oropharynx reducing the size of airway to not more than a pin hole [ figure 1 ] . patient was shifted to specialized center on the first postoperative day where he was treated medically . rest of the course in the hospital was uneventful and then he was discharged home .", "the reported incidence in this population group is 12.9/100,000 annually and is higher than that in the pediatric population . signs and symptoms at the time of presentation show variation among the patient group involved . sore throat , dysphagia , and change in voice are the common findings in the adults while the children usually present with the cardinal signs of airway obstruction as stridor , drooling , and dyspnea . the current literature supports the conservative approach for the patients in which no airway compromise is suspected . patients having a rapid progressive course , diabetes , or symptoms of impending airway obstruction like stridor or muffled voice are likely to be managed with the active airway intervention . we recommend that before taking any decision on the approach to a patient , it is very important to consider the type of health care setup and facilities available . the disease process may show marked variation in terms of symptoms and progression as it was happened in our patient . our patient presented with sore throat and he did not have any sign or symptoms of respiratory distress but still had rapid onset of massive airway edema . a retrospective review of nine healthy adults found that the signs of upper airway obstruction are characteristically absent in early phase of potentially fatal supraglottitis . . it also aids in tracking the disease progress and the response to medical treatment . severe swelling of the epiglottis and its extension to the arytenoids are the two factors strongly associated with the airway intervention . the management of our patient was based on the nasolaryngoscopy finding at the time of presentation which showed the clinically significant edema of oropharynx . air way manipulation in such high risk patients should be done in the operation theatre with a surgeon ready for emergency tracheostomy . the anesthetic options , inhalational induction using sevoflurane or awake trachesotomy , should be individualized according to the patient condition and clinical expertise available . in adult patients having acute supraglottitis , clinical parameters are not the reliable indicators of the airway condition , which may deteriorate rapidly . a multidisciplinary approach involving the otorhinolaryngologist and anesthesiologist is of prime importance for the management of airway . either the prophylactic or conservative approach may be used depending upon the patient condition and the health care facilities available . it is also very important to anticipate the difficulty and all the preparations for an emergency tracheostomy should be there for securing of airway ." ]

[ "a 15-year - old boy had complained of motility limitation in the right eye since a young age . his visual acuity was 20/20 in each eye , although an ocular motility examination revealed markedly limited abduction and mildly limited adduction in his right eye ( fig . 1 ) . on attempted adduction of the right eye , globe retraction ( fig . 2 ) with narrowing of the palpebral fissure was observed , and there mild upshoot and downshoot were also observed ( fig . an alternate prism cover test revealed a 16 prism diopters ( pd ) right esotropia ( et ) in the primary position , 25 pd et in right gaze , 10 pd et in left gaze at distance fixation , and 4 pd et at near fixation . he assumed a compensatory face turn to the right and did not complain of diplopia . duane 's retraction syndrome was inferred as the diagnosis until we noted that the patient 's right eye had slight enophthalmos . hertel 's exophthalmometry revealed a 1.5 mm difference between both eyes and the margin reflex distance 1 was 0.5 mm in the right eye . computed tomography of the orbits was performed and demonstrated an old medial orbital wall fracture with entrapment of the medial rectus muscle and surrounding tissues ( fig . however , there was no history of trauma or forceps delivery according to the patient or his parents . the patient 's ocular motor impairment was concluded to have arose from a long - term medial orbital wall fracture and was diagnosed as ' pseudo - duane 's retraction syndrome ' . because open reduction surgery for an old orbital wall fracture would be very difficult , and fruitless for this patient , we decided only to perform surgery on the eye muscle . the 5 mm recession of the right medial rectus muscle was successfully performed in order to correct the patient 's head turn and esotropia . postoperatively , the patient had orthotropia in the primary position , and the anomalous head posture disappeared , though there were still some limitations in both abduction and adduction in the right eye one year after the surgery .", "duane 's retraction syndrome is a well - known congenital ocular motility disorder caused by anomalous innervation and mechanics of the lateral rectus muscle , with secondary muscle changes sometimes superimposed . in 1976 , thomas duane reported five cases of pseudo - duane 's retraction syndrome showing similar , yet different , symptoms and sign as duane 's retraction syndrome.1 other authors preferred the names of ' inverse duane , reverse duane , or mirror - image duane retraction syndrome ' owing to the presentation of opposing clinical features compared with those of classic duane 's retraction syndrome . the etiology is , also , completely different from that of classic duane 's retraction syndrome . the primary lesion in pseudo - duane 's retraction syndrome is suspected to be the medial rectus muscle . most cases have been reported to result from the entrapment of the medial rectus muscle within the medial orbital wall due to trauma.1,3 congenital cases,4 recurrent pterygium,5 and myocysticercosis involving the medial rectus muscle6 have also been reported to be related with inverse duane 's retraction syndrome . in korea , jo et al.7 reported on inverse duane 's retraction syndrome with exotropia , and lew et al.8 reported a case of congenital inverse duane 's retraction syndrome with a tight medial rectus muscle . recently , a case of innervational etiology , such as bilateral inverse duane 's retraction syndrome , due to simultaneous co - contraction of both horizontal rectus muscles has been reported by khan.9 to the best of our knowledge , there is no report presenting very similar clinical features as those of classic duane 's retraction syndrome arising from the entrapment of the medial rectus muscle in a medial orbital wall fracture . this case would most appropriately be categorized as pseudo - duane 's retraction syndrome instead of inverse or reverse duane 's retraction syndrome . there might be some possibility that the patient acquired duane 's retraction syndrome prenatally , and that the medial orbital wall then fractured after birth . however , several pictures of this patient around one year of age revealed that there was no conspicuous head turn , and his family recalled that the limited eye movement was not noted until 2 - 3 years of age . the limitation of his eye movements , therefore , could be concluded as acquired due to unnoticed orbital trauma after one year of age . we report a case of pseudo - duane 's retraction syndrome caused by entrapment of the medial rectus muscle in an old medial orbital wall fracture presenting very similar clinical features as those of classic duane 's retraction syndrome . the importance of several tests such as the forced duction test and an imaging study should be emphasized in making the diagnosis for limited eye movement ." ]

[ "lumbar spine instability has been reported to be the leading cause of chronic back \n pain1 . an a abnormal vertebral joint \n creates mechanical lesions and pains in the lumbar spine , decreasing stability and \n increasing the range of motion , resulting in functional degeneration2 . these negative patterns have a variety of forms such as \n aging , medical history , and exercise deficiency and present serious problems in the age \n group of 2040 , due to developments of modern society and recent changes in various working \n forms of work3 , 4 . herniated nucleus pulposus ( hnp ) is a representative disease of the functional vertebral \n unit that occurs when the pulposus nucleus is exposed by rupture of the annulus fibrosus and \n it is a disease that causes chronic back pains5 , 6 . chronic back pain patients not only have \n weak deep muscles of the lumbar region and muscle imbalance compared to normal subjects , but \n also show reduction in the re - positioning ability which leads to problem with the stability \n of the spine , due to the reduction in proprioceptive sense , which causes lumbar pain and \n recurrence7 , 8 . they include exercises \n for increasing muscle strength , improving functions , and maintaining posture as well as \n preventing excessive movements of the lumbar spine9 . exercise rehabilitation approaches for strength and stability are \n important even after surgical treatments , due to degeneration and restricted activities10 , 11 \n and conservative methods of treatment by exercise have been recommended for the purpose of \n preventing recurrence of pain and improving functions12,13,14,15,16 . thus , exercise therapies based on the stabilization exercises are \n considered to be necessary for preventing chronic pain and reductions in functional \n capabilities by the reduction of functional instability in various of type and the \n improvement of motor functional capabilities of the lumbar joints . therefore , this study aims to help adult women with lumbar disc herniation recover muscle \n strength and stability through 8-week lumber extension strength exercise programs , and to \n provide data for constructing an integrated exercise program .", "in this study , an 8-week exercise program for lumbar muscle extension strength and \n stabilization was performed by 26 females older than 20 with lumbar disc herniation . this \n study was approved by the hankuk university of foreign studies and the institution where it \n was performed , and it complied with the ethical principles of the declaration of helsinki . \n the purposes and process of the study were fully explained to the subjects and their consent \n was obtained before participation . the subjects mean sd was 27.2 4.4 years old their mean \n sd height was 162.3 5.1 cm and their mean sd weight was 55.4 7.1 kg . the programs was conducted for a total of 8 weeks , 60 minutes a session , twice a week , to \n improve strength and stabilize lumbar extension . the exercise program was divided into \n warm - up exercises , main exercises and cool - down exercises . the warm - up exercises and \n cool - down exercises were conducted focusing on the range of joint motion ( rom ) without pain , \n utilizing cycles and steppers for 10 minutes , alternately . for the purpose of improving the \n lumbar stability and resistance muscles , the main exercises were designed to be individually \n conducted in the form of a circuit training in which the number of repetitions increased \n gradually , utilizing sling and weight exercise equipment . a lumbar extension strength machine ( medx , medx inc . , ocala , fl , usa ) was utilized for the \n evaluation of lumbar extensor strength . the maximum static muscular strength of lumbar \n extension was measured at 7 different angles of lumbar flexion : 0 , 12 , 24 , 36 , 48 , 60 , and \n 72 degrees . passive tests were conducted to determine whether to limit the range of motion \n before measurement . the tests were conducted 12 times at 45 lbs in accordance with the medx \n exercise measurement guidelines . the measurement was performed after fixing the pelvis and \n thigh of the subjects on the support . then , the motion of the lumbar spine was limited \n during measurement by adjusting the footrest . the subjects were asked to increasingly extend \n the lumbar spine by sufficiently considering the limited angular range of motion of the \n joints . the measurements were performed in the same manner at every angle by maintaining \n maximum muscle contraction for about 2 seconds . for the physical stability \n measurements , the total weight distribution index ( wdi ) was calculated by assessing the \n degree of interaction and coordination of the lower body through body away while maintaining \n a standing posture . for data processing , the statistical program spss ( spss inc . , the mean and standard deviation of the measurements was calculated for all metrics . to \n compare the difference between the pre - exercise and post - exercise state of the 8-week \n exercise program , the paired t - test was used and statistical significance was accepted for \n values of p < 0.05 .", "significant differences were observed in lumbar extension strength ( les ) between \n pre - exercise and post - exercise at every angle of lumbar flexion , but no significant \n difference was found in wdi ( % ) ( table \n 1table 1.changes of the les and wdivariableanglepre - exercisepost - exerciseles ( ft - lbs)061.8 33.880.1 31.6**1278.7 33.898.8 33.6**2487.6 36.5116.5 32.7***3698.6 35.9129.7 32.3***48104.7 35.0137.6 30.2***60113.1 36.9146.5 30.5***72122.3 40.1158.7 34.7***wdi ( % ) 5.9 3.35.0 2.8values are mean sd , les : lumbar extension strength , wdi : weight distribution \n index . the post - exercise les were found to be very significantly ( p<0.01 ) higher \n than pre - exercise at 0 degree and 12 degree , and extremity significantly ( p<0.001 ) higher \n than pre - exercise at 24 , 36 , 48 , and 72 degrees of lumbar flexion . values are mean sd , les : lumbar extension strength , wdi : weight distribution \n index .", "this study attempted to identify the positive impacts that were exerted on extension muscle \n strength and stability by an 8-week extension strength exercise program which was performed \n by 26 females with lumbar disc herniation . hnp is caused by the annulus fibrosus that is squeezed into the spinal canal when the \n pulposus nucleus is torn due to a degenerative intervertebral disc . it has been reported \n that approximately 29% of the projected and escaped intervertebral discs are associated with \n the pulposus nucleus17 . chronic back \n pains resulting from hnp aggravate the instability of the lumbar spine , causing degenerative \n changes , atrophy of muscle strength , and reduce flexibility and joint range of motion due to \n trunk damage and instability18 , 19 . lumbar herniated nucleus pulposus does not occur due to \n lumbar pain or disability , but more frequently occurs due to deterioration of the related \n muscles or functions interacting with them adjunctively8 . in addition , it is said that the joint range of motion is limited \n due to the loss of muscle strength and flexibility caused by occupational factors , mode of \n action , specific changes in posture , or degenerative disease18 . these musculoskeletal diseases can be generally improved by utilizing conservative \n treatments such as exercise9 , 18 . rehabilitation exercise therapies for muscular strength \n and stability are important even after surgery10 , \n 16 . various types of composite \n exercises and core exercises in addition to exercises for muscular strength and stability \n are currently being utilized8 , 12 . these exercise therapies help to stabilize the lumbar spine through lumbar and \n trunk dynamic stabilization and exercise modulation , and increase of muscle strength20 . similar to the present study , a study analyzing the impacts of an 8-week functional \n exercise program for lumbar muscle strength , that was performed by 26 females with \n degenerative disc findings , found that there were significant differences between \n pre - exercise and post - exercise15 in \n lumbar muscle extension strength at all 7 angles of lumbar flexion , proving that exercise \n participation develops stability of the muscles around the lumbar spine . in addition , a \n study analyzing the effects of decompression therapy by 4-week joint mobilization that was \n performed for patients with lumbar herniated nucleus pulposus , reported improvements in \n joint range of motion in flexion and extension21 , proving its effectiveness . similarly , a study of13 lumbar traction for patients with lumbar \n herniated nucleus pulposus , and a study11 \n of lumbar discectomy and stabilization exercises for patients with lumbar herniated nucleus \n pulposus , both reported improvements in flexion and extension . the improvements in functions \n pursuant to improved muscle strength and stability were statistically significant , as were \n the results of the studies cited above . therefore , prevention of excessive movement of the \n lumbar spine and trunk , in the patients with chronic back pains or lumbar herniated nucleus \n pulposus can be helpful in their daily life because they secure the joint range of motion , \n thereby improving strength and stability9 . thus , the development of muscular strength for stabilization and integrated exercise for \n pain reduction and rehabilitation help to maintain the range of joint motion , muscle \n strength , and balance21,22,23 . for the \n improvement and rehabilitation of inpaired capacity in daily life due to back \n pain - associated injuries experienced by about 80% of the population a higher occurrence \n rate8 , 10 when recurrence is included muscle weakness , and loss15 of balance the development of an \n integrated exercise program is required . the above results indicate that improving muscle extension strength to enhance and improve \n the functions the patients with chronic back pain or lumbar herniated nucleus pulposus can \n help improve muscle functions and increase the range of joint motion thereby exerting a \n positive impact on physical stability ." ]

[ "this article presents statistics on health care utilization , prices , expenses , employment , and work hours , as well as on national economic activity . some of these statistics are based on sample surveys conducted monthly or quarterly by government agencies or private organizations , and are available 1 to 3 months after the completion of the period . they provide the first glimpse at changes occurring within the general economy and the health care sector . the accompanying tables report selected quarterly statistics for 1990 through the first quarter of 1993 , and the calendar year aggregation of quarterly information in the past 3 years . , this calculation permits analysis of quarterly data to focus on the direction and magnitude of changes , without interference introduced by seasonal fluctuations . in the national health accounts , indicators such as these play an important role in the estimation of the latest historical year of health care expenditures . information that is more comprehensive tends to lag behind the close of a calendar year by 9 to 12 months or more . therefore , we rely extensively on indicators such as these to anticipate and predict changes in health care sector expenditures for the most recent year . other indicators help to identify specific reasons ( e.g. , increases in price inflation or declines in utilization ) for expenditure change . in the following sections , we will identify important indicators of health care and national economic activity and their sources . we then describe what these indicators tell us about general economic and health sector activity during the most recent quarter .", "since 1963 , the american hospital association ( aha ) , in cooperation with member hospitals , has been collecting data on the operation of community hospitals through its national hospital panel survey . community hospitals , which comprised more than 80 percent of all hospital facilities in the united states in 1991 , include all non - federal , short - term general , and other special hospitals open to the public . they exclude hospital units of institutions ; psychiatric facilities ; tuberculosis , other respiratory , and chronic disease hospitals ; institutions for the mentally retarded ; and alcoholism and chemical dependency hospitals . the sample is designed to produce estimates of community hospital indicators by bed size and region ( american hospital association , 1963 - 93 ) . in tables 1 and 2 , statistics covering expenses , utilization , beds , and personnel depict trends in the operation of community hospitals annually from 1990 to 1992 and quarterly for selected quarters from 1990 through 1993 . figure 1 shows changes from the same quarter 1 year earlier in various measures of hospital utilization for 1984 through the first quarter of 1993 . for purposes of national health expenditures ( nhe ) , survey statistics on revenues ( not shown on table 1 ) are analyzed in estimating the growth in the largest component of health care costs community hospital expenditures . this one segment of nhe accounted for 33 percent of all health spending in 1991 ( letsch et al . , 1992 ) . the survey also identifies important factors influencing expenditure growth patterns , such as changes in the number of beds in operation , number of admissions , length of stay , use of outpatient facilities , and number of surgeries .", "the u.s . bureau of labor statistics ( bls ) collects monthly information on employment for all workers , and earnings and work hours for non - supervisory workers in a sample of 370,000 establishments . data are collected through cooperative agreements with state agencies that also use this information to create state and local area statistics . the survey is designed to collect industry - specific information on wage and salary jobs in non - agricultural industries . it excludes statistics on self - employed persons and on those employed in the military ( u.s . department of labor , 1993a ) . approximately 5 percent of the population hold more than one job at any point in time . ( other surveys that are household - based , such as the current population survey [ cps ] , also record employment . in the cps , however , each person 's employment status is counted only once , either as employed , unemployed , or not in the labor force . ) once each year , monthly establishment - based employment statistics are adjusted to benchmarks created from annual establishment census information , resulting in revisions to previously published employment estimates . tables 3 and 4 and figure 2 present statistics on employment , average hourly earnings , and average weekly hours in private ( non - government ) health service establishments . similar statistics for the private non - agricultural sector , included on these tables , provide a basis for comparing the economy as a whole with the health sector in employment , earnings , and work hours . table 5 summarizes business activity in the health sector and the overall economy by measuring change in the implied non - supervisory work hours and payroll . implied work hours are the product of the number of non - supervisory employees and average weekly hours . implied non - supervisory payrolls figure 3 shows changes from the same quarter 1 year earlier in non - supervisory payroll for 1984 through the first quarter of 1993 . for purposes of nhe , changes in work hours by industry combined with changes in prices ( discussed in a later section ) can be used to gauge the direction and magnitude of expenditure change in specific industries . we use these composite indicators in the estimation of growth in physician and dental expenditures for the most recent period . we study the historical relationship of changes in this indicator to changes in expenditures , and estimate this relationship for the most recent period .", "bls publishes monthly information on changes in prices paid by consumers for a fixed market basket of goods and services . tables 6 and 7 and figure 4 present information on the consumer price index ( cpi ) for all urban consumers that measures changes in prices faced by 80 percent of the non - institutionalized population in the united states . ( the more restrictive wage earner cpi gauges prices faced by wage earners and clerical workers . these workers account for 32 percent of the non - institutionalized population [ u.s . the index reflects changes in prices charged for the same quality and quantity of goods or services purchased in the base period . for most items , the base period of 1982 - 84 is used to define the share of consumer expenditures purchasing specific services and products . those shares or weights remain constant in all years , even though consumption patterns of the household may change over time . cpis for health care goods and services depict price changes for out - of - pocket expenditures made directly by consumers . the composite cpi for medical care weights together product - specific or service - specific cpis in proportion to household out - of - pocket expenditures for these items . for example , the composite medical care cpi measures inflation for the 3 percent of hospital expenditures that are made out - of - pocket by consumers ; the remaining 97 percent of the costs of hospital care paid by private health insurers , medicare , medicaid , and other payers are not weighted into the cpi for medical care . in addition , some medical care sector indexes measure changes in list or charged prices , rather than in the prices actually received by providers after discounts are deducted . in several health care areas , received or transaction prices are difficult to capture , although bls is making advances in this area . in the nhe , a combination of cpis for selected medical care items , input price indexes for nursing homes , and the cpi for hospital and related services , adjusted by the health care financing administration ( hcfa ) to provide transaction price changes , are used as measures of inflation for the health industry . the indexes are used to develop a fixed - weight price index for personal health care to depict price changes affecting the entire health care industry more accurately than does the overall cpi medical care index ( letsch , 1993 ) . in 1979 , hcfa developed the medicare hospital input price index ( hospital market basket ) , which was designed to measure the pure price changes associated with expenditure changes for hospital services . in the early 1980s , the skilled nursing facility ( snf ) and home health agency ( hha ) input price indexes , often referred to as market baskets , were developed to price a consistent set of goods and services over time . also , in the early 1980s , the original medicare hospital input price index was revised for use in updating payment rates for the prospective payment system ( pps ) . all of these indexes have played an important role in helping to set medicare payment percent increases , and in understanding the contribution of input price increases to growing health expenditures . the input price indexes , or market baskets , are laspeyres or fixed - weight indexes that are constructed in two steps . for example , for the pps hospital input price index , the base period is 1987 . cost categories , such as food , fuel , and labor , are identified and their 1987 expenditure amounts determined . the proportion or share of total expenditures included in specific spending categories second , a price proxy is selected to match each expenditure category : its purpose is to measure the rate of price increase of the goods or services in that category . the price proxy index for each spending category is multiplied by the expenditure weight for that category . the sum of these products ( weights multiplied by the price index ) over all cost categories yields the composite input price index for any given time period , usually a fiscal year or a calendar year . the percent change in the input price index is an estimate of price change over time for a fixed quantity of goods and services purchased by a provider . the input price indexes are estimated on a historical basis and forecasted over several years . the hcfa - chosen price proxies are forecasted under contract with data resources , inc./mcgraw - hill ( dri ) . following every calendar year quarter , in march , june , september , and december , dri updates its macroeconomic forecasts of wages and prices based on updated historical information and revised forecast assumptions . some of the data in tables 8 through 13 are forecasted , and are expected to change as more recent historical data become available and subsequent quarterly forecasts are received . the methodology and price proxy definitions used in the input price indexes are described in the federal register notices that accompany the revisions of the pps , hha , and snf cost limits . a description of the current structure of the pps input price index was published in the september 4 , 1990 federal register . the most recent pps update for payment rates was published in the september 1 , 1992 federal register . the latest hha regulatory input price index was published in the july 1 , 1992 federal register , and the latest snf input price index was published in the october 7 , 1992 federal register . periodically , the input price indexes are revised to a new base year so that cost weights will reflect changes in the mix of goods and services that are purchased . each revision allows for new base weights , a new base year , and changes to certain price variables used for price proxies . each input price index is presented in two tables : the first is a percent - change table , and the second provides the actual index numbers from which the percentages were computed . figure 5 shows a comparison in the growth of the pps input price index with the cpi all items .", "bls publishes monthly information on changes in prices paid by consumers for a fixed market basket of goods and services . tables 6 and 7 and figure 4 present information on the consumer price index ( cpi ) for all urban consumers that measures changes in prices faced by 80 percent of the non - institutionalized population in the united states . ( the more restrictive wage earner cpi gauges prices faced by wage earners and clerical workers . these workers account for 32 percent of the non - institutionalized population [ u.s . the index reflects changes in prices charged for the same quality and quantity of goods or services purchased in the base period . for most items , the base period of 1982 - 84 is used to define the share of consumer expenditures purchasing specific services and products . those shares or weights remain constant in all years , even though consumption patterns of the household may change over time . cpis for health care goods and services depict price changes for out - of - pocket expenditures made directly by consumers . the composite cpi for medical care weights together product - specific or service - specific cpis in proportion to household out - of - pocket expenditures for these items . for example , the composite medical care cpi measures inflation for the 3 percent of hospital expenditures that are made out - of - pocket by consumers ; the remaining 97 percent of the costs of hospital care paid by private health insurers , medicare , medicaid , and other payers are not weighted into the cpi for medical care . in addition , some medical care sector indexes measure changes in list or charged prices , rather than in the prices actually received by providers after discounts are deducted . in several health care areas , received or transaction prices are difficult to capture , although bls is making advances in this area . in the nhe , a combination of cpis for selected medical care items , input price indexes for nursing homes , and the cpi for hospital and related services , adjusted by the health care financing administration ( hcfa ) to provide transaction price changes , are used as measures of inflation for the health industry . the indexes are used to develop a fixed - weight price index for personal health care to depict price changes affecting the entire health care industry more accurately than does the overall cpi medical care index ( letsch , 1993 ) .", "in 1979 , hcfa developed the medicare hospital input price index ( hospital market basket ) , which was designed to measure the pure price changes associated with expenditure changes for hospital services . in the early 1980s , the skilled nursing facility ( snf ) and home health agency ( hha ) input price indexes , often referred to as market baskets , were developed to price a consistent set of goods and services over time . also , in the early 1980s , the original medicare hospital input price index was revised for use in updating payment rates for the prospective payment system ( pps ) . all of these indexes have played an important role in helping to set medicare payment percent increases , and in understanding the contribution of input price increases to growing health expenditures . the input price indexes , or market baskets , are laspeyres or fixed - weight indexes that are constructed in two steps . for example , for the pps hospital input price index , the base period is 1987 . cost categories , such as food , fuel , and labor , are identified and their 1987 expenditure amounts determined . second , a price proxy is selected to match each expenditure category : its purpose is to measure the rate of price increase of the goods or services in that category . the price proxy index for each spending category the sum of these products ( weights multiplied by the price index ) over all cost categories yields the composite input price index for any given time period , usually a fiscal year or a calendar year . the percent change in the input price index is an estimate of price change over time for a fixed quantity of goods and services purchased by a provider . the input price indexes are estimated on a historical basis and forecasted over several years . the hcfa - chosen price proxies are forecasted under contract with data resources , inc./mcgraw - hill ( dri ) . following every calendar year quarter , in march , june , september , and december , dri updates its macroeconomic forecasts of wages and prices based on updated historical information and revised forecast assumptions . some of the data in tables 8 through 13 are forecasted , and are expected to change as more recent historical data become available and subsequent quarterly forecasts are received . the methodology and price proxy definitions used in the input price indexes are described in the federal register notices that accompany the revisions of the pps , hha , and snf cost limits . a description of the current structure of the pps input price index was published in the september 4 , 1990 federal register . the most recent pps update for payment rates was published in the september 1 , 1992 federal register . the latest hha regulatory input price index was published in the july 1 , 1992 federal register , and the latest snf input price index was published in the october 7 , 1992 federal register . periodically , the input price indexes are revised to a new base year so that cost weights will reflect changes in the mix of goods and services that are purchased . each revision allows for new base weights , a new base year , and changes to certain price variables used for price proxies . each input price index is presented in two tables : the first is a percent - change table , and the second provides the actual index numbers from which the percentages were computed . figure 5 shows a comparison in the growth of the pps input price index with the cpi all items .", "national economic indicators provide a context for understanding health - specific indicators and how change in the health sector relates to change in the economy as a whole . tables 14 and 15 and figure 6 present national indicators of output , employment , and inflation . economy as the value of output produced within the geographic boundaries of the united states by u.s . or foreign citizens or companies . real gdp removes the effects of prices from the valuation of goods and services produced , so that the growth of real gdp reflects changes in the physical output of the economy ( u.s . department of commerce , 1993 ) . growth in operating expenses for community hospitals slowed considerably in the first quarter of 1993 , increasing 7.5 percent . the deceleration continued steadily throughout 1992 , but appears to have leveled off in the first quarter of 1993 . all measures of utilization admissions , inpatient days , surgical operations , and outpatient visits grew more slowly or decelerated faster than they had during the first quarter of 1992 at the height of the flu epidemic . total employment in the health service sector continued to grow at nearly the same rate as in 1992 . in the first quarter of 1993 , there were 360,900 more health services jobs than in the first quarter of 1992 , an increase of 4.3 percent . for non - supervisory workers , the health service sector , maintaining steady employment growth during 1991 , appeared immune to the recent recession marked by sagging total private sector employment growth . in the past three quarters , growth in health services employment also appears to be unaffected by the recent upsurge in employment growth for all private , non - agricultural establishments , as health sector employment growth remains steady ( figure 2 ) . implied work hours ( the product of the number of non - supervisory employees and average weekly hours ) in private health service establishments grew at a rate lower than in any quarter since 1987 , 3.7 percent . slow growth was caused by the decline in average hours worked per week , rather than a slowing in employment growth . this may signal an impending slowdown in employment for the health service sector , as employers initially cut work hours rather than lay off workers when faced with falling demand for services . growth for implied payroll ( work hours times average hourly earnings ) in private health service establishments was also at its lowest since 1987 . growth in implied payroll for private hospitals has followed this trend as well , and may be one reason for the deceleration in operating - expense growth seen in the aha panel survey ( as previously noted ) . medical prices , as measured by the cpi for medical care , continued to increase more rapidly than prices for all other items . in the first quarter of 1993 , prices for medical care increased 6.3 percent from the first quarter of 1992 , more than two times the 2.9-percent growth for all other items . however , the gap between price increases for medical care and all other items has gotten smaller than what it was throughout 1992 ( figure 4 ) . although growth for nearly all components of the medical care cpi has decelerated , the most dramatic slowdown in growth occurred with the prices of prescription drugs . in calendar year 1991 , the cpi for prescription drugs increased 9.9 percent . in 1992 first , there has been a price war among retail establishments selling prescription drugs . as the number of non - traditional types of retail outlets has grown , competition against the traditional retail pharmaceutical outlets increased . mass - merchandisers , such as walmart , are competing for the business of prescription drug customers . secondly , recent proposals on health care reform have pharmaceutical manufacturers concerned about the free - market privileges from which they have historically benefitted . conceivably , manufacturers and wholesalers have been voluntarily holding pricing down in an effort to avoid being faced with less desirable , mandatory price controls . evidence of the behavior of drug manufacturers can be found in the producer price index ( ppi ) for pharmaceuticals , which measures average changes in prices received by domestic producers of commodities in all stages of processing . growth in the ppi for pharmaceuticals decelerated at nearly the same rate as the cpi for prescription drugs . in calendar year 1991 , the ppi for pharmaceuticals increased 8.4 percent . by the first quarter of 1993 , growth in this ppi slowed to 4.6 percent . in the first quarter of 1993 , overall economic conditions continued to improve modestly , as shown by the eighth straight quarter of positive growth in real gdp . the unemployment rate ( 7.0 percent ) was lower than it had been since the fourth quarter of 1991 . total employment in private non - agricultural establishments increased 1.3 percent , which is the largest increase experienced in nearly 3 years .", "growth in operating expenses for community hospitals slowed considerably in the first quarter of 1993 , increasing 7.5 percent . the deceleration continued steadily throughout 1992 , but appears to have leveled off in the first quarter of 1993 . all measures of utilization admissions , inpatient days , surgical operations , and outpatient visits grew more slowly or decelerated faster than they had during the first quarter of 1992 at the height of the flu epidemic . total employment in the health service sector continued to grow at nearly the same rate as in 1992 . in the first quarter of 1993 , there were 360,900 more health services jobs than in the first quarter of 1992 , an increase of 4.3 percent . for non - supervisory workers , the health service sector , maintaining steady employment growth during 1991 , appeared immune to the recent recession marked by sagging total private sector employment growth . in the past three quarters , growth in health services employment also appears to be unaffected by the recent upsurge in employment growth for all private , non - agricultural establishments , as health sector employment growth remains steady ( figure 2 ) . implied work hours ( the product of the number of non - supervisory employees and average weekly hours ) in private health service establishments grew at a rate lower than in any quarter since 1987 , 3.7 percent . slow growth was caused by the decline in average hours worked per week , rather than a slowing in employment growth . this may signal an impending slowdown in employment for the health service sector , as employers initially cut work hours rather than lay off workers when faced with falling demand for services . growth for implied payroll ( work hours times average hourly earnings ) in private health service establishments was also at its lowest since 1987 . growth in implied payroll for private hospitals has followed this trend as well , and may be one reason for the deceleration in operating - expense growth seen in the aha panel survey ( as previously noted ) . medical prices , as measured by the cpi for medical care , continued to increase more rapidly than prices for all other items . in the first quarter of 1993 , prices for medical care increased 6.3 percent from the first quarter of 1992 , more than two times the 2.9-percent growth for all other items . however , the gap between price increases for medical care and all other items has gotten smaller than what it was throughout 1992 ( figure 4 ) . although growth for nearly all components of the medical care cpi has decelerated , the most dramatic slowdown in growth occurred with the prices of prescription drugs . in calendar year 1991 , the cpi for prescription drugs increased 9.9 percent . in 1992 this growth decelerated to 7.6 percent . by the first quarter of 1993 , it slowed further to only 5.0 percent . as the number of non - traditional types of retail outlets has grown , competition against the traditional retail pharmaceutical outlets increased . mass - merchandisers , such as walmart , are competing for the business of prescription drug customers . secondly , recent proposals on health care reform have pharmaceutical manufacturers concerned about the free - market privileges from which they have historically benefitted . conceivably , manufacturers and wholesalers have been voluntarily holding pricing down in an effort to avoid being faced with less desirable , mandatory price controls . evidence of the behavior of drug manufacturers can be found in the producer price index ( ppi ) for pharmaceuticals , which measures average changes in prices received by domestic producers of commodities in all stages of processing . growth in the ppi for pharmaceuticals decelerated at nearly the same rate as the cpi for prescription drugs . in calendar year 1991 , the ppi for pharmaceuticals increased 8.4 percent . by the first quarter of 1993 , , overall economic conditions continued to improve modestly , as shown by the eighth straight quarter of positive growth in real gdp . the unemployment rate ( 7.0 percent ) was lower than it had been since the fourth quarter of 1991 . total employment in private non - agricultural establishments increased 1.3 percent , which is the largest increase experienced in nearly 3 years ." ]

[ "urinary retention and voiding dysfunction ( vd ) symptoms ( hesitancy , straining to void , difficulty in starting micturition , diminished stream , and sensations of incomplete emptying of the bladder ) are common and problematic features occurring after surgery for stress urinary incontinence ( sui ) , especially following a mid - urethral sling placement ( retropubic or trans - obturator procedure ) . they can lead to urinary infections , and can also require self - catheterization or sling section . the prevalence of urinary retention varies from 2.216% after surgery for sui.[13 ] preexisting voiding dysfunction is known to be a predictive factor for post - surgery urinary retention . in 2003 hong et al . , showed that the best predictive factor for obstructive complications was the maximum flow rate , with which it was shown to be directly correlated . it is thus important to screen women suffering from sui for emptying symptoms before such surgery . the purpose of this study was to determine whether the completion of a vd questionnaire could have a good predictive value for uroflowmetry findings , in a population of sui women showing no obvious etiologies of obstruction .", "we analyzed 415 sui women from the urodynamic database , who had undergone a filling cystometry in the department , and whose uroflowmetry indicated a total urine volume greater than 200 ml . women with neurological disorders , pelvic organ prolapse , urge or mixed urinary incontinence , detrusor overactivity or previous sui surgery were excluded . with these exclusion criteria , these 93 women were divided into two groups : those who complained of vd symptoms ( vds group ) according to the bristol female lower urinary tract symptoms ( bfluts ) questionnaire , and those without vd symptoms ( non - vds group ) . we investigated the parity , age , menopausal status , and concomitant anorectal disorders of each woman . the women were interviewed on the presence of emptying symptoms , and completed the bfluts questionnaire [ table 1 ] , which is systematic in our department . we screened for five items related to voiding difficulties : hesitancy , slow or intermittent stream , straining , or sensations of incomplete emptying . for the purposes of data analysis , those women who answered never to all five items were classed in the non - vds group . those women for whom one or more of the answers was positive ( i.e. : occasionally , sometimes , most of the time or all the time ) , were classified in the vds group . bristol questionnarire bfluts ( urinary symptoms questionnaire ) : the five items concerning voiding dysfunction the clinical examination included a physical examination , urodynamic testing and a free flow uroflowmetry and filling cystometry at a rate of 50 ml per minute ( duet , medtronic ) . the filling cystometry parameters studied were : compliance , detrusor overactivity ( do ) , detrusor sensation . none of the patients presented with abnormal compliance , do , or abnormal detrusor sensation . both a quantitative and a qualitative analysis of bladder outlet obstruction ( boo ) was made by uroflowmetry . quantitatively , a patient was considered to have boo when a maximum flow rate of less than 15 ml / sec was observed for a urine volume greater than 200 ml , and/or the post - void residual was greater than 50 ml , as measured with a bladder scan or by catheterization . the urine flow was also analyzed in terms of average flow rate , urine volume , voiding time and acceleration ( defined as the maximum flow rate divided by the time taken to reach maximum flow rate ) . the qualitative analysis dealt with the flow patterns : a standard bell - shaped three pathologic patterns were considered : intermittent or continuous polyphasic curves , and flat curves [ figures 1a c ] . we determined the sensitivity and specificity as well as the positive and negative predictive value of the vds questionnaire using the uroflowmetry data . ( a ) intermittent polyphasic curve ( b ) continuous polyphasic curve ( c ) flat curve a comparison of the clinical characteristics and uroflowmetry of the two groups was made using a wilcoxon test for continuous data and a fischer test for categorical data . as the bfluts questionnaire and urodynamics were identical to those systematically used for the routine evaluation of sui women in our department , the study did not require specific ethics committee approbation .", "we analyzed 415 sui women from the urodynamic database , who had undergone a filling cystometry in the department , and whose uroflowmetry indicated a total urine volume greater than 200 ml . women with neurological disorders , pelvic organ prolapse , urge or mixed urinary incontinence , detrusor overactivity or previous sui surgery were excluded . with these exclusion criteria , these 93 women were divided into two groups : those who complained of vd symptoms ( vds group ) according to the bristol female lower urinary tract symptoms ( bfluts ) questionnaire , and those without vd symptoms ( non - vds group ) . we investigated the parity , age , menopausal status , and concomitant anorectal disorders of each woman .", "the women were interviewed on the presence of emptying symptoms , and completed the bfluts questionnaire [ table 1 ] , which is systematic in our department . we screened for five items related to voiding difficulties : hesitancy , slow or intermittent stream , straining , or sensations of incomplete emptying . for the purposes of data analysis , those women who answered never to all five items were classed in the non - vds group . those women for whom one or more of the answers was positive ( i.e. : occasionally , sometimes , most of the time or all the time ) , were classified in the vds group .", "the clinical examination included a physical examination , urodynamic testing and a free flow uroflowmetry and filling cystometry at a rate of 50 ml per minute ( duet , medtronic ) . the filling cystometry parameters studied were : compliance , detrusor overactivity ( do ) , detrusor sensation . none of the patients presented with abnormal compliance , do , or abnormal detrusor sensation . both a quantitative and a qualitative analysis of bladder outlet obstruction ( boo ) was made by uroflowmetry . quantitatively , a patient was considered to have boo when a maximum flow rate of less than 15 ml / sec was observed for a urine volume greater than 200 ml , and/or the post - void residual was greater than 50 ml , as measured with a bladder scan or by catheterization . the urine flow was also analyzed in terms of average flow rate , urine volume , voiding time and acceleration ( defined as the maximum flow rate divided by the time taken to reach maximum flow rate ) . the qualitative analysis dealt with the flow patterns : a standard bell - shaped three pathologic patterns were considered : intermittent or continuous polyphasic curves , and flat curves [ figures 1a c ] . we determined the sensitivity and specificity as well as the positive and negative predictive value of the vds questionnaire using the uroflowmetry data . ( a ) intermittent polyphasic curve ( b ) continuous polyphasic curve ( c ) flat curve", "a comparison of the clinical characteristics and uroflowmetry of the two groups was made using a wilcoxon test for continuous data and a fischer test for categorical data .", "as the bfluts questionnaire and urodynamics were identical to those systematically used for the routine evaluation of sui women in our department , the study did not require specific ethics committee approbation .", "among the 93 women eligible for the study , 61% ( 57/93 ) complained of vd symptoms on the bfluts questionnaire ( vds group ) and 39% ( 36/93 ) had no vd symptoms ( non - vds group ) . patients characteristics are detailed in table 2 . no difference was observed between the two groups concerning age , parity , menopausal status , concomitant anorectal disorders and uroflowmetry parameters . in the vds group , 75% ( 27/36 ) of the women in the non - vds group had normal uroflowmetry , and 25% ( 9/36 ) an abnormal one without symptoms . the positive predictive value of the vds questionnaire was 32% and the negative predictive value was 75% [ table 3 ] . there was no statistical correlation between symptoms and the defined criteria of boo on uroflowmetry ( fischer test : p=0.64 ) . among the 42 women who complained of a sensation of incomplete emptying , only one had a real post - void residual greater than 50 ml . in this sui population without severe pelvic organ prolapse ( baden and walker staging system 1 ) , previous sui surgery , or neurological disorders ( the most frequent etiologies of voiding dysfunction in women ) we found a 29% ( 29/93 ) rate of abnormal uroflowmetry . characteristics of women with and without voiding difficulties symptoms in terms of age , menopausal status , parity , anorectal disorders and uroflowmetry parameters sensitivity , specificity , positive and negative predictive value of voiding dysfunction symptoms on bfluts multivariate analysis ( using multiple logistic regression method ) demonstrated no correlation between symptoms and quantitative uroflowmetry parameters ( maximum and average flow rate , acceleration , urine volume , time to maximum flow and voiding time ) , and no correlation was found between vds and age , menopausal status , parity or concomitant anorectal disorders [ table 4 ] . logistic regression method for multivariate analysis of urodynamic parameters ( maximal and average flow rate , time to void and acceleration ) , age , menopausal status , parity , concomitant anorectal disorders with respect to voiding difficulties symptoms univariate analysis of multiple factors with respect to voiding difficulties symptoms", "our results show that 25% of sui women without obstructive symptoms , i.e. without an obvious cause for bladder outlet obstruction ( no severe genital prolapse ( > grade 1 ) ) , having had no previous surgery for sui , and with no neurological disorders , have an abnormal uroflowmetry , and thus a higher risk of post - surgery obstructive disorders . our study clearly demonstrates the poor predictive value of the vds questionnaire , when compared with urodynamic data . the prevalence of voiding dysfunction symptoms among women is not easy to determine , in contrast to storage symptoms , which are more often related and analyzed . stress urinary incontinence and bladder outlet obstruction ( boo ) can coexist in women ; bradley found 19 cases of boo out of 104 ( 18% ) , defined on the basis of pressure flow studies among women presenting with sui . in our study , we found a high prevalence of vds ( 61% ) , probably because in the vds group we included women with any level of positive response , even those who gave one occasionally response to the vd items ( bfluts questionnaire ) . urodynamic evaluation of the voiding phase in sui women before surgery is useful in order to predict the risk of vd and urinary retention , and to inform women about these potential complications . surgical treatments of sui using mid - urethral sling procedures are known to affect the voiding phase : the spontaneous flow curve changes to a more obstructive pattern in 40% of cases , and the maximum and mean flow rates decrease significantly after one year . the incidence of urinary retention after such procedures ranges from 2.216%.[13 ] postoperative vd induces a decrease in global satisfaction after surgery , and leads to an impairment of the quality of life . factors which correlate highly with a postoperative voiding dysfunction include a preoperative peak flow rate < 15 ml / s ( several studies ) , and an abnormal uroflow pattern or detrusor pressure < 12 cm h2o.[31114 ] therefore , screening for such factors among sui women is critical . one of the main limitations of the current study is the lack of a standard definition for boo in urodynamics for women . since voiding cystometry had not been performed , boo can not be defined urodynamically in the current study . farrar et al . , defined obstruction as qmax < 15 ml / s with a voided volume of 200 ml . we added the flow curve pattern criteria , because a pathological pattern with a normal maximal flow rate can reflect voiding difficulties . moreover , in pressure flow studies in women , the transurethral catheter has a significant impact on the urine flow.[1418 ] however , free flow uroflowmetry is a composite interaction between the detrusor pressure and the resistance produced by the urethra . bladder outlet obstruction as well as impaired detrusor contractility can perturb uroflowmetry . in our population , we needed to detect voiding difficulties , whatever their origin , because among sui women both these causes of voiding disorders can promote obstructive complications after surgery . chassagne et al . , prospectively studied 35 clinically obstructed women and 124 control patients . they determined cutoff values for the pressure flow studies as : qmax<15 ml / s and pdet . qmax > 20 cm h2o , with a sensitivity of 74.3% and a specificity of 91.1% . no information was provided regarding the clinical criteria used to select the clinically obstructed patients . qmax > 20 cm h2o ) during detrusor pressure uroflow studies . among the 38 women considered as obstructed within this definition , they concluded that micturition symptoms relevant to bladder outlet obstruction are non - specific , and that a complete urodynamic evaluation is essential . the correlation between obstructive symptoms and objective urodynamic findings is known to be poor , but has never been studied in this specific population of sui women , for which all cases with a pop - q > stage 1 , previous surgery for sui , or neurological disorders , were excluded . indeed , we excluded the most common etiologies of urodynamic assessment of bladder outlet obstruction . groutz et al . , reported 26% of prior anti - incontinence surgery and 24% of severe genital prolapse in a population of 38 women presenting with urodynamically assessed obstructive criteria . wyndaele et al . , recently confirmed the poor correlation between symptoms and urodynamic data , and a high prevalence of vds in women , whether it be considered to have a pathological origin or not . the absence of voiding symptoms is not a guarantee of normal micturition , since we found that almost one - third of the women not complaining of any voiding difficulty were actually shown to have an abnormal uroflowmetry . previous studies[1421 ] have clearly demonstrated the lack of correlation between symptoms and urodynamic diagnoses , especially for obstructive symptoms . we found the same results , but in a particular population of sui women , with no obvious reasons for obstruction . even in this selected population , in which voiding dysfunctions should be less frequent than in the general population , we found that almost 30% of the patients had an abnormal uroflowmetry .", "no correlation was found between obstructive symptoms and boo as defined on uroflowmetry , in a specific population of sui women ." ]

[ "scurvy is a disease that played an important role in history and used to be the number one killer of sailors . it is still diagnosed in third - world countries because of malnutrition and in epidemic form in refugee camps .", "a 35-year - old patient was seen at the emergency department of a level 1 trauma centre with spontaneous bruisings on the lower extremity . initially , the patient was seen by an orthopaedic surgeon at an outpatient clinic with a painful knee without any preceding trauma . the procedure was postponed twice . at first , the arthroscopy was cancelled because the patient had the flu . the second time the orthopaedic surgeon postponed the operation because of extensive bruising on the right leg ( fig . 1 ) moreover , doctors of the internal medicine and dermatology department were consulted to explore the origin of the haematomas . 2 ) and a biopsy was performed . at the time of the current presentation at the emergency department , because of the progression of the haematomas to the patients left leg , the surgeon was consulted to rule out an active bleeding focus . \n figure 1:small bruises on the upper legs . \n the patient was an electrician , currently unemployed because of knee problems . since 10 weeks the haematomas on his right leg occurred after an episode of flu a month ago ( fig . ever since , he had been exhausted , and he had spent the majority of his time in bed . his dentist proposed to remove the decaying teeth . according to the patient , the bad teeth apparently , the patients eating regimen only consisted of bread , sometimes with spread , but mostly without any additions . for this eating habit on physical examination , we encountered a pale patient with haematomas on his upper legs , generally green / blue or yellow coloured . laboratory tests revealed anaemia with a haemoglobin drop of 2.5 points in 2 weeks ( from 8.6 to 5.7 mmol / l ) . no surgical cause for the haematomas was found . instead , the diagnosis of a severe vitamin c deficiency ( scurvy ) by malnutrition due to his eating disorder was considered . after laboratory blood tests were drawn to confirm the diagnosis , vitamin c supplements were started .", "it is regrettable that the united east india company ( voc ) lost more sailors on scurvy than on the battlefield during the seventeenth century . scurvy was one of the limiting factors for travelling long distances on ships because of the absence of fresh food , fruit and vitamins . scurvy was first described by hippocrates . later in 1753 , a surgeon of the royal navy described how citrus fruits enhanced the symptoms of scurvy . in 1930 , it was discovered that depletion of vitamin c level was the cause . vitamin c is needed for the synthesis of collagen , which is essential for firmness of the blood vessels . in patients with scurvy , the presentation of scurvy is often malaise , fatigue , stiff joints and bruising , mostly on the upper thighs and legs . the next stage consists of open wounds , jaundice , fever , loss of teeth and finally death . scurvy does not occur in most animals as they can synthesize their own vitamin c in contrast with the human , for example guinea pigs and certain monkey species . treatment is relatively simple with a versatile diet with citrus fruits , sweet peppers and tomatoes . the recommended daily quantity of vitamin c is 75 mg for women and 90 mg for man ( http://www.who.int/en/ ) , but up to 40% more can be necessary in smokers and during infection . nowadays , scurvy occurs predominantly in developed countries because of malnutrition , and frequently epidemics are reported from the lesser civilized areas . this present case report emphasizes that scurvy may still occur in developed countries and that patients with scurvy could be encountered by physicians of multiple medical disciplines . scurvy should be considered in risk groups , e.g. singles , patients with eating disorder , students , elderly , alcohol abusers and patients after gastric surgery [ 5 , 6 ] . recently , in wales ( uk ) in 2011 , a young patient died of scurvy ( http://www.bbc.com/news/uk-wales-31039895 ) . however , even in these modern timeframe , groups with a high risk of vitamin deficiencies can be discerned . in our patient , the biopsy could have been avoided , and supplements could have been initiated more quickly in case of higher awareness of the signs and symptoms of vitamin c deficiency .", "" ]

[ "human movement can be classified into walking and running , the latter of which easily \n fatigues the lower limb muscles1,2,3,4 . during running , the lower limbs must cope with the repeated \n transient impact of vertical ground reaction force ( grf ) , which is an abrupt collision force \n equal to about 1.5- to 3-fold the body weight5 . such repeated impacts are considered to cause lower limb muscle \n fatigue via chronic irritation . the incidence of running injury is affected by the running \n velocity and distance ran . investigated 17,000 patients6 and found a significantly higher incidence of osteoarthritis \n in men who were involved in running > 20 miles per week . koplan et al . found that the \n risk of injury increased with increasing weekly distance3 . on the other hand , imai et al.7 found that the number of marathon athletes who stopped running \n within four hours was significantly high . running \n faster generally produces greater ground reaction force ( grf ) and imposes greater stress on \n various parts of the body8 , 9 . running injuries occur most frequently in the knee , \n foot / ankle , and lower leg according to taunton , et al.10 , who found that the most common overuse injuries included \n patellofemoral pain syndrome , iliotibial band friction syndrome , and plantar fasciitis . running velocity is affected by various conditions including individual running ability . we \n postulated that the load imposed on the lower limbs would change at different running \n velocities . furthermore , because portion failure differs among individuals , the load applied \n to each muscle is probably not uniform . therefore , we analyzed muscle \n activity under free walking , jogging ( 8.7 km / h ) , and running ( 8.8 km / h ) conditions on a \n treadmill .", "ten male students without leg injuries ( age , 23.2 6.5 y ; height , 170.4 5.7 cm ; weight , \n 67.6 11.1 kg ; bmi , 23.3 3.2 ) provided written informed consent to participate after \n receiving an oral and written explanation of the study and its purpose . the ethics review \n board at heisei college of health sciences approved this study ( no . the \n participants did not routinely run but participated in recreational sports once or twice \n each week . muscle activity was measured by surface electromyography using a telemyo g2 and \n myoresearch xp ( noraxon usa inc . , scottsdale , az , usa ) with disposable m-00-s blue sensor \n polymer electrodes ( ambu a / s , ballerup , denmark ) attached to the belly of the muscle while \n the participants moved on a gait trainer system 2 treadmill ( biodex medical systems inc . muscle output was recorded at 30 frames / sec using a video camera to \n synchronize the movements with the electromyographic data . activity was assessed at the left \n vastus medialis , vastus lateralis , hip adductors , tibialis anterior , lateral head of \n gastrocnemius , medial head gastrocnemius , and soleus . maximum voluntary isometric contraction ( mvc ) was determined as manual resistance against a \n maximally contracted muscle . the participants walked , jogged , and ran for 10 minutes in \n random order , and the myogenic potentials were measured for 30 seconds 10 minutes later . \n analog signals of myogenic potential were processed using a band - pass filter ( 10500 hz ) at \n a sampling frequency of 1,000 hz . the greater trochanter , lower limb joint space , and lateral malleolus of the left hip , \n knee , and ankle were marked with tape to measure the range of motion . one 30-second cycle of \n walking , jogging , and running recorded with the video camera was selected , and then initial \n contact , mid stance , toe off , and the range of motion of hip flexion , knee flexion , and \n ankle dorsiflexion were measured on printouts . in addition , using the time required for one \n cycle , stride was calculated . electromyographic data were analyzed using the average value of each muscle output and \n central frequency . the average activity was calculated from 30-second cycles of walking , \n jogging , and running , including both the swing and stance phases . these output values were \n divided by the mvc to determine the % mvc of each muscle . in addition , lower limb joint \n angles on printouts were measured using a protractor . the data were analyzed using a one - way \n analysis of variance , and statistical significance was accepted at p < 0.05 .", "the average walking , jogging , and running speeds were 3.6 0.4 , 6.7 0.6 , and 10.4 \n 1.3 km / h , respectively . the average electromyographic activities of the vastus medial , tibialis anterior , medial \n head of the gastrocnemius , and lateral head of the gastrocnemius were significantly higher \n during jogging and running compared with walking . the hip adductors and vastus lateralis did not significantly \n differ ( table 1table 1.average % mvc of muscles ( n=10)walkingjoggingrunningvastus medialis12.52.735.85.3 * 38.84.6*vastus lateralis17.16.136.38.137.76.8hip adductors31.26.741.07.250.17.1tibialis anterior14.31.329.33.8 * 37.63.0*lateral head of the gastrocnemius16.03.042.68.5 * 40.86.2*medial head of the gastrocnemius30.83.758.17.6 * 63.35.3*soleus18.45.039.67.844.86.2*values are meansse . * p<0.05 , vs. walking . ) . the maximal electromyographic activities of the vastus medialis during jogging and running \n and medial head of the gastrocnemius during running were significantly higher than during \n walking ( table 2table 2.maximum % mvc of muscles ( n=10)walkingjoggingrunningvastus medialis54.87.6105.915.2 * 135.711.5*vastus lateralis68.129.0103.117.0134.423.6hip adductors147.231.598.620.2137.320.0tibialis anterior54.16.385.820.787.87.9lateral head of the gastrocnemius69.014.4125.527.7136.515.1medial head of the gastrocnemius129.921.6190.427.8224.226.0*soleus103.351.8113.625.9179.028.6values are meansse . the central frequency did not significantly differ ( table 3table 3.average central frequency of muscles ( n=10)walkingjoggingrunningvastus medialis23.16.437.95.932.46.4vastus lateralis29.75.840.35.641.86.9hip adductors15.24.120.44.123.33.4tibialis anterior59.86.066.06.566.17.4lateral head of the gastrocnemius34.37.142.77.255.76.0medial head of the gastrocnemius50.07.362.59.963.19.2soleus61.27.645.18.259.711.8values are meansse ) . the angle of the knee at initial contact , mid stance , and toe off significantly differed , \n with the knee being more flexed during jogging and running than walking the knee being more \n flexed during running than jogging at mid stance and toe off ( table 4table 4.average left lower limb joint angles ( n=10)walkingjoggingrunninghip joint flexionic20.52.424.52.228.02.9ms10.51.623.51.5 * 28.51.7*to6.02.23.02.6 * 5.51.9*knee joint flexionic4.22.114.82.2 * 17.22.0*ms15.02.141.51.5 * 48.01.5*,**to57.11.338.92.4 * 25.42.4*,**ankle joint dorsiflexionic2.23.64.02.06.21.1ms6.51.320.01.7 * 22.01.3*to14.82.214.82.720.13.5values are meansse . * p<0.05 , vs. walking . * * p<0.05 , vs. jogging . ic : initial \n contact , ms : mid stance , to : toe off ) . ic : initial \n contact , ms : mid stance , to : toe off the average lengths of the running stride were significantly longer than those of jogging \n and walking . also , that of jogging was significantly longer than that of walking ( table 5table 5.average length of stride ( n=10)walkingjoggingrunningstride ( m)1.240.041.460.06 * 2.140.08*,**values are meansse .", "hreljac identified training , anatomy , and biomechanical factors as risk factors associated \n with running , since fast running generates considerable grf and training to run stresses the \n joints , muscles , and ligaments12 . the \n present study investigated differences in the amount of muscle activity during walking , \n jogging , and running . all participants walked freely at their own pace and then jogged at \n 8.7 km / h and ran at 8.8 km / h . the central frequency of each muscle seemed to remain essentially unchanged between running \n and jogging compared with walking , and fatigue did not arise . the vastus lateralis and \n vastus medialis of the quadriceps not only act on the lower limb during running or walking \n but also suppress damage to the knee during weight - bearing in the stance phase . therefore , \n we speculated that the amount of muscle activity would increase as the grf increases . the \n averaged values of the vastus medialis were significantly higher during running and jogging \n compared with walking . brownstein et al.13 found that a knee position that is more flexed than extension is \n due to the amount of activity of the vastus medialis . the present study found that the knees \n were flexed significantly more during running and jogging compared with walking at initial \n contact and during mid stance . these findings support the notion that the vastus medialis \n works easily during jogging and running . in addition , kim et al.14 showed that the amount of activity in the vastus medialis \n rose in response to an elevated walking speed . furthermore , in a previous study15 , we compared the muscle activity during \n jogging and walking at the same velocity . in this study , the activity of the vastus medialis \n during jogging was significantly higher , and the knee joints exhibited significant flexion \n during jogging . load was \n especially applied in the direction of internal rotation in the stance phase . a study by ono \n et al.17 showed that the output of the \n vastus medialis was increased in the lower leg during internal rotation . on the other hand , \n the output at 90 of flexion between knee extension from the vicinity of the vastus \n lateralis muscle did not significantly change13 . in addition , the activity of the vastus lateralis muscle during \n walking was significantly higher , which could account for the small difference between \n walking and running . the average \n values of the adductor muscles did not significantly differ among walking , jogging , and \n running . along with the outer muscles of the hip joint such as the gluteus medius , the \n adductor muscles maintain the inner - outer intermediate position of the lower limb during \n running . the types of hip movement involved in running are primarily flexion and extension , \n with minimal adduction and abduction . in addition , because the treadmill floor is \n horizontal , the trunk is also likely to become upset . therefore , we considered that the \n adductor muscles do not play significant roles in walking , jogging and running . the averages values for the tibialis anterior muscle were significantly higher during \n running and jogging compared with walking . the tibialis anterior muscle contracts either \n centrifugally or isometrically before and after initial contact to control the foot to \n prevent falling18 , 19 . this muscle was significantly more contracted during running and \n jogging , perhaps because movement was faster . the average values of the lateral and medial heads of the gastrocnemius were significantly \n higher during running and jogging compared with walking . the gastrocnemius works from the \n loading response to the terminal stance between the stance phase18 . the knee joint extends in the late stance phase of the \n running stride via plantar flexion of the ankle joint . the force exerted on the achilles \n tendon during running exceeds 12-fold the weight of the runner20 . a large output by the gastrocnemius is required to \n advance the body during running . the average value of the soleus muscle was significantly higher during running than during \n walking . the soleus is a single joint muscle that runs from the proximal portion of the \n tibia and fibula to the achilles tendon . thus , the amount of muscle activity is not affected \n by the angle of the knee joint . because the knee flexes deeply in mid stance during running , \n more extension is required at toe off , and thus a large force is required for the triceps \n surae muscle . under such conditions , the soleus muscle works more easily than the \n gastrocnemius , which is a biarticular muscle . according to mann et al.21 , the angle of \n the lower limbs and the amount of muscle activity increases during running at higher \n velocities compared with walking . the stance phase is longer than the swing phase during \n walking but is shorter during running . according to kluitenberg et al.22 , grf on a treadmill and on the ground increases in the \n same way when aramptzis et al.23 reported that the mechanical power of the knee joint and \n ankle joint increases with increasing running velocity , and the present study found that , \n the stride was extended in accordance with the increase in velocity . we considered that \n exercise load is greater during running compared with walking due to these factors . the \n present study found that the amount of activity in the soleus muscle was significantly \n higher during running and jogging compared with the amounts of activity in the vastus \n medialis , tibialis anterior , and gastrocnemius muscle , which are involved in walking . \n therefore , it was suggested that an increase in velocity causes these muscles to carry a \n heavier load ." ]

[ "", "the online version of this article ( doi:10.1007/s13300 - 015 - 0133-z ) contains supplementary material , which is available to authorized users .", "chronic kidney disease ( ckd ) is a common condition in patients with type 2 diabetes ( t2 dm ) . an estimated 2035% of patients with t2 dm have moderate to severe renal impairment [ 1 , 2 ] . however , many antihyperglycemic medications are contraindicated or need to be used with caution in patients with ckd , complicating t2 dm treatment choices and management . patients with t2 dm and ckd are particularly susceptible to safety and tolerability issues related to many classes of oral antihyperglycemic agents ( oaha ) . dipeptidyl peptidase-4 inhibitors ( dpp-4i ) such as sitagliptin are well tolerated in a broad range of t2 dm patient types , including those with renal disease , and may therefore be preferentially used in patients with ckd . prior studies have demonstrated the preferential use of sitagliptin in several populations [ 47 ] . in general , patients initiating treatment with sitagliptin were older and had more complications of diabetes and comorbidities than patients initiating other antihyperglycemic therapies [ 47 ] . if not recognized and appropriately considered in the analysis , this preferential selection of patients with specific demographic and disease characteristics for treatment with sitagliptin ( channeling bias ) could lead to inaccurate treatment effect estimates in comparative analyses that include sitagliptin . the objective of this study was to describe the baseline characteristics of patients with t2 dm and ckd initiating treatment with sitagliptin or non - dpp-4i oahas to ascertain whether channeling exists in this patient population .", "the truven health marketscan databases ( marketscan , truven health analytics , ann arbor , mi , usa ) contain medical claims records for more than 150 million unique patients dating from 1996 . the records are derived from outpatient and inpatient insurance claims for employees of over 100 employers participating in more than 12 health plans , and their beneficiaries in the united states . records consist of commercial claims and healthcare encounters , including information on demographics , health plan membership , international classification of diseases , ninth revision , clinical modification ( icd-9-cm ) codes , and current procedure terminology ( cpt ) codes . the records of retirees with supplemental insurance are included in the database thus providing data on the elderly with continuity of care across those < 65 and 65 years of age . patients 25 years of age with t2 dm and ckd , with claims in the united states ( us ) between january 2006 and june 2012 , were identified in marketscan . of these patients , those initiating sitagliptin or a non - dpp-4i oaha were categorized by complexity of antihyperglycemic treatment . patients were identified as having t2 dm if marketscan records for the patient indicated at least one inpatient or outpatient diagnosis of diabetes and at least one prescription for oaha medication . patients with ckd were identified by icd-9-cm diagnostic codes ( 585 , 585.3 , 585.4 , 585.5 , 585.6 , 585.9 , 403 , 403.0 , 403.00 , 403.01 , 403.1 , 403.10 , 403.11 , 403.9 , 403.90 , 403.91 , 250.4 , 404 , 404.0 , 404.00 , 404.01 , 404.02 , 404.03 , 404.1 , 404.10 , 404.11 , 404.12 , 404.13 , 404.9 , 404.90 , 404.91 , 404.92 , 404.93 , 582 , 582.0 , 582.1 , 582.2 , 582.4 , 582.8 , 582.81 , 582.89 , 582.9 ) . antihyperglycemic treatment was defined as : ( 1 ) initiating monotherapy ( 1 new outpatient prescription record on or after the t2 dm diagnosis ) ; ( 2 ) escalating to dual combination therapy ( 1 new prescription for a 2nd class 90 days after the 1st class , with prescription for 1st class overlapping the index date of 2nd class ) ; ( 3 ) escalating to triple combination therapy ( 1 new prescription for a 3rd class 90 days after the 2nd class , with prescriptions for 1st and 2nd classes overlapping the index date of 3rd class ) . patients were required to have at least 1 year of continuous enrollment in the database prior to initiation / escalation of antihyperglycemic treatment . patients were excluded from the analysis if they had a diagnosis of type 1 diabetes , ketoacidosis , malnutrition - associated diabetes , drug - induced diabetes or gestational diabetes without a subsequent t2 dm diagnosis code . patients with icd-9-cm codes explicit for mild renal disease ( stage 1 and 2 ) and patients on insulin or other injectable therapy were also excluded from the analysis . demographics , and clinical conditions and health care resource utilization recorded up to 5 years before therapy initiation were assessed as baseline characteristics . over 70 clinical conditions and comorbidities may have been recorded in the database , including diabetes complications , cancers , and cardiovascular ( cv ) , metabolic , gastrointestinal , hepatic , infectious , psychiatric , pulmonary , and neurological events . types of health care resource utilization recorded in the database included physician and emergency department visits , hospitalizations , days hospitalized , and number of medications received . differences between sitagliptin and non - dpp-4i oaha treatment groups were compared using absolute standardized differences ( asd ) . asd is the difference of two means or proportions divided by the pooled estimate of the standard deviation . unlike the traditional p value , asd is a measure of difference that is not influenced by large sample sizes and has been demonstrated to be a better measure of covariate balance [ 10 , 12 ] . an asd of at least 10% was used to indicate a meaningful difference between treatment groups . this article does not contain any new studies with human or animal subjects performed by any of the authors .", "a total of 35,922 patients with t2 dm and ckd were identified as meeting the inclusion criteria . over 45% of patients ( 46.7% ; n = 16,742 ) initiated sitagliptin ( n = 1234 ) or a non - dpp-4i oaha monotherapy ( n = 15,508 ) , 40.5% ( n = 14,540 ) initiated an escalation to dual combination therapy ( sitagliptin , n = 2683 ; oaha , n = 11,857 ) , and 12.9% ( n = 4640 ) initiated an escalation to triple combination therapy ( sitagliptin , n = 1385 ; oaha , n = 3255 ) . roughly , 15% of patients with t2 dm and ckd ( 14.8% ; n = 5302 ) initiated treatment with sitagliptin . in comparison , in the patients excluded from this analysis due to a lack of recorded ckd , the percentage of patients initiating sitagliptin was 7.4% . the greatest differences between treatment groups were observed in patients initiating monotherapy or an escalation to dual combination therapy . compared to patients initiating monotherapy with non - dpp-4i oahas , patients initiating monotherapy with sitagliptin were older ( mean [ standard deviation ( sd ) ] : sitagliptin 68.8 [ 12.5 ] years , non - dpp-4i 66.6 [ 12.8 ] years ; asd 17% ) , were more likely to have a history of heart failure ( fig . 1a ; sitagliptin 23.0% , non - dpp-4i 18.6% ; asd 11% ) or arrhythmia ( fig . 1a ; sitagliptin 37.7% , non - dpp-4i 31.7% ; asd 13% ) , were more likely to use loop diuretics ( fig . 1a ; sitagliptin 44.2% , non - dpp-4i 38.0% ; asd 13% ) or beta - blockers ( fig . 1a ; sitagliptin 66.3% , non - dpp-4i 61.3% ; asd 11% ) , and had more physician visits ( fig . 1b ; mean [ sd ] : sitagliptin 73.2 [ 57.6 ] physician visits , non - dpp-4i 66.3 [ 55.4 ] physician visits ; asd 12% ) . the differences between treatment groups ( non - dpp-4i oaha users versus sitagliptin users ) observed in patients initiating an escalation to dual therapy were similar to those observed in patients initiating monotherapy , with the exception that the between - group age difference was not as great ( mean [ sd ] : sitagliptin 71.1 [ 11.1 ] years , non - dpp-4i 70.0 [ 11.0 ] years ; asd 10% ) and the differences for history of arrhythmia and use of beta - blockers were not meaningful ( fig . 1c , d).fig . 1baseline characteristics of patients with type 2 diabetes and chronic renal disease up to 5 years before initiating treatment with sitagliptin or non - dpp-4i oral antihyperglycemic agent as monotherapy or as part of dual or triple therapy . a , c , e clinical conditions and comorbidities . asd of 10% indicates a meaningful difference between treatment groups . for any between - group difference of asd of at least 10% asd absolute standardized difference , chf congestive heart failure , dpp-4i dipeptidyl peptidase-4 inhibitor , hosp hospital , htn hypertension , meds medications , mi myocardial infarction , phys physician , tia transient ischemic attack baseline characteristics of patients with type 2 diabetes and chronic renal disease up to 5 years before initiating treatment with sitagliptin or non - dpp-4i oral antihyperglycemic agent as monotherapy or as part of dual or triple therapy . a , c , e clinical conditions and comorbidities . asd of 10% indicates a meaningful difference between treatment groups . for any between - group difference of asd of at least 10% , asd absolute standardized difference , chf congestive heart failure , dpp-4i dipeptidyl peptidase-4 inhibitor , hosp hospital , htn hypertension , meds medications , mi myocardial infarction , phys physician , tia transient ischemic attack in patients initiating an escalation to triple combination therapy , the differences between treatment groups ( non - dpp-4i oaha users versus sitagliptin users ) were not as pronounced as those seen in patients initiating monotherapy or escalation to dual therapy , including the between - group age difference ( mean [ sd ] : sitagliptin 68.9 [ 10.9 ] years , non - dpp-4i 68.4 [ 10.5 ] years ; asd 5% ; fig . ", "in this study of patients with t2 dm from an employee - based insurance database , sitagliptin was initiated in a higher percentage of patients with t2 dm and ckd ( 14.8% ) compared to patients with t2 dm but no record of ckd ( 7.4% ) . unlike many other oahas , sitagliptin is approved for patients with any stage of renal disease . in light of this and its favorable renal safety profile [ 1215 ] , the higher use of sitagliptin in patients with ckd observed in the current analysis is not surprising . in general , patients with t2 dm and ckd who initiated treatment with sitagliptin tended to be older and were more likely to have a pre - treatment history of heart failure , arrhythmia , or use of loop diuretics or beta - blockers than patients initiating other classes of oaha . in this context , it is worth noting the results of a large , recently completed clinical trial examining the effects of adding sitagliptin to usual care in patients with t2 dm and cv disease . in the overall study population , no difference in cv event rates compared with placebo was observed ( hazard ratio [ hr ] for the primary composite cv outcome was 0.98 ; 95% confidence interval ( ci ) : 0.88 , 1.09 ; p < 0.001 for noninferiority ) . additionally , in patient subgroups evaluated by renal function , no difference in cv risk was noted for patients with ckd [ estimated glomerular filtration rate ( egfr ) < 60 ml / min/1.73 m ; hr = 0.92 ; 95% ci : 0.78 , 1.10 ) or those without ckd ( egfr 60 ml / min/1.73 m ; hr = 1.00 ; 95% ci : 0.89 , 1.13 ) . the most pronounced differences in baseline characteristics between the treatment groups were observed between patients initiating monotherapy . as treatment complexity increased , the differences in baseline characteristics between treatment groups persisted but were attenuated , presumably due to diminishing treatment options with increasing treatment complexity . these observations of channeling in patients receiving treatment with sitagliptin are similar to those previously reported in a general t2 dm population [ 47 ] . while the marketscan database includes insurance claims data on a large , diverse population from the us , these results may not be generalizable to the overall us population or to ex - us populations . in addition , the primary uses of these data are for administrative purposes , not research . consequently , the database has missing or limited data on a number of important disease characteristics and comorbidities . importantly for this study , patients with end - stage renal disease are likely underrepresented since these patients are medicare eligible . chronic renal disease was defined solely through icd-9-cm codes as laboratory data are not available in our dataset .", "this study further documents the presence of channeling in patients initiating treatment with sitagliptin . in this study , patients with ckd initiating treatment with sitagliptin were generally older and were more likely to have a pre - treatment history of heart failure , arrhythmia , or use of loop diuretics or beta - blockers than patients initiating other classes of oral therapies . if not recognized and analyzed appropriately , this channeling could lead to biased treatment effect estimates in comparative analyses , including those involving users of sitagliptin .", "", "k. g. brodovicz was an employee of merck sharp & dohme corp . , a subsidiary of merck & co. , inc . , kenilworth , nj , at the time this analysis was carried out and may own stock and/or hold stock options in the company . kenilworth , nj , at the time this analysis was carried out and may own stock and/or hold stock options in the company . , a subsidiary of merck & co. , inc . , kenilworth , nj and may own stock and/or hold stock options in the company .", "this article does not contain any new studies with human or animal subjects performed by any of the authors .", "this article is distributed under the terms of the creative commons attribution - noncommercial 4.0 international license ( http://creativecommons.org/licenses/by-nc/4.0/ ) , which permits any noncommercial use , distribution , and reproduction in any medium , provided you give appropriate credit to the original author(s ) and the source , provide a link to the creative commons license , and indicate if changes were made ." ]

[ "the use of the kuntscher nail has been the most important advancement in trauma surgery .", "he had an acetabulum fracture and a femoral shaft fracture treated 30 years ago with a reamed kuntscher femoral nail . lateral hip approach was performed and after attempting to remove the nail with the specific tools being unsuccessful we decided to be more aggressive . firstly , we performed a simple unicortical osteotomy on the lateral side from the proximal part to below the callus in order to decompress the femoral canal without success . secondly , a trench in the greater trochanter around the proximal hole was performed to hit the nail from below which was still insufficient and furthermore , the hole broke when hitting the nail so we needed to drill a new hole distally . several cerclages closed the osteotomy and a bone graft was used to close the trench .", "with this case report , we present a new salvage technique to remove an incarcerated kuntscher nail when all the described methods have failed .", "the use of the kuntscher nailing system for the treatment of long bone fractures has been the most important advancement in trauma surgery in recent history . since its first implementation in a german hospital in the late 30 s , removal of a kuntscher nail is considered a routine procedure but could be really challenging . bone ingrowth or overgrowth , damage to the proximal threads of the nail , and broken nails or locking screws may complicate the removal of intramedullary nails . the biggest challenge appears when all the described methods result in failure of removal of the nail . this article presents a case of an incarcerated femoral nail and describes a salvage procedure for nail extraction after all previously described methods have failed .", "the patient was involved in a plane accident 30 years before sustaining a femoral shaft fracture treated with a reamed kuntscher nail and a posterior wall acetabulum fracture treated with open reduction and internal fixation with lag screws ( fig.1 ) . the patient came to our outpatient clinic complaining about inguinal pain and chronic leg pain with limitation of activities of daily living , although he was able to walk for more than one hour . on physical examination , the ipsilateral knee had full range of motion and the patient did not need any crutches to walk without limping . the postelmerldaubign scale was 14 points ( 4 for pain , 5 for walking and 5 for range of motion ) . as a part of the initial evaluation , a blood test with infection parameters was performed and was negative for infection . pre - operative radiographs showed a healed femoral fracture in all 4 cortices with an intramedullary kuntscher nail without locking screws and cortical thickening at the fracture site ( fig . pre - operative x - ray of the pelvic ring : intramedullary kuntscher nail in the left femur and osteosynthesis with three screws in the posterior wall of the acetabulum . pre - operative x - ray of the distal part of the femur : fracture site healed and distal tip of the nail . the patient was informed about the incipient arthritis of the hip and the possibility to perform a one - stage or two - stage surgery . the surgical risks were discussed with the patient , including pain after hardware removal and failure to remove the nail , specially this last point because other surgeons had tried to do the same procedure few years before and had failed after many hours of surgery . firstly , remove the nail at all costs and depending on the outcome of this first surgery he would assess the hip replacement surgery . the patient was put in a lateral position and a lateral hip approach was done . the first step was to find the proximal tip of the nail which was found seated deep in the great trochanter . the initial device used to remove the nail was the conical extraction tool that was unsuccessful after several attempts . after the overgrowth bone was removed of the proximal part of the nail a hook extraction system was engaged with difficulty . however , the nail did not move after multiple hits with a 1 kg hammer and finally the hook broke itself . at this point , we decided to use the saw to perform a simple unicortical osteotomy in the proximal third of the femur to decompress the endomedullar canal ( fig . 3 ) . after this decompression osteotomy we tried to hit the nail from below with an impactor engaged in the proximal hole of the nail . however , the implant remained in the same position . clinicalintra operative image : simple unicortical osteotomy in the proximal third of the femur to decompress the endomedullar canal . after trying all these different ways to remove the nail being unsuccessful , we decided to continue the longitudinal osteotomy from proximal to distal in the lateral side of the femur . the nail was found in place with on growth and overgrowth in almost entire length of the nail . a new attempt to hammer the nail from below was performed and the nail started to move gradually until the proximal hole of the nail broke ( fig . 4 ) . after so many attempts , we did not give up and proceeded to drill a new hole distally with a diamond drill ( fig . 5 ) to finish the nail removal . clinical intra - operative image : detail of the moment when the nail started to move gradually until the proximal hole of the nail break . clinical image . subsequently , several cerclages and a bone allograft was used to close the longitudinal osteotomy ( fig . clinical intraoperative image : several cerclages closing the osteotomy with allograft bone used to close the longitudinal osteotomy . the patient was admitted to the hospital for pain and bleeding control . on the second day of hospitalization , the patient underwent a blood transfusion as his hemoglobin was reported to be 7.1 g / dl . the patient was discharged on day 4 after antibiotic prophylaxis , deep vein thrombosis prophylaxis with low - weight - molecular heparin and ambulation with crutches without weight bearing . at 8 weeks of follow - up the patient was satisfied at 1 year of follow - up with no complications and the x - ray showed complete healing of the longitudinal osteotomy ( fig . , the patient is free from pain in the leg with only sporadic hip pain , so there is no indication of hip replacement surgery for the time being", "various reasons have been described in the literature for nail incarceration , including excessive callus formation closing the intramedullary canal , ingrowth of bone into the nail , bone ingrowth through the locking holes and bent or broken nails . there are different techniques to remove retained intramedullary nails , most of these techniques are designed for broken nails , but others are for incarcerated nails . there is only one case similar to our case report by lindeque et al which describes removal of tibial nail using a large longitudinal osteotomy . we decided to perform a two - stage procedure especially due to the incipient arthritis of the hip . if our patient would have had advanced stage of arthritis , we could have considered a single - staged procedure with nail removal and hip replacement or a hip replacement without removing the nail . goosen et al treated a similar case in which they cut the proximal end of the nail to the length needed in order to implant a hip arthroplasty at the top of the nail . mont et al used this technique on fifteen patients with femoral implants or extraarticular deformities .", "however , despite the aggressiveness of the procedure , the patient had a good result , and the osteotomy healed normally with no complications . this is the first case published in the literature using this longitudinal osteotomy to remove a femoral nail . it is recommended to remove it as soon as it possible to minimize later complications ." ]

[ "the anticancer agent 5-fluoro-2-deoxyuridine ( floxuridine ) has been shown to be clinically effective in the treatment of colon carcinoma and colorectal cancer that has metastasized to the liver . however , the adverse effects associated with chemotherapeutics are still unresolved , and many efforts have been made to minimize side - effects and maximize therapeutic efficacy . prodrug strategies have been increasingly utilized over the past two decades in order to overcome undesirable physicochemical properties of drugs , to improve oral bioavailability and to minimize toxic side - effects . a majority of the efforts have focused on antiviral and anticancer drugs and reflect the need for improved targeting , more selective action and further development of orally available alternatives . amino acid ester prodrugs of poorly permeant anticancer and antiviral drugs have been designed for targeted delivery via specific transporters in order to improve their oral bioavailability and metabolic disposition . amino acid ester prodrugs have been shown to be substrates for pept1 , pept2 , and atb transporters , and their improved oral bioavailability has been attributed to enhanced transport via carrier - mediated mechanisms . alkyl ester prodrugs and amino acid ester prodrugs of floxuridine , for example , have been synthesized and tested for potential improvement of oral drug delivery . amino acid ester prodrugs of floxuridine and an antiviral agent , acyclovir , have been shown to be substrates of the pept1 transporter . pept1 is stereoselective and exhibits greater affinity for l - enantiomers of amino acids than d - enantiomers.(16 ) pept1 is predominantly expressed in the small intestine , has broad substrate specificity and can transport dipeptides , tripeptides , and -lactam antibiotics . the valyl ester prodrug of acyclovir significantly enhances oral bioavailability of acyclovir , and several reports suggest that oligopeptide transporters are responsible for absorption enhancement . amino acid ester prodrugs may also facilitate enhanced delivery to pancreatic ductal cancer cells such as aspc-1 and capan-2 , since these cells express oligopeptide transporters at relatively high levels.(25 ) the activation of prodrug to the parent drug following transport is an essential step and can not be ignored . it has been shown that a specific enzyme , valacyclovirase , is primarily responsible for the conversion of valacyclovir to acyclovir . it has also been suggested that this enzyme might be involved in the activation of other amino acid prodrugs.(26 ) kim and colleagues reported that the substrate specificity of valacyclovirase is largely determined by the amino acid acyl - linked promoiety of the prodrug.(27 ) the metabolic conversion of floxuridine to 5-fluorouracil following systemic delivery has been shown to be detrimental to therapeutic efficacy of floxuridine . the mechanism of action of 5-fluorouracil ( 5-fu ) and floxuridine ( fudr ) is well understood.(30 ) 5-fu toxicity is predominantly caused by 5-fu incorporation into rna . however , unlike 5-fu , fudr is specifically incorporated into dna and not into rna , which leads to the minimization of adverse effects . several groups have reported that floxuridine is more potent than 5-fu and that the inhibition of cell proliferation is 10- to 100-fold higher than that of 5-fu . however , floxuridine is rapidly converted to 5-fu in many tissues , including the liver , by the enzyme thymidine phosphorylase.(34 ) as a consequence , higher doses of floxuridine are required for maintenance of clinical efficacy , leading to greater toxicity . therefore , protection of the glycosidic bond of floxuridine is expected to maintain the high potency of the drug and facilitate administration of low doses that can selectively kill only proliferating cells by robust inhibition of dna synthesis . improving the chemical stability of floxuridine to thymidine phosphorylase may enhance its therapeutic efficacy at low doses and obviate toxicity concerns . although amino acid monoester prodrugs of floxuridine have been shown to provide enhanced pept1-mediated transport as well as enzymatic activation in intestinal and liver surrogate cell systems , dipeptide analogues may exhibit even higher affinity and transport via the oligopeptide transporter . therefore , dipeptide prodrugs may be delivered more to a target site by carrier mediated transporters , and extra amino acid attached prodrugs could be more suitable for specific enzymatic activation at a target site than mono amino acid ester prodrugs . several studies on amino acid modifications to increase specific transporter affinity have been conducted . however , direct comparisons of mono amino acid and dipeptide prodrugs in terms of transporter affinity , prodrug stability and activation have not been reported . in this report , we describe the synthesis , characterization , and stability of dipeptide monoester prodrugs of floxuridine . various dipeptides and peptidomimetics have been tested to characterize the hpept1 transporter and improve its affinity , and mono amino acid ester prodrugs have been evaluated as hpept1 substrates . based on those reports , six amino acids were chosen to be n - terminal amino acids of the dipeptide . the smallest amino acid , glycine , and bulky amino acids like phenylalanine and tyrosine were paired with those six amino acids to form dipeptides to test the hypothesis that molecular sizes may structurally affect its ester bond stability . the six dipeptide promoieties , l - phenylalanalyl - l - glycine , l - leucyl - l - glycine , l - glycyl - l - leucine , l - isoleucyl - l - glycine , l - valyl - l - phenylalanine , and l - phenylalanyl - l - tyrosine , were designed for targeted delivery to an oligopeptide transporter and tested . since 5-ester prodrugs were found to exhibit higher affinity for transporters than 3-ester prodrugs,(14 ) only 5-dipeptide monoester floxuridine prodrugs were examined in this study . uptake inhibition and permeability studies were conducted with caco-2 cells as well as with aspc-1 and capan-2 cells . the chemical stability at physiological ph and the enzymatic activation of the prodrugs in caco-2 , aspc-1 , and capan-2 cell homogenates were also evaluated to determine the effects of the amino acid / dipeptide promoiety structure on enzyme - mediated activation . the feasibility of selective antiproliferative action of amino acid / dipeptide floxuridine prodrugs was also explored using cancer cells that overexpress pept1 . finally , the stability and transport characteristics of the dipeptide monoester prodrugs of floxuridine were compared with those of the corresponding amino acid monoester prodrugs .", "the tert - butyloxycarbonyl ( boc ) protected amino acids boc - l - isoleucine , boc - l - glycine , boc - l - valine , boc - l - phenylalanine , boc - l - leucine , boc - l - glycyl - l - leucine , boc - l - phenylalanalyl - l - glycine , boc - l - leucyl - l - glycine , boc - l - isoleucyl - l - glycine , boc - l - valyl - l - phenylalanine , and boc - l - phenylalanyl - l - tyrosine were obtained from chem - impex ( wood dale , il ) . high - performance liquid chromatography ( hplc ) grade acetonitrile was obtained from fisher scientific ( st . louis , mo ) . n , n - dicyclohexylcarbodiimide ( dcc ) , n , n - dimethylaminopyridine ( dmap ) , trifluoroacetic acid ( tfa ) , and all other reagents and solvents were purchased from aldrich chemical co. ( milwaukee , wi ) . cell culture reagents were obtained from invitrogen ( carlsbad , ca ) , and cell culture supplies were obtained from corning ( corning , ny ) and falcon ( lincoln park , nj ) . the synthesis and characterization of 5-mono amino acid ester prodrugs of floxuridine have been reported previously . briefly , boc - protected dipeptides boc - l - glycyl - l - leucine , boc - l - phenylalanalyl - l - glycine , boc - l - leucyl - l - glycine , boc - l - isoleucyl - l - glycine , boc - l - valyl - l - phenylalanine , and boc - l - phenylalanyl - l - tyrosine , ( 1.1 mmol ) , dcc ( 1.1 mmol ) , and dmap ( 0.1 mmol ) were allowed to react with floxuridine ( 1 mmol ) in 7 ml of dry dmf for 24 h. the reaction progress was monitored by tlc ( ethyl acetate ) . the residue was extracted with ethyl acetate ( 30 ml ) and washed with water ( 2 20 ml ) , and saturated nacl ( 20 ml ) . the three spots observed on tlc were separated and purified using column chromatography ( dichloromethane ( dcm)/methanol , 20:1 ) . the boc group was cleaved by treating the residues with 5 ml tfa : dcm ( 1:1 ) . after 4 h the tfa salts of amino acid prodrugs of floxuridine were obtained as white fluffy solids . the combined yield , consisting of 3-monoester , 5-monoester , and 3,5-diesters , of each floxuridine prodrug was 60% . the prodrugs were determined to be 90%99% pure by reverse - phase hplc , and were easily separated from their parent compounds by reverse - phase hplc . the observed molecular weights of all prodrugs , determined by electrospray ionization mass spectra ( esi - ms ) obtained on a micromass lct esi - ms , were found to be consistent with those predicted by their structures . the structural identities of the prodrugs were then confirmed using proton nuclear magnetic resonance spectra ( h nmr ) , obtained on a 300 mhz bruker dpx-300 nmr spectrometer . 5-l - leucyl - l - glycyl - floxuridine : yield , 15% ; percent purity , 93% ; h nmr ( dmso - d6 ) , 0.840.92 ( 6h , m , ( ch3)2 ) , 1.501.77 ( 3h , m , ch2 ) , 2.122.28 ( 2h , m , c2 ) , 3.784.35 ( 7h , m , ch of leu and ch2 of gly , c3 , c4 , c5 ) , 6.16 ( 1h , t , c1 , j = 6.0 hz ) , 7.94 ( 1h , d , chf , j = 6.9 hz ) ; esi - ms , 417.1 ( m + h ) . 5-l - glycyl - l - leucyl - floxuridine : yield , 15% ; percent purity , 96% ; h nmr ( dmso - d6 ) , 0.85 ( 3h , d , ch3 , j = 6.5 hz ) , 0.90 ( 3h , d , ch3 , j = 6.5 hz ) , 1.511.68 ( 3h , m , ch2 ) , 2.122.26 ( 2h , m , c2 ) , 3.544.40 ( 7h , m , ch of leu and ch2 of gly , c3 , c4 , c5 ) , 6.16 ( 1h , t , c1 , j = 6.0 hz ) , 7.90 ( 1h , d , chf , j = 6.8 hz ) ; esi - ms , 417.1 ( m + h ) . 5-l - valyl - l - phenylalanyl - floxuridine : yield , 30% ; percent purity , 95% ; h nmr ( dmso - d6 ) , 0.90 ( 3h , d , ch3 , j = 6.9 hz ) , 0.95 ( 3h , d , ch3 , j = 6.9 hz ) , 2.082.20 ( 3h , m , c2 , ch of val ) , 3.02 ( 2h , m , ch2 of phe ) , 3.624.60 ( 6h , m , ch of val and phe , c3 , c4 , c5 ) , 6.14 ( 1h , t , c1 , j = 6.1 hz ) , 7.227.31 ( 5h , m , aromatic protons ) , 7.91 ( 1h , d , chf , j = 6.9 hz ) ; esi - ms , 494.1 ( m + h ) . 5-l - isoleucyl - l - glycyl - floxuridine : yield , 15% ; percent purity , 93% ; h nmr ( dmso - d6 ) , 0.87 ( 3h , t , ch3 , j=7.3 hz ) , 0.94 ( 3h , d , ch3 , j = 6.8 hz ) , 1.17 ( 1h , m , ch2 ) , 1.52 ( 1h , m , ch2 ) , 1.81 ( 1h , m , ch ) , 2.112.28 ( 2h , m , c2 ) , 3.904.31 ( 7h , m , ch of ile and ch2 of gly , c3 , c4 , c5 ) , 6.15 ( 1h , t , c1 , j = 6.5 hz ) , 7.94 ( 1h , d , chf , j = 6.9 hz ) ; esi - ms , 416.9 ( m + h ) . 5-l - phenylalanyl - l - glycyl - floxuridine : yield , 16% ; percent purity , 98% ; h nmr ( dmso - d6 ) , 2.122.28 ( 2h , m , c2 ) , 2.923.16 ( 2h , m , ch2 of phe ) , 3.904.34 ( 7h , m , ch of phe and ch2 of gly , c3 , c4 , c5 ) , 6.15 ( 1h , t , c1 , j = 6.5 hz ) , 7.277.36 ( 5h , m , aromatic protons ) , 7.94 ( 1h , d , chf , j = 6.5 hz ) ; esi - ms , 451.1 ( m + h ) . 5-l - phenylalanyl - l - tyrosyl - floxuridine : yield , 3.2% ; percent purity , 99% ; h nmr ( dmso - d6 ) , 2.102.32 ( 2h , m , c2 ) , 2.722.92 ( 4h , m , ch2 of phe and tyr ) , 3.904.29 ( 6h , m , ch of phe and tyr , c3 , c4 , c5 ) , 6.15 ( 1h , m , c1 ) , 6.657.32 ( 9h , m , aromatic protons ) , 7.93 ( 1h , m , chf ) ; esi - ms , 557.2 ( m + h ) . capan-2 cells ( passages 5054 ) , and aspc-1 cells ( passages 6365 ) from american type culture collection ( rockville , md ) were routinely maintained in rpmi-1640 containing 10% fetal bovine serum . caco-2 cells ( passages 3035 ) from american type culture collection ( rockville , md ) were routinely maintained in dmem containing 10% fetal bovine serum , 1% nonessential amino acids , 1 mmol / l sodium pyruvate , and 1% l - glutamine at 5% co2 and 90% relative humidity at 37 c . cells were grown in antibiotic - free media to avoid the possible transport interference by antibiotics . the cells were washed with 5 ml of ph 7.4 phosphate buffer ( 10 mmol / l ) , lysed by ultrasonication ( micro ultrasonic cell disrupter model kt40 , kontes , vineland , nj ) , and pelleted by centrifugation for 5 min at 1000 g . protein amount was quantified with bio - rad ( hercules , ca ) dc protein assay using bovine serum albumin as a standard . the protein amount was adjusted to 500 g / ml , and the hydrolysis reactions were carried out in 96-well plates ( corning ) . caco-2 , aspc-1 , and capan-2 cell suspensions ( 250 l ) were placed in triplicate wells , the reactions started with the addition of substrate , and cells were incubated at 37 c for 120 min . at the desired time point , sample aliquots ( 35 l ) were removed and added to 150 l of acetonitrile ( acn ) containing 0.1% tfa . the mixtures were filtered with a 0.45 m filter at 1000 g for 10 min at 4 c . undiluted plasma ( 250 l ) was added to each well in triplicate , and substrate was added to initiate the reactions that were conducted at 37 c for 2 h. at various time points , aliquots ( 35 l ) were removed and added to 150 l of acn containing 0.1% tfa . the mixtures were filtered with a 0.45 m filter at 1000 g for 10 min at 4 c . the nonenzymatic hydrolysis of the prodrugs was determined as described above , except that each well contained ph 7.4 phosphate buffer ( 10 mmol / l ) instead of cell homogenate or human plasma . the stability of floxuridine and its prodrugs in the presence of thymidine phosphorylase ( tp ) was assessed by incubating the desired substrates ( 200 m ) with tp ( 2.0 ng/l ) in phosphate buffer ( ph 7.0 ) at 37 c . aliquots of the incubation mixture were sampled at 0 , 1 , 3 , 5 , 10 , 30 , 60 , and 120 min , and quenched with cold acetonitrile ( acn ) with 0.1% tfa , filtered through a 0.45 m membrane , and analyzed for the concentrations of prodrug , floxuridine , and 5-fu by hplc . caco-2 cells at nine days postseeding , and aspc-1 and capan-2 cells , both at four days postseeding , were incubated with 10 mol / l gly - sar ( 9.98 mol / l gly - sar and 0.02 mol / l [ h]gly - sar ) along with various prodrug concentrations ( 50.05 mmol / l ) for 30 min . the cells were washed three times with ice - cold pbs and solubilized with 10 ml of scintillation cocktail ( scintiverse , fisher scientific , st.louis , mo ) , and the amount of cell - associated radioactivity was determined by scintillation counting ( beckman ls-9000 , beckman instruments , fullerton , ca ) . caco-2 cell monolayers were grown on collagen - coated polytetrafluoroethylene membranes for 21 to 24 days , and capan-2 cell monolayers were grown on the same type of membrane for 14 days . transepithelial electrical resistance ( teer ) was monitored , and values of 240280 /cm in caco-2 and 380420 /cm in capan-2 ( total area for both cells was 4.67 cm ) were used in the study . apical side and basolateral sides of transwell inserts were washed with mes ( ph 6.0 ) and hepes ( ph 7.4 ) , respectively . fresh mes and hepes buffers were reapplied to transwell inserts and incubated at 37 c for 15 min . freshly prepared 0.1 mm drug solution in mes buffer ( total 1.5 ml ) was placed in the donor chamber , and the receiver chamber was filled with hepes buffer ( total 2.5 ml ) sampling from the receiver chamber ( 200 l ) was conducted up to a period of 2 h at time intervals of 15 , 30 , 45 , 60 , 75 , 90 , and 120 min , at 37 c and replaced with an equal volume of fresh hepes buffer to maintain sink conditions in the receiver chamber . all samples were immediately acidified with 0.1% tfa and analyzed by reverse - phase hplc . the initial rates of hydrolysis were used to obtain the apparent first - order rate constants and to calculate the half - lives . the apparent first - order degradation rate constants of various floxuridine prodrugs at 37 c were determined by plotting the logarithm of prodrug remaining as a function of time . the slopes of these plots are related to the rate constant k and given by \n\n the degradation half - lives were then calculated by the equation \n\n statistical significance was evaluated with graphpad prism v. 3.0 by performing one - way analysis of variance with posthoc tukey s test to compare means . the apparent permeability ( papp ) for the prodrugs was calculated using the following equations : \n\n where jss is the steady state flux , m is the cumulative amount of prodrug , and regenerated mono amino acid prodrug , drug and 5-fu in the receiver compartment . the apparent permeability was calculated from steady state flux as follows : \n\n where a is the surface area of monolayer exposed to the permeant and c0 is the concentration of the prodrug in the donor solution . the concentrations of floxuridine and its prodrugs in the receiver and donor compartments were analyzed using hplc . the concentrations of prodrugs and their metabolites were determined on a waters hplc system ( waters , inc . , the hplc system consisted of two waters pumps ( model 515 ) , a waters autosampler ( wisp model 712 ) , and a waters uv detector ( 996 photodiode array detector ) controlled by waters millennium 32 software ( version 3.0.1 ) . samples were resolved in a waters xterra c18 reverse - phase column ( 5 m , 4.6 250 mm ) equipped with a guard column . the mobile phase consisted of 1% hfba / water ( solvent a ) and 1% hfba / acetonitrile ( solvent b ) with the solvent b gradient changing from 056% at a rate of 2%/min during a 28 min run . standard curves generated for each prodrug , and their parent drugs were utilized for quantitation of integrated area under peaks . the detection wavelength was 254 nm , and spectra were acquired in the 220380 nm range . the cells were seeded onto 96-well plates at 125,000 cells per well and allowed to attach / grow for 24 h before drug solutions were added . the culture medium ( rpmi-1640 + 10% fetal bovine serum ) was removed , and the cells were gently washed once with sterile ph 6.0 uptake buffer . floxuridine and floxuridine prodrugs were 2-fold serially diluted in ph 6.0 uptake buffer from 4 to 0.25 mmol / l . the wash buffer was removed , and 25 l of drug solution per well was added and incubated at 37 c for 2 h with aspc-1 cells and 4 h with capan-2 cells in the cell incubator . after this time period , the drug solutions were removed and the cells were gently washed twice with sterile uptake buffer . fresh culture medium was then added to each well after washing , and the cells were allowed to recover for 24 h before evaluating cell viability via 2,3-bis[2-methoxy-4-nitro-5-sulfophenyl]-2h - tetrazolium-5-carboxanilide inner salt ( xtt ) assays . a mixture ( 30 l ) containing xtt ( 1 mg / ml ) in sterile rpmi-1640 without phenol red and phenazine methosulfate ( n - methyl dibenzopyrazine methyl sulfate in sterile pbs , 0.383 mg / ml ) reagents was added to the cells and incubated at 37 c for 1 h , after which the absorbance at 450 nm was read .", "the total prodrug yield for each dipeptide was > 15% , and the purity for all prodrugs was > 90% as determined by hplc , where the impurity was the parent drug , floxuridine . the experiments concerning prodrug stability were performed at 37 c in ph 7.4 phosphate buffer . the estimated half - lives ( t1/2 ) obtained from linear regression of pseudo - first - order plots of prodrug concentration vs time for floxuridine prodrugs in ph 7.4 phosphate buffers alone and in caco-2 , aspc-1 , and capan-2 cell homogenates are listed in table 2 . prodrug metabolites such as floxuridine and 5-fu were monitored along with prodrug disappearance in this experiment . however , mass balance was not achieved because 5-fu was metabolized even further and those metabolites beyond 5-fu were not quantified ( figure 1 ) . dipeptide prodrugs with at least one aromatic amino acid moiety were next - best with regard to stability in enzyme - containing solutions such as plasma and cell homogenates , and those with two aromatic amino acids also exhibited chemical stability that was similar to that of 5-l - isoleucyl - floxuridine . all prodrugs exhibited 3- to 30-fold shorter half - lives in cell homogenates than in ph 7.4 phosphate buffer suggesting enzyme - catalyzed hydrolysis . with a few exceptions , the half - lives of all monoester and dipeptide prodrugs tested exhibited similar trends in the three cell homogenates and showed good linear correlations ( r = 0.870.93 ) . the composition of the amino acids in the dipeptide moiety exerted a profound effect on the stability of the ester bond regardless of the mode of attachment . thus , glycyl - containing dipeptide prodrugs were less stable in buffer alone compared to dipeptide prodrugs containing one or two aromatic amino acids . glycyl - containing dipeptide prodrugs were also less stable than the 5-l - glycyl ester prodrug . a comparison of the stability of 5-l - isoleucyl - floxuridine in various media with 5-l - isoleucyl - l - glycyl - floxuridine dramatically illustrates this effect ( table 2 ) . the metabolic stability of floxuridine and its amino ester prodrugs was assessed using thymidine phosphorylase . the results shown in table 3 indicate that floxuridine was rapidly degraded to the less active metabolite , 5-fluorouracil , by thymidine phosphorylase . the amino acid ester prodrugs of floxuridine were found to be quite resistant to degradation by thymidine phosphorylase . prodrugs containing the glycyl moiety , 5-l - glycyl , 5-l - leucyl - l - glycyl , 5-l - glycyl - l - leucyl , 5-l - phenylalanyl - l - glycyl , and 5-l - isoleucyl - l - glycyl floxuridine were 20- to 40-fold more stable than floxuridine to degradation by thymidine phosphorylase . the half - lives of 5-l - phenylalanyl - floxuridine , 5-l - isoleucyl - floxuridine , 5-l - valyl - l - phenylalanyl - floxuridine , and 5-l - phenylalanyl - l - tyrosyl - floxuridine were in excess of 500 min reflecting their superior resistance to metabolic degradation by thymidine phosphorylase . ic50 values of the amino acid / dipeptide monoester prodrugs of floxuridine for pept1 determined using inhibition of gly - sar uptake in caco-2 , aspc-1 , and capan-2 cells are summarized in table 4 . floxuridine showed minimal inhibition of gly - sar uptake , and ic50 values were 8.43 2.66 mm , 6.63 1.52 mm , and 16.06 6.71 mm in caco-2 , aspc-1 , and capan-2 cells , respectively . 5-l - isoleucyl - l - glycyl - floxuridine displayed the highest affinity for oligopeptide transporters in caco-2 cells ( ic50 = 0.39 0.01 mm ) and in aspc-1 cells ( ic50 = 0.29 0.00 mm ) and was second - best in capan-2 cells ( ic50 = 0.44 0.02 mm ) . with the exception of 5-l - leucyl and 5-l - glycyl dipeptide analogs with caco-2 cells , all dipeptide prodrugs of floxuridine exhibited 2- to 14-fold higher affinity for oligopeptide transporters than the corresponding 5-l - monoester prodrug . in particular , dipeptide prodrugs with at least one aromatic amino acid component consistently exhibited 3- to 5-fold higher affinity for the oligopeptide transporters than the corresponding monoester prodrug in all three cell lines tested . the apical - to - basolateral permeability of mono amino acid / dipeptide monoester prodrugs of floxuridine and parent floxuridine were determined at 37 c in caco-2 and capan-2 cell monolayers . all ester prodrugs of floxuridine exhibited 4- to 20-fold higher permeability than floxuridine in caco-2 cells . with the exception of 5-l - valyl - l - phenylalanyl - floxuridine , the permeability of all other dipeptide prodrugs of floxuridine across caco-2 monolayers was 2- to 4-fold higher than the corresponding 5-l - mono amino acid ester floxuridine prodrug . the permeability trends in caco-2 monolayers are consistent with the affinity data observed in uptake inhibition studies ; however , no simple correlations between permeability and affinity were evident . floxuridine was impermeant with capan-2 cell monolayers ; neither floxuridine nor its metabolite 5-fu could be detected suggesting the possibility of upregulation of metabolic enzymes such as tp and dihydropyrimidine dehydrogenase ( dpd ) in capan-2 cells . dpd is the rate - limiting enzyme involved in the catabolism of pyrimidines and is also the main enzyme involved in the degradation of structurally related compounds like 5-fu ( figure 1 ) . floxuridine permeability was indeed observed in the presence of dpd inhibitors , dipyridamole and cisplatin ; however , it was 1,000- or 10,000-fold lower than that obtained with caco-2 cells ( data not shown ) . the permeability of 5-l - valyl - l - phenylalanyl - floxuridine across caco-2 monolayers was quite low . 5-l - phenylalanyl - l - tyrosyl - floxuridine , however , exhibited dramatically lower permeability in capan-2 cells compared to its permeability in caco-2 cells . with the exception of 5-l - phenylalanyl - l - tyrosyl - floxuridine , the permeability of the floxuridine ester prodrugs in caco-2 cells was about 2-fold higher than the corresponding value in capan-2 cells ( r = 0.83 ) . unlike caco-2 monolayers , general permeability enhancement effects with dipeptide prodrugs compared to the corresponding 5-l - mono amino ester prodrug were not apparent with capan-2 cell monolayers . gi50 values for floxuridine and its 5-mono amino acid / dipeptide monoester prodrugs determined in cell proliferation studies with the pancreatic cancer cell lines , aspc-1 and capan-2 , are shown in table 6 . all prodrugs exhibit 4- to 8-fold enhanced antiproliferative activity in the two cell lines compared to parent floxuridine . thus , the gi50 values of all floxuridine prodrugs were in the range of 1.653.36 mm in aspc-1 and capan-2 cells as opposed to gi50 values of 22.85 mm and 17.63 mm for floxuridine in aspc-1 and capan-2 cells , respectively . these results are consistent with trends observed in gly - sar uptake inhibition studies . gly - sar and gly - pro did not inhibit the growth rate of capan-2 cells . additionally , 5-d - valyl - floxuridine exhibited antiproliferative activity similar to that of floxuridine and gly - sar , despite an affinity for pept1 that was similar to that of other mono amino acid / dipeptide monoester prodrugs of floxuridine .", "amino acid ester prodrugs have been widely employed to improve intestinal absorption of poorly permeant drugs . the antivirals valacyclovir and valganciclovir ( 8,38 ) are early examples of the clinical and commercial success of amino acid ester prodrug strategies . the enhanced oral bioavailability of these prodrugs ( 24,39 ) has been attributed to their enhanced transport by intestinal oligopeptide transporters , and to their efficient bioconversion to the parent drug by valacyclovirase . a variety of dipeptide and tripeptide compounds and prodrugs have also been investigated for their suitability as substrates for the pept1 transporter . we had previously reported the synthesis and evaluation of mono amino acid ester prodrugs of antiviral and anticancer drugs such as floxuridine , gemcitabine,(2 ) acyclovir,(15 ) and 2-bromo-5,6-dichloro-1-(-d - ribofuranosyl)benzimidazole ( bdcrb ) . these studies revealed that mono amino acid ester prodrugs in general provide enhanced pept1-mediated transport , a range of bioactivation rates , and enhanced glycosidic bond resistance to metabolic enzymes such as thymidine phosphorylase and cytidine deaminase . in this report , we describe the synthesis of dipeptide monoester prodrugs of floxuridine and their chemical stability , bioactivation and transport in caco-2 cells , a surrogate for intestinal transport , and in two pancreatic duct cell lines , aspc-1 and capan-2 , that overexpress the pept1 transporter . the dipeptide prodrugs appeared to be less stable in ph 7.4 buffers than the corresponding mono amino acid ester prodrugs . since no mono amino ester prodrug degradation products were detected , it is quite likely that the dipeptide monoester prodrugs degrade via parallel pathways similar to those suggested for gly - phe dipeptide alkyl ester prodrugs by larsen and colleagues.(45 ) thus , in addition to hydrolysis of the ester bond producing the dipeptide , a diketopiperazine cyclization product is also possible due to intramolecular condensation of the ester group with the free amino group of the dipeptide monoester prodrug . it has been reported that the rate of intramolecular aminolysis is comparable to that of ester hydrolysis and that cyclization is negligible at ph values below 6 . indeed , the formation of diketopiperizine was observed in a chemical stability study at ph 10 but not at lower ph values ( data not shown ) . the stability of the prodrugs in buffer was clearly influenced by the prodrug moiety of amino acids ; dipeptide prodrugs containing glycyl and leucyl moieties were less stable than those containing phenylalanyl dipeptide prodrugs . dipeptide prodrugs with two aromatic residues were the most stable in buffer as well as in cell homogenates . the enzymatic stabilities of 5-l - phenylalanyl - l - tyrosyl - floxuridine and 5-l - valyl - l - phenylalanyl - floxuridine were significantly enhanced compared to the other prodrugs , suggesting that bulky amino acids such as tyrosine and phenylalanine protect against enzyme - catalyzed hydrolysis of the ester linkage . the stability profiles of 5-l - phenylalanyl - l - tyrosyl - floxuridine and 5-l - valyl - l - phenylalanyl - floxuridine in cell homogenates , particularly caco-2 , suggest that activation to the parent drug following transport would be much slower than monoester prodrugs such as 5-l - valyl - floxuridine and reference prodrugs such as valacyclovir . the improved stability in biological surrogate media would facilitate prolonged systemic circulation of intact prodrugs for enhanced therapeutic action . the results of the affinity studies of the mono amino acid ester prodrugs for the oligopeptide transporter in caco-2 cells were generally consistent with previous findings in our laboratory,(14 ) as well as with amino acid prodrugs of acyclovir reported by beuchamp and colleagues.(48 ) no significant trends were noticeable regarding the affinity of the mono amino acid ester prodrugs in aspc-1 and capan-2 cells . with the exception of leucyl floxuridine , the affinities of the mono amino ester prodrugs were lower in aspc-1 and capan-2 compared to those observed with caco-2 cells . dipeptide monoester prodrugs exhibited enhanced affinity in all cell lines depending on the nature of the n - terminal amino acid moiety . thus , attachment of isoleucyl , phenylalanyl , or leucyl groups to glycyl floxuridine yielded 3- to 9-fold enhancement in affinity for the transporter . however , attachment of a glycyl promoiety to the n - terminus of leucyl floxuridine did not result in affinity enhancement . these findings are consistent with previous observations on the importance of the amino acid composition at the n - terminus in improving affinity for the pept1 oligopeptide transporter.(22 ) the results of apparent permeability of the floxuridine prodrugs across caco-2 monolayers are consistent with the affinity trends observed in gly - sar uptake inhibition studies . in light of previous studies with mono amino acid prodrugs of floxuridine that revealed excellent linear correlations between caco-2 permeability and pept1-mediated transport in hela / pept1 cells,(13 ) the enhanced permeability of the dipeptide monoester prodrugs across caco-2 monolayers may indicate enhanced pept1-mediated transport of the dipeptide prodrugs . the extremely low permeability of 5-l - valyl - l - phenylalanyl - floxuridine in caco-2 and capan-2 cells and that of 5-l - phenylalanyl - l - tyrosyl - floxuridine in capan-2 cells are not consistent with permeability profiles of 5-l - valyl - floxuridine in caco-2 cells reported earlier(13 ) or of 5-l - phenylalanyl - floxuridine in this study . the low permeability of these prodrugs is similar to the low permeability across caco-2 monolayers observed for monoester prodrugs containing l - valyl - l - tyrosyl dipeptide promoieties.(17 ) the estimated clogp values ( table 1 ) of these two were indicative of their being the most lipophilic prodrugs examined , and the contribution of mdr and mrp efflux transporters in permeability studies , therefore , was tested . however , the permeability of 5-l - phenylalanyl - l - tyrosyl - floxuridine in capan-2 cells was not affected by 1 mm verapamil , a known efflux pump inhibitor ( data not shown ) . the permeabilities of the floxuridine prodrugs were consistently lower in capan-2 cells compared to their corresponding values in caco-2 monolayers . dipeptide monoester prodrugs did not exhibit any significant enhancement in permeability compared to the mono amino acid ester prodrugs in capan-2 cells . although the permeability across capan-2 cells for all prodrugs was significantly higher than that of floxuridine alone , meaningful trends based on structureactivity correlations between transporter affinity and membrane permeability are not evident with the limited set of promoieties examined in this study . the detection of only 5-fu in the basolateral receiver compartment following transport of floxuridine across caco-2 monolayers suggests the instability of the glycosidic bond of floxuridine . the extent of conversion of prodrugs to 5-fu following transport was substantially lower in caco-2 and capan-2 cells . the average percent 5-fu observed in the basolateral compartment in caco-2 monolayer studies ( 43% ; range 092% ) was higher than the corresponding average with capan-2 monolayers ( 15% ; range 035% ) . in general , conversion of dipeptide prodrugs to 5-fu following transport across the monolayers was about 2-fold lower than that observed with mono amino ester prodrugs . the results are consistent with stability profiles of floxuridine and its prodrugs in the presence of thymidine phosphorylase , an enzyme involved in the in vivo for phosphorytic cleavage of floxuridine.(49 ) floxuridine was rapidly cleaved by thymidine phosphorylase , while all amino acid ester prodrugs examined in this study were at least 20-fold more stable to glycosidic bond cleavage by thymidine phosphorylase ( table 3 ) . the role of esterification of the hydroxyl groups in protecting glycosidic bond cleavage by thymidine phosphorylase , the rate - determining step in deprotection and in metabolic conversion of floxuridine to 5-fu , has been discussed in a previous study.(13 ) the cell proliferation studies in the pancreatic duct cancer cell lines confirmed the enhanced potency of the amino acid ester prodrugs compared to parent floxuridine . in many cases , dipeptide prodrugs exhibited better gi50 values even though the gi50 values for dipeptide monoester prodrugs in the two cell lines were not significantly different from those obtained with mono amino acid ester prodrugs . the gi50 values of prodrugs did not exhibit any discernible correlations with their permeability and/or bioactivation profiles in these cells . the lack of potency enhancement of 5-d - valyl - floxuridine in capan-2 cells compared to floxuridine suggests that activation of the prodrugs to the parent is essential for cytotoxic action and is enzyme - specific . the different amino acid promoieties of prodrugs may contribute to the different rates of prodrug activation inside cancer cells by particular activation enzymes . therefore , it would be difficult to discern a meaningful correlation between gi50 values and prodrug permeabilities with a limited experimental time course . this characteristic could lead to enzyme targeted activation of prodrugs at target sites after their membrane permeation . intracellular anabolism of floxuridine prodrugs may illustrate that transported drugs are converted to floxuridine and 5-fu via a sequential enzymatic pathway with higher concentrations of tp present in tumor tissue ( figure 2 ) . taken together , our results indicate that the dipeptide monoester prodrugs exhibit significantly higher affinity for the pept1 oligopeptide transporter and 2- to 4-fold higher permeability in caco-2 and capan-2 cells than the corresponding mono amino acid ester prodrugs , suggesting their potential for improved oral absorption and uptake in cancer cells . therefore , dipeptide prodrugs might possess an advantage over amino acid monoester prodrugs for cancer target delivery . three dipeptide prodrugs of floxuridine , 5-l - phenylalanyl - l - tyrosyl - floxuridine , 5-l - phenylalanyl - l - glycyl - floxuridine and 5-l - isoleucyl - l - glycyl - floxuridine , displayed significantly higher affinity for the pept1 oligopeptide transporter and caco-2 permeability . the delayed enzymatic activation , enhanced metabolic resistance and superior affinity to oligopeptide transporters of dipeptide prodrugs may facilitate their prolonged systemic circulation and enhanced therapeutic action . with its display of respectable stability in biological surrogate media and its approximately 2- to 3-fold shorter half - life in cancer cell homogenates than ones in human plasma and caco-2 cell homogenates , 5-l - phenylalanyl - l - tyrosyl - floxuridine could be an optimal candidate for cancer cell targeting with enzyme - specific activation ." ]

[ "the mammalian order primate that includes humans , apes , and monkeys in addition to several other organisms can be traced to the late cretaceous period . the rhesus macaque is in many ways an ideal model organism , being closely related to humans ( sharing a common ancestor about 25 million years ago ) and also sharing similar physiology , neurobiology , and susceptibility to infectious and metabolic diseases . since both the m. mulatta and h. sapiens genomes have been sequenced , it is known that the evolutionary distance between them is small , with local fluctuations and low divergence , particularly in chromosome x. on average , orthologs have about 97% identity between the genomes both at the nucleotide and amino acid sequence levels . approximately 50% of the rhesus macaque genome consists of various repetitive sequences , similar to the human genome . the phenomenon of retrotransposition that occurs in eukaryotic genomes of diverse taxonomic groups is implicated in various human genetic diseases . insertion sites of many non - long - terminal repeat ( ltr ) retrotransposons play an important role in genome evolution and are distributed throughout the genome . the phenomenon behind the selection of the insertion sites of these elements has been shown to be correlated with patterns found at pre - insertion loci . it is well known that mobile elements insertions are capable of altering gene expression , generating genomic deletions , and they can even create new genes and gene families . existing repetitive elements can also cause ectopic recombinations . despite the overall similarity in retrotransposon mobilization activity in the old world monkeys and hominid lineages , the retroelements that are presumed to have had the most dramatic impact in shaping primate genomes are the l1 family of line elements and the alu elements , their partner sines . besides contributing large amounts of dna to many genomes ( including at least 40% of the human genome ) they have also provided new genes , exons and other motifs involved in the physical and sequence structure of chromosomes . there are instances in which a previous element is now a part of the machinery that regulates gene expression . repetitive elements account for about 50% of the genome among all of the presently sequenced primate species ( table 1 ) . in m. mulatta , two classes of mobile elements are present , class i dna transposons and class ii retrotransposons . the transposons can also be categorized into different families and subfamilies , based on the relationships between their sequences . the rhesus family consists of about 320,000 copies of many families of dna transposons and about half a million copies of endogenous retroviruses . the l1s and alu elements account for most of the lineage specific insertions and these have been playing an important role in shaping the complete genome . elan was developed earlier as a suite of tools for genome - wide retrotransposon element analysis . the application of modules of this bioinformatics pipeline is described as follows : ( 1 ) elefinder performs a whole genome distribution analysis of the mges through a blastn search by making the use of perl / bioperl scripts by which the output files are parsed . it also extracts sequence 100 bp up and downstream at each mge site identified as a preinsertion locus . ( 2 ) dnascanner scans dna sequences such as preinsertion loci and analyses insertion hotspots of elements in detail so as to provide a set of signals or characteristics that are potentially recognized by an element for its insertion . the m. mulatta genome has a total of 22 chromosomes including x and y ( although the sequencing project did not sequence y ) . the only y chromosome that has been completely sequenced is of humans , and sequencing of the chimpanzee and mouse y chromosomes is in progress . the sequencing of the mammalian y chromosomes , of the organisms like rhesus macaque ( macaca mulatta ) , the white - tufted - ear marmoset ( callithrix jacchus ) , the rat ( rattus novergicus ) , the bull ( bos taurus ) and the opossum ( monodelphis domestica ) , is proposed and still under process . we present here a study of the primate macaca mulatta genome to identify and characterize insertion sites of the two representative retroelements present , and further , comparison with similar features of the human genome ( excluding the y chromosome ) . the structural and thermodynamic features as well as protein interaction measures are computed in preinsertion loci using the tool dna scanner .", "in the human genome , a full - length l1 element is around 6 kb long , and is reported to be the most successful tes in human genome by mass while alu elements , typically ~300 bp long are most successful in terms of copy number . currently , there are three macaque consensus sequences for alu : alumacya3 , alumacyb2 , and alumacyb4 and five of that for l1 : l1p4a , l1p4b , l1p4c , l1p4d , l1p4e in repbase ( version 13.5 ) . we first compute the nucleotide sequence divergence of l1 ( human ) with respect to the corresponding l1 ( macaca genome ) ( table 2(a ) ) . as can be seen , pairwise alignment shows a low percentage identity , with the major areas of dissimilarity in the 3 region . the macaca lineages show higher percentage similarity with each other ; with regard to the human genome , the l1 nearest to its human analog is l1p4d , while that which has diverged the most is l1p4e . macaca lineages show high similarity with each other and human alu seems to be most closely related to the macaca specific alumcaya3 ( table 2(b ) ) . tables 3 and 4 give details of the numbers of alu and l1 elements in each chromosome . the four groups constructed for the pre insertion loci were : intact on both ends , intact on 5 , intact on 3 and intact on neither end . about 1077410 copies of alus were found uniformly distributed on each chromosome . of these approximately 13.49% ( 145428 ) are truncated on the 5 end , 456752 copies ( 42.39% ) are truncated at both the ends , 30.29% are the truncated at 3 end ( 326447 ) . a negligible fraction ( 1.6% ) of l1 elements was intact on both sides : of the 94616 elements identified 22% ( 21044 ) were truncated at the 5 end and 1.38% ( 1314 ) were truncated at the 3 end and about 75% at both ends . as in the human genome , there are few functional alu copies in m. mulatta , and their distribution on the various chromosomes follows similar patterns ( fig . the x chromosome is known to have an exceptionally high number of the l1 elements ( fig . 1b ) , which also contained the largest number of truncated elements ( at both the ends ) . the y - axis represents the frequency of elements found on the different chromosomes ( marked along the x - axis ) . the y - axis represents the frequency of elements found on the different chromosomes ( marked along the x - axis ) . the pre - insertion loci were extracted and evaluated for various physicochemical properties as described in our earlier paper . the positions of the extrema were similar to those seen in other cases in the physicochemical profiles generated by dnascanner . similar tables were calculated for each m. mulatta chromosome and for all the 14 characteristics extrema were seen in the range of -9 to -11 bp for alu element and that for the l1 element was between -2 to -19 for the majority of the cases . for l1 elements , results are similar and table 5 gives the complete information about the values and the extrema for each of the properties . figures 2 and 3 show the graphs obtained for 4 physicochemical properties for alu and l1 elements insertion sites in macaca genome . control sequences were generated by scrambling the positive data set of pre - insertion sequences ; all these above properties gave a featureless distribution ( namely no extrema ) . another independent set of control sequences that were obtained by randomly selecting genomic sequences of 100 bp also gave similar featureless results . various signals upstream of the insertion sites of alu in chromosome 1 , for ( a ) stacking energy , ( b ) at content , ( c ) propeller twist and ( d ) protein induced deformability . the y axis represents value of the property and the x - axis gives the relative position with respect to the insertion site ( taken to be 0 ) . various signals upstream of the insertion sites of l1 in chromosome 1 , for ( a ) a rule , ( b ) nucleosomal bending , ( c ) nucleosomal positioning,(d ) protein induced deformability . the y axis represents value of the property and the x - axis gives the relative position with respect to the insertion site ( taken to be 0 ) . our rationale for the choice of the various parameters 1 ) regions with alternating purines / pyrimidines steps and at rich regions melt more readily . we found regions of low gc and high at content , indicating that a relatively less energy is required to melt dna near insertion sites , which in turn favors retrotransposition ( figs . ( 2 ) propeller twist is a property , involved in the distortion of the hydrogen bonds that hold two bases together . regions with specific dinucleotides with large propeller twist , followed by a lower propeller twist were obtained ( fig . 2c ) , which shows that latter regions may be easily distorted and are suitable for insertion . ( 3 ) nucleosomes are involved in dna compacting and providing transcription factors access to the respective regulatory regions . two different nucleosomal related features , the bending energy / persistence length and the position profiles of the nucleosomes , were studied . regions with comparatively low energies were obtained , within the upstream areas of the insertion sites . ( 4 ) stacking energy profiles showed a maximum near -10 , indicating that this region is unstable , leading to easy de - stacking of dna sequence , which would thereby enable an easy insertion of alu . ( 5 ) duplex stability is a measure of the relative stability of the dna - duplex structure , which is directly dependent on sequence . we obtained the region around the -10 position for alu and at -19 for l1 , with a peak , representing a region which would de - stack or melt easily . ( 6 ) dna deformability is an important property , dependent on the sequence and required for interaction with proteins . the dna deformability was calculated and a region ( at -10 for alu and -18 for l1 ) of low deformability was seen ; this facilitates retrotransposon insertion . the results of elefinder as well as the information curated in the inside database were used to find the distribution of truncation sites in the whole m. mulatta genome . the x - axis represents the length of element divided in bins of 25 , i.e.,125 , 2550 , and so on . the criteria used for the plotting was the occurrence of 5truncated and 3 intact ends and 3 truncated and 5 intact ends in the macaca genome . the basic aim was to identify the positions in the element sequence , where most of the times truncation occurs for the macaca genome as a whole . the graph plotted for the 3 truncated ends , the maximum number of hits were obtained in the last bin , i.e. , the 276300 bin has the maximum number of truncations in the macaca genome ( fig . similarly , for the 5 truncated category , the maximum number of truncations was found to be in the first bin , i.e. , the 125 bin ( fig . ( a ) the truncation distribution of alu element in macaca mulatta for bin size 25 and the graph is plotted for 3 end of alu truncated and its 5 end being intact . ( b ) the truncation distribution of alu element in macaca mulatta for bin size 25 and the graph is plotted for 5 end of alu truncated and its 3 end being intact .", "previously , we analyzed several genomes for distribution of mges as well as their insertion sites along with the signals facilitating their insertion . in the present study of alus ( sine ) and l1s ( line ) in the macaca genome we found that the insertion sites had physicochemical characteristics that were similar to those observed in other organisms , suggesting that these are generally important . the present study confirmed that the region 100 bp upstream from alu and l1 insertion sites show statistically significant distinctive properties both in the physical and structural characteristics , as well as in the energetics . these properties seem to play an important role in the insertion of mge . during insertion , a mge causes the target site to distort in a number of ways and requires the co - operative action of a number of proteins to break bonds , unwind the dna , and to nick the target site strand . it is due to this series of requirements , that the insertion sites for all the chromosomes , show a characteristic set of physicochemical properties , signified by the extremum peaks in each case . each of the peaks for the several properties carry biological significance and may be used further for the identification of potential new insertion sites . in each case , that the nature of the extremum that has a role in defining the trend of each property was identical for both alu and l1 ( table 5 ) , explaining that the signals that are needed for the insertion of the element is same , and are probably necessary for the insertion to actually occur , although also probably are not sufficient . detection of the most probable truncation sites for alu elements within the complete macaca genome revealed that during insertion the truncation distribution of alu peaks toward the starting positions in the case of the trailing edge truncation and is reversed for leading edge truncations . we have found that lines are present in large number in all the primate genomes which includes the recently studied gorilla genome as well as callithrix jaqqus , pan troglodytes , orangutan ( fig . there could be an evolutionary link in primate genomes through the spread of lines and sines ; alternately , there may have been a master l1 or retrotransposon copy in the genome of last common ancestor of all primates . the present work adds insight into primate genome architecture , showing the common structural features that promote mge insertion and genome expansion . in future work , we aim to compare the insertion sites across species- a task that will be facilitated as the diversity of sequenced genomes increases further .", "the genome sequence of macaca mulatta was retrieved from the ncbi ( ftp server : ftp://ftp.ncbi.nih.gov/genomes/ ) . the element sequence ( for alu and l1 ) were obtained from repbase and pairwise alignment was performed for the l1 for the human and macaca specific l1s and its lineages using standard procedures . elefinder was used to find the insertion site of alu and l1 in the macaca genome . this tool finds the nature , distribution , genomic location , and the site of truncation for each of the insertion sites and performs comparative genome analysis and also generates several set of sequences . since we have previously shown that intact copies show the presence of signal as compared with the truncated groups , the analysis of the full - length elements , i.e. , of those capable of transposition was also performed . the tool dna scanner analyses the dna for many physico - chemical properties by using various thermodynamic , protein interactions and sequence - based features , which are beyond the t density and at density . in accordance to the choice of input parameters , the program evaluates a number of properties , using windows that move along the length of the query dna sequence . since downstream sequences tend to show signals that are not sufficiently statistically significant only upstream sequences were investigated for both alu and l1 elements . the controls were selected by scrambling sequences , randomly picking sequences from genome as well as gene sequences ." ]

[ "the prevalence of ulcerative colitis ( uc ) has increased each year for the past several decades . a large - scale population - based cohort study shows that the flare - up rate in women is 1.2 times higher than that in men . accordingly , female gender appears to be a risk factor for frequent uc flare - up . female patients often suffer from uc symptoms during pregnancy as uc symptoms generally start to appear then , and a definitive diagnosis of uc has been confirmed in younger individuals in their teens to thirties . it has been estimated that approximately 25% of female uc patients conceive after uc diagnosis . in addition , the risk of flare - up and the development of associated inflammation during pregnancy is known to be increased in both the remission and the active stages of inflammatory bowel diseases ( ibd ) , including uc and crohn 's disease . the first trimester is considered to be a particularly high - risk time for flare - up of uc . in contrast , two european cohort studies of 634 pregnancies in 303 women showed that pregnancy improves the disease course , with a reduction in flare - ups in subsequent years [ 2 , 4 ] . therapeutic options are limited when flare - ups occur during pregnancy due to the concerns for the safety of fetus . according to previous reports and statements by the united states food and drug administration ( fda ) ( http://www.fda.gov/drugs/developmentapprovalprocess/developmentresources/labeling/ucm093307.htm ) , 5-aminosalicylic acid ( 5-asa ) , corticosteroids and granulocyte and monocyte adsorptive apheresis ( gma ; adacolumn ) however , we have often observed uc that is refractory to individual treatment with these drugs or with this modality , or to intensive therapeutic approaches that combine these drugs with this modality . intensive gma involving two gma sessions per week has recently been shown to be more efficacious than conventional weekly gma . furthermore , intensive gma also safely induced rapid remission in patients with moderately active uc inflammation . very recently , the drug tacrolimus was approved in japan for the treatment of patients with moderate or severe uc , regardless of whether the uc is dependent on or refractory to corticosteroids . tacrolimus is reportedly useful for the treatment of refractory uc due to its potent immunosuppressive properties , which induce inhibition of the transcription of the early activation genes encoding interleukin-2 , tumor necrosis factor- ( tnf- ) and interferon- that are responsible for the development of inflammation . we report herein the case of a patient with severe uc that had developed during the first trimester of pregnancy and was refractory to combination therapy with high - dose corticosteroids and intensive gma , but was successfully treated with tacrolimus following cesarean section early in the third trimester .", "in july 2009 , a 36-year - old pregnant woman was referred to our hospital for treatment of refractory uc . she had been diagnosed with uc ( total colitis ) at the age of 17 . oral 5-asa ( 2,250 mg / day ) had maintained her in remission up to the age of 31 . subsequently , repeated flare - ups had occurred and she had been treated with corticosteroids or with the routine weekly gma . azathioprine ( aza ) administration was also tried , but had to be stopped due to aza - induced pancytopenia . then , oral 5-asa ( 2,250 mg / day ) plus 3 mg betamethasone enema had induced and maintained remission up to 2008 . in april 2009 , at the age of 36 years , she became intentionally pregnant for the first time , while her uc was in remission with oral 5-asa at a dose of 2,250 mg daily . however , during pregnancy , the flare - up of her total colitis required daily intravenous administration of up to 80 mg / day prednisolone , oral 5-asa 2,250 mg / day and weekly gma for 10 weeks , followed by weekly lymphocytapheresis for 3 weeks under the management of a total parenteral nutrition program at the previous hospital . she underwent a blood transfusion due to the development of bloody bowel movements , which was followed by severe anemia with less than 8 g / dl of hemoglobin . antigenemia ( c7-hrp ) positivity against cytomegalovirus was transiently detected and subsequently spontaneously converted into a negative response . after referral to our hospital , the patient was orally administered 20 mg prednisolone and 2,250 mg mesalamine on a daily basis . physical examination revealed lower abdominal tenderness with repeated bloody stools ( 810 times a day ) . laboratory investigations revealed a white blood cell count of 9,900/l , hemoglobin 10.1 g / dl , c - reactive protein 2.41 mg / dl , serum albumin 2.9 g / dl and an erythrocyte sedimentation rate of 50 mm / h ( table 1 ) . a first sigmoidoscopy showed several deep longitudinal ulcerations with erythematous and edematous changes in the mucosa from the rectum to the sigmoid colon ( fig . immunohistochemical findings and a polymerase chain reaction analysis of cytomegalovirus in colon biopsy specimens were also negative . upon discussion of the remaining therapeutic options , she was first maintained on 20 mg prednisolone and 2,250 mg 5-asa daily ; these doses were increased to 40 mg predonisolone and 4,000 mg 5-asa daily in addition to 500 mg vancomycin daily for 1 week because of little improvement and stool culture positivity of clostridium difficile ( though cultures were negative for c. difficile toxin ) . the patient also underwent intensive gma therapy ( two sessions weekly ) , which was partially successful , resulting in almost complete disappearance of abdominal pain and a decrease in bowel movements to 35 times daily . however , her anemia was little improved and there was a gradual development of hypoalbuminemia to such an extent that transfusion of albumin was necessary every other day in order to maintain the serum level at 3.0 mg / dl , the recommended level for healthy development and safe delivery of a child . she was consequently unable to attain a further prolonged gestation and feared risks of blood - borne infections like hepatitis b , hepatitis c or aids viruses by repeated frequent blood transfusions . her first baby was prematurely delivered by cesarean section at 28 weeks and 1 day on september 9 ( birth weight 1,008 g , length 35 cm ) without any congenital malformations or neurological abnormalities . after cesarean section , the patient was started on oral tacrolimus ( prograf ) , aiming for serum trough levels of 1015 ng / ml for 2 weeks , followed by tapered serum trough levels of 510 ng / ml . her condition quickly improved in the following weeks and complete remission was achieved by tapering the prednisolone dose . total colonoscopy showed scattered regenerating areas with faintly erythematous changes in the mucosa of the transverse colon and the rectum and the appearance of mucosal healing at other sites 3 months after oral tacrolimus administration was started ( fig . tacrolimus is not currently approved in japan for maintenance therapy , and therefore tacrolimus administration was stopped .", "in clinical settings , therapeutic treatment for uc flare - up during pregnancy is limited because of concerns for the safety of the unborn child . we report herein the case of a patient with flared refractory uc during pregnancy who underwent a bridging therapy consisting of high - dose corticosteroids combined with intensive gma until it was impossible to prolong gestation any further . at that point , the incidence rates of flare - up and the development of uc during pregnancy reach approximately 30% during both the remission and the active stages . however , it has been reported that there is no evidence to suggest that pregnancy increases the relapse risk for patients with uc [ 2 , 4 ] . there is also some evidence to show that pregnancy has a favorable effect on uc over time . a retrospective study of 111 ibd patients showed that increased parity is associated with a reduction in surgical resections . thus , while relapses do occur in pregnant patients , such episodes are apparently not more frequent than those in non - pregnant individuals . the key point regarding whether uc will re - emerge during pregnancy or not is the degree of activity of uc at the time of conception . therefore , although the present case was in remission at the time of conception , this remission may not have involved complete mucosal healing . currently used medications , such as corticosteroids , purine analogues , cyclosporine , tacrolimus and anti - tnf blockers , are all associated with an increased risk of opportunistic infection . multivariate analysis of a recent case - control study performed in ibd patients showed that the use of corticosteroids increased the likelihood of opportunistic infection with a calculated odds ratio of approximately 4 compared with the use of mesalamine . numerous studies have described an association between opportunistic enteric infections and exacerbation or relapse of uc . pathogens involved as potential triggers of uc flare - ups include c. difficile , campylobacter spp . , escherichia coli , and cytomegalovirus . in particular , the risk of c. difficile - associated diarrhea is increased , not only by antibiotic exposure , but also by immune - compromising conditions in ibd patients , and there is therefore a strong focus on this risk during uc flare - ups . c. difficile - associated colitis in patients with ibd has a higher mortality than that in patients with c. difficile without a background of ibd . although neither toxin a nor b was detected in the present case , we eradicated c. difficle as a precautionary measure this treatment resulted in a partial response with 23 times fewer daily bowel movements than prior to eradication , suggesting that c. difficile infection might indeed be involved in the exacerbation of uc disease activity . repeated stool cultures and toxin analyses of c. difficile after eradication gave a negative result as did analysis of c7-hrp . pharmacologic management of uc currently relies on 5-asa , corticosteroids , immunomodulators ( aza and 6-mercaptopurine ( 6-mp ) ) , calcineurin inhibitors ( cyclosporine and tacrolimus ) , and tnf blockade . regarding medication during pregnancy , the most important point is to maintain remission and inactivation of disease , since the greatest risk to pregnancy is active disease . another key principle to disease management during uc flare - up is to remember that therapeutic treatment is limited due to concerns regarding potential fetal complications . 5-asa remains the first - line therapy for induction and maintenance of remission for patients with mild to moderately active uc , based on an extensive history of efficacy and safety . prospective controlled trials and a population - based cohort study of pregnant patients who had been exposed to mesalamine did not suggest that 5-asa posed an increased risk to the fetus , despite the fact that mesalamine and its metabolite , acetyl 5-asa , are found in cord plasma . corticosteroid therapy is a well - established and effective treatment for patients with active uc . a large case - control study and a meta - analysis of the use of corticosteroids during the first trimester of pregnancy reported an increased risk of oral clefts in the newborns with an odds ratio of 3.35 ( 95% confidence interval 1.975.69 ) and a low overall risk of major malformations with an odds ratio of 1.45 ( 95% confidence interval 0.82.60 ) . intensive leukocytapheresis ( adacolumn , jimro and cellsorba ; asahi medical company , tokyo , japan ) is a relatively safe procedure that is widely used in japan for the treatment of active uc . a case report of a patient with uc at one center reported that gma was effective for severe uc by inducing remission with no fetal complications . immunosuppressive therapy using aza or 6-mp is sometimes useful for maintenance of remission in uc . pregnant patients treated with aza or 6-mp for ibd showed no incidence of pregnancy complications or congenital malformations . a cohort study that investigated the pregnancy outcome in female patients with crohn 's disease showed a higher rate of congenital anomalies following antenatal exposure to aza compared with non - treated patients . thus , the safety of aza and 6-mp in the treatment of pregnant patients with ibd remains controversial . one report that investigated 100 pregnancies among transplant recipients showed a 68% live birth rate , 12% spontaneous abortion , 3% stillbirth , and 59% premature delivery . in contrast , a case report of a patient with uc described a successful pregnancy and delivery of a healthy baby with rapid remission and long - term maintenance . a meta - analysis of 15 studies of pregnancy outcomes after cyclosporine therapy reported no statistical difference in the rate of fetal malformations compared to that among the general population . a rapid clinical response to a tnf- inhibitor ( infliximab ) is obtained when this inhibitor is used for the treatment of uc . infliximab does not cross the placenta in the first trimester , but feasibly is likely to do so in the second and third trimesters , thus protecting the infant from infliximab exposure during the crucial period of organogenesis . this result suggests that infliximab treatment does not pose a significant risk of complications during pregnancy . the use of aza/6-mp , tacrolimus or cyclosporine during pregnancy has never been permitted in japan . furthermore , until june 2010 , infliximab treatment was not approved for treatment of active uc . based on all of the above , we ultimately selected the following treatment regime : bridging therapy using 5-asa , corticosteroids , and intensive gma until it was impossible to further prolong gestation followed by a rescue therapy using tacrolimus after cesarean section . this therapy ultimately resulted in clinical remission . in conclusion , for pregnant uc patients , combined therapy consisting of high - dose corticosteroids and intensive gma is recommended until it is impossible to prolong gestation any further . when clinical remission can not be obtained , rescue therapy using tacrolimus after cesarean section may be useful .", "the authors declare that no financial or other conflict of interests exists in relation to the content of this paper ." ]

[ "only a few cases of pulmonary vascular tumors diagnosed using endobronchial ultrasound - guided transbronchial needle aspiration ( ebus - tbna ) have been reported in the literature . they frequently present as filling defects in the pulmonary vasculature on computed tomography ( ct ) making it challenging to distinguish between vascular tumor and thrombotic emboli . although fluorodeoxyglucose - positive emission tomography ( pet ) scan may reportedly help differentiate malignant growth from benign emboli , pet scans are not routinely performed for this purpose . increased uptake on the pet scan increases the malignant suspicion of vascular tumors but in most cases ebus - tbna of mediastinal and hilar lymph nodes has proven value in diagnosis and staging for lung cancer . in addition , ebus - tbna may provide an opportunity to identify and sample endovascular abnormalities in the mediastinal and hilar area .", "a 43-year - old white male was diagnosed with leiomyosarcoma of proximal left thigh involving femoral vessels 2 years back . he was found to have pulmonary embolism involving right pulmonary artery for which he was started on anticoagulation and an inferior vena cava filter was placed prior to surgery . despite being on anticoagulation postoperatively , serial surveillance imaging continued to show persistent thrombus . eventually , an interval increase in size of the filling defect in right main pulmonary artery extending to the right lower lobe pulmonary artery was noted on contrast - enhanced chest ct [ figure 1 ] . at this point , intravascular metastatic tumor was suspected and the patient was referred to our interventional pulmonary service for diagnostic evaluation . the patient did not have any other imaging studies such as pet scan or magnetic resonance imaging of the chest . ebus ( bf - uc160f - ol8 ; olympus , tokyo , japan ) procedure was performed under general anesthesia . with the ultrasound and color flow doppler , an endovascular hyper - echoic lesion was identified in right pulmonary artery [ figure 2 ] . only one endovascular lesion was identified , which extended to the right lower lobe branch of the pulmonary artery . because of the nature of the lesion 's extension in the pulmonary artery , it was not possible to accurately size it but it was estimated to be around 20 mm in the largest diameter . ebus - tbna of this lesion using the 22 gauge ebus needle ( olympus , na-201sx-4022 ) was performed under general anesthesia with laryngeal mask airway using propofol intravenous drip and fentanyl intravenous intermittent injections . a core biopsy was obtained using the 22 gauge ebus needle and a total of five passes were performed during this procedure . rapid - on - site evaluation of fixed slides was bloody , and no malignant cells were identified . the procedure was performed without any complications and cytopathological and immunohistochemical evaluation confirmed the diagnosis of metastatic leiomyosarcoma [ figure 3 ] . the patient was started on gemcitabine plus docetaxel combination chemotherapy . ( a ) chest computed tomography ( ct ) image showing right pulmonary artery filling defect ( arrow ) diagnosed as pulmonary thrombotic emboli 2 years ago . ( b ) chest ct 2 years later showing enlarged right pulmonary artery filling extending to the right lower arterial branch consistent with vascular tumor ( arrow ) ( a ) endobronchial ultrasound ( ebus ) image of the right hilar area showing an vascular tumor of the right lower lobe pulmonary artery ( arrow ) . ( d ) ebus - guided transbronchial needle aspiration ( arrow ) of the right pulmonary artery tumor . the color doppler was used to ensure sampling the tumor area with the least blood flow ( a ) this is the tissue core biopsy of the right pulmonary mass lesion showing cells with abundant eosinophilic cytoplasm and spindled nuclei ( h and e , 200 original magnification ) . ( b ) these cells cytologically shows fine granular chromatin without prominent nucleoli ( papanicolaou stain , 600 original magnification ) . ( c ) immunohistochemical stains for smooth muscle actin shows strong immunoreactivity in these cells ( sma , 400 original magnification ) . ( d ) immunohistochemical stains for desmin also shows strong positivity in these malignant cells ( desmin , 200 original magnification )", "historically , most cases of pulmonary artery tumors were diagnosed with surgery or during postmortem examination . successful diagnosis of primary pulmonary artery leiomyosarcoma with catheterization and biopsy has also been reported . in the last few years , several cases of primary and metastatic pulmonary artery tumors diagnosed by ebus - tbna have been reported without any procedure - related complications . although pulmonary artery hematoma has been described from ebus - tbna , the pulmonary artery was inadvertently punctured in that case during a routine biopsy of mediastinal lymph node . in addition , there have been reports of using ebus - guided trans - pulmonary vascular lymph - node sampling without any complications . here , we present the first case of metastatic leiomyosarcoma of pulmonary artery diagnosed with ebus - tbna . the case reported is a clear example of the challenges in diagnosis of pulmonary artery tumors due to their endovascular location and the potential risk of bleeding . the use of color flow doppler during ebus - tbna of pulmonary vascular tumor is essential to avoid area of higher blood flow and to perform the biopsy in the tumoral area of least blood flow . given the potential higher risk of bleeding , anticoagulation or clopidogrel therapy should probably be discontinued prior to this procedure . clinically , the importance of high index of suspicion is also demonstrated as the patient was initially diagnosed with pulmonary embolism . misdiagnosing patients with pulmonary artery tumor emboli as thrombotic emboli can result in delaying effective tumor therapy with chemotherapy or surgery . the diagnosis of pulmonary embolism in patients with malignant diseases can be challenging especially in ill patients where the wells score is already high . our patient was asymptomatic , and the chest imaging was performed as part of surveillance and staging of his sarcoma . intravascular metastasis was suspected as an alternate diagnosis after the presumed failure of anticoagulation therapy and increased of the pulmonary artery lesion size . ebus - tbna is a safe procedure and serious complications are extremely rare . until now , ebus - tbna of the pulmonary vascular lesions did not report any serious complications .", "ebus - tbna seems to be a safe , feasible , and minimally invasive tool for the diagnosis of vascular tumors such as metastatic pulmonary artery leiomyosarcoma ." ]

[ "transitional cell carcinoma ( tcc ) of the urinary bladder can present as a non - muscle invasive or as a muscle - invasive lesion . the majority of patients ( approximately 75% ) present with non - muscle invasive tumors , which are limited to the mucosa ( ta ) or the lamina propria ( t1 ) ( 1 ) . . however , cis tends to behave more aggressively and is often found in association with high - grade non - muscle invasive tumors . prognostic factors in patients with non - muscle invasive bladder cancer have been the subject of numerous publications for many years ( 2 - 18 ) . depending on a patient 's characteristics , the probability of recurrence after transurethral resection ( tur ) at one year ranges from about 15% to 70% ( 2 ) , and the probability of progression at five years ranges from about 7% to 40% ( 6 ) . non - muscle invasive tumors may be managed with tur with or without intravesical therapy . however , not all non - muscle invasive bladder cancer patients have the same risk for disease recurrence and progression , and the absence of risk stratification between aggressive and indolent tumors contributes to potentially excessive frequent surveillance or unnecessary intravesical therapy . several studies have suggested risk tables for the recurrence and progression of non - muscle invasive bladder cancer ( 5 , 7 , 9 , 10 ) , but they can not calculate the probability of a certain event , such as the probability of recurrence within five years . the purpose of this study was to develop and validate prognostic nomograms for disease recurrence in patients with ta , t1 transitional cell carcinomas of the bladder . these nonograms will facilitate patient counseling , choosing the most appropriate adjuvant treatment after tur , and determining the frequency of follow - up in individual patients .", "thirty - eight training hospitals participated in this retrospective multicenter study . between january 1998 and december 2002 , 3,060 patients with newly diagnosed they were treated with transurethral resection ( tur ) and diagnosed with ta or t1 tcc of the bladder based on the 2002 american joint committee on cancer ( ajcc ) tnm staging system ( 19 ) . patients with prior histories of bladder cancer , non - tcc histology , primary cis , or a follow - up duration of less than 12 months were excluded . this cohort study was also limited to tumors whose grades were determined using the 1973 world health organization system . the median age was 63 yr ( 21 - 98 ) , and the median follow - up duration was 44 months ( 12 - 97 ) . the clinical and pathological data ( local ) , including sex , age , tumor size ( <3 cm or 3 cm ) , multiplicity ( single or multiple ) , t category ( ta or t1 ) , tumor grade , presence of concomitant cis or squamous differentiation , and intravesical therapy were obtained from each hospital and merged . one - thousand and eighty - two patients were treated with intravesical therapy after tur , and drugs used for intravesical therapy were as follows : bcg in 827 patients , mitomycin - c in 108 patients , epirubicin in 135 patients , and other drugs in 12 patients . follow - up data were also obtained , including pathologically proven recurrence and time to first recurrence , which was defined as the time period between the date of initial diagnosis and the date of recurrence . patients who were still alive or who had died before a recurrence were censored at the date of the last available follow - up cystoscopy . we assessed the impact of various clinical and pathological features on time to first recurrence . the predictive accuracy of each univariate and multivariate logistic regression model was tested using the area under the receiver operating characteristics ( roc ) curve . all univariate and multivariate models were internally validated with 500 bootstrap re - samples as a means of calculating the most unbiased predictive accuracy . statistical significance in this study all statistical tests were performed using r software ( r , version 2.4.1 , the r project for statistical computing , http://www.r-project.org ) .", "three - year and five - year recurrence - free rates were 64.3% and 55.3% , respectively ( fig . 1 ) . on univariate cox proportional hazard analysis , age , tumor size , multiplicity , tumor grade , concomitant cis , and intravesical therapy had a significant influence on recurrence - free survival ( p<0.05 ) ( table 2 ) . multivariate analysis revealed that age ( hazard ratio [ hr]=1.437 , p<0.001 ) , tumor size ( hr=1.328 , p=0.001 ) , multiplicity ( hr=1.505 , p<0.001 ) , tumor grade ( hr=1.347 , p=0.007 ) , concomitant cis ( hr=1.611 , p=0.007 ) , and intravesical therapy ( hr=0.681 , p<0.001 ) were independent predictors for disease - recurrence ( table 3 ) . based on this analysis , nomograms for the prediction of recurrence probabilities at three and five years were constructed ( fig . the scales of the nomograms reflected the coefficients from the cox model rescaled to a user - friendly ( 100 point ) range . the bootstrapping estimate of the predictive accuracy of the nomograms suggested that the area under the roc curve was approximately 0.599 at three years and 0.604 at five years . the results of bootstrap re - samples were 0.723 for the three - year estimation of the nomogram and 0.738 for the five - year estimation .", "the prognostic importance of various factors is not always consistent among various studies , and analyses of prognostic factors of the bladder tcc related to recurrence are sometimes difficult to compare ( 8) . this difficulty may be due to differences in the choice of the variables analyzed , their coding , and , in multivariate analyses , the correlation among the factors ( 10 ) . another important source of variability stems from differences in tumor status , especially between primary or recurrent tumors . this study showed that patient age , tumor size , multiplicity , tumor grade , cis , and intravesical therapy are significant predictors for recurrence in patients with ta , t1 tcc of the bladder . there was no difference in the time to the first recurrence between grade ii and grade iii tumors in the univariate analysis , so a dichotomized tumor grade ( grade i vs. grade ii / iii ) was used for the multivariate analysis ( table 2 ) . in addition , differences among intravesical instillation agents had no influence on time to first recurrence , and intravesical therapy was also simply dichotomized ( not performed vs. performed ) ( table 2 ) . of these , multiplicity and intravesical therapy following tur were the most influential determinants for prediction of recurrence in nomograms ( fig . tumor grade , tumor size , and patient age were less strong predictors than the ones mentioned previously . concomitant cis was a relatively weak variable , especially in nomograms for five years ( fig . 2 ) . in addition , in this study , the study cohort was limited to tumors that were newly diagnosed between 1998 and 2002 . nevertheless , tumor grade , t stage , concomitant cis , tumor size , intravesical therapy , tumor status ( primary vs. recurrent ) , and recurrence rate among other factors were generally identified as independent prognostic factors for disease recurrence ( 2 - 18 ) . in some studies , age , tumor location , and sex have also been regarded as independent risk factors ( 15 , 17 , 18 ) . notably , our nomograms showed that age is a strong determinant for prediction of recurrence . younger patients appear to have a more favorable prognosis because they present more frequently with non - muscle invasive , low - grade tumors . however , studies have shown that the risk for disease progression is the same , grade - for - grade , in younger patients as in older ones ( 20 , 21 ) . in contrast , our results suggest that age has a prognostic impact independent from other factors . these observations are consistent with the work by shariat et al . we can not explain why the age factor plays an important role in disease recurrence . differences in genetic and molecular aberrations in bladder tumors and accumulation of these aberrations in older patients may relate to age . 2 may be useful for patient counseling because they predict the probability that the patient will encounter recurrent bladder cancer within the next three to five years . they are also effective tools for selecting patients for experimental adjuvant therapy because they are likely to be more prognostically accurate than the typical risk stratification approaches that form patient groups by placing cutoffs on variables . in the context of a randomized clinical trial this procedure could be accomplished by computing predicted probabilities for each patient , which would simultaneously consider all prognostic variables , and by comparing the predictions across treatment arms . in our study , we suggested two nomograms that were very similar , but there were some differences in the weight of risk score . the nomogram for three years would be more suitable for short - term studies , and the five - year nomogram may be helpful for long - term studies . additionally , nomograms may aid in determining the scheduling of follow - up visits , as patients at lower risk for relapse or a second primary tumor may require less stringent follow - up evaluations ( 23 ) . the prediction for the area under the roc curve was approximately 0.599 for the three - year nomogram and was 0.604 for the five - year nomogram . despite being imperfect another limitation is that the nomogram predicts disease recurrence only within a maximum period of five years . the nomogram is additionally limited because it relies on postoperative variables , making it an inadequate preoperative patient counseling tool . it is important to remember that adjuvant therapy performed in this data set was a mixture of various intravesical therapies , and the decision as to which instillation drug should be chosen was left to the physicians . finally , experiencing a beneficial effect on intravesical therapy in this study does not mean that adjuvant intravescial therapy has to be performed in all cases of non - muscle invasive bladder tumors . the nomograms for non - muscle invasive bladder cancer in which a point system was used are very rare . ( 22 ) have reported that nomograms for non - muscle invasive bladder cancer can predict recurrence and progression , which included nuclear matrix protein 22 and cytology , as well as conventional predictors . we tested only conventional variables without ancillary markers , i.e. , nuclear matrix protein 22 . for this reason , the nomograms in our study may be more feasible in common clinical settings . in conclusion , current nomograms can be used to predict the probability of disease recurrence in patients with newly diagnosed ta , t1 transitional cell carcinoma of the bladder . they may be useful for patient counseling , clinical trial design , and patient follow - up planning ." ]

[ "endobronchial tuberculosis ( ebtb ) is a form of tuberculous infection that involves mainly the trachea and/or bronchi . the disease is often mistaken for more common lung diseases like pneumonia , asthma , lung cancer and other lung diseases . endobronchial stenosis is a common complication of ebtb despite the use of anti - tuberculous chemotherapy . we are presenting a case of ebtb that manifested with two endobronchial masses , which almost totally occluded the bronchial lumen and resulted in repeated episodes of post - obstructive pneumonia for more than a year prior to diagnosis . our patient was successfully treated with anti - tuberculous chemotherapy without the use of corticosteroids . repeated bronchoscopic examination after six months from initiating antituberculous treatment revealed complete resolution of the two lesions without residual bronchial stenosis .", "a 62 year old pakistani woman was admitted to hamad general hospital with history of fever for 10 days prior to admission . she denied any history of cough , hemoptysis , breathlessness , chest pain , nocturnal sweating or weight loss . prior to admission she was prescribed a seven - day course of amoxicillin that was changed to cephalexin by her family physician without improvement . for more than a year prior to this admission she had frequent visits to emergency room and a hospital admission for recurrent episodes of fever and cough that were diagnosed as community acquired pneumonia based on the radiographic finding of right lung opacity and the response to antibiotic therapy . three years earlier she was admitted for abdominal surgery due to a perforated duodenal ulcer and incidentally discovered to have type 2 diabetes for which she was commenced on glibenclamide . she had frequent visits to pakistan , the last of which was 2 years prior to her admission . eight months prior to her admission she was refused entry to canada because of abnormal chest radiograph . she was a housewife , life - long non - smoker , and never consumed alcohol . physical examination was remarkable for fever of 39.5 c and dull percussion note over the right lower and mid chest , without added sounds . laboratory investigations at admission revealed leucopenia of 1.8103/ul with neutropenia of 0.5103/ul and normal hemoglobin and platelet count . peripheral blood smear revealed marked leucopenia with severe neutropenia , few toxic , left - shifted neutrophils and reactive lymphocytes without malarial parasites seen ( picture of severe infection or drug induced cytopenia ) . bacterial culture of the sputum , 3 sputum samples for acid - fast bacilli smear and culture and human immunodeficiency virus ( hiv ) testing were all negative . chest radiograph revealed right lower and mid zone non - homogenous opacity ( figure 1 ) . computerized tomography ( ct scan ) of the chest and abdomen revealed a soft tissue enhancing mass in the lumen of the right main bronchus that was associated with distal parnechymal consolidation and multiple lymph node enlargement ( figure 2 ) . chest radiograph showing opacification of the right lower zone ct scan of the chest showing right bronchial mass with post - obstructive consolidation ( arrows ) bone marrow examination revealed a cellular marrow without evidence of involvement by neoplastic or granulomatous process . bronchoscopy was done and showed two large endobronchial masses , one in the right main bronchus and the other in the right upper lobe bronchus with glistening , whitish surface ( figure 3 ) . endobronchial biopsy was taken from both masses and reveled caseating granuloma with presence of acid - fast bacilli on zeihl - nelsen staining ( figure 4 ) . bronchoscopic picture showing a mass in the right main bronchus and another one in the right upper lobe bronchus histopathologic slides showing caseating granuloma with acid - fast bacilli ( arrow ) bronchoalveolar lavage culture for acid - fast bacilli was negative . she was started on intravenous meropenem for 14 days and antituberculous chemotherapy in the form of rifampicin , isoniazide , ethambutol and pyrazinamide for 2 months , and then continued on rifampicin and isoniazide for further 4 months . a repeated bronchoscopy 6 months later revealed complete resolution of the endobronchial masses without evidence of bronchial stenosis ( figure 5 ) . bronchoscopic picture of the right main bronchus and the right upper lobe bronchus after six months of treatment showing disappearance of the masses with no residual stenosis", "the disease remained infrequently reported and was mainly a postmortem pathological diagnosis until the advent of bronchoscopy in the late 1920s . ebtb is defined as tuberculous infection of the tracheobronchial tree with microbial and histopathological evidence [ 3 , 4 ] . this form of tuberculous infection continues to be an important health problem for three reasons ; firstly , its diagnosis is frequently delayed , particularly in developed countries , as the decreased incidence itself diminishes the suspicion of tuberculosis . secondly , bronchial stenosis is a serious complication of the disease that may develop despite efficacious antituberculous chemotherapy and thirdly , it is often misdiagnosed as bronchial asthma or lung cancer . the exact pathogenesis of ebtb is unknown , however , direct extension from adjacent pulmonary parenchymal lesion , implantation of the organisms from infected sputum , dissemination from the blood or erosion of a lymph node into the bronchus have all been suggested as possible mechanisms of the disease [ 3 , 8 ] . chung and lee identified seven subtypes of ebtb on bronchoscopic appearance ; the actively caseating type ( 43.0% ) , the edematous - hyperemic type ( 14.0% ) , the fibrostenotic type ( 10.5% ) , the tumorous type ( 10.5% ) , the granular type ( 11.4% ) , the ulcerative type ( 2.7% ) , and the non - specific bronchitic type ( 7.9% ) . among these subtypes , the prognosis of tumorous ebtb was found to be most grave and unpredictable . the majority of the tumorous ebtb cases studied by chung and lee changed to fibrostenotic type within 3 months of treatment . tumorous ebtb is characterized by an endobronchial mass whose surface is covered by caseous material and totally or near totally occludes the bronchial lumen . this form of ebtb is frequently mistaken for lung cancer , adenoma or carcinoid tumors . the two most important goals when treating ebtb are to eradicate tubercle bacilli and to prevent bronchial stenosis . although anti - tuberculous chemotherapy is effective in controlling infection , it does not prevent residual bronchostenosis [ 5 , 4 ] . oral corticosteroids have been used empirically to prevent bronchial stenosis , nevertheless , their role remains uncertain and controversial [ 9 , 10 ] . many patients with ebtb will require aggressive treatment like repeated dilatation , the use of stents or even resection to treat bronchial stenosis . some previous studies have suggested that delay in diagnosis of ebtb is an independent predictor of the development of persistent airway stenosis . our patient presented with two tumorous growths that almost completely obstructed the lumens of the right main bronchus and right upper lobe bronchus and resulted in recurrent episodes of post - obstructive pneumonia for more than a year prior to diagnosis . considering the prognosis of tumorous type ebtb and the delay in diagnosis as a predictor for the development of bronchial stenosis , healing without stenosis in our case seems interesting . it may suggest that the exact mechanism behind the tendency of some patients and certain types of ebtb to develop bronchial stenosis is not yet completely understood . future research should focus on the pathogenesis of bronchial inflammatory reaction induced by ebtb in order to understand this mechanism ." ]

[ "the present study was conducted in the psychiatry outpatient department of a tertiary care hospital during one year after obtaining clearance from institutional ethical committee . their sociodemographic profile , characteristics of migraine , psychiatric history , detailed physical examination as well as mental status examination was recorded . the patients were subjected to specialists opinion ( e.g. , ophthalmologist , ent or medical specialist ) and relevant investigations ( e.g. , fundus , x - ray skull , c.t . the cases suffering from organic mental disorders , chronic psychiatric disorders , epilepsy or drug dependence were excluded from the study .", "out of 3245 patients seen during the study period , 100 ( 3.2% ) were suffering from migraine . maximum patients belonged to age - group of 31 - 40 years ( 40% ) followed by 21 - 30 years ( 22% ) . a majority of migraineurs were married ( 76% ) , illiterate or just literate ( 55% ) , hindus ( 86% ) and housewives ( 56% ) [ table 1 ] . socio - demographic characteristics of patients with migraine family history of migraine was present in 12% cases whereas family history of depression was present in 6% . maximum patients had a total duration of migraine as one to three years ( 40% ) followed by less one year duration ( 32% ) . the commonest frequency of migraine was 1 - 2/week ( 54% ) or 2 - 3/month ( 26% ) . the provoking factors were reported in 18 patients ( 18% ) [ table 2 ] . migraine without aura ( previously called common migraine ) was the commonest variety ( 81% ) followed by migraine with aura ( previously called classis migraine ) ( 17% ) and complications of migraine ( 2% ) ( only two cases reported complications due to migraine both with fainting spells ) . the personality profile of the patients showed anankastic traits ( 25% ) , dysthymic traits ( 20% ) , histrionic traits ( 17% ) , anxious traits ( 14% ) , schizotypal traits ( 10% ) , cyclothymic traits ( 6% ) and others ( 8% ) . the physical comorbidity included hypertension ( 12% ) , cervical spondylosis ( 8% ) , refractive errors ( 7% ) , chronic sinusitis ( 3% ) and diabetes mellitus ( 2% ) . characteristic of migraine generalized anxiety disorder ( f41.1 ) was the commonest psychiatric diagnosis ( 34% ) followed by mixed anxiety and depressive disorder ( f41.2 ) ( 18% ) , 22 patients ( 22% ) did not have any psychiatric disorder [ table 3 ] .", "migraine is reported to be more common in persons between the age of 20 and 45 years . in the present study also , migraine was found to be more common among age group of 31 - 40 years ( 40% ) followed by 21 - 30 years of age ( 22% ) . this is also consistent with other studies[91416 ] and a majority of patients were married ( 76% ) . unilateral type of headache was much more common than the bilateral type and the headache was throbbing in nature in a majority of migraneurs . there is a wide range of age of onset of migraine reported in the literature ( 5 to 28 years ) with an average age at onset in mid - teens . they were fatigue , lack of adequate sleep , intake of alcohol , menstruation and oral contraceptives . the other provoking factors for migraine as reported in the literature e.g. , aged cheeses , caffeine , chocolate , concentrated sugar , dairy products , fermented , pickled food , fruits ( bananas , figs , raisins , pineapple etc . , ) vegetables ( onions , pea , pods , nuts , peanuts ) , yeast products , meats with nitrites , monosodium glutamate , saccharin etc . , could not be identified or reported by the patients in the present study . migraine without aura ( previously called common migraine ) was the commonest subtype seen ( in 81% ) . this is consistent with the reported findings that lifetime prevalence of migraine without aura is about 13% as compared to migraine with aura seen in less than 4% population . generalized anxiety disorder ( f41.1 ) was the commonest disorder followed by mixed anxiety and depressive disorder ( f41.2 ) and depressive episode ( f32 ) . mixed dissociative ( coversion ) disorders ( f44.7 ) ( fits and fainting ) were also seen among female migraineurs . previous clinical and community studies[1724 ] have also reported a strong association between migraine and depression as well as anxiety disorders and also vice - versa . the literature also indicates that patients with migraine are at reduced risk of suffering from anxiety , mood disorders and substance - related disorders compared with medication overuse headache sufferers . retrospective studies on the onset and course of these syndromes showed that the onset of anxiety generally preceded that of migraine whereas the onset of depression tended to occur after that of migraine . the studies on association of personality traits and migraine demonstrate increased prevalence of neuroticism - anxiety and depression as compared to healthy controls . but the present study , a cross sectional one , did not determine whether the onset of anxiety disorder and depression preceded or followed the migraine . health - related outcomes were worst in those with both migraines and a psychiatric disorder and intermediate in those with either condition alone . future long term follow up studies on larger sample are warranted to study this association .", "the present study confirms that majority ( 78% ) of patients with migraine had psychiatric disorders ." ]

[ "medullary thyroid carcinoma ( mtc ) is a rare neuroendocrine cancer that originates from thyroid parafollicular calcitonin-(ct- ) producing cells . mtc accounts for approximately 4% of all thyroid malignancies ; approximately 75% of these cases occur in the sporadic form , and 25% occur in the hereditary form [ 13 ] . mtc usually has a favorable prognosis , with a 10-year survival rate of 70%80% , if it is diagnosed and treated at an early stage when the tumor is confined to the thyroid . unfortunately , most cases of mtc present at diagnosis with metastases to the local and regional lymph nodes and to distant organs , especially the lungs , liver , and bones . patients with metastatic mtc have a 10-year overall survival rate of 40% , and metastasis is the main cause of death in patients with mtc [ 4 , 6 ] . locally advanced and distant metastatic diseases are incurable , as surgical resection and conventional radio- and cytotoxic chemotherapies are not effective against metastatic mtc [ 7 , 8 ] . clinical trials of various combinations of chemotherapeutic drugs have yielded unsatisfactory results [ 9 , 10 ] . however , research over the last years has led to a good understanding of the genetic defects and altered molecular pathways that are associated with the development of mtc . thus , multiple promising therapeutic agents that target these genetic alterations have been developed to treat progressive and advanced mtc . activating mutations of the tyrosine kinase receptor ( tkr ) rearranged during transfection ( ret ) this discovery has led to the development and introduction of targeted therapies , such as tyrosine kinase inhibitors ( tkis ) that target ret . several tkis directed toward ret kinase have been tested in vitro , preclinical , and clinical studies with promising results . unfortunately , these agents are not likely to be curative , as the longest duration of response observed was approximately 4 years , and the maintenance of agent - dependent effects may require continuous therapies , which are not without important side effects . the main reasons for the failure of these agents to cure mtc are the development of resistance to tkis that target the ret and other cell receptors and the activities of other signal transduction pathways that are involved in mtc tumorigenesis and progression but not directly targeted by tkis . in recent years , the discovery of mechanisms of resistance to tkis and of several other molecular events that contribute to mtc transformation and metastasis suggested that combinatory therapy may result in a more significant tumor growth inhibition . this has led to the development of novel compounds that have been used in several clinical trials , including tkis that can target multiple tkrs simultaneously in addition to ret and agents that can target other altered signaling pathways . other studies have demonstrated the potential for immunotherapy in combination with agents that target signal transduction pathways that are important for mtc growth . because the aim of these targeted therapies is to extend lifespan and increase the quality of life , it is very important to limit the toxicities of therapeutic agents , either alone or in combination . the possibility of testing these novel drugs in vitro ( in primary thyroid cancer cells ) and in vivo may help to improve the personalization of treatments .", "the role of the ret oncogene in the tumorigenesis of mtc has been characterized extensively . the ret gene encodes a transmembrane tyrosine kinase that binds to glial cell line - derived neurotrophic factor ( gdnf ) family ligands . ret signaling leads to the activation of the ras / mitogen - activated protein kinase ( mapk ) and the phosphatidylinositol 3 kinase ( pi3k)/akt pathways and has key roles in cell growth , differentiation , and survival . activating point mutations of the tkr ret have been reported in nearly all hereditary cases of mtc ; some of these mutations are included in the men2a , familial mtc , or men2b syndromes in which there is a genotypic / phenotypic correlation between the type of ret mutation and clinical features . germline mutations in the ret proto - oncogene are responsible for hereditary mtc , while somatic ret mutations are responsible for sporadic mtc . however , this paper will mainly focus on additional cellular signaling pathways other than ret responsible of mtc tumorigenesis and progression and potential targeted approaches for the treatment of advanced or metastatic mtc . although activating mutations of the tkr ret are believed to be the primary oncogenic event in the development of a majority of mtc cases , it is clear that ret cooperates with other signal transduction pathways to promote mtc tumorigenesis . in addition to ret , other kinase receptors may play a role in the development and progression of mtcs . similar to the ret receptor , the epidermal growth factor receptor ( egfr ) is a tkr that is associated with the regulation of cell growth , proliferation , and apoptosis . dimerization of the receptor following ligand binding results in transphosphorylation and the subsequent activation of several downstream signal pathways . egfr has been shown to be frequently overexpressed in various types of thyroid carcinomas , including mtc , and to play a role in cancer development and progression . in contrast , a recent report analyzing different mtc on tissue microarrays has demonstrated that only 20% of cases revealed moderate to strong reactivity for egfr , whereas the majority of the cases revealed weak and very focal positivity . with respect to the numbers of egfr gene copies in mtcs , the researchers did not detect amplifications but did find polysomes in 15% of the examined tumors . additionally , egfr was activated in a subset of mtcs , which suggests that this subset of patients might benefit from drugs that target also egfr . recent findings have shown that the ligand - induced activation of egfr can stimulate ret activation beyond signaling and growth stimulation . several egfr inhibitors have been shown to markedly inhibit the growth of the mtc tt and mz - crc-1 cell lines . because ret activation seems to be influenced by egfr , a recent study investigated whether egfr activation could be related to specific ret mutations in mtcs . the researchers found that tumors with the most aggressive ret mutations ( in codons 883/918 ) exhibited reduced egfr expression compared to other ret mutations . it could be speculated that the most aggressive ret mutations are less dependent on egfr activation . in fact , in the work by croyle et al . , in which cell lines with ret mutations in codon 634 and codon 918 were compared , the effect of egfr inhibition on the codon 918 mutated cell line appeared to be reduced , in agreement with the previous data . because the activation status of egfr seems to be related to ret activation however , no differences have been found in egfr activation between ret - positive and -negative tumors , which likely indicates that other molecular mechanisms lead to ret activation , such as increased ret gene copy numbers , altered promoter activity , or increased transcription in the ret mutation - negative tumors . these data suggest that egfr status determination in mtcs might be important but certainly deserves further investigations . the vascular endothelial growth factor receptor ( vegfr ) pathway is also important in the pathogenesis of mtc . there are three transmembrane receptors that mediate the angiogenic and lymphogenic effects of vegf : vegfr-1 , vegfr-2 , and vegfr-3 . overexpression of vegf and vegfr-2 has been found in mtc compared to normal thyroid tissue . the vegf proteins ( vegf - a , b , c , and d ) , which are secreted by tumor cells , act as ligands for the vegfr-2 receptors on endothelial cells and promote a signaling cascade through different pathways , such as plc--pkc - raf - mek - mapk and pi3k - akt , that stimulate cellular proliferation , migration , and survival and induce neoangiogenesis . angiogenesis is an essential alteration in cell physiology that predisposes the development of malignancy and is fundamental in tumor growth and metastasis . similarly to egfr , the overexpression of vegfr-2 in mtc has been shown to correlate with metastasis . several multitargeting tyrosine kinase inhibitors that block vegfr have shown promising clinical antitumor activity ; unfortunately , in most thyroid carcinomas and other solid tumors , the antiangiogenic effects are often only transitory and really often may have late paradoxically protumorigenic effects . additionally , it seems that a modest significant association has been observed between vegfr-2 expression and ret mutation status in primary tumors . the met proto - oncogene codes for the tk receptor for the hepatocyte growth factor ( hgf ) . met hyperactivation reportedly correlates with the metastatic abilities of tumor cells . met and hgf coexpression has been observed in a subset of mtc tumors and is associated with multifocality in mtc , which makes this interaction a potentially important target . in one report importantly , ret can induce the overexpression of c - met in this type of thyroid tumor . the fibroblast growth factor receptor 4 ( fgfr4 ) has also been reported to be overexpressed in mtc cell lines . inhibition of fgfr phosphorylation with the small molecule fgfr inhibitor pd173074 resulted in an arrest of cell proliferation and tumor growth . moreover , the dual inhibition of ret and fgfr combined with tyrosine kinase inhibitors resulted in greater suppressions of cell proliferation in vitro and tumor control in vivo than that which was achieved with either agent alone . these data highlight ret and fgfr4 as therapeutic targets and suggest a potential role for the use of combined tyrosine kinase inhibitors in the management of inoperable medullary thyroid cancers . finally , the platelet - derived growth factor receptor ( pdgfr ) also seems to play a role in differentiated thyroid cancer , although its role and function have not been fully investigated in mtc . several other signal transduction pathways have been implicated as contributors to mtc tumor growth , as illustrated in two recent studies [ 5 , 30 ] . these pathways include ret interactions with prb , p53 , p18 , and p27 as well as the phosphatidylinositol 3-kinase / akt / mtor and ras / raf / mek / erk pathways . \n ret interactions with tumor suppressor genes \n \n ( a ) prb and p53 . the tumor suppressor genes rb1 ( retinoblastoma ; prb protein ) and tp53 ( p53 protein ) are frequently mutated in human cancers , and it appears that , in cancer , both pathways must be inactivated to overcome senescence or apoptosis . there is extensive genetic evidence that the prb and p53 pathways are involved in mtc in rodents . further , the loss of tp53 further increased mtc formation in rb1-deficient mice [ 32 , 33 ] . it has been shown that in mice , ret cooperates with the inactivation of prb / p53 to cause experimental mtc . prb / p53 mutant mice have been shown to acquire ret mutations that are analogous to activating germline mutations that are observed in human men2a and familial medullary thyroid carcinoma ( fmtc ) . this suggests that murine mtc requires mutational dysregulations within both the ret and nuclear tumor suppressor gene pathways . however , mouse models may not mimic human disease , and a systematic analysis of the genes in the rb1 and tp53 pathways in human samples will help to clarify their roles in human mtc formation . this information may be important for the development of novel targeted therapeutic approaches for mtc . \n thyroid tumors show low expression of the cyclin - dependent kinase inhibitor ( cdki ) p27 ( kip1 ) , and recent evidence demonstrates that p27 is downregulated by the active ret mutant , ret / ptc1 , which is found in papillary thyroid carcinomas . these data implicate decreased p27 activity as an important event during thyroid tumorigenesis . however , p27 mice develop men - like tumors only in combination with the loss of p18 ( ink4c ) , another cdki . this suggests that p18 and p27 are functional collaborators in the suppression of tumorigenesis , that the loss of both is critical to the development of men tumors , and that both p18 and p27 are regulated by ret . \n the pi3k - akt - mammalian target of the rapamycin ( mtor ) cascade is important in tumorigenesis due to its ability to promote cell growth , proliferation , and survival . several examples provide evidence to support a role for the activation of the pi3k / akt / mtor signaling cascade in medullary thyroid cancer [ 3638 ] . several mechanisms have been shown to be involved in the activation of pi3k signaling in medullary thyroid cancer . a mutation of men2a ( ret - men2a ) has been shown to activate pi3k and its downstream effector , the serine / threonine kinase akt / protein kinase b . previous studies have demonstrated that a mutation of tyr-1062 , which is the intracellular docking site for shc and enigma on ret , abolishes the ret - men2a transforming activity . these studies further revealed that the mutation of tyr-1062 abrogates the binding of the p85 regulatory subunit of pi3k to ret - men2a and subsequent stimulation of the pi3k / akt pathway . furthermore , retroviral transduction of rat fibroblasts with a dominant - interfering form of pi3k was shown to suppress ret - men2a - dependent transformation , whereas the overexpression of akt enhanced ret - men2a oncogenic potential . in summary , these data are consistent with the notion that ret - mediated cell - transforming effects are critically dependent on the activation of the pi3k / akt / mtor pathway . in cell lines , the pi3k - akt / mtor pathway has been shown to be important in the pathogenesis of men2b . ret - men2b ( ret m918 t ) is more effectively autophosphorylated at ret y1062 than is ret - men2a , which subsequently leads to increased constitutive activation of the ras / mitogen - activated protein kinase ( mapk ) and pi3k / akt / mtor signaling cascades . furthermore , previous data report other possible mechanisms of pi3k activation in thyroid carcinomas , such as the overexpression of rai ( shcc / n - shc ) , which is a substrate of ret oncoproteins [ 5 , 42 ] . finally , the loss of expression of the phosphatase and tensin homologue ( pten ) gene , a tumor suppressor gene , may have a role in the activation of pi3k / akt in thyroid tumors . the absence of functional pten protein expression has been observed in various cancer cells and has led to the constitutive activation of downstream components of the pi3k pathway , including the akt and mtor kinases . preclinical models showed that inactivation of these kinases is able to reverse the effects of pten loss . these data raise the possibility that drugs that target either these kinases or pi3k itself might have significant therapeutic activity against pten - null cancers . mutations in major nodes of this signaling cascade have been observed in human cancers ; these mutations include gain - of - function mutations and amplifications of the genes encoding pi3k and akt [ 44 , 45 ] . however , a recent study on a series of 49 mtcs has shown that the pi3k genes were not mutated , and that the activation of the pi3k pathway was significantly associated with the status of ret mutations . in fact , using protein expression analysis , the same authors confirmed that the akt / mtor pathway was highly activated in mtc , especially in cases with germline ret mutations . interestingly , this association was not dependent on the type of mutation ( in either the codons of the juxta - membrane or of the tyrosine kinase portion of the receptors ) but was dependent on the hereditary nature of the mutation . in contrast , medullary carcinomas with sporadic ret mutations or with wild - type ret were observed with heterogeneous expression of akt / mtor pathway molecules , which suggests the need for further elucidation of alternative activation mechanisms . in a recent study , the pi3k / akt / mtor pathway was shown to be activated in mtc , particularly in the metastatic lymph nodes , and this pathway was shown to sustain malignant features of different mtc cell models . moreover , it has been shown that the selective inhibition of the mtor pathway in a germline - ret - mutated mtc cell line can effectively decrease cell viability and block the phosphorylated status of mtor signaling molecules , which confirms previously published in vitro data . another study used metformin , which is an antidiabetic agent that decreases the proliferation of cancer cells through the 5-amp - activated protein kinase - dependent inhibition of mtor , in mtc cell lines to show that the growth - inhibitory effects on the cells were associated with the downregulation of both the mtor/6sk and perk signaling pathways . altogether , these results strongly suggest that mtor might be a very efficacious target in patients with advanced or metastatic mtc . noteworthy , mtor inhibitors are currently being used in clinical trials for the treatment of medullary thyroid carcinoma . \n ras - raf - mek - erk pathway . unlike hereditary mtc , in which ret mutations are the critical events , in sporadic mtc , the genetic or molecular biomarkers have not been fully established . ras is a frequently mutated oncogene in a broad spectrum of human tumors , including thyroid carcinoma , mainly in the follicular forms . in this context , investigators aimed to determine whether mutations in the ras oncogene could play a possible role in the carcinogenesis of sporadic mtc . the initial study analyzed 15 sporadic mtcs for mutations in known hot spots ( codons 12 , 13 , and 61 ) of the h- and k - ras oncogenes by a direct sequencing technique , although no ras mutations were detected in any of the examined tumors . a different study on 49 mtc confirmed that ras mutations are a rare event in this type of tumor , regardless of ret mutational status . by contrast , different studies have demonstrated the presence of ras mutations in mtc . a mutational screening for h- , k- , n - ras , and braf in 13 sporadic and inherited mtcs revealed one sporadic ret - negative mtc ( stage iii ) with a mutation in the h - ras codon 13 ( g13r ) . another study analyzed 188 hereditary and sporadic mtcs for ras mutational status , revealing a low prevalence of mutations , which were confined only to ret - negative sporadic mtc . furthermore , recent studies have reported a quite high prevalence of ras mutations in sporadic mtc , particularly in ret - negative mtc ; 68% ( 17 of 25 ) of the ret - negative mtcs had mutations of ras compared to only 2.5% ( 1/40 ) of the ret - positive mtcs . these findings were confirmed by a different study that analyzed 17 sporadic mtcs by exome sequencing and found dominant and mutually exclusive oncogenic mutations in ret and ras ( h- and k - ras ) genes in 17 sporadic mtcs . as expected , most ras mutations corresponded to mutational hot spots in exons 2 and 3 , although some mutations were also detected in exon 4 . this study confirms that ret and ras mutations are mutually exclusive , and that they are probably 2 different oncogenic driver events in mtc . these results suggest that the activation of the proto - oncogenes ras and ret represents alternative genetic events in sporadic mtc tumorigenesis , and that more sensitive sequencing techniques such as next generation sequencing are necessary to detect mutations . for decades , the ras and raf families of oncogenes have been known to be transforming genes . however , in many normal cultured cell types , the sustained expression of activated ras or its downstream effector , raf , can elicit cell cycle arrest or senescence . the ras / raf - mediated growth arrest has been proposed as a defense mechanism against the inappropriate activation of the ras / raf signal transduction pathway [ 56 , 57 ] . according to this hypothesis , spontaneous mutations in ras genes , which may occur stochastically in all cell types , would be innocuous for the organism because these mutations would lead to growth arrest or senescence . hence , for carcinogenesis to occur in response to ras / raf activation , the growth arrest response must be inactivated . the growth arrest response to ras / raf activation is not limited to normal cells . several tumor cell lines that were derived from different tumor types , including medullary thyroid carcinoma , also experienced growth arrest , usually accompanied by differentiation or senescence [ 5860 ] . these findings indicate that some tumors retain a capability for growth arrest in response to ras / raf activation . the mechanism by which ras or raf activation can induce growth arrest is not completely understood . some investigators have reported that ras or raf activation could induce the expression and secretion of a protein that mediated differentiation and g1 cell cycle arrest in mtc cells . by protein purification and mass spectrometry , this protein has been identified as the leukemia inhibitory factor ( lif ) . stat3 activation was necessary for lif - mediated growth arrest and differentiation in mtc cells . in addition , the ras / raf / mek / erk pathway could also mediate growth arrest and differentiation by a second mechanism that is independent of lif / jak / stat3 . this novel autocrine - paracrine mechanism , which mediates crosstalk between the ras / raf / mek / erk and the jak - stat pathways , defines a novel mechanism of ras / raf - induced cell growth arrest [ 61 , 62 ] . the inactivation of gsk-3beta in tt cells by well - known gsk-3beta inhibitors , such as lithium chloride ( licl ) and sb216763 , is associated with both growth suppression and a significant decrease in neuroendocrine markers , such as human achaete - scute complex - like 1 and chromogranin a. growth inhibition by gsk-3beta inactivation was found to be associated with cell cycle arrest due to an increase in the levels of cyclin - dependent kinase inhibitors , such as p21 , p27 , and p15 . additionally , tt xenografts mice , treated with licl , showed a significant reduction in tumor volume compared with those that were treated with a control . therefore , gsk-3beta is a key downstream target of the raf-1 pathway in tt cells , and the inactivation of gsk-3beta alone is sufficient to inhibit the growth of tt cells both in vitro and in vivo . \n -catenin is a ubiquitously expressed multifunctional protein that plays an important role in cellular adhesion . a novel ret--catenin signaling pathway was found to be a critical contributor to enhanced cell proliferation and tumor progression in thyroid cancer . gujral et al . showed that ret could induce -catenin - mediated transcription , cell proliferation , and transformation in vitro and that -catenin nuclear localization and subsequent mediation of -catenin by ret are key secondary events in tumor growth and metastasis in vivo . this novel interaction suggests a mechanism that may underlie the broad and early metastatic potential of mtc . these data suggest an unrecognized role for -catenin signaling that may have implications for tyrosine kinase - mediated tumorigenesis in multiple tumor types and provide another potential target for therapeutic agents . in support , a recent study performed on tissue microarray observed that wnt pathway proteins , including wisp-1 , wisp-2 , and -catenin , were actively expressed in mtc . \n the nuclear factor kappa - b ( nf-b ) proteins , a family of transcription factors that are found virtually in all cells , are known to play crucial roles in the growth of many human malignancies . the ability of nf-b to target a large number of genes that regulate cell proliferation , differentiation , survival , and apoptosis provides clues towards its dysregulation during the processes of tumorigenesis , metastatic progression , and therapeutic resistance of tumors . nf-b is constitutively active in mtc through the ret - induced phosphorylation , ubiquitination , and proteosomal degradation of inhibitors of nf-b ( ikb ) , which allows nf-b to enter the nucleus and bind to dna . nf-b is frequently activated in mtc , and the activation of ret by somatic or germline mutations may be responsible for nf-b activation in these tumors . these results suggest that the nf-b pathway may be an important target for drug development in mtc . \n a recent study examined the expression of proteins involved in angiogenesis , inflammation , apoptosis , cell cycle , cell - to - cell contact , and carcinogenesis using high - throughput tissue microarrays from 23 patients with mtc . these authors identified several novel potentially important protein targets such as cox-1/2 , bcl-2a , gst- , gli-1 , gli-2 , gli-3 , and bmi-1 that may be therapeutically targeted in mtc . for example , cox-1 and cox-2 , which are two inflammation - related factors , were significantly expressed in these cases , suggesting that nonsteroidal anti - inflammatory drugs may provide benefit in some patients with mtc . then , the finding of antiapoptotic bcl-2a and gst- overexpression in mtc suggests that bcl-2a and gst- inhibitors might be a treatment option for patients with advanced or metastatic mtc . the same is applied to gli-1 , gli-2 , and gli-3 , members of sonic hedgehog homolog ( shh ) pathway , and bmi-1 , a cell - cycle marker that resulted overexpressed in these mtc samples . the studies of these markers , particularly the members of the shh , may improve our understanding of mechanism of resistance to current chemotherapeutic and/or tki regimens and identify novel potential therapeutic approaches .", "due to increased knowledge of the molecular pathogenesis of mtc , therapeutic agents that target specific altered pathways have been developed ( figure 1 ) . because the alterations of protein kinases and their pathways are involved in mtc development , several tyrosine kinase receptors inhibitors ( tkis ) have been tested in vitro , preclinical , and clinical studies . ret is certainly an attractive target for several types of tumors particularly for parafollicular c - cells - derived tumors , which are addicted to ret and its activity . tkis are small organic compounds that affect tyrosine kinase - dependent oncogenic pathways by competing with atp - binding sites of the tyrosine kinase catalytic domains . occupation of these sites inhibits autophosphorylation and activation of the tyrosine kinases and prevents the further activation of intracellular signaling pathways . several tkis that are directed against ret kinase have been developed for the treatment of mtc , but there is no currently available tyrosine kinase inhibitor specific to ret . however , several multitargeted tyrosine kinase inhibitors have demonstrated significant activity against ret ( table 1 ) , including vandetanib , sorafenib , motesanib , imatinib , and sunitinib [ 66 , 68 ] . the inhibition of only one kinase receptor may induce the compensatory activation of other tks and consequent resistance to treatment with tkis [ 69 , 70 ] . therefore , the simultaneous inhibition of multiple activated tks may be the best way to approach mtc [ 7173 ] . vandetanib ( zd6474 ) is an oral tki that targets ret , vegfr-2 , and -3 , and at higher concentrations , egfr . vandetanib selectively inhibits pathways that are critical for tumor growth and angiogenesis without leading to direct cytotoxic effects on tumor or endothelial cells . most of the mutant ret oncoproteins have demonstrated sensitivity to vandetanib , while mutations in which valine 804 is substituted by either leucine or methionine ( as observed in some cases of men2a ) rendered the ret kinase significantly resistant to vandetanib . this resistance is likely due to steric hindrance , as the val804gly mutation increased the sensitivity of ret to vandetanib . when ret activity was inhibited , overstimulation of egfr was able to partially compensate for ret through a partial rescue of mapk pathway activation . the inhibition of egfr by vandetanib has been shown to prevent this rescue of mapk pathway activation . these data support the idea that the dual inhibition of ret and egfr is important , as it may overcome the risk of an escape by mtc cells from a blockade of ret through the compensatory overstimulation of egfr . in addition , the expression of egfr has been demonstrated in tumor - associated endothelial cells . in this respect , anti - egfr agents have been shown to block the proliferation and migration of endothelial cells . therefore , the anti - egfr activity of vandetanib might result in an additional direct antiangiogenetic mechanism . one phase ii clinical trial showed the antitumor activity of vandetanib ( 300 mg / day ) in patients with hereditary mtc . in this study , 20% of the patients showed a partial response to vandetanib ( > 30% reduction in tumor diameter ) , while an additional 53% of patients presented with disease stability at 24 weeks . only 1 patient showed disease progression while receiving this agent . of interest , this patient was not affected by any of two ret mutations correlated to vandetanib resistance in which valine 804 is substituted by leucine or methionine , but by y791f ret germline mutation . another clinical trial , in which 19 patients with hereditary mtc were treated with vandetanib ( 100 mg / day ) , showed similar results . vandetanib is the only tki approved for the treatment of symptomatic or progressive mtc in patients with unresectable locally advanced or metastatic disease . the approval of vandetanib in april 2011 by the us food and drug administration ( fda ) was based on the results of the phase iii clinical trial , study d4200c00058 , in which 331 patients with unresectable locally advanced or metastatic mtc were randomly assigned to receive vandetanib ( 231 ) or a placebo ( 100 ) . this study showed that the median progression - free survival duration ( pfs ) was 11 months longer in the group that received vandetanib than in the placebo control group and that 45% of the patients had an objective response rate ( orr ) . common adverse events ( any grade ) occurred more frequently with vandetanib compared to the placebo and included diarrhea ( 56% versus 26% ) , rash ( 45% versus 11% ) , nausea ( 33% versus 16% ) , hypertension ( 32% versus 5% ) , and headache ( 26% versus 9% ) . the impact of overall survival of mtc patients treated with this compound is presently unknown . \n xl184 ( cabozantinib ) is an oral selective inhibitor of ret , c - met , and vegfr-2 . the phase i trial results indicated that cabozantinib is active in patients with mtc , including those who harbor somatic ret mutations and are potentially at high risk for progression and death . a global phase iii pivotal study in mtc is ongoing ( http://www.clinicaltrials.gov/ number nct00704730 ) . \n sorafenib ( bay 43 - 9006)is a multikinase inhibitor that targets braf , vegfr-2 , vegfr-3 , kit ( a stem cell growth factor proto - oncogene involved in cell survival and differentiation ) , and pdgfr . a phase ii clinical trial , in which sorafenib ( 400 mg / twice daily ) was given to 21 patients with metastatic medullary carcinoma , reported that of the patients with sporadic mtc , 87.5% achieved disease stability and 6.3% demonstrated partial responses . the treatment was prematurely terminated in mtc hereditary patients due to slow accrual . in a similar trial , recently , a study of sorafenib was conducted on advanced thyroid carcinoma patients , and partial responses were reported in six out of the 12 ( 50% ) patients with mtc , although the small number of patients requires further prospective studies . \n sunitinib ( su011248 ) is a small molecule inhibitor that targets many of the same protein kinases as sorafenib , including vegfr , pdgfr , kit , and ret . in a phase ii clinical trial , 33 patients with either well - differentiated thyroid carcinoma or mtc were treated with sunitinib . one patient had a complete response , 28% of the patients had partial responses , and 46% of the patients exhibited disease stability . the intermediate results of the phase ii thysu study also showed the efficacy of sunitinib in advanced medullary thyroid carcinoma . motesanib ( amg 706 ) is a multikinase inhibitor that targets vegfr receptors 1 , 2 , and 3 , pdgfr , and kit and exerts antiangiogenic and direct antitumor activities . a phase ii study performed in 91 patients with locally advanced or metastatic , progressive or symptomatic , mtc demonstrated that although the objective response rate was low , a significant proportion of the mtc patients ( 81% ) achieved disease stability while receiving motesanib . a recent study investigated the effects of motesanib on wild - type and mutant ret activity in vitro and on tumor xenograft growth in a mouse model of mtc . the results of this study demonstrated that motesanib inhibited thyroid tumor xenograft growth , predominantly through the inhibition of angiogenesis and possibly via the direct inhibition of vegfr2 and ret , which were expressed in tumor cells . these data suggest that angiogenic pathways and specifically the vegf pathway are still important for mtc cells . \n imatinib ( sti571 ) is a tki that inhibits ret , pdgfr , and kit . a phase ii trial in which imatinib was tested in metastatic mtc patients yielded disappointing results . the patients showed no objective responses ; however , a minority of patients achieved disease stability . several tk inhibitors have been tested in clinical trials , but the most effective inhibitor and whether there is any specificity for particular ret mutations remain unknown . a recent study compared the effects of four tkis ( axitinib , sunitinib , vandetanib , and xl184 ) on cell proliferation , ret expression and autophosphorylation , and erk activation in cell lines that express men2a ( mtc - tt ) and men2b ( mz - crc-1 ) mutation . the findings showed that the inhibitors were specific for different mutations , with xl184 being the most potent inhibitor against the men2a mutation and vandetanib the most effective against the men2b mutation in vitro . no tk inhibitor was superior for all tested cell lines , which indicates that mutation - specific therapies could be beneficial in mtc treatment . one of the mechanisms for the resistance of mtc to chemotherapeutic drugs is multidrug resistance ( mdr ) . mdr in cancer cells has been attributed to the overexpression of several plasma membrane atp - dependent efflux pumps , such as mdr-1 . the enzyme cyclooxygenase ( cox-2 ) has been shown to regulate mdr-1 expression in rat mesangial cells . furthermore , a study has shown that in vitro treatment of an mtc - derived cell line with rofecoxib , a cox-2 inhibitor , was able to sensitize mtc cells to doxorubicin . a recent study , performed in vitro , has shown that celecoxib , another cox-2 inhibitor , was able to induce both mtc cell apoptosis and sensitization to vinorelbine , thus enhancing the chemotherapeutic effect of this drug . a clinical trial , in which the in vivo activities of celecoxib were explored in mtc patients who can not benefit from available treatments , would be desirable after accounting for the possible cardiovascular risks of this drug . several other therapeutic agents are being investigated for their uses in the treatment of thyroid carcinomas , including mtc . these agents inhibit targets that are involved in development of mtc other than the tyrosine kinase receptors . we previously discussed that ras operates in a complex signaling network with multiple activators and effectors , which allows them to regulate many cellular functions such as cell proliferation , differentiation , apoptosis , and senescence . phosphatidylinositol 3-kinase ( pi3k ) is one of the main effector pathways of ras , regulating cell growth , cell cycle entry , cell survival , cytoskeleton reorganization , and metabolism . the presence of ras mutations in sporadic mtc and most importantly the frequent activation of the pi3k / akt / mtor pathway in several aggressive and metastatic mtcs strongly suggest that this cellular signaling pathway is a good candidate for targeted therapies against mtc . in fact , several in vitro evidences have demonstrated that the indirect blocking of this pathway , by pi3k inhibitors , or direct inhibition of mtor can mediate the induction of apoptosis and a decrease in cell viability in the mtc tt cell line . currently , there are several clinical trials in which patients with radioiodine - refractory differentiated and medullary thyroid carcinomas were recruited to test the efficacy of everolimus ( rad001 ) , a novel inhibitor of mtor , in combination with other drugs ( nct01625520 and nct01270321 ) . recently , researchers have developed a liposomal form of everolimus and have demonstrated the anticancer efficacy of this formulation against tt cells . studies have shown that metformin can decrease the proliferation of cancer cells through 5-amp - activated protein kinase-(ampk- ) dependent inhibition of mtor . some researchers have reported growth inhibitory effects of metformin against mtc cell lines ( tt and mz - crc-1 ) , which were attributable to the downregulation of both mtor/6sk and perk signaling . the expression of the molecular targets of metformin in human mtc cells suggests that this drug may be potentially useful in the treatment of mtc . pi3k - akt - mtor and raf - mek - erk signaling have been shown to be important in the resistance of thyroid cancer cells to apoptosis and the promotion of tumor progression . in this context , targeted anti - vegfr therapy or raf inhibition may be ineffective if pi3k signaling remains intact . therefore , two promising drugs , raf265 , a raf inhibitor that is active against vegfr2 , and bez235 , a pi3k inhibitor , were tested alone and in combination in preclinical mtc models that represented the key genotypes observed in refractory thyroid cancers . the study findings showed that a combination treatment with agents that inhibited both raf and pi3k pathways strongly inhibited growth both in vitro and in vivo . in addition , the investigators showed for the first time that raf265 potently inhibits the constitutively active ret , a form of the kinase that is observed in men2a . persistent ret activation , a frequent event in mtc , leads to the activation of the pi3k / akt / mtor , erk / mapk , and jak / stat3 pathways . recently , the efficacy of the jak1/2 inhibitor azd1480 against the growth of thyroid cancer was tested in vitro and in vivo in thyroid cancer cell lines that expressed oncogenic ret . the findings showed that azd1480 efficiently inhibited the growth and tumorigenesis of thyroid cancer cell lines that harbored oncogenic ret alterations , likely through the inhibition of pi3k - akt signaling ; this result supports the use of this inhibitor in patients with thyroid cancer , particularly in those with advanced mtc , for whom there are no effective therapeutic options . thus , somatostatin ( srif ) peptide analogues in combination with tkis may be a promising approach for the treatment of these tumors . the presence of different combinations of srif receptor ( sstr ) subtypes in a given patient may explain the variable clinical response to srif analogues and may promote the search for more selective drugs with different affinities to the various receptor subtypes . the currently available somatostatin analogues ( octreotide and lanreotide ) act preferentially through the somatostatin receptor subtype 2 ( sst2 ) . in mtc , these compounds have been reported to exert antisecretive effects on calcitonin but unfortunately are not reported to have antiproliferative effects . pasireotide ( som230 ) is a new somatostatin analogue that has a peculiar binding profile with high affinity for sst1 , sst2 , sst3 , and sst5 . preliminary data from a phase ii study of patients with metastatic carcinoma show that som230 is effective , and some clinical trials are exploring the efficacy of som230 alone or in combination with rad001 in patients with mtc ( nct01625520 and nct01270321 ) . the nf-b pathway is also a potential target for drug development , and a number of compounds have been developed to inhibit this pathway at different levels in cancer cells . studies have demonstrated that the proteosome inhibitor bortezomib exerted a promising antitumor effect in human mtc cells through the inhibition of ib degradation , which led to the inactivation of the transcriptional factor nf-b . patients are currently being recruited for a phase i / ii trial to study the combination of vandetanib plus bortezomib ( http://www.clinicaltrials.gov/ ) . immunization with tumor antigen - pulsed autologous dendritic cells ( dcs ) resulted in protective immunity and the rejection of various established human tumors . specifically , vaccination immunotherapy with calcitonin and/or carcinoembryonic antigen ( cea ) peptide - pulsed dcs was shown to result in the induction of a cellular , antigen - specific immune response in patients with mtc , which led to clinical responses in some patients . therefore , for the first time , a potential dc vaccination therapy was developed for patients with metastatic mtc . another study , which was performed in a transgenic mtc mouse model , has confirmed this finding . have reported on the in vitro findings of a vaccination trial in 5 mtc patients , who were treated with dcs that were generated using a new protocol , which consisted of granulocyte - macrophage colony - stimulating factor and interferon - alpha ( ifn - dcs ) . these investigators demonstrated that immunization with ifn - dcs led to a tumor epitope - specific th1 immune response in mtc patients . furthermore , a pilot trial of 10 patients has assessed the safety and efficacy , in terms of immune responses and clinical activities , of the dcs . in this study monitoring of the patients included serial measurements of calcitonin tumor markers , radiological imaging , and immunological in vitro tests , including t - cell interferon - gamma detection and cytotoxicity assays . after a median followup of 11 months ( range 726 ) , 3 ( 30% ) of the 10 patients exhibited disease stability , while 7 ( 70% ) of the patients progressed during treatment . a combined treatment with different tumor cell lysate - pulsed dcs increased the likelihood of a calcitonin tumor marker response and should therefore be preferred over monotherapy with dcs pulsed with a single lysate . thus , immunotherapy may be a promising alternative therapy in combination with agents that target specific signal transduction pathways for aggressive forms of mtc that are resistant to classical therapies . a significant antitumor effect was also observed with radioimmunotherapy using an anti - cea i - f6 monoclonal antibody in mtc - bearing nude mice . nevertheless , no complete responses were observed . similarly to chemotherapy , drugs that target the tumor microenvironment might improve the efficacy of radioimmunotherapy . this hypothesis was confirmed by a recent study in which pretreatment of mice grafted with the tt human medullary thyroid cancer cell line with antiangiogenic therapies was found to improve the efficacy of radioimmunotherapy with acceptable toxicity . another independent study , which was conducted in a mouse model of mtc , has found similar results with the angiogenesis inhibitor bevacizumab . future investigations will be performed to better understand how antiangiogenic agents enhance the efficacy of radioimmunotherapy . epigenetic drugs are expected to target the two main mechanisms of epigenetic alterations , dna methylation and acetylation , and are regarded with increasing interest by both endocrinologists and oncologists . concluded trials of such drugs have shown that few patients with advanced thyroid cancer responded completely , which suggests that these treatments were effective at stabilizing progressive disease . therefore , definitive results from clinical trials will clarify the true effectiveness of epigenetic drugs in these tumors . epigenetic drugs , when used in combination with other target molecules , might significantly increase response rates to treatment in advanced thyroid cancer patients , either by relaxing the chromatin structure to make dna more accessible to the effects of a dna targeting drug or by acting synergistically with antimitotic drugs . thus , epigenetic therapy may be a promising novel approach for the treatment of some cases of mtc . tumor cells often devise strategies to bypass the effects of antineoplastic agents , and the selection of therapy - resistant clones is frequently the reason for treatment failure . one characteristic of endocrine cancer is a general resistance to conventional chemotherapies or radiotherapies that would normally lead to apoptosis of the cancer cells . mtc can develop resistances to cytotoxic drugs due to the expression of the multidrug resistance ( mdr ) 1 gene . drugs that can oppose this mechanism of resistance to traditional chemotherapies may increase the sensitivity of mtc tumor cells to chemotherapy . for example , celecoxib , a cox-2 inhibitor , has been shown to potentiate the chemotherapeutic effect of vinorelbine in mtc . therefore , the synergistic actions of a cytotoxic drug and a compound that increases the sensitivity of mtc cells to such a drug could provide a treatment method for patients who can not benefit from tkis . however , the most promising results in patients with chemotherapy and radiotherapy - unresponsive mtc were obtained with tkis . multitargeted tyrosine kinase inhibitors , which inhibit multiple rtks simultaneously , including ret , have been developed to bypass this potential resistance mechanism . one complication is that such inhibitors may not only be more effective for targeting receptors in tumor cells but may also exhibit greater toxicity . thus , the challenge is to balance the increased efficacy of these inhibitors with the potential for a broader array of side effects . moreover , some mtc patients can not take advantage of these therapies due to specific ret mutations that confer resistance to tkis ( e.g. , ret v804 confers resistance to vandetanib ) [ 76 , 114 ] . finally an important study reported the existence of cancer stem - like cells in mtc , which exhibit the features of self - renewal and of multiple lineage differentiation that is dependent on ret proto - oncogene receptor activity suggesting a potential mechanism of resistance to cytotoxic or tkis agents .", "most cases of metastatic mtc are incurable due to resistance to conventional chemo- and radiotherapies . in recent decades , the identification of genetic defects and altered cellular signaling pathways involved in human mtc tumorigenesis have led to the development of targeted therapies , of which the most important are tyrosine kinase inhibitors . however , the low rates of partial responses or complete responses and the short duration of responses in mtc patients who were observed while taking these drugs prompted researchers to develop new drugs and alternative therapies to be combined with multi - tkis and to reduce potential cross - toxicity effects . to this end , a recent study has shown synergistic effects with a combination of sorafenib and the mek inhibitor azd6244 against a human mtc cell line . concomitant use of a raf inhibitor , raf265 , and a dual pi3k / mtor inhibitor , bez-235 , was another effective combinatorial therapy against thyroid cancer in xenograft mouse models . the mtor cascade is emerging probably as one of the most important deregulated pathways in advanced and metastatic mtc and certainly deserves further study . targeting mtor in combination might be efficacious in patients with this tumor types . however , a complete overview of all signaling pathways , including their interactions , role of the activating gene mutations that contribute to mtc tumorigenesis , and mechanisms of intrinsic and acquired resistance to treatments , is required and will permit us to identify the best therapy for each patient . novel combined or sequential therapies request a further step in the knowledge of the cellular signaling of this tumor . finally , larger multi - institutional clinical trials to fully understand the clinical benefits of these therapies are warranted ." ]

[ "all of the effects of antimicrobial agents against microbes , including the delineation of microbial resistance , are based upon the results of in vitro susceptibility testing . most of these susceptibility tests only measure bacteriostatic activity even though the agent being tested may have bactericidal activity . these authors point out the paucity of studies that have critically evaluated the effectiveness of antimicrobial therapy with results of in vitro susceptibility tests . such critical evaluations are not easily done , as susceptibility tests do not take into account the normal host defense mechanisms . however , the detection of resistance is somewhat predictive of poor outcome , although in the normal host this may be less clinically important due to the interaction of host defenses ( 17,18 ) . the ability of bactericidal activity to influence therapeutic efficacy and clinical outcome has been evaluated in infections that typically are refractory to antimicrobial therapy . these infections include endocarditis , meningitis , osteomyelitis , and infections in the neutropenic host . all are similar in that antimicrobial penetration and host defense mechanisms at the site of infection are limited . both experimental models of infection ( 1922 ) and clinical studies ( 2327 ) have shown that bactericidal activity predicts therapeutic efficacy and results in improved clinical outcome . bactericidal activity has been considered less important in respiratory tract infections , with the exception being acute infectious exacerbations in cystic fibrosis ( 28 ) . however , the relevance of pharmacokinetic and pharmacodynamics in the selection of antibiotics for respiratory tract infection has become increasingly recognized ( 29 ) . issues such as drug concentration at the site of infection , bactericidal activity , postantibiotic effect , and duration of therapy needed to achieve these effects are now being considered when antimicrobial agents are selected for the therapy of respiratory tract infections ( 29,30 ) . although host factors may allow a bacteriostatic agent to be used successfully in an infected patient , these factors appear to be less able to curtail the emergence of resistance . resistance , as a rule , occurs more rapidly with bacteriostatic agents such as tetracyclines , sulfonamides , and macrolides than it does with bactericidal agents such as beta - lactams and aminoglycosides ( 3133 ) . beta - lactam agents have been the antimicrobial agents of choice for the therapy of pneumococcal pneumonia since penicillin was first clinically introduced in the 1940s ( 17 ) . the emergence of macrolide resistance in s. pneumoniae has been rapid in comparison and has even been described during treatment of pneumococcal pneumonia ( 34 ) . bactericidal activity thus may be useful in the therapy of respiratory tract infections as a means to curtail , but not avoid , the emergence of resistance .", "the key to resolving the problem of antibacterial resistance lies in identifying the mechanisms that engender it ( 3133 ) . among the most important mechanisms are decreased ability of antibacterials to penetrate the bacterial cell wall , active efflux of antibacterial agents , inactivation of antibacterial agents , destruction of antibacterial agents , alteration of antibacterial target sites , development of bypass pathways around antibacterial targets , and constitutive phenotypic variation in bacterial physiology . subsequent exposure of the microorganism to a specific agent may then select the mutant , leading to the emergence of resistance . some resistance mechanisms , such as bacterial production of beta - lactamase , are inducible or can be derepressed ( 35 ) , requiring either upregulation or mutation of genetic material . thus , if resistance is to be suppressed , the opportunity for bacterial upregulation or mutation of genetic material must be minimized . one way to minimize upregulation , mutation , or both is by using bactericidal rather than merely bacteriostatic agents . microorganisms inhibited by a bacteriostatic agent or exposed to an insufficient concentration of a bactericidal agent remain alive and , ipso facto , retain the potential to become resistant or promulgate any resistance selected by the exposure to the antimicrobial agent . an example of this principle can be seen with the upper respiratory tract pathogen , streptococcus pyogenes , which to date has not developed resistance to penicillin , a bactericidal agent , but has developed resistance to erythromycin , a bacteriostatic agent ( 3638 ) . erythromycin resistance in s. pyogenes largely is due to upregulation of efflux ( 36 ) or to ribosomal mutation ( 37 ) . antimicrobial agents that kill this pathogen should be less likely to promulgate any strains having such resistance . another example is seen with the omp genes of gram - negative microorganisms . these omp genes encode porins that are sometimes flanked by insertion sequences . in the presence of the bacteriostatic agent , the mobility of insertion sequence flanking omp genes can be attenuated and will result in disruption of the omp genes . the reduced expression of these porins may lead to reduced uptake of the inducer , the antibacterial agent . specifically , insertion sequence interruption of the ompk36 porin gene in respiratory tract pathogen klebsiella pneumoniae has been shown to interfere in the expression of this porin gene and has resulted in clinical failure ( 39 ) . if a bactericidal agent kills a pathogen such as klebsiella before mutation of the porin gene , resistance is less likely to develop . these two examples illustrate the desirability of achieving bactericidal activity to curtail the emergence of resistance .", "bactericidal activity can be achieved through the mechanism of action for a single antimicrobial agent or by the use of combination therapy , or both . sulfamethoxazole / trimethoprim ( smx - tmp ) is an example of a combination of two agents , each of which alone is bacteriostatic , that achieves bactericidal activity . sulfamethoxazole inhibits dihydropteroate synthase , the bacterial enzyme that catalyzes the incorporation of p - aminobenzoid acid into dihydropteroic acid , the immediate precursor of folic acid , while trimethoprim was specifically synthesized as an inhibitor of dihydrofolate reductase ( 40 ) . smx - tmp has long been used for the therapy of respiratory tract infection ( 41 ) and has proven particularly useful in the treatment of acute exacerbations of chronic bronchitis . in fact , the world health organization continues to be recommend smx - tmp as the first - line treatment for pneumonia in children because of its low cost and ease of dosing . resistance to smx - tmp has emerged more slowly than for either agent used alone ( 42 ) . however , emergence of resistance to s. pneumoniae has occurred ( 43 ) and now may limit the use of smx - tmp in respiratory tract infections . combinations of antimicrobial agents are also used in the therapy of bacterial endocarditis to achieve synergism leading to increased bactericidal activity and improved sterilization of infected valves . bactericidal synergy for s. epidermidis can be demonstrated in vitro for the combination of vancomycin , rifampin , and gentamicin , which correlates well with the therapeutic results in an experimental animal model ( 44 ) . in a comparable clinical study of patients with prosthetic valve endocarditis caused by staphylococcus epidermidis , 90% were cured with a combination of vancomycin , rifampin , and/or gentamicin , compared with only 50% cured among those receiving vancomycin alone ( 45 ) . combination therapy for respiratory tract infections is less well studied except for acute respiratory tract infections occurring in cystic fibrosis patients . for example , combination therapy for treatment of pseudomonas aeruginosa pulmonary infections in cystic fibrosis patients achieved a cure rate of 89% if peak serum bactericidal titers were > 1:128 ( 28 ) . in contrast , 100% of patients failed therapy if their peak serum bactericidal titers were < 1:16 .", "other examples of the importance of bactericidal activity are the fluoroquinolones . studies of the bactericidal action of the quinolones against escherichia coli demonstrate at least two independent and important mechanisms of action . these bactericidal agents are only effective if the bacteria are actively dividing or synthesizing proteins and mrna . the bactericidal activity of the quinolone nalidixic acid , for example , is minimized by chloramphenicol , which prevents protein synthesis , and by rifampin , which prevents rna synthesis . however , ciprofloxacin and ofloxacin / levofloxacin respond differently . although the bactericidal action of these fluoroquinolones against e. coli is reduced , bactericidal action is not entirely eliminated by chloramphenicol or rifampin . this lack of elimination of bactericidal action suggests that these agents possess a secondary bactericidal mechanism of action that does not depend on the synthesis of protein and rna , and that may be active when the bacteria are in a nonreplicating state ( 46 ) . to understand this secondary bactericidal effect , consisting of approximately 20 genes , this system repairs structural damage to dna caused by antibacterial agents , mainly through bypass repair ( 4650 ) . another effect of the sos response , activated by fluoroquinolone - induced damage to the bacterial dna , is the discontinuation of cell replication . in addition to high concentrations of fluoroquinolone , which trigger the secondary bactericidal mechanism , higher concentrations at dna targets also play a role in the emergence of resistance because the postantibiotic effect of the fluoroquinolones is dependent upon concentration , time , and the microorganism . if the concentration of fluoroquinolone attained at the bacterial dna targets is high enough to activate the sos system for a duration that exceeds the capability of the particular microorganism to repair its dna damage and replicate , the microorganism dies . if the fluoroquinolone concentration is not adequate , however , a race occurs between cumulative damage over time and the selection of a resistant mutant . the concentration of fluoroquinolone required for sos - mediated discontinuation of cell replication is expressed as a peak concentration / minimum inhibitory concentration ( mic ) ratio and appears to require a ratio of approximately 10:1 ( 50,51 ) . a rat model for pseudomonas sepsis demonstrated that peak concentration / mic ratios > 20:1 once per day produced significantly ( p<0.5 ) better survival which may result in the selection of a mutant with altered topoisomerase than did regimens using the same dosage on a more fractionated schedule ( 52 ) . dosages that led to peak concentration / mic ratios < 10 times the mic did not result in as high a survival rate . indeed , when the peak concentration / mic ratio was < 10 times the mic , the best survival was predicted by the area under the curve / mic ratio , since repeated exposure to the fluoroquinolone causes damage cumulatively . the length of time that fluoroquinolone levels in plasma exceeded the mic had no influence on survival . the emergence of fluoroquinolone resistance with respect to staphylococcus aureus and p. aeruginosa has been well - documented ( 53 ) . this major problem is due to a wide variety of fluoroquinolone - resistance mechanisms ( 54,55 ) , particularly the mutation of dna gyrase ( 56 ) . while this type of resistance generally results in mics only four- to eight - fold higher than the susceptible isolate , recent studies have reported the development of high - level resistance ( e.g. , ciprofloxacin mic for p. aeruginosa of 1,024 mg / l ) mediated by efflux pumps targeting multiple antibacterial agents ( 57,58 ) . these multidrug efflux pumps could be overcome by high fluoroquinolone concentrations , some of which , however , would not be clinically achievable . a rabbit meningitis model further demonstrates how the inability to achieve peak concentration / mic ratios > 10:1 influences the postantibiotic effect . in an in vivo study , an exposure to ciprofloxacin at the mic had minimal impact ( 59 ) , underscoring the value of bactericidal activity with respect to fluoroquinolone therapy . the greater the activity of the fluoroquinolone , the more likely the agent will achieve serum or tissue levels that are > 10 times the mic , which in turn determines the secondary bactericidal and postantibiotic effects . consequently , newer fluoroquinolones such as gemifloxacin ( 60 ) and others now under development have markedly increased activity compared with traditional agents . for example , ciprofloxacin has mics against streptococcus pneumoniae of approximately 0.5 mg / l , while gemifloxacin has mics of approximately 0.03 mg / l . an important issue associated with the use of fluoroquinolones in the therapy of respiratory tract infections is the fact that fluoroquinolones also are used to treat other infections . the use of these agents for other infections means that the population already had been exposed to fluoroquinolones before their widespread use in respiratory tract infections . exposure of normal flora in these patients to subbactericidal concentrations of fluoroquinolones may allow resistant strains to emerge . cross - resistance is a well - recognized problem with fluoroquinolones ( 55 ) , and the enormous prior exposure of the population to these agents may have created resistant strains in the normal flora of the mucosal surfaces , skin , gastrointestinal tract , and reproductive tract . in addition , prior exposure may result in increasing mics due to subtle mutations of topoisomerases , which then may leave the microorganism only one step from a mutation that will produce overt resistance ( 55 ) . an example of such subtle topoisomerase mutation is seen with fluoroquinolones such as levofloxacin , which have been recommended and widely used for the therapy of pneumococcal pneumonia when penicillin resistance to s. pneumoniae is a problem ( 61 ) . unfortunately , the population has had considerable prior exposure to earlier fluoroquinolones , which has allowed rapid emergence of fluoroquinolone resistance in s. pneumoniae ( 62 ) . failure of treatment of pneumococcal pneumonia due to resistance to levofloxacin recently has been described ( 63 ) . this example confirms the problem of cross - resistance and further mutations resulting in increased resistance and suggests that newer fluoroquinolones such as gemifloxacin may be less effective or even ineffective against s. pneumoniae .", "other examples of the importance of bactericidal activity are the fluoroquinolones . studies of the bactericidal action of the quinolones against escherichia coli demonstrate at least two independent and important mechanisms of action . these bactericidal agents are only effective if the bacteria are actively dividing or synthesizing proteins and mrna . the bactericidal activity of the quinolone nalidixic acid , for example , is minimized by chloramphenicol , which prevents protein synthesis , and by rifampin , which prevents rna synthesis . however , ciprofloxacin and ofloxacin / levofloxacin respond differently . although the bactericidal action of these fluoroquinolones against e. coli is reduced , bactericidal action is not entirely eliminated by chloramphenicol or rifampin . this lack of elimination of bactericidal action suggests that these agents possess a secondary bactericidal mechanism of action that does not depend on the synthesis of protein and rna , and that may be active when the bacteria are in a nonreplicating state ( 46 ) . to understand this secondary bactericidal effect , consisting of approximately 20 genes , this system repairs structural damage to dna caused by antibacterial agents , mainly through bypass repair ( 4650 ) . another effect of the sos response , activated by fluoroquinolone - induced damage to the bacterial dna , is the discontinuation of cell replication . in addition to high concentrations of fluoroquinolone , which trigger the secondary bactericidal mechanism , higher concentrations at dna targets also play a role in the emergence of resistance because the postantibiotic effect of the fluoroquinolones is dependent upon concentration , time , and the microorganism . if the concentration of fluoroquinolone attained at the bacterial dna targets is high enough to activate the sos system for a duration that exceeds the capability of the particular microorganism to repair its dna damage and replicate , the microorganism dies . if the fluoroquinolone concentration is not adequate , however , a race occurs between cumulative damage over time and the selection of a resistant mutant . the concentration of fluoroquinolone required for sos - mediated discontinuation of cell replication is expressed as a peak concentration / minimum inhibitory concentration ( mic ) ratio and appears to require a ratio of approximately 10:1 ( 50,51 ) . a rat model for pseudomonas sepsis demonstrated that peak concentration / mic ratios > 20:1 once per day produced significantly ( p<0.5 ) better survival which may result in the selection of a mutant with altered topoisomerase than did regimens using the same dosage on a more fractionated schedule ( 52 ) . dosages that led to peak concentration / mic ratios < 10 times the mic did not result in as high a survival rate . indeed , when the peak concentration / mic ratio was < 10 times the mic , the best survival was predicted by the area under the curve / mic ratio , since repeated exposure to the fluoroquinolone causes damage cumulatively . the length of time that fluoroquinolone levels in plasma exceeded the mic had no influence on survival . the emergence of fluoroquinolone resistance with respect to staphylococcus aureus and p. aeruginosa has been well - documented ( 53 ) . this major problem is due to a wide variety of fluoroquinolone - resistance mechanisms ( 54,55 ) , particularly the mutation of dna gyrase ( 56 ) . while this type of resistance generally results in mics only four- to eight - fold higher than the susceptible isolate , recent studies have reported the development of high - level resistance ( e.g. , ciprofloxacin mic for p. aeruginosa of 1,024 mg / l ) mediated by efflux pumps targeting multiple antibacterial agents ( 57,58 ) . these multidrug efflux pumps could be overcome by high fluoroquinolone concentrations , some of which , however , would not be clinically achievable . a rabbit meningitis model further demonstrates how the inability to achieve peak concentration / mic ratios > 10:1 influences the postantibiotic effect . in an in vivo study , an exposure to ciprofloxacin at the mic had minimal impact ( 59 ) , underscoring the value of bactericidal activity with respect to fluoroquinolone therapy . the greater the activity of the fluoroquinolone , the more likely the agent will achieve serum or tissue levels that are > 10 times the mic , which in turn determines the secondary bactericidal and postantibiotic effects . consequently , newer fluoroquinolones such as gemifloxacin ( 60 ) and others now under development have markedly increased activity compared with traditional agents . for example , ciprofloxacin has mics against streptococcus pneumoniae of approximately 0.5 mg / l , while gemifloxacin has mics of approximately 0.03 mg / l . an important issue associated with the use of fluoroquinolones in the therapy of respiratory tract infections is the fact that fluoroquinolones also are used to treat other infections . the use of these agents for other infections means that the population already had been exposed to fluoroquinolones before their widespread use in respiratory tract infections . exposure of normal flora in these patients to subbactericidal concentrations of fluoroquinolones may allow resistant strains to emerge . cross - resistance is a well - recognized problem with fluoroquinolones ( 55 ) , and the enormous prior exposure of the population to these agents may have created resistant strains in the normal flora of the mucosal surfaces , skin , gastrointestinal tract , and reproductive tract . in addition , prior exposure may result in increasing mics due to subtle mutations of topoisomerases , which then may leave the microorganism only one step from a mutation that will produce overt resistance ( 55 ) . an example of such subtle topoisomerase mutation is seen with fluoroquinolones such as levofloxacin , which have been recommended and widely used for the therapy of pneumococcal pneumonia when penicillin resistance to s. pneumoniae is a problem ( 61 ) . unfortunately , the population has had considerable prior exposure to earlier fluoroquinolones , which has allowed rapid emergence of fluoroquinolone resistance in s. pneumoniae ( 62 ) . failure of treatment of pneumococcal pneumonia due to resistance to levofloxacin recently has been described ( 63 ) . this example confirms the problem of cross - resistance and further mutations resulting in increased resistance and suggests that newer fluoroquinolones such as gemifloxacin may be less effective or even ineffective against s. pneumoniae .", "the term macrolide was originally applied to specific compounds produced by various streptomyces species containing , as part of their structure , a macrocyclic lactone to which various deoxy sugars are attached . these bacteriostatic compounds bind to bacterial 50s ribosomes , inhibiting protein synthesis without a concomitant inhibition of nucleic acid synthesis . the classification has since been modified to include other structurally diverse agents , such as lincosamides and streptogramins , which are also produced by streptomyces species and target the 50s ribosome . the term mls ( macrolide , lincosamide , and streptogramin ) has become the accepted nomenclature for this important group of antibacterial agents except when the emphasis is on structural similarity , in which case the erythromycin congeners ( erythromycin - a , clarithromycin , and azithromycin ) are often referred to as the true macrolides ( 64 ) . although antibacterial agents in the mls class have been largely bacteriostatic , newer members demonstrate bactericidal activity . these new agents include quinupristin / dalfopristin and telithromycin . the bactericidal mechanism of action of quinupristin / dalfopristin , a combination of two streptogramins , is unique ( 65 ) . dalfopristin is an olefinic macrolactone that binds to the 50s subunit of the prokaryotic ribosome and interferes with the function of peptidyl transferase , thereby inactivating the donor and acceptor sites of the ribosome . in addition , dalfopristin triggers a conformational change in the ribosome that greatly increases the affinity of quinupristin , a peptidic macrolactone , which also binds to the 50s subunit of the ribosome and halts peptide chain elongation . consequently , protein synthesis is not only halted transiently by either component used alone but also halted permanently by the two components in combination , resulting in synergistic and concentration - independent bactericidal activity against many pathogens . this binding of both macrolactones distinguishes quinupristin / dalfopristin from other antibiotic classes ( 66,67 ) , with the attendant prolongation of the postantibiotic effect ( 68 ) representing a distinct advantage over older agents ( 69 ) . quinupristin / dalfopristin is bactericidal against staphylococci and streptococci such as s. pneumoniae , generally bacteriostatic against enterococcus faecium , and inactive against e. faecalis ( 70 ) . because quinupristin / dalfopristin is available only in an intravenous formulation , its utility for treating respiratory tract infections is limited to hospitalized patients moreover , clinical data on quinupristin / dalfopristin therapy of pneumococcal pneumonia caused by macrolide resistant strains of s. pneumoniae is lacking .", "telithromycin , the first of a new class of antibacterials , the ketolides , is approved for use in europe and is currently being reviewed by the u. s. food and drug administration ( 71 ) . the clinical use of telithromycin in germany , as well as safety data presented to the food and drug administration , suggests that the toxicity and adverse reactions are similar to those of clarithromycin . this similarity is not surprising , as the ketolides are novel semisynthetic erythromycin - a derivatives structurally similar to clarithromycin . the c6-hydroxyl of erythromycin - a has been replaced by a methoxy group , as in clarithromycin , improving acid stability . the main structural innovation is the lack of the neutral sugar , cladinose , in position c3 . the 3-l - cladinose sugar moiety is removed , and the resulting 3-hydroxy group is oxidized to a 3-keto group , which is responsible for preventing induction of macrolide resistance ( 72 ) . telithromycin is produced through substitution at positions 11 and 12 of the erythronolide a ring with a butyl imidazolyl pyridinyl side chain . the resulting c11,c12 carbamate extension facilitates a distinctly different and more effective interaction with domain ii of the 23s rrna than occurs with erythromycin - a or clarithromycin ( 73 ) and is responsible for increased activity against erythromycin - a resistant gram - positive cocci , such as s. pneumoniae , which develop resistance due to increased efflux ( 74,75 ) . moreover , the bactericidal action is effective against a number of other key respiratory pathogens , such as h. influenzae and c. pneumoniae ( 7678 ) , other gram - negative bacilli , such as m. catarrhalis and bordetella pertussis , and the intracellular pathogen legionella pneumophila ( 79 ) . unlike erythromycin - a ( which interacts with bacterial 23s ribosomal rna by contacts limited to hairpin 35 in domain ii of the ribosomal rna and to the peptidyl transferase loop in domain v ) , telithromycin is not a true macrolide because the l - cladinose moiety at position c3 has been replaced by a keto group and by alkylaryl side chains at positions c11,c12 . although both erythromycin - a and telithromycin bind to the peptidyl transferase loop ( the site of methylation by resistant bacteria ) , telithromycin binds much more avidly to hairpin 35 than erythromycin - a . in fact , telithromycin interacts strongly with two domains of the bacterial 23s rrna ( domains ii and v ) , which fold together in the tertiary 23s rrna to form a single drug - binding pocket ( 80,81 ) . the lack of the l - cladinose moiety , as well as the enhanced binding at domain ii and v , may explain why ketolides are associated with a low potential for inducing resistance ( 82,83 ) and contributes to telithromycin s sustained activity against mlsb - resistant strains ( in particular those with domain v modifications ) ( 73 ) . these features , in addition to the mic and the amount of drug delivered to the infection site , are considered strong predictors of a positive outcome ( 29,30 ) . however , the population has had enormous exposure to earlier macrolides . this influence means that resistance due to efflux or methylation of the 23s ribosome ( domain v ) may have already occurred in a large number of pneumococcal isolates . macrolide - resistant strains of s. pneumoniae to date have had a low incidence of cross - resistance to telithromycin ( 82,83 ) . however , increased efflux or other mutations might result in resistance to ketolides . to date , only two ketolide - resistant strains of s. pneumoniae have been identified ( 84 ) in over 10,000 pneumococcal isolates screened by the protekt study ( 10 ) . clearly , careful monitoring for ketolide resistance by surveillance studies such as the protekt study will need to be continued .", "meeting the challenge presented by the increasing numbers of bacterial pathogens resistant to common antibiotic treatments will require new types of antibacterial agents . therapies that maximize bactericidal effects are important because they reduce the development of bacterial resistance mechanisms . therefore , the use of bactericidal agents such as telithromycin for therapy of respiratory tract infections may well ensure that the antibacterial era endures long into the 21st century . however , careful monitoring of resistance will be needed to ensure that this agent remains active against common pathogens . stratton is associate professor of pathology and medicine and director of the clinical microbiology laboratory at the vanderbilt university medical center in nashville , tennessee . his research interests include the mechanisms of antimicrobial activity , antimicrobial resistance , and the pathogenesis of chlamydia pneumoniae ." ]

[ "sponges play an important role in the benthic - pelagic coupling on coral reefs ( lesser 2006 ) . the sponge community sequesters and processes organic matter and as such conserve energy and nutrients for the reef ecosystem . it is generally assumed that sponges on the fore - reef slope mainly trap allochthonous organic matter that may compensate the losses of material from reef ecosystems ( e.g. , richter et al . most reef sponges are extremely efficient in filter feeding ( e.g. , reiswig 1974 ; lesser 2006 ) . they preferably filter the picoplankton fraction from the flowing water ( e.g. , pile 1999 ; ribes et al . 2003 , 2005 ) . the major food resource of coral reef sponges , however , may well be dissolved organic matter ( reiswig 1990 ; yahel et al . 2003 ) in coral cavities are fueled mainly by dissolved organic matter ( dom ) ( de goeij et al . encrusting sponges cover together with coralline algae > 50% of the walls in coral cavities , caves , and undersides of corals ( vasseur 1974 ; richter and wunsch 1999 ; wunsch et al . this cryptic surface of 3-dimensionally well - developed reefs may exceed the open reef surface ( ginsburg 1983 ; richter et al . the sheer size of this reef habitat already preludes the grand role of its biota in organic matter cycling . dom removal by the cryptic biota on coral reefs can be huge ( up to 500 mmol c m cryptic surface d ) , with cavity sponges accounting for 70% of the consumed dom in coral reef cavities ( de goeij and van duyl 2007 ; these recent findings draw direct attention to the origin and sources of dom on coral reefs . phytoplankton ( including photoautotrophic bacteria ) usually is the main source of reactive dom in oligotrophic ocean water ; it releases dom as photosynthetic product or through food web processes and lysis ( carlson 2002 ) . on coral reefs extra sources of reactive dom include release of dom by corals through mucus production ( johannes 1967 ; richman et al . 1975 ; crossland et al . 1980 ; naumann et al . 2010 ) and extracellular release of dom by benthic algae ( e.g. , wada et al . 2007 ; the main consumers of reactive dom are usually heterotrophic bacteria ( e.g. , harvey et al . the fate of mucus and dissolved organic matter in reef overlying waters has been ascribed to consumption and mineralization by bacteria in the reef ambient water and in sediments ( e.g. , gast et al . the first indication that reef - derived dom may also be assimilated by higher trophic levels came from the abundance of the dietary fatty acid biomarker 20:46 in the encrusting dom feeding cavity sponge halisarca caerulea ( de goeij et al . 1991 ) and in coralline algae , rhodophyta ( viso and marty 1993 ) and its presence in sponges suggests that reef - derived organic matter may be an important food source for coral reef sponges . this study aims ( 1 ) to determine whether cavity sponges mainly rely on reef - produced or open water - derived dissolved organic matter and ( 2 ) to identify key sources of dom for cavity sponges . as putative food compounds different fractions of suspended matter , bacterioplankton , coral mucus , and coralline algae as proxies for dom were analyzed . through stable isotopes and fatty acid biomarkers , we characterized energy sources of cavity sponges collected from coral reefs and open water on the southwest coast of curaao , caribbean ( 1212n , 6856w ) . stable isotopes are a classical way to trace food sources of aquatic animals ( peterson and fry 1987 ) . the carbon and nitrogen stable isotope signatures of 12 sponge species were compared with those of putative food compounds . fatty acid biomarkers have been repeatedly used as source - specific indicators of dissolved and particulate organic matter both in environmental and in food web studies ( e.g. hall et al . the fa pattern of six sponge species and three types of reef food resources were analyzed , and the relative input of different sources to the diet of the sponges was determined .", "samples were collected from march 14 to 22 , 2006 , along four transects perpendicular to the sw coast of curaao ( fig . 1 ) . transects were placed 37 km apart from se to nw along the coast at lagun jan thiel ( ljt ) , at the ocean cruise terminal in otrabanda ( ct ) , at buoy 1 ( b1 ) of the carmabi reef close to piscaderabaai , and at slangenbaai ( sb ) . transects from the shore to open water cross the narrow fringing reefs and water masses representative for the variation in coral community composition and water quality along the sw coast of curaao ( van duyl 1985 ; gast et al . 1999 ; van duyl and gast 2001 ) . along each transect ( ljt , ct , b1 , and sb ) , we sampled 2 stations : fig . ( ljt , ct , b1 , and sb ) along the southwest coast of curaao , with an inset of the geographic position of the island in the caribbeanan off - shore open water station about 12 km distance from the reef where water was collected at 1517 m depth in the blue water anda coral reef station where we collected bottom water at 1517 m depth on the fore - reef slope , approximately 0.5 m above the coral bottom . position of sampling transects ( ljt , ct , b1 , and sb ) along the southwest coast of curaao , with an inset of the geographic position of the island in the caribbean an off - shore open water station about 12 km distance from the reef where water was collected at 1517 m depth in the blue water and a coral reef station where we collected bottom water at 1517 m depth on the fore - reef slope , approximately 0.5 m above the coral bottom . water samples were taken with a 6 l niskin bottle operated by a scuba diver . the niskin bottle was repeatedly filled and hauled on board a small open boat and emptied in a clean and sample washed 20 l container . at each station ( n = 8) , we collected 20 l. on the fore - reef slope stations ( n = 4 ) , we collected a few small pieces of the stony corals montastraea annularis and madracis mirabilis ( also siderastrea siderea and porites astreoides but only at b1 ) between 15 and 17 m depth , which were kept in seawater under natural light conditions until mucus collection on the next day . from the entrance of coral cavities at 1517 m depth on the fore - reef slope , we chiseled crusts of calcareous algae . from the same cavities , various species of encrusting sponges were collected , up to eight different species per station . the 20-l water samples were filtered over 47-mm - diameter combusted glass microfiber filters ( whatman ) , first over a gfc filter ( nominal pore size 1.2 m ) and then over a gff filter ( nominal pore size 0.7 m ) . after sea water filtration , filters were shortly washed with milli - q water ( mq ) to remove salt and were dried at 50c in a stove and stored in aluminum foil in the freezer until processing . the remaining bacterioplankton in the gff filtrate was concentrated with a vivaspin filter cartridge driven by a master volt tube pump . the concentrate was subsequently filtered over a 0.2 m pore size 25-mm - diameter anopore disc ( aluminum oxide membrane filter , whatman ) . the discs were briefly washed with mq after seawater filtration and dried at 50c in a stove ( 12 h ) . after drying , the filter was crumbled in a clean acid - washed glass funnel , the integrated polypropylene support ring of the filter was removed and the filter fragments were transferred to combusted silver capsules , which were closed with tweezers . subsequently , the folded capsules were placed in coded trays and stored in the freezer until processing . live corals were air - exposed during mucus collection and positioned upside down connected to a stand . after shortly spraying the live coral tissue with mq , the mucus produced by the coral was collected via an acid - washed glass funnel in combusted glass vials . after collection of approximately 2 ml mucus per coral , mucus samples were dried in a stove at 50c before being stored dry in the freezer . the cavity sponges and coralline algae were quickly washed with mq to remove salt and the tissue was subsequently removed from the underlying substratum by knife and scalpel . small pieces were fixed in ethanol ( 80% ) for taxonomical identification of the different sponge species . the rest of the pieces were collected in combusted glass vials dried at 50c and stored dry in the freezer . sponges and putative food sources were subject to stable isotope analysis . both carbon and nitrogen ( except for bacteria for which only corg was measured ) isotopic composition of the samples were determined using a fisons cn analyser coupled on line via a finnigan conflo 2 interface , to a finnigan delta s mass spectrometer . the carbon and nitrogen isotope ratios are expressed as corg and n relative to the vienna pee dee belemnite standard and air , respectively , and the standard error of the measurements is ~0.15. all carbon isotope samples ( except bacteria that were caught on aluminum filters ) were acidified ( tissue directly with acid and glass filters in acid vapor ) prior to measurements and corrected for individual sets of blanks ( isotope mass balance corrections ) . seawater as source of carbonates leading to possible enrichment of corg in case of un - acidified aluminum bacteria filters was eliminated by the rinse with mq water at the end of filtration . the dried sponge , coralline algae , and mucus material were first homogenized in a mortar . for isotope measurements , adequate amount of material was transferred to pre - combusted silver boats for acidification within cups , followed by oven drying to remove excess acid . from the remaining grounded material , samples from the b1 reef station were also analyzed for their total fatty acid composition using a method of one - step procedure of fatty acid extraction and methylation ( masood et al . fatty acid extraction and preparation of methyl esters ( fame ) were carried out according to masood et al . ( 2005 ) with reagent volumes adapted for use in 2.5-ml gc - vials using fame c19:0 as internal standard to calculate concentration of fas ( van gaever et al . these individual samples were analyzed separately for their fa compositions employing a large volume splitless injection method on a thermo finnigan trace ultra gc . main items of this method are the large volume liner with glass wool , pre - column deactivated silica 5 m 0.53 m , and analytical column sge bpx-70 50 m 0.32 mm 0.25 m . the identification of fames was based on the comparison of retention times with authentic commercially available reference material and standards . fatty acid source designation was achieved using data on distinctive fa for bacteria , algal carbon , and higher organisms ( e.g. , parrish et al . 2000 ; boschker and middelburg 2002 ; volkman 2006 ) . we ran one- and two - way anovas with non - transformed stable isotope data to determine whether variations in stable isotopes of sponges were due to sponge species and/or sponge location assuming no interaction effects ( not enough replication for testing interaction ) . the tukey s hsd method was used for pair wise comparisons of different sponge species ( multiple comparisons of means ) . anova s were also run for isotope signals of reef and open water - derived suspended matter . the siar stable isotope mixing model analysis ( parnell et al . 2010 ) was applied to investigate probable solutions for the diet of sponges based on dual stable isotope data of four sources ( gfc and gff fractions of suspended matter , crustose coralline algae , and coral mucus ) . we used the following trophic enrichment factors with standard deviations for the sponges : 3.5 0.5 for n and 1 1 for c ( vander zanden and rasmussen 2001 ; behringer and butler iv 2006 ) . the siar model takes data on organism isotopes and fits a bayesian model to their dietary habits based upon a gaussian likelihood with a mixture dirichlet - distributed prior on the mean . model fitting is via markov chain monte carlo ( mcmc ) which produces simulations of plausible values for each dietary source consistent with the data . the software package siar ( stable isotope analysis in r ) is freely available from the package section of the comprehensive r archive network website http://cran.r - project.org/ ( parnell and jackson 2010 ) . fatty acid composition patterns were explored with multivariate analyses of fas composition profiles ( non - transformed percentage abundance ) using the program primer version 5 ( clarke and gorley 2006 ) . multi - dimensional scaling ( mds plots ) of fa composition and dual isotope label patterns were compared for six sponge species and the three different reef - derived resources ( cca , mucus of m. annularis , and mucus of m. mirabilis ) . similarities between fa profiles were investigated using the simper ( similarity of percentages ) function , and statistical differences were determined using the anosim ( analysis of similarities ) function .", "samples were collected from march 14 to 22 , 2006 , along four transects perpendicular to the sw coast of curaao ( fig . 1 ) . transects were placed 37 km apart from se to nw along the coast at lagun jan thiel ( ljt ) , at the ocean cruise terminal in otrabanda ( ct ) , at buoy 1 ( b1 ) of the carmabi reef close to piscaderabaai , and at slangenbaai ( sb ) . transects from the shore to open water cross the narrow fringing reefs and water masses representative for the variation in coral community composition and water quality along the sw coast of curaao ( van duyl 1985 ; gast et al . 1999 ; van duyl and gast 2001 ) . along each transect ( ljt , ct , b1 , and sb ) , we sampled 2 stations : fig . ( ljt , ct , b1 , and sb ) along the southwest coast of curaao , with an inset of the geographic position of the island in the caribbeanan off - shore open water station about 12 km distance from the reef where water was collected at 1517 m depth in the blue water anda coral reef station where we collected bottom water at 1517 m depth on the fore - reef slope , approximately 0.5 m above the coral bottom . position of sampling transects ( ljt , ct , b1 , and sb ) along the southwest coast of curaao , with an inset of the geographic position of the island in the caribbean an off - shore open water station about 12 km distance from the reef where water was collected at 1517 m depth in the blue water and a coral reef station where we collected bottom water at 1517 m depth on the fore - reef slope , approximately 0.5 m above the coral bottom . water samples were taken with a 6 l niskin bottle operated by a scuba diver . the niskin bottle was repeatedly filled and hauled on board a small open boat and emptied in a clean and sample washed 20 l container . at each station ( n = 8) , we collected 20 l. on the fore - reef slope stations ( n = 4 ) , we collected a few small pieces of the stony corals montastraea annularis and madracis mirabilis ( also siderastrea siderea and porites astreoides but only at b1 ) between 15 and 17 m depth , which were kept in seawater under natural light conditions until mucus collection on the next day . from the entrance of coral cavities at 1517 m depth on the fore - reef slope , we chiseled crusts of calcareous algae . from the same cavities , various species of encrusting sponges were collected , up to eight different species per station .", "the 20-l water samples were filtered over 47-mm - diameter combusted glass microfiber filters ( whatman ) , first over a gfc filter ( nominal pore size 1.2 m ) and then over a gff filter ( nominal pore size 0.7 m ) . after sea water filtration , filters were shortly washed with milli - q water ( mq ) to remove salt and were dried at 50c in a stove and stored in aluminum foil in the freezer until processing . the remaining bacterioplankton in the gff filtrate was concentrated with a vivaspin filter cartridge driven by a master volt tube pump . the concentrate was subsequently filtered over a 0.2 m pore size 25-mm - diameter anopore disc ( aluminum oxide membrane filter , whatman ) . the discs were briefly washed with mq after seawater filtration and dried at 50c in a stove ( 12 h ) . after drying , the filter was crumbled in a clean acid - washed glass funnel , the integrated polypropylene support ring of the filter was removed and the filter fragments were transferred to combusted silver capsules , which were closed with tweezers . subsequently , the folded capsules were placed in coded trays and stored in the freezer until processing . live corals were air - exposed during mucus collection and positioned upside down connected to a stand . after shortly spraying the live coral tissue with mq , the mucus produced by the coral was collected via an acid - washed glass funnel in combusted glass vials . after collection of approximately 2 ml mucus per coral , mucus samples were dried in a stove at 50c before being stored dry in the freezer . the cavity sponges and coralline algae were quickly washed with mq to remove salt and the tissue was subsequently removed from the underlying substratum by knife and scalpel . small pieces were fixed in ethanol ( 80% ) for taxonomical identification of the different sponge species . the rest of the pieces were collected in combusted glass vials dried at 50c and stored dry in the freezer . sponges and putative food sources were subject to stable isotope analysis . both carbon and nitrogen ( except for bacteria for which only corg was measured ) isotopic composition of the samples were determined using a fisons cn analyser coupled on line via a finnigan conflo 2 interface , to a finnigan delta s mass spectrometer . the carbon and nitrogen isotope ratios are expressed as corg and n relative to the vienna pee dee belemnite standard and air , respectively , and the standard error of the measurements is ~0.15. all carbon isotope samples ( except bacteria that were caught on aluminum filters ) were acidified ( tissue directly with acid and glass filters in acid vapor ) prior to measurements and corrected for individual sets of blanks ( isotope mass balance corrections ) . seawater as source of carbonates leading to possible enrichment of corg in case of un - acidified aluminum bacteria filters was eliminated by the rinse with mq water at the end of filtration . the dried sponge , coralline algae , and mucus material were first homogenized in a mortar . for isotope measurements , adequate amount of material was transferred to pre - combusted silver boats for acidification within cups , followed by oven drying to remove excess acid . from the remaining grounded material , samples from the b1 reef station were also analyzed for their total fatty acid composition using a method of one - step procedure of fatty acid extraction and methylation ( masood et al . fatty acid extraction and preparation of methyl esters ( fame ) were carried out according to masood et al . ( 2005 ) with reagent volumes adapted for use in 2.5-ml gc - vials using fame c19:0 as internal standard to calculate concentration of fas ( van gaever et al . these individual samples were analyzed separately for their fa compositions employing a large volume splitless injection method on a thermo finnigan trace ultra gc . main items of this method are the large volume liner with glass wool , pre - column deactivated silica 5 m 0.53 m , and analytical column sge bpx-70 50 m 0.32 mm 0.25 m . the identification of fames was based on the comparison of retention times with authentic commercially available reference material and standards . fatty acid source designation was achieved using data on distinctive fa for bacteria , algal carbon , and higher organisms ( e.g. , parrish et al .", "we ran one- and two - way anovas with non - transformed stable isotope data to determine whether variations in stable isotopes of sponges were due to sponge species and/or sponge location assuming no interaction effects ( not enough replication for testing interaction ) . the tukey s hsd method was used for pair wise comparisons of different sponge species ( multiple comparisons of means ) . anova s were also run for isotope signals of reef and open water - derived suspended matter . the siar stable isotope mixing model analysis ( parnell et al . 2010 ) was applied to investigate probable solutions for the diet of sponges based on dual stable isotope data of four sources ( gfc and gff fractions of suspended matter , crustose coralline algae , and coral mucus ) . we used the following trophic enrichment factors with standard deviations for the sponges : 3.5 0.5 for n and 1 1 for c ( vander zanden and rasmussen 2001 ; behringer and butler iv 2006 ) . the siar model takes data on organism isotopes and fits a bayesian model to their dietary habits based upon a gaussian likelihood with a mixture dirichlet - distributed prior on the mean . model fitting is via markov chain monte carlo ( mcmc ) which produces simulations of plausible values for each dietary source consistent with the data . the software package siar ( stable isotope analysis in r ) is freely available from the package section of the comprehensive r archive network website http://cran.r - project.org/ ( parnell and jackson 2010 ) . fatty acid composition patterns were explored with multivariate analyses of fas composition profiles ( non - transformed percentage abundance ) using the program primer version 5 ( clarke and gorley 2006 ) . multi - dimensional scaling ( mds plots ) of fa composition and dual isotope label patterns were compared for six sponge species and the three different reef - derived resources ( cca , mucus of m. annularis , and mucus of m. mirabilis ) . similarities between fa profiles were investigated using the simper ( similarity of percentages ) function , and statistical differences were determined using the anosim ( analysis of similarities ) function .", "the sponge species collected on the reef stations were identified on basis of their tissue and skeletal characteristics . 2007 ) to 20.7 ( scopalina ruetzleri ) and n values ranging from 2.9 ( monanchora arbuscula ) to 7.1 ( scopalina ruetzleri ) ( table 1 ) . variations in corg and n data were significantly related to sponge species ( anova , f(5,17 ) = 30.3 and f(5,17 ) = 15.8 , p < 0.01 for both ) and not to reef station ( f(3,17 ) = 1.16 and f(3,17 ) = 0.83 , p > 0.35 for both ) . 0.05 ) were found between s. ruetzleri and h. caerulea , s. ruetzleri and niphates erecta , n. erecta and m. arbuscula , which were sampled at three to four reef sites ( table 1 ) . differences in dual stable isotope values between sponge species were small when compared to isotope values of sources . therefore , the sponge data of the different transects were combined in the fig . 2a , b. the stable isotope signals of particulate organic matter size fractions were not significantly different between the open water and reef water ( anova , p > 0.05 ) , but were kept separate in fig . 2a , b. figure 2a shows that open water and reef water bacteria have on average slightly different c signatures . variations in corg values of bacterioplankton were large between stations ( ljt and sb vs. ct and b1 , table 2 ) . only the reef water bacteria of station sb ( c : 17.9 ) were in trophic reach of sponges ( < 2 difference ) . the sponge trophic range overlaps with the range of coralline algae ( average c of 16.9 4.2 ) . coral mucus of montastraea annularis and madracis mirabilis was on average heavier in corg content than the sponges ( table 2 ) . coral mucus and coralline algae are potential sponge food because of a trophic level n increase of 34 ( fig . 2b).table 1sponge species collected at four reef stations with their respective average isotope signaturescryptic biotastationljtlagun jan thielctcruise terminalb1carmabi reefsbslangenbaaicodecncncncn \n halisarca caerulea \n\n n = 7sp118.793.6918.454.1218.333.1618.484.0218.204.0917.874.0718.734.63 \n clathria ( thalysis ) raraechelae \n\n n = 1sp218.914.03 \n chondrilla caribensis \n\n n = 1sp317.163.83 \n chelonaplysilla erecta \n\n n = 1sp419.944.68 \n desmapsamma anchorata \n\n n = 1sp518.815.61 \n scopalina ruetzleri \n\n n = 6sp619.765.9020.264.8520.795.4820.026.1319.417.0720.065.86 \n eurypon laughlini \n\n n = 218.955.6718.515.78 \n topsentia ophirhaphidites \n\n n = 219.635.3719.275.82 \n niphates erecta \n\n n = 617.704.0117.654.7917.934.4717.994.2117.974.7118.004.71 \n callyspongia vaginalis \n\n n = 217.723.7917.474.37 \n monanchora arbuscula \n\n n = 520.383.8320.403.4219.823.2819.952.8419.473.63 \n phorbas amaranthus \n\n n = 118.864.40codes sp1sp6 refer to sponges collected at b1 and correspond to sponge data presented in fig . 3 \n fig . 2plots of carbon ( a ) and nitrogen ( b ) stable isotope signatures of material collected from the four reef and four open water stations ( average and standard error ) . sponges ( n = 35 ) , bacteria ( bact n = 8) , coral mucus ( n = 9 ) , glass microfiber filters coarse ( gfc ) and fine ( gff ) represent values of suspended matter ( spm ) collected either from reef water or from open water offshore ( n = 4 or 5 ) . crustose coralline algae from two reef stations ( n = 3)table 2average isotope signatures of putative food sources for sponges collected from reef stations ljt , ct , b1 , and sb ( replicates , n = 23 , standard errors range from 0 to 0.4 , not shown)substrate sourcesstationljtlagun jan thielctcruise terminalb1carmabi reefsbslangenbaaicodecncncncnspm - gfc open water21.775.2723.873.3722.967.0021.613.94 reef water23.724.5123.385.1723.833.6722.532.66 crevice water21.402.96spm - gff open water20.863.8123.921.9725.872.8421.524.69 reef water21.194.5324.863.0024.364.4022.093.80 crevice water24.083.20bacteria open water21.93nd26.02nd27.31nd19.42nd reef water15.36nd26.40nd27.41nd17.85ndmacroalgae coralline algaecca13.373.6025.201.3012.124.05coral mucus m. annularis \n mu115.460.5415.784.1216.462.3514.243.21 m. mirabilis \n mu217.952.1216.534.2417.641.71 s. siderea \n 17.800.55 p. astreoides \n 16.871.11suspended particulate matter ( spm ) fractions collected on coarse ( gfc ) and fine ( gff ) glass fiber filters . codes cca and mu1 , mu2 refer to data collected at b1 and correspond to data presented in fig . 3 \n\n nd not done sponge species collected at four reef stations with their respective average isotope signatures codes sp1sp6 refer to sponges collected at b1 and correspond to sponge data presented in fig . 3 \n plots of carbon ( a ) and nitrogen ( b ) stable isotope signatures of material collected from the four reef and four open water stations ( average and standard error ) . sponges ( n = 35 ) , bacteria ( bact n = 8) , coral mucus ( n = 9 ) , glass microfiber filters coarse ( gfc ) and fine ( gff ) represent values of suspended matter ( spm ) collected either from reef water or from open water offshore ( n = 4 or 5 ) . crustose coralline algae from two reef stations ( n = 3 ) average isotope signatures of putative food sources for sponges collected from reef stations ljt , ct , b1 , and sb ( replicates , n = 23 , standard errors range from 0 to 0.4 , not shown ) suspended particulate matter ( spm ) fractions collected on coarse ( gfc ) and fine ( gff ) glass fiber filters . bacterioplankton ( bacteria ) was collected on aluminum oxide ( anopore ) membrane filters . codes cca and mu1 , mu2 refer to data collected at b1 and correspond to data presented in fig . 3 \n pooled analysis with the mixing model ( no distinction between sites or sponge species ) show that mucus ( mu1 and mu2 combined ) contributed to the average cavity sponge diet between 44 and 57% ( = 95% low and high confidence limits , mode 50% ) , cca between 0 and 10% ( mode 2% ) , and the different spm fractions between 0 and 33% ( mode 7% ) for gfc and 14 and 47% ( mode 37% ) for gff ( table 3a ) . of the overall diet 51% ( mode ) was reef - derived . therefore , we ran the siar mixing model also separate for the stations for which cca data were available , ct and b1 ( tables 2 , 3b , c ) . pooled analysis of sponges at ct ( no distinction between sponge species ) reflected a higher cca contribution ( between 6 and 43% , mode 31% ) than mucus ( 046% , mode 17% ) . together suspended matter supplemented the diet between 0 and 40% for the gfc fraction ( mode 17% ) and 1155% for the gff fraction ( mode of gfc and gff fractions together 51% , table 3b ) . at b1 , where coral cover is higher than at ct ( van duyl 1985 ; pers comm ) , the diet of an average cavity sponge ( no distinction between sponge species ) was dominated by reef - derived sources ( 73% ) with coral mucus and cca contributing for 60 and 13% ( mode ) and with 95% confidence between 5068% and 030% , respectively ( table 3c ) . the contribution of suspended matter fractions gfc and gff was within the 028/030% range ( modes 11 and 5% ) , respectively.table 3dual isotope mixing model analyses of the diet of spongessourceslow 95%high 95%modemeanmode%mean%(a ) average diet of sponges ( four stations ) \n gfc ro00.3260.0710.138 gff ro0.1400.4740.3710.32144.245.9 cca00.0950.0150.039 mucmix0.4350.5720.4980.50251.354.1(b ) diet of sponges at ct \n gfc ro00.4020.1700.194 gff ro0.1120.5520.3350.33350.552.7 cca0.0630.4280.3080.254 mucmix00.4550.1720.2184847.2(c ) diet of sponges at b1 \n gfc ro00.2750.1060.122 gff ro00.3000.0530.13015.925.2 cca0.0010.3010.1310.155 mucmix0.5020.6820.5960.59372.774.8the sources comprise two suspended matter size fractions , gfc ro > 1.2 m and gff ro > 0.7 and < 1.2 m from reef overlying and open water ( ro ) , cca representing crustose coralline algae and mucmix representing coral mucus of two different coral species , m. annularis and m. mirabilis . the 95% credibility intervals are presented of the different sources as well as the mode and the mean . mode% and mean% show the contribution of plankton - derived ( gfc and gff ) and reef - derived organic matter ( cca and mucmix ) in the diet as % dual isotope mixing model analyses of the diet of sponges the sources comprise two suspended matter size fractions , gfc ro > 1.2 m and gff ro > 0.7 and < 1.2 m from reef overlying and open water ( ro ) , cca representing crustose coralline algae and mucmix representing coral mucus of two different coral species , m. annularis and m. mirabilis . the 95% credibility intervals are presented of the different sources as well as the mode and the mean . mode% and mean% show the contribution of plankton - derived ( gfc and gff ) and reef - derived organic matter ( cca and mucmix ) in the diet as % for six sponge species , cca and mucus of two coral species at b1 dual isotopes as well as fatty acid patterns were measured ( fig . 3 ; table 4 ) . fas in sources were also present in most sponges , but the diversity in fas was higher in sponges . differences between sources ( cca and mucus ) and sponges in the fatty acid compositions are illustrated in fig . the euclidean distances show that the fas of sponges cluster together and are distinct from the sources . main fas of the sponge cluster included , in order of importance 16:0 , 20:46 , 18:0 , 20:53 , 18:17c , and branched 20:0 ( phytanic acid ) whereas in the case of the potential energy sources this included 16:0 , 18:0 , 18:19c , and 20:46 ( table 4 ) . the source groups were significantly different ( anosim , global r = 0.8 , p < 0.05 ) from the sponge group and simper analysis revealed that the differences are the relatively higher percentage abundance of 16:0 , 20:46 , 18:0 , and 18:19c in coral mucus and coralline algae but higher percentage abundance of phytanic acid , 24:0 and 20:53 in the sponges . these 7 fas together accounted for ~60% of the fa dissimilarity ( table 4 ; fig . 4 ) . among the three different sources , coralline algae , mucus of montastraea annularis , and madracis mirabilis , composition patterns were also significantly different ( anosim , global r = 1 , p < 0.05 ) . simper analysis revealed two very dominant fatty acids in the coralline algae ( 16:0 and 20:46 ) that together accounted for ~73% of the fa ; in mucus from m. annularis ( mu1 ) , four abundant fas made up ~70% ( 16:0 , 18:0 , 20:53 , and 18:19c ) ; in mucus from m. mirabilis ( mu2 ) , three abundant fas made up ~70% ( 16:0 , 18:0 , and 20:46 , table 2 ) . the major fas accounting for the dissimilarity between mucus from the two different coral species is the relatively higher percentage abundance of 20:46 and 18:0 in m. mirabilis ( mu2 ) but a relatively higher percentage abundance of 18:17c and 20:53 in m. annularis ( mu1 ) with these 4 fas accounting for ~60% of the dissimilarity between the coral species ( table 4 ) . three groups of sponges were distinguished among the 6 sponge species ( fig . 4 : h. caerulea ( sp1 ) , c. caribensis ( sp3 ) and c. erecta ( sp4 ) make up the first group ; c. raraechelae ( sp2 ) and d. anchorata ( sp5 ) the second and s. ruetzleri ( sp6 ) the third group ) . simper analysis revealed different combinations of fas , in order of dominance , accounting for ~70% of sponge group similarity : for the first group ( sp1 , sp3 , and sp4 ) fas 16:0 , br 20:0 ( phytanic acid ) , 18:0 , 20:46 , i15:0 , and 16:17c are the main fas . in the second group ( sp2 and sp5 ) fas 16:0 , 20:46 , 24:0 , 18:17c , 22:0 , 20:53 , and 20:63 determined primarily the composition pattern . in the third group ( sp6 ) , these were the five fas : 16:0 , 20:46 , 18:0 , 20:53 , and 14:0 ( table 4).fig . 3carbon and nitrogen isotopes of six sponge species ( sp1sp6 ) and putative organic matter sources for sponges at reef site b1 . the average and standard error for sp1 ( n = 3 ) and sp6 ( n = 2 ) , gfc - spm ( n = 3 ) , gff - spm ( n = 3 ) is presented . other data points ( sp2 , 3 , 4 , and 5 , cca and mucus from two coral species , montastraea annularis ( mu1 ) and madracis mirabilis ( mu2 ) do not have replicates other than repetitive sample analysis of the same specimen ) . see also tables 1 , 2 \n table 4fatty acid composition of six sponge species ( sp1sp6 , see table 1 ) , one crustose coralline alga ( cca ) and mucus ( mu ) from two coral species ( see table 2 ) , all collected from reef site b1sp1sp2sp3sp4sp5sp6ccamu1mu2i14:0 \n 0 ( 0)0 ( 0)0.7 ( 0.02)0 ( 0)0 ( 0)0 ( 0)0 ( 0)0 ( 0)0 ( 0)14:06.6 ( 0.55)2.6 ( 0.05)2.3 ( 0.08)3.6 ( 0.40)3.8 ( 0.55)9.1 ( 0.24)3.5 ( 0.10)5.3 ( 0.21)2.6 ( 0.05)ai15:0 \n 0.6 ( 0.05)0 ( 0)2.6 ( 0.02)0.5 ( 0.27)0.1 ( 0.07)0.3 ( 0.06)0.04 ( 0.04)0 ( 0)0 ( 0)i15:0 \n 5.3 ( 0.24)0.3 ( 0.06)9.8 ( 0.05)5.4 ( 0.25)0.8 ( 0.04)0.5 ( 0.16)0 ( 0)3.8 ( 1.90)4.2 ( 0.08)15:01.2 ( 0.11)0.5 ( 0.01)1.1 ( 0.07)1.4 ( 0.07)1.7 ( 0.15)7.5 ( 0.23)0.3 ( 0.07)0 ( 0)0 ( 0)i16:0 \n 0.6 ( 0.08)0.4 ( 0.02)1.3 ( 0.02)0.4 ( 0.20)0.7 ( 0.05)1.9 ( 0.05)0.3 ( 0.02)0 ( 0)0 ( 0)10me-16:0 \n 0 ( 0)0 ( 0)0 ( 0)0 ( 0)0.4 ( 0.07)0 ( 0)0 ( 0)0 ( 0)0 ( 0)16:260 ( 0)0 ( 0)0 ( 0)0 ( 0)0 ( 0)0 ( 0)0 ( 0)0 ( 0)0.51 ( 0.03)16:240 ( 0)0.2 ( 0.03)0 ( 0)0 ( 0)0.5 ( 0.00)0.1 ( 0.09)0.04 ( 0.04)0 ( 0)0 ( 0)16:15c0 ( 0)0.7 ( 0.03)0.9 ( 0.03)0.4 ( 0.18)0.6 ( 0.03)0.4 ( 0.02)0 ( 0)0 ( 0)0 ( 0)16:17c \n 3.3 ( 0.16)1.6 ( 0.02)12.6 ( 0.03)4.0 ( 0.11)4.2 ( 0.16)2.1 ( 0.04)0.5 ( 0.06)3.9 ( 0.50)0.6 ( 0.04)16:17 t \n 0 ( 0)0.15 ( 0.02)0.79 ( 0.01)0 ( 0)0.1 ( 0.07)0.3 ( 0.04)0 ( 0)0 ( 0)0 ( 0)16:017.1 ( 1.73)13.2 ( 0.27)18.4 ( 0.19)20.5 ( 0.39)12.1 ( 0.62)19.6 ( 0.52)40.7 ( 0.21)30.8 ( 0.84)27.8 ( 0.66)10me-17:0 \n 0 ( 0)0 ( 0)0.8 ( 0.15)0 ( 0)0 ( 0)0 ( 0)0 ( 0)0 ( 0)0 ( 0)17:17c0.9 ( 0.66)0.1 ( 0.00)1.9 ( 0.10)8.5 ( 0.42)0.5 ( 0.11)0.7 ( 0.22)0.4 ( 0.12)0 ( 0)0 ( 0)17:01.9 ( 0.08)0.5 ( 0.04)0.5 ( 0.49)2.6 ( 0.13)1.4 ( 0.00)0.5 ( 0.09)0.3 ( 0.00)0.5 ( 0.03)0 ( 0)i18:0 \n 0 ( 0)0.6 ( 0.05)0.3 ( 0.05)0 ( 0)0.6 ( 0.09)0.4 ( 0.02)0 ( 0)0 ( 0)0 ( 0)18:530.2 ( 0.22)1.1 ( 0.03)0.2 ( 0.05)0 ( 0)1.7 ( 0.23)0.1 ( 0.05)0.1 ( 0.00)1.5 ( 0.04)0 ( 0)18:50 ( 0)0 ( 0)0 ( 0)0 ( 0)0 ( 0)0 ( 0)0 ( 0)2.1 ( 1.03)0 ( 0)18:360.6 ( 0.56)0.3 ( 0.02)0.1 ( 0.04)0 ( 0)0 ( 0)0 ( 0)0 ( 0)4.1 ( 0.31)0 ( 0)18:330.5 ( 0.25)0.1 ( 0.07)0 ( 0)0.8 ( 0.21)0.3 ( 0.26)0 ( 0)0 ( 0)0 ( 0)0 ( 0)18:26c1.8 ( 0.12)0.8 ( 0.07)0.3 ( 0.02)2.2 ( 0.09)0.6 ( 0.30)0.9 ( 0.06)0.8 ( 0.02)0.4 ( 0.20)0.8 ( 0.05)18:17c5.7 ( 0.12)9.7 ( 0.06)3.3 ( 0.10)5.5 ( 0.04)6.6 ( 0.15)2.0 ( 0.06)4.5 ( 0.05)8.1 ( 0.33)0.7 ( 0.03)18:19c2.5 ( 0.50)1.9 ( 0.06)1.9 ( 0.11)4.2 ( 0.14)1.4 ( 0.26)2.0 ( 0.08)11.2 ( 0.10)9.1 ( 0.32)7.3 ( 0.12)18:09.4 ( 0.25)4.0 ( 1.61)9.7 ( 0.23)10.2 ( 0.29)5.6 ( 0.46)11.5 ( 0.06)3.0 ( 0.02)15.5 ( 0.34)25.4 ( 0.74)i20:0 \n 0.2 ( 0.20)0.8 ( 0.01)0 ( 0)0 ( 0)1.1 ( 0.14)0 ( 0)0 ( 0)0 ( 0)0 ( 0)20:534.5 ( 0.26)6.3 ( 0.24)3.4 ( 0.01)3.0 ( 0.25)5.0 ( 0.36)11.7 ( 0.26)0.1 ( 0.05)11.0 ( 0.15)4.4 ( 0.44)20:430 ( 0)0.10 ( 0.05)0 ( 0)0 ( 0)0.4 ( 0.08)0.7 ( 0.35)0.3 ( 0.30)0 ( 0)0 ( 0)20:4610.6 ( 0.68)11.1 ( 0.24)9.1 ( 0.25)8.1 ( 0.11)10.7 ( 0.48)15.2 ( 0.27)32.2 ( 0.75)0 ( 0)15.0 ( 0.34)20:360.7 ( 0.13)0.7 ( 0.12)0.5 ( 0.06)0.6 ( 0.08)0.5 ( 0.03)0.5 ( 0.05)0.4 ( 0.03)0 ( 0)0 ( 0)20:330 ( 0)0.1 ( 0.07)0 ( 0)0.1 ( 0.12)0.3 ( 0.13)0.1 ( 0.13)0 ( 0)0 ( 0)0 ( 0)phytanic acid15.5 ( 1.34)2.9 ( 0.13)13.4 ( 0.26)8.3 ( 0.29)1.8 ( 0.30)1.3 ( 0.19)0.2 ( 0.03)0 ( 0)0 ( 0)20:19c0.6 ( 0.39)0.2 ( 0.05)0.1 ( 0.00)0 ( 0)0.5 ( 0.10)0.1 ( 0.05)0.2 ( 0.04)0 ( 0)0.3 ( 0.28)20:290.3 ( 0.15)0.3 ( 0.05)0 ( 0)0.8 ( 0.02)0.9 ( 0.40)2.6 ( 0.04)0.1 ( 0.04)0 ( 0)0 ( 0)20:00.9 ( 0.04)2.2 ( 0.06)0.8 ( 0.04)1.7 ( 0.05)3.5 ( 0.16)2.5 ( 0.03)0.3 ( 0.05)3.1 ( 0.14)6.4 ( 0.21)22:631.0 ( 0.01)8.4 ( 0.14)0.1 ( 0.06)2.6 ( 0.27)3.6 ( 0.28)1.9 ( 0.02)0 ( 0)0 ( 0)0 ( 0)22:530 ( 0)0 ( 0)0.1 ( 0.09)2.8 ( 0.30)0 ( 0)0 ( 0)0.1 ( 0.03)0 ( 0)0 ( 0)22:460.5 ( 0.06)1.9 ( 0.14)0 ( 0)0.6 ( 0.58)0.3 ( 0.12)0 ( 0)0 ( 0)0.9 ( 0.44)1.9 ( 0.14)22:1110.2 ( 0.20)0.1 ( 0.03)0.5 ( 0.06)0.1 ( 0.11)0 ( 0)0 ( 0)0.1 ( 0.03)0 ( 0)0 ( 0)22:19c0 ( 0)0 ( 0)0.1 ( 0.05)0 ( 0)0 ( 0)1.0 ( 0.08)0.1 ( 0.07)0 ( 0)0 ( 0)22:01.9 ( 0.18)4.2 ( 0.25)0.7 ( 0.03)0.4 ( 0.19)18.1 ( 0.89)0.8 ( 0.20)0.2 ( 0.05)0 ( 0)2.2 ( 0.09)23:01.5 ( 0.17)2.1 ( 0.34)0.9 ( 0.05)0.1 ( 0.12)2.0 ( 0.14)0.1 ( 0.06)0 ( 0)0 ( 0)0 ( 0)24:03.5 ( 0.31)20.3 ( 0.96)1.1 ( 0.10)0.6 ( 0.06)7.8 ( 0.32)1.8 ( 0.04)0.3 ( 0.05)0 ( 0)0 ( 0)% bact - spec6.6/9.92.2/3.816.2/28.76.3/10.33.7/7.83.4/5.50.3/0.83.8/7.74.2/4.8average % se ( n = 3 ) \n bacteria - specific fa and last row is average % bacteria specific fa ( bact - spec ) with / without inclusion of 16:17cfig . 4multidimensional scaling ( mds ) plot showing similarity in fatty acid composition profiles of six sponge species ( sp16 ) , crustose coralline algae ( cca ) and the mucus of two coral species , montastraea annularis and madracis mirabilis , at reef site b1 ( see table 4 for list of fatty acids ) carbon and nitrogen isotopes of six sponge species ( sp1sp6 ) and putative organic matter sources for sponges at reef site b1 . the average and standard error for sp1 ( n = 3 ) and sp6 ( n = 2 ) , gfc - spm ( n = 3 ) , gff - spm ( n = 3 ) is presented . other data points ( sp2 , 3 , 4 , and 5 , cca and mucus from two coral species , montastraea annularis ( mu1 ) and madracis mirabilis ( mu2 ) do not have replicates other than repetitive sample analysis of the same specimen ) . see also tables 1 , 2 \n fatty acid composition of six sponge species ( sp1sp6 , see table 1 ) , one crustose coralline alga ( cca ) and mucus ( mu ) from two coral species ( see table 2 ) , all collected from reef site b1 average % se ( n = 3 ) \n bacteria - specific fa and last row is average % bacteria specific fa ( bact - spec ) with / without inclusion of 16:17c multidimensional scaling ( mds ) plot showing similarity in fatty acid composition profiles of six sponge species ( sp16 ) , crustose coralline algae ( cca ) and the mucus of two coral species , montastraea annularis and madracis mirabilis , at reef site b1 ( see table 4 for list of fatty acids ) for these three distinguished sponge groups at b1 , we also ran the isotope mixing model ( table 5 ) . the first group appears to rely mainly on reef - derived sources ( mucus and cca , mode and mean both > 75% ) . the second group probably relied less on mucus and more on cca and used more plankton - derived food compared with group 1 . ruetzleri only ) consists for about 51% ( mean ) of reef - derived and 49% ( mean ) of suspended matter ( plankton ) derived food . group 1 has a smaller centroid euclidean distance ( 23.64 ) to the average mucus mixture than groups 2 and 3 ( 32.43 and 24.55 ) in fig . this concurs with a larger contribution of mucus ( 66% ) to the diet of group 1 than that of the other two groups ( 36 and 33% ) ( fig . 4 ; table 5 ) . the lower contribution of cca in the diet of group 1 ( 10% mode ) compared to group 3 ( 19% mode ) was also reflected in fig . 4 . we did not find this for group 2 , which had the longest euclidean distance to cca ( 41.81 vs. 33.78 of group 3 and 37.37 of group 1 ) , while cca - derived food comprised 22% in the diet of this group . to further explore the relation between the stable isotope and fa data sets , we compared the matrices of fas and dual isotope signatures of sponges and reef resources ( figs . 3 , 4 ) and found a significant correlation between the two matrices ( primer , rho = 0.625 , p = < 0.01).table 5results of dual isotope mixing model analyses for different sponge groups at b1sourceslow 95%high 95%modemeanmode%mean%(a ) diet of group 1 \n\n h. caerulea , c. caribensis , c. erecta ( sp1 , sp3 , sp4)gfc ro00.2840.0360.117gff ro00.2440.0360.1047.222.1cca00.2860.0950.132mucmix0.5040.7960.6580.64775.377.9(b ) diet of group 2 \n\n c. raraechelae , d. anchorata ( sp2 , sp5)gfc ro00.4320.1670.216gff ro00.430.2020.20836.942.4cca00.4510.2190.219mucmix0.0770.6060.3570.35757.657.6(c ) diet of group 3 \n\n s. ruetzleri ( sp6)gfc ro0.0030.4870.2920.259gff ro00.4530.2850.23257.749.1cca00.4210.1880.207mucmix0.0230.5160.3270.30251.550.9 for further explanation , see table 3 \n results of dual isotope mixing model analyses for different sponge groups at b1 for further explanation , see table 3 \n", "cryptic encrusting sponges living in coral cavities on the fore - reef slope of fringing reefs sequester most of their organic matter from the passing water . they efficiently filter the pico- and nanoplankton , but dissolved organic matter ( dom ) appears to be the major resource of various sponge species living on the open reef and in coral cavities ( yahel et al . 2003 ; de goeij et al . . it may be dom released from phytoplankton , dom supplied to the reef from outside or dom released from the reef benthos . gradients in dom concentrations over the reef suggest that there is a net release of dom from coral reef waters to adjacent open waters ( van duyl and gast 2001 ) . only 1020% of the dom in reef water appears to be available for sponges ( de goeij et al . 2008a ) . by analyses of dual stable isotope signatures ( corg and n ) and fa patterns of sponges and their potential food sources , we obtained circumstantial evidence that the reef itself mainly feeds her cavity sponges . this remarkable finding implies that cryptic sponges support reef internal nutrient recycling and conservation of reef organic matter . it was surprising that none of the 12 sponge species examined appeared to live mainly on suspended particulate organic matter or dom derived from this source . the corg values of the spm fractions were in the range reported for marine suspended matter ( peterson and fry 1987 ) . bacterioplankton values were within 2 of spm in open water , which indicates that bacteria were the primary consumers of spm . this makes it highly likely that spm represents predominantly phytoplankton and that the bacterioplankton reflects the c isotope ratio of reactive dom released by phytoplankton ( e.g. , harvey et al . the c of spm did not change during passage over the reef , for instance by obtaining a typical c spm reef signal ( 17 to 20 : land et al . the n of spm did not change either and remained ~4. moreover , at two of the four stations ( ct and b1 ) comparable corg values of predominantly heterotrophic bacterioplankton ( 26 , 27 , table 2 ) between open water and reef bottom water suggest that this bacterioplankton remained dependent on phytoplankton doc . such low c values have been reported , for e.g. , synechococcus ( c 33 to 25 , brutemark et al . 2009 ) and prochlorococcus , both abundant in reef and open water along curaao ( van duyl et al . 2002 ) . residence time of the spm and bacterioplankton in reef overlying waters may have been too short for changes in isotopic ratios either due to rapid water exchange with the open water and/or due to spm removal by benthic suspension feeders . phytoplankton concentrations in reef surrounding waters in curaao are usually low ( van duyl et al . 2002 ) , and the organic matter demand of cryptic biota , cryptic sponges in particular , is high . cavity biota between 10 and 15 m depth on the fore - reef slope in curaao consume on average 350 mmol c m d of which cavity sponges consume on average 256 mmol c md ( 73% ) with the doc fraction comprising > 90% of the diet ( de goeij et al . this organic matter supply is orders of magnitude higher than the supply of pelagic primary production to reefs ( richter et al . it is evident that the supply of open water - derived phytoplankton and its dom release is insufficient to satisfy the total organic carbon requirements of coral reef cavity sponges . in accordance , the isotope mixing model results confirmed a spm contribution of less than < 50% in the diet of most sponges . this implies that the examined sponges with average corg of 18.9 and n of 4.6 mainly assimilate other sources than pelagic primary production . presence of distinct reactive dom in reef bottom water compared to open water was demonstrated by the increased c value of bacterioplankton at two of the four stations ( ljt and sb ) . bacterioplankton apparently assimilated a source of carbon not available in the open water , a source , which may also be available to the dom feeding cavity sponges . benthic primary producers usually have higher corg values than pelagic primary producers ( france 1995 ; fry 2006 ) . thus , assimilation of benthic algae - derived reactive doc may explain the elevated c values in bacterioplankton in reef bottom water at ljt and sb . bacteria respond quickly when exposed to changing resources in the vicinity of the reef bottom . enhanced bacterioplankton production in reef bottom waters , cavity waters , and coral mucus point to the reef bottom as the source of inorganic nutrients and reactive dom ( van duyl and gast 2001 ; scheffers et al . however , the c reef signal of bacterioplankton ( 17.9 to 15.4 ) was higher than that of most examined sponges ( 20.8 to 17.2 ) suggesting that sponges and bacterioplankton may not fully depend on the same source of reef - derived dom . sponges may exploit a wider size range of the operationally defined dom fraction than bacterioplankton ( de goeij et al . benthic primary producers such as corals and benthic macroalgae have been reported to release reactive dom ( e.g. , crossland 1983 , 1987 ; wild et al . the c values of the benthic substrates ( coral mucus of two dominant coral species and crustose coralline algae ) were on average higher in c than the spm and open water bacterioplankton and were more in range of the sponge stable isotope signals . the n values of reef - derived substrates with values 34 lower than those of sponges on average suggest a direct trophic link ( one trophic level distance ) . the lower n values of reef substrates versus open water substrates may be due to enhanced n2 fixation by the reef benthos ( davey et al . discharge from land or pollution may counteract this effect by introducing organic and inorganic n enriched in n. this may partly explain the variations in n in mucus , coralline algae , and sponges between different stations . the range of corg in crustose coralline algae ( cca ) of 25.2 to 12.1 was unexpectedly large , possibly due to the unique ontogeny of cca . younger portions of the cca may have lower corg values than older portions possibly because rapid photosynthesis in younger parts depends more on respired co2 than photosynthesis in older parts ( lee and carpenter 2001 ) . anyway , the lower range of corg values of cca was within 2 of our sponges . moreover , the n of cca ( 1.34.0 ) make it a likely food source for the majority of cavity sponges with 34 higher n values than the cca . little is known of exudation of organic matter by cca apart from the releases of allelochemicals ( e.g. , kim et al . total dom release by cca has not been determined as far as we know , but their productivity equals that of fleshy macroalgae and turf algae on reefs ( chrisholm 2003 ) . reported c values of 18.7 to 16.8 for dictyota sp.,19.3 for halimeda sp . ( raz - guzman macbeth and de la lanza espina 1991 ; lepoint et al . 2000 ) , and n values of 0.53 of macroalgae on coral reefs ( yamamuro et al . 1995 ; france et al . 1998 ) fall in the same range as cca ( corg 25.2 to 12.1 , n 1.34 ) . therefore , dom released from these brown and green macroalgae may have also contributed to the isotope signal in sponges . trophic transfers of organic matter derived from benthic macroalgae and mangroves , to sponges have been reported before ( behringer and butler iv 2006 ; granek et al . 2009 ) and appear to be important in the nutrition of sponges . unlike cca , coral mucus has already been described as an important food source on coral reefs ( wild et al . 1980 ; wild et al . 2004 ) and may be a suitable source of dom for cavity sponges . the c of the mucus samples of montastraea annularis and madracis mirabilis ( range 17.9 to 14.2 ) is higher than that of most cavity sponges , implying that sponges do not feed exclusively on mucus or mucus - derived dom . coral - derived organic matter is a reactive substrate for bacterioplankton growth ( ferrier - pags et al . 2000 ) and may have contributed to the c reef signal of bacterioplankton at ljt ( 15.4 ) . the average n of mucus ( 1.9 ) and that of cavity sponges ( 4.6 ) are consistent with mucus / mucus - derived dom as a food source for most cavity sponges . it is evident that individually , neither phytoplankton , bacterioplankton , cca ( benthic macroalgae ) nor coral mucus can account for the sponge dual isotope signatures . the isotope mixing model analysis showed that cavity sponges incorporate from half to three quarters of their organic matter from mucus and cca ( benthic macroalgae ) with mucus as the dominant source of reef - derived organic matter ( up to 66% of the diet ) . it appears that with decreasing coral cover the contribution of coral mucus to the diet of sponges decreases and shifts to a larger contribution of cca ( benthic macroalgae ) and phytoplankton . at station ct with a lower coral cover than at the other reef stations , mucus only contributed 17% ( mode ) to the diet of sponges while the bulk food was provided by cca including other benthic macroalgae ( 31% ) and small phytoplankton ( 34% , gff fraction ) . this was different at b1 , where coral cover on the slope is relatively high ( van duyl 1985 ; bak and nieuwland 1995 ) and the sponges reflect a diet of mainly mucus ( 60% , mode ) with 13% cca . this suggests that the sponge community is opportunistic and consumes om according to availability irrespective of the dom source . this does not imply that all examined sponge species at a particular reef site have similar diets . this is further corroborated with our fa profiles of sponges at b1 . the overall similarity in fa composition pattern of the three groups within these six sponge species ( based on significantly different fa compositions ) also had different diets according to the isotope mixing model analysis , implying differences in the proportional use of mucus , benthic algae ( including cca ) , and phytoplankton - derived dom . this suggests that there is trophic niche segregation among sponges which may be an important factor facilitating co - existence of different sponge species ( thurber 2007 ) . furthermore , the differences in diet may to some extent be reflected in the fa compositions of sponge groups suggesting that the selected food resources may indeed form part of the diet of sponges . the fatty acid profiles of our coral mucus and cca sources resemble those reported for coral tissue and cca ( e.g. , latyshev et al . 1991 ; although many dominant fas such as 14:0 , 16:0 , and 18:0 ( table 2 ) are common to many organisms , some fas have been identified as potential tracer of food source in sponges . for this study area specifically , for example , de goeij et al . ( 2008b ) conclude from isotope tracer experiments that the dominant fa 20:46 found in the sponge halisarca caerulea has an exogenous source . interestingly , 20:46 is found dominant in all 6 sponge species examined and it is also dominant in cca and m. mirabilis mucus . the high cover of cca in cavities ( 30% of the hard bottom surface in cavities , scheffers et al . 2004 ) , its close proximity to cavity sponges and the fact that cca was rich in 20:46 , may have contributed to the 20:46 content in sponges . in sponge groups 2 and 3 , this fa was the second most abundant ( > 10% of total fas ) and the diet of these sponge groups consisted for 1922% ( mode ) of cca ( including other macroalgae ) . in sponge group 1 , the predominantly mucus feeding group , 20:46 was the third most abundant fa with a lower relative abundance than in the other groups ( < 10% ) . this coincided with a lower contribution of cca in their diet ( 10% mode ) . trophic transfer of this fa may be directly linked to the consumption of cca as part of macroalgal - derived organic matter . phytanic acid , which can be considered as a sponge biomarker ( de goeij et al . 2008b ) was the second most abundant fa in group 1 . for its synthesis , degradation products of chlorophyll a are required , possibly delivered to the sponge by sponge associated phototrophic microbes , considering the relatively high amount of the likely bacterial specific fa 16:17c as well as the overall high % of bacteria specific fas in group 1 ( up to 29% compared with up to 10% of total fas in the other groups , table 4 ) . sponge species in group 1 indeed harbor - rich microbial communities ( hill et al . 2005 ; erwin and thacker 2007 ) . mutualism between sponges and their associated microorganisms may have influenced the diet of group 1 compared with groups 2 and 3 . weisz et al . ( 2007 ) show that sponges with high versus low abundances of associated microbes may have distinct diets . in line , we show that the diet of sponges ( based on stable isotopes as well as fas ) varies with abundance of bacteria specific fas . interestingly , sponges with a relatively high abundance of associated microbes ( group 1 ) appear to be more dependent on reef - derived food than other sponges . the fa 20:53 , a dominant fa in ( benthic ) diatoms and the mucus of corals , particularly in mucus of m. annularis was most abundant in s. ruetzleri ( group 3 ) . the siar model analysis showed that the contribution of phytoplankton - derived food was highest in this sponge ( mean 49% and mode 57% , both plankton size fractions together ) , which may suggest that it feeds on diatoms or diatom - derived om rich in 20:53 . the other sponge groups ( 1 and 2 ) may obtain 20:53 predominantly by consuming mucus considering the higher contribution of mucus and lower plankton - derived food in the diet of these groups than in the diet of s. ruetzleri ( group 3 ) . diatom - derived om as well as mucus may have contributed to the abundance of 20:53 in sponges . considering the congruencies between the fa compositions and the dual stable isotope signals in the trophic transfer and relations between sources and consumers , it was not surprising that the matrices ( based on euclidean distances ) of the reef sources and consumers of both approaches were significantly correlated . both methods apparently lead to comparable results with fa composition and biomarkers identifying the food items of consumers , and evidencing trophic transfer and with dual stable isotope analyses estimating the contribution of the different sources to the diet of consumers . results of both methods strongly support a trophic transfer from zooxanthellate corals and cca to cavity sponges . the quantitative contribution of cca to the diet of sponges remains unresolved , because its dual isotope signal overlaps with that of other benthic macroalgae .", "results unambiguously point to the reef benthos as the main source of organic matter for encrusting cavity sponges on coral reefs . the contribution of open water - derived organic matter as food for the cavity sponge community was usually less than 50% . food sources for sponges on the reef comprise dom derived from coral mucus and benthic macroalgae ( cca ) . the prominent presence of a characteristic fatty acid of coral mucus and cca , 20:46 in sponges further confirms this trophic transfer . ( 2008b , 2009 ) found that the cavity sponge halisarca caerulea converts assimilated dom in sponge biomass and detrital material . combining this with the knowledge that ( 1 ) the cover of cavity sponges is high on fore - reef slopes ( scheffers et al . 2004 ) , ( 2 ) dom assimilation by cavity sponges is high ( de goeij et al . 2008a ) , and ( 3 ) most of the om assimilated by sponges is reef - derived ( this study ) , we argue that cryptic sponges play a key role in conserving reef - produced dom for the reef system by converting it into pom . whether the cryptic sponge link in the coral reef food web is favorable for the coral reef health status remains to be investigated ." ]

[ "the asialoglycoprotein receptor ( asgpr ) ( also known as the ashwell receptor ) mediates the capture and endocytosis of galactose- ( gal ) and n - acetylgalactosamine- ( galnac ) terminating glycoproteins . the relevance of this function has been the subject of much debate ; the primary role may be the removal of potentially hazardous glycoconjugates arising from normal tissue turnover , tissue injury , disease , and other causes . studies using knock - out mice have provided evidence for direct involvement of the asgpr in removal of abnormally sialylated plasma glycoproteins . mice lacking the sialyltransferase st3gal4 showed prolonged bleeding which was attributed to asgpr - mediated clearance of at least one plasma hemostatic component , von willebrand factor ( vwf ) , that showed decreased sialylation . findings in mice lacking the asgpr demonstrated that , during sepsis , the receptor removed components of hemostasis ( vwf and platelets ) that had been desialylated by bacterial neuraminidase and thereby allowed hemostatic adaptation that moderated disseminated intravascular coagulation and improved host survival . the asgpr may therefore be poised for rapid clearance of plasma glycoproteins that , for whatever reason , show decreased or abnormal sialylation . the highest level of expression of the asgpr is in the liver , in which it is located on the sinusoidal face of hepatocytes . low - level expression has been shown in various other cell types , such as , peritoneal macrophages in rat , human intestinal epithelial cells , mouse testis , and the rat thyroid gland . the galactosyl homeostasis theory proposes that the balance of both gal and galnac glycoconjugates is important for normal tissue physiology [ 1 , 9 ] ; whether or not expression of the asgpr at these other sites represents a need for localized constitutive control of such glycoconjugates is not known . a major area of interest focussing on the asgpr is the targeted gene transfer / delivery of drugs to the liver [ 10 , 11 ] . for example , using galnac as a ligand on a sirna - containing complex , the latter was successfully targeted to hepatocytes after simple intravenous injection into the tail vein in mice . moreover , sirna - mediated knock - down of targeted genes was demonstrated within the hepatocytes . besides its potential importance in allowing liver - specific drug targeting , the asgpr is a key factor in the design and administration of glycoprotein pharmaceuticals more generally : the activity of the receptor can impact upon drug half life and thereby the window of therapeutic efficacy . human asgpr is composed of two types of subunit : a major subunit ( asialoglycoprotein receptor 1 , asgr1 ) and minor subunit ( asialoglycoprotein receptor 2 , asgr2 ) . both subunits are type ii , single pass proteins that broadly comprise a cytoplasmic domain , transmembrane domain , and extracellular carbohydrate recognition domain ( crd ) [ 14 , 15 ] . the subunits may exist as asgr1-asgr2 heterooligomers , asgr1homotrimers and homotetramers , and asgr2 homodimers and homotetramers . these different quaternary forms may allow for functional differences , such as , substrate specificity or rate of endocytosis [ 1 , 16 ] . the genes encoding asgr1 and asgr2 ( asgr1 and asgr2 , resp . ) are located on the short arm of autosome 17 , approximately 58.6 kilobases ( kb ) apart . the genes are evolutionarily related but differ significantly in their structural organization : asgr1 comprises 8 exons and is approximately 6 kb long , asgr2 contains 9 exons occupying 13.5 kb of dna [ 14 , 15 ] . until recently , asgr1 was thought to yield one transcript encoding a single protein . however , in 2010 , liu et al . demonstrated the existence of two alternatively spliced transcripts . the longer transcript , t1 , contains all 8 exons and is by far the more abundant ; it encodes full - length asgr1 ( isoform a , 291 aminoacids ) . the shorter transcript , t2 , has an in - frame deletion of exon 3 resulting in the loss of 39 residues ( isoform b , 252 amino acids ) . asgr2 gives rise to five transcripts ( th2 , t1 , t2 , t3 , and t4 ) encoding four isoforms ( a to d ) that contain different in - frame deletions arising from alternative exon splicing events . isoforms a and c contain 5 aminoacids that serve as a proteolysis cleavage signal near the junction between the transmembrane domain and the crd . cleavage at this site results in secretion of the crd as a soluble protein [ 18 , 19 ] . isoforms b and d lack this signal therefore they are not proteolytically cleaved but rather remain membrane bound where they may oligomerize with asgr1 isoform a to form native asgpr at the cell surface . the secreted forms of asgr1 and asgr2 are able to associate into soluble asgpr [ 17 , 19 ] . there is evidence to suggest that the soluble receptor may bind free substrates in the circulation and carry them to the liver for uptake and degradation . aside from membrane attachment / secretion , it is not known whether further functional variation , such as , substrate specificity , may be associated with the different isoforms of asgr1 and asgr2 . based on the observation above that the asgpr is expressed in rat peritoneal macrophages , it was considered possible that monocytes , the lineage precursor of tissue macrophages , may also express the receptor . to the best of our knowledge , the present study investigated the expression of asgr1 and asgr2 in human peripheral blood monocytes . the data showed that both asgr1 and asgr2 are expressed in human monocytes in the circulation , that expression can not be detected in lymphocytes and granulocytes , that the transcripts of both genes differ between individuals and that , in a given individual , the transcription profile for asgr2 is restricted to one of two patterns . the findings are of potential importance for health and disease in a variety of disciplines .", "genes , transcripts , and proteins are referred to by their formal scientific names as listed in the national centre for biotechnology information ( ncbi ) , which complies with standardized international nomenclature . gene sizes , exon numbering , and so forth were obtained from the reference sequences listed in table 1 . edta - anticoagulated whole blood in excess of that required for routine blood tests was anonymized and handled in accordance with medical research council guidelines . citrate- or edta - anticoagulated whole blood ( 5 ml ) was centrifuged at 200 g for 10 minutes , ambient temperature to prepare platelet - rich plasma ( prp ) . two - thirds of the volume of the prp was carefully removed from above the buffy coat , centrifuged at 1800 g for 10 minutes to pellet the platelets , and then the supernatant plasma returned to the original blood sample . as described above , the blood sample was loaded onto a discontinuous histopaque ( sigma aldrich , dorset , uk ) gradient comprising histopaque 1119 ( 2 ml , lower layer ) and histopaque 1077 ( 3 ml , upper layer ) . following centrifugation at 800 g for 1 h at ambient temperature , the cells at the interface between the plasma and histopaque 1077 ( monocytes and lymphocytes ) were harvested ; the cells at the interface between histopaque 1077 and 1119 ( principally granulocytes with a small proportion of lymphocytes ) were also harvested . harvested cells were washed by resuspension in 10 ml phosphate buffered saline ph 7.2 ( pbs ) followed by centrifugation at 250 g for 10 minutes at ambient temperature . the cell pellet was resuspended in pbs ( 0.7 ml ) and an aliquot ( 0.2 ml ) was diluted 1 : 1 ( v / v ) with pbs and used for determination of cell counts on a pentra 120 ( horiba abx , montpellier , france ) . citrate- or edta - anticoagulated whole blood ( 5 ml ) was depleted of platelets as described above ( separation of white blood cells ) . the blood sample ( 3 ml ) was then loaded onto histopaque 1077 ( 3 ml ) and centrifuged to separate the white blood cells ( wbc ) ( 400 g , 30 min , ambient temperature ) . the wbc interface was harvested , washed , and an aliquot used for determination of cell counts as described above ( separation of white blood cells ) . the remaining cells , suspended in pbs , were separated according to forward scatter and side scatter light characteristics using a moflo high speed cell sorter ( beckman coulter , high wycombe , bucks , uk ) . gating was restrictive rather than permissive : each gate was set only for the core population of cells that had the required scatter characteristics . in particular , the lymphocyte gate was set to minimise the possibility of small monocytes being harvested . purity checks were subsequently performed by reanalysis of aliquots of the sorted cells in the flow cytometer ; purity was typically around 98% . all reagents and consumables for cell culture were supplied by invitrogen life technologies ltd , paisley , ireland . ( human hepatocyte carcinoma ) and thp1 ( human acute monocytic leukemia ) cells were cultured in rpmi1640 medium + l - glutamine , supplemented with 10% ( v / v ) fetal calf serum and containing penicillin ( 50 units / ml ) and streptomycin ( 50 g / ml ) . cells were grown at 37c in water - saturated air ( 95% , v / v ) , co2 ( 5% , v / v ) in 25 cm flasks . hepg2 cells ( adherent cell line ) were liberated from the flask wall mechanically using a plastic scraper and were separated by exposure to shear force . hepg2 has been shown by others to express high levels of the ashwell receptor and was used as a positive control in all relevant experiments . rna was extracted using rneasy kits ( qiagen , west sussex , uk ) according to the manufacturer 's instructions . yield was determined spectrophotometrically and then 1.0 g was reverse transcribed into cdna using random hexamers and the high capacity cdna reverse transcription kit ( life technologies ltd / applied biosystems , paisley , uk ) according to the manufacturer 's instructions . standard polymerase chain reactions ( pcrs ) typically contained approximately 30 ng cdna in a mixture of dntps ( 100 mol / l each ) , tris - hcl ph8.0 ( 10 mmol / l ) , mgcl2 ( 1.5 mmol / l ) , taq dna polymerase ( 1u ) ( applied biosystems , warwickshire , uk ) , and primers ( figure 1 ) in a final volume of 25 l . all primers were used at 0.5 pcr was done using a 2720 dna thermal cycler ( applied biosystems , warwickshire , uk ) . the primer sequences ( 5 to 3 ) were as follows : asg1rtf gaaagatgaagtcgctagagt asg1rtr aggctccgcaggtcagacac a1cdsf1 gtagcgcgacggccagtactgaagaacctgggaatcagac a1cdsr1 cagggcgcagcgatgacagctcctcaccttcggaacatca a1test2 gaccaaggagtatcaagacctt asg2rtf cacacctggtggtcatcaac asg2rtr aattatctggctgagtgacag asgr2rtf3 agctgagctcggaggaaaatg asgr2rtr2 gcagctcggcttgcagctgtg a2cdsf1 gtagcgcgacggccagtcccagccctcagagcaacctca a2cdsr1 cagggcgcagcgatgactcaacagagaagccagagctggg b2mrtf tccgtggccttagctgtgct b2mrtr ccagtccttgctgaaagaca n13f gtagcgcgacggccagt n13r cagggcgcagcgatgac asg1rtf gaaagatgaagtcgctagagt asg1rtr aggctccgcaggtcagacac a1cdsf1 gtagcgcgacggccagtactgaagaacctgggaatcagac a1cdsr1 cagggcgcagcgatgacagctcctcaccttcggaacatca a1test2 gaccaaggagtatcaagacctt asg2rtf cacacctggtggtcatcaac asg2rtr aattatctggctgagtgacag asgr2rtf3 agctgagctcggaggaaaatg asgr2rtr2 gcagctcggcttgcagctgtg a2cdsf1 gtagcgcgacggccagtcccagccctcagagcaacctca a2cdsr1 cagggcgcagcgatgactcaacagagaagccagagctggg b2mrtf tccgtggccttagctgtgct b2mrtr ccagtccttgctgaaagaca n13f gtagcgcgacggccagt n13r cagggcgcagcgatgac primers were designed for rt - pcr according to the following criteria : ( 1 ) they flanked at least one intron ; ( 2 ) they were specific for asgr1 or asgr2 transcripts , cross hybridization was not possible despite the sequence homology between the coding sequences of the two genes . n13f and n13r are , respectively , modified m13 universal and reverse sequencing primers as previously described . underlined nucleotides are not part of asgr1 or asgr2 sequence but are tails corresponding to n13f or n13r to facilitate sequence analysis . for nested pcr , the first - round product was then diluted 10-fold with water and 1 l of diluent was used as the substrate in the second round of pcr . pcr conditions were as follows : standard pcr : 94c for 30 s ; 60c for 30 s ; 72c for 1 min . nested pcr : 1st round 94c for 30 s ; 60c for 30 s ; 72c for 1 min 30 s. nested pcr : 2nd round 94c for 30 s ; 60c for 30 s ; 72c for 1 min.routinely , 30 cycles of amplification were used ; however , for real time pcr , 55 cycles were employed . standard pcr : 94c for 30 s ; 60c for 30 s ; 72c for 1 min . nested pcr : 1st round 94c for 30 s ; 60c for 30 s ; 72c for 1 min 30 s. nested pcr : 2nd round 94c for 30 s ; 60c for 30 s ; 72c for 1 min . \n asgr1 and asgr2 transcript levels were measured using lightcycler faststart dna master sybr green i ( roche products ltd , hertfordshire , uk ) according to the manufacturer 's instructions , with 3 mmol / l mgcl2 final concentration in the reaction . reactions contained 2 ng cdna per 20 l and relevant primers ( figure 1 ) . analyses were done in duplicate in a lightcycler ii using lightcycler v4.0 software ( perkin elmer - applied biosystems , warwickshire , uk ) using the following conditions : 94c for 10 min followed by 55 cycles comprising 94c for 10 s ; 64c for 5 s ; 72c for 10 s. pcr products were purified using the highpure kit ( boehringer mannheim , nottingham , uk ) and then sequenced using bigdye3.1 according the manufacturer 's instructions ( perkin elmer - applied biosystems , warrington , uk ) . sequencing primers were either the 5 pcr primer , 3 pcr primer , n13f or n13r according to the amplification product . sequencing reaction products were purified using qiaquick pcr purification columns ( qiagen , west sussex , uk ) and then electrophoresed on an applied biosystems 3130xl genetic analyser . agarose gel electrophoresis : the analyses used 2% ( w / v ) gels and 1x tbe buffer ( tris ( 90 mmol / l ) , boric acid ( 90 mmol / l ) , edta ( 1.25 mmol / l ) , ph 8.0 ) ; visualization was done using ethidium bromide staining and uv light . polyacrylamide gel electrophoresis : gels comprised polyacrylamide ( total acrylamide = 5% , w / v ; cross link = 3.3% , w / v ) and 1x tbe buffer , visualization was done using silver staining . the dna size standard pbr322/mspi ( new england biolabs , hertfordshire , uk ) was used for all electrophoretic analyses .", "initially , peripheral blood mononuclear cells ( pbmcs ) were harvested and screened for asgr1 and asgr2 expression without fractionation into monocytes / lymphocytes / granulocytes . rt - pcr of rna extracted from pbmcs demonstrated the presence of both asgr1 and asgr2 transcripts ( figure 2(a ) ) . these were also detected in the monocyte cell line thp1 ( figure 2(a ) ) . following these initial findings , pbmcs were fractionated in order to localize the cells in which asgr1 and asgr2 expression was present . histopaque gradients allowed separation of cells into monocytes + lymphocytes ( m + l ) and granulocytes + lymphocytes ( g + l ) . these cell preparations typically contained 10% monocytes/90% lymphocytes ( m + l ) and 94% granulocytes/10% lymphocytes ( g + l ) ( data not shown ) . using rt - pcr , asgr1 and asgr2 transcripts were detected in rna from the m + l fraction but not in rna from the g + l fraction ( figure 2(b ) ) . these findings were reproducible for blood samples taken from 3 different individuals ( data not shown ) . the g + l fraction did not yield a product for the transcripts even after 50 cycles of rt - pcr amplification ( figure 2(b ) ) . some nonspecific products were obtained as a result of this high number of cycles ; however , these did not interfere with the main result of the experiment ( figure 2(b ) ) . because lymphocytes were common to both cell fractions , and because the g + l fraction was reproducibly negative for asgr1 and asgr2 transcripts , the data suggested that expression of the two genes was localized to monocytes . to confirm this , monocytes and lymphocytes were formally cell sorted using flow cytometry , rna extracted and screened using rt - pcr . monocytes gave a positive result for both asgr1 and asgr2 transcripts , whilst lymphocytes did not give a pcr product , even after 50 cycles of amplification ( figure 2(c ) ) . this high cycle number resulted in the burst - through of some nonspecific products ; however , these did not interfere with the interpretation ( figure 2(c ) ) . these data provide strong evidence for expression of asgr1 and asgr2 in monocytes but not in lymphocytes or granulocytes . the longer transcript ( t1 ) encodes isoform a ( full - length asgr1 ) , the shorter transcript ( t2 ) has an in - frame deletion of 117 nucleotides in the coding sequence resulting in a shorter isoform ( isoform b ) ( figure 1(a ) ) . the latter lacks the transmembrane domain and is secreted as a soluble protein . in the liver , t1 has been shown to be the predominant isoform , with very little t2 detectable . using a nested pcr approach to screen rna from the m + l cell fraction of peripheral blood , different individuals showed the presence of either t1 or of both t1 and t2 ( figure 3 ) . among the five individuals screened , none showed the presence of transcript t2 on its own . in combination with the data in figure 2 ( which showed that asgr1 transcripts are detected in monocytes and not lymphocytes ) , these data suggest that the monocyte transcription profile for asgr1 differs between individuals . five transcripts have been described for asgr2 , giving rise to four protein isoforms ( figure 1(b ) ) . using a rt - pcr designed to detect transcripts encoding different isoforms , the product profiles obtained for rna extracted from the histopaque m+l cell fraction differed among individuals . two distinct profiles were obtained , the first corresponded to transcripts encoding isoforms a , b , c , and d , the second to transcripts encoding isoforms b and d only ( figure 4 ) . asgr2 isoforms a and c can give rise to soluble protein via proteolysis between the transmembrane domain and the crd . isoforms b and d lack the proteolysis site and can not produce the soluble form . the data therefore indicate that in some individuals , monocytes may produce both soluble and membrane - bound asgr2 , whilst in others , the soluble form is not produced by these cells . real - time pcr was optimized for primer pairs asg1rtf + asg1rtr , asg2rtf + asg2rtr ( which , respectively , amplify all asgr1 and all asgr2 transcripts ) and b2mrtf + b2mrtr ( which amplify the reference target gene , b2 m ) . for each primer pair , a specific product was obtained that had a characteristic melting curve ( figure 5 ) . following pcr optimization , transcripts were measured using relative quantification , in which the target was asgr1 or asgr2 , the reference was b2 m , the calibrator was hepg2 , and the unknown was flow sorted monocytes or thp1 . b2 m is a recommended reference target for quantitative pcr , having the advantages of a single transcript , no processed pseudogene and expression at similar levels in a wide range of tissues . flow - sorted monocytes and thp1 cells gave similar results : relative to expression in hepg2 , asgr1 transcripts were between 1.53e-07 to 7.53e-06-fold less , whilst asgr2 transcripts were between 7.16e-05 and 3.78e-04-fold less . figure 5 illustrates relative quantification of asgr1 and asgr2 transcripts in cell - sorted monocytes . the ratio of expression of asgr1 : asgr2 in monocytes and the monocyte cell line thp1 was approximately 1 : 100 . to ascertain whether thp1 would be a suitable cell line for future asgpr studies in monocytes , the coding sequences of the asgr1 and asgr2 transcripts produced by these cells were determined . a nested pcr strategy was used as follows : the first round of synthesis amplified the entire coding sequence plus some 5 and 3 flanking sequence and then second round pcrs amplified nested portions within the first round product . one of the nested portions contained the region that differed between transcripts and gave products of different size according to the transcript . these products were electrophoresed , excised from the gel , reamplified individually , and then sequenced , to give the sequence of each of the coding regions that differed between transcripts . thp1 asgr1 and asgr2 transcripts corresponded with previously described splice variants found in the liver ( data not shown ) . the findings demonstrate that thp1 cells have the capacity to transcribe and process correctly , transcripts encoding functional isoforms of the asgpr . taken together with the results in figures 3 and 4 , the data provide evidence that monocytes express correctly processed transcripts from both asgr1 and asgr2 and thereby have the potential to produce functional asgpr . the coding sequence for asgr1 in thp1 differed from the ncbi reference sequence ( table 1 ) by a single nucleotide : c.267g > a , for which the monocyte cell line was homozygous ( data not shown ) . this change is silent at the protein level ( codon 89 , aag , changes to aaa , both encoding lysine ) . the change is a naturally occurring variant ( rs55714927 ) listed in the international snp database ( dbsnp ) . the thp1 asgr2 coding sequence for any transcript did not differ to the corresponding ncbi reference sequence ( table 1 ) ( data not shown ) .", "in this study , expression of asgr1 and asgr2 was demonstrated in peripheral blood monocytes . for both genes , transcript profiles were obtained that corresponded with known splice variants found in the liver . to the best of our knowledge , this is the first report of the expression of correctly processed transcripts of asgr1 and asgr2 by human monocytes . in rat , a transcript encoding an asialoglycoprotein - binding protein was isolated from a peritoneal macrophage cdna library and was highly homologous to that of the rodent hepatic asgpr . the data were interpreted to indicate that the rodent macrophage asialoglycoprotein - binding protein and the liver asgpr were encoded by related genes ; however , it now seems possible that alternative splicing may underlie the differences . the findings of the present study do not suggest expression of alternative asgpr - related genes in monocytes , rather they are entirely consistent with transcription of asgr1 and asgr2 , as occurs in the liver . the various transcripts of asgr1 and asgr2 encode different isoforms of the proteins ( figure 1 ) . it is not known whether the isoforms differ in their specificity or functionality , however it is predicted that certain isoforms have the potential to give rise to soluble forms of each protein . asgr1 transcript t2 has an in - frame deletion of 117 bp that encode the transmembrane domain ; the resulting isoform , th2 and t3 encode isoforms a ( t1 and th2 ' ) and c ( t3 ) which contain a proteolysis signal that , upon cleavage , gives rise to soluble protein . transcripts t2 and t4 , respectively , encode isoforms b and d which lack the proteolysis signal and are membrane bound . the data presented here indicate that monocytes are able to express transcripts encoding soluble and membrane - bound isoforms of the asgpr proteins . asgr2 was found to give rise to two transcript profiles , only one of which was present in the monocytes from any given individual . one profile corresponded with transcripts encoding both soluble and membrane - bound asgr2 isoforms ( a , b , c , and d ) , the other with membrane - bound asgr2 isoforms ( b and d ) only . this novel finding indicates a fundamental difference between individuals . the underlying basis for this and whether or not it has physiologic significance in health or disease merit further exploration . the level of asgr1 and asgr2 expression was considerably less in monocytes and the monocyte cell line thp1 compared with the liver cell line hepg2 . it should be borne in mind that hepg2 expresses high levels of the receptor and the monocyte expression was relative to this . that monocyte transcripts were not rare within the cells was indicated by the fact that they were readily detected using rt - pcr at routine cycle numbers . low level of expression of the asgpr has been reported previously in certain nonhepatic tissues ( rat macrophages , human intestinal epithelial cells , mouse testis , and rat thyroid gland ) . it would be relevant to explore whether asgr1 and asgr2 transcription alters upon monocyte activation . the relative expression of asgr1 and asgr2 in monocytes and thp1 ( 1 : 100 ) differed notably from ratios reported in liver ( 1 : 2 and 1 : 6 ) . the difference may be real , or it may reflect differences in methodology between studies or possibly a difference in the amplification efficiency of the primer pair used for asgr1 compared with that used for asgr2 . the true relative expression of the two genes by monocytes therefore remains to be established . an important question arising from these results is whether monocytes translate asgr1 and asgr2 transcripts and produce functional asgpr . the restricted expression of the genes in monocytes , but not in lymphocytes or granulocytes , suggests the transcripts are not produced randomly but specifically . based on the fundamental principles of biology , this is likely to be for translation , it is difficult to think why else different transcripts encoding different isoforms may be produced by one specific cell type in the blood . the restricted tissue specificity for asgpr expression in the body , and the lower expression level observed at the nonhepatic locations , could signal a specific role or function at those sites . in the case of monocytes , the receptor could , at the very least , serve a scavenger function where there is infection or tissue injury . expression of correctly processed transcripts of asgr1 and asgr2 by circulating monocytes has potentially significant implications in several important areas . if monocytes express functional asgpr , they may contribute towards the normal physiological processes undertaken by the hepatocyte receptor . whilst hepatocyte asgpr is localized to the liver and relies upon the circulation to deliver ligands to it , the monocyte receptor would represent a mobile pool that can reach ligands in most parts of the body . monocyte asgpr may additionally interact with ligands in the blood , as does liver asgpr . thus , the monocyte receptor , if it is produced , may overlap functionally with that of the liver but may have additional physiological roles elsewhere in the body . hepatic asgpr has been shown to be directly involved in the normal turnover of an important protein of primary hemostasis , vwf . studies in knock - out mice indicated that the asgpr is engaged in the constitutive control of vwf level and can , additionally , remove hemostatic components ( vwf and platelets ) desialylated by bacterial neuraminidase , a possible survival mechanism in disseminated intravascular coagulation . the results in these studies were ascribed to the activity of the liver receptor ; however , our data raise the possibility that monocytes may contribute to the relevant physiological processes via the asgpr . the findings have implications for the design of drugs targeting the liver via the asgpr and drugs that are cleared by this receptor [ 29 , 30 ] . various strategies have been used , for example , conjugation of drug with galactosyl terminating molecules , as has been done with antiviral nucleoside analogues in the treatment of chronic viral hepatitis . besides drug targeting , strategies to deliver genes or other nucleic acids to the liver have also made use of the asgpr [ 1012 ] . relatively recently , successful in vivo delivery of sirnas to the liver in mice has been achieved via simple intravenous injection employing asgpr - specific conjugates containing galnac . pharmacological targeting of the asgpr could not be considered to be predominantly liver - specific if monocytes express the receptor .", "\n asgr1 and asgr2 are expressed in peripheral blood monocytes in humans . for both genes , monocytes have the ability to produce correctly spliced transcripts encoding each of the known protein isoforms . however , there are interindividual differences in the transcript profiles ; of particular note , despite several possible asgr2 transcripts , just two combinations were found to occur . this observation indicates that , in any given individual , asgr2 mrna splicing is restricted to one of two profiles . quantitative studies indicate that expression of both asgr1 and asgr2 is lower in monocytes than in the liver , but none - the - less is readily detected in monocytes ( in comparison to other blood cells in which expression could not be demonstrated ) . the liver may represent a static site to which blood carries glycoconjugates for asgpr - mediated removal , whilst monocytes may represent a mobile pool that can reach sites where the activity of the receptor is needed . the data presented here open various important avenues for future research , a notable one of which is the measurement and characterization of monocyte asgpr protein . the results for the cell line thp1 indicated it could be used as a model system for the investigation of monocyte aspgr function and activity . monocytes play a pivotal role in inflammation and immunity , the finding of asgpr transcripts within these cells offers new insight into their biochemistry and functional potential ." ]

[ "the prevalence of obesity in the united states has increased over the past several decades . according to the national health and nutrition examination survey ( nhanes ) results , between the years of 1988 and 1994 , 22.9% of adults aged 20 years and older exceeded the criteria for adult obesity [ body mass index ( bmi ) 30 kgm ] ( 17 ) . by the 20112012 survey , that percentage had increased to 35.1% ( 19 ) . this represents more than a 50% increase in obesity prevalence among american adults aged 20 years and older over the course of two decades . perhaps more concerning is the prevalence of obesity among american youth , defined by the centers for disease control and prevention ( cdc ) as a bmi greater than or equal to the 95 percentile on the cdc growth charts ( 2 ) . among children and adolescents aged 2 19 years , the prevalence of obesity increased from 5.5% between the years of 1976 and 1980 to 16.9% between 2007 and 2008 ( 18 ) and remained 16.9% between 2011 and 2012 ( 19 ) . analyses of several large - scale data pools confirm that obesity contributes to the risk for development of many negative health outcomes including coronary heart disease , hypertriglyceridemia , hypercholesterolemia , hypertension , and type ii diabetes ( 20 , 23 ) . using secondary data , thompson and colleagues developed a model to analyze the relationship between bmi and several disease conditions in adults ( 23 ) . notably , they found that the risks for hypertension and type ii diabetes are at least 2- and 3-fold higher for obese individuals with bmi values of 32.5 kgm and 37.5 kgm , respectively , as compared to normal - weight individuals with bmi values of 22.5 kgm . obesity - related health risks are not limited to adults . according to an analysis of bogalusa heart study data , the odds ratios between childhood obesity and many cardiovascular disease risk factors , including hypercholesterolemia , hypertriglyceridemia , hyperinsulinemia , and hypertension are between 2.4 and 12.6 , indicating a strong , positive association between childhood obesity and these specific risk factors ( 8) . finkelstein and colleagues estimated that in 2006 , the annual per capita medical expenditure for an obese person was $ 1,429 ( adjusted to reflect 2008 dollars ) higher than for a person of normal weight , which represents 42% higher medical costs for obese individuals compared to individuals with normal body weights ( 5 ) . data from over 3,000 counties and county equivalents across the united states indicate that in 2006 , approximately 54 million individuals met the criteria for obesity ( 16 ) . this equates to an extra $ 77 billion ( adjusted to reflect 2008 dollars ) in medical spending attributable to obesity in 2006 alone . beginning in the 2013 2014 school year , the president s council on fitness , sports & nutrition adopted the presidential youth fitness program to replace the president s challenge physical fitness test ( 22 ) . this program aims to encourage healthy , active lifestyles among youth . as part of this program , schools use the presidential youth fitness program s fitnessgram to assess health - related fitness and use these data to inform physical education instruction . the fitnessgram scientific advisory board has developed four categories for classification of body composition : very lean , healthy fitness zone ( hfz ) , needs improvement some risk ( ni sr ) , and needs improvement high risk ( ni hr ) . risk level was established based on body fat percentage , and body fat cutoff percentages were converted to corresponding bmi values . for ten - year olds , the ni hr category includes boys with a bmi 20.8 kgm and girls with a bmi 21.0 kgm ( 12 , 13 , 15 ) . these bmi cutoff values are lower than those utilized by the cdc , which defines childhood obesity as having a bmi at or above the 95 percentile on sex - specific bmi - for - age growth charts ( 2 ) . the corresponding bmi values that the cdc uses to indicate obesity are 22.03 kgm for boys aged 10.00 10.49 years , 24.16 kgm for boys aged 10.50 10.99 years , 23.18 kgm for girls aged 10.00 10.49 years , and 23.35 kgm for girls aged 10.50 10.99 years ( 11 ) . thus , using the cdc childhood obesity estimates could result in a substantial underestimation of the number of children at risk for negative health outcomes based upon bmi . children identified as obese by bmi have an increased risk of developing health complications that were previously thought to be limited to adults such as hypertension and type ii diabetes mellitus ( 3 ) . these conditions are also well - known risk factors for the development of cardiovascular disease . obese children aged ten years and older are likely to remain obese into early adulthood ( 28 ) , and therefore , accrue medical costs associated with obesity - related conditions . knowledge of the medical costs associated with childhood obesity can provide a basis by which to justify the cost of childhood obesity prevention and treatment efforts . to this end , finkelstein and colleagues analyzed the lifetime direct medical costs for an obese ten - year - old beyond the costs that a ten - year - old at a normal body weight would incur over his or her lifespan ( 7 ) . the six investigations included in the meta - analysis each estimated longevity using a variety of factors such as probability of survival based on weight status ( 6 ) , gender , and race ( 4 , 14 , 2325 , 27 ) . based upon this meta - analysis , two low- and high - end cost estimates were provided : one that accounted for adulthood weight gain among normal - weight children and one that compared against children who remained at normal weight through adulthood . results suggested that an obese ten - year - old , typically in the fifth grade , will incur between $ 12,660 ( low - end ; recommended ) and $ 19,630 ( high - end ) of incremental direct medical costs when accounting for weight gain through adulthood and between $ 16,310 ( low - end ) and $ 19,350 ( high - end ) with a recommended cost estimate of $ 19,000 when contrasted with a child who remains at normal weight throughout adulthood ( 4 , 7 , 14 , 23 , 24 , 27 ) . using these recommended estimates along with results from the fitnessgram body composition classifications , the purpose of this analysis is to estimate the lifetime economic impact of childhood obesity for this single age cohort in the two most populous states , california and texas .", "fitnessgram data from the school years 20102011 , 20112012 , and 20122013 were obtained for california ( 1 ) and texas ( 21 ) . these data were school - level and included boys and girls from all public school districts in these two states . the total number of fifth grade students tested for bmi in california and in texas and the number of fifth grade students in each bmi category were calculated for each of the three school years . the fitnessgram scientific advisory board has determined that bmi values at or above 20.8 kgm for ten - year - old boys and 21.0 kgm for ten - year - old girls represent high health risk ( 15 ) . the california report included the total number of fifth graders tested for body composition as well as the number and percentage of students in each fitness zone . the texas report included data for each grade level and further separated the data by district and gender . the total number of fifth graders tested for body composition and the number and percentage of students in each fitness zone were calculated using excel . then , using the low , high , and recommended cost estimates suggested by finkelstein and colleagues ( 7 ) , the lifetime direct medical costs attributable to obesity were calculated for students in the ni hr category for each of the three school years in california and in texas by multiplying the number of students in this category by the corresponding cost estimate per obese student the first set of estimates compared the direct medical costs for obese children against the direct medical costs for normal - weight children who gain weight as adults . the second set of estimates compared the direct medical costs for obese children against the direct medical costs for normal - weight children who remain at normal body weight as adults the results reflect the lifetime direct medical costs attributable to obesity for each fifth grade cohort over the three - year period in california and texas . the analysis used the costs estimated for a ten - year - old obese child ; however , it should be noted that students in the fifth grade range from ages 911 .", "the percentage of fifth grade students with bmi values in each category remained stable from the 2010 2011 school year through the 2012 2013 school year within each state ( see table 1 ) . just over half of fifth graders in each state were identified as having bmi values in the hfz , whereas at least one - third of fifth graders in each state were identified as having bmi values in the ni hr for bmi , and in texas , between 36.5 and 36.8 percent of students were categorized as ni hr for bmi during this timeframe . despite their geographical distance from one another , california and texas had comparable percentages of students in each category for each of the three school years . hr zone for each year in each state was multiplied by the estimated per capita lifetime direct medical costs of obesity previously established by finkelstein and colleagues ( 7 ) . the resulting values represent the low , high , and recommended statewide lifetime costs of obesity for the ten - year - old cohorts accounting for adulthood weight gain ( see table 2 ) and compared to children who maintain normal weight as adults ( see table 3 ) .", "using the presidential youth fitness program s fitnessgram body composition data , results indicate that in each of the two most populous states , childhood obesity for each cohort of fifth graders over the 3-year timeframe will cost between $ 1.4 and $ 3.0 billion ( compared to normal - weight children who become overweight as adults ) and $ 1.8 and $ 3.0 billion ( compared to normal - weight children who remain at normal weight as adults ) beyond the direct medical expenses for children of normal weight who remain at normal weight throughout adulthood . these results represent the costs solely for fifth graders in california and texas and not the additional accrued expenses for children of other ages as finkelstein and colleagues only estimated costs for the ten - year - old age group ( 7 ) . additionally , these values represent only the direct medical costs and not indirect costs , such as absenteeism , which would result in higher estimates . throughout the three years for which data were analyzed , the number of fifth graders who presented with bmi values in the ni this underscores the need for the development of effective childhood obesity prevention and reduction efforts . fitnessgram results indicate that on average , 33.9% of fifth graders in california and 36.7% of fifth graders in texas have bmi values that place them at high risk for problematic health outcomes . the number of ten - year - olds in the us population was just over 4 million on july 1 each year from 2010 to 2012 ( 26 ) . if the percentage of fifth graders with bmi values in the ni hr category in california and texas were extrapolated to the us population of ten - year - olds , this results in a potential lifetime economic burden of approximately $ 17 billion ( accounting for adulthood weight gain ) or $ 25 billion ( not accounting for adulthood weight gain ) in direct medical costs beyond that of individuals at a healthy weight for each single - year age cohort . in contrast to these findings , nhanes data from 2011 2012 indicate that 17.7% of children aged 6 11 were classified as obese by bmi according to the cdc standards ( 19 ) . using this obesity estimate along with recommended cost estimates , the increased lifetime economic burden of obesity would be approximately $ 9 billion ( accounting for adulthood weight gain ) or $ 13.5 billion ( not accounting for adulthood weight gain ) in direct medical costs for each single - year age cohort . this discrepancy might be partially due to the method used for the determination of childhood obesity . the cdc defines obesity for youth ages 2 19 as having a bmi greater than or equal to the 95 percentile on sex - specific bmi - for - age growth charts ( 2 ) . using this method , the minimum bmi values that indicate obesity are 22.03 kgm for boys aged 10.00 10.49 years , 24.16 kgm for boys aged 10.50 10.99 years , 23.18 kgm for girls aged 10.00 10.49 years , and 23.35 kgm for girls aged 10.50 10.99 years ( 11 ) . the bmi values that indicate childhood obesity per the cdc method are higher than those utilized in the fitnessgram to indicate high risk of excess adiposity - associated health problems . the fitnessgram scientific advisory board has identified body fat percentages that correspond with increased metabolic syndrome and cardiovascular disease risk factors in children and calculated the associated bmi values ( 9 , 13 ) . these bmi values , 20.8 kgm for ten - year - old boys and 21.0 kgm for ten - year - old girls , were identified as the cutoff values for high - risk bmi ( 15 ) . meta - analysis conducted by javed and colleagues suggests that the cdc bmi standard to determine childhood obesity status compared to reference measures of adiposity defined as a high body fat percentage ( i.e. , dual - energy x - ray absorptiometry scan , hydrostatic weighing , or air - displacement plethysmography ) is highly specific ( pooled specificity = 0.93 ) but less sensitive ( pooled sensitivity = 0.73 ) and thus might fail to detect excess body fatness in over 25% of cases ( 10 ) . therefore , the lower bmi cutoff values used to determine high - risk bmi in the fitnessgram will increase the sensitivity of the childhood obesity estimate . while the fitnessgram is a useful tool to help identify children who are at increased risk based on bmi and researchers can use this information to estimate the economic impact of obesity , a limitation of this study is that fitnessgram results were not available for many states . is administered to students nationwide as part of the presidential youth fitness program , more data will become available and more rigorous analysis should be performed on nationwide data . however , the current analysis uses data from the two most populous states in the union and underscores the large economic impact of childhood obesity . using bmi data from the presidential youth fitness program s fitnessgram over a three - year timespan and the estimated lifetime direct medical costs associated with obesity as recommended by finkelstein and colleagues ( 7 ) , results indicate that the estimated lifetime medical costs of childhood obesity in the two most populous states , california and texas , are between $ 1.4 and $ 3.0 billion for each single - year age cohort analyzed . this information can be used to encourage spending , resource development , and prevention program implementation to reduce obesity in these two states . further analyses should be conducted to estimate the economic burden associated with childhood obesity using the criterion - referenced fitnessgram bmi standards across the united states when data are available ." ]

[ "brown tumor is a non - neoplastic giant cell lesion characterized by increased circulating levels of parathyroid hormone ( pth ) . it is usually an uncommon lesion occurring with the frequency of 4.5% in primary hyperparathyroidism ( hpt ) and 1.5 - 1.7% in cases of secondary hpt , with overall incidence of 0.1% . hpt can be classified into : primary , which occurs due to hyperplasia , benign or malignant neoplasm of one or more parathyroid gland . secondary hpt is caused as a result of hypocalcemia , vitamin d deficiency or secondary to chronic renal insufficiency , which acts as a stimulus for pth production . tertiary hpt is associated with renal failure and autonomous functioning glands in long - standing secondary hpt cases . the fourth type of hpt has been recognized , which occurs due to increased pth levels synthesized in patients with malignant diseases . we report an interesting and rather unique case of a brown tumor of maxilla and mandible developing after acute exogenous thyroxine poisoning in a young female patient under treatment for hypothyroidism and ectopic intrathoracic parathyroid adenoma .", "a 23-year - old female reported to our department with the chief complaint of a swelling on the left side of the lower jaw for past 4 months producing facial asymmetry . patient was a known hypothyroid and was under exogenous levothyroxine ( l - thyroxine ) therapy for the past 3 years . she gave history of l - thyroxine poisoning ( approximately 4000 mcg stat dose ) 4 months back after which she developed rapidly growing swelling on the left side of the jaw . extraoral examination revealed the presence of a well - circumscribed expansile swelling in the left mandibular body region measuring 5 cm 4 cm , which was hard , non - tender and non - mobile without any surface changes . intraorally , obliteration of buccal vestibule on the left side with intact normal mucosa was seen . no mobility , loss of vitality or tenderness was elicited with any teeth in the left quadrant . biochemical assay and blood analysis revealed an increased value of serum alkaline phosphatase ( 420 u / l ; normal range : 100 - 172 u / l ) , serum pth ( 370.40 pg / ml ; normal range : 50 - 300 pg / ml ) and serum calcium ( 13.3 mgs / dl ; normal range : 8.5 - 11.0 mg / dl ) . the serum phosphorus level was decreased ( 2.4 mg / dl ; normal range : 2.7 - 4.5 mg / dl ) . cone beam computed tomography ( ct ) scan of the facial region revealed a well - defined soft tissue lesion within the left body of the mandible of approximately 3.5 cm 2.8 cm [ figure 1a and d ] . it also represented well - defined hypodense lesions in relation to the right body of the mandible measuring 2.5 cm 1.0 cm [ figure 1d ] and anterior maxilla , measuring 3.5 cm 3.6 cm [ figure 1b ] . there was also lytic lesion on the left side skull bone with generalized reduction in bone density [ figure 1c ] . a full body skeletal survey was also performed , which revealed no such lesions in long bones . ( a ) computed tomography scan ( axial section ) showing well - defined soft tissue lesion within the left body of the mandible . ( d ) 3d reconstruction showing bilateral lytic lesion within the body of the mandible and generalized reduction in the bone density ( arrow indicating the lesion ) ultrasound of neck failed to reveal any pathology in thyroid and parathyroid glands . to further assess the parathyroid gland status tc sestamibi - spect parathyroid scintigraphy was carried out , which demonstrated relatively prominent flow of activity toward left submandibular salivary gland region . abnormal ovoid region of intense tracer concentration in the anterior mediastinum in right paratracheal region was noted . the findings were suggestive of ectopic ( intrathoracic ) parathyroid gland with neoplastic changes in left submandibular salivary gland region [ figure 2a ] . ( a ) tc sestamibi - single photon emission computed tomography parathyroid scintigraphy image showing intense tracer concentration in right paratracheal region and left submandibular region . ( b ) computed tomography scan ( axial section ) showing well defined mass in intrathoracic prevascular space ct scan of the chest was taken , which revealed a moderate size nodular lesion showing heterogeneous enhancement in right prevascular space measuring 3.0 cm 2.4 cm [ figure 2b ] . the history , biochemical values and imaging reports corroborated with the clinical features of the brown tumor of hpt associated with pathologic ectopic parathyroid gland . an incisional biopsy of the mandibular lesion was performed under local anesthesia that revealed fibro collagenous tissue containing plenty of osteoclastic giant cells dispersed throughout the lesion with small fragments of reactive bone , the features consistent with reparative giant cell granuloma . thoracotomy was carried out and ectopic intrathoracic parathyroid gland was excised [ figure 3a ] . a combination of sharp and blunt dissection was used to excise the mass and it was delivered per oral in total [ figure 3b ] . post - operative serum calcium level was 10.6 mg / dl and pth level 11.90 pg / mg . intra - operative view of ( a ) ectopic parathyroid gland . ( b ) left mandibular lesion the intrathoracic mass and mandibular specimen was sent for histopathological examination . the intrathoracic mass revealed parathyroid neoplasm suggestive of atypical parathyroid adenoma [ figure 4a ] . the mandibular lesion presented a giant cell proliferation in the background of a variably fibrotic stroma . the giant cells were arranged in sheets with little intervening spindle cell stroma . at the periphery osteopenic bone trabecule these features were suggestive of brown tumor of hpt [ figure 4b ] . ( a ) histopathological section of mandibular lesion showing giant cell proliferation with variable areas of haemorrhage and hemosiderin deposition ( h and e , 20 ) . ( b ) histopathological section of parathyroid neoplasm composed of nuclear pleomorphism with cystic changes , suggestive of parathyroid adenoma ( h and e , 20 )", "pth plays a key role in calcium and phosphate balance between extracellular fluid and bones . brown tumor is relatively an uncommon lesion associated with hpt , which results in an abnormal osteoclastic and osteoblastic activity resulting in resorption and fibrous replacement of the bone . brown tumor is more commonly found in ribs , clavicles , pelvis , femur and facial bones . in craniofacial region mandible radiographically , this lesion appears as well - defined unilocular or multilocular radiolucencies causing cortical plate expansion and often thinning of the cortical plates . the density of jaw is decreased due to generalized demineralization of the medullary bones along with change in trabecule pattern giving a mixed radiopaque - radiolucent appearance . brown tumor mimics giant cell lesions and it can be distinguished from the latter based upon the clinical history and biochemical profile of the patient indicating hpt . due to overlapping clinical and radiological features , patients presenting in maxillofacial department with suspected giant cell lesion should undergo biochemical assay to rule out hpt . other differentials to be included are cherubism , aneurysmal bone cyst , paget 's disease , langerhans cell histiocytosis , osteosarcoma and osteomyelitis . histopathologically , brown tumor reveals multinucleated giant cells in a background of spindle cell proliferation along with a large amount of hemosiderin deposition , vascularity and hemorrhage giving brown appearance to this lesion . the most interesting aspect of this case report is association of brown tumor with ectopic intrathoracic parathyroid gland with normal functioning anatomic parathyroid glands . ectopic parathyroid glands are uncommon , mainly arising due to abnormal migration of parathyroid tissue during embryogenesis . it has been reported that in almost 16% cases of hpt , ectopic parathyroid glands are present , which may often go unnoticed and are a cause for failed parathyroid exploration . the uniqueness of the case is further defined by its occurrence at a very young age ( 23 years ) along with its bilateral presentation with simultaneous involvement of maxilla , mandible and skull bones in a brief period . this patient was hypothyroid , under thyroxine therapy for past 3 years with an episode of acute poisoning of l - thyroxine before the onset of swelling of the jaw . the routine biochemical examination of patient taken 3 months prior to the onset of swelling revealed normal serum calcium and phosphorus levels and hypothyroid state . unfortunately , consultant endocrinologist and physicians failed to observe any relation between the hyperparathyroid state of the patient and exogenous thyroxine . to best of our knowledge , no case of brown tumor of hpt with such aggressive behavior and wide spectrum of clinical findings associated with acute thyroxine ingestion has been reported in the past . hence , we assume that either bolus toxic dose of thyroxine or chronic state of hypothyroidism has caused a high pth and serum calcium levels resulting in a hyperparathyroid state causing bone remodeling events in the craniofacial region . few authors have reported that prolonged thyroid - stimulating hormone ( tsh ) stimulation may lead to hpt or a state of hpt in hypothyroidism and vice versa . this case report establishes a credible support for this hypothesis and brings out a definite correlation between tsh inhibition and onset of hpt . the treatment of brown tumor mainly focuses on correction of the underlying disorder and maintenance of normal pth and serum calcium levels . use of systemic or intralesional corticosteroid have been reported to reduce the size of the lesion . long - term follow - up of such lesion is mandatory as variable clinical behavior of the lesion following normalization of the pth and serum calcium levels has been reported . we have also adopted a similar protocol with surgical excision of the pathological ectopic parathyroid gland and mandibular tumor , which was causing severe disfigurement of the patient 's face . pth and serum calcium levels were found to be normal within 3 days after surgery . follow - up radiographs of the patient has revealed marked regression in the craniofacial lesions . ultra sonographic scan , ct scan and full body skeletal survey in conjunction with complete biochemical analysis can be carried out to assess the pathological parathyroid gland and extent of lesions in long bones . latest imaging techniques such as tc - sestamibi scan and fluorine - fluorodeoxyglucose - positron emission tomography / ct have been proved to be an effective and useful diagnostic modality in assessing location and functioning of parathyroid glands . our patient represents a rare case of brown tumor with a wide spectrum of associated clinical findings . in conclusion , the management of the brown tumor should involve early diagnosis , complete biochemical assay and full body skeletal survey followed by normalization of pth , serum calcium and phosphorus levels and parathyroidectomy , if indicated . in the absence of any pathology of anatomic parathyroid this case emphasizes the need for periodic biochemical investigations in the hypothyroid patients on exogenous thyroxine therapy ." ]

[ "during april october 2009 , bird bandings were conducted in the protected area of finca ribavellosa in la rioja , spain ( 4214n , 254w ) . ticks were collected from birds and classified through taxonomic keys ( 7 ) and molecular methods ( 8) . dna was individually extracted by using 2 incubations of 20 minutes each with ammonium hydroxide ( 1 ml of 25% ammonia and 19 ml of milli - q water that had been autoclaved ) at 100c and 90c . dna extracts were used as templates for pcrs targeting fragment genes for tick classification and for bacteria detection ( table 1 ) . two negative controls , 1 containing water instead of template dna and the other with template dna but without primers , and a positive control ( a tick extract , a. phagocytophilum , b. burgdorferi sensu stricto , or r. slovaca ) were included in all pcrs . amplification products were sequenced , and nucleotide sequences were compared with those available in genbank by using a blast search ( www.ncbi.nlm.nih.gov/blast/blast.cgi ) . phylogenetic and molecular evolutionary analyses were conducted by using mega4 ( 16 in technical appendix ) . , reference ; msp , p44 major surface protein gene ; flab , flagellin gene ; ompb , 120-kda genus common antigen gene ; ompa , 190-kda protein antigen gene ; glta , citrate synthase gene . r = a / g ; w = a / t . a total of 222 ticks belonging to the species haemaphysalis punctata ( n = 1 ) , ixodes frontalis ( n = 7 ) , i. arboricola ( n = 26 ) , i. ricinus ( n = 181 ) , and other ixodes spp . two nucleotide sequences for the 16s rrna fragment gene of i. arboricola ticks were recorded ( genbank accession nos . jf791812 and jf791813 ) ( table 2 ) . * l , larva ; msp , p44 major surface protein gene ; n , nymph ; flab , flagellin gene ; 5s-23s is , 5s-23s rrna intergenic spacer ; ompb , 120-kda genus common antigen gene ; ompa , 190-kda protein antigen gene ; glta , citrate synthase gene . a. phagocytophilum was detected only in 1 larva of an i. ricinus tick ( 0.5% ) . the most prevalent genospecies was b. garinii ( n = 19 ) , which was detected in i. ricinus ( n = 16 ) , h. punctata ( n = 1 ) , i. frontalis ( n = 1 ) , and ixodes sp . b. valaisiana was amplified in 9 samples ( 8 i. ricinus and 1 ixodes sp . r. monacensis ( n = 1 ) , r. helvetica ( n = 1 ) , r. sibirica sibirica ( n = 1 ) , and rickettsia spp . furthermore , according to glta , ompa , and ompb sequence analysis , a possible new rickettsia sp . was found in 25 i. arboricola ticks and 2 i. ricinus ticks . for these 27 samples , highest identities with r. heilongjiangensis ( 97.1% ) and r. japonica ( 99.1% ) were found for ompa ( genbank accession no . jf758826 ) nucleotide sequences , respectively , whereas glta nucleotide sequences were identical to those from both rickettsia spp . according to multilocus sequence typing ( data not shown ) and genetic criteria agreed on by experts , a candidatus status could be assigned . we named it candidatus rickettsia vini ( 17 in technical appendix ) ( table 2 ) . ( figure ) . the phylogenetic position of candidatus rickettsia vini based on the ompa nucleotide sequences in a study of the role of birds in dispersal of etiologic agents of tick - borne zoonoses , spain , 2009 . the percentage of replicate trees in which the associated taxa clustered in the bootstrap test ( 1,000 replicates ) is shown next to the branches . the tree is drawn to scale , with branch lengths in the same units as those of the evolutionary distances used to infer the phylogenetic tree . the evolutionary distances were computed by using the kimura 2-parameter method and are in the units of the number of base substitutions per site .", "the presence of anaplasma , borrelia , and rickettsia species in ticks removed from passerine birds corroborates the role of these vertebrates in the epidemiology and dispersion of tick - borne pathogens in spain and in other zones of the planet . some of the parasitized birds in our study , such as the european robin ( erithacus rubecula ) or eurasian blackcap ( sylvia atricapilla ) , are considered migratory or partial migratory birds . in addition , these species share an ecologic niche and ectoparasites ( horizontal transmission ) with other migratory birds that cover long distances from africa to the eurasian region . except for i. arboricola , the tick species captured in this study previously had been found on birds in spain ( 18 in technical appendix ) . the high prevalence of i. ricinus ticks was expected because it is the most frequent tick in this area , and the immature stages of this tick frequently parasitize birds . i. ricinus ticks are the main vectors of a. phagocytophilum in europe , and this microorganism has been detected on vegetation in the studied area ( 1 ) . however , the low prevalence ( 0.5% ) of a. phagocytophilum in the ticks in our study corroborates data from other studies ( 19,20 in technical appendix ) . the presence of a. phagocytophilum in a larva in our study supports the role of birds as reservoirs of a. phagocytophilum . the prevalence ( 13.1% ) of b. burgdorferi in our samples is similar to prevalences reported in other studies in europe in which i. ricinus is the main species of tick captured from birds ( 19 in technical appendix ) . in spain , b. garinii , b. valaisiana , and b. afzelii have been detected in ticks from birds ( 18 in technical appendix ) . according to our data , the human pathogen b. garinii was the most prevalent species , as reported in birds from europe ( 21 in technical appendix ) . although it has been recently detected in ticks from birds in norway ( 22 in technical appendix ) , its finding in spain was unexpected . regarding rickettsia species , r. monacensis and r. helvetica are among the human pathogens detected in our study . both species have been identified in ticks from birds in europe ( 19,20,23 in technical appendix ) . on the contrary , candidatus rickettsia vini , a potential new rickettsia species , also detected in our study , has not been related to human disease ( 17 in technical appendix ) . several genospecies closely related to r. heilongjiangensis and r. japonica have been identified in ixodes spp . r. sibirica sibirica , responsible for siberian tick typhus in western people s republic of china and in siberia , was also amplified in an i. ricinus larva in this study . our data confirm the involvement of birds in the cycle of human tick - borne diseases .", "" ]

[ "central nervous system drugs ( 58.7 % ) were the most prescribed class of inappropriate medications in korean long - term care facilities.inappropriate medication use was associated with the number of co - medications and long - term care insurance grade 3 , which means less dependence and a requirement of low - level care.effective management of nursing home residents belonging to long - term care grade 3 via reducing potentially inappropriate medications is considered .", "korea became an aging society in 2000 , and in 2008 , the prevalence of individuals aged 65 years or older was 10.3 % . in 2018 , korea will become an aged society when 14.4 % of its population comprise the elderly , and a super - aged society by 2026 [ 1 , 2 ] . to overcome this situation , the korean government introduced a new social insurance scheme for long - term care ( ltc ) in july 2008 . the ltc insurance program provides social services for elderly people with a few functional limitations . the purpose of this insurance system was to meet the markedly increased demand for elderly healthcare as a result of a rapidly aging population , elevated expectations for healthcare , and a change in the pattern of medical conditions in the elderly from acute illness to chronic disability . this insurance uses the ltc grade for denoting how much help is required for an elderly person in their daily lives . after the implementation of ltc insurance , the number of nursing facilities in korea also increased sharply from 1717 locations ( 68,581 people ) in 2008 to 3751 locations ( 116,782 people ) . researchers have documented the widespread incidence of inappropriate medication use in elderly persons and reported an estimated prevalence from 4.8 to 45.6 % [ 511 ] . the proper use of medicines and monitoring for adverse effects are important factors in the treatment of elderly patients . aging is associated with a reduction in first - pass metabolism and therefore an increase in the bioavailability and distribution of drugs , which increases the risk of adverse effects ; these risks grow exponentially when a number of different drugs are used . because of the potentially serious consequences of exaggerated or incorrect prescriptions , screening tools have been created to detect inadequacies in drug prescriptions . in 2012 , the american geriatrics society ( ags ) and an interdisciplinary panel of experts in geriatric care and pharmacotherapy reached a consensus on the 2012 ags beers criteria . fifty - three medications or medication classes encompass the final updated criteria , which are divided into three categories : potentially inappropriate medications ( pims ) or classes to avoid in older adults ; pims or classes to avoid in older adults with certain diseases and syndromes that the listed drugs can exacerbate ; and medications to be used with caution in older adults . elderly nursing home residents regularly receive complex multi - drug therapy because of the presence of both acute and chronic diseases . for this reason , there have been few reports dealing with the prevalence of pim prescriptions or their adverse effects on elderly patients in south korea [ 14 , 15 ] . to our knowledge , there have been no reports on the prevalence of pim prescriptions in south korea ltc facilities using the 2012 version of the beers criteria . hence , we evaluate the frequency of inappropriate medication use in elderly patients admitted to nursing homes in korea by applying the newly revised 2012 ags beers criteria .", "a retrospective cross - sectional survey study was performed in patients aged 65 years or older , which produced a sample of 824 people admitted to 20 nursing facilities in northwest korea from january 2012 to february 2012 . we excluded four patients who did not take any medications , 259 patients with incomplete medical records , and 32 patients who were not included in any ltci programs . we assessed the patients age , sex , co - medication , comorbidity , activities of daily living ( adl ) , length of stay , grade of ltc insurance for seniors , and the bed size and business type of the ltc care facilities . the ltc grade is based on standards of five areas of physical functions ( adl ) , cognition , behavioral changes ( behavioral problems ) , demand on nursing care , and need for rehabilitation , and judgment standards made in consideration of service necessary according to the state of functions . on a checklist with a maximum score of 100 , a score of 55 and over makes an individual eligible for insured care . categories of ltc grade are defined as follows : grade 1 ( most severe)the elderly person has one of the following handicaps : he or she can not go to or get out of bed unaided ; experiences behavioral difficulties , impaired judgment , and frequent memory loss as a result of severe brain injury ; or completely needs full assistance with all the activities of daily life and records a ltc acknowledgment score of at least 95 ; grade 2 ( severe)the elderly person can not eat , defecate nor dress themselves unaided ; has impaired judgment and memory loss due to dementia ; needs considerable help in moving or moving in a wheelchair ; spends most parts of daily life in bed and records an ltc acknowledgment score of at least 75 but less than 95 ; grade 3 ( moderate)the elderly person partially needs considerable ltc protection ; some degree of help for eating , dressing / undressing , using the toilet , looking after himself or herself , performing household tasks , and performing their everyday activities outside the home ; and records an ltc acknowledgement score of at least 55 but less than 75 ; no grade ( mild)the elderly person needs some help in one or two activities of daily life , including bathing and dressing / undressing and records an ltc acknowledgment score of less than 55 . prescriptions were assessed for the use of pims according to the 2012 ags beers criteria . we focused on evaluating 34 pims to avoid in older adults and one of the categories in the 2012 update to the ags s beers criteria . drug disease interactions and drugs to be used with caution in geriatric patients were also assessed using the beers criteria . anti - cholinergics include brompheniramine , carbinoxamine , chlorpheniramine , clemastine , cyproheptadine , dexbrompheniramine , dexchlorpheniramine , diphenhydramine ( oral ) , doxylamine , hydroxyzine , promethazine , and triprolidine . cardiovascular medications include alpha blockers , alpha agonists , guanabenz , guanfacine , methyldopa , reserpine ( > 0.1 mg / day ) , anti - arrhythmic drugs ( class ia , ic , iii ) , and amiodarone . central nervous system drugs include tertiary tricyclic antidepressants , antipsychotics , barbiturates , and benzodiazepines . we calculated the descriptive statistics to illustrate characteristics of the study population by comparing persons on pims with those not on pims . the distributions of baseline descriptive statistics are expressed as proportions and means with standard deviations . in the case of categorical variables , cross - tabulations with chi - square tests were used in comparing the differences . for continuous variables , the statistically significant difference in means was determined by the independent t test . concurrent pim use was defined as the number of pim prescriptions within an individual incidence year . logistic regression analysis was performed to identify the risk factors for pim exposure where pim use ( 0 or 1 ) was the dependent variable and the independent variables included age , sex , adl , length of stay , number of comorbidities , number of co - medications , and grade of ltc insurance . use of pims has been consistently associated with female sex , higher number of medications , higher number of chronic diseases , and older age [ 1621 ] . all statistical analyses were performed using spss 18.0 for windows ( spss inc . , chicago , il , usa ) .", "this study recruited 529 patients ; 221 of these did not use a pim , while the remaining 308 patients were currently taking pims . significant differences between those prescribed and those not prescribed a pim were found for sex , age , deductible class , number of different medications used , number of chronic conditions , total healthcare costs in the previous year , and number of concurrent pims . the average number of medications in the pim group was 4.0 2.3 , while the non - pim group s average number of medications was 6.4 2.9 ( p < 0.001 ) . in addition , the average number of comorbidities was 3.3 1.4 in the pim group and 3.8 1.5 in the non - pim group ( p < 0.001 ) . the number of patients whose ltc insurance for seniors was grade 3 was relatively higher in the pim group than it was in the non - pim group . the six most commonly prescribed classes of medicines within the anatomical therapeutic chemical classification system were as follows : central nervous system ( n = 930 ; 36.4 % ) , alimentary tract and metabolism ( n = 553 ; 21.6 % ) , cardiovascular system ( n = 388 ; 15.1 % ) , blood and blood - forming organs ( n = 236 ; 9.2 % ) , respiratory system ( n = 115 ; 4.5 % ) , and musculoskeletal system ( n = 72 ; 2.8 % ) . table 2 presents the number of pims prescribed in ltc facilities.table 1general characteristics of the residents in long - term care facilitiesvariablesnon - pims [ n = 221 ( % ) ] pims [ n = 308 ( % ) ] \n p valueage ( years)81.6 8.980.2 8.40.067sex ( male)64 ( 29.0%)59 ( 19.2%)0.080number of co - medications4.0 2.36.4 2.9<0.001 \n 03105 ( 47.5%)51 ( 16.6% ) 4582 ( 37.1%)112 ( 36.4% ) 6732 ( 14.5%)103 ( 33.4% ) 82 ( 0.9%)42 ( 13.6%)number of co - morbidities3.3 1.43.77 1.5<0.001 \n 0270 ( 31.7%)58 ( 18.8% ) 352 ( 23.5%)90 ( 29.2% ) 461 ( 27.6%)66 ( 21.4% ) 538 ( 17.2%)94 ( 30.5%)number of adls1.2 1.21.3 1.20.405 adl bathing8 ( 3.6%)7 ( 2.3%)0.357 dressing52 ( 23.5%)62 ( 20.1%)0.348 eating132 ( 59.7%)209 ( 67.9%)0.054 toileting58 ( 26.2%)87 ( 28.2%)0.611 walking22 ( 10.0%)42 ( 13.6%)0.200length of stay ( months)28.4 25.926.7 29.20.494grade of long - term care insurance for senior 138 ( 17.2%)31 ( 10.1%)0.008 \n 283 ( 37.6%)100 ( 32.5% ) 3100 ( 45.2%)177 ( 57.5%)bed size of long - term care facilities < 2954 ( 24.4%)74 ( 24.0%)0.950 \n 305966 ( 29.9%)96 ( 31.2% ) 60101 ( 45.7%)138 ( 44.8%)business type of long - term care facilities corporation159 ( 71.9%)223 ( 72.4%)0.908 \n private operator62 ( 28.1%)85 ( 27.6%)values are presented as number ( % ) \n pim potentially inappropriate medication , adl activities of daily living \n p value applied to row 47 inclusive \n p value applied to row 912 inclusive \n p value applied to row 2022 inclusive \n p value applied to row 2325 inclusive \n p value applied to row 2627 inclusivetable 2number of potentially inappropriate medications in the residents of long - term care facilitiesnumber of potentially inappropriate medicationsnumber ( % ) 0221 ( 41.8)1189 ( 35.7)292 ( 17.4)320 ( 3.8)46 ( 1.1)51 ( 0.2)total529 ( 100.0 ) general characteristics of the residents in long - term care facilities values are presented as number ( % ) \n pim potentially inappropriate medication , adl activities of daily living \n p value applied to row 47 inclusive \n p value applied to row 912 inclusive \n p value applied to row 2022 inclusive \n p value applied to row 2325 inclusive \n p value applied to row 2627 inclusive number of potentially inappropriate medications in the residents of long - term care facilities the six most commonly prescribed classes of medications in our patients were as follows : central nervous system ( n = 271 ; 58.7 % ) , anticholinergics ( n = 98 ; 21.2 % ) , cardiovascular system ( n = 50 ; 10.8 % ) , endocrine system ( n = 22 ; 4.8 % ) , analgesics ( n = 9 ; 1.9 % ) , and anti - parkinsonian drugs ( n = 9 ; 1.9 % ) ( table 3 ) . specifically , the most common pim subtype was quetiapine ( n = 131 ; 28.4 % ) , followed by chlorpheniramine ( n = 73 ; 15.8 % ) , risperidone ( n = 30 ; 6.5 % ) , zolpidem ( n = 27 ; 5.8 % ) , and spironolactone ( n = 26 , 5.6 % ) ( table 4 ) . multivariate logistic regression analyses were applied , and the factors that exhibited significant associations with pim prescriptions are shown in table 5.table 3six most commonly prescribed potentially inappropriate medications classesmedications class ( atc code)number ( % ) central nervous system ( n05-n06)271 ( 58.7)anticholinergics ( n04a)98 ( 21.2)cardiovascular system ( c)50 ( 10.8)endocrine system ( g03)22 ( 4.8)analgesics ( n02)9 ( 1.9)anti - parkinsonian drugs ( n04 ) 9 ( 1.9)medication classes are stratified according to 2012 american geriatrics society beers criteria for potentially inappropriate medication use in older adults ( ) means codes of anatomical therapeutic chemical ( atc ) classificationtable 4prevalence of potentially inappropriate medications according to individual drugsdrugs ( atc code)number ( % ) quetiapine ( n05ah04)131 ( 28.4)chlorpeniramine ( r06ab04)73 ( 15.8)risperidone ( n05ax08)30 ( 6.5)zolpidem ( n05cf02)27 ( 5.8)spironolactone ( c03da01)26 ( 5.6)olanzapine ( n05ah03 ) 21 ( 4.5)lorazepam ( n05ba06)19 ( 4.1)alprazolam ( n05ba12)16 ( 3.5)hydroxyzine ( n05bb01)13 ( 2.8)cyproheptadine ( r06ax02)12 ( 2.6)doxazosin ( c02ca04)12 ( 2.6)sliding scale insulin ( a10ab01)12 ( 2.6)amitriptyline ( n06aa09)11 ( 2.4)megestrol ( g03ac05)10 ( 2.2)meloxicam ( n01ac06)9 ( 1.9)benztropine ( n04ac01)7 ( 1.5)nifedipine ( c08ca05)7 ( 1.5)diazepam ( n05ba01)6 ( 1.3)clonazepam ( n03ae01)5 ( 1.1)terazosin ( g04ca03)3 ( 0.6)total462 ( 100)medication classes are stratified according to 2012 american geriatrics society beers criteria for potentially inappropriate medication use in older adults ( ) means codes of anatomical therapeutic chemical ( atc ) classificationtable 5logistic regression analysis for potentially inappropriate medications used in the residents of long - term care facilitiesvariables \n \n standard error \n p valueadjusted or ( 95 % ci)age0.0030.0120.8001.00 ( 0.981.02)sex ( female)0.1360.3160.6661.15 ( 0.622.13)number of co - medications 031.00 450.9030.243<0.0012.47 ( 1.533.97 ) 671.6880.316<0.0015.41 ( 2.9110.06 ) 83.6000.761<0.00136.61 ( 8.24162.68)number of co - morbidities 021.00 30.4880.2710.0731.63 ( 0.862.76 ) 40.0740.2780.7910.93 ( 0.541.60 ) 50.4380.2940.1371.55 ( 0.872.76)grade of long - term care insurance for seniors 11.00 20.2710.3120.3851.31 ( 0.712.42 ) 30.7090.3440.0392.03 ( 1.043.99)adjusted for activities of daily living , length of stay , bed size and business type of long - term care facilitiesgrade of long - term care insurance for seniors made based on standards of five areas of physical functions ( activities of daily living ) , cognition , behavioral changes , demand on nursing care , and need for rehabilitation and judgment standards made in consideration of service necessary according to the state of functions . categories of ltc grade are defined as follows : grade 1 ( most severe ) ; grade 2 ( severe ) ; grade 3 ( moderate ) six most commonly prescribed potentially inappropriate medications classes medication classes are stratified according to 2012 american geriatrics society beers criteria for potentially inappropriate medication use in older adults ( ) means codes of anatomical therapeutic chemical ( atc ) classification prevalence of potentially inappropriate medications according to individual drugs medication classes are stratified according to 2012 american geriatrics society beers criteria for potentially inappropriate medication use in older adults ( ) means codes of anatomical therapeutic chemical ( atc ) classification logistic regression analysis for potentially inappropriate medications used in the residents of long - term care facilities adjusted for activities of daily living , length of stay , bed size and business type of long - term care facilities grade of long - term care insurance for seniors made based on standards of five areas of physical functions ( activities of daily living ) , cognition , behavioral changes , demand on nursing care , and need for rehabilitation and judgment standards made in consideration of service necessary according to the state of functions . categories of ltc grade are defined as follows : grade 1 ( most severe ) ; grade 2 ( severe ) ; grade 3 ( moderate )", "the present study focuses on a growing public health problem : inappropriate medication prescriptions in ltc facilities . a disturbingly high level of pims were prescribed ( 58.2 % ) , which is of concern , indicating room for improvement . a comparison with the results from studies conducted previously worldwide is not straightforward owing to variations in methods , such as data and duration of collection , study criteria , and characteristics of the population groups . despite these variations , this prevalence was similar to those observed in the usa , with values of 49 % of elderly patients who were admitted with one or more of the seven most common medical diagnoses and 55.3 % in those undergoing surgery during their hospitalization , and 56.1 % of those in acute care hospitals in japan . the results described in the multivariate analysis regarding the factors associated with a potentially inappropriate prescription showed that the likelihood was determined by the number of drugs prescribed during the patient s hospitalization . , the results of a logistic regression model showed that multiple diseases and a higher use of drugs during hospital stay predicted pim prescription . multivariate analyses also revealed that the number of drugs prescribed seemed to be one of the most important independent predictors for receiving an inappropriate medication [ 27 , 28 ] . furthermore , inappropriate medication use was higher with the ltc insurance grade 3 , which means less dependence and a requirement of low - level care . this can be explained by the fact that most of the residents in korean ltc facilities have been diagnosed with dementia or another neurodegenerative disorder . considering central nervous system drugs ( 58.7 % ) were the most prescribed class of inappropriate medications , such prescriptions are used to manage behavioral and psychiatric symptoms . when interpreting the findings of the current study , some limitations to the methodology that could bias estimates are worth mentioning . the first limitation lies with the fact that the study was cross sectional , which does not allow us to identify the causal relationship of pim with associated factors in nature . second , the beers criteria have been examined extensively in research since their development and found to be effective in identifying pim and advising close monitoring of certain medications . however , evidence supporting the effectiveness of the beers criteria in consistently reducing the adverse effects of drugs or decreasing costs or mortality is lacking [ 29 , 30 ] . the beers criteria does not take into account geriatric patients in palliative care or hospice , does not detect prescribing omissions , underuse of medications , inappropriate dosing of medications , or duplication of drug classes [ 31 , 32 ] . third , although the information was gathered mainly from a chart review , recall bias may have been a problem because patients reported their current medications through a structured interview that took place before admission , including the duration of treatment and the dosage ; this information may have been inaccurate . fourth , this sample is unlikely to be representative of all koreans because the study was conducted in one region of the country and , therefore , the ability to generalize the findings is questionable . central nervous system drugs ( 58.7 % ) were the most prescribed class of inappropriate medications in korean ltc facilities . inappropriate medication use was associated with the number of co - medications and ltc insurance grade 3 , which means less dependence and a requirement of low - level care .", "central nervous system drugs ( 58.7 % ) were the most prescribed class of inappropriate medications . there was a relationship between inappropriate medication use and the number of co - medications . the frequency of inappropriate medication prescriptions was higher among patients whose ltc insurance for seniors was grade 3 , which means less dependence and a requirement of low - level care .", "this retrospective study was carried out after obtaining the permission of the institutional review board of myoung - ji hospital in korea and has been performed in accordance with the ethical standards of the declaration of helsinki .", "kang soo lee , sang - hwan kim , and hee - jin hwang have no conflicts of interest to declare .", "kang soo lee , sang - hwan kim , and hee - jin hwang certify that no funding has been received for the conduct of this study and/or preparation of this manuscript ." ]

[ "in patients with chronic hepatitis and in those with liver cirrhosis , detection of increasing incidences of hepatocellular carcinoma ( hcc ) requires careful monitoring every 36 months using ultrasound sonography ( us ) , computed tomography ( ct ) , magnetic resonance imaging ( mri ) , and frequent blood tests . once hcc is detected , patients experience repeated recurrence , despite the fact that a variety of hcc treatment methods have been developed , such as anti - viral agents , surgical treatment , percutaneous ethanol injection ( peit ) , radiofrequency ablation ( rfa ) , trans - catheter arterial chemoembolization ( tace ) , and molecular - target drugs . in the last 10 years , tumor vaccines generated from patients ' own formalin - fixed hcc tissues the autologous formalin - fixed tumor vaccine ( aftv ) has been reported to reduce the recurrence risk of primary resected hepatitis b virus - background hcc by 81% 1 . in one case , recurrence of multiple - recurrent hepatitis c virus ( hcv)-back ground hcc was clearly suppressed long - term without any additional treatment 2 . here , we report a case in which aftv injection resulted in suppression of multiple - recurrent hcv - background hcc recurrence . in this case , we detected a significant density of glypican-3 ( gpc3)-specific cytotoxic t lymphocytes ( ctl ) in the blood at 12 months after the last intradermal injection of aftv .", "a 55-year - old female patient was diagnosed with hcv - related hepatitis in 2002 . liver biopsy showed active chronic hepatitis accompanied by bridging fibrosis and necrotic inflammatory reactions . to reduce the activity of chronic hepatitis , the patient was treated with consensus interferon for 24 weeks . results showed complete remission of the hepatitis as liver transaminases normalized , as well as conversion of seropositive hcv to negative up to the present . when she was 57 years old , two 20-mm hccs were observed in left lobes s2 and s3 , and a left hepatic lobectomy was performed in june 2004 . in addition , two 10-mm hccs in s5 and s7 were treated with radiofrequency ablation ( rfa ) in september 2008 . the 10-mm hcc in s5 was detected again in january 2011 , and was treated with trans - catheter arterial chemoembolization ( tace ) and rfa . in january 2012 , a new 10-mm hcc was found in s6 , and a resection was done after treatment with rfa . pathologies obtained after the two hepatectomies showed poorly differentiated hcc in the 2004 specimen and moderately differentiated hcc in the 2012 specimen ( fig.1 ) . the liver function has been kept good and the bilirubin levels were < 2 mg / dl . the patient did not hope liver transplantation but desired aftv therapy because of the rapid decline in the recurrence interval , that is , 51- , 28- , 12- , and 4-months . pathology and glypican-3 ( gpc3 ) expression in hepatocellular carcinomas . ( a ) h&e staining and ( b ) gpc3 immunohistochemistry of representative tissue from a 2004-resected hepatocellular carcinoma ( hcc ) specimen of the present case . ( c ) h&e staining and ( d ) gpc3 immunohistochemistry from a 2012-resected specimen . gpc3 expression ( b , d ) was observed in areas with hcc ( arrows ) , but not in cirrhotic areas ( white stars ) . we prepared aftv as reported previously 3 using a total of 1.56 g of autologous hcc tissue recovered from formalin - fixed and paraffin - embedded tumors from the two operations . according to the therapeutic schedule employed 1 , a single course of aftv therapy applied from september to october 2012 consisted of the following : ( 1 ) a delayed - type hypersensitivity ( dth ) test with immunoadjuvant - free fixed hcc fragments applied to a forearm was initiated 48 h before the first aftv injection to check for allergic reaction . ( 2 ) up to three rounds of aftv were injected intradermally into the upper arm at 2 week intervals . ( 3 ) a second dth test , performed 2 weeks after the last aftv injection to the other forearm , showed a positive dth response . ( 4 ) ultrasound sonography and blood tests for tumor markers which were conducted every 3 months , and computerized tomography every 6 months , revealed no evidence of recurrence or generation of new hcc lesions for more than 27 months . immunohistochemistry to detect gpc3 4 in the hcc specimen resected in 2004 revealed strong expression of gpc in the hcc lesion ( fig.1b ) . we also detected gpc3 expression in the 2012 specimen resected after treatment with rfa ( fig.1d ) . however , we did not observe any gpc3 expression within cirrhotic lesions in either specimen ( fig.1b and d ) . to evaluate aftv - induced gpc3-reactive ctl , we carried out interferon--specific elispot assays as described previously 5 , using a target human hcc cell line expressing gpc3 ( sk - hep-1/gpc3 ) . the cell line was developed from sk - hep-1/hla - a0201/2402 cells by transfecting with human gpc3-gene . a control cell line ( sk - hep-1/vec ) although hla subtypes of the patient and the target cell line differ ( hla - a0206/3303 and hla - a0201/2402 , respectively ) , hla - a2 ( a0201)-restricted gpc3 epitopes are cross - reactive with hla - a0206 , allowing detection of gpc3-specific ctl that are reactive to the target cell line 5 . glypican-3-specific ctls were clearly observed in peripheral blood drawn 12 months after the first injection of aftv ( average 21.5 spots against sk - hep-1/hgpc3 cells vs. nine spots against sk - hep-1/vec control cells ) ( fig.2 ) . lymphocytes were prepared from the patient 's blood drawn at 12 months after autologous formalin - fixed tumor vaccine ( aftv ) injection . we detected hla - a2-restricted glypican-3 ( gpc3 ) peptide - specific cytotoxic t lymphocytes in the 12-month blood . sk - hep-1/hgpc3 , human gpc3 gene - transfected sk - hep-1 cells ( sk - hep-1 with hla - a a0201/2402 ) , a human hepatocellular carcinoma cell line unable to express gpc3 ; sk - hep-1/vec , control vector gene - transfected sk - hep-1 cell line . effector cells ( cd8 t cells ) , 1 10 cells / well ; target cells ( sk - hep-1 cells ) , 5 10 cells / well .", "gpc3 , a heparan - sulfate proteoglycans linked to the outer surface of cell membrane via a glycosylphosphatidylinositol anchor 6 , is frequently overexpressed in hcc 7,8 and in precancerous lesions in the liver 9 . for this reason , a recombinant humanized monoclonal antibody against gpc3 10 and a gpc3-peptide vaccine 11 have been developed for treatment of hcc . treatments with these new agents were well tolerated , and noted measurable immune responses and antitumor efficacy . however , clinical outcome were not necessarily prominent in these phase i trials compared to the previous expectations derived from preclinical studies . autologous formalin - fixed tumor vaccine differs from these specified molecule - targeted agents in that the autologous tumor , containing a wide array of unidentified antigens , is the source of antigens . thus , ctl induced with aftv made from tumor tissue must be polyclonal by nature ; for example , polyclonal ctl induced in vitro with a formalin - fixed carcinoembryonic antigen protein 12 . at present , no one provided any evidence that the impure tumor antigenic formalin - fixed autologous hcc tissue is truly active to induce a specific cellular immune response against a specified tumor antigenic molecule . the present case is the first one we could identify gpc3-specific cellular immune response based on the autologous formalin - fixed hcc . while we detected gpc3-specific ctl in the patient 's blood 12 months after aftv treatment , few gpc3-specific ctl were detected 16 months after the treatment ( data not shown ) . these results may suggest that , although the conspicuous life span of gpc3-specific ctl in blood is < 16 months , the immunoprotective effect of aftv continues beyond gpc3-specific ctl lifespan in blood , since this patient presently continued to show no evidence of hcc recurrence 32 months after the second resection of hcc . we consider two hypotheses to explain this continued protection : ( 1 ) the gpc3-specific ctl may have differentiated into memory t cells , which migrate to lymphatic tissues and are therefore not conspicuously detectable in peripheral blood . ( 2 ) the gpc3-specific ctl apoptosed after killing all target hcc cells in vivo , thereby eliminating all tumor antigens and preventing replicative stimulation to active ctl .", "this is the first case we could identify gpc3-specific cellular immune response based on impure tumor antigenic formalin - fixed autologous hcc tissue . present results suggest that aftv should be taken in consideration as one of treatment modalities in cases involving potential hcc derived from chronic hepatitis and liver cirrhosis .", "" ]

[ "in this and the next issue of critical care , john haddad presents a comprehensive review on the contributions of transcription factors to lung injury . the topic is large and ever changing , and the complete coverage of nuclear factor-b ( nf-b ) and hypoxia - inducible factor ( hif)-1 is spread over two issues . in critical care the majority of these patients progress to the point at which they require intubation and mechanical ventilation , with an associated high mortality . recent studies have demonstrated that low tidal volume ( 6 ml / kg ) ventilation strategies dramatically reduce this mortality . however , many other clinical trials of various treatments have failed at either reducing the lung injury or accelerating the healing to the end - point of reduced mortality . in this age of genomics and proteomics we continue to explore the association of gene and environment . with respect to lung injury , we need to identify and understand the mechanisms that predispose patients to the excessive inflammation resulting from an overactive innate immune response that characterizes sepsis and lung injury . these include stimuli , signal transduction ( receptors , enzyme cascades , transcription factors ) , gene(s ) response and the measured clinical phenotype . john haddad , in his two - part review , identifies many ' clinical stimuli ' in cell culture , animal model and patient studies representing an oxidative stress that can generate a response via nf-b or hif-1 dependent signalling .", "nf-b was originally described in b lymphocytes , but it is now recognized as a member of the rel family of transcription factors and is a critical response element in many cytokine - dependent events or inflammatory conditions . as a result of this link , nf-b has become a major target for new therapeutic approaches in such clinical disease states as asthma , cancer , arthritis , and cardiovascular and neurodegenerative conditions . haddad discusses the roles of critical care conditions such as hyperoxia , haemorrhage and resuscitation ; the ' stress response ' to illness ( interleukin-6 , interleukin-8 , tumour necrosis factor , rantes [ regulated upon activation , normal t cell expressed and secreted ] ) ; and mechanical ventilation and ischaemia / reperfusion . in all of these conditions these dynamic variations in cellular redox or oxidative stress , if in disequilibrium , may regulate gene expression and lead to apoptosis ( cell death without inflammation ) , inflammation and lung injury .", "the master regulatory element of hypoxic conditions and adapting oxidative stresses to gene expression is hif-1 . hif-1 , a dna - binding protein , has increased stability and binding in hypoxic conditions and is degraded rapidly in normoxia . the accumulation of the -subunits allows for heterodimer formation and translocation into the nucleus during hypoxia . this process leads to selective upregulation of genes whose products are involved in hypoxia and inflammatory lung injury . these include erythropoietin , vascular endothelial growth factor ( vegf ) and glucose transporter . work by haddad has demonstrated that proinflammatory cytokines also activate hif-1 stability and dna binding . this effect was most profound in hypoxic conditions and was , in fact , greater than that in hypoxaemia alone . it is felt that hif-1 , via its action on vegf expression , is directly related to lung injury by endothelial barrier dysfunction mediated by vegf and recognized clinically as increased pulmonary vascular permeability . haddad discusses in detail how hypoxia and inflammatory stimuli initiate many signalling cascades via hif-1 to generate a response phenotype to these oxidative stresses .", "understanding the molecular signalling that couples oxidative stresses via nf-b or hif-1 to acute lung injury should generate new therapeutic options . haddad discusses the rationale for the use of tyloxapol to reduce proinflammatory cytokines , n - acetyl cysteine ( a glutathione precursor ) to reduce neutrophil - associated alveolitis in chronic conditions such as cystic fibrosis , and the use of pyrrolidine dithiocarbamate in transplantation to reduce neutrophil - associated oxidant lung injury . two new compounds , isohelenin and lisofylline , a phosphodiesterase inhibitor , are described as being able to reduce proinflammatory cytokines and ameliorate oxidant lung injury in animal models . as exciting as this emerging field is , with its predictable contribution to future ' bench to bedside ' discussions , a more complete mechanistic understanding and future clinical trials will assist in the realization of improved treatment and reduced mortality from oxidant - mediated lung injury .", "", "hif = hypoxia - inducible factor ; nf-b = nuclear factor-b ; vegf = vascular endothelial growth factor ." ]

[ "we enrolled 13 consecutive patients between march 2005 and march 2009 and who met the following inclusion criteria : 1 ) they were diagnosed with acral lentiginous melanoma by punch biopsy ; 2 ) their skin lesion confined to the foot ; 3 ) there was no skin or soft tissue disease on the ipsilateral lower leg . we routinely checked the preoperative ultrasonography for popliteal and inguinal lymph node metastasis , and we performed computed tomography of the chest and positron emission tomography to assess for distant metastasis . a distally - based island sural flap was used in 10 cases for hindfoot reconstruction , and the lateral supramalleolar fasciocutaneous flap was used in 3 cases for lateral arch reconstruction of the mid- and forefoot after wide excision of malignant melanomas ( table 1 ) . eight patients were women and 5 were men with mean age of 60.3 years ( range , 35 to 73 years ) . the mean duration of follow - up was 23.3 months ( range , 6 to 48 months ) . one patient had ipsilateral inguinal and popliteal lymph node metastasis , and one patient had ipsilateral inguinal lymph node metastasis at the time of diagnosis . we performed wide excision of the malignant melanoma with a 2 cm margin in all the patients . after wide excision , we confirmed that the margin of resection was free of tumor by frozen section , and then we measured the exact size of the defect . the distally based island sural flap was outlined at the junction of the two heads of g the astrocnemius muscle . a line of incision was traced over the presumed course of the sural nerve and the lesser saphenous vein . the pivotal point of the pedicle was three fingers breadth proximal to the tip of the lateral malleolus . 1 ) . the lateral supramalleolar fasciocutaneous flap need an essential landmark , which is the perforating branch of the peroneal artery as it pierces the interosseous membrane at the distal tibiofibular angle about 5 cm proximal to the tip of the lateral malleolus . the fasciocutaneous flap contained the superficial peroneal nerve , the perforating branch from the peroneal artery and the venae comitantes ( fig . 2 ) . we attempted neurorrhaphy between the proximally cut superficial peroneal nerve and the distally cut lateral plantar nerve in the two lateral supramalleolar flaps . at a mean time of 21 days after the first operation , the skin graft on the flap donor site and opening the pedicle tunnel was carried out with full thickness skin , which was obtained from the ipsilateral inguinal area . inguinal lymph node dissection was concomitantly performed , after harvesting the full thickness skin graft , in 10 patients who had \" thick melanomas \" ( > 1.0 mm in thickness by breslow microstaging ) and who had lymph node metastasis seen on the preoperative ultrasonography . three patients with \" thin melanoma \" ( 1.0 mm in thickness by breslow microstaging ) had a split thickness skin graft that was harvested from the thigh without inguinal lymph node dissection.9 ) low molecular weight dextran was routinely used for 5 days postoperatively . partial and full weight bearing ambulation could be started after 6 weeks and 12 weeks after the first operation without concern for wound healing .", "we performed wide excision of the malignant melanoma with a 2 cm margin in all the patients . after wide excision , we confirmed that the margin of resection was free of tumor by frozen section , and then we measured the exact size of the defect . the distally based island sural flap was outlined at the junction of the two heads of g the astrocnemius muscle . a line of incision was traced over the presumed course of the sural nerve and the lesser saphenous vein . the pivotal point of the pedicle was three fingers breadth proximal to the tip of the lateral malleolus . 1 ) . the lateral supramalleolar fasciocutaneous flap need an essential landmark , which is the perforating branch of the peroneal artery as it pierces the interosseous membrane at the distal tibiofibular angle about 5 cm proximal to the tip of the lateral malleolus . the fasciocutaneous flap contained the superficial peroneal nerve , the perforating branch from the peroneal artery and the venae comitantes ( fig . 2 ) . we attempted neurorrhaphy between the proximally cut superficial peroneal nerve and the distally cut lateral plantar nerve in the two lateral supramalleolar flaps . at a mean time of 21 days after the first operation , the skin graft on the flap donor site and opening the pedicle tunnel was carried out with full thickness skin , which was obtained from the ipsilateral inguinal area . inguinal lymph node dissection was concomitantly performed , after harvesting the full thickness skin graft , in 10 patients who had \" thick melanomas \" ( > 1.0 mm in thickness by breslow microstaging ) and who had lymph node metastasis seen on the preoperative ultrasonography . three patients with \" thin melanoma \" ( 1.0 mm in thickness by breslow microstaging ) had a split thickness skin graft that was harvested from the thigh without inguinal lymph node dissection.9 )", "partial and full weight bearing ambulation could be started after 6 weeks and 12 weeks after the first operation without concern for wound healing .", "one patient , who had a split thickness skin graft without lymph node dissection , was revealed to have pulmonary and inguinal lymph node metastasis at 4 months postoperatively , and the patient died of disease at 13 months . among those who underwent elective inguinal lymph node dissection , 2 patients were revealed to be alive with disease and 3 patients died of disease at 7 , 10 , 13 , 15 months later after operation respectively . the length of the flap varied from 7.5 to 12 cm ( mean length , 9.6 cm ) and the width varied from 6.5 to 12 cm ( mean width , 8.8 cm ) . in 4 cases , superficial necrosis developed , but this was successfully treated by debridement and suture or skin graft ( table 1 ) . all 13 flaps survived completely and they provided stable defect coverage , good contour and normal weight bearing ambulation . as for the patients who had neurorrhaphy , the recovery of sensation was not observed .", "distally based fasciocutaneous flaps on the leg were first introduced in 1983.10 ) the main advantages of these flaps are a well - defined surface that is independent of a lengthwidth ratio and the preservation of the main vascular axis . in most cases , the sural nerve descends in between the two heads of the gastrocnemius muscle and it penetrates the deep fascia at the median point of the leg . the superficial sural artery originates from the popliteal or sural arteries , and it reaches the sural nerve at 2 cm to 3 cm after its emergence , then subdivides into the medial , median and lateral superficial sural arteries . the median superficial sural artery follows the course of the sural nerve , and then it emits numerous branches toward the skin at the lower half of the leg , along its superficial path . the peroneal artery , in turn , makes other anastomoses , notably through its descending branch , and especially with the anterior tibial artery . several authors have stated that the principal anastomosis occurs at above to 5 centimeters from the lateral malleolus.2,11 - 13 ) although there are some reports of a preoperative lesser saphenous vein mapping method that used doppler ultrasound4 ) or using a simple rubber tourniquet for making the superficial vessels prominent,2 ) we did not use these techniques . however , the incision was initiated in the proximal extreme of the flap , we identified the lesser saphenous vein , sural artery and nerve , and then we made further incision with centralizing on the presumed vessel course as much as possible . the distally based sural flap had a tendency of having a short flap pedicle for coverage of a forefoot defect , as compared to that of the lateral supramalleolar flap . the lateral supramalleolar flap is a distally based fasciocutaneous flap that is vascularized by branches of a perforating branch of the dorsal peroneal artery . this branch is constant and it emerges 5 cm above the lateral malleolus , with 2 or 3 ascending cutaneous branches and a deep descending branch . the ascending branches are included in the intermuscular septum between the extensor digitorum longus and the peroneus brevis , and the ascending branches perforate the fascia and then they supply the skin over the lower lateral half of the leg . the descending branch runs distally below the deep fascia , and it anastomoses with the anterolateral malleolar branch of the tibialis anterior artery , and then it continues into the foot to form anastomoses with the tarsi arteries and dorsal arch . the point of emergence of the perforating branch of the dorsal peroneal artery could be detected \" by palpating the groove just above and anterior to the lateral malleolus.\"14 ) this represents the pivot point . the axis of the flap is represented by a midline drawn from the anterior tibial crest to the posterior margin of the fibula . voche et al.5 ) distinguished the type of arterial blood supply to the lateral supramalleloar flap depending on how far distally the flap is raised , and this can include a mixed antegrade and retrograde blood supply . so this flap can have a longer pedicle length due to the various possible vascular networks and the flap can reach to the forefoot . almeida et al.2 ) reported on the complications in their 71 cases of a reverse - flow island sural flap , including partial ( 22.1% ) or total ( 4.2% ) flap necrosis , infection ( 8.5% ) and venous congestion ( 4.1% ) . voche et al.5 ) reported venous congestion and partial flap necrosis ( 5 to 30% ) in their 41 cases of using the lateral supramalleolar flap . they presented the delayed neurofasicocutaneous sural flap , which is initially completely elevated and it is then fixed again at the donor site using running sutures for 7 to 15 days . after confirming the flap 's survival , the flap was raised again and transposed into the defect . this delayed procedure could be an alternative to overcome these problems and to increase the reliability and viability of the flap . tan et al.15 ) treated three patients with a supercharged reverse flow sural flap to reduce venous congestion and edema , and the venous drainage was achieved by end - to - end anastomosis between the free end of the lesser saphenous vein and a superficial vein on the medial site of the ankle . among our 4 patients with partial necrosis , 2 occurred in the distally based sural artery flap . partial necrosis developed on the lateral margin of the flap that was transposed medially on the plantar surface . the flap sizes of these patients were not too much larger than that of the other patients , but the routes of passage of the sural vascular pedicle were more laterally located from the flap center . therefore , at the time of sural flap dissection , the skin island should be redrawn and shifted either medially or laterally as the dissection progresses , while trying to keep the pedicle centralized with regard to the flap . the other two cases of partial necrosis developed on the distal portion of the transposed lateral supramelleolar flap . these flaps were large size ( 12 9 , 10.5 9 cm ) with long pedicle lengths to reach the metatarso - phalangeal joint of the fifth toe . we confirmed well - blanched , transposed flap color to the lateral arch of the forefoot and then we completely sutured the pedicle tunnel . from these cases , we suggest that an opened pedicle tunnel can be beneficial for the long length pedicle and a large flap size . when the defects are larger and more anterior , free tissue transfer is often required because it can provide a large amount of tissue.6 ) however , there are some disadvantages such as donor - site morbidity , an increased operation time , the use of a major vessel of the leg and the necessity of microsurgical expertise . moreover , langstein et al.16 ) reported the free tissue transfer for limb salvage of soft tissue malignancies on the foot . according to their results , over 50% of the patients with local recurrence and persistent disease required below knee amputation . voche et al.5 ) suggested the lateral supramalleolar flap is reliable and useful for coverage of the lower leg , ankle and foot skin defects , but coverage of the weight - bearing surface of the foot should be avoided . however , we had satisfactory results for a the large defect of the lateral half of the midfoot and forefoot , including a weight bearing area , so there seems to be no problem if the pedicle can be placed in a non - weight bearing portion or delayed weight bearing is performed . one patient developed multiple inguinal lymph node and lung metastases after a late split thickness skin graft on the donor defect area and the patient had received a lateral supramalleolar flap . this all suggested the necessity of inguinal lymph node biopsy or dissection , and many articles have emphasized that sentinel lymph node biopsy needs to be done in a patient in the malignant melanoma.17 ) if this patient had received a full thickness skin graft instead of a split skin graft , then we would have performed inguinal lymph node dissection . our delayed full thickness skin graft had benefits with respect to confirming the flap 's viability in a critical period , the one - time - approach for ipsilateral lymph node dissection after harvesting the full thickness skin and the safety for the pedicle tunnel that remained open rather than performing primary closure . in conclusion , the distally based sural flap and lateral supramalleolar flap provide effective coverage of variable sized soft tissue defects on the foot after wide excision of malignant melanoma , this is quick and safe surgery without the necessity of microsurgical expertise , it preserves the major arteries of the leg and the donor - site morbidity is acceptable . the distally based sural flap is useful for the hindfoot , and the lateral supramalleolar flap is good for lateral archs of the mid- and forefoot ." ]

[ "techniques and equipment to accomplish endotracheal ( et ) intubation were the precursor to modern day invasive mechanical ventilation . in recent years , however , the popularity of the et tube has waned . clinically , the et tube is seen as an impediment to spontaneous breathing , a transit route for bacteria to the lower airway , and with the advent of noninvasive ventilation a device to be avoided when possible . of particular interest has been the effect of the et tube on work of breathing and methods to eliminate this work . commonly , pressure support ventilation ( psv ) has been suggested as the technique of choice for eliminating imposed work due to the et tube . more recently , the technique of automatic tube compensation ( atc ) has become available to specifically address this issue . in this issue of critical care , maeda and colleagues compare the technique of atc , as provided by the drager evita 4 ( dragerwerks , lubeck , germany ) and the puritan bennett 840 ( carlsbad , ca , usa ) , versus psv in reducing imposed work of breathing in a lung model . before i comment on the merits of the study , clearly , before the advent of pressure support ventilation in the early 1980s , patients were successfully weaned using t - piece trials and intermittent mandatory ventilation , with no apparent untoward effects . in 1986 , shapiro and coworkers presented data from three normal volunteers breathing through et tubes at a constant tidal volume of 500 ml . that report is widely quoted but is limited by the use of unintubated normal individuals and the requirement for a constant tidal volume during increasing respiratory rates . additionally , close review of the data demonstrates that with a size 8.0 et tube the work of breathing in joules per minute does not become excessive until minute ventilation exceeds 15 l / min . brochard and colleagues compared work of breathing during assisted ventilation , four levels of pressure support , continuous positive airway pressure , and after extubation in an effort to determine the role of pressure support in overcoming the imposed work presented by the et tube . that trial evaluated both patients with normal lungs and those with chronic obstructive pulmonary disease ( copd ) . the authors concluded that the pressure support level that eliminated imposed work was between 3 and 14 cmh2o . interestingly , this was determined retrospectively by matching the work of breathing after extubation to the level of pressure support that resulted in equivalent work of breathing during mechanical ventilation . recent work suggests that the work of breathing postextubation may actually increase compared with work of breathing through the et tube , raising questions about the conclusion of the study by brochard and colleagues . weissman evaluated flow - volume loops in 18 postoperative patients intubated with size 7.0 and 8.0 et tubes and found that only ' minimal limitation to airflow ' occurred at volumes and frequencies associated with tidal breathing . that study is one of the very few that contemplate the idea that et tube resistance may not be important when the appropriate size is chosen and the patients pulmonary function has improved to the point that weaning may be considered . of course , there are numerous other studies that suggest that et tube resistance may represent a significant impediment to spontaneous breathing . however , it is important to note that although there remains concern about et tube resistance , and the literature is replete with lung model studies of increased work of breathing , there is not a single clinical trial that suggests that spontaneous breathing through the et tube results in untoward outcomes . the report by maeda and coworkers in this issue of critical care evaluates the two most popular methods of overcoming et tube resistance , namely psv and atc . the authors concluded that tube compensation could not overcome the pressure time product associated with triggering and that pressure support is as effective as atc at 100% . there are , however , tremendous disadvantages to a lung model study in comparing these techniques . calculating the pressure time product and work includes the work required to trigger the ventilator , which can only be overcome by direct measurement of tracheal pressure and triggering from the tracheal signal . this method has been proposed by many , and advanced by the group from gainesville . additionally , although the lung model allows consistency , it can not react to differences in gas delivery . in several human studies comparing psv with atc , the slow flow and longer inspiratory time associated with psv has been associated with dysynchrony . when used in a patient with copd , the patient 's high airway resistance and increased compliance allow even small amounts of psv to cause hyperinflation and auto - peep ( positive end - expiratory pressure ) . alterations in pulmonary mechanics , along with the preference of the copd patient for short inspiratory times and long expiratory times , result in neuromechanical dysynchrony during psv . the main proposed advantages of atc over psv are reduced work of breathing as patient demand varies , preservation of a normal , variable breathing pattern , and improved synchrony . in a recent trial of spontaneous breathing before extubation , haberthur and coworkers failed to show any advantage of atc over psv or t - tube trials . one issue not addressed in the study by maeda and coworkers is the role of expiratory compensation . one distinct difference in the operation of the drager evita 4 and puritan bennett 840 is that evita 4 provides both inspiratory and expiratory compensation for et tube resistance . in these cases , the airway pressure may be allowed to drop below peep to facilitate expiratory flow . new modes and new techniques are developed in the hope of resolving clinical problems and often concentrate on a short - term physiologic end - point . conventional wisdom suggests that the et tube is an impediment to efficient spontaneous breathing , yet clinical evidence during spontaneous breathing trials appears to argue to the contrary . the real question may be whether overcoming et tube resistance is necessary , not whether atc is as good as or better than psv . the future of atc , like many new techniques , may not be in overcoming et tube resistance , but as a method of support during spontaneous breathing that improves patient - ventilator synchrony as compared with psv . additional clinical studies are required to complement the excellent laboratory work by the group from osaka reported in this issue .", "", "atc = automatic tube compensation ; copd = chronic obstructive pulmonary disease ; et = endotracheal ; peep = positive end - expiratory pressure ; psv = pressure support ventilation ." ]

[ "bed rest , heart failure , depletion of intravascular volume , and aging often induce hypotension when the body or trunk is upright.15 generally , a tachycardic response occurs due to vagal withdrawal according to the downward blood shift that occurs under orthostatic stress in healthy humans,6 although orthostatic hypotension presents as an excessive drop in cardiac output ( q ) and lower tachycardic response in frail and elderly patients as a consequence of inadequate vascular contraction or autonomic dysfunction.7,8 numerous studies have suggested that advancing age is associated with decreases in vagal nerve activity.912 age - related decreases in vagal nerve activity have been suggested as contributing factors for orthostatic hypotension in elderly individuals.7,13 orthostatic hypotension has been reported in more than 60% of frail older patients in an acute geriatric ward.5 previous studies have observed orthostatic hypotension in 54% of seated older inpatients resting on a bed for more than 12 h.14 in light of these facts , methods of preventing hypovolemia and hypotension during orthostatic stress need to be investigated . pointed out that studies of orthostatic hypotension in frail patients , such as those with decompensated heart failure , are scarce and preventive interventions remain insufficient.2 clinically , frail patients are placed in fowler s position or a semiseated position on the bed . these positions are often clinically used without distinction between acute- or chronic - phase illness . the patient is placed in a reclined position with the backrest between 30 and 60 and with flexed or straight knees in fowler s position.15,16 breathing , eating , and other routine daily activities are considered to be facilitated in fowler s position.15,1720 some studies have suggested a relationship between trunk angle and hemodynamics during fowler s position.2124 cicolini et al . reported that blood pressure in fowler s position was intermediate between the seated and supine positions in both young healthy individuals and hypertensive patients.23,24 those studies indicated that the effects of orthostatic stress on hemodynamics in fowler s position may be substantial in frail patients . how posture can prevent the hypovolemia and hypotension caused by orthostatic stress during fowler s position is important and should be addressed . our previous study indicated that fowler s position with an upright upper trunk is effective for maintaining circulatory volume with lower tachycardia via vagal withdrawal compared with having the whole trunk upright in younger subjects.25 however , whether an upright upper trunk in fowler s position allows easy maintenance of circulatory volume in cases with autonomic hypofunction associated with aging remains unclear . we postulated that stroke volume ( sv ) would be higher and heart rate ( hr ) would be lower with the upper trunk upright than with the whole trunk upright in fowler s position in both older and younger subjects . in addition , we presumed that the lower hr would be caused by reduced sympathetic activation in older individuals but by reduced vagal withdrawal in younger individuals . the present study was performed as a cross - sectional study to assess our hypothesis with a fundamental study of the effects of the two fowler s positions on hemodynamics and hr variability parameters in healthy older and younger subjects .", "we assessed hemodynamics and hr variability in 11 male younger subjects ( mean age standard error of the mean [ sem ] : 20.50.2 years ; range : 2022 years ; weight : 60.61.8 kg ; height : 170.21.8 cm ) and 11 male community - dwelling older subjects ( mean age sem : 69.51.2 years ; range : 6479 years ; weight : 62.02.1 kg ; height : 165.41.8 cm ) . all subjects were interviewed regarding medical history , and blood pressure was checked after a period of rest . final decisions on subject selections were made by consultations between a medical doctor and researchers . potential subjects were excluded when they had a history of cardiovascular disease , respiratory disease or other chronic medical disease , or were not normotensive ( systolic bold pressure below 140 mmhg and diastolic blood pressure below 90 mmhg ) . all subjects in the final analysis were healthy and had no history of chronic or acute cardiovascular or respiratory disease or other chronic diseases . subjects were instructed to refrain from beverages containing caffeine or alcohol for 24 h before starting experiments and to refrain from eating and drinking after 2,200 h on the day prior to the experiments that started in the morning or to consume a light breakfast before experiments that started in the afternoon . all experiments were implemented between 1,100 and 1,400 h , because blood pressure fluctuates according to a circadian pattern stabilizing at approximately noon . the ethics commission of the international university of health and welfare approved the study , and all participants provided voluntary written consent to participate after being fully informed about the procedure , risks , and protocol . we collected physiological data with the patient in the supine position and two fowler s positions . prior to experiments , subjects rested in a thermoneutral room at 28c for 15 min and were set up for electrocardiography ( ecg ) , noninvasive arterial pressure monitoring , and impedance cardiography ( icg ) . measurements in the supine position were made with sufficient time between measurements in the two fowler s positions . between measurements in each fowler s position , subjects rested for more than 3 min . data were recorded for 5 min in each of the supine position and the two fowler s positions . subjects were placed in the fowler s positions on a bed at 30 of lower trunk inclination and 60 of upper trunk inclination ( ut60 ) and 60 of whole trunk inclination ( wt60 ) ( figure 1 ) . we defined the upper and lower segments at ut60 around the spinous process of the 10th thoracic vertebra . the height of the bottom of the upper and lower trunk was adjusted according to individual trunk size . all experiments were performed in our laboratory ( odawara , kanagawa , japan ) under controlled thermoneutral temperature . hr was estimated from type ii ecg ( ecg 100c ; biopac systems , goleta , ca , usa ) in all experiments . icg ( nico 100c ; biopac systems ) was performed using eight spot electrodes ( vitrode m ; nihon kohden , tokyo , japan ) attached to the neck and lower thorax of each subject for icg based on a previous study.26 sv was estimated from transthoracic bioimpedance using bernstein s method that has been validated as offering high reliability comparable to the technique of thermodilution.26 icg allows continuous noninvasive evaluation of sv . noninvasive continuous arterial pressure was measured in the radial artery by tonometry using an arterial pressure monitor ( bp-608ev ; omron colin , tokyo , japan ) . mean arterial pressure ( map ) was estimated as one third pulse pressure plus diastolic pressure . ecg , thoracic bioimpedance , and continuous arterial pressure signals were recorded on a personal computer using the mp150 data acquisition system ( biopac systems ) at a sampling rate of 1 khz . we performed frequency domain and time domain analysis of ecg for the assessment of vagal function . we calculated logarithm - transformed respiratory sinus arrhythmia ( ln rsa ) from the power spectrum of the rr intervals ( 0.150.4 hz ) . we thus calculated the square root of the mean of the sum of the squares of differences between adjacent rr intervals ( rmssd ) , number of pairs of adjacent rr intervals differing by more than 50 ms ( nn50 ) and the proportion derived by dividing nn50 by the total number of rr intervals ( pnn50 ) for 5 min . all parameters of hr variability reflect vagal modulation.27,28 changes in hemodynamic variables from supine and hr variability parameters in the three positions in subjects from the two age groups were compared by two - way mixed - design analysis of variance ( anova ) . when three positions two age group interactions were significant , one - way repeated - measures anova of the three positions in each subject and one - way anova of subjects from the two age groups in each position were used to evaluate simple main effects . subsequent post hoc analysis to determine differences between the three positions in each age group were evaluated using a paired t - test with shaffer s multiple comparison procedure in each age group.29 the level of statistical significance was set at p<0.05 . data were statistically analyzed using r for windows version 3.3.0 statistical software ( www.r-project.org ) and the car 2.14 package .", "we assessed hemodynamics and hr variability in 11 male younger subjects ( mean age standard error of the mean [ sem ] : 20.50.2 years ; range : 2022 years ; weight : 60.61.8 kg ; height : 170.21.8 cm ) and 11 male community - dwelling older subjects ( mean age sem : 69.51.2 years ; range : 6479 years ; weight : 62.02.1 kg ; height : 165.41.8 cm ) . all subjects were interviewed regarding medical history , and blood pressure was checked after a period of rest . final decisions on subject selections were made by consultations between a medical doctor and researchers . potential subjects were excluded when they had a history of cardiovascular disease , respiratory disease or other chronic medical disease , or were not normotensive ( systolic bold pressure below 140 mmhg and diastolic blood pressure below 90 mmhg ) . all subjects in the final analysis were healthy and had no history of chronic or acute cardiovascular or respiratory disease or other chronic diseases . subjects were instructed to refrain from beverages containing caffeine or alcohol for 24 h before starting experiments and to refrain from eating and drinking after 2,200 h on the day prior to the experiments that started in the morning or to consume a light breakfast before experiments that started in the afternoon . all experiments were implemented between 1,100 and 1,400 h , because blood pressure fluctuates according to a circadian pattern stabilizing at approximately noon . the ethics commission of the international university of health and welfare approved the study , and all participants provided voluntary written consent to participate after being fully informed about the procedure , risks , and protocol .", "we collected physiological data with the patient in the supine position and two fowler s positions . prior to experiments , subjects rested in a thermoneutral room at 28c for 15 min and were set up for electrocardiography ( ecg ) , noninvasive arterial pressure monitoring , and impedance cardiography ( icg ) . measurements in the supine position were made with sufficient time between measurements in the two fowler s positions . between measurements in each fowler s position , subjects rested for more than 3 min . data were recorded for 5 min in each of the supine position and the two fowler s positions . subjects were placed in the fowler s positions on a bed at 30 of lower trunk inclination and 60 of upper trunk inclination ( ut60 ) and 60 of whole trunk inclination ( wt60 ) ( figure 1 ) . we defined the upper and lower segments at ut60 around the spinous process of the 10th thoracic vertebra . the height of the bottom of the upper and lower trunk was adjusted according to individual trunk size . all experiments were performed in our laboratory ( odawara , kanagawa , japan ) under controlled thermoneutral temperature .", "hr was estimated from type ii ecg ( ecg 100c ; biopac systems , goleta , ca , usa ) in all experiments . icg ( nico 100c ; biopac systems ) was performed using eight spot electrodes ( vitrode m ; nihon kohden , tokyo , japan ) attached to the neck and lower thorax of each subject for icg based on a previous study.26 sv was estimated from transthoracic bioimpedance using bernstein s method that has been validated as offering high reliability comparable to the technique of thermodilution.26 icg allows continuous noninvasive evaluation of sv . noninvasive continuous arterial pressure was measured in the radial artery by tonometry using an arterial pressure monitor ( bp-608ev ; omron colin , tokyo , japan ) . mean arterial pressure ( map ) was estimated as one third pulse pressure plus diastolic pressure . ecg , thoracic bioimpedance , and continuous arterial pressure signals were recorded on a personal computer using the mp150 data acquisition system ( biopac systems ) at a sampling rate of 1 khz . we performed frequency domain and time domain analysis of ecg for the assessment of vagal function . we calculated logarithm - transformed respiratory sinus arrhythmia ( ln rsa ) from the power spectrum of the rr intervals ( 0.150.4 hz ) . we thus calculated the square root of the mean of the sum of the squares of differences between adjacent rr intervals ( rmssd ) , number of pairs of adjacent rr intervals differing by more than 50 ms ( nn50 ) and the proportion derived by dividing nn50 by the total number of rr intervals ( pnn50 ) for 5 min .", "changes in hemodynamic variables from supine and hr variability parameters in the three positions in subjects from the two age groups were compared by two - way mixed - design analysis of variance ( anova ) . when three positions two age group interactions were significant , one - way repeated - measures anova of the three positions in each subject and one - way anova of subjects from the two age groups in each position were used to evaluate simple main effects . subsequent post hoc analysis to determine differences between the three positions in each age group were evaluated using a paired t - test with shaffer s multiple comparison procedure in each age group.29 the level of statistical significance was set at p<0.05 . data were statistically analyzed using r for windows version 3.3.0 statistical software ( www.r-project.org ) and the car 2.14 package .", "figure 2 shows the results of changes in hemodynamic variables from supine at all positions . change in hr ( hr ) increased and change in sv ( sv ) decreased with the change from supine to an upright trunk in younger and older subjects . two - way mixed - design anova of hr and sv revealed significant main effects of the three positions ( hr , f = 31.73 ; sv , f = 15.73 ; p<0.05 ) , but no significant main effects of the two age groups ( p>0.05 ) and no significant three positions two age groups interactions ( p>0.05 ) . multiple comparisons for each age group showed that hr ( ut60 and wt60 in younger , 2.91.2 beats / min and 6.61.4 beats / min , respectively ; ut60 and wt60 in older , 2.80.7 beats / min and 5.00.9 beats / min , respectively ) was significantly lower at ut60 than at wt60 and at supine than at ut60 and wt60 . in addition , sv ( ut60 and wt60 in younger , 4.42.8 ml and 13.72.9 ml , respectively ; ut60 and wt60 in older , 0.33.3 ml and 7.43.1 ml , respectively ) was significantly higher at ut60 and supine than at wt60 in older and younger subjects ( p<0.05 ) . anova for changes in q ( q : ut60 and wt60 in younger , 0.10.2 l and 0.30.2 l , respectively ; ut60 and wt60 in older , 0.20.2 l and 0.00.2 l , respectively ) revealed a significant main effect of the three positions ( q , f = 3.55 , p<0.05 ) but no significant main effect of the two age groups ( p>0.05 ) and no significant interaction of three positions two age groups ( p>0.05 ) . multiple comparisons among each age group showed no significant differences between the three positions ( p>0.05 ) . anova of changes in map ( map : ut60 and wt60 in younger , 1.21.9 mmhg and 4.24.0 mmhg , respectively ; ut60 and wt60 in older , 0.52.8 mmhg and 2.72.6 mmhg , respectively ) revealed no significant main effects for the three positions ( p>0.05 ) or two age groups ( p>0.05 ) and no significant interaction of the three positions two age groups ( p>0.05 ) . although all parameters decreased with the change from supine to upright trunk in younger subjects , significant differences were not seen between all positions in older subjects . these parameters in older subjects were lower compared with younger subjects for each position ( table 2 ) . two - way mixed - design anova of ln rsa , rmssd , nn50 , and pnn50 revealed significant main effects of the three positions ( p<0.05 ) and two age groups ( p<0.05 ) but significant three positions two age groups interactions ( p<0.05 ) . post hoc analysis revealed significant simple main effects of the three positions in younger subjects ( ln rsa in younger , f = 8.67 ; rmssd in younger , f = 6.71 ; nn50 in younger , f = 5.95 ; pnn50 in younger , f = 7.12 ; p<0.05 ) but no significant simple main effect of the three positions in older subjects ( p>0.05 ) and significant simple main effects of the two age groups among each position ( ln rsa of supine , f = 34.6 ; rmssd of supine , f = 25.18 ; nn50 of supine , f = 27.45 ; pnn50 of supine , f = 29.77 ; ln rsa of ut60 , f = 24.72 ; rmssd of ut60 , f = 19.87 ; nn50 of ut60 , f = 20.43 ; pnn50 of ut60 , f = 19.46 ; ln rsa of wt60 , f = 14.36 ; rmssd of wt60 , f = 4.95 ; nn50 of wt60 , f = 6.59 ; pnn50 of wt60 , f = 6.12 ; p<0.05 ) . multiple comparisons among the three positions showed that all hr variability parameters were significantly higher at ut60 and supine position than at wt60 in younger subjects ( p<0.05 ) .", "figure 2 shows the results of changes in hemodynamic variables from supine at all positions . change in hr ( hr ) increased and change in sv ( sv ) decreased with the change from supine to an upright trunk in younger and older subjects . two - way mixed - design anova of hr and sv revealed significant main effects of the three positions ( hr , f = 31.73 ; sv , f = 15.73 ; p<0.05 ) , but no significant main effects of the two age groups ( p>0.05 ) and no significant three positions two age groups interactions ( p>0.05 ) . multiple comparisons for each age group showed that hr ( ut60 and wt60 in younger , 2.91.2 beats / min and 6.61.4 beats / min , respectively ; ut60 and wt60 in older , 2.80.7 beats / min and 5.00.9 beats / min , respectively ) was significantly lower at ut60 than at wt60 and at supine than at ut60 and wt60 . in addition , sv ( ut60 and wt60 in younger , 4.42.8 ml and 13.72.9 ml , respectively ; ut60 and wt60 in older , 0.33.3 ml and 7.43.1 ml , respectively ) was significantly higher at ut60 and supine than at wt60 in older and younger subjects ( p<0.05 ) . anova for changes in q ( q : ut60 and wt60 in younger , 0.10.2 l and 0.30.2 l , respectively ; ut60 and wt60 in older , 0.20.2 l and 0.00.2 l , respectively ) revealed a significant main effect of the three positions ( q , f = 3.55 , p<0.05 ) but no significant main effect of the two age groups ( p>0.05 ) and no significant interaction of three positions two age groups ( p>0.05 ) . multiple comparisons among each age group showed no significant differences between the three positions ( p>0.05 ) . anova of changes in map ( map : ut60 and wt60 in younger , 1.21.9 mmhg and 4.24.0 mmhg , respectively ; ut60 and wt60 in older , 0.52.8 mmhg and 2.72.6 mmhg , respectively ) revealed no significant main effects for the three positions ( p>0.05 ) or two age groups ( p>0.05 ) and no significant interaction of the three positions two age groups ( p>0.05 ) .", "although all parameters decreased with the change from supine to upright trunk in younger subjects , significant differences were not seen between all positions in older subjects . these parameters in older subjects were lower compared with younger subjects for each position ( table 2 ) . two - way mixed - design anova of ln rsa , rmssd , nn50 , and pnn50 revealed significant main effects of the three positions ( p<0.05 ) and two age groups ( p<0.05 ) but significant three positions two age groups interactions ( p<0.05 ) . post hoc analysis revealed significant simple main effects of the three positions in younger subjects ( ln rsa in younger , f = 8.67 ; rmssd in younger , f = 6.71 ; nn50 in younger , f = 5.95 ; pnn50 in younger , f = 7.12 ; p<0.05 ) but no significant simple main effect of the three positions in older subjects ( p>0.05 ) and significant simple main effects of the two age groups among each position ( ln rsa of supine , f = 34.6 ; rmssd of supine , f = 25.18 ; nn50 of supine , f = 27.45 ; pnn50 of supine , f = 29.77 ; ln rsa of ut60 , f = 24.72 ; rmssd of ut60 , f = 19.87 ; nn50 of ut60 , f = 20.43 ; pnn50 of ut60 , f = 19.46 ; ln rsa of wt60 , f = 14.36 ; rmssd of wt60 , f = 4.95 ; nn50 of wt60 , f = 6.59 ; pnn50 of wt60 , f = 6.12 ; p<0.05 ) . multiple comparisons among the three positions showed that all hr variability parameters were significantly higher at ut60 and supine position than at wt60 in younger subjects ( p<0.05 ) .", "the major findings of the present study were as follows : 1 ) the reductions in sv and tachycardic response were smaller with the upper trunk upright compared with the whole trunk upright , in healthy young and older individuals , and 2 ) the reduced tachycardic response with the upright upper trunk would be caused by decreased vagal withdrawal in younger subjects and reduced sympathetic activation in older subjects . orthostatic stress reportedly occurs with the shift in blood volume to the abdomen and legs in healthy individuals.30,31 at ut60 , subdivision of the trunk into upper and lower segments was defined by the spinous process of the 10th thoracic vertebra , under the presumption that since the heart is located close to the center of rotation of the bottom of the dorsal thorax , even if the upper trunk is upright , the level of the heart is lower with ut60 than with wt60 . in addition , the abdomen and pelvic segments at ut60 were not upright compared with wt60 . orthostatic stress might therefore be smaller at ut60 than at wt60 , suggesting differences in the distribution of the blood volume shift to lower parts of the body at ut60 compared to wt60 in both subject groups . moreover , these results were observed to be similar to the findings of our previous study in healthy young subjects.25 some previous studies have reported the effects of advancing age on sv under orthostatic stress induced by lower body negative pressure ( lbnp ) . these previous studies revealed that the reduction of sv was significantly lower among older individuals than among younger individuals under higher lbnp , although changes in sv did not differ between age groups under lower level lbnp.32,33 tsutsui et al . indicated that hypovolemia was less among older subjects than among the younger during higher level lbnp because leg compliance in the older subjects was reduced according to decreased capacitance function with age.33 with the present findings , significant differences in sv between age groups with the two fowler s positions were not observed . these results appear similar to previous findings during lower level lbnp but appear to differ from previous findings for higher - level lbnp.33 in fowler s position , since only the trunk and head were upright and the lower extremities were similar to the level in the supine position , orthostatic stress would be limited . differences in leg compliance with aging were thus indicated to have no effect on differences in sv between younger and older subjects , because the shift in blood volume to the lower extremities was regarded as too small . in this study , sv was less than approximately 14 ml during the two fowler s positions in both age groups . positive hr occurred with the change from supine to upright trunk and hr was lower at ut60 than at wt60 in both age groups . these tachycardic responses were suggested to be the result of the negative sv being lower at ut60 than at wt60 . however , since all hr variability parameters in older subjects differed from those of younger subjects in the three positions , the mechanisms underlying the tachycardic responses reflected in the present results were suggested to differ between younger and older subjects . generally , tachycardic response less than 100 beats / min is attributed to vagal withdrawal.34 we therefore concluded that the tachycardic responses in the present results were caused by vagal withdrawal in younger subjects . in addition , vagal withdrawal would be lower at ut60 than at wt60 because ln rsa , rmssd , nn50 , and pnn50 were higher at ut60 compared with wt60 in younger subjects . however , no significant differences were seen among all positions and ln rsa , rmssd , nn50 , and pnn50 were lower in older subjects than in younger subjects in each position . vagal function is well known to reduce with age.912 these results suggested that vagal function was reduced in older subjects and tachycardic response was caused by mechanisms other than vagal withdrawal . nevertheless , the tachycardic response was significantly different between the two fowler s positions in older subjects . some previous studies have indicated that sympathetic nerve function and sympathetic baroreflex function are maintained with age.10,32,3537 the tachycardic response of older subjects with an upright trunk might thus be suggested to result from sympathetic activation in the present study , rather than vagal withdrawal . from the above , compared with wt60 , ut60 might inhibit decreases in sv and inhibit tachycardic response by reducing vagal withdrawal in younger subjects and by reducing sympathetic activation in older subjects . although sv was higher at ut60 than at wt60 in both age groups , q and map did not differ between the two fowler s positions in either age group or between the two age groups in either fowler s position . these results suggest that the tachycardic response and vasomotor contraction response maintained q and map to compensate for reduced sv under orthostatic stress regardless of age . such findings may be attributed to the regulation of tachycardic response and vasomotor contraction via vagal withdrawal in younger individuals and via sympathetic activation in older individuals . our findings indicate that an upright upper trunk during fowler s position allowed maintenance of sv and inhibited tachycardic response compared to an upright whole trunk regardless of age , although the autonomic mechanisms underlying tachycardic responses differed between younger and older adults . an upright upper trunk in fowler s position might help to reduce orthostatic stress and facilitate routine activities and conversation in frail patients . some studies have suggested that leg compression bandaging could prevent orthostatic hypotension in older patients.2,38 although that method might indeed be effective , that approach requires a more time - consuming procedure and the patient may feel a sense of uncomfortable restriction from the bandaging . our proposed method offers the advantages that the procedure to tilt the upper trunk is very simple and patients do not require compression bandaging or use of stockings to maintain circulatory volume when the patient wants to raise the body on the bed .", "the present results suggest that reduced tachycardic response with an upright upper trunk may be regulated by reduced sympathetic activation compared with having the whole trunk upright during fowler s position in older subjects . however , the present study did not directly assess sympathetic nerve activity in the two fowler s positions or while supine . to corroborate our findings , confirmation by direct measurement of sympathetic nerve activity or venous plasma norepinephrine concentration in fowler s positions in younger and older subjects may be necessary . in consideration of using a fowler s position such as ut60 at clinical sites , validation in patients with orthostatic intolerance is needed because the influences of an upright upper trunk on hemodynamics and cardiovascular regulation in such patients have yet to be completely clarified .", "we demonstrated that an upright upper trunk during fowler s position allowed maintenance of sv and inhibited tachycardic responses compared to having the whole trunk upright in both younger and older subjects . such inhibition of tachycardic responses might be caused by reduced vagal withdrawal in younger subjects and by reduced sympathetic activation in older subjects . an upright upper trunk during fowler s position might be useful to maintain circulatory volume for reduced orthostatic stress and to facilitate daily activities in frail patients at clinical sites ." ]

[ "alzheimer 's disease ( ad ) is a progressive , neurodegenerative brain disorder which affects over 37 million people worldwide with an estimated global cost of over $ 600 billion in 2010 [ 1 , 2 ] . ad is a growing socioeconomic and financial burden due to its strong correlation with ageing ; around 1 in 3 people aged over 80 years have ad , which means that a rapid rise in ad cases is anticipated as life expectancy continues to increase . although several therapeutics are currently available to slow disease progression , there is currently no way to halt or prevent ad . ad is characterized by the presence of extracellular senile plaques and intracellular neurofibrillary tangles in the brain . the major constituents of senile plaques are the amyloid- ( a ) peptides , which are derived from the proteolytic processing of the amyloid precursor protein ( app ) within lipid rafts . the a peptide , notably a142 , is highly aggregation prone and self - assembles to form a heterogeneous mixture of oligomers and protofibrils , ultimately depositing as fibrils in senile plaques . an accumulating body of evidence indicates that soluble a oligomers , which correlate strongly with disease onset and severity , are the major neurotoxic species in ad [ 58 ] . although a oligomers are neurotoxic at nanomolar concentrations and cause ad - related memory deficits , the cellular mechanisms of toxicity are poorly characterised . recently , several neuronal receptors which bind a oligomers have been identified , including the cellular prion protein ( prp ) and glutamate receptors [ 10 , 11 ] among others . interestingly , these receptors reside primarily within , or partition into , cholesterol - rich microdomains within the plasma membrane known as lipid rafts . the three steps which underlie a oligomer - mediated neuropathology in ad , are ( 1 ) a production , ( 2 ) a assembly into oligomers and ( 3 ) a oligomers interacting with neuronal receptors . crucially , all three of these processes occur in lipid raft domains of the plasma membrane which are considered to play a key role in the development of ad . in this paper , we will outline the pivotal role that lipid rafts play in linking together the generation , self - assembly and toxicity of a oligomers , which underlie the development of the neuropathology in ad . a major focus will be upon the interaction between a oligomers and their putative cellular receptors .", "the multitude of different lipids and proteins within the plasma membrane were once thought to be distributed homogeneously across the entire lipid bilayer , as proposed by the fluid mosaic model in 1972 . however , the plasma membrane is now known to be more akin to a sea of disordered phospholipids , in which float microdomains with distinct lipid compositions , known as lipid rafts . lipid rafts are small ( 10200 nm ) , heterogeneous and highly dynamic assemblies that are enriched in specific components , namely cholesterol and sphingolipids ( figure 1 ) [ 14 , 15 ] . biochemically , lipid rafts are defined by their relative insolubility in nonionic detergents at low temperature , conferring upon them the alternative name , detergent - resistant membranes ( drms ) . lipid rafts are also known as liquid - ordered domains because the highly saturated sphingolipid acyl chains enable closer lipid packing , and therefore more restricted lateral movement , than the mainly unsaturated acyl chains of the phospholipids in the surrounding nonraft regions of the membrane . functionally , lipid rafts serve to compartmentalise cellular processes by concentrating certain proteins and lipids within the same microenvironment . lipid rafts are particularly enriched in glycosyl - phosphatidylinositol ( gpi)-anchored and acylated proteins due to the preferential intercalation of the saturated acyl chains into the liquid - ordered environment . other proteins can also associate with lipid rafts either directly or through binding to other cofactors or ligands . the dynamic clustering and pinching off of lipid rafts regulates the spatial and temporal assembly of signalling and trafficking molecules , forming short - lived but vital signalling platforms . lipid rafts are implicated in various essential cellular functions , including signal transduction , cell adhesion and protein / lipid sorting . of particular relevance here are cell signalling , sorting and axon guidance , as these processes are essential for neural development and synaptic plasticity [ 19 , 20 ] . crucially , neuronal lipid rafts are also required for the maintenance of dendritic spines and healthy synapses , which are vital for neural communication including learning and memory ; processes which fail in ad . the observation that lipid rafts are much more abundant in mature hippocampal neurons than in other cell types emphasises their physiological importance within the memory centre of the healthy brain , and may explain why hippocampal neurons are a primary target for a oligomer toxicity and destruction in ad . lipid rafts are involved in the regulation of app processing and the generation of the a peptide which is the driving force in ad pathology [ 23 , 24 ] . for comprehensive reviews detailing the involvement of membrane rafts in ad and a production , the a peptide is produced by the lipid raft dependent amyloidogenic processing of its precursor protein , app ( figure 1 ) . the amyloidogenic cleavage of full - length app is initiated by the -site app cleaving enzyme-1 ( bace1 ) , a transmembrane aspartic metalloprotease . a large , soluble ectodomain ( sapp ) is released to leave behind a membrane - anchored c - terminal fragment ( c99 ) which retains the intact a sequence . the second amyloidogenic cleavage of app involves a -secretase complex which contains presenilin-1 or presenilin-2 ( the catalytic component ) , presenilin enhancer-2 ( pen2 ) , nicastrin and anterior pharynx defective-1 ( aph1 ) . the -secretase complex cleaves the remaining c99 stub to release a peptides of between 3942 residues in length , depending upon the precise cleavage site , along with the app intracellular domain ( aicd ) . although the majority of full - length app is localised to nonraft regions of the plasma membrane , where nonamyloidogenic cleavage by the -secretases adam 9 , 10 , and 17 precludes a formation , a subset of both app and bace1 partitions into lipid rafts along with -secretase components . both bace1 and the -secretase subunits undergo posttranslational s - palmitoylation which aids their targeting to lipid raft domains . in the case of app , a direct interaction with cholesterol the major component of lipid rafts was recently identified . high cholesterol increases the partitioning of app , along with bace1 and -secretase components , into lipid rafts . a large body of evidence points towards lipid rafts being the physiological site of amyloidogenic a production by bace1 and the -secretase complex . for example , both the copatching of app and bace1 by cross - linking antibodies and the exclusive targeting of bace1 to lipid rafts by the addition of a gpi - anchor significantly increased app cleavage at the -secretase site . furthermore , enrichments in lipid raft components , namely cholesterol and ganglioside gm1 , promote the generation of a [ 31 , 33 ] . all four of the -secretase subunits are also enriched and active within lipid raft fractions derived from human brain [ 34 , 35 ] and lipid raft - type membranes in vitro [ 36 , 37 ] . in the brain , the majority of a is found within detergent - resistant , glycolipid - enriched rafts , along with -secretase components . the composition of lipid rafts purified from ad brains has been shown to be abnormal , with the rafts being more ordered and more viscous , which implies that the modulation of lipid raft composition may present a therapeutic avenue for modulating ad - related neuropathology . this has led to a number of researchers investigating whether depleting lipid raft components could lower a production and therefore prevent ad . cholesterol , being a major component of lipid rafts and a risk factor for ad , was the obvious choice to target . for a recent review of the involvement of cholesterol in ad , cholesterol depletion has indeed been shown to reduce app partitioning into lipid rafts which precludes its interaction with bace1 and -secretase components , thus lowering a production . hypercholesterolaemia is linked to increased a production and deposition in the brain , both in humans [ 4345 ] and in rodents [ 4648 ] and is linked to an increased risk of developing ad . cholesterol depletion also lowers a production in cultured cells and one study showed that a 70% reduction in cholesterol in living hippocampal neurons was sufficient to completely abolish a production . taking this into account , cholesterol - lowering drugs known as some retrospective epidemiological studies have shown that the administration of statins , which lower cholesterol levels , can reduce the incidence of dementia , including ad [ 5153 ] . however , other studies have shown no correlation between statin usage and dementia and the effect of statins upon disease progression and cognitive decline in ad patients has been challenged . intriguingly , it was revealed recently that a production actually reduces cholesterol in cultured cells of neuronal origin by increasing efflux , possibly acting as a chaperone to remove excess cholesterol from the brain to the circulation . although a reduction in cholesterol may go some way towards reducing a levels in the brain , much longer - term epidemiological studies and clinical trials initiated before significant neuronal loss and cognitive function are apparent are required in order to further elucidate the effects of lowering cholesterol levels upon ad onset and neuropathology . lipid rafts contain many essential components other than cholesterol , such as sphingolipids , and it is likely that the modulation of just one factor will not completely abolish a production in vivo . it is important to remember that cholesterol metabolism in the brain is largely isolated from the rest of the body by the blood - brain barrier . as nearly all of the cholesterol in the brain is synthesised in situ , the modulation of cholesterol levels within neurons represents a more difficult pharmaceutical challenge and the blood - brain barrier permeability of the drugs used needs to be considered . furthermore , even if cholestxerol depletion mediates a reduction in a levels , a oligomers effect neurotoxicity and memory impairments at low nanomolar concentrations . therefore , residual levels of a production may be sufficient for continued a oligomer - mediated toxicity .", "the a peptide is natively unfolded and , under certain conditions , it aggregates to form a heterogeneous mixture of soluble oligomers , protofibrils and fibrils . it was accepted for a long time that the a fibrils that deposit in neuritic plaques , which are observed post mortem in diseased brains , were responsible for neurotoxicity in ad . a fibrils have been reported to induce neuronal dysfunction and cell death , although fibrils are less potent neurotoxins than soluble forms of a [ 60 , 61 ] . interestingly , fibrils have been found to become more neurotoxic upon fragmentation , raising the possibility that soluble species released from fibril ends may underlie their neurotoxicity . a plethora of studies have now demonstrated that levels of soluble a oligomers in the brain correlate much better than plaques or fibrils with ad onset , progression and severity [ 5 , 6 , 8 , 63 , 64 ] . within the last fifteen years , a large number of studies from research groups worldwide have reported the existence of many different oligomeric assemblies from various sources , including ad brain and cerebrospinal fluid ( csf ) samples , secreted into the conditioned medium of cultured cells or prepared artificially from recombinant or synthetic a peptides . a heterogeneous range of sizes and peptide conformations have been observed among these natural and artificial a oligomers , including dimers and trimers [ 66 , 67 ] , tetramers , hexamers and the dodecameric a*56 , globulomers , ring - shaped annular protofibrils and higher molecular weight a-derived diffusible ligands ( addls ) which can comprise hundreds of monomeric subunits [ 9 , 70 ] ( figure 2 ) . however , despite the disparity in size and source , a oligomers appear to share important functional properties . notably , both natural and synthetic a oligomer preparations bind to hippocampal neurons and cells of neuronal lineage , causing a loss of dendritic spines , neurotoxicity , the inhibition of long - term synaptic potentiation ( ltp : an electrophysiological correlate of learning and memory ) and impairments in working memory at nanomolar concentrations [ 64 , 67 , 68 , 7073 ] . the preferential binding and toxicity of a oligomers towards neurons in the hippocampus may explain why a oligomers correlate with ad severity and disease progression [ 9 , 68 , 70 ] . a is a physiological peptide which is present in the brain tissue and csf of healthy subjects throughout life , without necessarily causing neurodegeneration [ 7476 ] . many studies have shown that monomeric , nonaggregated a does not cause the neurotoxic effects that are mediated by a oligomers . in fact , monomeric a has recently been reported to have neuroprotective roles in the brain [ 77 , 78 ] . the aggregation of a is necessary for its toxicity and the emerging picture is that soluble a oligomers are the proximate neurotoxins in ad [ 8 , 80 ] . the aggregation of a is therefore a critical step in the development of ad pathogenesis , and one in which lipid rafts appear to play a fundamental role . neuronal sensitivity to a-induced toxicity has been found to be dependent upon a binding to the cell membrane and a has been identified in lipid rafts from cultured cells and from human and rodent brains . soluble a dimers accumulate rapidly , and have been found at elevated levels , in lipid raft fractions isolated from human and transgenic mouse model ad brains . importantly , a has been shown to accumulate in presynaptic terminals in ad cortex where it colocalises with the lipid raft markers cholesterol and ganglioside gm1 . taken together , these data suggest that a accumulation and aggregation within lipid rafts may underlie ad neuropathology . as cholesterol is a major component of lipid rafts , it was postulated to facilitate a oligomerisation on neuronal membranes . the brain is particularly enriched in cholesterol , harbouring over 23% of the body 's total complement but comprising only around 2% of total body mass . however , the role of cholesterol in promoting the assembly of a is controversial and conflicting evidence has been presented in recent years . the main difficulty is being able to distinguish between the key role of cholesterol in building the lipid raft domains necessary for a production and the suggested role of cholesterol in promoting a oligomerisation . as discussed previously , raised cholesterol has been linked to ad ; is this solely due to an increase in total lipid raft composition of the plasma membrane which increases amyloidogenic processing of app to yield more a peptide or due to a direct effect on a oligomerisation ? a growing body of evidence suggests that certain components of lipid raft domains may play a much more sinister role in catalysing the conversion of the aggregation - prone a peptide to its neurotoxic , oligomeric states . cholesterol is known to modulate the interaction of the a peptide with lipid bilayers . further , a oligomers isolated from ad patients associate with drms in a cholesterol - dependent manner , and cholesterol depletion reduces the aggregation of a . it is currently unknown , however , whether this latter effect is due to a direct interaction between a and cholesterol , or due to the overall depletion in lipid raft domains and/or the subsequent change in composition and properties brought on by a reduction in cholesterol . conversely , a recent study revealed that increasing the level of cholesterol in human neuroblastoma cells actually reduced the ability of synthetic a oligomers to bind , in spite of the colocalisation of the a oligomers with the lipid raft component ganglioside gm1 . these data agree with the authors ' previous finding that an increased level of membrane cholesterol exerts a protective effect against a oligomer toxicity . in the more recent study it was proposed that a fluctuation in cholesterol levels may alter the physical properties of lipid rafts thereby modulating oligomer binding . cholesterol can also facilitate a aggregation through the structural modification of other lipid raft components . a recent study using reconstituted membranes revealed a structural role for cholesterol in modulating the conformation of glycosphingolipids . depending on the type of glycosphingolipid , cholesterol can either facilitate ( such as for ganglioside gm1 ) or inhibit the interaction of a peptides with lipid rafts through fine - tuning of the glycosphingolipid conformation . this reinforces the notion that a binding to , and aggregation upon , neuronal lipid raft domains can not be ascribed to a single component , but rather that multiple players are likely to be involved . in fact , mounting evidence suggests that gangliosides within lipid rafts appear to be the main driving force behind the oligomerisation of a on neuronal membranes . the development of ad within certain brain regions has been found to correlate with increased ganglioside levels . gangliosides are glycosphingolipids with one or more sialic acid moieties attached to the sugar chain . gangliosides are found predominantly in the central nervous system , where they are enriched in lipid rafts due to the preferential packing of their saturated acyl chains within the liquid - ordered phase . a study in 1995 revealed that a population of membrane - bound a tightly bound to gangliosides exists in ad brains . more recently , exogenously - applied a was shown to bind to neuronal membranes and to redistribute into lipid rafts where it colocalised with ganglioside gm1 in a time - dependent manner . gm1 facilitated the binding and accumulation of a oligomers at lipid raft domains and appeared to be required for the a oligomer - mediated lipid peroxidation of drms . ganglioside gm1 contains just one sialic acid moiety and plays important physiological roles in neuronal function . a appears to interact with the sialic acid moiety of gangliosides such as gm1 and these bound aggregates can go on to seed further a aggregation . the interaction between sialic acid and a induces a conformational rearrangement of the a peptide chain which may potentiate a oligomerisation . drms derived from ganglioside - rich rat brain , but not from liver , were found to promote the oligomerisation of a . further , this study revealed that the removal of cholesterol or protein from these raft fractions did not prevent a aggregation , providing evidence that neither cholesterol nor protein is essential for this process . however , lipid raft fractions containing very low levels of gangliosides still retained some a oligomerisation ability , and therefore ganglioside - independent aggregation mechanisms can not be ruled out .", "when the first synthetic a oligomers were prepared from a142 peptide by the klein laboratory in 1998 , it was observed that their binding to hippocampal neurons and cultured nerve cells was abolished by treating the cells with trypsin . this , coupled with the low oligomer concentration ( 5 nm ) required for neurotoxicity , implied that specific protein receptors were responsible for the binding of a oligomers and for the subsequent transduction and amplification of neurotoxicity . indeed , a recent study found that a oligomer binding to neurons was saturable with an estimated apparent kd of ~0.4 nm . this finding implied that one or more high - affinity receptors are responsible for a oligomer binding and subsequent neurotoxicity . immunofluorescence microscopy has revealed that a oligomers bind to dendritic spines of hippocampal neurons where they colocalise with postsynaptic markers [ 9 , 98 , 99 ] . interestingly , a oligomer binding to neurons has a punctate appearance , which is reminiscent of the appearance of lipid raft localised proteins . several putative neuronal receptors for a have been identified in recent years , namely proteins that are related to mechanisms of memory and neuroprotection in the brain . noteworthy , all of these receptors either reside primarily within , or can partition into , lipid raft domains at the surface of neurons . lipid rafts may therefore hold the key to understanding how the deleterious effects of a oligomers are transduced through binding to specific receptors within these microdomains . in 2009 , laurn and colleagues reported that the cellular prion protein ( prp ) is a specific , high - affinity neuronal receptor for a142 oligomers . prp is a gpi - anchored protein that is expressed at high levels in the brain , particularly at synapses and axons , where it resides in lipid rafts . the misfolded form of the prion protein ( prp ) is infamous for being the causative agent in mad cow disease ( bovine spongiform encephalopathy , bse ) and its human equivalent , creutzfeldt - jakob disease ( cjd ) . although the correctly - folded prp is critical for prion disease pathogenesis , its physiological function remains enigmatic , with potential neuroprotective roles in oxidative stress defence , metal ion homeostasis and antiapoptosis . in a search to identify neuronal receptors for a oligomers , laurn et al . screened a mouse brain expression library of 225,000 cdna constructs from which only two positive clones , both encoding full - length prp , were isolated that were able to bind a oligomers with high affinity and specificity . interestingly , the prp homologues shadoo and doppel were found not to bind a oligomers to any significant degree . a further , more focussed screen of 352 clones encoding transmembrane proteins identified amyloid- precursor - like protein 1 ( aplp1 ) and transmembrane protein 30b ( tmem30b ) as weak a receptors , although their specificity for oligomeric a was poor . the 7 nicotinic acetylcholine receptor ( nachr7 ) and the receptor for advanced glycation end products ( rage ) were also assayed due to their previously reported affinities for a peptides [ 103 , 104 ] , although neither displayed high - affinity a oligomer binding . therefore , prp was the only identified receptor to display both high affinity and high specificity for a oligomers . a direct interaction between prp and a oligomers was confirmed and the core oligomer binding region of prp was narrowed down to amino acids 95110 , a positively charged cluster rich in lysine residues . prp was also shown to mediate the inhibition of ltp that is induced when hippocampal slices were incubated with a oligomers at nanomolar concentrations . a follow - up in vivo study revealed that the presence of prp is required for the a oligomer - mediated memory impairments in an ad model mouse . taken together , these data indicate a strong association between a oligomers binding to prp within lipid rafts of hippocampal neurons and the induction of memory deficits that are characteristic of ad . nevertheless , there has been some dispute over the role of prp in transducing the deleterious effects of a oligomers in vivo , as other studies have reported data which oppose this theory . first , balducci and colleagues reported that although a oligomers bind tightly to prp they cause impairments in long - term memory in mice independently of prp . in this study , the effects of synthetic a oligomers upon wild - type mice were observed , whereas gimbel et al . further , the synthetic depsipeptide and the oligomer preparation method utilised by balducci et al . differed from those used by gimbel and coworkers , raising the possibility that prp does not have the same binding affinity for all types of a oligomers . second , the aguzzi group crossed an ad mouse model , which suffers from a-dependent memory deficits in the form of ltp impairment , with mice expressing either wild - type prp , a secreted form of prp ( lacking its gpi anchor ) or no prp . they found that the presence or absence of wild - type prp had no effect upon the a-mediated inhibition of ltp . however , expression of the secreted form of prp was found to suppress the impairment in ltp , which the authors proposed may be due to the potential chelation and subsequent degradation of a oligomers by soluble prp in the extracellular milieu . third , kessels and coworkers reported the influence of prp upon hippocampal neurons expressing a c - terminally truncated form of app in a viral expression construct . the same loss of dendritic spines and inhibition of ltp were observed in the presence and absence of prp , suggesting that a-mediated synaptic defects do not require prp . however , laurn and colleagues have emphasised the differences in the model system utilised by kessels and coworkers in their study which may account for the opposing data , namely the viral expression of app , a higher concentration of a oligomers and a difference in the observed suppression of synaptic plasticity . further investigation is needed to clarify the role of prp in modulating the a oligomer - mediated impairments in memory and ltp . differences in the oligomer preparations , age and genotype of the mouse models , the nature of the promoter elements driving gene expression and the particular memory tests employed by the different authors may account for the discrepancies in the data . the binding of a oligomers to prp is not the first time that prp has been linked to ad . senile plaques from a subset of ad patients were observed to contain prp and abundant a deposits have been observed in some cjd cases . furthermore , the met / val 129 polymorphism in the prnp gene that encodes prp is a risk factor for early - onset ad . in 2007 , we demonstrated that prp negatively modulates a production through inhibition of the app cleaving enzyme , bace1 . these data , along with the recent discovery that prp binds to a oligomers and transduces their deleterious effects , raises the intriguing possibility of a feedback loop . we propose that , physiologically , prp maintains a production at a low level through bace1 inhibition , but in ad this interaction may be disrupted by a oligomers binding to prp and causing its segregation from bace1 . therefore , a oligomers binding to prp may also promote their own production through the ablation of bace1 inhibition by prp . more recently , levels of prp have been shown to be reduced in ad brains [ 115 , 116 ] possibly arguing against prp being involved in mediating the neurotoxic effects of a oligomers , at least in the terminal stages of the disease . it is important to note that laurn and colleagues reported that the removal of prp from hippocampal neurons only reduced a oligomer binding by approximately 50% . this suggests that other receptors not identified in the expression library screen due to nonpreferential binding conditions or a low affinity for the particular type of a oligomers that were used , and/or nonprotein lipid raft components , may play equally crucial roles in a oligomer binding and neurotoxicity . glutamate receptors , which possibly exist in a complex with prp , represent a candidate interacting partner for a oligomers which could explain the deleterious effects upon hippocampal synaptic plasticity . synaptic failure and impairments in synaptic plasticity are hallmarks of early ad neuropathology [ 100 , 118 , 119 ] . ltp and long - term depression ( ltd ) are mechanistic dimmer switches which facilitate synaptic plasticity by strengthening or weakening communication across a synapse , respectively , with ltp being essential for hippocampal - dependent learning and memory [ 120 , 121 ] . numerous lines of study have confirmed that soluble a oligomers from various sources , including those isolated from ad brains , disrupt hippocampal ltp in vitro and in vivo and cause impairments in learning and memory [ 9 , 67 , 70 , 107 , 122 , 123 ] . although not all studies agree , it has also been demonstrated that a oligomers can provoke ltd which opposes ltp [ 67 , 124 , 125 ] . neuronal receptors which modulate ltp and/or ltd are therefore likely candidates for the specific binding of a oligomers . additionally , glutamate receptor dysfunction has been implicated in ad which is characterised by memory deficits caused by impaired synaptic plasticity . glutamate receptors consist of two classes ; ionotropic ( cation - specific ion channels ) and metabotropic ( g - protein - coupled ) . n - methyl - d - aspartate receptors ( nmdars ) constitute a major class of glutamate receptors in the mammalian brain which localise to the postsynaptic membrane of excitatory synapses . the membrane channel is usually blocked by mg ions which are displaced when synaptic transmission results in depolarisation and glutamate release and binding . nmdar channel opening leads to the rapid influx of ca which triggers ltp induction . longer - term effects which maintain the reinforced synapse include the activation of -amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptors ( ampars ) , altered gene expression and kinase activity and the growth of new dendritic spines . interestingly , nmdar activation can also stimulate ltd , having the opposing effect of synapse weakening , and this appears to depend upon the nature of the stimulus and the subtype of nmdar involved . nmdars localise to lipid raft domains where they interact with flotillins [ 131 , 132 ] although they can move laterally between raft and nonraft domains in response to cues including phosphorylation . statins , which deplete cellular cholesterol thus reducing lipid raft formation , have been shown to reduce the localisation of nmdars to lipid raft domains , which has a neuroprotective effect . mounting evidence points towards a central role for nmdars in the modulation of a oligomer toxicity . soluble a oligomers inhibit nmdar - dependent ltp [ 70 , 135 ] and exhibit postsynaptic binding to hippocampal neurons which express nmdar subunits glun1 and glun2b . a reduction in nmdar subunits glun1 and glun2b crucially , a recent study has confirmed that a oligomer - mediated early synaptic dysfunction depends upon the activation of glun2b - containing nmdars . a oligomers were found to decrease the nmdar - dependent influx of ca into dendritic spines , and to reduce dendritic spine and synapse density in a mechanism which involve the subsequent phosphorylation of tau . nmdar antagonists , including one which is specific for glun2b subunits , were able to reverse the a-induced loss of dendritic spine density [ 100 , 137 , 139 ] . these effects are consistent with a oligomers blocking the nmdar - mediated stimulation of ltp whilst promoting nmdar - mediated ltd . in addition , a oligomers have been shown to stimulate the excessive generation of reactive oxygen species ( ros ) through an nmdar - dependent mechanism , suggesting a link between aberrant ros regulation and a-induced cognitive impairment . furthermore , evidence to confirm a direct interaction between a oligomers and nmdar subunits has recently been presented . partial colocalisation was observed between nmdar glun2b and a oligomers in hippocampal slices , which increased upon the addition of glutamate , although the maximum colocalisation was less than 50% . however , an indirect model proposed by venkitaramani and colleagues suggests that the a oligomer - mediated decrease in glun2b - containing nmdars results from the former binding to -7 nicotinic acetylcholine receptors ( 7nachr ) , which activates striatal - enriched tyrosine phosphatase ( step ) , in turn stimulating nmdar internalisation . more recent data has revealed elevated levels of step in a mouse model of ad and in human ad brains , and that the removal of step abrogates the a-mediated reduction in nmdars at the cell surface . whether or not a oligomers interact with nmdars directly , growing evidence suggests that nmdars play an important role in transducing the deleterious effects of a oligomers upon synaptic functionality . the mglur5 metabotropic glutamate receptor plays important regulatory roles in neuronal calcium mobilisation and the modulation of ltp and excitatory postsynaptic potentials in hippocampal neurons [ 144 , 145 ] . recently , mglur5 was identified as a novel a oligomer receptor in a study of the behaviour of fluorescently - labelled a oligomers on hippocampal neurons and their interaction with neuronal receptors . the a oligomers bound to excitatory synapses where their mobility decreased as they aggregated to form larger clusters over time . consistent with previous data , a oligomers caused a removal in nmdars from synapses and were found to coimmunoprecipitate with nmdar subunits . interestingly , the a oligomers also formed complexes with mglur5 receptors , which caused their lateral redistribution into dendritic spines followed by ca dysregulation . renner and colleagues also observed a time - dependent increase in lipid raft - localised mglur5s which suggests that a oligomers reduce the mobility of mglurs , causing their aberrant aggregation within pathological signalling platforms . when mglur5 was removed from mouse hippocampal neurons , a oligomer binding was reduced by approximately 80% and the loss of nmdars from the cell surface was prevented . metabotropic glutamate receptors have been implicated previously in the pathogenesis of ad and other neurodegenerative disorders . impaired mglur signalling in the cortex of ad patients has been shown to correlate with ad - related neuropathological changes . a recent study revealed that the a peptide upregulates the expression of mglur5s in astrocytes , protective nonneuronal cells which are implicated in ad pathogenesis and inflammation . increased levels of mglur5s were observed in the brains of down 's syndrome patients ; a disease in which elevated levels of a result from the triplication of the app gene . various other lipid raft - associated proteins have been reported to effect a-mediated synaptic dysfunction . for instance , the removal of nerve growth factor receptors ( ngfrs ) , including trka and p75 neurotrophin receptor , from cells treated with gm1-induced a oligomers caused a significant reduction in oligomer - mediated cytoxicity . ngfr dysfunction and aberrant ngf signalling is associated with ad and increased a production [ 152 , 153 ] . although no direct interaction has been shown to our knowledge , it is possible that interplay between a oligomers and ngfrs may form part of a positive feedback loop which serves to reinforce a oligomer production , whilst blocking ngf signalling with deleterious effects upon neuronal survival . physiologically , ngf binds to trka causing the translocation and clustering of receptors within lipid rafts . the binding of a oligomers to trka and other ngfrs may therefore cause aberrant lipid raft clustering which prevents or disrupts the formation of the normal signalling platforms . recent research proposes that impaired insulin signalling may be involved in ad , even leading to the hypothesis that ad represents a third type of diabetes . insulin receptors , which are robustly expressed in hippocampal neurons , were found to bind a oligomers and to undergo internalisation from dendritic spines . perturbations in insulin signalling in the brain caused by a oligomers may impair memory and ltp . interestingly , insulin receptor subunits are also enriched in lipid raft domains in hippocampal neurons . the emerging picture is that lipid rafts accommodate multiple receptors for a oligomers , namely prp along with nmdar , mglur5 and possibly other , lower affinity receptors . interestingly , there is evidence to suggest that these three lipid raft - associated receptors interact together . it has also been reported that prp inhibited nmdar function in hippocampal neurons and coimmunoprecipitated with nmdar subunits . the functional and physical links between these a oligomer receptors suggest the existence of a multi - component , a oligomer binding raft complex , comprising of prp , mglur5 and nmdar ( figure 3 ) . whether the formation of this complex is required for oligomer binding , or whether the interaction of a oligomers with the individual proteins induces its assembly , is a chicken and egg situation . one possible hypothesis is that a oligomers promote the clustering of prp and glutamate receptors into pathological mega - scaffolds which induce both toxic loss- and gain - of - function downstream effects . for instance , the aberrant localisation of glutamate receptors may impede neuronal signalling mechanisms including ltp , while the clustering or internalisation of nmdars may promote their ltd - inducing functionality . the combined effects of oligomer binding upon more than one glutamate receptor is likely to be a large disturbance in ca homeostasis which results in pathological signalling cascades . interestingly , the prp - mediated response to oxidative stress is thought to induce signalling cascades which can modulate ca flux and synaptic plasticity . furthermore , a oligomers may cause the internalisation or loss of function of components such as prp thus reducing neuroprotection against oxidative stress at the cell surface . the clustering of a oligomers at lipid raft domains may also cause damage to physiologically important signalling rafts , thus impairing neuronal function . furthermore , the a oligomer - induced redistribution of neuronal proteins into lipid rafts may influence their nonraft interacting partners , with additional deleterious effects upon neuronal function and integrity .", "neuronal lipid rafts are crucial modulators of a production and aggregation , leading to the accumulation of neurotoxic a oligomers in the brain which drive ad pathology . recent evidence now incriminates lipid rafts as pathological signalling platforms in which a oligomer receptors , such as prp and glutamate receptors , cluster . a oligomer binding appears to induce the aberrant localisation of these proteins with deleterious effects upon their physiological functions including hippocampal ltp , which underlies memory , and defence against oxidative stress . in this way , lipid rafts appear to be directly responsible for the transduction of a oligomer - mediated memory impairments and neurotoxicity which characterise ad . lipid rafts are not only implicated in ad but may also be the key to a range of neurodegenerative proteinopathies , including parkinson 's disease , huntington 's disease , amyotrophic lateral sclerosis and prion diseases ( reviewed in ) . indeed , lipid raft disruption protects neurons against the toxicity of other oligomers besides a and lipid rafts may therefore represent generic platforms for oligomer - mediated neurotoxicity . understanding the cell biology of the downstream effects of amyloid oligomers binding to neuronal lipid raft proteins may uncover potential therapeutic targets for the prevention of ad and other neurodegenerative diseases ." ]

[ "in dentistry , the concept of aesthetics is extremely subjective and is related to beauty , harmony and the needs of the patient . the interactions between new restorative materials and techniques allow the reproduction of dental structures , restoring form and function in such a way that restorative procedures become imperceptible . nevertheless , during the evaluation of aesthetically compromised teeth , we encounter unfavorable clinical situations of great complexity , characterized by deep invasions of the mineralized structures . the reproduction of the optical characteristics of the teeth , such as translucency , opalescence and fluorescence , requires a considerable knowledge of restorative techniques and the materials currently available . dental enamel defects have been associated with a broad spectrum of aetiologies , including genetic and epigenetic factors such as systemic , local and environmental factors . a serious disturbance that occurs during the stages of enamel formation will impact the quality and/or quantity of the enamel formed , depending on the phase of amelogenesis that is affected and the duration of the stimulus on the ameloblasts . the consequence of this disturbance in the formation of the organic enamel matrix is enamel hypoplasia , which can be characterized as small grooves , depressions and cracks in the enamel surface that can be viewed in mild cases . this article presents a case report of a restorative treatment of enamel hypoplasia using hybrid composite resin to mask color alteration and enamel defects of the anterior upper teeth .", "a 22-year - old female patient was referred to the dental clinic , reporting a visual discomfort from the presence of irregularities and discoloration in the maxillary incisors . dental history and clinical examination revealed that she had a soft form of enamel hypoplasia [ figure 1 ] . clinical examination also evidenced an enamel defect in the maxillary lateral and central incisors , with rough surfaces with irregular limits that principally involve the middle third of the crown [ figure 2 ] . initial clinical aspect of the maxillary incisors a buccal view of the central and lateral incisors with hypoplastic alterations the clinical situation revealed that it was not possible to re - establish aesthetics and function without the use of a restorative procedure . the position and pattern of the enamel irregularities , the occlusion and a tooth remnant with a large substrate suggested that a composite resin restoration would be a reliable option for this case . the patient was systemically healthy , presented an overall plaque index and gingival index of below 10% and the restorative area was free from visible plaque . a slight enameloplasty , using a spherical 1015f diamond bur ( kg sorensen , so paulo , brazil ) and manual instruments , was performed on both the irregularities and the limits of the tooth defect [ figures 3 and 4 ] . the regularization of the defects created a good substrate that was favorable for adhesive restorations . delimitation of the tooth irregularities with graphite enameloplasty with a spherical diamond bur for smoothing out defects the color was recorded using the vitapan classical scale ( vita zahnfabrik , bad sckingen , germany ) , and the shade a2/a3 was considered as the initial color . briefly , the dental surface was acid etched ( 35% phosphoric acid ) [ figure 5 ] , rinsed for 30 s and dried with absorbent paper . a two - component adhesive system ( adhese , ivoclar vivadent ag , schaan , liechtenstein ) was applied on the dentin and the enamel and was light - cured for 10 s with an intensity of 1400 mw / cm ( radii led curing light , sdi , australia ) [ figure 6 ] . the dental surface was acid etched ( 35% phosphoric acid ) a two - component adhesive system was applied on the dentin and on the enamel a combination of the incremental and stratified layering technique was used to fill the tooth using a highly aesthetic nanohybrid composite resin , ips - empress ( ivoclar vivadent ag ) . the composite was added in increments of 1.52 mm and was light - cured after every layer , according to the manufacturer 's instructions . first , the dentin was simulated with a thin layer of a microhybrid composite ( da3 ) and a final layer with an enamel composite ( ea2 ) , which was placed with a fine # 2 brush ( cosmedent , chicago , usa ) for fine detailing / texturizing to simulate the enamel , increasing the final brightness of the restoration [ figure 7 ] . a clinical view of the central incisor immediately after the restorative procedures the contouring was refined using 30-blade carbide trimming burs ( 9714ff , kg sorensen ) , and the final polishing was performed with a high - luster polishing paste ( opal l , renfert gmbh , hilzingen , germany ) using goat - hair brushes and cotton buffs ( renfert gmbh ) . four months after the restoration , a good final aspect was observed and the lateral smile view exhibited an imperceptible restoration [ figures 8 and 9 ] .", "with the valuation of aesthetics , minimally invasive restorative techniques have provided an expansion of the current conservative philosophy . nevertheless , during the evaluation of aesthetically compromised teeth , we encounter adverse clinical conditions of great complexity , marked by the invasion of the mineralized structures at depth . enamel hypoplasia is an incomplete or defective formation in the organic matrix of the enamel and remaining certain areas susceptible to decay ; it is responsible for a major proportion of lesions . the irregularities present in a hypoplasia provide favorable conditions for the retention of plaque and the early development of caries lesions , which progress and reach deep into the enamel and the dentin . one of the signs of hypoplastic lesions is diminishing enamel luster and dental surfaces that have become eroded with cavitations and irregular wear because of the loss of the microanatomy affecting the color , morphology and texture of teeth . on some occasions , hypoplasia is mistaken for fluorosis ; however , enamel hypoplasia is an incomplete or defective formation in the organic matrix of the enamel , triggered by diseases , systemic disorders , trauma and infections in the pulp of deciduous teeth . it manifests with partial or complete absence of the enamel , which can be systemic ( when it affects a group of teeth ) or local ( when it has asymmetric distribution and is relegated to a single tooth ) . because it is neither fully transparent nor fully opaque , some modern composites provide optical similarities consistent with natural teeth , yielding satisfactory levels of opalescence , value and chroma . it is important to consider that the final restoration is dependent on both the thickness and the varying degrees of translucency and opacity of the several layers of the composite . of all dental structures describe a minimally invasive technique performed in cases of enamel hypoplasia based on enamel microabrasion and complemented with composite resin restorations . the procedures employed are simple , but they require knowledge of the real causes of the staining and comprehension of restorative techniques . various treatment protocols may be performed , depending on the level of involvement and the severity of the lesions . composite resin restorations are fully capable of reproducing the appearance of a natural tooth with highly aesthetic outcomes . in this context , the main goal of the treatment of enamel hypoplasia is to re - establish the anatomical harmony between occlusion , function and aesthetics and to restore patient self - esteem , promoting social and psychological benefits .", "in conclusion , this case report demonstrates that restorative rehabilitation , in addition to promoting health , may provide a more favorable aesthetic appearance for the smile , matching the tooth polychromatic and raising the self - esteem of the patient ." ]

[ "gastrointestinal lipomas are rare , mostly small and detected incidentally during endoscopic examination ( 1 ) . these tumours are benign proliferations of mature fatty tissue arising in the submucosa and predominately arise in the large intestine ( 51 - 70% ) preferentially on the right side . the majority of symptomatic lesions occur in adults in the sixth decade of life ( 2 ) . lipohypertrophy of the ileo - caecal valve is classified as a variant of normal ( 1 ) . the vast majority are asymptomatic but they can manifest due to intussusceptions , ulceration leading to haemorrhage or iron deficiency anaemia , intestinal obstruction or present as an abdominal mass . most are compressible and submucosal although they can rarely develop in the serosa and appear as a fold or polyp . they contain mature adipose tissue and usually have a thick capsule surrounding the tumour ( 2 ) . these changes if extensive can mimic a liposarcoma ; however , frank liposarcoma of the colon is extremely rare and requires the presence of lipoblasts ( 2 ) . mucosal biopsies can be unhelpful and yield either intact mucosa , granulation / inflammatory changes or fat necrosis . . it can be difficult to separate the two and even endoscopic ultrasound can be non - diagnostic and adequate histology sampling may require a resection ( 3 ) . where a biopsy diagnosis has been made endoscopic resection or limited resection can be undertaken removing the need for major resectional surgery ( 3 ) . where this is not technically feasible a minimally invasive approach using either mini - laparotomy or laparoscopic resection has successfully been reported ( 4,5 ) .", "a 74 year old man with a background of chronic obstructive airways disease ( coad ) was referred for urgent assessment by his general practioner with a 1 month history of lower abdominal pain and altered bowel habit . abdominal and rectal examination was unremarkable and routine blood testing including carcinoembryonic antigen ( cea ) was normal . a large ulcerating polypoidal lesion was found at his hepatic flexure ( figure 1 ) . colonoscopy demonstrating large pedunculated ulcerating lesion found at hepatic flexure histology from biopsies taken showed no evidence of neoplasia or dysplasia but was felt to most likely be unrepresentative of the endoscopic lesion . a staging ct scan of chest , abdomen and pelvis was arranged as part of pre - operative staging protocol and this demonstrated a large 3.3 x 4.3 x 3.4 cm heterogeneous enhancing colonic polyp , which predominately enhanced with fatty attenuation ( figure 2 ) . proximal to the lesion was circumferential colonic wall thickening and surrounding fat stranding suspicious of colonic malignancy . there was concern about colonic malignancy and following discussion at a mdt meeting he was offered a surgical resection . ct scan of the abdomen showing the lesion ( marked a ) a laparoscopic extended right hemicolectomy was performed under general anaesthesia . there were no complications and the patient made an excellent recovery and was discharged home . gross and microscopic histological examination showed a submucosal lipoma with areas of fat necrosis and surface ulceration with extensive granulation tissue . polypoidal tumour measuring 4 cm with an area of central ulceration gross slices of the tumour show adipose tissue expanding the submucosa . there are areas of fat necrosis and mucosal ulceration microscopy shows lobules of mature adipocytes .", "imaging may reveal tissue with the signal and uptake of adipose tissue but a confident diagnosis may not be possible . endoscopists , radiologists and pathologists need to be aware of this entity . careful discussion and review of the investigations at an mdt meeting may permit a pre - operative diagnosis . endoscopic resection can be used where technically feasible but where doubt remains or this is not feasible then laparoscopic or open resection may be required ." ]

[ "pekinensis ) is a diploid ( 2n = 2x = 20 ) dicot with a genomic size of 550 mb ( http://www.brassica.info/resource/ ) . the species originated in china and now has become one of the most important and widely cultivated leaf vegetables in asia . the tight leafy head is the main edible part . after a long history of domestication , chinese cabbage evolves into different cultivars with a variety of characteristics , such as rosette leaf morphology , heading leaf morphology , leafy head shape , size , and structure , flowering time , nutrient composition , and resistance to biotic and abiotic . a better understanding of the molecular mechanism of evolution of chinese cabbage and further development of marker - assisted selection ( mas ) will accelerate the selection process of improved cultivars to meet the growing consumers and environmental needs . although progress has been made in underlining the molecular mechanism [ 25 ] , many aspects are still unclear . molecular markers have been widely used to study the genetic basis of important traits and map regulatory genes in plants . markers tightly linked with important agronomic traits can potentially be used for molecular breeding to develop improved cultivars . many molecular markers and genetic maps of chinese cabbage have been reported previously [ 625 ] . however , there is still a great need to develop novel molecular markers for construction of high - density linkage maps for genetics and molecular studies of important traits in chinese cabbage . simple sequence repeat ( ssr ) markers or microsatellite markers are among the most important markers in plants . ssrs have been widely used in genetic mapping and molecular breeding in plants because they are highly abundant and have significant polymorphism . other factors , like accessibility for detection , reliability , and codominance , also make them perfect markers for such purposes . ssrs found in transcribed sequences are called expressed sequence - simple sequence repeats ( est - ssrs ) . compared with genomic - ssrs detected in noncoding sequences , est - ssrs are more efficient for qtl mapping , gene targeting , and mas . as transcribed sequences are more conserved than noncoding sequences , the transferability of est - ssrs is better than genomic - ssrs [ 2830 ] , which can be utilized for cross genome comparison and evolutionary analysis [ 27 , 31 ] . additionally , abundant ests were generated in recent years with the development of next - generation sequencing approaches , making identification of est - ssrs more practical and cost - efficient . many est - ssrs have been identified in chinese cabbage [ 16 , 20 , 25 , 3336 ] . because whole genome sequencing of chinese cabbage is still underway , new est - ssrs could also be identified for further studies such as high - density genetic linkage map construction , gene / qtl mapping , and cultivar identification . in our previous study , the whole transcriptomes were analyzed for the rosette leaves and folding leaves of a typical heading chinese cabbage , namely , fushanbaotou , using a solexa / illumina rna - seq platform , and a large - scale est database was generated . in this study , we further assembled those ests from the rl and fl libraries into nonredundant unigenes . a total of 10,420 est - ssrs were identified , among which 2744 est - ssrs are detected for the first time , according to the ssr marker database for brassica ( http://oilcrops.info/ssrdb ) . we characterized these identified est - ssrs and designed 7877 pcr primer pairs for 1561 est - ssrs . furthermore , serving as a validation purpose , we tested polymorphisms of 24 est - ssrs . we expect this study can pave the road for further investigation of new est - ssr markers and for construction of high - density genetic maps .", "for est - ssr identification and primer design , a typical heading chinese cabbage , namely , fushanbaotou , was used in this study . for primer assessment and ssr polymorphism analysis , a panel of twenty - four cultivars of chinese cabbage was used , including nineteen morphologically diverse cultivars of brassica rapa l. ssp . pekinensis ( b. pekinensis l. ) and five brassica rapa l. chinensis ( b. chinensis l. ) . leaves were collected after they were grown for two weeks from ten seedlings of each cultivar and were pooled together for dna extraction . we assembled the clean read dataset presented by wang et al . from the rl and fl libraries according to the methods described by wang et al . using the trinity software ( http://trinityrnaseq.sourceforge.net/ ) . redundant sequences were removed and overlapping unigenes were assembled into continuous sequences by the tigr gene indices clustering ( tgicl ) tools . similarity was set at 94% and an overlap length was set at 100 bp . parameters were set with a minimum number of 12 , 6 , 5 , 5 , 4 , and 4 repeat units for identification of mono- , di- , tri- , tetra- , penta- , and hexanucleotide motifs , respectively . primer length ranged from 18 to 28 bp ( with an optimality at 23 ) . the physical positions of the est - ssrs identified in the study were determined by aligning the ssrs and flanking sequences ( 50 bp at each side ) to the brassica rapa ( chiifu-401 ) reference genome ( http://brassicadb.org/brad/ ) using blastn . new est - ssrs were identified by comparing with previously reported ssrs in the ssr marker database for brassica ( http://oilcrops.info/ssrdb ) . the dna sample of the chinese cabbage fushanbaotou was used as template to detect the availability of ssr primers designed above . the dna samples of those aforementioned twenty - four cultivars of chinese cabbage were used as templates for ssr polymorphism analysis . the polymorphisms of est - ssrs were validated by 6% denaturing polyacrylamide gel electrophoresis , 12% nondenaturing polyacrylamide gel electrophoresis , and sequencing .", "high quality clean read data from the rl and fl libraries by wang et al . a total of 99,684 and 95,411 contigs were obtained , with an average length of 333 and 342 bp and a median length ( n50 ) of 531 and 536 bp , from the rl and fl libraries , respectively ( table 1 ) . contigs from the same transcript were detected with paired - end reads , as well as the distances between these contigs . using the trinity software package , we assembled these contigs into unigenes , in which ns were removed . a total of 46,294 and 48,473 unigenes from the rl and fl libraries were obtained with an average length of 707 and 680 bp and a median length ( n50 ) of 1000 and 980 bp , respectively ( table 1 ) . size distribution of the contigs and unigenes is consistent with the rl and fl libraries as shown in figure 1 , indicating that our illumina sequencing solution is reliable and reproducible . unigenes from the two samples were combined ; redundant unigenes were removed ; and the rest was assembled with tgicl to form a single dataset , which represents 40.7 mb of sequence and contains a total of 51,694 nonredundant unigenes , with an average read length of 788 bp , and a median read length ( n50 ) of 1154 bp ( table 1 ) . the sequences of the unigenes are listed in table s1 ( see supplementary material available online at http://dx.doi.org/10.1155/2015/473028 ) . the length of 24,271 nonredundant unigenes ( 46.95% ) is between 200 and 500 bp ; the length of 13,613 ( 26.33% ) is between 501 and 1,000 bp , and the length of 13,810 ( 26.72% ) is longer than 1,000 bp ( figure 1 ) . a total of 10420 est - ssrs were detected with the microsatellite software ( misa ; http://pgrc.ipk-gatersleben.de/misa/ ) in 8571 unigenes , accounting for 16.6% of total nonredundant unigenes ( tables 2 and s2 ) . the mean ssr density is one per 3.9 kb , corresponding to one for every 5.0 nonredundant unigenes . 1502 unigenes ( 17.5% ) harbored more than one ssr and 666 ssrs ( 6.4% ) were present in compound formation that had more than one repeat type ( table 2 ) . the ssrs with tri- and dinucleotide repeat motifs were the most common ( 4,405 , 42.27% ; 4,043 , 38.80% , resp . ) , followed by mono- ( 1,644 , 15.78% ) , hexa- ( 126 , 1.21% ) , penta- ( 112 , 1.07% ) and tetra- ( 90 , 0.86% ) nucleotide repeat motifs ( figure 2 ) . the most common two repeat motif types accounted for 81.07% of the total ssrs detected , and the rest repeat motifs types only accounted for 18.93% . the iterate number of repeat units in an est - ssr ranged from 4 to 25 . the occurrence frequency of est - ssts with different iterate numbers was found to be unequal either . est - ssrs with iterate number of 5 ( 2832 , 27.18% ) were the most common ones , followed by 6 ( 2739 , 26.29% ) , 7 ( 1368 , 13.13% ) , 8 ( 703 , 6.75% ) , 12 ( 542 , 5.20% ) , and 9 ( 480 , 4.61% ) ( table s3 ) . a dinucleotide containing est - ssrs with a maximum of 25 repeat units was identified . for est - ssrs with more than 10 repeat units , the mononucleotide repeat motifs were the most abundant , accounting for 93.46% of these est - ssrs . the lengths of est - ssr sequences ranged from 12 to 65 bp ( table s4 ) . the longest one is a pentanucleotide containing est - ssr with 65 bp in length . the lengths of most est - ssrs are from 12 to 20 bp , accounting for 91.47% of the total est - ssrs , followed by est - ssrs with 2130 bp in length ( 874 ssrs , 8.39% ) . only 13 est - ssrs were identified with over 30 bp , accounting for 0.12% of the total est - ssrs . a total of 124 est - ssr motifs were identified , including 2 mono- , 3 di- , 10 tri- , 13 tetra- , 33 penta- , and 63 hexanucleotide repeat units containing est - ssrs . the dominant motif identified in our est - ssrs was ag / ct ( 3,519 , 33.8% ) , followed by a / t ( 1,562 , 15.0% ) , aag / ctt ( 1,445 , 13.9% ) , agg / cct ( 776 , 7.4% ) , atc / atg ( 627 , 6.0% ) , aac / gtt ( 392 , 4.4% ) , acc / ggt ( 392 , 3.8% ) , ac / gt ( 349 , 3.3% ) , and agc / ctg ( 317 , 3.0% ) ( figure 3 ) . the other 115 motifs have low frequency , accounting only for 9.3% of total est - ssrs . physical locations of the est - ssrs were assigned by searching against the nonredundant ( nr ) protein database of ncbi ( http://www.ncbi.nlm.nih.gov/ ) and the brassica database ( http://brassicadb.org/brad/ ) using blastx . our results showed that 4329 est - ssrs ( 44.4% ) were located in coding regions ( cdss ) , 3456 ( 35.5% ) in 5-utrs , and 1297 ( 13.3% ) in 3-utrs ( figure 4 , table s4 ) . locations of the remaining 672 est - ssrs ( 6.9% ) were not successfully assigned ( figure 4 , table s4 ) . for the est - ssrs localized in the cds region , trinucleotide repeats were the most common ones , accounting for 62.72% of the total est - ssrs localized in this region , followed by dinucleotide repeats ( 897 , 20.72% ) , mononucleotide repeats ( 325 , 7.51 ) , and compound formation ( 287 , 6.63% ) ( table s4 ) . dinucleotide repeats ( 1909 , 55.24% ) were the dominant types in 5-utrs , followed by trinucleotide repeats ( 730 , 21.12% ) , mononucleotide repeats ( 483 , 13.98% ) , and compound formation ones ( 214 , 6.19% ) ( table s4 ) . mono- , di- , and trinucleotide repeat est - ssrs were the top three types found in 3-utrs , accounting for 35.08% , 30.07% , and 28.60% of the total est - ssrs localized in these regions , respectively . the est - ssrs and the flanking sequences ( 50 bp on each side ) were aligned to the brassica rapa ( chiifu-401 ) reference genome ( http://brassicadb.org/brad/ ) using blastn to determine their physical positions . new est - ssrs were identified by comparing with the earlier reported ssrs in the ssr marker database for brassica ( http://oilcrops.info/ssrdb ) . a total of 2744 new est - ssrs ( 26.3% ) were identified in the study . of the 7676 known ssrs ( 73.6% ) , 2317 est - ssrs ( 22.2% ) show polymorphism with different repeat numbers , and 5359 ( 51.4% ) were exactly the same with the earlier reported ssrs based on the brassica rapa ( chiifu-401 ) genomic sequence ( table s2 ) . a total of 7877 pcr primer pairs from the unique sequences flanking 1561 est - ssr loci were designed according to the criteria described in section 2 using primer 3 ( table s5 ) . for each est - ssr locus , a maximum of 5 alternative primer pairs was designed . the other 8859 est - ssrs , which had no appropriate pcr primer pairs designed as their flanking sequences , did not fulfill the primer design criteria mentioned above . for the 1561 est - ssrs with pcr primers designed , pcr primers of those aforementioned 24 loci with n 20 bp were selected for primer synthesis and amplification evaluation in chinese cabbage fushanbaotou . nineteen ( 79.2% ) of these 24 est - ssr loci successfully yielded pcr amplicons in fushanbaotou . we sequenced these nineteen pcr amplicons and found that the amplicons in thirteen loci were exactly the same as expected ; two were longer than the expected size , and four were shorter ( table 3 ) . size deviation of five est - ssrs loci with the expected sizes ( br - es6 , br - es7 , br - es8 , br - es12 , and br - es18 ) was due to the variations of ssr repeat motifs ( table s6 ) . one amplicon ( br - es16 ) deviated from the expected sizes and had an additional 86 bp containing a ( tc)9 motif near the ssr repeat motif region ( table s6 ) . nineteen effective primer pairs were used for polymorphism validation for these aforementioned 24 chinese cabbage cultivars . the results showed that 17 loci ( 89.5% ) were polymorphic ( figure 5 ) . a total of 56 alleles at the 17 polymorphic loci were identified and the average number of alleles per ssr locus was 3.29 with a range between 2 and 6 . a maximum of 6 alleles was detected for br - es16 and br - es18 loci . br - es6 and br - es11 had no polymorphic allele in all 24 cultivars in this study ( figure 5 , tables 3 and s4 ) . of the 17 polymorphic loci , twelve loci were polymorphic in all cultivars of b. pekinensis l. and b. chinensis l. three loci ( br - es2 , br - es9 , and br - es19 ) had no polymorphism in the cultivars of b. pekinensis l. but had polymorphism in the cultivars of b. chinensis l. , while two loci ( br - es4 and br - es7 ) were polymorphic in the cultivars of b. pekinensis l. but were not polymorphic in the cultivars of b. chinensis l. ( figure 5 , table s8 ) . we sequenced the polymorphic alleles of the 17 polymorphic loci and found that polymorphisms of 9 loci ( br - es1 , br - es4 , br - es7 , br - es8 , br - es10 , br - es14 , br - es17 , br - es18 , and br - es19 ) were because of different iterate numbers of ssr repeat motifs . in another 6 polymorphic loci ( br - es2 , br - es3 , br - es12 , br - es13 , br - es15 , and br - es16 ) , the most polymorphic alleles were found in the repeat motifs with additional changes in other regions ( table s7 ) . for example , compared with the allele br - es3 - 160 bp in fushanbaotou , the polymorphic alleles br - es3 - 163 bp and 145 bp had different iterate numbers of the tag / atc repeat motif , while the polymorphic allele 99 bp had not only a different number of the repeat motif , but also a deletion in another region ( table s7 ) . the other two polymorphic loci , br - es5 and br - es9 , had polymorphisms that are not related with the repeat numbers of ssr motifs ( table s7 ) .", "illumina paired - end rna sequencing is one of the fast immerging next - generation sequencing ( ngs ) technologies . because of its advantages in high - throughput , high accuracy , and low cost , illumina paired - end sequencing has been widely used for de novo transcriptome sequencing and assembly and transcriptome quality and quantity analysis in many plants [ 37 , 38 , 42 , 43 ] . in our previous study , the transcriptome of rosette and folding leaves in chinese cabbage was analyzed using the illumina paired - end rna sequencing technology , and abundant clean reads and ests with high quality were obtained . the large quantity of clean reads would increase coverage depth of transcriptome nucleotide , enhance sequencing accuracy , and provide useful information for developing new tools for genetic mapping and molecular breeding of chinese cabbage . in this study , we further assembled the clean reads into contigs and unigenes from the rl and fl libraries , respectively . the parameters for both contigs and unigenes between the two libraries had no significant differences ( table 1 ) , indicating our illumina sequencing solutions have high reliability and reproducibility . the unigenes of the two libraries were further assembled and a total of 51,694 nonredundant unigenes were obtained from the 40.7 mb sequence data . we discovered more nonredundant unigenes than those in previous studies [ 35 , 36 ] , which represent a large portion of the chinese cabbage transcriptome and are important for a comprehensive understanding of est - ssrs . a total of 10,420 ssrs with over 12 bp were identified from the deep transcriptome sequence dataset of chinese cabbage . the frequency of occurrence of ssrs is slightly higher than those reported in previous studies on chinese cabbage ( about 8.415.6% ) [ 20 , 3436 ] and also higher than those of other dicotyledonous species such as peanut ( 6.8% ) , sweetpotato ( 8.2% ) , sesame ( 8.9% ) , pigeonpea ( 7.6% ) , grapes ( 2.5% ) , pepper ( 4.9% ) , and flax ( 3.5% ) , but it is lower than those of coffee ( 18.5% ) , radish ( 23.8% ) , and caster bean ( 28.4% ) . detection of est - ssrs depends on a number of factors such as genome structure , tools and parameters for est - ssrs detection and exploration , and size of dataset for unigene assembly . the frequency of ssrs with different sizes of repeat units is not evenly distributed in plants . previous studies showed dinucleotide ssr loci are the most abundant class in safflower , pigeonpea , and sesame , whereas trinucleotide repeats are the most frequent ones in barley , sweetpotato , jatropha curcas , iris , pepper , caster bean , flax , cucurbita pepo , and radish . in ramie and wheat , dinucleotide and trinucleotide trinucleotide ( 4405 , 42.3% ) was found to be the most common repeat motif class in chinese cabbage , followed by dinucleotide ( 4043 , 38.8% ) ( figure 2 ) . however , on the genomic level , of chinese cabbage , dinucleotide is the most common repeat motif , followed by trinucleotide . we found the most dominant mononucleotide repeat motif in chinese cabbage was a / t ( 1,562 , accounting for 15.0% of the total est - ssrs ) , which is consistent with previous reports for chinese cabbage and for other plants such as arabidopsis , rice , wheat , radish , castor bean , gossypium raimondii , oil palm , and eggplant . for dinucleotide motif , ag / ct was the most common repeat motif , accounting for 87.0% of the total dinucleotide est - ssrs . it is in close agreement with the results in previous studies for genic ssrs in chinese cabbage [ 20 , 36 ] and those in most other plants such as sweetpotato , iris , sesame , and radish . the ag / ct repeat motif was also the most dominant repeat among all the est - ssrs identified in this study , accounting for 33.8% of the total est - ssrs . however , for genomic - ssrs in chinese cabbage , at / ta is the most common dinucleotide motif . the aag / ctt ( 1,445 , 13.9% ) motif was the most frequent motif among trinucleotide est - ssrs in the study , which is consistent with the results in previous studies in chinese cabbage [ 25 , 36 ] and many dicot species , for example , arabidopsis , soybean , peanut , sweetpotato , radish , and sesame . in many monocot species such as maize , barley , and sorghum [ 66 , 67 ] , ccg / ggc is the most dominant trinucleotide repeat motif . it is considered a specific feature of monocot genomes due to the high gc content in monocot genomes . of all 10420 est - ssrs identified in this study , more than 70% have been identified and presented in the ssr marker database ( http://oilcrops.info/ssrdb ) , among which over half were exactly the same with the earlier reported ssrs based on the brassica rapa ( chiifu-401 ) genomic sequence ( table s2 ) . 2317 est - ssrs ( 22.2% ) with polymorphism in different repeat numbers could further be used for identification of chiifu-401 and fushanbaotou and for genetic linkage map constructions using these two cultivars as parents . a total of 2744 new est - ssrs ( 26.3% ) were identified in the study , which , in combination with previously discovered est - ssrs , could be used for high - density genetic linkage map construction , gene / qtl mapping , cultivar identification , and so forth . in the present study , 79.2% of the est - ssrs primer pairs selected for primer evaluation successfully generated high quality amplicons , indicating that the ests from the high - throughput rna sequencing of chinese cabbage transcriptome are suitable for specific primer design . the unsuccessfully designed primer pairs may be due to splice sites , large introns , chimeric primer(s ) , or poor quality sequences . we found that all amplicons contained the expected ssrs and the ssrs in 13 amplicons were exactly the same as predicted ( table s6 ) . the deviation of est - ssr pcr amplicons from the expected size is likely due to the presence of introns , large insertions or repeat number variations , a lack of specificity , or assembly errors . in the present study , we found five of six amplicons with unexpected sizes had different iterate number of ssr repeat units , while the other one had a 86 bp insertion near the expected ssr repeat motif region ( table s6 ) . these results suggested that the unigenes assembled from the high - throughput rna sequencing of chinese cabbage transcriptome are reliable , and the est - ssrs identified in our dataset could be used for further studies , such as genetic mapping and cultivar identification . most of the est - ssr loci ( accounting for 89.5% of the tested loci ) were found to be polymorphic among the 24 tested cabbage cultivars . the mean number of alleles per ssr locus was 3.29 with a range between 2 and 6 ( table 3 ) , indicating that polymorphism of est - ssrs in chinese cabbage is relatively high . most of the polymorphisms of the tested est - ssr loci are due to the variations of ssr repeat motifs in this study . there were only two loci where the polymorphisms were not related to the ssr repeat motif variations ( table s6 ) . the results indicate that the est - ssrs identified and the pcr primers designed in this study could further be used for constructing high - density genetic linkage maps , mapping quantitative trait loci , assessing germplasm polymorphism and evolution , marker - assisted selection , and cloning functional gene in chinese cabbage . in summary , we assembled a large set of clean reads with high quality derived from the chinese cabbage transcriptome using high - throughput rna sequencing technology with a solexa / illumina platform . a total of 51,694 nonredundant unigenes were obtained from 40.7 mb sequence data , providing substantial knowledge for est - ssr identification and characterization . 10,420 est - ssrs were identified and characterized , and pcr primer pairs for 1561 est - ssrs were designed . by comparing with previously reported ssrs in the ssr marker database for brassica ( http://oilcrops.info/ssrdb ) , we identified a total of 2744 new est - ssrs . primer pairs for 24 est - ssrs were selected for primer evaluation , and 79.2% of the 24 est - ssr loci successfully generated high quality amplicons . among the effective primers , 89.5% of them showed polymorphism in 24 cultivars of chinese cabbage . the est - ssrs developed in this study , in combination with previously reported est - ssrs , will provide valuable resources for constructing high - density genetic linkage maps , mapping quantitative trait loci , assessing germplasm polymorphism and evolution , marker - assisted selection , and cloning functional gene in chinese cabbage . to our knowledge , this is the first successful attempt to develop large quantity of est - ssrs with high quality based on the transcriptome of chinese cabbage using high - throughput rna sequencing technology ." ]

[ "much of the current success in clinical positron emission tomography ( pet ) can be attributed to the development of 2-(f ) fluoro-2-deoxy - d - glucose ( f18-fdg ) . it is the most commonly used radiopharmaceutical in the pet , with a half - life of 110 min . before the release of f18-fdg for human use , the quality control tests need to be performed to check the safety of the product . the bet using gel clot method is a 60-min test and typically performed after the decay of the f18-fdg sample to determine the endotoxin content . the gel clot is technically the most simple and was the first bet approved by the food and drug administration ( fda ) . endotoxin is a subset of pyrogens that are strictly of gram - negative origin , a natural complex of lipopolysaccharides occurring in the outer layer of the bilayered gram - negative bacterial cell . from the circulating blood cells of limulus polyphemus , called amebocytes , a clear lysate is obtained that forms an opaque gel in the presence of extremely low concentrations of bacterial endotoxins . pharmacopeia ( usp ) , pharmacopeia , f18-fdg should not contain more than 175/v usp endotoxin units ( eu ) per milliliter of f18-fdg injection , in which v is the maximum administered total dose in milliliters , at the expiration time . however , no such standards have been recommended by indian pharmacopoeia commission ( ipc ) till date . the ipc is taking measures to include radiopharmaceuticals in the indian pharmacopoeia . the objective of this study protocol was to set up a standard pyrogen testing facility and to establish documented evidence if the process employed for bet testing of f18-fdg by gel clot method produces the desired results consistently , when performed as per the standard operating procedures .", "random samples of the f18-fdg from september 2010 to march 2011 were subjected to the gel clot bet . f18-fdg was synthesized in the in - house medical cyclotron and radiochemistry lab at the department of nuclear medicine and pet centre , using the tracerlab mxfdg ( ge healthcare , mnster , germany ) . the assay was performed at four different maximum valid dilutions ( mvds , i.e. 1:10 , 1:100 , 1:350 and 1:700 ) . the ph of the samples was measured to ensure a ph within the range 6.08.0 for the validity of the gel clot procedure . the standard gel clot test for assessing the bacterial endotoxin content consisted of four controls : negative water control ( nwc ) , positive water control ( pwc ) , negative product control ( npc ) and positive product control ( ppc ) . the nwc is the endotoxin - free limulus amaebocyte lysate ( lal ) reagent water . the matched control standard endotoxin ( cse ) , lal reagent and lal reagent water obtained from charles river laboratories india private limited , bangalore , india , were used in this study . the sensitivity of the lal reagent contained in each vial was 0.125 eu / ml . the test for confirmation of lysate sensitivity was carried out with every new batch of the lysate as per the usp < 85 > recommendations . the cse having predetermined amount of endotoxin was prepared according to the directions for use given in the specific certificate of analysis ( coa ) . the cse stock solution of 20 eu / ml was prepared with endotoxin - free water and vortexed for 5 min . all the dilutions were made in the depyrogenated 16 125 mm glass tubes using endotoxin - free water and pyrogen - free sterile pipettes tips . depyrogenations were performed in the dry heat oven at 250c for 1 hour , when the endotoxin - free glass tubes were not obtained commercially . the bet was performed using 0.1 ml of f18-fdg sample and 0.1 ml of reconstituted lal reagent per tube . the lal reagent was constituted after the addition of lal reagent water ( endotoxin free ) in the freeze - dried power of lysate . the pwc and ppc used for these tests were at the endotoxin concentration of 0.5 eu / ml . the four dilutions of the f18-fdg , i.e. 1:10 , 1:100 , 1:350 and 1:700 , were freshly prepared from the batches and subjected to the gel clot assay . the ppc was separately prepared for all the dilutions at the endotoxin concentration of 0.25 eu / ml . the reaction solution was mixed thoroughly and placed immediately in the incubator at 37c1c for 602 min . at the end of the incubation period , if the gel had formed and remained intact in the bottom of the reaction tube after an inversion of 180 , the test was considered positive . a positive test indicated that the concentration of endotoxin in the tube is greater than or equal to the sensitivity of the lal reagent . any other state of the reaction mixture constituted a negative test , which indicated an endotoxin concentration less than the lal reagent sensitivity . the test was considered negative when the tube is inverted and the gel breaks or collapses .", "random samples of the f18-fdg from september 2010 to march 2011 were subjected to the gel clot bet . f18-fdg was synthesized in the in - house medical cyclotron and radiochemistry lab at the department of nuclear medicine and pet centre , using the tracerlab mxfdg ( ge healthcare , mnster , germany ) . the assay was performed at four different maximum valid dilutions ( mvds , i.e. 1:10 , 1:100 , 1:350 and 1:700 ) . the ph of the samples was measured to ensure a ph within the range 6.08.0 for the validity of the gel clot procedure .", "the standard gel clot test for assessing the bacterial endotoxin content consisted of four controls : negative water control ( nwc ) , positive water control ( pwc ) , negative product control ( npc ) and positive product control ( ppc ) . the nwc is the endotoxin - free limulus amaebocyte lysate ( lal ) reagent water . the matched control standard endotoxin ( cse ) , lal reagent and lal reagent water obtained from charles river laboratories india private limited , bangalore , india , were used in this study . the sensitivity of the lal reagent contained in each vial was 0.125 eu / ml . the test for confirmation of lysate sensitivity was carried out with every new batch of the lysate as per the usp < 85 > recommendations . the cse having predetermined amount of endotoxin was prepared according to the directions for use given in the specific certificate of analysis ( coa ) . the cse stock solution of 20 eu / ml was prepared with endotoxin - free water and vortexed for 5 min .", "all the dilutions were made in the depyrogenated 16 125 mm glass tubes using endotoxin - free water and pyrogen - free sterile pipettes tips . depyrogenations were performed in the dry heat oven at 250c for 1 hour , when the endotoxin - free glass tubes were not obtained commercially .", "the bet was performed using 0.1 ml of f18-fdg sample and 0.1 ml of reconstituted lal reagent per tube . the lal reagent was constituted after the addition of lal reagent water ( endotoxin free ) in the freeze - dried power of lysate . the pwc and ppc used for these tests were at the endotoxin concentration of 0.5 eu / ml . the four dilutions of the f18-fdg , i.e. 1:10 , 1:100 , 1:350 and 1:700 , were freshly prepared from the batches and subjected to the gel clot assay . the ppc was separately prepared for all the dilutions at the endotoxin concentration of 0.25 eu / ml . the reaction solution was mixed thoroughly and placed immediately in the incubator at 37c1c for 602 min . at the end of the incubation period , if the gel had formed and remained intact in the bottom of the reaction tube after an inversion of 180 , the test was considered positive . a positive test indicated that the concentration of endotoxin in the tube is greater than or equal to the sensitivity of the lal reagent . any other state of the reaction mixture constituted a negative test , which indicated an endotoxin concentration less than the lal reagent sensitivity . the test was considered negative when the tube is inverted and the gel breaks or collapses .", "the mean ph was 7.05 ( 6.57.5 ) . the total numbers of tests performed on the f18-fdg were 100 excluding nwc , pwc and ppc . table 1 summarizes the results of the undiluted f18-fdg on the positive control solutions at an endotoxin concentration of 0.5 eu / ml ( 4 ) . of the 10 undiluted f18-fdg batches , this indicated that all the batches did not contain endotoxin greater than 0.5 eu / ml . all the 20 positive endotoxin control pwc vials gelled . only 18 out of 20 ppc vials gelled after incubation at 37c for 60 min . results for undiluted f18-fdg sample table 2 summarizes the results for the 60-min gel clot assay on the four different dilutions of the f18-fdg samples . all the 20 positive endotoxin control pwc vials gelled . none of the 20 1:10 f18-fdg sample vials gelled after 60-min incubation at 37c . however , 1 out of 20 ppc vials for the 1:10 dilution did not gel probably due to some interference with the gel formation at the lysate sensitivity of 0.125 eu / ml . all the remaining vials for the 1:100 , 1 : 350 and 1:700 dilutions did not gel . this indicated that all the vials did not contain endotoxin greater than 0.125 eu / ml . results for the diluted f18-fdg samples", "the gel clot method is often considered as the most accurate and sensitive procedure for testing endotoxin content in injectable radiopharmaceutical products because fewer false - positive and false - negative results are observed when this method is used . the total time taken to complete the lal reaction requires optimal ph range . in the undiluted samples , the measured ph ( 7.05 ) was well within the acceptable range ( i.e. 6.08.0 ) for the gel clot assay . the f18-fdg produced in the tracerlab mx synthesis module is neutralized in the citrate buffer which contains multivalent ions . nakao et al . reported the effect of the citrate salt concentration on the endotoxin test for the f18-fdg preparations . these authors reported that the undiluted sample showed the recovery less than 20% , beyond the acceptance of the usp . similar results were found in the present study with the undiluted samples as two vials of the ppc ( endotoxin concentration equal to 0.5 eu / ml ) did not gel , indicating the interference with the gel formation . the interference may be due to the presence of the citrate ions . at the expiration time , the maximum administered total dose in milliliters of fdg should contain less than 175 eu . therefore , the total f18-fdg preparation at any time did not contain more than 8 eu ( 0.5 eu / ml 16 ml ) . however , the undiluted sample did show the inhibition of the gel formation as shown in table 1 . therefore , the sample was tested for the various dilutions 1:10 , 1:100 , 1:350 and 1:700 . the 350 and 700 dilution factors were considered according to the limit of 175 eu / ml ( single patient dose supplied to the other institute or when the final elution is in 23 ml due to some technical errors ) . the rate of inhibition improved with the dilutions in table 2 . the gel clot assay has a major drawback which limits its use for the short - lived radiopharmaceuticals . in addition to this drawback , errors made by technical personnel and the misinterpretation of results are also common problems . the 60-min bet is described in usp<85 > , bacterial endotoxins test , and is also recommended for pyrogenicity testing in the draft guidance of the fda on current good manufacturing practice ( cgmp ) for pet drug products . because the remainder of the required quality assurance ( qa ) testing for f18-fdg injection , with the exception of the sterility test , can be completed in approximately 2030 min , delaying the release of the short - lived f18-fdg injection for an additional 3040 min is not practical and is , in fact , wasteful . an in - process 20-min bet must be performed before release of the drug product , and a standard 60-min bet must also be completed . some other techniques to determine endotoxins are also known , such as the chromogenic ( color development ) and the turbidimetric ( turbidity development ) tests , both of which can provide valuable quantitative and qualitative information about the endotoxin concentration in samples . regardless of which method is used , pet laboratories and pharmacies should ensure that their technicians are well trained and educated in the endotoxin testing method of choice .", "this study suggests that the bet needs to be performed , standardized and documented in each cyclotron and pet facility . the dilution of the test sample is the easiest means to resolve the potential product inhibition / enhancement problem during the gel clot testing procedure . the final f18-fdg preparation at any time point did not contain more than 8 eu , thus making it safe for human administration ." ]

[ "prostate cancer becomes one of the most common cancers in developed and developing countries [ 13 ] . it is because life expectancy rised ; age is one of the prostate cancer risk factors . moreover there is wide availability of prostate - specific antigen ( psa ) serum test , which makes possible to diagnose clinically silent , low stage disease . number of such patients is growing and makes management of this disease even harder in every day oncology care ; optimal management is still controversial . there is a wide range of treatment methods and one of the most important outcome risk factors is local tumor control . there are risk categories , in which are propositions of treatment ( table 1 ) . very low risk category was introduced by national comprehensive cancer center ( nccn ) in 2010 . \n risk categories and treatment options according to nccn prostate specific antigen density if predicted probability of nodal involvement is 2% neoadjuvant , concomitant or adjuvant in selected patients without fixation radical prostatectomy ( rp ) remains one of basic curative therapy for prostate cancer , especially for low and inermediate risk patients . complications include perioperative short- term side effects as blood loss , wound infection or from anesthesia , and long - term , postoperative , as incontinence or impotence [ 58 ] . three - dimensional conformal radiotherapy ( 3dcrt ) , dynamic techniques like intense - modulated ( imrt ) or arc radiotherapy and extracranial stereotactic techniques allow to prepare normal tissue sparing plans with clinical target volume ( ctv ) high dose prescription . not only photon beams , but also particles , e.g. protons are used for highly conformal irradiation . every day image - guided radiotherapy ( igrt ) use , especially with intraprostatic seed markers , makes possible dose escalation and less toxicity with smaller margins contouring . brachytherapy , combined with external - beam radiotherapy ( ebrt ) or alone , remains one of best tools for absolute dose escalation inside prostate . due to low alpha / beta ratio for prostate cancer these protocols are favorable , in which hypofractionation is used . both low - dose ( ldr ) and high - dose rate ( hdr ) brachytherapy ( bt ) are used in prostate cancer patients . 27 kev , half - life : 59 days ) or palladium-103 ( pd ; mean photon energy 21kev , half - life : 17 days ) hdr brachytherapy is , particularly , based on iridium-192 ( ir ; mean photon energy 400 kev , half - life : 74 days ) stepping source , which is driven into temporary implant catheters by computer - controlled unit . it also makes high dose escalation possible , but interstitial implant is needed [ 12 , 13 ] . radiotherapy complications are acute and late , mostly in bladder and rectum , like incontinence , diarrhea , urinary stricture , impotence and proctitis . outcome is similar to surgery , however tolerance of treatment seems better for radiotherapy excluding proctitis rates , which are higher in irradiated patients . patient for rt are usually those , who can not undergo surgery , older than 65 years or with locally advanced disease , e.g. extracapsular spread [ 5 , 14 , 15 ] . patients with shorter life expectancy or inconvinced to treat their disease are recommended for psa testing at least every six months , digital rectal examination ( dre ) at least every twelve months and , especially those with longer life expectancy , for repeated prostate biopsy at least every year . if there is disease progression observed , then patient should undergo clinical evaluation to choose optimal treatment option . although clinical progression is still not well defined and requires physician judgement and treatment option should be chosen wisely after patient discussion with his doctor [ 5 , 16 ] . comparative analysis of psa free survival outcomes by prostate cancer results study group has been published , recently . it contains comparison of results from 848 articles selected from over 18000 published between 2000 and 2010 . only radical treatment was considered containing bt ( including hdr ) , ebrt ( including imrt ) , rp , proton thereapy , hifu and cryotherapy . pcrsg agreed unanimously for study inclusion criteria as : patient stratification into pretreatment groups ( according to d'amico , zelefsky or nccn ) , psa free time endpoint ( astro , phoenix , psa < 0.2 ng / ml for rp ) , both clinical and pathological staging , minimum of 72 gy ebrt ( imrt or 3dcrt ) , results published in peer - review journals only , minimum median follow - up of 5 years . morover minimum patients number for each risk group was accepted as 100 for low and intermediate and 50 for high risk group . results of this study suggest that bt alone , particularly seed implant , provides superior psa free survival in low risk patients . ebrt combined with bt seems to be equal to bt alone , and better than ebrt alone or rp , in intermediate risk group . combined irradiation ( ebrt with bt ) with or without androgen deprivation therapy seems to be superior for high - risk patients . although these results are encouraging to choose bt as an element of managment , it should be remembered that selection bias may play main role , mostly in intermediate risk group . according to lack of large , randomized studies these may help to choose ultimate treatment decision both for physician and his patient . bt seems to be superior option for dose escalation and psa control in prostate cancer patients . this is also reason to recall guidelines of european and north american societies on prostate cancer brachytherapy , both hdr and ldr .", "european association of urology states that transperineal bt alone qualification criteria are : clinical stage between t1c and t2a , without nodal involvment or metastases , six or less gleason score diagnosed with sufficient number of random biopsies , initial psa level of 10 ng / ml or less , no more than 50% of biopsy cores with cancer , prostate volume of less than 50 cm and a good ipss ( < 20 fair tolerance ; < 9 good tolerance ) . ldr - bt is recommended both by eau and gec / estro as safe and effective in low risk group of prostate cancer patients with life expectancy longer than 5 years . post - turp patients should avoid this procedure , however if turp was performed several years earlier some patients can undergo ldr - bt after careful evaluation . hdr - bt is recommended as a dose escalation technique combined with ebrt for patients with intermediate or high risk of failure with life expectancy longer than 5 years . the exclusion criteria are : prostate volume bigger than 60 cm ( hormonal downsizing to reduce benign prostate hyperplasia is indicated ) , transurethral resection of prostate within six months , infiltration of external sphincter of the bladder neck , significant urinary obstructive symptoms ( residual urine volume > 50 cm , ipss > 12 and qmax < 15 cm / s ) , technical issues ( pubic arch interference , trus prostate - rectum distance less then 5 mm , lack of proper positioning of patient , anaesthesia or complementary ebrt contraindications ) . moreover these guidelines state that hdr - bt alone should be considered as an investigational treatment with proper fractionation . salvage hdr - bt should be also performed in a prospective clinical trial , only . abs states that hdr - bt provides highly conformal treatment with less irradiation for pelvic organs - at - risk and excellent outcome . all patients should be considered for these aproach , particularly for intermediate and high relapse risk patients as an irradiation boost or as a monotherapy for low risk patients . prior rectal surgery or pelvic irradiation , i.e. rectal cancer treatment , in prostate cancer patients should be carefully evaluated and complications and outcome risk factors should be discussed with special hdr - bt center expertise . inflammatory bowel disease patients should be considered for hdr - bt if not suitable for rp , asymptomatic and not required treatment for at least 0.5 to 10 years . hdr - bt alone seems to be better than ebrt alone or combined with hdr boost , because of smaller bowel volumes irradiated . turp should be performed at least 90 days before hdr - bt , an aerated gel should be given into urethtra to outline its shape and special attention should be given to not exceed 110% of prescription dose . most feasible glands for hdr - bt are those beneath 50 cm , but abs guidelines allow to treat larger ones . pubic arch interference , baseline urinary function and application technique ( fixed template or freehand ) should be carefully considered . patients should be informed about potential risks of erectile dysfunction or acute and late urinary side effects . abs states that absolute contraindications include preexisting rectal fistule , impossibility of anaesthesia and no proof of malignancy . absolute contraindications include poor performance status and life expectancy shorter than 10 years , spinal or general anaesthesia not possible , large post turp defects and lack of rectum , which makes trus impossible . ipss value over 20 points can correlate with increased urinary toxicity and needs careful evaluation . prostate volume over 60 cm is not a contraindication and even with pubic arch interference can be considered for ldr - bt with short adt course ( 3 - 4 months ) to downsize the gland . also freehand implantation is acceptable , but experienced practitioners should perform ldr - bt in such cases . abs states that ldr - bt alone should be done in low risk patients and as option for intermediate group . ebrt and permanent seed combination is considered as standard of care for high risk patients .", "hdr - bt , according to gec / estro - eau recommendations , should be done under trus guidance with template , its proper fixation and treatment planning software . additional imaging with ct or mri after implantation may be used . clinical target volume ( ctv ) for hdr - bt can be whole gland ( prostate surface ) with homogenous needles distribution or with addition of visible tumor boost inside ctv . prostate surface dose prescription differs among cancer centers and is between 6 to 10 gy per fraction with total dose of 12 - 20 gy in 2 to 4 fractions combined with ebrt of 45 to 54 gy in 6 - 7 weeks . organs - at - risk doses should not exceed 120% of mtd for urethra and less then 6 gy per fraction for rectum . those doses should be precisely stated and valuated in clinical trials with long follow - up including penile bulb maximum dose . proximal tips of catheters should be visualized and images should be taken at least 9 mm above and below ctv . organs - at - risk should be confined including rectum , urethra , bladder and penile bulb . minimum of 14 catheters should be placed or more , particularly if boost within boost is planned . especially urethra piercing should be avoided . at least 90% of ctv should be covered with prescribed dose with aiming 95% of ctv . hdr - bt boost is given in one to six and hdr - bt alone in three to six fractions . due to wide heterogeneity of fractionation schedules , oar constraints are based on experienced hdr centers references , e.g. from less then 105% to less then 125% for urethra . ldr - bt should be performed under trus guidance according to gec / estro guidelines . if possible gross tumor volume ( gtv ) should be delineated on pre - treatment scans . ctv should contain whole prostate with 3 mm margin in all directions except posterior ( rectal wall ) and cranial ( bladder neck ) if needed . dose prescription to 100% isodose should be 145 gy for i and 125 gy for pd seeds . at least 95% of ctv should be covered with 100% isodose with no more than 50% of ctv with isodose 150% . maximum dose in 2 cm for rectal wall should be no more than 145 gy and in 0.1 cm less than 200 gy . 150% of prescribed dose should cover less than 10% of urethra volume and 130% of this dose should cover less than 30% of its volume . it should be done as a preplanning , either as a separate procedure or on the implanting day in operational room . main procedure should be performed with trus and template ; patient position and probe angle should be similar to preplanned . minimum is biplanar , high resolution ( 5 - 12 mhz ) trus with dedicated planning software . team should consist at least of trained radiation oncologist and qualified medical physicist , but presence of urologist , certified dosimetrist or other supportive staff is appropriate . abs does not suggest any seed deposition technique , however it should have excellent outcome , be reproducible and with optimal dosimetry . both stranded and loose seeds can be chosen for implantation . i and pd implants showed excellent outcomes , so abs do not favor any of them . ldr - bt alone prescription dose to ptv should range from 140 - 160 gy for i seeds and 110 - 125 gy for pd . if combination of ebrt and seed implantation is planned , i ptv dose should be between 108 - 110 gy and pd ptv dose should be between 90 - 100 gy . ebrt dose should be 41.4 - 50.4 gy ( 1.8 gy / day , but 2 gy / day is also acceptable ) . ldr - bt is usually performed 0 - 8 weeks after ebrt , but there is no evidence for optimal sequence of these . reverse approach is also accepted , which may theoretically be better , because of simultaneous irradiation from implant and ebrt and possibility of adjusting ebrt if needed . dose constrains for organs at risk should not exceed 150% of prescribed dose in 5% and 125% of prescribed dose in 30% of urethral volume in the preplan . prescribed dose should be in less then 1 cm of rectum on day 1 dosimetry and in less then 1.3 cm on day 30 . although ct performed immediately or one day after the implantation has several positives , e.g. early detection of dosimetric problems , but after implant oedema can derive dosimetric underestimations . it is 12 - 20 days after implantation for pd and 23 - 37 days for i. erectile function organs at risk e.g. penile bulb are still not agreed , though there are no recommendations on these .", "both ldr and hdr - bt patients should be seen 6 weeks after implantation ( last one for temporary implants ) according to gec / estro recommendations . should be examined every 3 months , every 6 months until 5 years after treatment and then annually . dre , psa test , side effects evaluation ( urinary , rectal , potency toxicity and ipss ) and trus should be done [ 18 , 20 ] . abs suggests to follow - up hdr - bt patients every six months for first 2 - 3 years , and then at least annually . it should consist of dre , psa test and toxicity evaluation ( urinary , rectal and sexual function ) . phoenix definition of biochemical relapse is recommended , although case individual assessment is required and patient should be informed about psa bounce . ldr - bt patients should be seen every six to twelve months with regular intervals . post bt rectal biopsies or urinary instrumentation should be avoided and all of the risks and benefits should be considered [ 21 , 22 ] .", "brachytherapy is supreme tool in prostate cancer management with a wide range of options in every risk group ( table 2 ) . excellent outcomes and relatively small irradiated volume seems more beneficial than any risk of intraoperative implantation , particularly in wisely selected patients . feasibility of seeding or catheterization is basic for choosing appropriate candidates for bt , however there are articles describing series of patient with non - fitting anatomy , i.e. prostate smaller than 20 cm or bigger then 50 cm or post turp patients [ 24 , 25 ] . assesment should consist of careful clinical examination including dre , patient 's history ( i.e. urologic , prior pelvic rt , surgery or trauma , inflammatory bowel disease , connective tissue dissorders ) , pretherapy psa serum level , biopsy proven cancer with gleason score and clinical staging . trus stays basic imaging , but ct and mri are also very useful , either before procedure and as a planning guidance . new abilities of mri , i.e. spectroscopy and diffusion , and 11c pet - ct should be discussed more in next recommendations [ 2628 ] . gec / estro and eau recommendations on prostate cancer treatment with temporary implants with stepping sources are from 2005 and on permanent seeds from 2000 with 2007 update . although general approach for bt , both hdr and ldr , has not particular differences across the world , european recommendations need an update . \n recommendations comparison for gec/ estro and abs [ 18 , 2022 ] under investigation for high risk patients to institutional review board " ]

[ "only 2030% of patients with group a beta hemolytic streptococcus ( gabhs ) pharyngitis presents with classical symptoms of the disease . reliance on clinical judgment alone has a poor predictive value and results in 80% to 95% overestimation of disease [ 2 , 3 ] . diagnostic strategies for acute gabhs pharyngitis are thus based on epidemiological factors , signs , and symptoms , as well as the result of throat cultures ( tcs ) . several studies have shown that the use of throat culture leads to more judicious use of antibiotics [ 57 ] . physicians prescribe antibiotics for acute pharyngitis as they are concerned that patients with this complaint may be suffering from gabhs infection that if left untreated might develop suppurative complications , such as , tonsillar abscess or nonsuppurative complications , such as , rheumatic fever [ 6 , 8 ] . antibiotics , however ; confer only minor symptomatic benefits for gabhs sore throat . they shorten the duration of symptoms by merely half a day on average [ 8 , 9 ] . more recent studies have shown that antibiotic use only reduced the incidence of rheumatic fever by a mere 0.5 cases per 100,000 . the importance of preventing rheumatic fever has lessened as the incidence of rheumatic fever and rheumatic heart disease has declined significantly in the last 20 years , from a mean annual incidence of 13.4 per 100,000 to 5 per 100,000 . prevalence has decreased as well from 5.7 per 1,000 in the eighties to 0.5 per 1,000 in 2000 [ 8 , 10 , 11 ] . this failure probably stems from the fact that about 20% of children with gabhs is infected with bacteria which contain m protein , a virulence factor located on the surface of the bacterial wall that confers resistance to commonly used antibiotics . newer beta - lactamase - resistant antibiotics did not prevent this treatment failure [ 13 , 14 ] . review of the literature from 1945 to 1999 , which includes 10,484 cases of gabhs sore throat , found that antibiotic treatment reduced the occurrence of acute otitis media , a common complication of this disease , by a mere 25% , compared to the placebo group and sinusitis by only 50% . rheumatic fever , a nonsuppurative complication , was reduced by less than 33% , compared to placebo [ 8 , 10 , 11 , 15 ] . in addition to the uncertainly in the scientific literature , parents seem to be uncertain regarding the benefits of antibiotic treatment for acute gabhs pharyngitis and tend to stop treatment earlier than prescribed . in a pilot study , we randomly followed 75 children with gabhs pharyngitis for 6 months and have found that more than 75% of them did not complete ten days of antibiotics . this finding led us to conduct a multisite , prospective cohort observational study , the results of which are reported here . the goal of this study was to determine whether noncompliance with antibiotic treatment affects short - term or long - term complications .", "two central , primarily rural , and agricultural regions of the largest health maintenance organization ( hmo ) in israel , comprising approximately one million patients . using a standard protocol , we located from our computerized data base 107,840 patients , aged 6 months to 18 years , who were examined by their primary care physician for upper respiratory tract infection , tonsillitis , pharyngitis , sore throat , tonsillopharyngitis , neck pain , cervical lymphadenopathy , pta , rpa , from january 1 , 1999 until december 31 , 2000 . we then accessed the charts of 78,473 of these children who were diagnosed with infected throat or one of the differential variants , excluding all children diagnosed as having viral upper respiratory infections . 47,000 of these patients were formally diagnosed with acute pharyngitis or acute tonsillitis and received a prescription for antibiotics , indicating that their physician suspected bacterial disease . in the index visit , 35,000 of these children had at least four out of five symptoms in the modified centor criteria used for this study and nadir modified breese epidemiological and clinical score card ( ecsc ) that has 91% sensitivity and 98% specificity when the score was above 15 ( score between 4 and 36 ) for the diagnosis of gabhs [ 1719 ] . colonies yielding beta - hemolysis were grouped for surface carbohydrate assessment by using a latex bead agglutination test ( figure 1 ) . of the 6336 children ( with positive cultures with 4 or more centor criteria and 15 or higher ecsc ) , 4,775 parents consented to enroll their children to the study ( figure 1 ) . excluded from the study were children who were diagnosed as gabhs chronic carriers or who had suffered from post - gabhs complications ; had any chronic illness , such as , renal or hepatic impairment ; had bleeding disorder ; had congenital or acquired immunodeficiency or suffered from malignancy . initial patient / parent contact was made by one of the authors ( m. sarrell ) within 3 to 5 days of the initial positive throat culture . at that time , initial information regarding the illness and whether a prescription for antibiotics was given by the primary care physician . the attending physicians of the two thousand study patients were contacted by email within 48 hours of the enrollment by one author ( m. sarrell ) . the physicians were requested to inform the authors of any additional cultures taken during therapy , and to request that they obtain two additional throat cultures and engage in improve adherence strategies by providing information , counseling , reminders , reinforcement , and if needed personal attention or supervision . while repeated cultures are not routinely recommended for asymptomatic patients who have completed a course of antimicrobial therapy , in light of the poor compliance with treatment in the pilot study , performance of such follow - up cultures was considered important for the purposes of the study . the first follow - up culture was performed within 10 to 14 days of the initial positive culture regardless of treatment status . the purpose of this culture was verification of antibiotics treatment failure or persistence of gabhs in the oropharynx of the untreated patients . the second additional throat culture was taken between days 21 and 30 after the initial positive culture , regardless of treatment status , to ascertain the presence of residual gabhs or recurrences . treating physicians were also requested to obtain blood for liver enzymes , renal function tests , and urine analysis from all the participants and to perform annual follow - up evaluation thereafter . a second patient / parent contact was made by our study coordinator within 10 to 14 days of initiation of antibiotic treatment . she collected information about demographic characteristics , past medical history , febrile status , need for repeat throat culture during the treatment period ( that was not part of the study protocol ) , and type of medication prescribed . during this contact she obtained information about the number of days of actual treatment , omission compliance and complications , the patients / parents perceived as deriving from the treatment ( or lack thereof ) . the computerized charts of the participants were searched within 2 to 4 weeks of the second patient / parent contact for additional information , including demographic characteristics , medical and environmental history , initial clinical data , such as , in - office fever evaluation , results of the physical examination , additional culture taken , type of antibiotics used , and disposition of prescription received . a second search of the computerized medical charts was performed by our research assistant between 30 and 90 days of initiation of medical treatment , to ascertain that the 2 requested throat cultures were obtained . relapse or recurrence of clinical or bacterial pharyngitis , suppurative or nonsuppurative complication , or even whether the participants complained of any sore throat within 30 days of completion of treatment were also evaluated . in order to assure that all possible short - term complications that occurred within 90 days of the index case were obtained , an additional comprehensive search of the hmo database was done within 120 days of the second computer search . we ascertained that findings that were either not available on the original computerized chart or were seen by other than their primary care physician , ( e.g. , emergency departments , patients that relocated ) , were not overlooked . the charts of the participants were then reviewed by one of the authors on a yearly basis , from january 2000 to january 2010 , noting possible late nonsuppurative complications of gabhs infection . no patients were lost to followup , even if they had changed physicians , due to our ability to track them through the centralized database to their new physician or another hmo . the children that were enlisted to the army ( and thus not members of any hmo during their military service ) were contacted either through their former attending physician or the military physician . minor treatment failure was defined as any clinical or bacterial recurrence of pharyngitis during the short - term follow - up period and its correlation to compliance with treatment . major treatment failure was defined as retropharyngeal or peritonsillar abscess or long - term complications , such as rheumatic fever . suppurative complications were chosen as a model , because the nonsuppurative complications ( rheumatic heart disease , arthritis , carditis ) have been practically eradicated in our region . this cohort study was designed to analyze rare events ( according to the cioms classification 110 events per 10,000 children years ) . the annual incidence of peritonsillar abscess ( pta ) in our region is 24 cases per 100,000 and the incidence of retropharyngeal abscess ( rpa ) is 57 cases per 100,000 . power calculations suggested 6,500 to 7,000 person - years of intervention would be needed to detect a 22% difference in pta and rpa between the fully treated ( ft ) and partially treated ( pt ) arms of the study population . furthermore , one - sided alpha of 0.025 , a statistical power of 95% , and the pta / rpa incidence given above showed that approximately 19,000 children - years would be needed to show the noninferiority of ft versus pt . since the primary outcome of interest is the pta / rpa hazard ratio between ft and pt . the null hypothesis to be tested is hr pta / rpa > 2 ( i.e. , the pta / rpa hazard ratio for ft versus pt is higher or equal to 2 ) . the pta / rpa hazard ratio was calculated for ft versus pt . for purposes of analysis , participants were divided into four subgroups based on length of treatment : 1st subgroup ( untreated ) , those who did not receive any treatment , 2nd subgroup ( partially treated ) , children that received antibiotics for 1 to 3 days , 3rd subgroup ( mostly - treated ) , children treated for 4 to 6 days , and 4th subgroup ( fully - treated ) children treated between 7 to 10 days . data are presented as proportions ( with 99% confidence intervals [ cis ] ) , means ( with sds ) , or medians ( with interquartile ranges ) , using pearson tests , student 's tests , or fisher exact test . comparisons of length of treatment according to time and treatment were assessed using the repeated measures and analysis of variance and the paired t test . a 2-tailed p value of.05 was used to determine the statistical significance of differences observed between groups and to calculate confidence intervals around differences in sample means and odds ratios . we used the mcnamara test to measure the changes between the groups and their subgroups regard to the length of antibiotic treatment .", "over half of their children ( 1023 , 51% ) were between the ages of 6 months and 6.9 years , and over half 1,039 ( 52% ) were female . the majority of children ( 1,821 , 91% ) were prescribed penicillin or amoxicillin , allergic or intolerant to penicillin were treated with cephalosporin 25 ( 1.5% ) , erythromycin 109 ( 5.5% ) , and azithromycin 45 ( 2.5% ) , all medication were prescribed twice daily for 10 days , except azithromycin once daily for 5 days . no statistical correlation was found between the type of antibiotics , the children received , or the demographic characteristics and the complications found in the later medical examinations . only 196 children ( 9.8% ) actually completed 10 days of antibiotic treatment . despite having received a prescription from their physician , two hundred and thirteen participants ( 11% ) did not start taking any treatment whatsoever , including those who did not even purchase antibiotics . as shown in table 1 a no statistical correlation was found concerning length frequency and duration , palatability , number of daily dose of treatment , but a statistically significant difference was found between all the subgroups concerning the length of antibiotics treatment ( p < the majority of children ( 1192 , 59.6% ) had 3 days or less of fever , defined as any rectal temperature less than 38.5c or oral temperature less than 37.8c . the majority of children ( 1591 , 80% ) received medication for four to six days at the most ( partially treated subgroup ) . as illustrated in table 1 , the association between the duration of fever and the number of days of treatment was statistically significant ( p < .0001 ) . of the 306 ( 15.3% ) children with clinically diagnosed recurrent tonsillopharyngitis , only 236 ( 12.3% ) had positive gabhs findings on the throat culture taken within 10 to 14 days after conclusion of the primary infection . an additional thirty - four ( 1.7% ) had a positive second study culture ( taken 2130 days after the index positive gabhs culture ) . of note is the fact that the majority ( 156 , 66% ) of the positive study culture at 1014 days were found among the subgroup treated for 7 to 10 days . no such positive results were found in the subgroup treated for 1 up to 3 days . furthermore , no positive gabhs throat cultures were found on the second study culture in the untreated group . the majority ( 26 , 76% ) of positive gabhs cultures were in the mostly treated subgroups . as illustrated in table 2 , these findings were both statistically significant ( p < .0001 ) ( table 2 ) . cervical lymphadenitis , acute otitis media , and impetigo were the only suppurative complications noted . 110 ( 5.5% ) children developed cervical lymphadenitis , most ( 52 , 47% ) among the 6 to 7 days treatment subgroup and 33 ( 33% ) among the 4 to 5 days treatment subgroup , a significant difference among the treatment subgroups ( p < .0001 ) . additionally , no children developed nonsuppurative complications during 10 years of followup nor did any of the children develop iga nephropathy during the follow - up period . furthermore , they were no association between the five modified centor criteria and development of complication , even when stratified by type of antibiotics or the season of the year . altogether , 304 ( 15% ) new onset cases of acute otitis media ( aom ) were diagnosed within 30 days of the initial diagnosis . however , only 31 ( 10% ) of those were in the untreated subgroup , as compared to 141 ( 46% ) in the 7 to 10 days treatment subgroup , 98 ( 38% ) in the 4 to 6 days treatment subgroup and 98 ( 33% ) in the 1 to 3 days subgroup , a statistically significant difference among the all treatment subgroups ( p < .0001 ) . attempting to elucidate the possible causes for the differences between the recurrence of gabhs and the length of antibiotic treatment or clinical score on enrolment or illness severity , a multivariate stepwise logistic analysis was performed . the duration of fever was the most significant predictor for such recurrence , age under 6 years being less significant , while treatment for 7 to 10 days had no significant influence on the recurrence of gabhs . of note is that the contribution of the duration of fever was apparent even after controlling for the concomitant influence of age , gender , medical history , single- or two - parent home , type of antibiotics or the season of the year , and concomitant illnesses , such as , conjunctivitis , otitis media , upper respiratory infection , gastroenteritis , or lymphadenitis , which may have otherwise explained the influence of the length of treatment in relation to those illnesses ( table 3 ) .", "this study found a very poor parent / child compliance to antibiotic treatment prescribed for symptomatic , culture - positive gabhs tonsillopharyngitis . 11% of children did not start taking any treatment at all , and only 10% completed a full course of treatment . the reason for this low rate of compliance is unclear , but it coincides with other reported studies [ 14 , 16 ] . we speculate that a large proportion of lack of compliance is the parent 's sensation that antibiotics are potentially dangerous and overprescribed [ 18 , 19 ] . despite this poor compliance , in our study as in others , there was a very low rate of suppurative complications . furthermore , despite the poor compliance , we found no increase in the incidence of acute rheumatic fever , the most dreaded complication of gabhs , in our patients . in fact , since the year 2000 , the incidence of rf in our region has declined from 2.2 per 100,000 to 0.2 per 100,000 in 2008 , according to the epidemiological department of the israeli ministry of health . this is in concordance with other developed countries , including , the united states , where the original recommendation for 10 days of antibiotic treatment of gabhs originated . in that country , currently there are only 10 cases of rf per 100,000 patients with gabhs pharyngitis , and only 1 case per 10,000 patients with acute rheumatic fever develop rheumatic heart disease [ 2022 ] . in fact , concomitant with the increased use of antibiotics , recurrence of gabhs in the usa rose from 9% and 10.7% in the years 1975 to 1979 , respectively , to 25.9% and 37.5% in the years 1995 to 1996 , despite the decline in acute rheumatic fever . 14% of patients in our study had a recurrent infection , proven by a gabhs - positive throat cultures . this percentage is similar to other studies which found that penicillin failed to eradicate gabhs from the throat in approximately 13% to 26% of the patients evaluated [ 23 , 24 ] . the majority of recurrences in our study were in the younger group ( mean age of 10.2 years , and 60% of them younger than 9.9 years ) . this is consistent with other published studies where such recurrences were more frequent among children aged 1 to 8 years than among children aged between 13 and 19 years [ 24 , 25 ] . historically , prescribing 10 days of oral penicillin began in the 1950s , substituting the intramuscular injections of long - acting parenteral penicillin , based on surrogate markers of eradication of gabhs from the tonsillopharynx . however , no study has conclusively proven that this practice unequivocally prevents acute rheumatic fever [ 26 , 27 ] . even though orally prescribed penicillin appeared to be equally effective for clinical and laboratory resolution of signs and symptoms , it is difficult to administer and expensive , considering the staggering financial burden of approximately 140 office visits per annum per 1,000 children younger than 15 years [ 28 , 29 ] . substituting azithromycin or cephalosporins for penicillin was found to produce better bacteriological and clinical results and also required a shorter course of treatment [ 30 , 31 ] . our results may not apply to adults , sick people , or chronic gabhs carriers . it does not address the optimal length of treatment required to achieve appropriate eradication of the microbe or whether complete eradication is required at all . the method of pill / doses counts is not a good measure of adherence , but due to it simplicity and empiric nature it was found adequate for this study . we were unable to assess the true variation of the incidence of acute rheumatic fever , due to the fact that this disease has been practically eradicated from our population .", "our data suggest that the large majority of parents / patients stop administering antibiotics to their children who suffer from gabhs prior to the completion of the recommended course . a more judicious use of antibiotics would promote and improve compliance , cut costs , and prove more convenient to parents and children alike ." ]

[ "myofascial pain syndrome ( mps ) can be caused by frequent muscle or fascial stiffness as a \n result of prolonged tension and muscle fatigue due to repetitive stress of muscles or \n overuse of particular muscles1 , 2 . mps activates trigger points in 54% of women and 45% of men , and is regarded as \n the most common cause of pain in the musculoskeletal system3 . in particular , the upper trapezius requires head movement according \n to the direction of view , but it can be vulnerable to damage when the hands and arms are \n used repetitively in work that requires precise control4,5,6 . once myofascial trigger points are activated , changes in the \n structural characteristics and contraction function of the muscle will occur . the most \n distinctive changes are taut bands , tender nodules , referred pain , local twitch response , \n muscle weakness , and restricted range of motion3 . to evaluate the contraction function of skeletal muscle , various methods can be used . among \n them , surface electromyography ( emg ) analyzes functional changes in muscle by measuring \n quantitative changes in motor unit action potential that is activated by muscle \n contraction7 , 8 . surface emg is widely used in kinetic analysis to diagnose normal \n or abnormal function in muscles and nerves according to amplitude and frequency9 . it has several advantages , as it is \n noninvasive and convenient , and can perform measurement even during dynamic motion10 , 11 . although a number of clinical reports on the pathologic mechanisms or clinical diagnosis \n and treatment of mps can be found , few studies have been conducted on the changes in \n contraction function in myofascial trigger point areas or on the electrophysiological \n characteristics and neuromuscular physiological information . this study aimed to compare the \n electrophysiological characteristics of normal muscles versus muscles with latent or active \n myofascial trigger points , and to identify their neuromuscular physiological \n characteristics , in order to provide a quantitative evaluation of mps and clinical \n foundational data for its diagnosis .", "this study was approved by the \n research agency , and all participants provided written informed consent . subjects were \n selected among those with no known neurologic disease , no regular exercise habit , and no \n drug use that could affect the experimental result . subjects in the active myofascial trigger point group were those diagnosed with mps \n by a physician and whose clinical characteristics were pain in the upper trapezius during \n rest , taut bands , tender nodules , referred pain , local twitch response , and muscle weakness . \n subjects in the latent myofascial trigger point group were those not diagnosed with mps but \n who felt tenderness when the upper trapezius was stimulated . mean age , height , and weight , respectively , were 23.27 \n 4.21 years , 172.32 8.44 cm , and 64.14 6.54 kg in the active trigger point group ; 23.74 \n 6.47 years , 174.76 6.22 cm , and 66.74 5.74 kg in the latent trigger point group ; and \n 24.17 3.14 years , 171.21 9.64 cm , and 63.44 7.51 kg in the control group . to measure maximum voluntary isometric contraction ( mvic ) , the shoulders and heads of the \n subjects were firmly fixed and pulled as the dynamometer as maximum power , thereby measuring \n mvic against the upper trapezius . endurance time was measured from the start of mvic to a \n 50% reduction in contraction force . median frequency ( mdf ) was measured by using emg at the \n muscle belly of the upper trapezius during mvic . muscle fatigue index was calculated by \n obtaining the mdf at a section where the mvic force was reduced from 100% to 50% , and remove \n the 50% mdf from 100% mdf was divided into 100% mdf . the sampling rate for the surface emg \n signal was set at 1,000 hz , and the frequency band filter was set at 20 to 450 hz , using one \n channel . storage and analysis of the emg signals was performed using acqknowledge 3.8.1 \n ( biopac systems , goleta , ca , usa ) . the average of three measurements was calculated and used \n in the analyses ; 10 minutes of rest was given between measurements to prevent muscle \n fatigue . statistical analyses were performed using spss version 18.0 for windows ( spss , inc . \n one - way analysis of variance was conducted to examine differences among \n groups with respect to the measured items , while the tukey test was conducted for post hoc \n analysis .", "there were no significant differences in mvic or endurance time among the three groups . \n however , mdf was significantly different among all three groups ( p < 0.05 ) ( table 1table 1.comparison of mvic , et , mdf , and fi among the three groupsgroup a ( n = 30)group b ( n = 30)group c ( n = 30)post hocmvic , kg19.811.5 * 22.19.423.510.2/et , s48.59.749.510.251.28.8/mdf , hz102.521.488.523.184.517.4a < cmfi0.150.070.080.040.060.04a < cdata are presented as mean sd . * significant difference among the three groups ( p \n < 0.05 ) . group a : active myofascial trigger points ; group b : latent myofascial \n trigger points ; group c : control . et : endurance time ; mdf : median frequency ; mfi : \n muscle fatigue index ; mvic : maximal voluntary isometric contraction ) . tukey post hoc results showed that the active myofascial \n trigger point group was significantly different from the control group . muscle fatigue index \n also was significantly different among all three groups ( p < 0.05 ) ( table 1 ) . tukey post hoc results showed \n that the active myofascial trigger point group was significantly different from the control \n group . data are presented as mean sd . * significant difference among the three groups ( p \n < 0.05 ) . group a : active myofascial trigger points ; group b : latent myofascial \n trigger points ; group c : control . et : endurance time ; mdf : median frequency ; mfi : \n muscle fatigue index ; mvic : maximal voluntary isometric contraction", "this study aimed to measure mvic , endurance , mdf , and muscle fatigue index of normal \n muscles versus muscles with latent or active myofascial trigger points , thereby identifying \n the neuromuscular physiological characteristics of muscles with active myofascial trigger \n points and providing clinical foundational data that are applicable for the quantitative \n evaluation and diagnosis of mps . surface emg , which was used to evaluate the functionality of trigger points in this study , \n is nonintrusive and convenient ; thus , it is widely used in studies on the functional \n characteristics of muscle , by analyzing the electrical activity of muscle . the results of \n mdf according to surface emg show changes in recruitment of fast - twitch muscle fibers and \n conduction velocity of motor unit action potential12 . in addition , increases in mdf reflect recruitment of type ii \n fibers , and muscle fatigue index can be analyzed according to the relationship between type \n ii fibers and mdf13 , 14 . in the present experiment , mdf was significantly higher in the \n active trigger point muscles than in normal muscles . the above results indicate that as \n trigger points were activated , recruitment of motor unit action potential of type ii fibers \n also increased . in addition , muscle fatigue index also increased due to the increased \n distribution of type ii fibers . however , mvic was lower in active trigger point muscles than \n in normal muscles . although a high correlation between muscle strength and mdf has been \n reported15 , 16 , the same correlation was not found in this study . this result was \n due to increased recruitment of motor unit action potential of type ii fibers in active \n trigger point muscles , which more easily induced muscle fatigue as a physiological \n phenomenon , thereby reducing muscle strength . in other words , the greater the fatigue , the \n weaker the muscle strength17 ; endurance \n also was decreased due to muscle weakening . therefore , this study s results will be effective in complementing the physical therapy \n diagnosis of mps which , until now , has focused on physical examination only by understanding \n not only the usefulness of electrophysiological analysis in mps diagnosis , but also the \n neuromuscular physiological characteristics of active trigger point muscles ." ]

[ " primary or secondary neurondocrine ( ne ) tumours of the female genital tract are rare . cervical small cell carcinoma and ovarian carcinoids are the most common gynaecological ne tumours .", "neuroendocrine tumours comprise a set of neoplasms that arises from the diffuse neuroendocrine cell system . these tumours are more commonly identified in the gastrointestinal tract , pancreas , lung and thymus . recently , a simplified terminology has been proposed , dividing ne tumours in two groups : poorly differentiated neuroendocrine carcinomas ( necs ) and well - differentiated neuroendocrine tumours ( nets ) . necs include small cell carcinoma and large cell neuroendocrine carcinoma , while nets account for typical and atypical carcinoids [ 14 ] . the clinical features of gynaecological ne tumours generally depend on the organ of origin and are non - specific . however , some patients may present with paraneoplastic syndromes owing to the production of several peptides and hormones . the absence of endocrine clinical syndromes in most patients with ne tumours is possibly related to the release of insufficient amounts or inactive hormones . the purpose of this article is to review the epidemiological , clinical and imaging features with pathological correlation of primary gynaecological ne tumours , emphasising the importance of differentiating them from metastatic disease and other carcinomas with an ne component .", "for the classification of ne differentiation , tumour cells have to express at least two ne markers such as chromogranin a , synaptophysin or neuron - specific enolase . a great variety of other peptides and hormones may be found , including calcitonin , gastrin , serotonin , substance p , vasoactive intestinal peptide , pancreatic polypeptide , somatostatin and adrenocorticotrophic hormone [ 1 , 3 ] . some cancers display a combination of ne and non - ne features , usually either glandular or squamous components . the amount of ne component within a non - ne carcinoma may range from a single ne cell to a well - identifiable ne tumour cell population . in this set , two terms are widely accepted : mixed exocrine - endocrine carcinoma ( meec ) and ( adeno)carcinoma with ( focal ) ne differentiation . the finding of a focal non - ne differentiation in almost pure ne tumours is less common . according to the world health organisation ( who ) classification of ne tumours , the diagnosis of a mixed exocrine - endocrine tumour should take into account at least two major diagnostic parameters : an extension of at least 30 % for each component and the recognition of structural ne features such as well - differentiated organoid or solid / diffuse growth patterns . in fact , no reasonable explanation is provided for the limit of 30 % , and consequently morphological criteria should also be considered [ 7 , 8 ] . carcinomas with focal ne differentiation have been identified in several non - ne tumours of the gynaecological tract , such as endometrial endometrioid adenocarcinomas , endocervical adenocarcinomas and adenosquamous carcinomas , and even ovarian surface epithelial neoplasms of mucinous , endometrioid and serous types . these tumours display less than one - third of ne cells and a non - ne growth pattern , and the finding of these ne cells has not been shown to affect outcome [ 5 , 7 ] . few data are currently at our disposal regarding the prognosis of mixed exocrine - endocrine carcinoma ( meec ) in comparison to pure ne or non - ne tumours . however , the therapeutic schemes are different and the accurate histological diagnosis is mandatory the differentiation of small cell ne carcinomas from poorly differentiated squamous cell carcinoma ( scc ) with ne features may be especially difficult . sometimes , and particularly for cervical cancers , the recognition of the ne component is only possible after the hysterectomy , since the tissue obtained on cervical biopsy may be insufficient , leading to the diagnosis of poorly differentiated cervical cancer .", "due to the rarity of these tumours , data in the literature concerning their imaging features are scarce . we know that small cell carcinoma and large cell ne carcinoma tend to behave aggressively , in contrast to carcinoids , which are typically confined to the organ . nevertheless , these are non - specific features and the available data regarding these extremely rare tumours are limited and discourage scientific generalisations . consequently , no reliable guidelines , for either diagnosis or treatment , are established . for staging purposes , physicians and radiologists should consider the currently used revised international federation of gynecology and obstetrics ( figo ) staging system [ 911 ] . the imaging approach to gynaecological ne tumours is similar to that for other histological types . for the cervix , uterus and adnexa , ultrasound ( us ) using both transabdominal and transvaginal probes plays a critical role in the initial diagnosis . the use of computed tomography ( ct ) or positron emission tomography - computed tomography ( pet - ct ) is established in cervical and endometrial tumours for detection of nodal and distant metastases , which may be particularly useful for poorly differentiated ne carcinomas , typically invasive and metastatic . in ovarian cancers , ct is also indicated to evaluate the extent of disease and detect nonresectable metastases . magnetic resonance imaging ( mri ) may be used for characterising indeterminate adnexal masses and for pre - treatment staging purposes , essentially in cervical and endometrial tumours . mri may replace ct in the staging of adnexal tumours in young females , pregnancy , renal insufficiency and allergy to iodinated contrast [ 10 , 12 , 13 ] ( table 1).table 1histological classification of ne tumours . table created by the authors based on the literature review [ 14 , 7]poorly differentiated neuroendocrine carcinomas ( necs)small cell carcinomalarge cell neuroendocrine carcinomawell - differentiated neuroendocrine tumours ( nets)typical carcinoidatypical carcinoidcombination of ne and non - ne featuresmixed exocrine - endocrine carcinoma ( meec ) ( adeno ) carcinoma with ( focal ) ne differentiation histological classification of ne tumours . table created by the authors based on the literature review [ 14 , 7 ] ne tumours of the vagina and vulva are much rarer . us plays a limited role in the diagnosis , but ct and mri may be used for staging purposes . mri is primarily used for local staging of vaginal tumours and should be performed after vaginal filling with gel . particularly for typical and atypical carcinoids ( well - differentiated neuroendocrine tumours ) , patients with negative octreotide scans should not be considered for somatostatin analogue therapy and typically show better responses to chemotherapy schemes .", "", "primary carcinoid tumours of the ovary are rare and account for less than 5 % of all carcinoid tumours and for less than 0.1 % of all ovarian neoplasms . these are germ cell tumours in origin and classified as teratomas with a predominance of ne features . the great majority is asymptomatic and incidentally found on cross - sectional or ultrasound imaging . the median age of diagnosis is 55 years of age ( range from 17 to 83 years ) , with most of the patients being peri- or postmenopausal [ 1 , 1417 ] . these tumours are typically unilateral , slow growing and diagnosed in an early stage . in a 5-decade analysis performed by modlin et al . , 66 % of 113 carcinoid ovarian tumours were localised lesions , while 22 % 31 % presented with distant spread . they may exist in pure forms , predominantly solid with small cysts or as a nodule within a mature teratoma , mucinous cystadenoma or even brenner tumour . ovarian carcinoids contain well - differentiated ne cells and some subtypes are similar to the gastrointestinal carcinoids . they are immunoreactive to at least one neuroendocrine marker , including chromogranin , synaptophysin or leu-7 , and may also be present in peptide hormones such as pancreatic polypeptide , gastrin , vasoactive intestinal peptides and glucagon . insular carcinoid is the most common type of ovarian carcinoid , typically presenting with a pelvic mass . near 30 % of patients will have signs and symptoms of carcinoid syndrome , including facial flushing , diarrhoea , bronchospasm and oedema . it happens because serotonin - like substances are directly released into the systemic circulation through the ovarian venous system , bypassing hepatic deactivation . carcinoid syndrome is less common in the other subtypes ( 13 % in trabecular and 3.2 % in strumal carcinoids ) . trabecular carcinoid constitutes the second most common ovarian carcinoid tumour and 25 % of patients will present with constipation due to peptide yy production , which inhibits intestinal motility [ 15 , 17 ] . some cases of hirsutism are also thought to be related to peptide yy production , which is known to inhibit peripheral steroid - producing cells [ 14 , 19 ] . mucinous carcinoids are rare ( 1.5 % ) , may be pure or associated with mature teratomas . in these cases , the differential diagnosis must include metastasis from a gastrointestinal tumour and primary mucinous appendiceal carcinoid . we should also consider strumal carcinoids , tumours that contain normal thyroid and carcinoid tissues . eight per cent of the patients may present with thyroid hormone - related symptoms and some ovarian strumal carcinoids are also reported to cause severe constipation owing to peptide yy production [ 15 , 22 ] . primary carcinoid tumours typically behave in a benign fashion , and the prognosis is generally favourable . if the tumour presents with stage i , survival may be greater than 90 % ; however , for women with advanced stage disease , the prognosis is poor and the 5-year survival is approximately 33 % . attending to the more favourable prognosis of ovarian carcinoid tumours , the differentiation of such lesions from other highly malignant ovarian neoplasms is mandatory in order to choose the most appropriate therapeutic options . particular note should be taken in relation to mucinous carcinoid , which behaves more aggressively and may present with extra - ovarian spread and lymph node involvement . while performing the diagnosis of an ovarian carcinoid , it is important to rule out ovarian metastases , essentially from the gastrointestinal tract . the insular and trabecular subtypes most commonly have metastases in the ovary simulating a primary tumour . metastatic carcinoid is frequently bilateral , while primary ovarian carcinoids tend to be unilateral [ 1 , 23 ] . compared the features of primary insular carcinoids and metastatic midgut carcinoids and concluded that the presence of extra - ovarian tumour , bilaterality , multinodularity , vascular invasion and the absence of teratomatous elements are suggestive of an extra - ovarian origin .", "both small cell carcinoma and large cell ne carcinoma of the ovary are highly malignant and aggressive , regardless of the stage . ovarian small cell carcinoma resembles the pulmonary type and is often associated with common epithelial tumours , typically an endometrioid carcinoma , suggesting an origin from ovarian surface epithelium . its immune profile includes positivity for neuron - specific enolase and less commonly for chromogranin [ 1 , 5 ] . large cell ne carcinomas have been associated with benign and malignant surface epithelial - stromal tumours , and immunohistochemical markers for chromogranin are typically positive [ 25 , 26 ] . we review three cases of neuroendocrine ovarian tumours , one primary carcinoid and two secondary carcinoid tumours ( figs . 1 , 2 and 3 ) . once again , we emphasise that few data are provided in the literature regarding the imaging features of these tumours all the cases show well - circumscribed , predominately solid ovarian tumours . however , fig . 1 exemplifies a typical benign behaviour , while fig . figure 2 represents an atypical presentation of metastatic disease , with overlap between benign and malignant features.fig . 1 \n a e struma carcinoid of the right ovary . a 49-year - old female complaining of pelvic and lower abdominal pain . ultrasound ( a ) and axial enhanced ct image ( b ) . large , heterogeneous , mixed tumour of the ovary , predominantly solid , with necrotic areas and calcifications . the solid portions are moderately echogenic on us and hyperdense on enhanced ct , while cystic areas are anechogenic on us and hypodense on ct . this tumour is composed of areas of thyroid tissue and carcinoid ( h&e ) , the latter having acinar and trabecular architecture ( c ) . the tumour cells show positive cytoplasmatic staining for chromogranine ( d ) and for synaptophysin ( not shown ) . the thyroid area with compact folicular structure presents intense immunoreactivity for thyroglobulin ( e)fig . 2 \n a d metastatic ovarian carcinoid of unknown primary origin in a 23-year - old female complaining of pelvic pain and amenorrhoea . sagittal t2-weighted mr image ( a ) and axial t1-weighted mr image with fat saturation , after intravenous gadolinium administration ( b ) . large , well - defined solid lesion of the left ovary , cranially and anteriorly located in relation to the uterus . on t2wi , it displays intermediate signal intensity and shows a central high signal region . the lesion shows peripheral , intense contrast enhancement and a large central area of necrosis . h&e section of the ovary occupied by a tumour with insular pattern composed by neuroendocrine cells ( c ) . these cells have intense cytoplasmatic staining for synaptophysin ( d ) and have small chromogranine - positive granules in the cytoplasm ( not shown)fig . 3 \n a b metastatic , bilateral ovarian carcinoid , from a primary jejunal tumour in a 28-year - old female complaining of pelvic pain and dyspareunia . multiple liver metastases were also seen ( not shown ) \n a e struma carcinoid of the right ovary . large , heterogeneous , mixed tumour of the ovary , predominantly solid , with necrotic areas and calcifications . the solid portions are moderately echogenic on us and hyperdense on enhanced ct , while cystic areas are anechogenic on us and hypodense on ct . this tumour is composed of areas of thyroid tissue and carcinoid ( h&e ) , the latter having acinar and trabecular architecture ( c ) . the tumour cells show positive cytoplasmatic staining for chromogranine ( d ) and for synaptophysin ( not shown ) . the thyroid area with compact folicular structure presents intense immunoreactivity for thyroglobulin ( e ) \n a d metastatic ovarian carcinoid of unknown primary origin in a 23-year - old female complaining of pelvic pain and amenorrhoea . sagittal t2-weighted mr image ( a ) and axial t1-weighted mr image with fat saturation , after intravenous gadolinium administration ( b ) . large , well - defined solid lesion of the left ovary , cranially and anteriorly located in relation to the uterus . on t2wi , it displays intermediate signal intensity and shows a central high signal region . the lesion shows peripheral , intense contrast enhancement and a large central area of necrosis . h&e section of the ovary occupied by a tumour with insular pattern composed by neuroendocrine cells ( c ) . these cells have intense cytoplasmatic staining for synaptophysin ( d ) and have small chromogranine - positive granules in the cytoplasm ( not shown ) \n a b metastatic , bilateral ovarian carcinoid , from a primary jejunal tumour in a 28-year - old female complaining of pelvic pain and dyspareunia . coronal ( a ) and axial ( b ) enhanced ct images .", "large cell ne carcinoma and carcinoid types are rarer than the former and few data can be found in the literature .", "staging and treatment strategies for both small and large cell cervical carcinoma globally follow the same criteria used for common histological types of cervical carcinomas . small cell carcinoma accounts for 16 % of cervical carcinomas [ 6 , 27 ] . median age of diagnosis is in the 5th decade , ranging from 21 to 87 years . some patients present with a cervical mass and an abnormal pap smear may be found . this tumour is strongly associated with human papilloma virus 18 ( hpv-18 ) , but hpv-16-positive tumours have also been demonstrated . the most commonly found are hypercalcaemia ( parathormone ) , hypoglycaemia ( insulin ) , carcinoid syndrome ( serotonin ) , cushing s syndrome ( corticotropin ) , siadh ( vasopressin ) and myasthenia gravis . most tumours are voluminous , exceeding 6 cm , and show deep cervical infiltration and necrosis . often , growth may be exophytic , which appears to be associated with a better prognosis . nevertheless , it is generally a highly aggressive tumour with a worse prognosis than that of poorly differentiated squamous cell carcinomas . the rates of lymphovascular space invasion and extra - pelvic recurrences for bone , supraclavicular lymph nodes and lung are particularly high [ 6 , 27 , 28 , 30 ] . according to mccusker et al . , females with small cell tumours have 1.84 times greater risk of death compared to patients with squamous cell carcinomas . it appears to have a similar outcome to small cell carcinoma and its treatment remains challenging because of the high rate of recurrence and distant metastases even with early stage disease [ 2 , 32 ] . we review three cases of cervical small cell carcinoma ( figs . 4 , 5 and 6 ) . cervical necs resemble cervical squamous cell carcinoma , displaying the same mri features : low signal intensity on t1-weighted images ( t1wi ) and high signal intensity on t2-weighted images ( t2wi ) . no histological distinction can be provided regarding only imaging features . however , according to the literature , cervical necs are generally highly aggressive and expected to be diagnosed in advanced figo stages . concordantly , we illustrate necs in iv - a ( invasion of adjacent organs ) ( fig . 4 ) and iii - b ( invasion of the pelvic side wall ) ( fig . 6 ) stages.fig . 4 \n a b cervical neuroendocrine tumour ( figo iv - a ; invasion of adjacent organs ) . a 32-year - old female complaining of vaginal bleeding after intercourse and fetid vaginal discharge . sagittal t2-weighted mr image ( a ) and axial t2-weighted mr image ( b ) . the parametria are circumferentially infiltrated and the tumour extends anteriorly to the bladder , with transmural invasion and fistulae ( arrow ) . . 5 \n a e cervical small cell carcinoma ( figo ii - a ; invasion of the upper two - thirds of vagina with no parametrial invasion ) . sagittal t2-weighted mr image ( a ) , axial t2-weighted mr images ( b ) and sagittal diffusion weighted image ( dwi ) , b(c ) retroverted uterus with an anterior cervical tumour , highly restrictive on dwi . no parametrial invasion is noted , but huge , bilateral obturator lymph nodes are found ( arrows ) . the left ovary shows follicular activity and is posteriorly displaced ( arrowhead ) . in this h&e section the cervix is occupied by a solid tumour , composed of small cells , with uniform nuclei and scarce cytoplasm ( d ) . some tumour cells show positive cytoplasmatic staining for synaptophysin ( e ) and for chromogranin ( not shown)fig . 6 \n a b cervical small cell carcinoma ( figo iii - b ; extension to the pelvic side wall ) . a 64 year - old female complaining of menorrhagia . axial t2-weighted mr image ( a ) and axial t1-weighted mr image with fat saturation after intravenous gadolinium administration ( b ) . cervical tumour extending posteriorly to the pelvic wall ( asterisk ) and superiorly to the left adnexal area , where it forms a huge solid , heterogeneous mass with central necrotic areas ( arrow ) . this mass shows intense enhancement after gadolinium administration and is adherent to the uterine corpus , which may be found inferiorly . bilateral internal iliac lymph nodes are also noted ( arrowheads ) \n a b cervical neuroendocrine tumour ( figo iv - a ; invasion of adjacent organs ) . a 32-year - old female complaining of vaginal bleeding after intercourse and fetid vaginal discharge . sagittal t2-weighted mr image ( a ) and axial t2-weighted mr image ( b ) . large cervical cancer with infiltration of the lower segment of the uterine corpus . the parametria are circumferentially infiltrated and the tumour extends anteriorly to the bladder , with transmural invasion and fistulae ( arrow ) . bilateral , nodal metastases of the external iliac groups are also seen ( arrowheads ) \n a e cervical small cell carcinoma ( figo ii - a ; invasion of the upper two - thirds of vagina with no parametrial invasion ) . sagittal t2-weighted mr image ( a ) , axial t2-weighted mr images ( b ) and sagittal diffusion weighted image ( dwi ) , b(c ) retroverted uterus with an anterior cervical tumour , highly restrictive on dwi . no parametrial invasion is noted , but huge , bilateral obturator lymph nodes are found ( arrows ) . the left ovary shows follicular activity and is posteriorly displaced ( arrowhead ) . in this h&e section the cervix is occupied by a solid tumour , composed of small cells , with uniform nuclei and scarce cytoplasm ( d ) . some tumour cells show positive cytoplasmatic staining for synaptophysin ( e ) and for chromogranin ( not shown ) \n a b cervical small cell carcinoma ( figo iii - b ; extension to the pelvic side wall ) . axial t2-weighted mr image ( a ) and axial t1-weighted mr image with fat saturation after intravenous gadolinium administration ( b ) . cervical tumour extending posteriorly to the pelvic wall ( asterisk ) and superiorly to the left adnexal area , where it forms a huge solid , heterogeneous mass with central necrotic areas ( arrow ) . this mass shows intense enhancement after gadolinium administration and is adherent to the uterine corpus , which may be found inferiorly .", "well - differentiated neuroendocrine tumours ( nets ) include typical and atypical carcinoid tumours . among the uncommon sites of primary carcinoid tumours , the uterine cervix constitutes one of the rarest locations , representing only 0.5 % to 5 % of cervical cancers . carcinoid syndrome is very rare and even in the lack of clinically evident carcinoid syndrome , many patients present with elevated urinary 5-hydroxyindoleacetic acid ( 5-hiaa ) . however , the diagnosis of a cervical carcinoid is frequently postoperative and laboratorial investigation is typically not helpful since it is not performed in the absence of symptoms . these tumours display a very aggressive , malignant behaviour , and their prognosis is poor ( 2- or 3-year survival rates , ranging from 12.5 to 33 % , according to some studies ) . atypical carcinoids of the cervix are also very rare and , according to a review of yoshida et al . , only 13 cases have been reported in the literature .", "the reported endometrial neoplasms with ne differentiation essentially include small cell carcinoma and endometrial adenocarcinoma with ne cells . small cell carcinoma of the endometrium resembles that of the lung and is uncommon , accounting for less than 1 % of all endometrial carcinomas . like in other endometrial carcinomas , abnormal bleeding is the primary presenting symptom , but some patients present with advanced disease , sometimes with pain from metastases . these tumours usually present as bulky intraluminal masses , and deep myometrial invasion ( 3350 % ) and extra - uterine spread ( near 50 % ) are common . pelvic lymph nodes , adnexa and the peritoneum constitute the typical sites of extra - uterine involvement . the overall prognosis is poor [ 5 , 35 ] . in 50 to 66 % , endometrial small cell carcinoma displays an admixed component of grade 1 or 2 endometrioid adenocarcinoma , and few cases showed a malignant mixed mullerian tumour within a predominant small cell carcinoma . we review two cases of poorly differentiated endometrial carcinoma with ne differentiation ( figs . 7 and 8) . like in cervical carcinoma , imaging does not allow histological distinction , since all endometrial cancers tend to present similarly : low to moderate signal on t2wi and hypointensity relative to the hyperintense enhancing myometrium on dynamic contrast - enhanced mri sequences . however , when a highly aggressive endometrial tumour is found , a neuroendocrine nature may be suspected . there are no consistent data regarding the prognosis of non - pure ne endometrial tumours ; however , the cases we illustrate were diagnosed in advanced figo stages , iv - b ( distant metastases ) ( fig . 7 ) and iii - c1 ( involvement of pelvic nodes ) ( fig . 7 \n a d poorly differentiated endometrial carcinoma with ne differentiation ( figo iv - b ; distant metastases ) . axial t2-weighted mr image ( a ) and axial enhanced ct image ( b ) . there is no invasion of the cervical stroma or bladder ( not shown ) , but a right obturator node ( arrow ) is found . ct evaluation shows that the disease has disseminated outside the pelvis , revealing para - aortic lymph nodes ( arrowhead ) as well as retroperitoneal and peritoneal metastases ( asterisks ) . vagina biopsy ( h&e ) infiltrated by a solid tumour composed by sheets of uniform cells , with small oval nuclei and scarse cytoplasm ( c ) . these cells have an intense cytoplasmatic staining for neuron - specific enolase ( d ) and have small chromogranine - positive granules in the cytoplasm ( not shown ) . 8 \n a d undifferentiated endometrial carcinoma with ne differentiation ( figo iii - c1 ; involvement of pelvic nodes ) . endometrial tumour prolapsing into the cervical canal , without invasion of the cervical stroma and myometrium . the tumour extends bilaterally through the lumen of the tubes to the parametrial tissues ( arrows ) . h&e section of the tumour with a solid pattern composed by large cells with pleomorphic nuclei , mitoses and scarce cytoplasm ( c ) . these cells have small chromogranine - positive granules ( d ) and small synaptophysin granules in the cytoplasm ( not shown ) and are strongly positive for pancytokeratin cam 5.2 ( not shown ) \n a d poorly differentiated endometrial carcinoma with ne differentiation ( figo iv - b ; distant metastases ) . axial t2-weighted mr image ( a ) and axial enhanced ct image ( b ) . there is no invasion of the cervical stroma or bladder ( not shown ) , but a right obturator node ( arrow ) is found . ct evaluation shows that the disease has disseminated outside the pelvis , revealing para - aortic lymph nodes ( arrowhead ) as well as retroperitoneal and peritoneal metastases ( asterisks ) . vagina biopsy ( h&e ) infiltrated by a solid tumour composed by sheets of uniform cells , with small oval nuclei and scarse cytoplasm ( c ) . these cells have an intense cytoplasmatic staining for neuron - specific enolase ( d ) and have small chromogranine - positive granules in the cytoplasm ( not shown ) . this tumour was synaptophysin negative \n a d undifferentiated endometrial carcinoma with ne differentiation ( figo iii - c1 ; involvement of pelvic nodes ) . endometrial tumour prolapsing into the cervical canal , without invasion of the cervical stroma and myometrium . the tumour extends bilaterally through the lumen of the tubes to the parametrial tissues ( arrows ) . h&e section of the tumour with a solid pattern composed by large cells with pleomorphic nuclei , mitoses and scarce cytoplasm ( c ) . these cells have small chromogranine - positive granules ( d ) and small synaptophysin granules in the cytoplasm ( not shown ) and are strongly positive for pancytokeratin cam 5.2 ( not shown )", "neuroendocrine tumours of the fallopian tube , vagina and vulva are very rare and only a few cases have been reported . in the fallopian tube , these tumours encompass carcinoids and small cell carcinoma , and they are not well known . in the vagina , almost ten cases of small cell carcinoma have been reported , occurring in females between 41 and 78 years of age . like in other vaginal tumours , the most frequent complaint was vaginal bleeding or discharge . metastatic disease was common in this small cohort , so the prognosis is thought to be poor . in the vulva , neuroendocrine differentiation may be found in small cell carcinoma of the bartholin gland and merkel cell tumours , which tend to present as vulvar masses .", "two groups are currently considered : necs , including small cell carcinoma and large cell ne carcinoma , and nets , which encompass typical and atypical carcinoids . the clinical features of theses tumours are non - specific and depend on the organ of origin and on the extension and aggressiveness of the disease . the imaging evaluation should follow the same criteria used for other tumours , and figo remains the preferred staging system . the diagnosis is obviously histological , and the role of imaging tools essentially includes initial detection , staging and biopsy guidance . however , some points should be taken into account when imaging studies are performed : cervical small cell carcinoma and ovarian carcinoid are the most common gynaecological ne tumours.cervical small cell carcinomas usually behave aggressively.ovarian carcinoids tend to behave in a benign fashion.while managing an ovarian carcinoid , extra - ovarian extension , bilaterality and multinodularity should raise the suspicion of metastatic disease.endometrial ne tumours are very rare and are usually small cell carcinoma or adenocarcinoma with ne differentiation.as for other tumours , us , ct , pet - ct and mri remain the most commonly used imaging tools , but octreotide scans may be useful for typical and atypical carcinoids . ovarian carcinoids tend to behave in a benign fashion . while managing an ovarian carcinoid , extra - ovarian extension , bilaterality and multinodularity should raise the suspicion of metastatic disease . endometrial ne tumours are very rare and are usually small cell carcinoma or adenocarcinoma with ne differentiation . as for other tumours , us , ct , pet - ct and mri remain the most commonly used imaging tools , but octreotide scans may be useful for typical and atypical carcinoids .", "" ]

[ "adenoid cystic carcinoma ( adcc ) is a malignant salivary gland tumor that was first described by billroth in 1859 under the name cylindroma attributing to its cribriform appearance formed by the tumor cells with cylindrical pseudolumina or pseudospaces . the term adenoid cystic carcinoma was introduced by ewing ( foote and frazell ) in 1954 . adcc is a relatively rare malignant salivary gland tumor comprising less than 1% of all malignancies of head and neck . it is the 5 most common malignancy of salivary gland origin , representing 5 - 10% of all salivary gland neoplasms . the parotid and submandibular glands are the two most common sites for adcc accounting for 55% of the cases . among the major glands , adcc accounts for 8.3% of all palatal salivary gland tumors and 17.7% of malignant palatal salivary gland tumors ( afip series ) . the other less common sites are lower lip , retromolar tonsillar pillar area , sublingual gland , buccal mucosa and floor of the mouth . the nose and paranasal sinuses represent the next most common sites for minor gland adccs . the tumor is most often clinically deceptive by its small size and slow growth , which actually overlies its extensive subclinical invasion and marked ability for early metastasis making the prognosis questionable . the three recognized histological variants of adcc are cribriform , tubular and solid although , cribriform is the most commonest and solid is the least commonest . it is not uncommon to have more than one histopathologic pattern in a single neoplasm and rather all three patterns can be observed in the majority of tumors . the main reason for histological typing is to assess the prognostic difference between histologic types . tubular pattern ( well differentiated ) is believed to have the best prognosis compared to the cribriform pattern ( moderately differentiated ) and solid pattern ( poorly differentiated ) .", "a 60-year - old male patient reported to the department of oral and maxillofacial surgery with a chief complaint of pain and discharge in the upper left back region of the jaw since one and half years . according to the patient one year prior to our consultation , he got the maxillary molars extracted from a local dentist due to pain and mobility of the teeth in that area . upon consultation patient revealed that the pain continued to exist even after the extraction . the patient is a known hypertensive and is on medication since three years for the same . the patient had smoking habit , which he quit only a couple of years ago . intraoral examination revealed a solitary erythematous swelling with diffuse borders involving the left posterior portion of hard palate and was also seen involving the soft palate on the same side . the swelling was seen extending from mesial aspect of first premolar to 1 cm posterior to tuberosity on left side , involving the palatal area but not crossing the midline [ figure 1 ] . intraorally , the lesion was seen involving the hard and soft palate but not crossing the midline the swelling was nontender . the clinical differential diagnosis included a benign or malignant neoplasm of minor salivary glands , a neoplasm of maxillary sinus . ct scan showing complete obliteration of left maxillary sinus an incisional biopsy of palate and sinus lining was performed . islands of uniform cells arranged in cord - like pattern with hyperchromatic nuclei were seen enclosing round to oval pseudocystic spaces in the stroma . the tumor cells are also seen arranged in the form of solid islands [ figure 4 ] and ductal pattern [ figure 5 ] . focal areas showed small cords and longitudinal tubules of isomorphic cells set in a background of densely hyalinized stroma [ figure 6 ] . variable - sized cribriform spaces formed by small deeply basophilic cells imparting swiss cheese pattern solid pattern composed of nests of basaloid cells and mitotic figures tubular pattern characterized by ductal structures formed by layers of isomorphic basaloid cells tubules of isomorphic tumor cells set in a densely hyalinized stroma a diagnosis of adcc ( cribriform pattern ) was established . the patient was treated by wide surgical excision with clear margins and hemi - maxillectomy of left maxillary region with post - radiotherapy . the present case was staged as t4n0m0 based on american joint committee on cancer as a guide to prognosis . the patient was under regular follow - up and is free of the disease at one - year follow - up .", "adenoid cystic carcinoma most often presents a diagnostic and treatment challenge owing to the rarity of the lesion . most findings regarding adcc are actually based upon studies with a small number of patients and there is a need for further information regarding its clinical behaviour as well as treatment modalities and their results . adcc may occur at any age although in most cases the patients age ranged from 24 to 78 years . the age of patients affected with major salivary gland tumors has been shown to be younger ( mean 44 years ) compared to the age of those who developed tumors of the minor glands ( mean 54 years ) and shows female predilection ( f : m 1.2:1 ) . pain is a common and important finding , occurring early in the course of the disease before there is a noticeable swelling . palate is more commonly involved generally the area of greater palatine foramen . among the malignant neoplasms of minor salivary glands , the most common was mucoepidermoid carcinoma ( 21.8% ) followed by polymorphous low grade adenocarcinoma ( plga ) ( 7.1% ) and adccs of the minor glands have been reported to have worse prognosis than those of the major salivary glands . tumors involving the nose , paranasal sinuses and maxillary sinus have the worst prognosis as they are usually detected with higher stages at the time of diagnosis . tumors of minor salivary glands usually have the tendency to infiltrate extra glandular soft tissues and bone thereby allowing increased dissemination of the tumor . lymph node involvement is uncommon ( < 5% of cases ) and is usually due to contiguous spread rather than lymphatic permeation or embolization . the differential diagnosis of adcc includes plga , basal cell adenoma ( bca ) , mixed tumor and basaloid squamous cell carcinoma ( bsc ) . the cribriform pattern so typical of adcc may also rarely be seen in bca , mixed tumor and plga , and the distinction between plga and adcc is more challenging . a polymorphous architecture characterizes plga whereas adcc has a more limited range of histologic patterns with no more than three patterns . plga shows uniform cell population with cytologically bland , round or oval vesicular nuclei and pale eosinophilic cytoplasm where as cells in adcc have clear cytoplasm , angular , hyperchromatic nuclei and may show mitotic activity . the ki-67 index is reported to be 10 times higher in adcc compared to plga . smooth muscle markers of myoepithelial differentiation are positive in adcc but negative in plga . though plga may form solid areas , they lack the overall high - grade feel associated with adcc . occasional foci in pleomorphic adenoma ( pa ) can resemble adcc but the presence of typical myxochondroid matrix and plasmacytoid or spindle shaped cells helps to avoid confusion . cribriform structures may sometimes be observed in bca and such cases can be differentiated from adcc on the basis of gradual structural alteration from areas typical of bca . the peripheral palisading and focal squamous differentiation with whorling pattern present in bca are not usually encountered in adcc . the basement membrane material secreted by bsc tends to dissect between tumor cells rather than form crisp cribriform spaces seen in adcc . focal keratinization , attachment to rete pegs , and presence of surface squamous dysplasia or carcinoma in situ helps to distinguish it from adcc . immunohistochemical studies demonstrated that the pseudocysts are positive for periodic acid schiff reagent ( pas ) and alcian blue and contain basement membrane components such as type iv collagen , heparin sulfate and laminin isoforms . epithelial cells are positive for carcinoembryonic antigen ( cea ) and epithelial membrane antigen ( ema ) . duct lining cells are positive for c - kit ( cd117 ) and myoepithelial cells are positive for s-100 protein , calponin , p63 , smooth muscle actin and myosin . expression of s-100 , glial fibrillary acidic protein ( gfap ) and neural cell adhesion molecule have been correlated with the presence of perineural invasion . molecular genetic data : alterations in chromosomes 6q , 9p and 17p12 - 13 are the most frequent cytogenetic alterations reported . hypermethylation of the promoter region of the p16 gene was associated with higher histologic grades of malignancy . possible treatment modalities available for the treatment of adcc are surgery , radiotherapy , chemotherapy and combined therapy . it requires excision with the widest surgical margins possible as tumor cells extend well beyond the clinical and radiographic margins . neutron therapy , which involves larger particles of greater energy can achieve reasonable local control as a primary therapeutic modality . main factors associated with patient survival are anatomic location , primary lesion size , presence or absence of metastasis at the time of diagnosis , perineural invasion and histological variant . distant metastasis occurs in 25%-50% of patients and lung is the most common involved site . the 5-year survival rate after effective treatment is 75% , but long - term survival rates are low ( 10 years-20% and 15 years-10% ) . the present patient was recalled at every 6-month interval in view of the sinus involvement and propensity for distant metastasis .", "lesions involving the sinus tend to have a poor prognosis due to its infiltrative growth and distant metastasis ." ]

[ "the quantity of trauma victims and the management involved in attending them leads to a great workload in most hospitals and places an enormous amount of pressure on the health care system . furthermore , traumatic injuries have been reported as the leading cause of death in the first 40 years of life and appear to be on the increase . during the last decade , interpersonal violence ( ipv ) was one of the main etiological factors of fractures of the maxillofacial complex . road traffic accidents remain the most important cause of maxillofacial trauma worldwide , although falls and assaults have become more significant in north america , brazil and europe . blunt and cutting wounds on the head and neck are also common . legal underreporting is common due to associations with alcohol abuse , illicit drug use , firearms and acts of violence against women , children , and the elderly , which generate fear , shame , low self - esteem and a sense of powerlessness . facial fractures associated to ipv have functional , aesthetic and psychological effects on the victims , as well as a socioeconomic impact on the health systems of many countries .these victims are more likely to suffer from depression , anxiety and post - traumatic stress disorder . epidemiological studies help to identify demands , develop prevention programs and structure an integrated care system . the aim of this retrospective study was to compare the peculiarities of maxillofacial injuries caused by interpersonal violence with other etiologic factors .", "this retrospective study involved data collected from clinical notes and surgical records of patients treated at seven different hospitals located in three different cities in so paulo state , brazil . the sample was selected based on analysis of medical records of facial trauma patients attended by the department of oral and maxillofacial surgery in the piracicaba dental school at the university of campinas from january 1999 to december 2012 . a standardized form was designed to investigate the epidemiologic features of maxillofacial traumas , considering aspects such as age , gender , diagnosis , soft tissue lesions , facial injuries and general injuries . the exclusion criterion was incomplete information about the type of trauma on the medical chart . the origin of the facial trauma was classified as follows : traffic accidents ( automobile and motorcycle ) ; work accidents ; sport accidents ; falls ; interpersonal violence ; cycling accidents ; pedestrian accidents and others . facial injury sites were classified as follows : upper ( frontal bone ) ; middle ( maxilla , nasal bones , zygomatic - orbital complex , naso - orbital ethmoidal ) and lower ( mandible ) . mandibular fractures were described according to the anatomic site : condylar fractures ; angle fractures ; body fractures and fractures of symphysis . the present study was approved by the research ethics committee of piracicaba dental school , state university of campinas ( fop / unicamp ) under protocol number 75/2013 . data were submitted to statistical analysis ( simple descriptive statistics and chi - squared test ) with the support of the statistical package for social sciences ( spss 18.0 for windows , spss inc , chicago , il ) . binary logistic regression and the chi - square test were performed and the results were considered relevant when p < 0.05 . these included absolute frequencies ( raw counts ) and relative frequencies ( proportions or percentages of the total number of observations ) .", "based on the 13-year study period , 3,724 patient referrals to the maxillofacial surgery department were enrolled in the present study . the median age at the time of admission was 29.2 years , with a standard deviation of 17.06 years . a total of 612 patients ( 16.4% ) exhibited facial injuries related to ipv . in this group , male victims prevailed with 81% ( n = 496 ) and the mean age was 31.28 years , with a standard deviation of 13.33 years . weekly consumption of alcohol was reported by 32.4% and tobacco use was 43.8% . in total , 79 patients ( 12.8% ) reported using non - injecting illicit drugs and 14 ( 2.2% ) stated that they currently used injecting drugs . in 176 cases , isolated alveolar - dental injuries were observed in 35 patients . with regards to maxillofacial fractures , table 2 shows the distribution of diagnoses in the general sample and among patients who were victims of physical assault . \n distribution of patients with facial injuries according to etiological factors \n \n n = number of patients . \n \n distribution of facial injury diagnoses among a general sample and patients whose facial injury was associated with interpersonal violence ( ipv ) \n \n n = number of patients . \n in the cases of mandibular fractures , the anatomic regions most affected were the body and the mandibular angle , with 36 cases in each region , followed by the condyle ( 25 cases ) , symphysis ( 9 cases ) and isolated mandibular ramus ( 2 cases ) . in 41 patients , fractures involving more than one anatomic region of the mandible lacerations and abrasions on the face were identified in 181 and 105 patients , respectively . table 3 displays the distribution of body injuries in these patients , when compared to the general sample . \n distribution of body injuries among patients with facial trauma and patients whose facial injury was associated with interpersonal violence ( ipv ) \n \n the calculation is based on whole sample ( n = 3724 ) . \n \n the calculation is based on patients that involved with ipv ( n = 612 ) . \n \n comparison of features of facial injury of victims of interpersonal violence ( ipv ) and other etiologic factors \n \n n = number of patients ; = chi - square . \n a greater number of fractures and lacerations of the face was observed , although with fewer facial abrasions . with regards to the area of bone fractures , fewer injuries occurred in other regions of the body , mainly due to fewer injuries of the upper and lower limbs . however , patients that were associated with ipv exhibited a greater number of injuries to the neurocranium . binary logistic regression was performed to determine whether fractures in facial injuries were affected by gender , age ( median 30 years ) , drug use , the presence of lacerations or the presence of abrasions . fractures were associated with gender : male patients are more at risk than females ( or = 1.61 , p < 0.002 , 95% ci : 1.05 to 2.46 ) .", "although motor vehicle accidents are still the main cause of maxillofacial fractures in some developing countries , recent data from developed countries have shown that ipv is the dominant cause . ipv is one of the leading causes of maxillofacial fractures and its prevalence in a population varies according to geographic region and appears to be associated with factors such as socioeconomic status , population density and age characteristics . the prevalence of male victims has been reported in most studies , ranging from 61% to 92% , as well as a mean age of approximately 30 years [ 10 - 14 ] . however , children are also affected and several studies have reported the patterns and severity of these injuries . this age group is susceptible to craniofacial trauma due to their greater cranial mass - to - body weight ratio . compared to adults , less 65 patients were under 18 years of age , although most of them ( 36 patients ) were aged between 16 and 18 years . these patients mainly exhibited nasal bone ( 21 patients ) and mandibular fractures ( 12 patients ) , results which are in accordance with the literature . the prevalence of male victims is influenced by cultural models of gender , defined as the set of attributes , values , roles and behavior patterns that are expected from a man in a particular culture . generally , the traits valued in this socialization are aggression , domination and exploitation of danger , which could contribute to their association with ipv . ipv among females is mainly associated with domestic violence . in the present study , it was not possible to determine the pattern of violence suffered . when the victim is female , the case should be investigated regardless of the site of the injury , as there is a greater possibility that they are the victim of physical aggression due to the vulnerability of the gender . another relevant factor is the differences in female participation in social activities , making them more ( or less ) prone to urban violence . patients who were victims of physical assault , unlike other etiologies such as sports accidents , are often affected by problems such as drug use and poverty . in the present study , we found high consumption rates of alcohol , tobacco and non - injecting drugs . its consumption results in an increase in confidence , followed by the subjective feeling of increased mental and physical capacity , as well as impaired judgment and coordination . . found that alcohol was involved in 87% of maxillofacial fractures caused by ipv , compared with 58% for motor vehicle accidents . studies have reported that fractures of the mandible are the most prevalent , followed by zygomatic complex fractures [ 17 - 19 ] . furthermore , we showed that the prevalence of mandibular and nasal bone fractures was higher in this group of patients . the literature indicates that trauma associated with ipv are less severe than those associated with other etiological factors due to the magnitude and speed of impact . despite this fact , patients in which ipv was the etiologic factor exhibited a higher prevalence of bone fractures when compared to all other patients treated . possibly , some patients with minor injuries do not seek medical care due to shame or fear . a high frequency of soft tissue lesions were found on the face , particularly lacerations . in the literature , the most common orofacial injuries are lip injuries , followed by other soft tissue injuries on the face , gingival and oral mucosa injuries , and teeth and/or periodontal injuries . the pattern of facial fractures is related to the type , direction and force of impact , as well as the anatomical features of the area . ipv injuries are usually caused by punches or kicks , for which the face is the main target region . the face is probably the target for most acts of physical aggression as it is easily reached , due to its location at the same height as the aggressor s raised arm . it has also been suggested that the aggressor either consciously or unconsciously wishes to affect the victim s self - esteem . males appear to be injured by more dangerous mechanisms and are more frequently injured by objects than females . the mandible , which is mobile and prominent on the face , is more susceptible to trauma . in the present study , the region of the mandibular angle has been considered the least resistant , mainly due to the presence of the mandibular third molar . these accidents often cause pan - facial , cranial , orthopedic , abdominal and cervical spine injuries , which may require multidisciplinary input , with significant interventions such as intubation , craniotomy and tracheostomy . conversely , ipv tends to be associated with isolated fractures , particularly in the mandibular region . the present study confirmed that most patients were affected by a fracture in only one region of the face . a lower prevalence of injuries was recorded for other parts of body . although the world health organization considers the response of health - care services to victims of violence to be an international priority , health professionals are generally not qualified to identify the injuries or council victims . the role of health professionals is to identify the etiology of the injury and , in cases of physical aggression , provide the victim with information on where to seek help . moreover , health professionals are not well prepared to ask sensitive questions and are unaware of victim - support institutions .", "the findings of the present study demonstrated that facial trauma caused by interpersonal violence seem to be associated with a higher rate of facial fractures and lacerations when compared to all other patients with facial injuries . male patients are more likely to exhibit severe injuries and exhibited a greater amount of bone fractures . prominent areas of the face and neurocranium should be carefully examined as they tend to be more prone to injuries .", "glaucia maria bovi ambrosano , associate professor , department of community dentistry , campinas state university piracicaba dental school , for statistical analysis assistance ." ]

[ "the influence of protecting \n groups on the reactivity and selectivity \n of glycosyl donors is a widely recognized and exploited phenomenon . the corresponding influence of protecting groups on the anomeric \n equilibrium , while evident for many years , is less widely studied and exploited . recent examples of the latter \n include the recognition that 2n,3o - oxazolidinones both facilitate anomerization in the 2-amino-2-deoxyhexopyranosides \n and stabilize the axial over the equatorial anomer , with similar effects being apparent in hexopyranosides carrying \n a 2,3-o - cyclic carbonate group , and the realization that cyclic 4,6-o - acetals modulate \n the anomeric effect in the hexopyranoses . our interest in the use of the n - acetyl-4o,5n - oxazolidinone protected \n sialyl donors , and their n - desacetyl \n counterparts , which have emerged as some of \n the most powerful and equatorially selective systems for the preparation \n of sialyl o - glycosides , as well as their c- and s - counterparts , prompted us \n to examine the effect of these systems on the anomeric equilibrium \n of sialyl glycosides . the magnitude of the anomeric effect is typically \n assessed either by mutarotation of anomeric hemiacetals or by the \n brnsted or lewis acid - mediated equilibration of glycosides , \n and such methods have been used to determine the position of the anomeric \n equilibrium in both n - acetyl neuraminic acid itself \n and its methyl glycoside , leading to the conclusion that the axial glycoside is significantly \n more strongly favored in the sialic acids ( figure 1 ) than in glucose and that mutarotation of the hemiacetal \n takes place via a ring - opening mechanism . the attempted synthesis of a n - acetyl-4o,5n - protected sialyl \n hemiacetal 2 by hydrolysis of the corresponding thioglycoside 3 resulted in the formation of a complex mixture of the two \n anomers \n of 2 and of the acyclic form 4 , and its \n hydrate 5 , as determined by nmr spectroscopy , in which \n the latter two species predominated ( figure 2 ) . the complexity of the spectra together with the predominance of \n the open - chain forms revealed the strain placed on the pyranose forms \n by the presence of the trans - fused oxazolidinone \n ring , even if no distortion of the pyranose ring is evident from x - ray \n structures , and precluded use of the standard \n methods in this investigation . compounds employed in and arising from \n the mutarotation of an oxazolidinone - protected \n sialose derivative . accordingly , we turned \n our attention to the use of neutral methods \n for the equilibration of sialic acid glycosides such as would not \n involve the intermediacy of the anomeric hemiacetal and would be compatible \n with the readily cleaved activated oxazolidinone \n ring . precedent for the equilibration of anomeric stereochemistry \n through the reversible homolytic cleavage and reformation of anomeric \n c h , c co , and c te bonds , suggested \n that the answer might lie in radical reactions . the need to approximate \n as closely as possible the properties of o - glycosidic \n bonds suggested the synthesis and equilibration of o - glycosyl derivatives of sterically hindered n , n - disubstituted hydroxylamines by the fischer albeit less substituted than \n the systems required for the radical equilibration process , glycosyl \n hydroxylamines are found in nature in the enediyne antibiotics calicheamicin \n 16 and esperamicin 7 , and simple hydroxylamines have been employed as glycosidic bond \n surrogates in neoglycoconjugates ( figure 3 ) . moreover , the distinct conformational preferences of the o - glycosyl hydroxylamine linkage have been advanced as a \n design element used by nature to assist in the binding of calicheamicin \n to the minor groove of dna.o - glycosyl hydroxylamines have been identified as metabolites of various \n drugs , including glucosides and glucuronides \n of the antioxidant 2,2,6,6-tetramethylpiperidin-1-ol . natural products featuring the o - glycosyl hydroxylamine \n moiety . in a preliminary communication \n we established the concept with \n sialyl glycosides of 2,2,4,4-tetramethylpiperidin-1-ol in a single \n solvent . in this article we report in \n full on the synthesis of the o - sialyl glycosides \n of two further hydroxylamines of differing steric bulk and conduct \n equilibration studies in three solvents spanning a broad range of \n polarities . the influence of the sialyl protecting groups , solvent \n polarity , and hydroxylamine steric bulk on the thermal equilibration \n reactions of the sialyl hydroxylamines are presented and afford insight \n into the influence of the trans - fused oxazolidinone \n group in sialic acid chemistry . the lack of kinetic selectivity of \n sialyl anomeric radicals is discussed from the viewpoint of their \n conformation , which is based on literature electron spin resonance \n data of cognate radicals .", "despite the presence of o - glycosyl hydroxylamines \n in various enediyne antibiotics and their use in neoglycoconjugates , \n literature methods for their synthesis are limited to the glycosylation \n of ( i ) various n - acylated hydroxylamines , e.g. , n - hydroxyphthalimide and n - carboethoxy \n hydroxylamine , ( ii ) oximes , and ( iii ) nitrones , each with subsequent manipulation of the functionality at nitrogen . \n these methods are , however , not suitable for the synthesis of the \n sterically hindered o - glycosyl n , n - dialkylhydroxylamines required for this investigation , \n and we therefore turned to the design of alternative routes . a brief \n investigation of the direct glycosylation of n - hydroxy-2,2,6,6-tetramethylpiperidine \n with efficient sialyl donors such as developed previously in our laboratory was unfruitful , perhaps for reasons of steric \n hindrance , and we turned therefore to radical reactions and their \n relative indifference to steric constraints . previous workers have generated sialyl anomeric radicals for the \n purposes of c - sialoside formation by the action of \n stannyl radicals on sialyl chlorides , but we have \n preferred simple photolysis of a readily available s - sialyl xanthate ester 8 . we note in passing that attempted photochemical equilibration of \n xanthate 8 resulted , in a process reminiscent of the \n barton fortunately , 254 nm \n photolysis of 8 through pyrex \n in a rayonnet photoreactor in the presence of the stable nitroxyl \n radicals tempo ( 10 ) , tmio ( 11 ) , and sg1 ( 12 ) resulted in the formation of the desired o - glycosyl hydroxylamines 1416 as \n reported in scheme 2 . attempted application \n of this method to dbno 13(107 ) resulted only in the formation of the glycal 9 . that \n the photolysis of 8 can be interrupted with appropriate \n radical traps before the formation of glycal 9 indicates \n that it takes place via a two - step process giving an initial radical \n pair followed by disproportionation ( scheme 1 ) . this observation , which is critical to the success of the project , \n differs from the original conclusion of the barton and porter laboratories \n regarding the photoelimination of thiobenzoate esters . those workers \n preferred a concerted elimination from a photochemically excited state \n of the thiocarbonyl ester on the basis of ( i ) the observation of a \n short - lived transient on irradiation of the thiobenzoate , and ( ii ) \n the inability to trap radical intermediates with ( unspecified ) radical \n traps . we also note , however , and more \n in line with the results observed here , that the photolysis of s - acyl xanthate esters is known to proceed with homolytic \n scission of the s - acyl bond resulting in acyl radical \n formation . returning to the synthesis of the o - glycosyl hydroxylamines , \n when the photolysis of 8 was conducted in the presence \n of tempo ( 10 ) the product 14 was obtained \n as an approximately 1:2 mixture , favoring the isomer ( - ) with \n the axial hydroxylamino residue , in 69% yield together with 10% of \n the glycal . with tmio ( 11 ) , the adduct 15 was obtained in 72% yield as an approximate 1:2.2 : \n mixture . photolysis in dichloroethane in the presence of racemic sg1 \n ( 12 ) gave only the glycal 9 , but the anomeric \n radical could be intercepted in 45% yield when neat sg1 ( 12 equiv ) \n was used as solvent . finally , photolysis in the presence of di(t - butyl)nitroxide in dichloroethane afforded only the glycal 9 . given the use of racemic sg1 , there are four potential \n diastereomers of 16 , but the product was isolated as \n a mixture of two predominant but inseparable isomers , the major one \n of which we tentatively assign as an equatorial ( - ) adduct \n and the minor as an axial ( - ) adduct without commenting \n on the configuration at the stereogenic \n center adjacent to the phosphoryl group . the anomeric stereochemistry \n in each of the adducts 1416 is assigned \n on the basis of the j heteronuclear coupling \n constant between the anomeric carboxyl carbon and the axial methylene \n proton at c3 in the pyranose ring , which is diagnostic in the sialic \n acid glycosides . these assignments are also supported by noe measurements for the \n axial ( - ) anomer of 14 and subsequent members \n of the same series ( vide infra ) , which reveal the spatial proximity \n of the axial h6 in the pyranose ring and one or more of the methyl \n singlets in the hydroxylamine moiety . resubmission of 14 to the photolysis conditions did not result in any change in the \n anomeric ratio consistent with the lack of a suitable chromophore , \n and indicating the products 1416 to be kinetic mixtures . rate constants for the trapping of \n alkyl radicals by nitroxyl radicals , while high ( 10 to \n 10 s ) , are nevertheless below the \n diffusion controlled limit for stabilized alkyl radicals and are dependent \n on steric bulk in both the radical and the trap . the stereoselectivities observed in the formation of 1416 therefore must factor in the inherent face \n selectivity of the intermediate radical 18 ( figure 4 ) and the steric bulk of the trap , which according \n to bowry and ingold , follows the trend dbno > tempo > tmio on \n the \n basis of kinetic trapping data ( sg1 not being included in the study ) . we conclude therefore that radical 18 shows a modest axial selectivity that can be overridden by the use \n of the presumably more bulky trap sg1 . this modest axial selectivity \n is consistent with the work of paulsen and matschulat , who recorded \n an axial / equatorial trapping preference of 1.8:1 for the reaction \n of 18 with allyltributylstannane at 60 c in thf , but not with the work of nagy and bednarski , \n who reported an approximate axial / equatorial ratio of 1:1 for the \n same reaction conducted at room temperature under photochemical conditions . we depict radical 18 as a \n close to planar -radical \n with extensive delocalization onto the carboxyl oxygen resulting in \n two distinct conformers about the exocyclic c1c2 bond ( figure 4 ) on the basis of literature esr data for simple \n model radicals . thus , esr studies of the tri - o - acetyl-2-deoxy-1-glucosyl \n radical 19 show it to adopt a chair conformation with \n an out of plane bend of 6 for the anomeric carbon consistent \n with a radical that is 90% sp hybridized . the methoxycarbonylmethyl radical 20 is a planar \n -radical with extensive delocalization onto the carboxyl oxygen \n and a barrier to rotation about the ch2co2me bond of 11 kcal mol , and the methoxy(methoxycarbonyl)methyl radical 21 displays esr parameters that closely mirror those of 20 , including the hyperfine splitting ah indicative of coupling to the ester methyl hydrogens , which is diagnostic \n of extensive delocalization . finally , \n the close model radicals 22 and 23 also \n show esr spectral parameters consistent with those for 20 , including hyperfine splitting by the ester methyl hydrogens and \n two distinct rotamers about the c5co2me bond . the two radicals 22 and 23 , isomeric at \n the -position , adopt different conformations so as in each \n case to maximize the overlap of the -acetoxy group with the \n singly filled orbital , a phenomenon known as quasi - homoanomeric stabilization . it follows that when the -position is unsubstituted as in \n radicals 18 and 19 , and the constraint of \n the quasi - homoanomeric interaction absent , the chair conformation \n will be retained . predicted structure of the intermediate \n radical 18 and literature structures of the model radicals 1923 with key esr parameters ( hyperfine \n splitting constants a in mt ) . presumably , it is the close to -type , approximately \n planar \n structure of radical 18 and the presence of the anomeric \n carboxyl group that accounts for the low kinetic stereoselectivities \n in its reactions with radical traps , which contrast with the high \n axial selectivity seen in the chemistry of simple per acetylated glycosyl \n radicals , including 19 , and their 1-alkoxy derivatives . thus , trapping of radical 18 along the axial direction , \n while favored on stereoelectronic grounds and leading directly to \n the chair conformation of the product , involves a 1,3-diaxial interaction \n between the axial h4 and h6 and the partially formed c2o bond , \n while equatorial trapping results in 1,3-diaxial interaction of h4 \n and h6 with the fully formed c2-co2me bond albeit while \n placing the incoming bulky hydroxylamine in the sterically more accessible \n equatorial position ( figure 5 ) . this latter \n mode only begins to predominate with the most bulky nitroxide trap , \n sg1 ( 12 ) and the formation of 16 ( scheme 2 ) . a similar rationale has been previously invoked \n for exo endo - selectivity , \n with competing steric interactions between a full covalent bond to \n a substituent at the radical center and partially formed covalent \n bond to an incoming trap for the bicyclic radical 24 . competing transition states for the trapping of radical 18 showing 1,3-diaxial interactions with h4 and h6 , and structure \n of \n the radical 24 . with a series of glycosyl hydroxylamines in hand , and with \n a view \n to examining the influence of protecting groups on the anomeric equilibrium , \n a set of standard protecting group manipulations were applied to 14 and 15 , as illustrated in scheme 3 , giving a number of derivatives for subsequent \n equilibration studies . a series of equilibration \n reactions were then conducted by heating \n individually ( 0.050.1 m ) solutions of substances 14 , 15 , and 3033 to \n 90 c in each of deuteriobenzene , deuterio-1,2-dichloroethane , \n and deuterioacetonitrile , with periodic monitoring by nmr spectroscopy \n until no further change was observed ( table 1 ) . attempted equilibration of the sg1 derivative 16 resulted \n only in the formation of the elimination product 9 , for \n which reason , coupled with the problem of extra diastereomers arising \n from the stereogenic center in the aglycone , the sg1 series was not \n pursued further . a further compound , the n , n - diacetyl tempo glycoside 25 was also subjected \n to equilibration in deuterio-1,2-dichloroethane ( table 1 ) ; however , further work with this compound was not conducted \n in other solvents , nor was the tmio analogue prepared . the mechanism \n of the equilibration process involves reversible homolytic scission \n of the glycosyl - hydroxylamine c o bond to an anomeric radical \n and a persistent aminoxyl radical ( scheme 4 ) . ingold radical effect that the recombination is intermolecular \n rather than intramolecular within the confines of the initial radical \n pair . the intermolecular nature of the process enables its use in \n combinatorial library generation , and \n for the present purposes it was readily demonstrated by a simple crossover \n experiment . thus , heating of 15 in the presence of an \n equimolar amount of tempo in 1,2-dichloroethane to 90 c for \n nine days , after which no further change was observed , resulted in \n the formation of an approximately 1:2 mixture of 14 and 15 , both as a mixture of anomers favoring the -anomers . \n the predominace of the tmio sialosides 15 over the tempo \n sialosides 14 in this equilibrated mixture indicates \n the greater thermodynamic stability of 15 over 14 , which is consistent with the less hindered , more tied \n back nature and therefore less persistent \n nature of the tmio radical 11 in comparison to the tempo \n radical 10 . successful achievement of the \n equilibration process required rigorous \n exclusion of oxygen , which was achieved by copious sparring with argon , \n and possibly moisture , as with some batches of deuterioacetonitrile \n a further type of byproduct exemplified by 34 was observed \n ( scheme 5 ) . while this thermal oxidative decarboxylation \n process of a sialic acid glycoside is certainly interesting in view \n of other sialic acid decarboxylation processes , both oxidative and reductive , we have not pursed \n it further at present , especially as it could be avoided by degassing \n and use of fresh deuterioacetonitrile . first , as compared to sialic acid itself ( figure 1 ) and to simple methyl sialosides the o - sialyl hydroxylamines studied \n all show an inverted preference for the equatorial over the axial \n glycosides . second , there is a solvent effect on the position of the \n anomeric equilibrium with the equatorial ( - ) anomers generally \n being more highly favored in the higher polarity solvents . third , \n the magnitude of this solvent effect is on the whole greater in the \n tmio series ( table 1 , entries 2 , 5 , and 7 ) \n than in the tempo series ( table 1 , entries \n 1 , 4 , and 6 ) . fourth , the anomeric ratio at equilibrium is a function \n of the protecting groups employed with the same trends being seen \n for the both the tempo and tmio series of compounds . the general \n preference of the equatorial over the axial glycosides \n seen in table 1 , which contrasts sharply with \n the strong anomeric effect in simple sialosides , reflects the significant \n steric bulk of the hindered hydroxylamine aglycones and the attendant \n destabilization of the axial glycosides through classical 1,3-diaxial \n interactions . this reversal of the anomeric preference between simple \n sialosides and those of hindered hydroxylamines does not detract from \n the validity of comparisons within the later series of compounds that \n form the core of this article . the observed solvent effect , which \n is consistent with the well - known general \n trend whereby the anomeric effect is greatest in less polar solvents , \n simply reflects the more polar nature of equatorial versus axial glycosides . \n the greater solvent dependence of the tmio series as compared to the \n tempo series of compounds presumably arises from the more polar nature \n of the tmio group relative to the tempo group , which is a function \n of the presence of the electron - withdrawing arene in the tmio moiety . the most consistent trend , which holds for \n both the tempo and tmio series of compounds and for all three solvents \n assayed , involves the change in anomeric ratio as a function of protecting \n groups at the o4 and n5 positions . thus , there is generally a greater \n preference for the equatorial glycoside , or a smaller anomeric effect , \n in the 4o,5n - oxazolidinone series \n ( table 1 , entries 4 and 5 ) , than in the n - acetyl-4o,5n - oxazolidinone \n series ( table 1 , entries 6 and 7 ) , which in \n turn show a greater equatorial preference than the 4o,5n - diacetyl series ( table 1 , entries 1 and 2 ) . although less data is available , the 4o,5n,5n - triacetyl compounds \n ( table 1 , entry 3 ) appear to fall between the \n diacetyl and the n - acetyloxazolidinones . decreasing preference \n for the axial ( - ) sialoside as a function \n of protecting group . turning to the reasons underlying the general greater preference \n for the equatorial glycosides ( figure 6 ) in \n the oxazolidinone series , we discount steric arguments based on a \n smaller steric clash between the aglycone and the o4 protecting group \n in the oxazolidinones because the usual exoanomeric effect conformation about the glycosidic \n bond will orient the aglycone toward the rear of the molecule and \n away from o4 ( figure 7 ) . indeed , the typical \n exoanomeric effect conformation with an n o anomeric \n c ring oxygen torsion angle of -60 is evident \n in the x - ray crystal structure of a calicheamicin derivative , in the x - ray structures of a simple o - glycosyl \n hydroxylamine , and of various o - glycosyl oximes and hydroxyimides , albeit a molecular mechanics - based computational \n paper appears to suggest a n o anomeric c ring \n oxygen torsion angle of 170. newman \n projection about the hydroxylamine n o bond showing \n the typical exoanomeric effect conformation of the o - glycosyl hydroxylamines . rather we suggest that the influence \n of the oxazolidinone on the \n anomeric effect is rooted in the highly polar nature of the oxazolidinone \n system with its strong dipole moment aligned with the axis of the \n carbonyl bond ( figure 8) . thus , as illustrated in figure 9 , the oxazolidinone \n moiety exhibits a powerful electron - withdrawing effect in the mean \n plane of the pyranose ring due to the alignment of the carbonyl dipole \n with the polar c4o4 and c5n5 bonds . this is to be \n contrasted with the 4o,5n - diacetyl \n system in which , assuming the standard minimum energy conformations \n of the ester and amide groups with the latter apparent from \n the 180 h5c5n5nh torsion angle with jnh , h5 = 10 hz , the two carbonyl \n dipoles are oriented in opposite directions and approximately perpendicular \n to the c4o4 and c5n5 bonds resulting overall in a \n smaller electron - withdrawing effect . the electron - withdrawing effect \n of the n - acetyloxazolidinone system , while still \n powerful because of the alignment of the oxazolidinone carbonyl with \n the c4o4 and c5n5 bonds in the mean plane of the pyranose \n ring , is moderated by the orientation of the acetyl group , which , \n as is clear from the available x - ray crystal structures and literature data with simple models , is oriented so as to minimize the overall dipole ( figure 8) at least in weakly polar environments . dipole moments \n ( debye units ) of open chain and cyclic carbonyl \n functionalities in nonpolar solvents . orientations of the key o4 and n5 protecting group carbonyl dipole \n moments in the o - sialyl hydroxylamines ( side chains \n omitted for clarity ) . if the anomeric effect is understood in terms of donation \n of electron \n density from a lone pair ( n ) on the ring oxygen into \n the synperiplanar c o * orbital of the axial glycosidic \n bond , the influence of the oxazolidinone can be \n attributed to the lowering of the energy of the lone pair due to the \n presence of the strongly electron - withdrawing group , which in turn \n reduces the n * interaction and so \n diminishes the anomeric effect . in valence bond terms this equates \n to the destabilization of the double bond no bond resonance \n form owing to the increased energy of the oxocarbenium ion arising \n from the presence of the strongly electron - withdrawing protecting \n group ( figure 10 ) . it can also be argued in \n view of the high dipole moment of the oxazolidinone group that there \n is a dipolar component to the stabilization of the equatorial glycosides . \n thus , in the axial glycosides the vectors of the oxazolidinone dipole \n and the anomeric carbon oxygen bond dipole subtend an angle of approximately \n 90 , whereas in the equatorial glycoside the angle subtended \n is approximately 60 , suggesting that the equatorial glycosides \n will be more highly stabilized in less polar media , as is the case \n ( table 1 ) .", "a new method of equilibration of sialyl anomeric \n c o bonds \n has been developed on the basis of the fischer ingold persistent \n radical effect . this method enables the investigation of protecting \n groups on the anomeric equilibrium and is compatible with acid and \n base sensitive functionality . the trans - fused oxazolidinone \n moiety is found by this method to stabilize equatorial glycosides \n over their axial counterparts , i.e. , to reduce the magnitude of the \n anomeric effect . this effect , which adds to a series of recent observations \n on the influence of cyclic protecting groups on the anomeric effect , is a manifestation of the strongly electron - withdrawing nature of \n the trans - fused oxazolidinone , ( and by extrapolation trans - fused cyclic carbonates ) , which is a direct consequence \n of the highly dipolar nature of such heterocycles . the strongly electron - withdrawing \n nature of these groups manifest by the present study more than likely \n also plays an important role in the high kinetic selectivity observed \n in the trans - fused oxazolidinone ( and cyclic carbonate)-directed \n -sialoside synthesis methods . the unusually poor kinetic diastereoselectivity \n of anomeric radicals in the sialic acid series is a function of the \n -type planar nature of these radicals coupled with the existence \n of competing 1,3-diaxial interactions in the diastereomeric transition \n states for the formation of both anomers ." ]

[ "familial hemiplegic migraine ( fhm ) is an autosomal dominant rare type of migraine with aura characterized by some degree of hemiparesis . fhm1 , fhm2 and fhm3 are caused by mutations in the ion - channel genes cacna1a , atp1a2 and scn1a , respectively [ 24 ] . the majority of fhm families have pure fhm , but cerebellar ataxia is frequent in fhm families with mutation in the cacna1a gene [ 5 , 6 ] . we present a norwegian family with a v628 m mutation in the atp1a2 gene ( fig . 1 ) . 1the pedigree , the arrow indicate the proband , squares are men and circles are women , filled symbols are affected , and forward slash indicate deceased the pedigree , the arrow indicate the proband , squares are men and circles are women , filled symbols are affected , and forward slash indicate deceased", "a 16-year - old male was referred to the neurological ward on a hot summer day due to a prolonged attack of fhm . the patient had played soccer and shortly after heading a ball he experienced a left - sided homonymous hemianopsia , followed by left - sided sensory symptoms and motor weakness , and then a contralateral migrainous headache . from the age of 2 years he experienced several attacks of sudden drowsiness , nausea and headache . most attacks were preceded by head trauma and were interpreted as commotio . at the age of 6 years he also experienced motor weakness and reduced coordination of the hand during attacks , and at the age of 9 years this was followed by dysphasia and somnolence . several ct - scans of the brain were normal . at the age of 10 years he had the diagnosis fhm after a prolonged attack with visual disturbances , scotoma , sensory symptoms , motor weakness , aphasia , somnolence and contralateral headache . he was discharged with 75 mg acetylsalicyl acid daily , and 160 mg propranolol daily . after initiation of the prophylactic treatment , the attack frequency 12 times per year was unchanged , but the duration of the aura symptoms and headache was reduced to 12 and 2436 h duration , respectively . prior to hospital admission the patient barely drank or ate anything for 5 days due to nausea and severe migrainous headache . at first , he received treatment with metoclopramide , paracetamole and ketobemidon and 1,000 ml i.v . blood test including blood count , b-12 , creatine kinase , electrolytes , liver status , tsh , antinuclear antibodies , anticardiolipin antibodies and rheumatoid factor were all normal . due to fear of vasoconstriction and migraine infarction , several measures were evaluated including continuous conservative management and verapamil treatment . after external advice continuous infusion of intravenous nimodipine 510 ml / h ( dose ) was initiated . the patient s symptoms worsened within hours , and the following morning he had a generalized tonic total infusion dose was then 16 mg . an acute mri showed mild swelling of the right parietal lobe ( figs . 2 , 3 ) . he continued to have some degree of hemiparesis along with apraxia , homonymous hemianopsia and mild cognitive failure , i.e. , 25 of 30 points on the mini mental state examination ( mmse ) , and mildly impaired memory score and moderately impaired construction score on the cognistat . at that time a single photon emission computed tomography ( spect ) showed reduced perfusion in the right hemisphere , predominantly in the temporal and parietal lobe ( fig . 4 ) . the patient was discharged after 3 weeks hospitalization and re - admitted 4 weeks later on day 55 . at that time he suffered from dizziness and memory deficits . clinical examination disclosed a partial homonymous hemianopsia , and the mmse score was 29 due to one point lost on the memory task . this provoked an attack of 1-week duration , and he was advised to refrain from intensive physical activity.fig . 2t2-weighted mri on day 10 showing hyperintensity and swelling of grey matter in the right temporal and parietal regionsfig . 3apparent diffusion coefficient ( adc ) map on day 10 showing restricted diffusion in the right temporal and parietal regionsfig . 499 m tc - hmpao - spect on day 22 showing cerebral blood flow hypoperfusion in the right hemisphere , predominantly in the temporal and parietal regions t2-weighted mri on day 10 showing hyperintensity and swelling of grey matter in the right temporal and parietal regions apparent diffusion coefficient ( adc ) map on day 10 showing restricted diffusion in the right temporal and parietal regions 99 m tc - hmpao - spect on day 22 showing cerebral blood flow hypoperfusion in the right hemisphere , predominantly in the temporal and parietal regions grandmother . the proband s deceased grandmother on the mother s side was reported to have had attacks of hemiplegia , but never had epileptic seizures . it usually started with unilateral sensory symptoms followed by unilateral hemiparesis and then she got a contralateral headache . initially the attacks lasted up to 4 days and occurred from two to four times every month . the attack duration and frequency declined during adolescence , and she experienced her last attack at age 38 years . the attacks were often provoked by physical activity and the affected side varied between attacks . he experienced his first attack at the age of 13 year and had not more than 15 attacks since then . the attacks usually start with dizziness followed by homonymous visual disturbances , unilateral sensory symptoms , aphasia and unilateral weakness and then a contralateral headache . the aura symptoms usually last from 1 to 6 h , while the headache last up to 24 h. the aura symptoms change side from attack to attack . the nucleotide 1987 g > a substitution causes a change of the amino acid valine to methionine ( v628 m ) . both 16-year - old patients and mother had the mutation , while the elder brother was not tested .", "a 16-year - old male was referred to the neurological ward on a hot summer day due to a prolonged attack of fhm . the patient had played soccer and shortly after heading a ball he experienced a left - sided homonymous hemianopsia , followed by left - sided sensory symptoms and motor weakness , and then a contralateral migrainous headache . from the age of 2 years he experienced several attacks of sudden drowsiness , nausea and headache . most attacks were preceded by head trauma and were interpreted as commotio . at the age of 6 years he also experienced motor weakness and reduced coordination of the hand during attacks , and at the age of 9 years this was followed by dysphasia and somnolence . several ct - scans of the brain were normal . at the age of 10 years he had the diagnosis fhm after a prolonged attack with visual disturbances , scotoma , sensory symptoms , motor weakness , aphasia , somnolence and contralateral headache . he was discharged with 75 mg acetylsalicyl acid daily , and 160 mg propranolol daily . after initiation of the prophylactic treatment , the attack frequency 12 times per year was unchanged , but the duration of the aura symptoms and headache was reduced to 12 and 2436 h duration , respectively . prior to hospital admission the patient barely drank or ate anything for 5 days due to nausea and severe migrainous headache . at first , he received treatment with metoclopramide , paracetamole and ketobemidon and 1,000 ml i.v . blood test including blood count , b-12 , creatine kinase , electrolytes , liver status , tsh , antinuclear antibodies , anticardiolipin antibodies and rheumatoid factor were all normal . due to fear of vasoconstriction and migraine infarction , several measures were evaluated including continuous conservative management and verapamil treatment . after external advice continuous infusion of intravenous nimodipine 510 ml / h ( dose ) was initiated . the patient s symptoms worsened within hours , and the following morning he had a generalized tonic total infusion dose was then 16 mg . an acute mri showed mild swelling of the right parietal lobe ( figs . 2 , 3 ) . he continued to have some degree of hemiparesis along with apraxia , homonymous hemianopsia and mild cognitive failure , i.e. , 25 of 30 points on the mini mental state examination ( mmse ) , and mildly impaired memory score and moderately impaired construction score on the cognistat . at that time a single photon emission computed tomography ( spect ) showed reduced perfusion in the right hemisphere , predominantly in the temporal and parietal lobe ( fig . 4 ) . the patient was discharged after 3 weeks hospitalization and re - admitted 4 weeks later on day 55 . at that time he suffered from dizziness and memory deficits . clinical examination disclosed a partial homonymous hemianopsia , and the mmse score was 29 due to one point lost on the memory task . this provoked an attack of 1-week duration , and he was advised to refrain from intensive physical activity.fig . 2t2-weighted mri on day 10 showing hyperintensity and swelling of grey matter in the right temporal and parietal regionsfig . 3apparent diffusion coefficient ( adc ) map on day 10 showing restricted diffusion in the right temporal and parietal regionsfig . 499 m tc - hmpao - spect on day 22 showing cerebral blood flow hypoperfusion in the right hemisphere , predominantly in the temporal and parietal regions t2-weighted mri on day 10 showing hyperintensity and swelling of grey matter in the right temporal and parietal regions apparent diffusion coefficient ( adc ) map on day 10 showing restricted diffusion in the right temporal and parietal regions 99 m tc - hmpao - spect on day 22 showing cerebral blood flow hypoperfusion in the right hemisphere , predominantly in the temporal and parietal regions", "the proband s deceased grandmother on the mother s side was reported to have had attacks of hemiplegia , but never had epileptic seizures . mother . it usually started with unilateral sensory symptoms followed by unilateral hemiparesis and then she got a contralateral headache . initially the attacks lasted up to 4 days and occurred from two to four times every month . the attack duration and frequency declined during adolescence , and she experienced her last attack at age 38 years . the attacks were often provoked by physical activity and the affected side varied between attacks . he experienced his first attack at the age of 13 year and had not more than 15 attacks since then . the attacks usually start with dizziness followed by homonymous visual disturbances , unilateral sensory symptoms , aphasia and unilateral weakness and then a contralateral headache . the aura symptoms usually last from 1 to 6 h , while the headache last up to 24 h. the aura symptoms change side from attack to attack .", "the nucleotide 1987 g > a substitution causes a change of the amino acid valine to methionine ( v628 m ) . both 16-year - old patients and mother had the mutation , while the elder brother was not tested .", "the phenotype genotype correlation of the identified mutation ( v628 m ) is strengthened by the fact that it has also been reported in a turkish family . the norwegian family had attacks of pure fhm , with pronounced intra - familial variation in frequency , severity and duration of attacks . physical activity provoked attacks in the affected alive , and mild head trauma provoked attacks in the proband . mutations in the atp1a2 gene usually cause pure fhm , but alternating hemiplegia of childhood , benign familial infantile convulsions , cerebellar symptoms , severe episodic neurological deficits and mental retardation have also been reported [ 818 ] . the hypovolemia caused by dehydration and arterial hypotension probably added to sustain the prolonged fhm attack , but these factors alone has not previously been sufficient to cause a generalized tonic the seizure is most likely caused by nimodipine , as the proband and his mother both noticed worsening of the aura symptoms after initiation of the intravenous nimodipine infusion . nimodipine is a calcium - channel blocker that dilates cerebral vessels and it is used to prevent delayed cerebral ischemia following subarachnoid hemorrhage . in theory nimodipine might prevent the vasospasm of fhm by lowering ca - influx . however , the continuous intravenous infusion of nimodipine probably aggravated the arterial hypotension , a known side effect . this caused additional hypoperfusion and hypoxia in the right hemisphere , which lead to a generalized tonic clonic seizure and a secondary edema as shown on mri and spect ( for details see above ) . we conclude that nimodipine is contraindicated in the management of prolonged fhm attack , and recommend conservative management except from supplement of sufficient intravenous fluid in nauseated patients in order to avoid hypovolemia ." ]

[ "a few days later , four more cases occurred among postal workers at the brentwood mail processing facility in the washington area . the appearance of new cases in different locations around the country suggested contamination with b. anthracis of several postal facilities . in each location , the population potentially exposed was large . public health , criminal investigation , and postal authorities at local , state and federal levels investigated the suspected bioterrorism event . within hours of the discovery of clusters of cases , the centers for disease control and prevention(cdc ) deployed teams to four different locations to support state and local investigations . four letters containing anthrax spores were known to have been postmarked and processed in the hamilton mail processing center ( hmpc ) located in hamilton township , a suburb of trenton , new jersey . the hmpc is part of a complicated network of stations and buildings designed to move millions of pieces of mail per day . it is not a typical post office , but a very large facility located in a 281,387 square foot building with many operations areas containing mechanized equipment . it was typically staffed by 250 employees per shift and visited by numerous others in the course of processing 2 million items per day . on october 19 , , , , , field investigation in trenton was initiated by a cdc team composed of an epidemiologist , environmental experts , occupational physicians , epidemic intelligence service ( eis ) officers , a public health informatics fellow , and support personnel . the team was headquartered in the new jersey department of health and senior services ( njdhss ) and had access to the local area network and computing environment of the department . this article describes the experience of the informatics fellow and the new jersey geographic information system(gis ) coordinator during the first two weeks of the investigation in assessing information system needs and organizing on - site computer support for the new jersey arm of the investigation .", "early in the investigation , the number of people exposed to anthrax was estimated to be large . the response team planned to sample for anthrax contamination in the facility ; identify the exposed population ; locate , culture , and give prophylactic antibiotics to those most likely to be exposed ; and monitor the exposed and treated persons over time for potential long - term effects . information on each person and sample was to be obtained , stored , analyzed , and augmented over time . for epidemiologic investigation and management purposes , summary reports had to be generated frequently . because of the large number of agencies involved and the rapid progress of events , a system of document management for the many drafts of guidelines and other communications was also needed . immediate needs for output included lists of employees , clients , visitors , and other potentially exposed persons . the lists were used by eis officers for individual follow - up and were linked to the map of floor plans of the postal facility and environmental sampling results to help identify persons with the greatest likelihood of exposure . investigators and managers needed summary information , including the percentage of exposed patients receiving medication and the distribution of exposed persons by county . the media relations ' officer of the team produced reports as often as twice a day for the public . information needs of the emergency response team in new jersey not all potential data sources were available during the investigation . the database system in the building was unavailable , as the computers had been turned off due to concern that fans in the computers might create air currents that would jeopardize safety or alter environmental sampling results . the list of employees in the facility computers was therefore unavailable to the investigators and had to be assembled from other sources . digital autocad drawing files of the facility were also stored on a workstation within the facility , and were likewise unavailable a situation that complicated the production of accurate and representative floor - plan maps . laboratory results included cultures of both human and environmental samples performed by the new jersey state laboratory and cdc laboratories . managing reports from samples processed in different laboratories required linking of multiple unique identifiers . electronic documents that were produced or revised during the investigation included survey results , background documents , guidelines , antibiotic stockpile logistics , and press releases . frequent revisions made it necessary to identify and provide access to the latest documents and to track document revisions . the information system developed consisted of three main components : a database of possibly exposed persons , a gis of the physical plant and equipment , and a document repository . the exposed - person database required merging of files in multiple formats , manual data entry , rapid analysis , and frequent production of reports . gis work was done using floor plans produced in arcview gis 3.2a ( environmental systems research institute , inc . , redlands , ca ) by screen - digitizing scanned not - to - scale xerographic copies of autocad drawings of the postal building . documents were made available to the team by using web pages ( html ) on the new jersey department of health intranet to link to the latest copies of the files . building outlines , walls , work areas , equipment , furniture , the ventilation system and diffusers , and environmental sampling locations were digitized and stored as shapefiles , a format used by both the arcview gis and epi map software . the geographical features were then linked to environmental sampling data to specific locations in the building using epi map . a unique sample identification number was used as the key for linking the shapefile to the environmental sample database ( figure 1 ) . as the map creation process progressed over the 2-week period , additional , larger size paper drawings were provided to which a complete floor plan and heating , ventilation , and air conditioning systems components could be added . another version of the floor plan has been published and is available on the internet . ( environmental.png ) preliminary sampling at the mail facility 1 to support investigations in other facilities where the letters were manipulated , digitized floor plans of the carteret and west trenton post offices were produced from rudimentary sketches . since epi map is public domain software , it was installed on a number of computers without need for licensing making a gis tool freely available to the investigators . the document repository was created using html on an intranet site inside the firewall of the njdhss . the web page included up - to - date information such as press releases and a list of activities for the day . it was updated twice a day or more often when important information had to be communicated to the rest of the investigation team . each link was checked on a daily basis to ensure that the correct document was being accessed .", "early in the investigation , the number of people exposed to anthrax was estimated to be large . the response team planned to sample for anthrax contamination in the facility ; identify the exposed population ; locate , culture , and give prophylactic antibiotics to those most likely to be exposed ; and monitor the exposed and treated persons over time for potential long - term effects . information on each person and sample was to be obtained , stored , analyzed , and augmented over time . for epidemiologic investigation and management purposes , summary reports had to be generated frequently . because of the large number of agencies involved and the rapid progress of events , a system of document management for the many drafts of guidelines and other communications was also needed . immediate needs for output included lists of employees , clients , visitors , and other potentially exposed persons . the lists were used by eis officers for individual follow - up and were linked to the map of floor plans of the postal facility and environmental sampling results to help identify persons with the greatest likelihood of exposure . investigators and managers needed summary information , including the percentage of exposed patients receiving medication and the distribution of exposed persons by county . the media relations ' officer of the team produced reports as often as twice a day for the public . information needs of the emergency response team in new jersey not all potential data sources were available during the investigation . the database system in the building was unavailable , as the computers had been turned off due to concern that fans in the computers might create air currents that would jeopardize safety or alter environmental sampling results . the list of employees in the facility computers was therefore unavailable to the investigators and had to be assembled from other sources . digital autocad drawing files of the facility were also stored on a workstation within the facility , and were likewise unavailable a situation that complicated the production of accurate and representative floor - plan maps . laboratory results included cultures of both human and environmental samples performed by the new jersey state laboratory and cdc laboratories . managing reports from samples processed in different laboratories required linking of multiple unique identifiers . electronic documents that were produced or revised during the investigation included survey results , background documents , guidelines , antibiotic stockpile logistics , and press releases . frequent revisions made it necessary to identify and provide access to the latest documents and to track document revisions .", "the information system developed consisted of three main components : a database of possibly exposed persons , a gis of the physical plant and equipment , and a document repository . the exposed - person database required merging of files in multiple formats , manual data entry , rapid analysis , and frequent production of reports . gis work was done using floor plans produced in arcview gis 3.2a ( environmental systems research institute , inc . , redlands , ca ) by screen - digitizing scanned not - to - scale xerographic copies of autocad drawings of the postal building . documents were made available to the team by using web pages ( html ) on the new jersey department of health intranet to link to the latest copies of the files . building outlines , walls , work areas , equipment , furniture , the ventilation system and diffusers , and environmental sampling locations were digitized and stored as shapefiles , a format used by both the arcview gis and epi map software . the geographical features were then linked to environmental sampling data to specific locations in the building using epi map . a unique sample identification number was used as the key for linking the shapefile to the environmental sample database ( figure 1 ) . as the map creation process progressed over the 2-week period , additional , larger size paper drawings were provided to which a complete floor plan and heating , ventilation , and air conditioning systems components could be added . another version of the floor plan has been published and is available on the internet . ( environmental.png ) preliminary sampling at the mail facility 1 to support investigations in other facilities where the letters were manipulated , digitized floor plans of the carteret and west trenton post offices were produced from rudimentary sketches . since epi map is public domain software , it was installed on a number of computers without need for licensing making a gis tool freely available to the investigators . the document repository was created using html on an intranet site inside the firewall of the njdhss . the web page included up - to - date information such as press releases and a list of activities for the day . it was updated twice a day or more often when important information had to be communicated to the rest of the investigation team . each link was checked on a daily basis to ensure that the correct document was being accessed .", "recent publications on informatics and bioterrorism have focused on detection of bioterrorist events . some have reviewed the informatics contribution to past emergencies and formulated proposals for various kinds of surveillance and/or response [ 6 - 10 ] . the goal of this paper is to present needs , difficulties , and solutions encountered in the first 2 weeks of a single field investigation . every epidemic investigation is unique , but a comprehensive review of activities carried out during an actual investigation may focus discussion on understanding and improving the informatics response in such events . at the beginning of this investigation , although the njdhss provided a secure computer environment in which to work , many elements of the system had to be designed and set up during the investigation . much of the base information did not exist ( e.g. , gis of the hamilton facility ) or had been made unavailable by the event under investigation ( e.g. , hamilton facility autocad digital drawing files and employee lists ) . as in most field investigations , both data sources and hypotheses shifted and evolved over the course of the investigation . during an investigation , information is critical for decision - making processes and for detection of cases , identification of risk factors , and managing prevention and control measures . in the first hours or days , the emergency response team is required to design and implement an information system capable of providing reliable , timely information . experience in developing such \" emergency information systems \" and with the software being used plays an important role in determining the time needed to complete the task . in this event , close collaboration between the epidemiologist and informaticians was supported by software designed for field investigation and for exchange of data with other commercial products . the presence of trained professionals from a gis center was an important element in being able to map the site of the investigation . use of industry standard shapefiles and microsoft access databases allowed working copies to be distributed and used in public domain software as needed . a database system was operational within two days of the beginning of operations , and the gis elements evolved over a two - week period as floor plans became available . potential problems identified initially included lags in entry of clinical data , lack of access to data sources because computer systems were disrupted or inaccessible , and the variety of formats and platforms that were designed for other purposes . at least one source produced data in different formats on different days . in field investigation , the informatics environment is defined by the agencies , networks , and individual computers from which data are obtained and with which exchange of data occurs . unless the entire investigation is internal to a single agency or company , each of the partners state , county , health care facility , law enforcement agency , industry , or other entity has its own informatics environment . the standards most likely to be common to all the partners are those of the computer industry , such as the internet , microsoft windows , and popular gis standards . those conducting the investigation must be prepared to adapt to the standards used by the data source partners rather than the reverse . in this investigation , existing database systems provided useful information , but the data items were available on paper , in excel files , in text files , in access files , and in arcview shapefiles . the informatician is responsible for merging and integrating elements stored in different database formats to make the information available to the emergency response team . the need for a speedy public health response is a challenge for informaticians because the steps that are typically time consuming , such as requirements generation , analysis , design , implementation , and testing of a new system , must be completed in hours rather than in weeks or months . in this experience , some parts of the system were functional within two days after arrival at the investigation site . epi info 2000 was used to set up databases for manual data entry and updating and for importing and merging data provided by collaborating sources in a variety of microsoft windows formats . the system developed took advantage of several features available in epi info through its use of commercial component software and computer industry standards : rapid development of a relational database , in which identifying information was localized to a single table for security purposes importation of data from several of the 20 different file formats that can be read in epi info 2000 the ability to perform data management interactively but to preserve and replay the steps through automatically generated programs or scripts the ability to link and display microsoft access data with arcview shapefiles to create maps rapid development , with minimal coding , simplifying the testing and debugging process the ability to add or delete variables from a database merely by revising a form on the screen . the availability of analytic output and epidemiologic statistics in the same program used for data management interaction with high end gis programs and transition of database management to a commercial program through epi info 's incorporation of gis and windows standards public domain status of the program allowed downloading the latest version from the internet and distributing it to any number of partners without licensing difficulties geographical and spatial analysis has gained importance in public health during the last few years . the availability of maps during the investigation can be attributed to the fact that the njdhss had made resources available from its gis center . the gis professional was able to create the shapefiles while the rest of the emergency response team ( ert ) focused on data collection and data management . once created , maps were widely available for use among all members of the team , and epi map 2000 could be used to link data in microsoft access files to the shapefiles of the building floor plans . the main use of gis in this investigation was to create a relatively detailed base map and to locate environmental sampling and provide spatial analysis and visual support to the investigation . we identified and located all samples taken in the different facilities . in a matter of days we connected the database system with the map files to provide up to date information regarding sample processing and results . the maps created provided a new perspective of the magnitude of contamination inside the facility and also identified non - contaminated areas . we extended the mapping capabilities to illustrate the area of coverage of the active and passive surveillance systems implemented in surrounding communities for the detection of new cases ( figure 2 ) . the surveillance system was originally restricted to nine counties and was latter extended to others . changes in the number of centers included in the surveillance system were reflected in different versions of the same map to document changes over time . ( surveillance.png ) surveillance of new cases in new jersey because of the diversity of the data sources during the investigation , the database system required frequent maintenance . we were able to automate most of the data management routines using epi info program ( scripting ) files and to produce automatic reports . laboratory results were available through the local area network in the new jersey state health department where the team worked . although we might have been able to connect to the laboratory system to obtain real - time updates , for security reasons , the laboratory results for the investigation were exported and became available to the emergency response team at the end of each day . there was therefore a modest , but significant delay in availability of laboratory information . during emergency field situations , any system intended for use by more than one group of people should be easy to use , compatible with other software , and well documented . the database was documented using entity relationship ( er ) diagrams ( figure 3 ) . epi info has a command to display the structure of a table , making it easy to document the system for the replacement team that arrived after two weeks . this second team preferred to work with microsoft access rather than epi info , but the fact that epi info 2000 stores data in generic access 97 tables facilitated the transition . ( databasemodel.eps ) example of the entity relationship diagram for the database system implemented document tracking and version control are important when geographically separated teams are working on the same set of problems . in this case each one of the field sites had a set of experts developing documents and recommendations that applied to the whole event and not only to the geographic area of investigation . it was important to keep the most recent set of recommendations available to all members of the emergency response team for decision - making and information dissemination . during the investigation , we were able to access the most recent documents with minimal effort , using links in a web page . a more sophisticated version could be developed to allow tracking changes in a document over time .", "emergency situations require rapid design and implementation of databases to provide reliable information in the field . having the ability to respond rapidly to emergency situations requires planning and preparedness . key elements in preparation are in paying sufficient attention to informatics support and having both staff and software that can adapt quickly to new situations and computing environments . the likelihood of success is greater if the same people and software provide support for more routine epidemic investigations in this field investigation , the informatics environment included excel spreadsheets , files in several other formats , paper questionnaires and computer printouts , an existing gis capability using arcview , and the need for frequent revisions in database structure , frequent summary reports , and protection of personal identifiers . software for field use must be flexible enough to interact with and unite numerous data sources and computing environments . investigators must be prepared for new situations , and be ready to adapt new techniques and software as the needs of an investigation unfold . the traditional steps in systems development of requirements gathering , analysis , design , implementation , and testing must be traversed in rapid sequence during the first few hours or days of an investigation and repeated again as the system evolves and capabilities are added . more formalized approach to systems development needs to be either extensively modified or compressed to account for the time - critical nature of the situation . the use of commercial software standards such as windows file formats , web pages , and mainstream gis programs facilitates the rapid implementation of systems in the field . the design of systems for emergencies should include methods for storing and maintaining version control of documents and images in addition to more structured data .", "a floor plan of the contaminated hamilton facility was available only as an incomplete and poor quality 8 1/2 11 inch photocopy of the original ' e ' sized autocad drawing . it was scanned as a tiff image , imported into arcview gis 3.2 software and used as a backdrop to create shapefiles of the building outline , walls , operational areas and equipment placements , and niosh and fbi sampling locations . shapefiles were developed using a scanned copy of the floor plan of each facility and digitized using arcview . the elements of information to be displayed were divided into several layers showing samples taken by different agencies and their location . after completion , the shapefiles were linked to the data using epi map 2000 , a component of epi info that is arcviewcompatible . elements of information stored in databases created in epi info 2000 were sent directly to epi map for displaying ( figure 1 ) . the process was automated by using scripts or programs . to obtain data on persons possibly exposed , a liaison between the u.s . he was able to obtain ms - excelfiles or computer printouts listing personnel for each of the facilities under investigation . additional information was added to those lists to record presence in the facility during the exposure period , sex of the employee , and post exposure prophylaxis ( pep ) . most of the clinical follow - up services , including pep , were provided by the local hospital . the informatics department of the hospital extracted relevant clinical data from the database system and made them available to the investigation team as excel tables on some days and comma delimited text files on other days . primary data items collected by eis officers and other staff were entered into epi info 2000 or into excel and then imported into epi info 2000 ( microsoft access 97 ) format . potentially exposed populations such as regular visitors and relatives of postal workers were identified and manually entered into the main database as the investigation proceeded . demographic characteristics of potentially exposed persons were assembled from various sources , including the local hospital where pep was administered . when pep was offered to a large group of people , tracking of different treatment protocols and their results became necessary . paper forms were designed not to become obsolete if protocols are modified during the follow up , and similar revisions in the database were expected . database management was done in epi info 2000 , the windows version of epi info . epi info 2000 was developed at cdc from commercial component software and visual basic and offers compatibility with microsoft access files and 20 other standard database formats . it includes a mapping program that uses the arcview compatible shapefile format and allows the display of data from access tables on shapefiles . most of the basic statistics needed for reporting and analysis are built in so that we did not have to spend time coding or debugging algorithms . the data collection and data management tools in epi info do not require expert database managers . the database system consisted of a central database designed and maintained in epi info 2000 . the unique key at first contained information ( was \" intelligent \" ) , but we designed a mechanism to replace intelligent keys by non - intelligent keys . the intelligent key contained facility code , deployment place ( nj ) exposed unique identifier , and postal facility involved . we included the deployment site in the key assuming that the information would be linked with other sites at a latter time . from the beginning of the operation , security was a concern . because of the complexity of the investigation we decided that all sensitive information defined as information that would allow identification of specific individuals would be handled separately from the rest of the database . we created a single flat table with all identifiers and related the table to the rest of the database system . with that structure identifiers were not sent to cdc headquarters in atlanta , for example , and sensitive data were protected by the security features of the njdhss computing environment . a commercial html editor ( microsoft front page 2000 ) was used for the maintenance of the document repository web page . web pages included in the system did not contain any special scripting that required an advanced web programming techniques . the level of html coding was basic , and mostly inserted automatically by front page . the document repository allowed coding and storing versions of documents during the progress of the investigation . the document check - in process included a simple computer - based form with the name of the document , the author , and a time stamp . the first two elements were used to create a catalog , and the timestamp was used for versioning control .", "a floor plan of the contaminated hamilton facility was available only as an incomplete and poor quality 8 1/2 11 inch photocopy of the original ' e ' sized autocad drawing . it was scanned as a tiff image , imported into arcview gis 3.2 software and used as a backdrop to create shapefiles of the building outline , walls , operational areas and equipment placements , and niosh and fbi sampling locations . shapefiles were developed using a scanned copy of the floor plan of each facility and digitized using arcview . the elements of information to be displayed were divided into several layers showing samples taken by different agencies and their location . after completion , the shapefiles were linked to the data using epi map 2000 , a component of epi info that is arcviewcompatible . elements of information stored in databases created in epi info 2000 were sent directly to epi map for displaying ( figure 1 ) .", "to obtain data on persons possibly exposed , a liaison between the u.s . postal service and the epidemiologic team he was able to obtain ms - excelfiles or computer printouts listing personnel for each of the facilities under investigation . additional information was added to those lists to record presence in the facility during the exposure period , sex of the employee , and post exposure prophylaxis ( pep ) . most of the clinical follow - up services , including pep , were provided by the local hospital . the informatics department of the hospital extracted relevant clinical data from the database system and made them available to the investigation team as excel tables on some days and comma delimited text files on other days . primary data items collected by eis officers and other staff were entered into epi info 2000 or into excel and then imported into epi info 2000 ( microsoft access 97 ) format . potentially exposed populations such as regular visitors and relatives of postal workers were identified and manually entered into the main database as the investigation proceeded . demographic characteristics of potentially exposed persons were assembled from various sources , including the local hospital where pep was administered . when pep was offered to a large group of people , paper forms were designed not to become obsolete if protocols are modified during the follow up , and similar revisions in the database were expected .", "database management was done in epi info 2000 , the windows version of epi info . epi info 2000 was developed at cdc from commercial component software and visual basic and offers compatibility with microsoft access files and 20 other standard database formats . it includes a mapping program that uses the arcview compatible shapefile format and allows the display of data from access tables on shapefiles . most of the basic statistics needed for reporting and analysis are built in so that we did not have to spend time coding or debugging algorithms . the data collection and data management tools in epi info do not require expert database managers . the database system consisted of a central database designed and maintained in epi info 2000 . the unique key at first contained information ( was \" intelligent \" ) , but we designed a mechanism to replace intelligent keys by non - intelligent keys . the intelligent key contained facility code , deployment place ( nj ) exposed unique identifier , and postal facility involved . we included the deployment site in the key assuming that the information would be linked with other sites at a latter time .", "from the beginning of the operation , security was a concern . because of the complexity of the investigation we decided that all sensitive information defined as information that would allow identification of specific individuals would be handled separately from the rest of the database . we created a single flat table with all identifiers and related the table to the rest of the database system . with that structure identifiers were not sent to cdc headquarters in atlanta , for example , and sensitive data were protected by the security features of the njdhss computing environment .", "a commercial html editor ( microsoft front page 2000 ) was used for the maintenance of the document repository web page . web pages included in the system did not contain any special scripting that required an advanced web programming techniques . the level of html coding was basic , and mostly inserted automatically by front page . the document repository allowed coding and storing versions of documents during the progress of the investigation . members of the team were instructed to check in documents on a regular basis . the document check - in process included a simple computer - based form with the name of the document , the author , and a time stamp . the first two elements were used to create a catalog , and the timestamp was used for versioning control .", "jz performed the analysis of informatics needs , set up the epi info portions of the field system and the document management system , and drafted the manuscript . rs developed the arcview gis system and shapefiles used in the investigation , and contributed to the manuscript . ad provided advice on the analysis of informatics needs and the development of the epi info applications through daily telephone conversations and wrote portions of the manuscript .", "esri ( environmental systems research institute ) provided a special license for the free distribution of mapobjects software within epiinfo / epimap 2000 ." ]

[ "duodenal ulcer perforation is still a common complication of chronic peptic ulcer disease . despite the wide spread use of anti - secretory and h. pylori eradication therapy most of the literature pertaining to the situation in the developed world , showed that the disease is largely confined to the elderly patients taking ulcerogenic medications.[15 ] the situation in the developed nations is summed up by johnson : the surgeon s major role in the management of peptic ulcer disease will be the performance of life - saving emergency operations in the elderly unfit patient . in contrast to the developing world , the patients are younger and have a long life - time of potentially useful activity ahead of them[18 ] as anti - secretory and anti - h . pylori eradication drugs are been freely used , we had expected an improvement in this disease condition . hence , we set out in this review to look at the prevalence , pattern of presentation , risk factors and management outcome in the study environment and we also set out to look at the management pattern if sufficient for a semi - urban area in a developing world .", "this review was conducted at the federal medical centre ido - ekiti , southwest nigeria . the case records of all patients with clinically established diagnosis of pdus , managed in this center from january 2004 to december 2011 were reviewed . the diagnostic protocol for every patient at presentation included : the clinical findings , abdominal ultrasound , and chest x - rays which in some cases gave further credence to the diagnosis . full blood count , urea and electrolytes , creatinine , and urinalysis results were documented . the patients were optimized for surgery with intravenous fluids , antibiotics , and urethral catheterization . clinical and intra - operative findings , treatment outcome and follow - ups were all evaluated .", "none of the patients had a prior diagnosis of their ulcer by an upper gastro - intestinal endoscopy ( ugie ) before presentation . although , 20 ( 66.6% ) of them had peptic ulcer symptoms with , inadequate or no medical treatment . the remainder , 10 ( 33.3% ) presented for the first time with perforation , with no prior treatment for peptic ulcer disease . the notable risk factor was the free abuse of herbal concoction ( admixture of local gin , spices , roots and bitters ) for body pains . fifteen patients took alcohol and only two took non - steroidal anti - inflammatory drugs [ table 1 ] . a good proportion of the patients 76.6% were referred to us from private health institutions , while the rest came to our center from their homes . after adequate resuscitation , all the 30 patients had emergency surgery of simple closure of their perforations , re - enforced with an omental patch and thorough peritoneal larvage . most of the 26 managed patients had a favorable outcome ; were discharged home and followed - up at the clinic for 4 - 6 weeks but later lost to follow - up .", "pdu is still a major complication of chronic peptic ulcer disease seen quite often in the study center , as well as other centers of the world as a frequent cause of acute abdomen . although experience from some parts of nigeria showed that gastric outlet obstruction has overtaken pdu in incidence , it is still frequently seen in many centers in nigeria , as well as many centers in the developed world.[17 ] this study has also highlighted that the perforation affected mostly the younger age group ( in their 3 -6 decade ) [ table 2 ] , which is in keeping with studies in many centers in the developing world.[111 ] much has been written about non - operative management of pdu in the western world . since the early works of croft et al . , there has been considerable interests in the non - operative management of pdus . in a randomized trial comparing surgical and non - surgical therapy , for pdu , they showed a mortality rate of 5% in each group and no difference in morbidity . , have also shown that non - operative therapy could be effective in selected patients . they showed that as much as 81% of their patients were treated conservatively , but 43% later had surgery . some writers have claimed that virtually all patients with pdu , could be managed conservatively . however , conservative management has not been accepted by many workers ; whereas , most surgeons have difficulty in understanding how a patient who has wide spread peritonitis with food debris widely distributed throughout the abdominal cavity can improve without operation . undoubtedly , there are patients with small leaks , from a perforation and with relatively mild peritoneal contamination who may be managed conservatively ; these are in a minority . we did not consider this treatment option because of the delay in presentation , 2 - 7 days as well as the socio - economic implications of long hospitalization . all patients were operated as soon as they were resuscitated and optimized for surgery . in the pre h. pylori era , in the developed world , it has been shown that only 30% of patients with pdu treated with simple closure and thorough peritoneal larvage had good long - term result . in the present era , ( h. pylori era ) , studies have shown , that operation may achieve long - term satisfactory results , only when h. pylori infections , present in 50 - 70% of patients with pdu is totally eliminated . however , all have agreed that it is sometimes difficult to determine the h. pylori status of patients having emergent operation for perforated d.u . in this study , none of the patients had an ugie done before presentation and surgery ; and in all of them , their h. pylori status was not known : although , 20 ( 66.6% ) of them were erratically treated at one time or the other for peptic ulcer disease symptoms . all patients had simple closure of their perforation with omental patch reinforcement , thorough peritoneal larvage and h. pylori eradication therapy was instituted . this is only palliative and is sufficient for the elderly patients in the developed world . patients who have suffered one perforation may suffer another one if anti - secretory drugs are not maintained ; as it were , for life . this life - long treatment is obviously not within the reach of an average patient in the developing world . in this study , most workers , from the developing world have also shown that pdu , affects mostly the younger age group.[18 ] all have attested to the fact that this group are not likely to be anti eradication drug compliant for life . the costs of these drugs , re - infection by h. pylori organisms even after the eradication and dyspeptic symptoms after surgery,[18 ] shows that this palliative surgery ( omental patch ) is obviously not appropriate for a resource poor center , vis - a - vis for the developing world ; that a shift towards the free use of definitive ulcer surgery should be the goal . dempsey summed it all , using the possible h. pylori infection eradication as an excuse not to do a definitive ulcer operation in any patient with perforated d - u is irrational . therefore the various surgical options that have been proposed by workers in the field include : \n omental patch closure + highly selective vagotomyomental patch closure + bilateral truncal vagotomy ( btv)resectional surgery + truncal vagotomypyloroplasty + btv . \n dakubo et al . , writing from a west african sub - region had shown statistically that age greater than 60 years , alcohol intake and resectional surgery are key factors in predicting post - operative morbidity and mortality . it stands therefore to reason that since the majority of the patients in the study center vis - a - vis developing world are below 60 years , they stand to benefit from a curative definitive ulcer surgery . pyloroplasty ( inco - operating the perforation ) and btv is quite safe and highly recommended because of its short operative time , simplicity and easily reproducible by all , even trainee surgeons . omental patch closure + highly selective vagotomy omental patch closure + bilateral truncal vagotomy ( btv ) resectional surgery + truncal vagotomy pyloroplasty + btv .", "pdu disease is still a frequent cause of acute abdomen in many centers of the developing world where it affects mostly the youths . the relative high costs of triple regime therapy for h. pylori eradication , fear of re - perforation and easy loss to follow - up , call for an urgent re - appraisal of the present method of surgical treatment . therefore , a more liberal role for wide spread definitive ulcer surgery is suggested for most of our young patients ." ]

[ "hemophilia b is a chronic hereditary disease characterized by a deficiency in factor ix ( fix ) activity . it is less common than hemophilia a which is due to factor viii ( fviii ) deficiency . according to the world federation of hemophilia global survey of 2014 , 178,500 persons were identified with hemophilia across 106 countries , of whom only 16.1% had hemophilia b.1 hemophilia b is an x - linked disease . missense , frameshift , and nonsense mutations are the most frequently seen , and deletions are rarely described.2 the severity of the disease is related to clotting factor levels . the disease is classified as severe , moderate , or mild when the clotting factor levels are < 1 , 15 , or > 5 , respectively.3 people with mild - to - moderate hemophilia rarely bleed unless after trauma or invasive procedures . frequency and severity of bleeding is greatest in severe hemophilia b. data from the us show that only 36% of patients with hemophilia b have the severe form of the disease.4 recurrent and spontaneous bleeding into joints and/or soft tissues since early infancy are hallmarks of severity . gastrointestinal and intracranial bleeding can be life threatening.3 repeated bleeding into joints without adequate treatment can result in crippling chronic joint disease , pain , and reduced quality of life.3,58 the introduction and availability of factor concentrate has dramatically improved the treatment of hemophilia with a significant decrease in morbidity and mortality , and an increase in quality of life.9 early on - demand treatment of acute bleeding episodes decreases the number of joint deformities compared to untreated or minimally treated patient.10,11 nevertheless , long - term musculoskeletal follow - up of on - demand treatment in hemophilia showed a progressive deterioration of the joint functions in these patients . as on - demand treatment appears to be clearly suboptimal , prophylaxis meaning preventive use of clotting factor given at regular intervals was proposed and adopted since several decades in sweden.12 in 1994 , the medical and scientific advisory council ( masac ) of the us national hemophilia foundation issued guidelines stating that prophylaxis with twice- or thrice - weekly fix infusion , at a dose of 2540 iu / kg , should be considered the optimal treatment for hemophilia b.13 the european pediatric network for haemophilia management define primary prophylaxis as regular treatment started after first episode of bleeding and secondary prophylaxis as regular or intermittent regular treatment started after several episodes of bleeding.14,15 the world federation of hemophila ( wfh ) guidelines recommend prophylaxis to prevent bleed and joint destruction and preserve normal musculoskeletal function . moreover , it is advisable to give it to all patients before performing any activities associated with an increased risk of trauma . prophylaxis should be the state - of - art treatment.3 despite the guidelines , prophylaxis has not been universally adopted . medical , psychosocial , and cost controversies limit the implementation of prophylaxis.16 in the canadian 2006 survey , only 32% of patients with severe hemophilia b received prophylaxis , while 69% of patients with hemophilia a received the treatment . this difference was particularly notable in the 02 years age - group ( 17% in hemophilia b versus 53% in hemophilia a ) and also present in patients > 18 years of age ( 20% versus 55% ) . this difference could be explained by a less severe phenotype , less frequent joint bleeds , later presentation in life , paucity of clinical trials studying the use of prophylaxis , or simply a current treatment tradition.17 moderate hemophilia b is diagnosed much more frequently than the severe ( 37% versus 27% ) form . positivity to cross - reacting material , which corresponds to measurable level of fix antigen in plasma , is frequently observed in hemophilia b. this could be explained by the frequency of non - null mutation . most mutations in hemophilia b are missense mutations and these result in mild - to - moderate form of the disease and account for variable factor levels in plasma.18 studies reporting prophylactic use of fix in hemophilia b patients are limited in number , and concern mainly small populations within larger clinical trials.1922 benefits of prophylaxis remain questionable even if intuitively the tendency is in favor.23,24 there is currently no evidence to suggest or refute prophylaxis.25 following a 6-month regimen of prophylaxis with recombinant fix ( rix ) , patients achieved significantly meaningful improvements in physical health - related quality of life ( hrqol ) . those who switched from intermittent prophylaxis to on - demand prophylaxis experienced improvements in physical and mental hrqol.26 there is no general agreement on the optimal prophylaxis regimen , and some schemes differ from those proposed by the consensus perspectives on prophylactic therapy for hemophilia , held in london , september 2021 , 2002.14 given the paucity of controlled clinical trials regarding prophylaxis in subjects with hemophilia b , choice of treatment approach is limited to clinical judgment , clinical experience , and interpretation of currently available data based on pharmacokinetics ( pk ) , bleeding phenotype , and type of fix used . in recent years , greater attention has been paid to the pk of coagulation factor , dosing intervals , and trough levels . pk parameters had an increasing role in management choice even if there was no clear evidence on clinical efficacy . they are routinely measured in clinical practice to guide treatment dosing , particularly for primary prophylaxis , and in connection with surgery.27 in 2011 , the european medicines agency considered appropriate incremental recovery , half - life , area under the curve ( auc ) , and clearance to be the most important surrogate end points for efficacy of fix products.28 pk parameters of fix are not well characterized or widely investigated . the pk of fix are more complicated than those of fviii , and also differ between plasma - derived and recombinant forms resulting in variation between studies . fix has a longer half - life in the circulation than fviii.29 according to sampling time , the half - life of fix could be different . after administration of 75 iu / kg of nonacog alfa to patients aged 1261 years , the half - life was reported as 2224 hours when sampled at 72 hours,30 and after administration of 50 iu / g , the half - life was reported as 34 hours when sampled at 96 hours.31 a sampling schedule at 48 hours gives shorter half - life . in powell s study , the residual fix observed 1 week after administration of fix is supportive of longer half - life.31 strategy to achieve prophylaxis is to maintain the plasma level of factor activity at or above 1 u / dl.3 in current bio - assays , accuracy can be expected to be rather poor at the conventional target of 1 u / dl , which is the lower limit of the assays.32 this issue with assaying was clearly demonstrated by the discrepancies in factor levels in patients with mild - to - moderate and severe hemophilia in the uk national external quality assessment service data.33 furthermore , measuring plasma fix activity may not fully reflect the hemostatic efficacy of infused fix . fix is a small protein ( 55 kda ) with access to both intravascular and extravascular compartments.34 a number of clinical observations in hemophilia b patients suggest the presence of extravascular pool of fix . continuous infusion of fix results in reduced dose requirement of fix to maintain a level of 100%.35 furthermore , there are experimental data demonstrating that fix binds to collagen iv . this may be a source of hemostatically active fix which is not measurable by plasma assays.34,36 experiments on baboons showed that perfusion of excess bovine fix increased the circulating fix proportionally . reanalysis of these data suggests that the extravascular component contains at least threefold more fix than that present in the circulation.34 two experiments on mouse demonstrated the affinity of fix to collagen iv and its impact on hemostasis . in a knock - in mouse model expressing a fix variant with reduced affinity to collagen iv , hemostasis was delayed despite high levels of fix . bolus infusion of fix variant with enhanced collagen affinity demonstrates a prolonged hemostatic effect in hemophilia b mouse . this hemostatic effect persists days after plasma levels reach less than 1%.37 fix ( and fixa ) binds rapidly and reversibly to vascular endothelium and subendothelial extracellular matrix . this is mediated by the interaction of specific residues in the fix gla domain with collagen iv , located predominantly in the basement membrane.38,39 the clinical significance of maintaining a 1% trough level is mainly applicable in fviii deficiency . such evidence does not exist in fix deficiency and is widely debated.40 in a cohort of 64 patients ( 51 hemophilia a and 13 hemophilia b ) described by ahnstrom et al , some patients did not bleed with a trough level less than 1% , while others bled with a trough level higher than 3% . they found that there is no relationship between factor level and incidence of bleed and that the correlation was very weak . authors suggest that dosing in prophylactic treatment should be individualized.41 due to interindividual variations in pk parameters , targeting a particular trough level may not be appropriate for every individual.41 relationship between fix trough levels and therapeutic outcomes has not been confirmed in clinical trials.40 baseline factor levels are not the only determinants of bleeding phenotype in hemophilia . with the same factor level , the severity and frequency of bleeding may be different for people with hemophilia.42 in hemophilia b , where limited data exist , there is a need to strike a balance between clinical and pk end points in the evaluation of clinical efficacy.43 in hemophilia , bleeding frequency is considered a key indicator of the efficacy of the treatment regimen . the hemophilia severity score ( hss ) has been developed as a method to predict bleeding score in hemophilia.44 it includes in its assessment the annual joint bleeding rate , annual factor consumption , and wfh orthopedic score . this score was used by vyas et al to evaluate 178 hemophilia patients without inhibitors in a single us center ( hemophilia a [ n=139 ] , hemophilia b [ n=39 ] ) . they found heterogeneity of hemophilia phenotype and widespread variability in the hss values of patients with the same baseline factor activity.45 data from a single - center cohort study of 171 patients with severe hemophilia a and b in the netherlands demonstrated the importance of clinical issues in determining the phenotype . they found that age at first joint bleed was an indicator of bleeding pattern.46 there was higher annual clotting factor consumption in subjects who experienced a joint bleed at an early age comparing to those who experienced later in life.47 according to the united kingdom haemophilia centres doctors organisation ( ukhcdo ) annual report , a large variation in rates of clotting factor concentrate consumption in patients with same diagnosis was also widely observed.48 clinical assessment of the frequency and severity of bleeds remain an important measure of the efficacy of treatment for hemophilia b. the role of pk - guided therapy and its relationship to clinical efficacy remain open issues to be established . historically , effective treatment of hemophilia b started with fresh frozen plasma and prothrombin complex concentrate . in the early 1990s , highly purified plasma - derived factor concentrate was introduced.49,50 since then , large numbers have become commercially available.51 improvement in sourcing and purification procedure of blood components and the introduction of different steps of viral inactivation increased the safety of plasma - derived concentrates.52 despite these improvements , concerns remain and transfusion - transmitted emerging pathogens like prion and unencapsulated virus should not be overlooked.5356 in 1997 , the first purified rfix product , nonacog alfa , received us food and drug administration ( fda ) approval followed in 2014 by another rfix product , bax326 . these rfix products have a lower risk of pathogenic contamination and have low activated fix activity , which confers low thrombogenic potential in humans.2 traditionally , in vivo recovery ( ivr ) is the parameter used to characterize the pk properties of coagulation factors.57 following bolus injection , recombinant protein has lower ivr compared to plasma - derived fix . terminal half - life is similar for the two products ( 1719 hours).40,58,59 pk studies that enrolled 308 subjects with hemophilia b in three comparative studies showed that the ivr of rfix is approximately one - third to one - half that of plasma - derived fix.58,60,61 this disparity in ivr was also noted by kisker et al in a double - blind crossover study of plasma - derived fix and rfix in 15 subjects older than 5 years with severe hemophilia b.62 this disparity could be related to baseline fix levels , body weight , and age.58,63 while some individuals have identical recoveries with both types of concentrates , others have pronounced differences.64 a recent survey in italy indicated that plasma - derived fix and rfix are used in similar doses with similar outcomes.65 despite disparity in recovery , recombinant coagulant factors are nowadays the preferred treatment option for hemophiliacs and , in particular , for pediatric patients mainly in light of the wide margin of safety and efficacy . wfh who and nnh propose the twice- or thrice - weekly prophylaxis dose of 50 iu / kg . this regimen was extrapolated from the fviii prophylaxis experience , early pk data , and the few studies done on fix . in the original phase 3 nonacog alfa study in previously treated subjects aged 12 years , the mean dose was 40.3 iu / kg administered 23 times weekly.22 in the phase 3 trial of reformulated nonacog alfa in previously treated subjects , the median dose was 51.7 iu / kg administered 23 times weekly.30 frequency and dose of prophylaxis were determined by the investigator in these two studies . both the studies demonstrated safety and efficacy in persons with hemophilia b. however , rigorous regimens of prophylaxis are difficult and adherence remains a problem.66 only 45% of individuals with severe hemophilia b are currently receiving prophylaxis in the us.67 cost of clotting factor is certainly a main obstacle for the implementation of such management . it is the largest predictor of overall cost in the care of people with hemophilia.68,69 however , the leading reasons for lack of adherence to the prescribed regimen are time consumption , convenient access to peripheral vein , forgetfulness , and the feeling of being healthy with the disappearance of symptoms with time.70,71 many patients find it very difficult to spend 1520 minutes every morning to mix and infuse intravenous factor . this is certainly more difficult in children where venous access could be difficult and where central venous access devices are associated with the concomitant risk of infection and thrombosis . in an european survey carried out by de moerloose between october 2005 and september 2006 , an interview was conducted with 30 patients in each of six european countries ( france , germany , italy , spain , sweden , and the uk ) , resulting in a total of 180 patients . the feeling of reduction , fluctuation , or disappearance of symptoms was cited in 38% of cases , forgetfulness in 36% , lack of time for the treatment in 30% , and convenience in 30% . forgetfulness was the reason most often cited by patients on prophylaxis ( 46%).72 therefore , new approaches of management must be proposed to achieve adherence and make patients lives easier . despite recent promising success in gene therapy for hemophilia b , a cure for hemophilia is not yet available.73,74 novel clotting formulations with longer half - life represent a major advance but at a high financial cost . it has the potential of increasing convenience to patient , owing to fewer infusions , less preparation and infusion time , and preservation of venous access in those for whom venous access is a challenge.75 there is some evidence to support such a regimen . according to powel s study , residual fix was observed 1 week after administration of fix.31 maintaining a 1% trough level is widely debated in fix deficiency.40 experimental data demonstrate that fix has access to both intravascular and extravascular compartments with potential availability of clinically significant extravascular stores of fix.34 patients with hemophilia b seem to have less severe phenotype and less frequent joint bleed than those with hemophilia a. vyas et al found heterogeneity of hemophilia phenotype and widespread variability in the hss values of 178 patients with the same baseline factor activity.45 in 1976 , morfini et al published the first randomized trial comparing once - weekly and twice - weekly prophylaxis with on - demand treatment in ten subjects with hemophilia b over 1 year.20 a total of 7.5 iu / kg was administered to the twice - weekly group and 15 iu / kg to the once - weekly group . the two prophylactic groups had a significant reduction in bleeding episodes when compared to the observed 1-year period preceding the trial ( p<0.005 ) . patients having measurable fix in plasma for a higher number of days bleed less.20 in 2014 , valentino et al published a phase 4 multicenter , randomized , open - label , four - period crossover study that evaluated the efficacy and safety of nonacog alfa as a prophylaxis regimen ( 50 iu / kg twice - weekly or 100 iu / kg once - weekly ) compared with on - demand administration.75 inclusion criteria were being male , aged 665 years , with severe - to - moderately severe hemophilia ( fix 2 ) , and 12 or more bleeding episodes , including six or more hemarthroses episodes . the primary end point was the annual bleeding rate ( abr ) of two prophylactic regimens compared to on - demand treatment . the abr was 35.1 , 2.6 , and 4.6 for the on - demand treatment , 50 iu / kg twice a week , and 100 iu / kg once a week , respectively . a significant difference was observed between the two prophylaxis groups and the on - demand group ( p<0.0001 ) with a reduction of bleed of 89.4% in favor of the prophylaxis group . no patient discontinued the prophylactic treatment because of inefficacy or less - than - expected effect . there was no serious adverse event , or report of thrombogenicity , or occurrence of inhibitors.75 the use of high dose of fix ( 100 iu / kg per dose ) was of concern as it resulted in thrombogenicity . in a review conducted by rendo et al of five clinical trials in patients with hemophilia b , patients who received 100 iu / kg per dose of nonacog alfa reported no thrombotic events based on clinical findings and laboratory markers such as thrombin antithrombin ( tat ) and d - dimers.77 this finding was also confirmed in a study conducted by kavakli et al . this study evaluated the efficacy and safety of once - weekly prophylaxis with 100 iu / kg nonacog alfa compared with on - demand treatment in 25 adolescent and adult patients for a period of 52 weeks.76 at visits 2 and 4 of the study , assessment of thrombosis was done with monitoring of d - dimers and tat iii complex . none of the patients developed clinical thrombotic event and there was no inhibitor occurrence . otherwise , mean abr was significantly lower in the prophylactic group comparing to the on - demand treatment group . there was 3.6 bleeding events for the prophylactic group and 32.9 events for the on - demand group ( p<0.0001 ) . most interestingly , eight of 17 patients had a fix superior to 2 u / dl 1 week after dosing . no severe adverse event was observed and once - weekly prophylaxis was well tolerated.77 the studies of valentino75 and kavakli76 showed efficacy of once - weekly prophylaxis with no unexpected safety issues , no thrombotic event , no occurrence of inhibitors , and significant reduction in bleeding episodes . the population size of the studies was small , although this is quite frequent in hemophilia b studies . forty - one patients were evaluated in the twice - weekly prophylaxis group of the valantino study and 25 patients in the kavakli study . besides , the study conducted by valantino was of short duration . this is relatively a too short period to confirm safety and efficacy of a product . the kavakli study was conducted over a 52-week period and supports safety and efficacy of this regimen in a better way . otherwise , the two studies were conducted in previously treated patients and 92% of the patients included in the kavakli study had tertiary prophylaxis . the benefit of such regimen in untreated patient or in primary prophylaxis or secondary prophylaxis remains to be demonstrated . effect of switching from twice - weekly to once - weekly prophylaxis is not yet known .", "in 1994 , the medical and scientific advisory council ( masac ) of the us national hemophilia foundation issued guidelines stating that prophylaxis with twice- or thrice - weekly fix infusion , at a dose of 2540 iu / kg , should be considered the optimal treatment for hemophilia b.13 the european pediatric network for haemophilia management define primary prophylaxis as regular treatment started after first episode of bleeding and secondary prophylaxis as regular or intermittent regular treatment started after several episodes of bleeding.14,15 the world federation of hemophila ( wfh ) guidelines recommend prophylaxis to prevent bleed and joint destruction and preserve normal musculoskeletal function . moreover , it is advisable to give it to all patients before performing any activities associated with an increased risk of trauma . prophylaxis should be the state - of - art treatment.3 despite the guidelines , prophylaxis has not been universally adopted . medical , psychosocial , and cost controversies limit the implementation of prophylaxis.16 in the canadian 2006 survey , only 32% of patients with severe hemophilia b received prophylaxis , while 69% of patients with hemophilia a received the treatment . this difference was particularly notable in the 02 years age - group ( 17% in hemophilia b versus 53% in hemophilia a ) and also present in patients > 18 years of age ( 20% versus 55% ) . this difference could be explained by a less severe phenotype , less frequent joint bleeds , later presentation in life , paucity of clinical trials studying the use of prophylaxis , or simply a current treatment tradition.17 moderate hemophilia b is diagnosed much more frequently than the severe ( 37% versus 27% ) form . positivity to cross - reacting material , which corresponds to measurable level of fix antigen in plasma , is frequently observed in hemophilia b. this could be explained by the frequency of non - null mutation . most mutations in hemophilia b are missense mutations and these result in mild - to - moderate form of the disease and account for variable factor levels in plasma.18 studies reporting prophylactic use of fix in hemophilia b patients are limited in number , and concern mainly small populations within larger clinical trials.1922 benefits of prophylaxis remain questionable even if intuitively the tendency is in favor.23,24 there is currently no evidence to suggest or refute prophylaxis.25 following a 6-month regimen of prophylaxis with recombinant fix ( rix ) , patients achieved significantly meaningful improvements in physical health - related quality of life ( hrqol ) . those who switched from intermittent prophylaxis to on - demand prophylaxis experienced improvements in physical and mental hrqol.26", "there is no general agreement on the optimal prophylaxis regimen , and some schemes differ from those proposed by the consensus perspectives on prophylactic therapy for hemophilia , held in london , september 2021 , 2002.14 given the paucity of controlled clinical trials regarding prophylaxis in subjects with hemophilia b , choice of treatment approach is limited to clinical judgment , clinical experience , and interpretation of currently available data based on pharmacokinetics ( pk ) , bleeding phenotype , and type of fix used .", "in recent years , greater attention has been paid to the pk of coagulation factor , dosing intervals , and trough levels . pk parameters had an increasing role in management choice even if there was no clear evidence on clinical efficacy . they are routinely measured in clinical practice to guide treatment dosing , particularly for primary prophylaxis , and in connection with surgery.27 in 2011 , the european medicines agency considered appropriate incremental recovery , half - life , area under the curve ( auc ) , and clearance to be the most important surrogate end points for efficacy of fix products.28 pk parameters of fix are not well characterized or widely investigated . the pk of fix are more complicated than those of fviii , and also differ between plasma - derived and recombinant forms resulting in variation between studies . fix has a longer half - life in the circulation than fviii.29 according to sampling time , the half - life of fix could be different . after administration of 75 iu / kg of nonacog alfa to patients aged 1261 years , the half - life was reported as 2224 hours when sampled at 72 hours,30 and after administration of 50 iu / g , the half - life was reported as 34 hours when sampled at 96 hours.31 a sampling schedule at 48 hours gives shorter half - life . in powell s study , the residual fix observed 1 week after administration of fix is supportive of longer half - life.31 strategy to achieve prophylaxis is to maintain the plasma level of factor activity at or above 1 u / dl.3 in current bio - assays , accuracy can be expected to be rather poor at the conventional target of 1 u / dl , which is the lower limit of the assays.32 this issue with assaying was clearly demonstrated by the discrepancies in factor levels in patients with mild - to - moderate and severe hemophilia in the uk national external quality assessment service data.33 furthermore , measuring plasma fix activity may not fully reflect the hemostatic efficacy of infused fix . fix is a small protein ( 55 kda ) with access to both intravascular and extravascular compartments.34 a number of clinical observations in hemophilia b patients suggest the presence of extravascular pool of fix . continuous infusion of fix results in reduced dose requirement of fix to maintain a level of 100%.35 furthermore , there are experimental data demonstrating that fix binds to collagen iv . this may be a source of hemostatically active fix which is not measurable by plasma assays.34,36 experiments on baboons showed that perfusion of excess bovine fix increased the circulating fix proportionally . reanalysis of these data suggests that the extravascular component contains at least threefold more fix than that present in the circulation.34 two experiments on mouse demonstrated the affinity of fix to collagen iv and its impact on hemostasis . in a knock - in mouse model expressing a fix variant with reduced affinity to collagen iv , hemostasis was delayed despite high levels of fix . bolus infusion of fix variant with enhanced collagen affinity demonstrates a prolonged hemostatic effect in hemophilia b mouse . this hemostatic effect persists days after plasma levels reach less than 1%.37 fix ( and fixa ) binds rapidly and reversibly to vascular endothelium and subendothelial extracellular matrix . this is mediated by the interaction of specific residues in the fix gla domain with collagen iv , located predominantly in the basement membrane.38,39 the clinical significance of maintaining a 1% trough level is mainly applicable in fviii deficiency . such evidence does not exist in fix deficiency and is widely debated.40 in a cohort of 64 patients ( 51 hemophilia a and 13 hemophilia b ) described by ahnstrom et al , some patients did not bleed with a trough level less than 1% , while others bled with a trough level higher than 3% . they found that there is no relationship between factor level and incidence of bleed and that the correlation was very weak . authors suggest that dosing in prophylactic treatment should be individualized.41 due to interindividual variations in pk parameters , targeting a particular trough level may not be appropriate for every individual.41 relationship between fix trough levels and therapeutic outcomes has not been confirmed in clinical trials.40", "baseline factor levels are not the only determinants of bleeding phenotype in hemophilia . with the same factor level , the severity and frequency of bleeding may be different for people with hemophilia.42 in hemophilia b , where limited data exist , there is a need to strike a balance between clinical and pk end points in the evaluation of clinical efficacy.43 in hemophilia , bleeding frequency is considered a key indicator of the efficacy of the treatment regimen . the hemophilia severity score ( hss ) has been developed as a method to predict bleeding score in hemophilia.44 it includes in its assessment the annual joint bleeding rate , annual factor consumption , and wfh orthopedic score . this score was used by vyas et al to evaluate 178 hemophilia patients without inhibitors in a single us center ( hemophilia a [ n=139 ] , hemophilia b [ n=39 ] ) . they found heterogeneity of hemophilia phenotype and widespread variability in the hss values of patients with the same baseline factor activity.45 data from a single - center cohort study of 171 patients with severe hemophilia a and b in the netherlands demonstrated the importance of clinical issues in determining the phenotype . they found that age at first joint bleed was an indicator of bleeding pattern.46 there was higher annual clotting factor consumption in subjects who experienced a joint bleed at an early age comparing to those who experienced later in life.47 according to the united kingdom haemophilia centres doctors organisation ( ukhcdo ) annual report , a large variation in rates of clotting factor concentrate consumption in patients with same diagnosis was also widely observed.48 clinical assessment of the frequency and severity of bleeds remain an important measure of the efficacy of treatment for hemophilia b. the role of pk - guided therapy and its relationship to clinical efficacy remain open issues to be established .", "historically , effective treatment of hemophilia b started with fresh frozen plasma and prothrombin complex concentrate . in the early 1990s , highly purified plasma - derived factor concentrate was introduced.49,50 since then , large numbers have become commercially available.51 improvement in sourcing and purification procedure of blood components and the introduction of different steps of viral inactivation increased the safety of plasma - derived concentrates.52 despite these improvements , concerns remain and transfusion - transmitted emerging pathogens like prion and unencapsulated virus should not be overlooked.5356 in 1997 , the first purified rfix product , nonacog alfa , received us food and drug administration ( fda ) approval followed in 2014 by another rfix product , bax326 . these rfix products have a lower risk of pathogenic contamination and have low activated fix activity , which confers low thrombogenic potential in humans.2 traditionally , in vivo recovery ( ivr ) is the parameter used to characterize the pk properties of coagulation factors.57 following bolus injection , recombinant protein has lower ivr compared to plasma - derived fix . terminal half - life is similar for the two products ( 1719 hours).40,58,59 pk studies that enrolled 308 subjects with hemophilia b in three comparative studies showed that the ivr of rfix is approximately one - third to one - half that of plasma - derived fix.58,60,61 this disparity in ivr was also noted by kisker et al in a double - blind crossover study of plasma - derived fix and rfix in 15 subjects older than 5 years with severe hemophilia b.62 this disparity could be related to baseline fix levels , body weight , and age.58,63 while some individuals have identical recoveries with both types of concentrates , others have pronounced differences.64 a recent survey in italy indicated that plasma - derived fix and rfix are used in similar doses with similar outcomes.65 despite disparity in recovery , recombinant coagulant factors are nowadays the preferred treatment option for hemophiliacs and , in particular , for pediatric patients mainly in light of the wide margin of safety and efficacy .", "wfh who and nnh propose the twice- or thrice - weekly prophylaxis dose of 50 iu / kg . this regimen was extrapolated from the fviii prophylaxis experience , early pk data , and the few studies done on fix . in the original phase 3 nonacog alfa study in previously treated subjects aged 12 years , the mean dose was 40.3 iu / kg administered 23 times weekly.22 in the phase 3 trial of reformulated nonacog alfa in previously treated subjects , the median dose was 51.7 iu / kg administered 23 times weekly.30 frequency and dose of prophylaxis were determined by the investigator in these two studies . both the studies demonstrated safety and efficacy in persons with hemophilia b. however , rigorous regimens of prophylaxis are difficult and adherence remains a problem.66 only 45% of individuals with severe hemophilia b are currently receiving prophylaxis in the us.67 cost of clotting factor is certainly a main obstacle for the implementation of such management . it is the largest predictor of overall cost in the care of people with hemophilia.68,69 however , the leading reasons for lack of adherence to the prescribed regimen are time consumption , convenient access to peripheral vein , forgetfulness , and the feeling of being healthy with the disappearance of symptoms with time.70,71 many patients find it very difficult to spend 1520 minutes every morning to mix and infuse intravenous factor . this is certainly more difficult in children where venous access could be difficult and where central venous access devices are associated with the concomitant risk of infection and thrombosis . in an european survey carried out by de moerloose between october 2005 and september 2006 , an interview was conducted with 30 patients in each of six european countries ( france , germany , italy , spain , sweden , and the uk ) , resulting in a total of 180 patients . the feeling of reduction , fluctuation , or disappearance of symptoms was cited in 38% of cases , forgetfulness in 36% , lack of time for the treatment in 30% , and convenience in 30% . forgetfulness was the reason most often cited by patients on prophylaxis ( 46%).72 therefore , new approaches of management must be proposed to achieve adherence and make patients lives easier . despite recent promising success in gene therapy for hemophilia b , a cure for hemophilia is not yet available.73,74 novel clotting formulations with longer half - life represent a major advance but at a high financial cost . it has the potential of increasing convenience to patient , owing to fewer infusions , less preparation and infusion time , and preservation of venous access in those for whom venous access is a challenge.75 there is some evidence to support such a regimen . according to powel s study , residual fix was observed 1 week after administration of fix.31 maintaining a 1% trough level is widely debated in fix deficiency.40 experimental data demonstrate that fix has access to both intravascular and extravascular compartments with potential availability of clinically significant extravascular stores of fix.34 patients with hemophilia b seem to have less severe phenotype and less frequent joint bleed than those with hemophilia a. vyas et al found heterogeneity of hemophilia phenotype and widespread variability in the hss values of 178 patients with the same baseline factor activity.45 in 1976 , morfini et al published the first randomized trial comparing once - weekly and twice - weekly prophylaxis with on - demand treatment in ten subjects with hemophilia b over 1 year.20 a total of 7.5 iu / kg was administered to the twice - weekly group and 15 iu / kg to the once - weekly group . the two prophylactic groups had a significant reduction in bleeding episodes when compared to the observed 1-year period preceding the trial ( p<0.005 ) . patients having measurable fix in plasma for a higher number of days bleed less.20 in 2014 , valentino et al published a phase 4 multicenter , randomized , open - label , four - period crossover study that evaluated the efficacy and safety of nonacog alfa as a prophylaxis regimen ( 50 iu / kg twice - weekly or 100 iu / kg once - weekly ) compared with on - demand administration.75 inclusion criteria were being male , aged 665 years , with severe - to - moderately severe hemophilia ( fix 2 ) , and 12 or more bleeding episodes , including six or more hemarthroses episodes . the primary end point was the annual bleeding rate ( abr ) of two prophylactic regimens compared to on - demand treatment . the abr was 35.1 , 2.6 , and 4.6 for the on - demand treatment , 50 iu / kg twice a week , and 100 iu / kg once a week , respectively . a significant difference was observed between the two prophylaxis groups and the on - demand group ( p<0.0001 ) with a reduction of bleed of 89.4% in favor of the prophylaxis group . no patient discontinued the prophylactic treatment because of inefficacy or less - than - expected effect . there was no serious adverse event , or report of thrombogenicity , or occurrence of inhibitors.75 the use of high dose of fix ( 100 iu / kg per dose ) was of concern as it resulted in thrombogenicity . in a review conducted by rendo et al of five clinical trials in patients with hemophilia b , patients who received 100 iu / kg per dose of nonacog alfa reported no thrombotic events based on clinical findings and laboratory markers such as thrombin antithrombin ( tat ) and d - dimers.77 this finding was also confirmed in a study conducted by kavakli et al . this study evaluated the efficacy and safety of once - weekly prophylaxis with 100 iu / kg nonacog alfa compared with on - demand treatment in 25 adolescent and adult patients for a period of 52 weeks.76 at visits 2 and 4 of the study , assessment of thrombosis was done with monitoring of d - dimers and tat iii complex . none of the patients developed clinical thrombotic event and there was no inhibitor occurrence . otherwise , mean abr was significantly lower in the prophylactic group comparing to the on - demand treatment group . there was 3.6 bleeding events for the prophylactic group and 32.9 events for the on - demand group ( p<0.0001 ) . most interestingly , eight of 17 patients had a fix superior to 2 u / dl 1 week after dosing . no severe adverse event was observed and once - weekly prophylaxis was well tolerated.77 the studies of valentino75 and kavakli76 showed efficacy of once - weekly prophylaxis with no unexpected safety issues , no thrombotic event , no occurrence of inhibitors , and significant reduction in bleeding episodes . the population size of the studies was small , although this is quite frequent in hemophilia b studies . forty - one patients were evaluated in the twice - weekly prophylaxis group of the valantino study and 25 patients in the kavakli study . besides , the study conducted by valantino was of short duration . this is relatively a too short period to confirm safety and efficacy of a product . the kavakli study was conducted over a 52-week period and supports safety and efficacy of this regimen in a better way . otherwise , the two studies were conducted in previously treated patients and 92% of the patients included in the kavakli study had tertiary prophylaxis . the benefit of such regimen in untreated patient or in primary prophylaxis or secondary prophylaxis remains to be demonstrated . effect of switching from twice - weekly to once - weekly prophylaxis is not yet known .", "the current unmet challenges with regard to management of hemophilia b are financial sustainability , inhibitor occurrence , and poor uptake of prophylaxis . prophylactic regimen must be more convenient to patients and their caregivers , while being effective and safe to improve adherence to treatment . further research is needed to identify ideal prophylaxis regimens for patients with varying severity of hemophilia b. once - weekly prophylaxis with rix may be a viable treatment option for patients with hemophilia b. prophylaxis regimen at 100 iu / kg may be a safe and effective alternative to twice - weekly prophylaxis at 50 iu / kg . however , it remains unknown how patients with a less severe bleeding phenotype or with better baseline joint status might respond to once - weekly dosing with rix . in many regions of the world , fix doses less than the standard 50 iu / kg twice - weekly dose are followed . to minimize the cost of treatment and to tailor individual treatment to clinical response , it would be of interest to investigate the effect of once - weekly administration of lower doses of fix ." ]

[ "protease inhibitors have been purified from an array of leguminous and nonleguminous species encompassing torresea cearensis , erythrina caffra , dolichos lablab , crotalaria paulina , medicago scutellata [ 5 , 6 ] , canavalia gladiata , pisum sativum , dimorphandra mollis , swartzia pickellii , psophocarpus tetragonolobus , delonix regina , poecilanthe parviflora , adenanthera pavonina , cajanus cajan , dolichos biflorus , phaseolus acutifolius , arachis hypogaea , leucaena leucocephala , bauhinia bauhinioides , bauhinia variegata , bauhinia ungulata , vigna unguiculata , lens culinaris , glycine max , peltophorum dubium , pithecellobium dulce , glycine soja , and barley . protease inhibitors impair the activity of insect midgut proteases and thus adversely affect protein digestion and health in insects . they represent one of the multitude of entomotoxic proteins [ 30 , 31 ] . in addition to insecticidal activity [ 3235 ] , protease inhibitors demonstrate antiproliferative and antitumor activities [ 3645 ] . the objective of the present study was to isolate and characterize proteins with protease inhibitory activity from white cloud beans .", "an aqueous extract of the beans ( 250 g ) was produced by blending in distilled water ( 3 ml / g ) followed by centrifugation ( 14000 g for 25 minutes at 4c ) . the resulting supernatant was applied to a 5 20 cm column of deae - cellulose ( sigma ) in 10 mm tris - hcl buffer ( ph 7.4 ) . after elution of unadsorbed proteins ( fraction d1 ) , the column was eluted successively with 0.2 m nacl and 1 m nacl in the tris - hcl buffer . fraction d2 eluted with 0.2 m nacl was dialyzed to remove nacl and then subjected to affinity chromatography on a 5 15 cm of affi - gel blue gel ( bio - rad ) in 10 mm tris hcl buffer ( ph 7.4 ) . the unadsorbed fraction ( b1 ) was dialyzed against 10 mm nh4oac buffer ( ph 5 ) and then applied to a 2.5 20 cm column of sp - sepharose ( ge healthcare ) . after elution of unadsorbed proteins ( fraction s1 ) , the column was eluted with a 0 - 1 m nacl concentration gradient in the nh4oac buffer . the first and second adsorbed fractions ( sp2 and sp3 ) were then further purified by gel filtration on a superdex 75 hr 10/30 column ( ge healthcare ) in 0.2 m nh4hco3 buffer ( ph 8.5 ) using an akta purifier ( ge healthcare ) . the molecular mass of the isolated proteins was determined by sodium dodecyl sulfate - polyacrylamide gel electrophoresis ( sds - page ) following the procedure of laemmli and favre . gel filtration on an fplc - superdex 75 column , previously calibrated with molecular mass marker proteins ( ge healthcare ) , was employed to determine the molecular mass of the protein . the n - terminal sequence of the protein was analyzed by using a hewlett - packard hp g1000a edman degradation unit and an hp 1000 hplc system . the test sample ( 20 l ) was added to 160 l of a 1% casein solution in 0.1 m tris - hcl buffer ( ph 7.4 ) . trypsin ( 20 l of a 0.5 mg / ml solution ) was then added and the mixture was incubated at 37c for 15 minutes followed by addition of trichloroacetic acid ( 0.4 ml , 5% ) that was added to bring the reaction to an end . after centrifugation the absorbance of the resulting supernatant , which indicates the amount of casein fragments produced by trypsin , was read at 280 nm . the % inhibition of trypsin activity is equal to the % decrease in absorbance of the supernatant . the isolated trypsin inhibitor ( 2.5 m ) was treated with dithiothreitol ( dtt ) at the final concentration 2.5 , 10 and 40 mm for 5 , 20 , and 80 minutes at 37c . soybean trypsin inhibitor from sigma ( 2.5 m ) was similarly treated and used as a positive control . the reaction was terminated by adding iodoacetamide at twice the amount of thiol functions at each dtt concentration . residual trypsin inhibitor activity was measured at ph 7.4 as described above in assay for trypsin inhibitory activity . the highest iodoacetamide concentration used in the test was devoid of any effect on trypsin activity and the trypsin inhibitory activity of isolated trypsin inhibitor and soybean trypsin inhibitor . the cell lines l1210 ( human leukemia ) and mbl2 ( murine lymphoma ) were obtained from american type culture collection . the cell line was maintained in dulbecco modified eagles ' medium ( dmem ) supplemented with 10% fetal bovine serum ( fbs ) , 100 mg / l streptomycin , and 100 iu / ml penicillin , at 37c in a humidified atmosphere of 5% co2 . cells ( 1 10 ) in their exponential growth phase were seeded into each well of a 96-well culture plate ( nunc , denmark ) and incubated for 3 hours prior to addition of the trypsin inhibitor . incubation was performed for an additional 48 hours . radioactive precursor , 1 ci ( [ h - methyl]-thymidine , from ge healthcare ) , was then introduced to each well and the incubation continued for 6 hours . the assay for hiv reverse transcriptase inhibitory activity was carried out in view of the report that trypsin inhibitors manifest this activity [ 50 , 51 ] . it was conducted according to instructions supplied with the assay kit from boehringer mannheim ( germany ) . the assay makes following use of the ability of reverse transcriptase to synthesize dna , commencing from the template / primer hybrid poly ( a ) oligo ( dt ) 15 . the digoxigenin- and biotin - labeled nucleotides in an optimized ratio are incorporated into one of the same dna molecule , which is freshly synthesized by the reverse transcriptase ( rt ) . the detection and quantification of synthesized dna as a parameter for rt activity are based on a sandwich elisa protocol . biotin - labeled dna binds to the surface of microtiter plate modules that have been precoated with strepatavidin . in the following step , an antibody to digoxigenin , conjugated to peroxidase , binds to the digoxigenin - labeled dna . in the last step the peroxidase enzyme affects the cleavage of the substrate , yielding a colored reaction product . the absorbance of the sample at 405 nm which is directly correlated to the level of rt activity can be measured using a microtiter plate ( elisa ) reader . a fixed amount ( 46 ng ) of recombinant hiv-1 reverse transcriptase was used . the inhibitory activity of the trypsin inhibitor was calculated as percent inhibition compared to a control without the trypsin inhibitor . the plasmid that expressed his - tagged wild - type hiv-1 integrase , pt7 - 7-his ( y | tx)-hiv-1-in , was a generous gift from professor s.a . a 1-liter culture of e. coli bl21 ( de3 ) cells containing the expressing plasmid was grown at 37c until it reached od600 0.7 - 0.8 . cells were induced by addition of 0.8 mm iptg ( isopropyl--d - thiogalactopyranoside ) and harvested , after 4 hours of incubation , by centrifugation at 6000 g for 10 minutes at 4c . cells were suspended at a concentration of 10 ml / g wet cell paste in 20 mm tris - hcl buffer ( ph 8.0 ) containing 0.1 mm edta , 2 mm -mercaptoethanol , 0.5 m nacl , and 5 mm imidazole . after incubation at 4c for 1 hour , the lysate was sonicated and centrifuged at 40 000 g at 4c for 20 minutes . the pellet was homogenized in 50 ml buffer a ( 20 mm tris - hcl , ph 8.0 , 2 m nacl , 2 mm -mercaptoethanol ) which contained 5 mm imidazole . the suspension was rotated at 4c for 1 hour and cleared by centrifugation at 40 000 g at 4c for 20 minutes . the supernatant was applied to a 1 ml chelating sepharose ( ge healthcare ) column charged with 50 mm imidazole . the column was eluted with five column volumes of buffer a containing 5 mm imidazole , and the protein was eluted with three column volumes of buffer a containing 200 and 400 mm imidazole , respectively . protein containing fractions were pooled , and edta was added to a final concentration of 5 mm , followed by dialysis against buffer b ( 20 mm hepes , ph 7.5 , 1 mm edta , 1 m nacl , 20% glycerol ) containing 2 mm -mercaptoethanol and then against buffer b containing 1 mm dithiothreitol . a nonradioactive elisa - based hiv-1 integrase assay was carried out according to the dna - coated plate method . in this study , 1 g of smal - linearized pbluescript sk was coated onto each well in the presence of 2 m nacl as target dna . the donor dna was prepared by annealing vu5br ( 5-biotin - gtgtggaaaatctcta- gcagt-3 ) and vu5 ( 5-actgctagagattttccacac-3 ) in 10 mm tris - hc1 , ph 8.0 , 1 mm edta , and 0.1 m nacl at 80c , followed by 30 minutes at room temperature . integrase reaction was conducted in 20 mm hepes ( ph 7.5 ) containing 10 mm mncl2 , 30 mm nacl , 10 mm dithiothreitol , and 0.05% nonidet - p40 ( sigma ) . after the reaction , biotinylated dna immobilized on the wells was incubated with streptavidin - conjugated alkaline phosphatase ( boehringer - mannheim , mannheim , germany ) , followed by colorimetric detection with 1 mg / ml p - nitrophenyl phosphate in 10% diethanolamine buffer ( ph 9.8 ) containing 0.5 mm mgcl2 . the activity of sars coronavirus ( cov ) protease was reflected by a cleavage of designed substrate which is composed of two proteins linked by a cleavage site for sars cov protease . the reaction was carried out in a mixture containing 5 m sars cov protease , 5 m sample , and 20 m substrate and buffer [ 20 mm tris - hcl ( ph 7.5 ) , 20 mm nacl and 10 mm beta - mercaptoethanol ] for 40 minutes at 37c . the reaction was then terminated by heating at 100c for 2 minutes . then the reaction mixture was analysed by sodium dodecyl sulfate - polyacrylamide gel electrophoresis ( sds - page ) . if sars cov protease is inhibited by the test sample , there is only one band , which is the intact substrate , shown in sds - page . the assay for antifungal activity toward botrytis cinerea and fuserium oxysporum was executed in 100 mm 15 mm petri plates containing 10 ml of potato dextrose agar . after the mycelial colony had grown to a sufficiently large size , sterile blank paper disks ( 0.625 cm in diameter ) were laid at a distance of 0.5 cm away from the edge of the mycelial colony . an aliquot ( 15 l ) of the trypsin inhibitor was added to a disk . the plates were exposed at 23c for 72 hours until mycelial growth had enveloped the disks containing the control and had produced crescents of inhibition around disks containing samples with antifungal activity .", "anion exchange chromatography of the bean extract on deae - cellulose resolved it into three fractions , an unadsorbed fraction d1 together with two adsorbed fractions d2 and d3 . after affinity chromatography of fraction d2 on affi - gel blue gel , the activity appeared in the unadsorbed fraction b1 ( data not shown ) . ion exchange chromatography of fraction b1 on sp - sepharose resolved it into a small unadsorbed fraction sp1 and three large adsorbed fractions ( sp2 , sp3 , and sp4 ) of about the same size ( figure 1 ) . final purification of sp2 on superdex 75 produced two fractions , sp2su1 and sp2su2 ( figure 2(a ) ) . gel filtration of sp3 on superdex 75 yielded two fractions sp3su1 and sp3su2 ( figure 2(b ) ) . fractions sp2su2 and sp3su2 , both with a molecular mass of 16 kda as determined by gel filtration on superdex 75 , were the only fractions with trypsin inhibitory activity . both sp2su2 and sp3su2 displayed a molecular mass of 16 kda in sds - page ( figure 3 ) and gel filtration ( figure 2 ) . these two white cloud bean trypsin inhibitors inhibited trypsin with an ic50 of about 0.6 m ( figure 4 ) . dtt treatment curtailed the trypsin inhibiting activity in a dose- and time - dependent manner ( table 3 ) . the two trypsin inhibitors did not inhibit hiv-1 reverse transcriptase when tested at various concentrations up to 100 m ( table 4 ) . they lacked antifungal activity when tested up to 24 g / disk ( 100 m , 15 l ) ( data not shown ) . the ic50 values of the inhibitory effects of the trypsin inhibitors on l1210 cells were , respectively , 21.5 m and 28.8 m ( table 4 ) . however , there was no activity toward mbl2 cells when tested up to 100 m . ", "the present study disclosed the production of two trypsin inhibitors with closely related n - terminal sequences chromatographic behavior and bioactivities by the white cloud bean variety of phaseolus vulgaris . the trypsin inhibitors demonstrate the same molecular mass ; both are adsorbed on deae - cellulose and unadsorbed on affi - gel blue gel but can be separated by ion exchange chromatography on sp - sepharose . they have approximately the same trypsin inhibitory potency , and neither of them inhibits hiv-1 reverse transcriptase inhibitory activity , hiv-1 integrase inhibitory activity , sars coronavirus proteinase inhibitory activity , or fungal growth . both inhibitors exhibit an antiproliferative activity toward l1210 cells albeit with a small difference in potency , while there is little activity toward mbl2 cells . the difference in yields of the two trypsin inhibitors from the white cloud beans is only slight . the two trypsin inhibitors exhibit n - terminal sequence homology with those of other leguminous trypsin inhibitors such as inhibitors mungbean ( vigna mungo ) , cowpea ( vigna unguiculata ) , and lima bean ( phaseolus lunatus ) . whereas leguminous antifungal proteins [ 48 , 49 ] , like nonleguminous antifungal proteins , are unadsorbed on deae - cellulose and adsorbed on affi - gel blue gel , white cloud bean trypsin inhibitors are adsorbed on deae - cellulose and unadsorbed on affi - gel blue gel . thus the purification procedure adopted in the present investigation can be conveniently used to separate trypsin inhibitors from antifungal proteins . the antiproliferative activity of white cloud bean trypsin inhibitors is consistent with similar observations on field bean trypsin inhibitor [ 39 , 40 , 42 , 43 , 54 ] . it is noteworthy that white cloud bean trypsin inhibitors do not exert a similar action on lymphoma mbl2 cells . in contrast to broad bean trypsin inhibitor [ 48 , 56 ] , those from white cloud bean do not inhibit hiv-1 reverse transcriptase . this is reminiscent of the finding that lentil and vigna mungo inhibitors have little or no hiv-1 reverse transcriptase inhibitory and antifungal activities [ 57 , 58 ] . in summary , the isolation of two trypsin inhibitors with very similar biochemical and biological characteristics from white cloud beans was achieved in the present investigation . white cloud bean trypsin inhibitors demonstrate antiproliferative activity against tumor cells but do no inhibit mycelial growth or hiv-1 reverse transcriptase . previously isolated p. vulgaris trypsin inhibitors have not been so tested [ 6064 ] . they reportedly have a molecular mass of about 9 kda [ 63 , 65 ] or 13 kda , smaller than the value of 16 kda obtained for white cloud bean trypsin inhibitors ." ]

[ "although about two - thirds of patients with epilepsy ( pwe ) treated with antiepileptic drugs ( aeds ) reach seizure - freedom , about one - third remains drug - resistant to the current therapies.1 despite the introduction of new aeds with a better pharmacokinetic and safety profile compared to old generation aeds , today , one of the major causes of failure of antiepileptic treatment is poor adherence often due to occurrence of adverse drug reactions ( adrs ) , leading up to 25% of patients to discontinue treatment before the achievement of effective doses and with a consequent increase of health care costs.2,3 during the last 25 years , many efforts have been directed to the development of new aeds with different mechanisms of action able to reduce brain hyperexcitability ; recently considerable interest has been focused on synaptic vesicle protein 2a ( sv2a ) and its role as a target for aeds.4 the first drug of this new class approved for epilepsy is levetiracetam ( lev ) , and from this lead compound , several racetam analogs have been synthesized.5 based on target - drug program , brivaracetam ( brv ) ( 2s)-2-[(4r)-2-oxo-4-propylpyrro - lidinyl]butanamide , an n - propyl analog of lev has been identified and has entered clinical trials for pwe;6 it is an sv2a ligand with high selectivity and a 1030-fold higher potency , depending on the experimental conditions , when compared to lev.7,8 the purpose of this review is to present updated data available on the pharmacology , efficacy , and tolerability of brv . we have conducted a systematic search in the pubmed and cochrane library databases up to august 14 , 2015 summarizing all relevant data for efficacy , safety , and tolerability of brv in the treatment of partial - onset seizure .", "although the correlation between sv2a binding and anti - convulsant potency in animal models has been previously demonstrated , the role of sv2a in neurotransmission still remains unclear.9 in fact , even if it has been established that sv2a protein is involved in normal synaptic vesicle function , the exact mechanism of synaptic vesicle cycling regulation and neurotransmitter release remains unknown.5,9 several preclinical studies have demonstrated that brv is more potent and efficacious than lev in animal models of both focal and generalized epilepsy.10 in particular , in fully amygdala - kindled rats , brv induced a significant suppression in motor - seizure severity from a dose of 21.2 mg / kg , whereas lev caused a similar effect from a dose of 170 mg / kg . brv also significantly reduced the after - discharge duration at the highest dose tested ( 212.3 mg / kg ) , whereas lev was inactive on this parameter up to 1,700 mg / kg.10 moreover , brv protected significantly against both partial and generalized seizures in fully amygdala - kindled mice resistant to phenytoin ( effective dose 50 [ ed50 ] : 68.3 mg / kg , intraperitoneal [ ip]).10 recently , it has been demonstrated that brv has a higher brain permeability than lev , with consequently more rapid onset of action after acute dosing in audiogenic mice ; this fast onset of action might also have a potential clinical relevance for the treatment of status epilepticus or cluster seizures.11 another study confirmed the protective activity of brv against kindled seizures with focal seizure threshold and significantly severity significantly modified.12 furthermore , a recent study , using a rapid kindling model in p14 , p21 , p28 , and p60 rats , has evaluated two doses of brv 10 and 100 mg / kg , demonstrating that brv 100 mg / kg significantly increased the after - discharge threshold at all ages , whereas brv 10 mg / kg increased after - discharge threshold in p60 , p28 , and p21 rats . brv also reduced the after - discharge duration , achieving statistical significance with 10 and 100 mg / kg at p60 and with 100 mg / kg , at p21 . at p60 , brv increases the number of stimulations required to reach stage 45 seizures in a dose - dependent manner . at p28 and p21 , brv increased the number of stimulations required to develop stage 45 seizures in a dose - dependent manner , with almost complete elimination of stage 45 seizures.13 moreover , brv showed a marked synergism with diazepam to reduce seizure duration in self - sustained status epilepticus induced by stimulation of the perforant path.14 a recent study has evaluated the antiseizure and antimyoclonic activities of brv in comparison to lev in an animal model of posthypoxic myoclonus , showing higher efficacy of brv ( 0.3 mg / kg ) than lev ( 3 mg / kg ) against posthypoxic seizures.15 furthermore , recent experiments conducted in transgenic mice with alzheimer s disease supported an adjunctive and peculiar role of brv that not only revealed an efficacy against spike - wave discharges similar to ethosuximide , but it showed the ability to reverse memory impairment , thus extending the potential spectrum of action of this new aed.16 in addition to sv2a block , brv also exhibits inhibitory activity on neuronal voltage - gated sodium channels ( vgsc ) playing a role as a partial antagonist , as has been reported for other aeds.17,18 in particular , experimental studies on primary cortical cultures have demonstrated that brv is able to prolong the sodium channel time recovery from fast inactivation , and this effect could reduce the availability of sodium channel during high - frequency repetitive firing.17,19 even if this data has been refuted by another recent experimental study that has showed that this vgsc inhibition does not impair sustained repetitive firing in neurons of neuroblastoma cells,20 this is an important aspect , which deserves to be better clarified , since the lack of effect of brv to reduce neuronal excitability by blocking high repetitive firing in neurons might exclude that the modulation of vgsc contributes to antiseizure effects of brv .", "brv presents a favorable pharmacokinetic profile , linear and predictable , with low intersubject variability and almost 100% bioavailability.2123 the pharmacokinetic properties of brv have been studied in healthy adult volunteers , in the elderly , in patients with pwe , and in those with hepatic or renal impairment.2225 the pharmacokinetic differences in elderly subjects compared to healthy volunteers are not so important as to require any dose adjustment.25 absorption of brv is unaffected by the presence of food , including high fat meals ; after oral administration , brv is rapidly absorbed by the gastrointestinal tract , and displays linear and dose - proportional profile over the dose range tested.22,26 its distribution volume is close to total body water ( vz=0.5 l / kg ) , and it binds weakly to plasma proteins ( 17.5% ) . its terminal half - life is ~9 hours.21 saliva and plasma brv levels are highly correlated , brv crosses the mucosa by passive diffusion , therefore , the saliva concentration of brv is correlated with plasma concentration . it is possible to speculate that saliva might be a suitable sample for monitoring brv levels when blood sampling could be a limiting factor.23 brv is extensively metabolized through several metabolic pathways and is fully excreted by urine ( only 8%11% remains unchanged ) . brv is eliminated primarily by metabolism , with the major metabolic pathway involving hydrolysis of the acetamide group resulting in formation of an acid metabolite ( brv - ac ; 34.2% of a radiolabeled dose in urine).21 a secondary pathway , mainly mediated by cytochrome p450 ( cyp ) 2c19,27 forms a hydroxy metabolite ( brv - oh ; 15.9% of dose in urine).21 a combination of these two pathways leads to the formation of a hydroxyacid metabolite ( 15.2% of dose in urine);21,28 only 8.6% of the dose is recovered as the unchanged compound in urine.21 all three metabolites of brv are pharmacologically inactive ( unpublished results ) in an open - label study conducted in patients with liver disease , the plasma half - life of brv was prolonged up to 17.4 hours in correlation with the severity of hepatic impairment ; however , the exposure to brv is increased by 50%60% in patients with hepatic impairment , irrespective of severity classified by child pugh score.25,26 these data suggest that the maximum daily dose of brv might be reduced by one - third in patients with hepatic impairment.25 in severe renal impairment , the exposure to a single oral dose of 200 mg brv not requiring dialysis ( creatinine clearance < 15 ml / min ) , and renal clearance of three metabolites ( acid , hydroxy , and hydroxyacid ) , was decreased 10-fold in patients with severe renal impairment.24 nevertheless , there are data showing a toxicological coverage for metabolites , without the evidence of any safety issues ( ucb data file ) . based on these observations , a dose adjustment for brv should not be required at any stage of renal dysfunction .", "the efficacy of brv as add - on therapy in patients with uncontrolled partial seizures has been assessed in six randomized placebo - controlled clinical trials ( table 1).29 in the first two studies , brv as adjunctive therapy in adult patients with partial epilepsy and poor control with 12 concomitant aeds , at different doses ( 5 , 20 , 50 , and 50150 mg / d ) has been evaluated.30,31 french et al30 reported a statistically significant reduction of seizure frequency achieved at the 50 mg / d dose , with high tolerability and infrequent adrs . in particular , the percentage reduction over placebo in focal seizure frequency / week was directly correlated to brv dose , respectively 9.8% at 5 mg / d , 14.9% at 20 mg / d , and 22.1% at 50 mg / d , with a median percent reduction from baseline in seizure frequency / week of 21.7% ( placebo ) , 29.9% ( brv5 ) , 42.6% ( brv20 ) , and 53.1% ( brv50 ) ; 50% responder rates were 16.7% ( placebo ) , 32.0% ( brv5 ) , 44.2% ( brv20 ) , and 55.8% ( brv50 ) ; seizure freedom rates during the 7-week treatment period were 1.9% ( placebo ) , 8.0% ( brv5 ) , 7.7% ( brv20 ) , and 7.7% ( brv50 ) . on the other hand , higher doses of brv would not seem to be more effective , in fact , van paesschen et al31 did not find significant differences in seizure frequency reduction between brv 50 and 150 mg / d during the 7-week maintenance period . in particular , the median seizure frequency / week was 1.00 , 1.96 , and 1.86 in the group treated with brv 50 mg / d , brv 150 mg / d , and placebo , respectively.31 the reduction in baseline - adjusted seizure frequency / week over placebo during the maintenance period was 14.7% in the brv 50 mg / d group and was 13.6% in the brv 150 mg / d group ; however , a significant difference over placebo was observed on several secondary efficacy outcomes ( 10 weeks combined up - titration and maintenance period).31 in fact , after the 10-week treatment period , the median seizure frequency / week was 1.10 , 2.05 , and 1.95 in the brv 50 mg / d , brv 150 mg / d , and placebo groups , respectively . in the maintenance period , 50% responder rates were 23.1% for placebo compared with 39.6% for brv50 and 33.3% for brv150 . during the treatment period , 50% responder rates were 17.3% for placebo compared with 35.8% for brv50 and 30.8% for brv150 . nine patients were seizure - free during the 10-week treatment period in the brv50 group ( three in the brv150 group , only one in the placebo group ) . in the study by ryvlin et al,32 the efficacy and safety / tolerability of brv ( at doses of 20 , 50 , and 100 mg / d ) in patients with uncontrolled partial seizures with / without secondary generalization , despite treatment with one or two concomitant aeds , was investigated . the percent reduction over placebo in baseline - adjusted seizure frequency / week was 6.8% , 6.5% , and 11.7% in the brv 20 , 50 , and 100 mg / d groups , respectively . the percent reduction over placebo in baseline - adjusted seizure frequency/28 days was 9.2% and 20.5% in the brv 50 and 100 mg / d groups , respectively . median percent reductions from baseline were 30.0% for brv 20 mg / d , 26.8% for brv 50 mg / d , and 32.5% for brv 100 mg / d in comparison to 17.0% for placebo . responder rates ( 50% ) were 27.3% , 27.3% , and 36.0% for brv 20 , 50 , and 100 mg / d , respectively , in comparison to 20.0% for placebo . based on these results , only brv 100 mg / d was able to significantly reduce seizure frequency / week over placebo . indeed , in their randomized placebo - controlled trial , adjunctive brv at a daily dose of 50 mg significantly decreased seizure frequency , while lower dosages ( 5 and 20 mg / d ) did not achieve significant differences.33 in more detail , the percent reduction in partial - onset seizure frequency / week in comparison to placebo was 0.9% ( p=0.885 ) for brv 5 mg / d , 4.1% ( p=0.492 ) for brv 20 mg / d , and 12.8% ( p=0.025 ) for brv 50 mg / d ; in the brv 50 mg / d group , statistical significance was also observed for the 50% responder rate ( brv 32.7% vs placebo 16.7% ) and median percent reduction from baseline in focal seizure frequency / week ( brv 30.5% vs placebo 17.8% ) . recently a randomized , multicenter , double - blind phase iii trial was conducted by klein et al34 to evaluate the efficacy and the safety profile of brv at fixed doses of 100200 mg / d in adult patients with refractory partial onset seizures . responder rate was 21.6% for placebo group , 38.9% for brv 100 mg / d , and 37.8% for brv 200 mg / d ; the percent reduction of partial onset seizures in 28-day frequency was 22.8% for brv 100 mg and 23.2% for brv 200 mg . kwan et al35 conducted a double - blind , randomized , placebo - controlled trial investigating the safety and tolerability profile of adjunctive brv ( at individualized tailored doses ranging from 20 to 150 mg / d ) in patients with partial or generalized refractory epilepsies . the percent of reduction of focal seizure frequency / week in the brv group in comparison to placebo was 7.3% , while only in the generalized seizures group , the number of seizure days / week decreased from 1.42 at baseline to 0.63 during the treatment period in brv - treated patients ( n=36 ) , and from 1.47 at baseline to 1.26 during the treatment period in the placebo group ( n=13).35 the median percent reduction in baseline - adjusted seizure frequency / week was 26.9% brv vs 18.9% placebo , and the 50% responder rate was 30.3% brv vs 16.7% placebo . the median percent reduction from baseline in generalized seizure days / week was 42.6% vs 20.7% , and the 50% responder rate was 44.4% vs 15.4% in brv - treated and placebo - treated patients , respectively . similar to lev , brv might become a useful aed for the treatment of myoclonic seizures occurring in the setting of idiopathic generalized epilepsies ( eg , juvenile myoclonic epilepsy)36 or of progressive myoclonic epilepsies.37 two randomized , placebo - controlled trials evaluating efficacy and safety of adjunctive brv ( 5150 mg / d ) in unverricht lundborg disease , the most common and less severe form of progressive myoclonic epilepsies,38 failed to show a significant improvement of myoclonus in these patients.39 however , sample size was small ( 106 patients randomized in the two trials ) , and the patients were allowed to receive lev.39 moreover , it is well known that myoclonus may present high inter- and intrapatients variability ( with patients experiencing good days and bad days ) in unverricht currently an open - label , multicenter , follow - up study to evaluate the long - term safety and efficacy of brv is ongoing ( brite study - nct01339559 ) . finally , to date , in all studies performed , brv was evaluated as an oral tablet formulation , and no data are available about intravenous infusion since the study nct02088957 , aiming at a comparison of the efficacy and safety of intravenous brv vs phenytoin in adult subjects with nonconvulsive electrographic seizures , was terminated for low enrollment .", "the most commonly reported adverse effects with brv in adults were primarily related to the central nervous system and included somnolence , fatigue , and dizziness.22 these adverse effects were mild to moderate , and the tolerability profile is so excellent that it did not impair therapeutic compliance . in fact , the daily dose of brv ( 20150 mg ) was well tolerated and associated with 6.1% of discontinuation rates due to adrs compared to 5.0% of the placebo group.35 furthermore , adrs induced by brv seem to be time - related , disappearing during the course of treatment . the entity of sedative effects of brv measured by psychometric tests is dose - related in healthy men and appeared clearly from 600 mg upwards as a decrease in attention , motor control , and alertness.22 moreover , the type and the severity of adrs are not influenced by food.22 as demonstrated in healthy males , a twice - daily dosing regimen could be a good clinical practice to reduce blood fluctuations and peak , which might influence the appearance of adverse events.22 no effects on cardiac function were reported even at very high daily dosages ( up to 800 mg / d).40 no data about fertility and/or potential teratogenic effect of brv in humans are currently available ; however , no adverse effects were detected up to the highest tested oral dose of 400 mg / kg / d on fertility , and no effects on pregnancy or fetal development at 600 mg / d were observed in animals.26 seizure aggravation or the appearance of new generalized seizures was rare : three studies reported this adverse event , occurring in similar proportions between placebo and treated group ( 4.3% vs 5.2% , p=0.67).32,33,35 in the above - reported five randomized clinical trials , 1,639 subjects were included in an intention - to - treat analysis ( 1,214 treated with brv and 425 with placebo).3035 no differences were observed in the proportion of subjects experiencing at least one adverse event ( 65.5% with brv vs 60.5% with placebo , p=0.10 ) . most events were mild to moderate ; actually , comprehensive withdrawal rate due to adverse events was quite low and similar in brv and placebo arms ( 5.4% with brv vs 4.2% with placebo , p=0.37 ) . serious adverse events were quite rare and equally distributed ( 2.9% with brv vs 4.4% with placebo , p=0.16 ) . adverse events that were observed in at least 5% of subjects in either group are listed in table 2 . the proportion of patients reporting fatigue and somnolence was significantly higher in brv group compared to placebo ( table 2 ) . irritability was reported in three studies only , and it was present in a small proportion of subjects ( 3% receiving brv , 1% receiving placebo , p=0.36 ) .", "because of its advantageous pharmacokinetic profile , brv treatment does not appear to influence plasma concentrations of other aeds such as carbamazepine , lamotrigine , lev , oxcarbazepine , topiramate , or valproic acid.41 however , carbamazepine plasma levels are slightly reduced by coadministration of brv ( 400 mg / d ) , while levels of carbamazepine - epoxide are increased in a dose - dependent manner.26,42 this increase of plasma concentration of carbamazepine - epoxide is the result of inhibition by brv of epoxide hydrolase that metabolizes carbamazepine - epoxide into carbamazepine - diol.42 high doses of brv ( 400 mg / d ) cause a moderate decrease of ethinylestradiol and levonorgestrel plasma levels ( components of oral contraceptives ) but this posological range has no impact on ovulation . no effect on contraceptive disposition is reported at therapeutic doses of brv 100 mg / d.39 interestingly , there is a possible negative interaction between brv and lev , in fact , the concomitant use of both drugs may reduce brv efficacy ; however , this evidence is not robust because the number of patients with concomitant lev was very small , other studies may be useful to assess this apparent pharmacodynamic interaction.33", "brv is a novel aed whose efficacy in partial epilepsies has been studied and established in five randomized controlled trials;3035 furthermore , two recent meta - analyses have confirmed significant effects for brv in patients with refractory partial seizures.29,43 considering that brv shares part of its mechanism of action with lev and that its ability to inhibit vgsc ( still debated ) is in common with several other aeds , it will be very intriguing to see how this drug will behave in real - life clinical practice . accordingly , it could be hypothesized that brv might possess at least the same effectiveness as lev . based on this hypothesis , brv may be reasonably considered as a valuable add - on aed in patients with partial seizures , also considering its suggested good tolerability . however , specific studies are needed to confirm its efficacy in specific epileptic syndromes , for example , a decreased expression of sv2a in the hippocampus of patients with temporal lobe epilepsy with hippocampal sclerosis has been documented and might represent a pharmacoresistance mechanism in some cases ; however , lev has been reported to be effective.44,45 in addition , because of its good safety and pharmacokinetic profile , brv might be ideal for use in monotherapy , as previously demonstrated for lev.46 finally , few studies have been performed , and more randomized double - blind studies are needed to confirm these considerations and to demonstrate if brv might really confirm its promises and become a new tool for epileptologists ." ]

[ "\n acute intussusception is one of the most common causes of acute abdomen in infants . management includes both surgical and non - surgical methods , with gradually increasing importance recently being accorded to the latter . conservative measures , including hydrostatic reduction , are the methods of choice for initial management . though widely accepted , the expertise is still not widely available , especially in developing countries .", "\n a six - month - old child presented with complaints of repeated episodes of vomiting that contained only ingested milk . this was associated with three episodes of loose stools , initially watery and later with fresh red blood per rectum with jelly - like consistency . there was no history of fever , decreased urine output , lethargy , abnormal body movements , or difficulty in breathing . her immunizations were fully up to date with no history of rota virus immunization . \n \n on admission abdominal examination was remarkable for an ill - defined mass that could be felt in the right hypochondrium . she was initially kept nil per oral and started on conservative measures , including antibiotics . an urgent abdominal ultrasonography was done , which showed a round mass - like lesion giving a target appearance in the right hypochondrium ( suggestive of ileocolic intussusception ) . she was taken for immediate intervention , and as per surgical opinion , a hydrostatic reduction under radiological guidance was started . \n \n the child was first stabilized using intravenous fluids to treat dehydration , and a pre - procedure x - ray abdomen was performed to rule out intestinal perforation . the procedure was done in the ultrasonography room in the presence of a treating physician and a pediatric surgeon . without using any sedation , a 16 f foley catheter was inserted into the rectum in the supine position and the balloon was gently inflated while maintaining a tight anal seal . \n \n the patient s vitals , which included abdominal girth and distension , were monitored throughout the procedure . lactate solution , warmed to body temperature , was then slowly introduced into the catheter through a bag hanging at a height of approximately 100 cm . during reduction , the intussusceptum was observed under continuous ultrasound guidance as it proceeded to the cecum and then reduced across the ileocecal valve ( figures 1 - 4 ) . \n \n ileal loop ( star ) within ascending colon ( arrow ) , longitudinal view . \n \n this was associated with the patient s improved condition , which included less crying and irritability . the parents were told about the possibility of recurrence and asked to pay close attention for the onset of symptoms . \n", "\n acute intussusception is defined as the telescoping of the proximal bowel ( intussusceptum ) into the distal bowel ( intussuscipiens ) . the usual locations include the ileocolic region and ileocecal junction , which comprise the majority of cases . intussusception mostly presents between four months and two years , while the peak incidence is found around middle infancy . \n \n diagnosis usually needs a high suspicion on the part of the treating physician , as presentation can be quite varied , including irritability , vomiting , and poor feeding . characteristic manifestations include crying episodes , fresh red blood in stools ( hematochezia ) , and a mass in the abdomen . differential diagnoses include acute gastroenteritis , dysentery , sepsis syndrome , and volvulus , amongst others . the diagnosis is usually confirmed sonographically , which is highly accurate and has a reported sensitivity that exceeds 90% . various signs have been described in the literature , depicting intussusception as an abdominal mass with a target sign on the transverse section , a pseudokidney ( or sandwich sign ) on the longitudinal section , and a crescent - in - doughnut sign on axial images . \n \n the management of intussusception has seen a paradigm shift in recent years . in the past , the preferred non - surgical method involved use of a barium enema for reduction , followed by the air insufflation method . \n \n hydrostatic reduction using ultrasound - guided saline reduction has recently gained acceptance as the procedure of choice for initial nonsurgical management of intussusceptions in children . this popularity can be attributed to the avoidance of radiation exposure to the child and the treating team , as well as to the high success rates that have been achieved . \n \n there is still some controversy regarding the exact method of the procedure , which can be attributed to the poor training of physicians and to the general belief that intussusception is entirely a surgical problem , especially in developing countries . this procedure should be undertaken with a close liaison between pediatrics , pediatric surgery , and radiology teams to obtain the best results . the surgeon and physician should always be present at the time of reduction for clinical monitoring . \n \n after adequate optimization , including temperature controlled settings , the procedure should ideally be undertaken without any sedation . this is helpful for assessing a successful reduction using clinical criteria , as described later . \n \n we used ringer s lactate due to its near physiological constitution , avoiding the risk of chemical peritonitis due to a barium enema or tension pneumoperitoneum due to an air enema , as seen in cases of intestinal perforation . the risk of intestinal perforation following such a procedure is rarely encountered due to less hydrostatic pressure exerted and an even amount of pressure exerted on the bowel walls as compared to air insufflations . even if intestinal perforation occurs we chose 100 cm h2o pressure to lessen the risk of perforation , though different studies have used a wide range of pressures ( 75 to 125 cm h2o).6 , \n 9 \n \n the main ultrasonographical criteria of successful reduction is the flow of the fluid from the cecum into the terminal ileum . general improvement in the clinical profile of the patient including relief from crying , stable vitals , increasing abdominal distension during the procedure ( which indicates filling of the small bowel ) , and the disappearance of the abdominal mass , should also be given due consideration when deciding to terminate the procedure . \n \n a repeat ultrasound should always be done after the procedure as the chances of recurrence is high , especially in the immediate post - procedure period . , this method should be undertaken as teamwork , and not considered the work of a single specialty , which is the best way of treating the patients according to the standards of today . \n", "" ]

[ "aging , a multifactorial process of enormous complexity , is characterized by impairment of physiochemical and biological aspects of cellular functions ( harman 1992 ) . oxidative stress , an unavoidable consequence in the metabolism of oxygen in aerobic cells , is a major factor in the aging process and , in the course of many chronic diseases , associated with aging ( mattson 2002 ) . many predisposing conditions which increase in prevalence during aging , such as obesity , insulin resistance , inflammation , changes in the activity of the hypothalamus hypophysis suprarenal axis , stress , and hypertension , contribute to increase prevalence of cardiovascular diseases ( veronica and esther 2012 ) . lipid infiltration in the myocardium is the foremost disorder encountered in the development of the aging process ( johannsen and ravussin 2010 ) . aging is frequently accompanied by several pathological conditions and some associated phenomena such as increased lipid peroxidation , generation of free radicals , and increased peroxidation of nitric oxide ( no ) to its toxic species , resulting from oxidative stress which significantly alters the incidence of cardiovascular diseases ( guarner et al . alteration in glutathione - dependent antioxidant system is expected to exert a significant impact on physiological and metabolic functions of cellular membranes . enhanced lipid peroxidation and deterioration of membrane structure has been well established during the aging process ( yu 2005 ) . preventing and treating cardiovascular diseases would be useful in promoting normal aging . the identification of natural molecule with antioxidant , antilipidemic , and membrane - stabilizing properties is , therefore , one strategy to facilitate healthy aging . chitosan is one of the most abundant naturally occurring polysaccharides present in shellfish , clams , krill , oysters , squid , fungi , and insects ( cardenas et al . it is a polymer of -(1 - 4)-d - glucosamine ( fig . 1 ) , and it is chemically similar to that of the plant fiber , cellulose . it has been reported to possess antilipidemic ( santhosh et al . previously , anandan et al . ( 2004 ) observed the antiulcerogenic potential of chitosan against hcl the free radical quenching property of this marine polysaccharide has also been studied in detail ( xing et al . it has profound applications in the fields of clarification and purification , chromatography , paper and textiles , photography , food and nutrition , agriculture , pharmaceutical and medical , cosmetics , biodegradable membranes , and biotechnology ( santhosh et al . though the beneficial effects of chitosan have been extensively studied , the antiaging effect of chitosan has not yet been explored.fig . 1structure of chitosan structure of chitosan in the present study , an attempt has been made to assess the salubrious effect of dietary chitosan intake on myocardial lipid peroxidation and glutathione - dependent antioxidant status in young and aged rats by virtue of its antioxidant and hypolipidemic properties .", "reduced glutathione , tetraethoxypropane , and 2-thiobarbituric acid were procured from m / s sigma chemical company , st . chitosan ( mw , 750,000 da ; viscosity , 8 cp ; deacetylation rate , 8587 % ; purity , 98.6 % ) used in the experiment was a kind gift from dr . t. k. thankkappan , principal scientist , central institute of fisheries technology , cochin , india . male wistar strain albino rats , weighing 120150 g [ 18 young rats of 23 months old ( mean age , 79.2 6.53 days ) ] and 350400 g [ 18 aged rats of 2025 months old ( mean age , 712 51.6 days ) ] , were selected for the study . the animals were housed individually in polypropylene cages under hygienic and standard environmental conditions ( 28 2 c ; humidity , 6070 % ; 12 h light / dark cycle ) . the animals were allowed a standard diet ( m / s sai foods , bangalore , india ; table 1 ) and water ad libitum . the experiment was carried out according to guidelines of the committee for the purpose of control and supervision of experiments on animals , new delhi , india , and approved by the institutional animal ethics committee of the central institute of fisheries technology , cochin , india.table 1composition of standard diets . no.ingredientscomposition ( g/100 g diet)1carbohydrate ( nitrogen free)56.22crude protein22.03ash7.54crude oil4.25crude fiber3.06glucose2.57vitamins1.88sand silica1.49calcium0.810phosphorus0.6 composition of standard diet seven days after acclimatization , the animals were divided into two major groups : group i consisted of 18 normal young rats and group ii consisted of 18 normal aged rats . each group was further subdivided into three groups ( six rats each ) : one control group ( group ia and group iia ) and two experimental groups based on the duration of supplementation of chitosan at 2 % level along with feed 30 days ( group ib and group iib ) and 60 days ( group ic and group iic ) . at the end of the experimental period , the animals were sacrificed , and the blood was collected in a heparinized tube for the separation of plasma . the heart tissue was excised immediately and homogenized in ice - cold 0.1-m tris hcl buffer in a potter the homogenate was used for the estimation of lipid peroxides ( lpo ; ohkawa et al . 1979 ) , reduced glutathione ( gsh ; ellman 1959 ) , glutathione reductase ( gr ; stall et al . high - density lipoprotein - cholesterol ( hdl - cholesterol ) in plasma was determined by the method of izzo et al . ( 1981 ) , and low - density lipoprotein - cholesterol ( ldl - cholesterol ) was estimated according to the calculation of friedwald et al . ( 1974 ) after extracting total lipids according to the method of folch et al . multiple comparisons of the significant anova were performed by duncan 's multiple range comparison test . a p value < 0.05 was considered as statistically significant . all data were analyzed with the aid of statistical package program spss 12.0 for windows .", "reduced glutathione , tetraethoxypropane , and 2-thiobarbituric acid were procured from m / s sigma chemical company , st . chitosan ( mw , 750,000 da ; viscosity , 8 cp ; deacetylation rate , 8587 % ; purity , 98.6 % ) used in the experiment was a kind gift from dr . t. k. thankkappan , principal scientist , central institute of fisheries technology , cochin , india .", "male wistar strain albino rats , weighing 120150 g [ 18 young rats of 23 months old ( mean age , 79.2 6.53 days ) ] and 350400 g [ 18 aged rats of 2025 months old ( mean age , 712 51.6 days ) ] , were selected for the study . the animals were housed individually in polypropylene cages under hygienic and standard environmental conditions ( 28 2 c ; humidity , 6070 % ; 12 h light / dark cycle ) . the animals were allowed a standard diet ( m / s sai foods , bangalore , india ; table 1 ) and water ad libitum . the experiment was carried out according to guidelines of the committee for the purpose of control and supervision of experiments on animals , new delhi , india , and approved by the institutional animal ethics committee of the central institute of fisheries technology , cochin , india.table 1composition of standard diets . no.ingredientscomposition ( g/100 g diet)1carbohydrate ( nitrogen free)56.22crude protein22.03ash7.54crude oil4.25crude fiber3.06glucose2.57vitamins1.88sand silica1.49calcium0.810phosphorus0.6 composition of standard diet", "seven days after acclimatization , the animals were divided into two major groups : group i consisted of 18 normal young rats and group ii consisted of 18 normal aged rats . each group was further subdivided into three groups ( six rats each ) : one control group ( group ia and group iia ) and two experimental groups based on the duration of supplementation of chitosan at 2 % level along with feed 30 days ( group ib and group iib ) and 60 days ( group ic and group iic ) . at the end of the experimental period , the animals were sacrificed , and the blood was collected in a heparinized tube for the separation of plasma . the heart tissue was excised immediately and homogenized in ice - cold 0.1-m tris hcl buffer in a potter the homogenate was used for the estimation of lipid peroxides ( lpo ; ohkawa et al . 1979 ) , reduced glutathione ( gsh ; ellman 1959 ) , glutathione reductase ( gr ; stall et al . 1969 ) , and glutathione peroxidase ( gpx ; paglia and valentine 1967 ) . high - density lipoprotein - cholesterol ( hdl - cholesterol ) in plasma was determined by the method of izzo et al . ( 1981 ) , and low - density lipoprotein - cholesterol ( ldl - cholesterol ) was estimated according to the calculation of friedwald et al . ( 1974 ) after extracting total lipids according to the method of folch et al .", "multiple comparisons of the significant anova were performed by duncan 's multiple range comparison test . a p value < 0.05 was considered as statistically significant . all data were analyzed with the aid of statistical package program spss 12.0 for windows .", "significant ( p < 0.05 ) variation was observed in the body weight ( grams ) of young ( initial , 129 9.05 ; final , 249 18.3 ) and aged ( initial , 382 27.2 ; final , 336 23.1 ) chitosan - supplemented groups of rats . the significant ( p < 0.05 ) loss observed in the body weight of chitosan - supplemented aged animals might be related to the fibrous nature of chitosan . interestingly , the total food intake ( grams per 60 days ) of aged chitosan - supplemented rats ( 904 78.4 ) was comparable to that of young rats ( 745 59.5 ) . level of total cholesterol was significantly ( p < 0.05 ) higher in plasma and heart tissue of group iia aged rats as compared to group ia young control rats , indicating the development of mild age - associated hypercholesterolemic condition ( tables 2 and 3 ) . the level of ldl - cholesterol was slightly ( p < 0.05 ) higher in group iia aged rats , whereas hdl - cholesterol levels were significantly lower compared to group ia young animals ( table 2 ) . this aspect might be due to the augmented mobilization of ldl - cholesterol from the blood into the cell membranes , resulting in abnormal cholesterol deposition in the myocardium . in the present study , the dietary supplementation with chitosan significantly reduced the total cholesterol level in plasma and myocardial tissue of group iic aged rats as compared to group iia rats . it also kept the levels of ldl - cholesterol and hdl - cholesterol in plasma comparable to that of group ic rats . 2009 ) , which showed that the positively charged amino groups of chitosan possess the ability to bind negatively charged molecules such as lipids and bile acids , inducing a greater fractional excretion in the feces . also ( 2007 ) suggested that chitosan improve lipid metabolism by regulating total cholesterol and ldl - cholesterol by upregulation of hepatic ldl receptor mrna expression , increasing the excretion of fecal bile acids . previous studies ( yao and chiang 2002 ) pointed out that chitosan supplementation was capable of lowering the levels of plasma total cholesterol and ldl - cholesterol in experimental animals . in the present study , a slight decline in the level of total cholesterol and ldl - cholesterol were also noted in group ic chitosan - fed young rats , ascertaining the anticholesterolemic property of chitosan ( ylitalo et al . 2002).table 2effect of dietary chitosan supplementation on total cholesterol , hdl - cholesterol , and ldl - cholesterol in plasma of young and aged ratsparametersyoung ratsaged ratsgroup ia ( control)group ib ( 30 days)group ic ( 60 days)group iia ( control)group iib ( 30 days)group iic ( 60 days)total cholesterol79.9 5.36 a , b76.2 4.98 a , b73.1 5.07 a98.4 9.12 c91.7 8.56 c87.3 8.21 b , chdl - cholesterol42.2 3.11 a , b , c44.9 3.48 b , c47.5 3.29 c33.2 2.68 d36.4 2.56 a39.7 3.74 a , bldl - cholesterol24.3 1.42 a22.7 1.31 a , b20.3 1.18 b48.4 2.72 c43.1 2.14 d38.3 2.27 eresults are mean sd for six rats . values expressed : total cholesterol , hdl - cholesterol , and ldl - cholesterol , milligrams per deciliter . values that have a different letter ( a , b , c , d , e , f ) differ significantly with each other ( p < 0.05 ; duncan 's multiple range test)table 3effect of dietary chitosan supplementation on the levels of total cholesterol , lipid peroxides , and reduced glutathione ( gsh ) and the activities of glutathione - dependent antioxidant enzymes [ glutathione peroxidase ( gpx ) and glutathione reductase ( gr ) ] in the heart tissue of young and aged ratsparametersyoung ratsaged ratsgroup ia ( control)group ib ( 30 days)group ic ( 60 days)group iia ( control)group iib ( 30 days)group iic ( 60 days)total cholesterol2.72 0.17 a , b2.56 0.14 a2.43 0.16 a3.68 0.32 c3.29 0.21 d3.04 0.25 b , dlipid peroxides1.08 0.07 a0.98 0.06 a0.97 0.07 a2.58 0.14 b1.96 0.09 c1.54 0.11 dgsh10.9 0.84 a12.3 1.02 a , b14.5 1.17 c7.54 0.61 d8.76 0.69 d , e9.52 0.85 a , egpx5.23 0.35 a5.51 0.41 a , b5.98 0.37 b3.12 0.18 c4.05 0.26 d4.56 0.34 dgr0.43 0.02 a0.52 0.04 b0.58 0.03 c0.22 0.01 d0.29 0.03 e0.36 0.02 fresults are mean sd for six animals . values expressed : total cholesterol , milligrams per gram wet tissue ; lipid peroxides , nanomoles mda released per milligram protein ; gsh , micrograms per milligram protein ; gpx , micrograms gsh oxidized per minute per milligram protein ; gr , nanomoles nadph oxidized per minute per milligram protein . values that have a different letter ( a , b , c , d , e , f ) differ significantly with each other ( p < 0.05 ; duncan 's multiple range test ) effect of dietary chitosan supplementation on total cholesterol , hdl - cholesterol , and ldl - cholesterol in plasma of young and aged rats results are mean sd for six rats . values expressed : total cholesterol , hdl - cholesterol , and ldl - cholesterol , milligrams per deciliter . values that have a different letter ( a , b , c , d , e , f ) differ significantly with each other ( p < 0.05 ; duncan 's multiple range test ) effect of dietary chitosan supplementation on the levels of total cholesterol , lipid peroxides , and reduced glutathione ( gsh ) and the activities of glutathione - dependent antioxidant enzymes [ glutathione peroxidase ( gpx ) and glutathione reductase ( gr ) ] in the heart tissue of young and aged rats results are mean sd for six animals . values expressed : total cholesterol , milligrams per gram wet tissue ; lipid peroxides , nanomoles mda released per milligram protein ; gsh , micrograms per milligram protein ; gpx , micrograms gsh oxidized per minute per milligram protein ; gr , nanomoles nadph oxidized per minute per milligram protein . values that have a different letter ( a , b , c , d , e , f ) differ significantly with each other ( p < 0.05 ; duncan 's multiple range test ) sumiyoshi and kimura ( 2006 ) suggested that the lipid - lowering effects of chitosan might be mediated by increases in fecal fat and/or bile acid excretion resulting from the binding of bile acids , and by a decrease in the absorption of dietary cholesterol from the small intestine . ( 2009 ) have shown that normal intestinal microbiota might also positively influence immune responses and protect against the development of inflammatory diseases systemically through the formation of short - chain fatty acids by fermentation of dietary fiber in the intestine . chitosan , a biopolymer of glucosamine derived from chitin that is chemically similar to that of cellulose , acts as a dietary fiber in gastrointestinal tract ( gallaher et al . it is possible that chitosan may function through the generation of gut metabolites , such as short - chain fatty acids / short - chain oligosaccharides , in attenuating the development of inflammatory processes related to aging . in the present study , there was a significant ( p < 0.05 ) increase in the level of lipid peroxidation observed with a concomitant reduction in the level of nonenzymatic ( gsh ) and enzymatic ( gpx and gr ) antioxidants in the heart tissue of group iia aged rats as compared to group ia young control animals ( table 3 ) . this concurs with the earlier findings ( subramanian and james 2010 ) , which indicated that the higher vulnerability of aged myocardium to peroxidative damage was mainly due to a decline in the level of free radical scavengers . depletion of gsh results in enhanced lipid peroxidation , and excessive lipid peroxidation can cause increased gsh consumption during aging ( denniss et al . the reduction in the activity of gpx and gr may be due to the reduced availability of gsh . gpx offers protection to the cellular and subcellular membranes from the peroxidative damage by eliminating hydrogen peroxide and lipid peroxide ( li et al . inhibition of gsh - dependent antioxidant enzymes makes myocardial cell membranes more susceptible to oxidative damage in aging . gsh and gsh - dependent enzyme systems may be directly related to the pathogenic mechanisms related to age - associated disorders ( goncharova et al . 2007 ) . in our study , the dietary chitosan intake significantly attenuated the age - associated oxidative stress and maintained the level of the glutathione - dependent antioxidant status in the heart tissue at near normal . ( 2003 ) have shown that chitosan has strong antioxidative effects , which decrease free radical production and increase antioxidant enzyme activities during ccl4-induced lipid peroxidation in rats . ( 2004 ) have suggested that chitosan may eliminate various free radicals by the action of nitrogen on the c-2 position of the chitosan . ( 2001 ) reported that the scavenging mechanism of chitosan is related to the fact that the free radicals can react with the hydrogen ion from the ammonium ions to form a stable molecule . the normal young rats receiving chitosan ( group ic ) did not show any significant change when compared with normal ( group ia ) rats , indicating that it does not per se have any adverse effects . in conclusion , the overall antiaging effect of dietary chitosan intake is probably related to its ability to inhibit the increased accumulation of lipids both in the systemic circulation and in the myocardium by its antilipidemic property , or to normal maintenance of the activities of glutathione - dependent antioxidant enzymes and the level of gsh , which protect myocardial membrane against oxidative stress by decreasing lipid peroxidation reactions ." ]

[ "cleft lip and palate ( clp ) patients are going through an extensive treatment with \n orthodontic and surgical correction of the position of teeth and hard and soft \n tissues . the aim of the primary surgery is to close the clefts of the lip and the \n soft palate . the aim of the secondary surgery is to close the cleft of the alveolus \n by bone grafting . surgery of the clefts induces formation of scar tissue , which \n affects the soft tissue matrix that guides the development of the maxillary complex . \n the scar tissue as well as a reduced growth of the mid face often causes a maxillary \n retrognatism , that adversely affects the chewing function , the ability to speak , the \n facial aesthetics , social life as well as psychological and general \n wellbeing of the clp - patients . for that \n reason , between 25 to 60% of the clp - patients need a surgical treatment of the \n maxillary retrognatism . this \n surgical - orthodontic treatment is the last part of the rehabilitation of the \n clp - patient , which has the objective to create a good dental occlusion and function , \n more harmonic facial aesthetics and increase the quality of life . since the \n 1970 's the standard treatment of clp - patients with a maxillary hypoplasia has \n been a le fort i osteotomy with a bone graft . treating extensive sagittal discrepancies maxillary surgery has to \n be combined with mandibular set - back . maxillary surgery is difficult in clp - patients \n because of the scar tissue , a tendency to relapse , poor bone quality and quantity \n and a reduced blood supply in the affected area . these conditions are responsible for a typical relapse of 20 - 25% \n . to compensate for this an overcorrection is often made during the \n surgical procedure , which can lead to an \n unpredictable final result . polley and figueroa described the use of \n distraction osteogenesis ( do ) as an alternative treatment of maxillary hypoplasia \n using an external bone distraction device . the principle of this treatment was to \n induce formation of immature bone in the gap after a le fort i osteotomy by gradual \n tensile strength separating the two segments . studies of the treatment have shown a significantly reduced \n tendency of relapse , favourable changes \n of the soft tissue and changes of the \n velopharyngeal closure similar to that of conventional advancement . the duration of the course of treatment is up to 16 weeks longer when choosing do . in \n this period the appliance penetrates the buccal mucosa in the sulcus and the patient \n must take care of the daily activation and keep it clean . the aim of this retrospective pilot study was to examine and compare the cleft lip \n and palate patients ' satisfaction after treatment with either maxillary distraction \n or traditional advancement of the maxilla after a le fort i osteotomy .", "in the period 1996 - 2007 forty - two clp - patients with need for advancement of the \n maxilla were surgically treated at the department of oral and maxillofacial surgery , \n aarhus university hospital by either traditional advancement of the maxilla or \n distraction osteogenesis . until 2000 the standard regime of treatment was a \n traditional advancement of the maxillary complex after le fort i osteotomy . since \n 2000 maxillary distraction has provided an alternative in treatment of clp - patients \n requiring a maxillary advancement of 10 mm or more . consequently , the patients in \n this study consisted of two groups of clp - patients with the need for \n surgical - orthodontic correction of maxillary hypoplasia . a criterion for both groups \n was that the postsurgical orthodontics had to be finished if the patient was to be \n included in the study . conventional group ( conv ) included patients treated with \n traditional advancement of the maxilla after a le fort i osteotomy in the period \n 1996 - 2007 . the group do included patients treated with maxillary distraction table 1 . patients ' characteristics according to gender , type of cleft , type \n of surgery performed , type of distractors used and age at surgery unsegmented le fort i osteotomy and internal distraction . unsegmented le fort i osteotomy and external distraction . m = male ; f = female ; uclp = unilateral cleft lip and palate ; bclp = \n bilateral cleft lip and palate ; cl . fifteen patients met the inclusion criteria in the do group and ten patients in the \n conv group . the composition of the two groups according to gender , type of cleft , \n type of distraction , type of distractors used , age at surgery and type of surgery \n performed is presented in table 1 . group do consisted of 10 males and 5 females with \n a mean age at the time of surgery of 17.5 ( sd 2.3 ) years while group conv consisted \n of 5 males and 5 females with a mean age at the time of surgery of 17.8 ( sd 2.6 ) \n years . a quantitative method , a questionnaire , existing literature was reviewed and a list of \n relevant subjects was made and operationalized in a questionnaire containing 13 \n questions about the patients ' perception of aesthetics and function . the patients were asked to answer by making a mark on a vas - scale scaled 0 - 100 \n . the score 0 indicating the highest \n level of satisfaction with functional parameters or facial aesthetics and the score \n 100 indicating the lowest level of satisfaction . the end points of the scales were \n unequivocal and easy to understand , for example no pain / intolerable pain ; very \n satisfied / very unsatisfied ; no discomfort / worst imaginable discomfort . the \n accompanying letter contained information about the aim of the study and how to \n answer . the patients were asked to return the questionnaire by pre - paid mail after \n two weeks . the study was approved \n by the central denmark region committees on biomedical research ethics . all patients had presurgical orthodontic treatment and were treated surgically with a \n high le fort i osteotomy . in the conv group the treatment was a conventional \n combined orthodontic - surgical treatment with model surgery and splint fabrication \n for the maxillary position and completed with postsurgical orthodontics . the \n patients in the conv group had an average advancement of 6.98 mm ( range 5 - 11 mm ) . \n patients from the do group had the distraction device placed in pre - planned position \n calculated from lateral cephalograms and adjusted on a three - dimensional print of \n the skull based on a computed tomography ( ct ) or a cone beam ct ( cbct ) . the appliances used for distraction were synthes internal distractor ( synthes , west \n chester , pa , usa ) , kls martin internal distractor ( kls martin group , tuttlingen , \n germany ) and rigid external device ( red ) kls martin ( kls martin group , tuttlingen , \n germany ) for the external distraction procedures ( table 1 ) . all the patients treated with distraction were registered for model surgery using the \n same procedure as for the conventional treated patients using face bow registration , \n wax bite and articulator mounting . the patients had surgical splints fabricated and \n in the cases of do the splint was used as a guide for using intermaxillary elastics \n after the active distraction . the maxilla was thereby manipulated into the final \n planned position . in five of the do patients the palatal defect caused an unstable \n intersegmental position . the use of the splint was refrained from and intermaxillary \n elastics were used to guide the segments into occlusion . during the surgical procedure the internal distraction devices were adapted to the \n maxilla in the planned position . the screw holes were marked and the devices were \n removed in order to complete the le fort i osteotomy . after ensuring mobility of the \n maxilla the devices were fixed to the maxilla and tested for interference free \n activation . the mean latency period after device placement was 4.9 days ( range 4 - 7 days ) . \n during the active phase of distraction the appliances were activated on a daily \n basis either by the patient or an assistant , usually a family member . activation was \n done twice a day with a rate of 0.5 mm , corresponding to 1.0 mm daily . activation \n went on until the planned position of the maxilla was achieved and intermaxillary \n elastics were then used to adjust the final position . the mean periodof active \n distraction was 17.7 days ( range 13 - 28 days ) and the mean advancement of the \n maxilla was 12 mm ( range 6 - 16 mm ) . after an average consolidation period of 77.3 \n days ( range 35 - 213 days ) , the patients were readmitted and the devices removed in \n general anaesthesia . the treatment was a conventional combined orthodontic - surgical treatment with \n model surgery and splint fabrication for the maxillary position and completed with \n postsurgical orthodontics . unpaired t - tests were performed to analyse intergroup differences regarding duration \n of orthodontic treatment and vas - scores in spss 18.0 ( ibm , usa ) . statistical \n significance was defined as p < 0.05 .", "the duration of the orthodontic treatment was in average 10 months longer in the do \n group than the conv group and this difference was significant ( p < 0.05 ) . neither \n the age distribution nor the period of time between surgery and completion of the \n questionnaire differed significantly ( p < 0.05 ) table 2 . distribution of the patients ' groups according to gender , age at \n surgery and period between surgery and completion of the \n questionnaire after the primary surgery with insertion of the \n distractors . after the surgical procedure . unpaired t - test , states p < 0.05 between patients of do \n and conv groups . nineteen out of 25 patients returned the questionnaires and the total response ratio \n was 76% . results of the patients ' satisfaction on a continuous visual \n analog - scale ( vas ) on a vas - scale scaled 0 - 100 with the score 0 indicating the \n highest level of satisfaction with functional parameters or facial \n aesthetics and the score 100 indicating the lowest level of \n satisfaction . both groups felt a great deal of satisfaction with their appearance both according to \n themselves and the perceptions of relatives and other people 's reaction in \n general . both groups were satisfied with their general well being and felt few \n restrictions or discomfort during social activities . according to functional \n parameters the groups were alike . both groups were minimally affected by pain and \n sensory disturbances and reported a great deal of satisfaction with speech and \n breathing . the discomfort during eating and drinking and sleep were low as well in \n both groups . the greatest difference occurred in the parameter satisfaction with the \n duration of the treatment course . the do group scored higher on the vas - scale \n according to less satisfaction with the duration than the conv group . statistical \n analyses revealed no significant differences ( p > 0.05 ) among the groups which \n may be explained by the numbers of patients included in the study .", "distraction osteogenesis has become a widely used treatment of maxillary hypoplasia \n in clp - patients because of the reports of better stability and the possibility for \n larger advancements . however , it is a more complicated treatment because of the \n period with active distraction , the obligate need for good cooperation and the long \n consolidation phase with the patient still wearing the appliance . the present study \n is a pilot study and evaluates retrospectively patients ' satisfaction in two groups \n of clp - patients treated for maxillary hypoplasia with either maxillary distraction \n or conventional le fort i advancement . the number of patients was limited and \n especially the conv group was small and the number of patients responding was lower \n than in the do group . the results indicated a high level of satisfaction with the facial aesthetic at the \n end of treatment in both the do and the conv group . the parameters pain and sensory \n disturbances did not differ a lot between the groups in this study . it could be \n hypothesized that more extensive osteotomies and preoperative advancements in conv \n could induced more sensory disturbances and pain compared with a gradual movement \n and distraction histogenesis of soft tissues when using do . the groups had comparable scores according to the functional parameters eating and \n drinking , sleep , speech and breathing . do was significantly less satisfied with the \n duration of the treatment than conv probably according to a longer duration of the \n orthodontic treatment . the influence of the period with the distractors mounted on \n the level of satisfaction was not measured but it can be hypothesized that this \n period is troublesome . further studies of this period between mounting and removal \n is needed as the prolonged total treatment time is a disadvantage and perhaps the \n most important difference when choosing do instead of conventional treatment . a \n greater understanding of the cellular processes during the period of distraction and \n the period of consolidation and possibility to accelerate the genesis and maturation \n of bone by the use of pharmacological agents could reduce the duration of these \n periods . by a reduction of the duration of these aforementioned periods the \n probable inconveniences could be reduced and possibly of a greater patients ' \n satisfaction and lesser discomfort could be achieved . another way to reduce the \n strain on the do patients would be the continuous development of the distractors , \n e.g. reduction in size , partly removable appliances , continuous activation etc . \n . patients ' satisfaction in association with distraction is a subject sparsely \n examined in the existing literature . no studies describes patients ' satisfaction \n during internal distraction while only a single retrospective survey with a quite \n small population has studied patients ' satisfaction during external distraction . concluded that most of \n the patients receiving red treatment had an increased satisfaction with facial \n aesthetics after the treatment than before the treatment in spite of a great deal of \n dissatisfaction with the facial aesthetics during the course of treatment . a long term study of patients ' perception of function and satisfaction showed that \n orthognathic surgery resulted in a subjective estimation of function , appearance , \n health , and interpersonal relationships that was higher than that among pretreatment \n and no - treatment control groups . a newly \n prospective study of patients receiving orthognathic surgery showed that perception \n of function and general satisfaction significantly increased after orthognathic \n surgery and that the parameters were positive correlated . this study also showed a general high level of \n satisfaction with appearance and functional parameters in clp - patients treated with \n either do or conventional treatment . the retrospective design of this survey and the two years between the operation and \n the completion of the questionnaire diminished the reliability of the patients ' \n answers . the use of a questionnaires cause problems with the internal validity , \n because the questionnaire is designed with a limited amount of topics , that might \n not all be the most valid according to every single patient but representing a \n selection bias . further use of this questionnaire necessitates a validation . instead \n a validated questionnaire , for instance the oral health impact profile or \n orthognathic quality of life questionnaire can be used in further studies . prospective surveys should \n be based on a validated questionnaire and include the period between mounting and \n removal of the distractors . a comparative study of patients ' satisfaction during \n three different courses of treatment , traditional advancement , external distraction \n and internal distraction , could probably lead to a greater understanding of this \n important subject .", "1 . cleft lip and palate patients experience a high level of satisfaction with \n functional parameters and aesthetics after surgical - orthodontic treatment of \n maxillary hypoplasia . patients treated with distraction osteogenesis were less satisfied with the \n duration of their treatment than the conventional group .", "no external \n funding , apart from the support of the authors ' institution , was available for \n this study ." ]

[ "a rising trend in the incidence and prevalence of inflammatory bowel disease ( ibd ) in asia has been recognized for the past two decades . the thiopurine drugs azathioprine ( aza ) and mercaptopurine are widely used for the treatment of ibd and have proven to be effective in both inducing and maintaining remission of crohn 's disease and ulcerative colitis ; however adverse effects can occur in 928% of patients , and these adverse effects often necessitate a dose reduction or discontinuation . nevertheless , some reports suggested that neutropenia during aza therapy reduced the relapse rates in ibd patients [ 1 , 2 ] , and that the eradication of sensitized leukocytes , which was done by leukapheresis or bone marrow transplantation , improved ibd in some cases [ 3 , 4 ] . there have also been some cases of ulcerative colitis with prolonged remission following aza - induced pancytopenia [ 5 , 6 ] .", "a 22-year - old man with a known history of crohn 's colitis who had undergone fistulectomy for complex perianal fistula 2 years previously was admitted with a complaint of severe weight loss ( 25 kg during 2 years ) , diarrhea , abdominal pain and recurrent perianal tenderness . physical exam revealed fistular openings and subcutaneous abscess pockets with severe tenderness on the anus and buttock . he was not able to maintain a sitting or supine position , so his social activity was limited . contrast - enhanced computed tomography scan of the abdomen showed multifocal inflammatory wall thickening and thick - walled abscess pockets with the beaded appearance of subcutaneous small abscesses in the precoccygeal and perianal area ( fig . abscess drainage and a seton operation were performed , then aza was administered at a starting dose of 25 mg ; this was increased up to 50 mg after 2 weeks . he then revisited the hospital and presented with high fever ( 39.2c ) and myalgia . on general peripheral blood test , leukocytes were 180/l ( segmented cells 6% ) , hemoglobin was 6.6 g / dl and platelets were 48,000/l . after 2 weeks of administering human recombinant granulocyte colony - stimulating factor and broad - spectrum antibiotic therapy , his fever subsided and the cell count fully recovered . escherichia coli was found on blood culture , but it was sensitive to the antibiotics . after recovering from cytopenia , the frequency of bowel movements decreased and the perianal pain and oozing improved gradually . follow - up colonoscopy was performed 3 months later and demonstrated diffuse fibrotic scar instead of multiple ulcerations ( fig . he gained 10 kg within 6 months and is now on regular follow - up without clinical recurrence ( cdai score = 114 ) .", "therefore , a conventional immunosuppressive dose of less than 2.5 mg / kg / day causes predictable mild leukopenia . rarely however , sudden , severe and unexpected myelosuppression , which is possibly idiosyncratic , has also been reported when low to moderate doses ( < 2 mg / kg / day ) of the drug were used . in these cases , the cytopenic patients are vulnerable to the development of sepsis that necessitates hospital admission for intensive care . however , the preferential suppression of neutrophils develops when leukopenia occurs , which suggests that aza 's antiinflammatory effects are mediated through its effects on neutrophils as well . in fact , clinical relapse of ibd is characterized by increased neutrophil migration into the intestine . . moreover , some reports have described cases of ulcerative colitis with prolonged remission following pancytopenia . burke et al . reported prolonged remission in excess of 4 years following induced pancytopenia , where 3 of the 4 patients who developed severe neutropenia remained in remission for up to 21 months following that episode . first , given that altered host immunity plays an important role in ibd activity , it is possible that this patient 's host immunity was reset following the pancytopenia caused by aza . according to one report that analyzed the course of patients with crohn 's disease and ulcerative colitis and who underwent allogeneic stem cell transplantation for myeloid leukemia and myelodysplastic syndrome , 10 of 11 patients showed no ibd activity after stem cell transplantation , and the colonoscopy after complete discontinuation of prophylactic posttransplant immunosuppression revealed no pathologic findings . second , the possible benefit of granulocyte macrophage colony - stimulating factor ( gm - csf ) can be hypothesized . dieckgraefe and korzenik investigated the safety and possible benefit of gm - csf for the treatment of 15 patients with moderate to severe crohn 's disease . third , the original bowel flora is temporarily altered after total gut decontamination and long - term antibacterial treatment . therefore , the most likely theory seems to be the modification of a genetically determined immune abnormality that is responsible for the chronic intestinal inflammation by the reset of the immune system or modification of an altered microbial environment . however , it is unclear whether this mechanism can affect the long - term clinical course . some studies have reported that tpmt genotype or activity does not predict the development of aza - induced myelotoxicity . on the other hand , some reports have suggested a substantial correlation between low enzyme activity and the development of myelotoxicity [ 13 , 14 ] . reported that assessment of the tpmt genotype or activity can reduce the risk of myelotoxicity in approximately one - third of patients . in our case , the tpmt was the wild type and this result raised doubts whether tpmt can be a reasonable screening test to identify patients with a high risk of severe myelotoxicity due to an inherited deficiency of tpmt activity . in conclusion , we report here a patient who had crohn 's colitis and complicated perianal fistulas that required immunosuppression , and who achieved endoscopically determined remission that showed accelerated mucosal healing as well as clinical remission after aza - induced pancytopenia ." ]

[ "diabetic macular edema ( dme ) is a common complication of diabetic retinopathy ( dr ) and a leading cause of visual loss in this population [ 1 , 2 ] . major components of dme are retinal microvascular dysfunction and blood - retinal barrier ( brb ) breakdown with consequent increase in vascular permeability that allows plasma compounds to leak into the retina [ 35 ] . there is evidence that upregulation of angiogenic and inflammatory factors , including vascular endothelial growth factor ( vegf ) , and downregulation of antiangiogenic factors as well as redox shift contribute to the breakdown of the brb in dr [ 510 ] . oxidative stress and inflammation also play an important role in the pathogenesis of dr and dme . vegf causes conformational changes in the tight junctions of the retinal vascular endothelial cells and plays a major role in the increased vascular permeability and brb breakdown in diabetic eyes [ 5 , 7 , 11 , 12 ] . vitreous vegf levels correlate significantly with the severity of dr , but dme can occur in nonproliferative dr ( npdr ) as well as proliferative dr ( pdr ) . interventional studies on ranibizumab , a monoclonal antibody against vegf , have shown that intraocular injections of ranibizumab significantly reduce foveal thickness and improve visual acuity in patients with dme [ 14 , 15 ] . however , the conclusions of the studies were not based on the comparison of the real intravitreal concentration of vegf with the foveal thickness in oct ; they only asses the retinal thickness before and after therapy . in our earlier study , we found that also the intravitreal uric acid ( ua ) concentrations correlated significantly with degree of dr . we suspect that ua may play a role in the pathogenesis of dr and dme : studies of ua strongly suggest that its redox potential affects endothelial function and might contribute to the brb breakdown . the correlation of intravitreal ua with vegf in npdr and dme has not been studied yet . optical coherence tomography ( oct ) has enabled clinicians to noninvasively evaluate the effect of dr on retinal thickness in a standard clinical setting [ 18 , 19 ] . however , there are very limited data on how oct parameters in dme correlate with vitreous levels of vegf and other biochemical parameters . the aim of our study was to analyse the vitreous and serum of diabetic patients with dme and severe npdr and compare them to nondiabetic controls . the analysis focused on vegf and ua as two possible pathogenetic factors in the development of dme . we compared blood and vitreous levels of vegf , ua , and protein between the two study groups and describe their correlation with the changes seen in oct .", "first group involved 16 subjects with type 2 diabetes mellitus ( dm ) with npdr and cystoid dme . in this group , the mean duration of dm was 18.6 8.3 years and 15 patients ( 93.75% ) were treated with insulin and 1 patient ( 6.25% ) was treated with peroral antidiabetics . a group of 13 nondiabetic subjects with idiopathic epiretinal membrane and diffuse retinal thickening served as control . dm duration was defined as the duration from the first diagnosis of dm to the time of vitreous sampling . all patients underwent a standard ophthalmologic examination including measurement of best corrected visual acuity , slit - lamp biomicroscopy , indirect ophthalmoscopy , and oct . the retinopathy was graded according to the early treatment diabetic retinopathy study research group and patients enrolled in the study had moderate to severe nonproliferative dr ( npdr ) . the center involving dme was defined clinically and confirmed by retinal thickening in cross - sectional spectral domain ( sd ) oct scans . the indications for vitrectomy in this study were macular edema and preoperative best corrected visual acuity ( bcva ) more than 0.3 logmar ( logarithm of the minimum angle of resolution ) and in the diabetic group no or poor response to previous therapy with photocoagulation or intravitreal injection . exclusion criteria were as follows : ( a ) history of intraocular haemorrhage , ( b ) prior vitreoretinal surgery , ( c ) other ocular surgeries or laser coagulation less than 6 months prior to the operation , ( d ) history of ocular inflammation , ( e ) proliferative dr or other retinal conditions causing neovascularisation , ( f ) ophthalmic disorders associated with macular edema , and ( g ) treatment with intravitreal anti - vegf or steroid injections ( e.g. , triamcinolone , dexamethasone , bevacizumab , ranibizumab , and aflibercept ) less than 6 months prior to the operation . at the time of the study , all patients were in a stable clinical condition without clinical or laboratory signs of acute inflammation . the research was approved by the local institutional ethics committee , faculty of medicine and dentistry , palacky university olomouc , czech republic . data and sample collection was independent of all treatment decisions . it did not affect a patient 's access to treatment and fully complied with all ethical and legal requirements for noninterventional data collection in the czech republic . all patients gave written informed consent to the treatment , as well as data collection . the reported investigations were in accordance with the principles of the current version of the declaration of helsinki . oct examinations were performed one day before vitrectomy with spectral domain oct ( cirrus hd - oct , carl zeiss meditec ag , jena , germany ) using macular cube acquisition according to the manufacturer 's protocol . the macular cube 512 128 scan consists of 128 raster scans with 512 a - scans , within a 6 6 mm macular area . the mean central retinal thickness ( crt , i.e. , central subfield thickness ) from the internal limiting membrane to the retinal pigment epithelium at the fovea was defined as the mean retinal thickness in a 1 mm diameter circular zone concentred on the fovea . also cube volume ( cv ) and cube average thickness ( cat ) of the scanned area were calculated by cirrus hd - oct software and checked for accuracy . the cv is calculated from the 1 mm diameter zone and cat from the central 6 mm diameter zone concentred on the fovea . based on previous studies that evaluated morphological changes in dme [ 22 , 23 ] , the central scan through the fovea was assessed for the presence of intraretinal cysts and serous retinal detachment ( srd ) by an independent examiner . vitrectomy was performed to improve visual acuity and to decrease retinal thickness in the macula . each patient underwent standard three - port therapeutic pars plana vitrectomy using current surgical techniques ( the alcon constellation vision system ) . before opening the infusion port at the start of the vitrectomy , undiluted vitreous samples were obtained and collected in sterile tubes ( cca . 0.3 ml ) . overnight fasting blood samples were drawn from the antecubital vein at the time of vitrectomy and used for biochemical assay . the concentration of ua was estimated using enzymatic methods ( uricase - peroxidase ) with photometric detection ( modular , roche , germany ) . hba1c was measured by high performance liquid chromatography and calibration was traced to the reference method of the international federation of clinical chemistry ( variant ii , bio - rad ; http://www.bio-rad.com/ ) . the concentration of vegf was quantified by enzyme linked immunosorbent assay ( elisa ) using a commercial human vegf kit ( r and d systems , minneapolis , mn , usa ) according to the manufacturer 's protocol . the limits of quantification for vegf were min = 31.2 pg / ml and max = 1000 pg / ml , respectively . we calculated the median with 1st and 3rd quartile ( iqr , interquartile range ) . in 16 subjects , the intravitreal vegf and in 3 subjects the intravitreal ua concentration were under the detection limit ; these subjects were included in the statistical analysis to avoid selection bias . hence , we used the nonparametric analysis for ordinal variables , and the concentrations under the detection limit were assigned the comparison between dme group and control group was done by mann - whitney u test and fisher 's exact test .", "biochemical analysis of the vitreous showed significant differences between dm and control group in the concentration of vegf , ua , and total protein but not albumin as shown in table 2 and figures 13 . in all nondiabetic control subjects , the concentration of vegf in vitreous was under the detection limit of 31.2 pg / ml . in the diabetic group , ua concentration in vitreous correlated significantly with vitreous vegf concentration ( = 0.559 , p = 0.03 ) . however , in dme vitreous vegf and ua did not correlate with the total vitreous protein . further , in the control group , no significant correlation between the biochemical analytes in vitreous was found . figure 4 shows the relationship between vitreous vegf and vitreous ua of dme and control group . median of serum concentration of ua in diabetic patients was significantly elevated compared with the control group ( 337.0 mol / l , iqr : 324.0407.0 mol / l in dm group versus 259.5 mol / l , iqr : 220.0334.8 mol / l in control group ; p = 0.025 ) . also median concentration of vegf in serum of diabetic patients ( 414.3 pg / ml , iqr : 293.1512.0 pg / ml ) was higher than in controls ( 332.7 pg / ml , iqr : 149.4551.8 pg / ml ) , but the difference was not significant . there was a significant correlation between ua concentrations in serum and vitreous ( = 0.652 , p = 0.016 ) in the control group but not in dme . further , no significant correlation between concentrations of vegf in serum and vitreous was found in both groups . the median crt , cat , and cv did not differ significantly between both groups and are listed in table 3 . significant difference was found in presence of srd between the groups as shown in table 3 . in the diabetic group , there was a significant correlation between crt and cat ( = 0.589 , p = 0.016 ) . the crt of dm subjects also correlated significantly with the cv ( = 0.581 , p = 0.018 ) . however , the strongest correlation in the dm group was between cat and cv ( = 0.999 , p < 0.001 ) . the srd was found in the oct scans of 6 diabetic eyes , but its presence did not correlate with any of the other oct parameters . further , among all oct parameters , only cv correlated significantly with the concentration of vitreous vegf in the dm group ( = 0.515 , p = 0.041 ) . the crt , cat , cv , and srd show in dm and control subjects no significant correlation to vitreous concentrations of ua , albumin , or total protein . the correlation of logmar bcva with changes in oct parameters and vitreous content was also evaluated and we found it to be nonsignificant in both groups . there was also no correlation between oct parameters and serous concentrations of ua or vegf . the results demonstrate that biochemical analysis of the vitreous showed significant higher concentrations of vegf , ua , and total protein in dm and control group . moreover , in patients with dme intravitreal levels of ua correlate significantly with intravitreal levels of vegf . furthermore , we found that the cv measured with cirrus hd - oct correlate significantly with the concentration of vegf in the vitreous of patients with npdr and dme . in our earlier study , we showed that the levels of intravitreal ua correlated significantly with the degree of dr and recently also serum ua concentration has been found to be associated with increase in severity of dr . finding significant higher ua concentration in vitreous of dm compared to controls and a correlation between ua and vegf in the vitreous of npdr patients supports our assumption that ua too may be one contributing causal factor in the pathogenesis of dr . ua is a degradation product of metabolism and under normal conditions ua acts as an antioxidant . in diabetics , hyperglycaemia induces redox stress , which leads to consumption of the naturally occurring local antioxidants protecting capillary endothelium . this results in urate redox shuttle , meaning that ua paradoxically becomes prooxidant and contributes to endothelial dysfunction through oxidative - redox stress . johnson et al . showed that local ischemia results , via enzymatic activation , in increased ua production as well as oxidant formation . decreased total antioxidant status was shown to contribute to the progression of pdr via induction of vegf . on the other side , high ua concentration in the vitreous of diabetic patients the vegf - induced production of reactive oxygen species was attenuated by urate ; however , it did not modify the vegf - induced changes in permeability of monolayers . this could explain the correlation of ua and vegf in the vitreous of diabetic group found in the present study . it has to be elucidated whether ua is originating from leakage of retinal vessels , which is increased in dr , or from local production . although total vitreous protein was significantly higher in the diabetic group compared to controls , its level did not correlate with both ua and vegf . furthermore , in the diabetic subjects we found no correlation between serum and vitreous level of ua . however , to be able to distinguish the origin of increased ua in the vitreous , further analyses , for example , with tagged ua , should be done . since there was a correlation between vitreous ua and vegf but no correlation between vitreous ua and oct parameters , we conclude that ua has a probable relation with diabetic microangiopathy and accordingly dr but not directly with the development of dme . recent studies have shown that vegf causes conformational changes in the tight junctions of retinal vascular endothelial cells and plays a major role in the elevated vascular permeability in diabetic eyes with dme . it is well known that the vitreous vegf levels correlate significantly with the severity of dr [ 1113 , 28 ] . few authors have also found a significant correlation between retinal thickness at the fovea measured on oct and vegf concentrations in the vitreous [ 29 , 30 ] and aqueous . the association of vitreous vegf levels and dme morphology was studied by sonoda et al . and these authors showed no significant differences in vegf concentrations in cystoid versus diffuse aspect of dme . in the present study , there was no significant correlation between vitreous vegf levels and crt of diabetic patients . however , the results show that in dme increase in cv correlated with increased concentration of vegf in the vitreous . the retinal thickness at the central fovea in funatsu et al . was calculated as average foveal thickness from 4 manual measurements per patient . used the average thickness of the central area with 1000 m in diameter calculated by humphrey oct . defined the central macular thickness as the average thickness of the central 500 m in diameter . the mean crt in dme is widely accepted as the new surrogate marker for evaluating treatment efficacy . this is also because the changes in the fovea are deciding for the visual acuity . in our study , the crt , cat , and cv in both dm and control group did not correlate with the logmar bcva . there are also studies evaluating the effect of the anti - vegf therapy using both the mean foveal thickness and cv . on the other hand , since dme usually affects the macular area and not only the foveal region , assessment of vegf concentration in clinical practice using the cv is comprehensible . like us , sonoda et al . showed that there was no significant correlation between intravitreal vegf levels and the amount of subretinal fluid in dme . other studies have reported that eyes with serous retinal detachment often have a poor prognosis after treatment [ 22 , 36 ] . the strength of the study described here is that it determined the relationship between the levels of intravitreal biochemical parameters and retinal morphology at the same time . the limitation was the small sample size ( 29 eyes ) . this was caused by decreasing use of vitrectomy for dme and this curtailed collection of vitreous samples . although our vitrectomy for dme might be considered overtreatment , it was a comparatively effective method as it stabilized the intraocular condition of dme and the efficacy was maintained for a long period . in interpreting or generalizing our results , it should be remembered that the findings demonstrate association of vegf levels in the vitreous with the cube volume , but they do not prove cause and effect . further , the study was focused on vegf and ua ; however , the pathogenesis of the dme is complex and still not fully understood .", "vitreous concentrations of uric acid and vegf were significantly higher in dm subjects than in controls . moreover , vitreous ua concentration correlated significantly with the vitreous vegf concentrations in patients with npdr and cystoid dme . increased vegf concentrations are known to be involved in the pathogenesis of dme . our results suggest that , apart from vegf , the role of ua in the pathogenesis and progression of dr should also be considered . comparing oct parameters to the vitreous levels of ua and vegf , we found that increased concentration of intravitreal vegf in patients with npdr and cystoid dme correlated with increase of cube volume calculated by cirrus hd - oct . since dme usually affects the macular area and not only the foveal region , the assessment of the vegf concentration in clinical practice using the cube volume is comprehensible . this oct parameter could be used to assess the efficacy of anti - vegf therapy ." ]

[ "diabetes is the most frequent cause of end - stage renal disease in industrialised countries [ 1 , 2 ] . clinically , diabetic nephropathy is characterized by the development of albuminuria and a subsequent decline in glomerular filtration rate . this severe complication significantly influences the risk of cardiovascular disease as well as mortality and quality of life [ 3 , 4 ] . at present the most important identified risk factors are diabetes duration , arterial blood pressure , and glycaemic regulation . as evident from an increasing incidence of affected patients , however , there is still a great need for new strategies in the treatment and prevention of diabetic nephropathy . clear evidence indicates that the pathogenesis of diabetic nephropathy is multifactorial and triggered by a complex series of pathophysiological events . the inflammatory response in diabetes is highly complex involving proinflammatory cytokines and chemokines , for example , il1 the impact of complement activation on the diabetic kidney may well , in part , be mediated through induction of cytokine response and inflammation [ 911 ] . several studies have linked diabetic late - complications to the complement system of the innate immune system [ 12 , 13 ] . the complement system plays a crucial role in recognition and clearance of infectious microbes and the system forms a link between innate and adaptive immunity . the activation of the complement system results in the release of multiple inflammatory signaling molecules . ultimately complement activation leads to the formation of pore - forming membrane attack complexes ( macs ) that are inserted in the cell membranes to mediate lyses of the cell through osmotic stress . however , in mammalian cells , it has been shown that sublytic amounts of mac can increase production of il-8 and monocyte chemoattractant protein 1 dependent on nfb nuclear translocation . furthermore , macs are shown to have a mitogenic effect and cause release of basic fibroblast growth factor and platelet - derived growth factor from endothelial cells leading to fibrosis in neighboring cells including glomerular mesangial cells [ 16 , 17 ] . the latter effects of mac may explain the link between complement and diabetic kidney damage . three activations pathways exist : the classical , the alternative , and the lectin pathway . the present paper focuses on the lectin pathway , in which at least five soluble pattern - recognition molecules are characterized that may activate the complement system , that is , mannan - binding lectin ( mbl ) , h - ficolin , l - ficolin , m - ficolin , and collectin - k1 . the three ficolins utilize a fibrinogen - like domain that binds , for example , n - acetylglucosamine , n - acetylgalactosamine , and n - acetyl - neuraminic acid , whereas mbl and cl - k1 have a carbohydrate recognition domain and through this bind specifically to patterns of monosaccharides . a very recent publication reports a close association between ficolin and diabetic nephropathy in patients with type 1 diabetes . the observational design of the study , however , limits its ability to study a cause - effect relationship . when ficolins bind they all initiate activation of associated serine proteases ( mbl associated serine proteases , masps ) , which subsequently cleave the complement factors , c2 and c4 , leading to further complement activation [ 20 , 21 ] . eventually , complement activation leads to the formation of macs causing cell lyses or induction of fibrosis . the balance between activation and inhibition of the complement cascade is tightly controlled by regulatory proteins in order to prevent damage of healthy host cells . in diabetes , inappropriate effects of the complement system may be present as glycation - induced dysfunction of the complement inhibitory mechanism and consequently overactivation of the system is indicated [ 2325 ] . it is speculated that diabetic patients are exposed to uncontrolled complement attack partly due to altered molecular patterns on the cell surfaces as a consequence of high blood glucose [ 24 , 25 ] . most significantly , an association is seen between diabetic nephropathy and the lectin pathway [ 2628 ] . we have previously demonstrated direct cause - effect relationship between presence of mbl and worsening of kidney injury in a mouse model of diabetic nephropathy [ 29 , 30 ] . we speculate that ficolins also exert detrimental effects in diabetes similar to mbl through activation of the lectin pathway as indicated in patients with type 1 diabetes . this study aimed to investigate the impact of ficolin b ( the orthologue to human m - ficolin ) on the development of diabetic nephropathy in a mouse model of type 1 diabetes .", "we used 11-week - old , female ficolin b knockout mice and age - matched , female c57bl/6j bomtac wild - type mice ( taconic , ry , denmark ) . the knockout ficolin b model was backcrossed more than 10 generations to a c57bl/6j bomtac genetic background ( own breeding ) . in each cage there were three to eight mice and they had free access to tap water and standard chow ( altromin number 1324 ; lage , germany ) . the environment was stable with a 12-hour light - dark cycle , temperature at 21 1c , and humidity of 55 5% . the ficolin b knockout mice and the wild - type mice were randomized into a diabetic and nondiabetic group ; thus four groups were made : ( 1 ) diabetic knockout mice ( n = 6 ) , ( 2 ) nondiabetic knockout mice ( n = 7 ) , ( 3 ) diabetic wild - type mice ( n = 11 ) , and ( 4 ) nondiabetic wild - type mice ( n = 11 ) . diabetes was induced by intraperitoneal injections of streptozotocin ( stz ) dissolved in a cold 10 mm citrate buffer ( doses of 55 mg / kg body weight , sigma aldrich , st louis , mo , usa ) on five consecutive days . the 18-week experiment was initiated when the mice were classified as diabetic ( blood glucose > 15 mm ) . animals with more than 15% sustained weight loss , signs of illness , or persistent ketonuria were excluded from the study . blood glucose was measured from tail vein by contour ( bayer diabetes care , kgs . lyngby , denmark ) . with combur test d strip ( roche diagnostics gmbh , mannheim , germany ) two mice from each diabetic group were excluded because of insufficient increase in blood glucose levels . furthermore , two mice from the diabetic knockout group were excluded because of weight loss > 15% of body weight . the excluded mice were not included in the number of animals per group indicated above . spot urine was collected in eppendorf tubes on five consecutive days prior to sacrifice of the animals . the blood samples were drawn from under the tongue at baseline and from the retroorbital venous plexus at study end and collected in potassium edta tubes ( sarstedt , nmbrecht , germany ) . the animals were anesthetized by an intraperitoneal dose of ketamine at 0.5 mg / g body weight and xylazine at 0.2 mg / g body weight ( ketaminol 4 vet and narcoxyl vet , resp . , urinary albumin excretion was determined by mouse albumin elisa quantification kit ( bethyl laboratories , inc . , urine creatinine was measured by isocratic high - performance liquid chromatography ( hplc ) on a zorbax scx300 column ( agilent , usa ) using a slight modification of a method first reported by yuen et al . . in brief , 5 l urine was added to 100 l acetonitrile containing 0.5% acetic acid and vortexed for 15 seconds to extract the creatinine . after 15 min of 20c storage and centrifugation the supernatants were evaporated and then reconstituted with 25 l 5 mm sodium acetate , ph 4.1 . duplicate samples ( 10 ul each ) were fractionated on a 50 mm 2.1 mm zorbax scx300 column with an in - front scx guard column . isocratic hplc was performed at a flow rate of 1 ml / min , and uv absorbance was monitored at 225 nm . a standard curve was created by including a 2-fold dilution series of creatinine anhydrous ( sigma aldrich ) . this study was designed with two independent factors ; diabetes / nondiabetes and knockout / wild - type and thus analysed by two - way anova for normal distributed variable with equal variance . the main focus of interest was the interaction between the diabetic factor and the knockout factor ; that is , does ficolin b modify the effects of diabetes on the effect parameters ? if no interaction was found , the independent effects of diabetes and ficolin b on the kidney were estimated . for pairwise comparison , normal distributed data was tested with student 's t - test , whereas otherwise the wilcoxon mann - whitney rank sum test was used . data are given as mean ( 95% confidence interval ( ci ) ) unless else is stated .", "at baseline , the knockout mice on average weighed 20.0 g , which was slightly less than the wild type mice , 20.8 g ( p = 0.04 ) . no difference was found between the two diabetic groups or between the two nondiabetic groups ( table 1 ) . after 18 weeks an expected difference in body weight was observed between the diabetic and the nondiabetic mice independently of knockout status ( p < 0.001 ) . the nondiabetic mice weighed 3.2 g ( ci : 2.0 g4.3 g ) more than the diabetic mice . furthermore the diabetic knockout mice were significantly smaller than the diabetic wild type ( p < 0.05 ) . as presented in table 1 , blood glucose , estimated as area under the curve ( auc ) , did not differ between the two diabetic groups ( p = 0.69 ) or between the two nondiabetic groups ( p = 0.13 ) . the kidney weight was equally increased in diabetic wild - type mice , 24% ( ci : 13%36% ) , and in the diabetic knockout mice , 29% ( ci : 12%47% ) , compared to the respective control groups ( figure 2(a ) ) . no interaction between knockout and diabetes was found ( p = 0.60 ) , indicating that wild - type and knockout mice develop the same degree of diabetes - induced renal hypertrophy . the considerable body weight difference between the two diabetic groups at study end indicated that the kidney weight was to be normalised to the body weight . ficolin b did not modify the diabetes - induced increase in kidney weight when testing for interaction ( p = 0.11 ) . furthermore , no significant statistical difference was found in kidney weight per body weight between the diabetic wild - type , 1.95 mg / g , and the diabetic knockout , 2.89 mg / g ( p = 0.09 ) . the albumin - to - creatinine ration ( acr ) was higher among the diabetic wild - type mice , 76 mg / g ( ci : 50103 mg / g ) , compared to the nondiabetic wild - type mice , 44 mg / g ( ci : 2563 mg / g ) , p = 0.07 . similarly , the acr of diabetic knockout mice was 96 mg / g ( ci : 71122 mg / g ) compared to the nondiabetic knockout group , 34 mg / g ( ci : 2344 mg / g ) , p < 0.001 . as depicted in figure 3 no interaction was observed between diabetes and ficolin b knockout , p = 0.21 .", "in the present study we found no association between diabetes - induced kidney changes and the presence of ficolin b. we conclude that ficolin b is not responsible for , or a crucial contributory factor in , the pathophysiology of diabetic nephropathy . in our study , the kidney weight and to some extent the acr were altered by diabetes as expected . the diabetes - induced increase in kidney weight , measured by comparing the diabetic mice with the nondiabetic mice , was not statistically different between the wild - type and ficolin b knockout mice . the diabetes - induced increase in kidney weight was 24% in the wild - type mice and 29% in the ficolin b knockout mice . taking the lower body weight of the knockout mice into account , the difference in renal hypertrophy was still insignificant when comparing the wild - type mice and the ficolin b knockout mice . similarly , the diabetic change seen in acr was not altered in the absence of ficolin b. the experimental setup including four groups matched on age , body weight , and genetical background was a strength to the study , as the diabetes factor and the knockout factor were the only modulators of the outcome . most importantly both diabetic groups did reach and sustain blood glucose levels of above 15 mm . at study end , the body weight differed among groups , which impeded the analyses of the diabetic kidney damage , because the knockout mice appear to be more vulnerable to type 1 diabetes mellitus . our study provides important new information on the association between the lectin pathway and diabetic kidney damage . we are the first to investigate the role of ficolin b ( which corresponds to ficolin m in human ) in the inflammatory response of diabetic nephropathy . in mice with deficiency of mbl , the classical functional and physical renal changes normally seen in this experimental model of type 1 diabetes were modified [ 29 , 30 ] . the fact that ficolin b does not appear to modulate diabetic effects on the kidney emphasizes the importance of mbl compared with ficolin b. both mbl and ficolin b activate the lectin pathway of the complement system , but only deficiency of mbl has been shown to protect against diabetic kidney damage . this indicates that the role of the lectin pathway in the development of diabetic nephropathy is complex and may depend on the specific carbohydrate - binding properties of mbl as previously described . the function of other complement factors in the first parts of the lectin pathway ( e.g. , ficolin a and masps ) in the pathology of diabetic kidney disease remains unknown and must be explored in further studies . one study indicates that ficolin a and ficolin b exert a cooperatively defensive role in destroying streptococcus pneumoniae , suggesting a synergetic immunological effect . this emphasises the need for further investigations involving both mouse ficolins . in order to fully understand the involvement of the lectin pathway in the development of diabetic nephropathy , an additional parallel experiment with masps is of particular interest given that they represent the limiting downward step in the complement activation", "in conclusion , this study demonstrates that ficolin b does not modify the kidney weight and acr in a type 1 diabetes mouse model . this indicates that the role of the lectin pathway in the development of diabetic nephropathy is specific and that hyperglycaemia - induced glycations on renal cells may be more prone to bind mbl than ficolin b." ]

[ "how to choose surgical approach in severe multilevel cervical cord compression case is a hot debate on spine surgery . some surgeons think anterior surgery should be of the primary choice , because of direct decompression , restoring intervertebral height and reconstruction of stability7,12 ) . some surgeons prefer posterior approach , owing to easy decompression , low surgical risks and complications14 ) . whereas other surgeons suggest that combined anterior and posterior approach at one stage achieve more sufficient decompression though with increasing of complications and costs10 ) . multiple factors should be considered when a surgery is to be performed , especially on patients with multilevel cord compression from both ventral and dorsal parts . which approach is better to decompress the cord sufficiently and maintain the spinal column simultaneously , anterior or posterior ? however , in clinical practice , surgeon 's experience and surgical skills are usually of the primary consideration . although anterior discectomy and fusion ( acdf ) , or corpectomy and fusion ( accf ) has satisfactory results in treatment of multilevel lesions of cervical spondylosis and ossification of the posterior longitudinal ligament ( opll ) , some patients remain complain of persistence or recurrence of new symptoms . reports elucidated the causes of unsatisfactory results and the revision techniques have so far been limited . thus , the purpose of this study was to investigate the causes for failed anterior multilevel acdf or accf , and the outcomes of secondary laminoplasty .", "between feb 2003 and may 2011 , 23 patients who complained of persistence of primary symptoms or occurrence of new symptoms for more than 3 months after multilevel anterior cervical surgery ( acdf or accf ) in our spine surgery center were reviewed in the study . patients demonstrated as neck pain , cervical movement restriction , spasticity , sensory loss , weakness , or sphincter dysfunction to different extent . therapeutic treatments included traction , collar support , physical therapy , functional exercise and analgesics . of 23 patients , the study population consisted of 12 men and 5 women , with a mean age of 59.95.6 ( range , 49 - 78 ) years old . main indications for the second surgery were when patients displayed signs of cord compression at least at 2 levels associated with / without canal stenosis corresponding to signs of myelopathy . major exclusion criteria were symptomatic treatment less than 3 months , axial neck pain as the solitary symptom , cervical instability , active systemic infection , and other contraindications in routine surgery . instability documented as angle difference ( cobb angle ) more than 15 degrees and/or listhesis more than 3 mm on extension and flexion lateral views . the patient underwent a general anesthesia and is positioned prone with the head and neck held in slight flexion on the operating table . a cervical midline incision is performed down to the cervical fascia , and the cervical musculature is reflected off of the involved cervical lamina . the decompression levels extended to one level cranial or / and caudal to compressive lesions are included . a 4-mm laminotomy is created just medial to the level of the pedicles on the clinically more symptomatic side , or on the most narrowed side on images , if there is no dominant symptom side . then the involved ligaments and flavum is removed until the pulse of dura sac is seen . the external cortex is thin out to a 3- to 4-mm trough on the contralateral lamina , again just medial to the level of the pedicles , and inner cortex is preserved . the laminae are lifted carefully to create a greenstick fracture on the hinge side , expanding the spinal canal diameter . then cervical titanium mini - plate ( medtronic sofamer danek , memphis , usa or depuy synthes , bettlach , switzerland ) is placed at each level secured by two 4-mm screws onto the lamina and two at the level of the lateral masses . at last the patient is placed in a hard cervical collar for the first 6 weeks after surgery . patients ' ages , gender , disease , the first surgical technique and levels , intervals between the first surgery and the onset of new symptoms or the persistence of primary symptoms , re - surgical levels , and causes for revision were examined . the outcomes were evaluated preoperatively , at 1 week , 2 months , 6 months , and the final visit . scores are based on the rating of motor function ( fingers , 0 to 4 points ; shoulder and elbows , -2 to 0 points ; and lower extremity , 0 to 4 points ) , sensory function ( upper extremity , 0 to 2 points ; lower extremity , 0 to 2 points ; and trunk , 0 to 2 points ) and urinary bladder function ( 0 to 3 points ) . a normal joa score is 17 points . recovery rate was calculated as : ( scores at follow up - scores preoperatively)/(17-scores preoperatively)100% . recovery rate more than 75% was classified as excellent , 50 - 75% good , 25 - 50% fair , and less than 25% poor ; the excellent to good rate was calculated . patients were required to rate their neck pain , using the visual analogue scale ( vas ; 0 mm = no pain , 100 mm = worst pain ) at different intervals , supplemented with at 1 day postoperatively . cervical alignment was created by a line parallel to the inferior aspect of the c2 body and a line parallel to that of the c7 body , according to cobb 's method on neutral lateral view ( fig . all data were analyzed by sas 8.0 ( statistical analysis system , sas institute inc . ,", "between feb 2003 and may 2011 , 23 patients who complained of persistence of primary symptoms or occurrence of new symptoms for more than 3 months after multilevel anterior cervical surgery ( acdf or accf ) in our spine surgery center were reviewed in the study . patients demonstrated as neck pain , cervical movement restriction , spasticity , sensory loss , weakness , or sphincter dysfunction to different extent . therapeutic treatments included traction , collar support , physical therapy , functional exercise and analgesics . of 23 patients , the study population consisted of 12 men and 5 women , with a mean age of 59.95.6 ( range , 49 - 78 ) years old . main indications for the second surgery were when patients displayed signs of cord compression at least at 2 levels associated with / without canal stenosis corresponding to signs of myelopathy . major exclusion criteria were symptomatic treatment less than 3 months , axial neck pain as the solitary symptom , cervical instability , active systemic infection , and other contraindications in routine surgery . instability documented as angle difference ( cobb angle ) more than 15 degrees and/or listhesis more than 3 mm on extension and flexion lateral views .", "the patient underwent a general anesthesia and is positioned prone with the head and neck held in slight flexion on the operating table . a cervical midline incision is performed down to the cervical fascia , and the cervical musculature is reflected off of the involved cervical lamina . the decompression levels extended to one level cranial or / and caudal to compressive lesions are included . a 4-mm laminotomy is created just medial to the level of the pedicles on the clinically more symptomatic side , or on the most narrowed side on images , if there is no dominant symptom side . then the involved ligaments and flavum is removed until the pulse of dura sac is seen . the external cortex is thin out to a 3- to 4-mm trough on the contralateral lamina , again just medial to the level of the pedicles , and inner cortex is preserved . the laminae are lifted carefully to create a greenstick fracture on the hinge side , expanding the spinal canal diameter . then cervical titanium mini - plate ( medtronic sofamer danek , memphis , usa or depuy synthes , bettlach , switzerland ) is placed at each level secured by two 4-mm screws onto the lamina and two at the level of the lateral masses . at last , the patient is placed in a hard cervical collar for the first 6 weeks after surgery .", "patients ' ages , gender , disease , the first surgical technique and levels , intervals between the first surgery and the onset of new symptoms or the persistence of primary symptoms , re - surgical levels , and causes for revision were examined . the outcomes were evaluated preoperatively , at 1 week , 2 months , 6 months , and the final visit . scores are based on the rating of motor function ( fingers , 0 to 4 points ; shoulder and elbows , -2 to 0 points ; and lower extremity , 0 to 4 points ) , sensory function ( upper extremity , 0 to 2 points ; lower extremity , 0 to 2 points ; and trunk , 0 to 2 points ) and urinary bladder function ( 0 to 3 points ) . recovery rate was calculated as : ( scores at follow up - scores preoperatively)/(17-scores preoperatively)100% . recovery rate more than 75% was classified as excellent , 50 - 75% good , 25 - 50% fair , and less than 25% poor ; the excellent to good rate was calculated . patients were required to rate their neck pain , using the visual analogue scale ( vas ; 0 mm = no pain , 100 mm = worst pain ) at different intervals , supplemented with at 1 day postoperatively . cervical alignment was created by a line parallel to the inferior aspect of the c2 body and a line parallel to that of the c7 body , according to cobb 's method on neutral lateral view ( fig .", "all data were analyzed by sas 8.0 ( statistical analysis system , sas institute inc . , cary , nc , usa ) .", "mean duration between the first surgery and the onset of new symptoms or persistence of symptoms was 14.54.2 ( range , 1 to 44 ) months . causes for revision surgery were inappropriate approach in 3 patients ( 17.6% ) , insufficient decompression in 4 patients ( 23.5% ) , adjacent degeneration in 2 patients ( 11.8% ) , and disease progression in 8 patients ( 47.1% ) . there were 8 patients of disease progression , with 4 cases of opll and 4 cases of cervical spondylotic myelopathy ( csm ) . the progression levels increased from 1.250.2 at the first surgery to 2.250.4 at the second surgery on opll patients , and from 1.50.2 to 2.50.4 on csm patients . mean follow - up duration was 29.712.1 ( range , 6 - 84 ) months . mean joa score was 10.54.1 preoperatively , 11.84.2 at 1 week , 13.54.4 at 2 months , 14.14.8 at 6 months and 13.94.6 at the final visit ( table 2 ) ; significant improvement achieved at 2 months ( p<0.05 ) and maintained thereafter ( p>0.05 ) . mean recovery rate was 20.0% , 46.1% , 55.4% , and 52.3% after surgery , respectively ; significant improvement was detected at 2 months ( p<0.05 ) and maintained with the time ( p>0.05 ) . one case had excellent result , 5 good , 7 fair , and 4 poor , with an excellent to good rate of 35.3% at 1 week ; two cases had excellent results , 8 good , 5 fair , and 2 poor , with an excellent to good rate of 58.8% at 2 months ; three cases had excellent results , 9 good , 4 fair , and 1 poor , with an excellent to good rate of 70.6% at 6 months ; three cases had excellent results , 8 good , 4 fair , and 2 poor , with an excellent to good rate of 64.7% at the final visit . mean vas score was 29.116.7 preoperatively , 51.127.6 at 1 day , 30.717.2 at 1 week , 9.19.9 at 2 months , 8.57.9 at 6 months , and 9.08.2 at the final visit . vas score decreased at 1 week ( p<0.05 ) and at 2 months ( p<0.05 ) . mean lordotic angle was 11.710.3 preoperatively , 11.110.2 at 1 week , 11.710.3 at 2 months , 10.99.7 at 6 months and 10.39.1 at the final visit ; no significance was observed during the follow up ( p>0.05 ) ( fig . one case demonstrated as axial pain and relieved 2 weeks after pain management and physical therapy .", "acdf or accf has excellent and good results in treatment of cervical spondylosis and opll . the anterior approach removes pathological compression to the cord directly , stabilizes spine column , and maintains cervical alignment . however , if the disease involved multiple levels or posterior compression , the ideal effects of anterior approach are difficult to achieve3,5 ) . it is not easy in performing sufficient decompression and preserving cervical range of motion on acdf or accf . besides , corpectomy of multilevel vertebrae in series destroys the integrity of spine column and has a risk of nonunion . especially for patients with congenital or acquired narrowed canal , the compression to cord remains after initial anterior surgery . in the study , 3 patients demonstrated narrowed canal associated with posterior compression and persistent even after aggravation of symptoms after anterior surgery . however , after the secondary laminoplasty , the canal is enlarged significantly and the cord is given more space to breathe1 ) . if the compression was mainly from the posterior part associated with or without canal stenosis , the posterior approach should be performed . second cause was adjacent degeneration . in a study by matsumoto et al.11 ) that acdf patients had significantly higher incidence of progression of disc degeneration than control subjects . prasarn et al.15 ) thought biomechanics altered after fusion , with an increased adjacent - segment motion in cervical spine . after fixation and fusion , there is a change in the load of the stiffed fusion which accelerated the degeneration of adjacent disc and endplate , especially on the caudal level . faldini et al.6 ) thought proper lordotic alignment could prevent adjacent degeneration . in our opinion , though factors of degeneration were not systematically elucidated , maintaining lordosis and exercising cervical dorsal musculatures could help a lot . it was thought that factors influencing decompression included surgical approach , technique and experience of surgeon , and overall knowledge of pathologic structure . osteophyte , ossified nucleus pulposus , opll and abnormal curvature venous plexus increased complexity of decompression , especially in patients with multilevel lesions or on narrowed canal . the last but not the least was disease progression . in the study , half of patients displayed as extension of cord compression though after sufficient initial anterior decompression . the symptoms aggravated gradually until the patients seek for the surgeons . after the revised posterior surgery , the enlarged canal was enough to compensate for the spinal cord in a narrowed space for a long time . thus , in the study , symptoms of patients with disease progression alleviated immediately after revision . factors of progression are not clear , which may include metabolism , heredity , endocrine secretion and biomechanics . choi et al.4 ) also believed that age , severity of disease , irreversible changes of gray matter in cord , duration of symptoms , and diabetes mellitus took important parts . patients ' age , general status , extent and range of compression , and safety should be considered , when planning a revision surgery . pang et al.13 ) thought although anterior surgery was more effective in relieving cord compromise , inadequate decompression and disease progression might require secondary laminoplasty . scar tissue around anterior region after anterior surgery increased risks of neurovascular , trachea or esophagus injury . be - sides , once the cage and vertebrae above and below are fused , it was difficult to remove the protruded or ossified materials along posterior wall of vertebrae , especially in multilevel segments . it was thought that myelopathy could be treated via anterior or posterior approaches , but risks and complications in acdf increase . average joa score , recovery rate , and excellent to good rate did n't improve until at 2 months , and attained the maximum at 6 months , with a slight deterioration thereafter . however , it was reported by hyun et al.9 ) that loss of alignment was time - dependent but no further decreased after 18 months . in the study , the lordosis maintained during the entire follow up . in a study by baba et al.2 ) , excellent to good rate of secondary laminoplasty was 55.6% . they thought that narrowed canal added to the risk of recurrence , and additional laminoplasty could prevent structural compromise occurring adjacent vertebrae . symptoms and signs had no obvious alleviation , with high - signal intensity remained persistent . yagi et al.18 ) also thought that long - term outcome was significantly worse in these patients . the outcome was also worse in patients with expansion of high - signal area , which the causes might be not only from necrosis secondary to ischemia of the anterior spinal artery , but also from the repeated minor traumas inflicted on the cord from an unstable spine . combining the research and related literatures , we thought that multiple factors affect outcomes of revision surgery , which included age , extent lesion of cord , surgical times , mental disease , and so on . edwards et al.5 ) deemed that both corpectomy and laminoplasty arrested progression in multilevel myelopathy , which resulted in significant neurologic recovery and pain reduction . however , the laminoplasty cohort required less pain medication than did the corpectomy cohort . given the higher prevalence of complications in anterior approach , it was believed that laminoplasty might be the preferred treatment in the absence of preoperative kyphosis . however , although it is a safe and effective technique , complications include paralysis of c5 nerve root , axial pain , and instability of spine , cerebral spinal fluid leakage and close of \" opening door\"16 ) . laminoplasty preserving the c7 muscle attachment is very important . in the study , except for the decompression extending to t1 , all the other cases preserve muscle insertions into the c7 spinous process . it was also reported that this preservation was associated with a significantly decreased frequency of postoperative axial neck pain8 ) . future studies will seek to research in a prospective , randomized and controlled way with a longer duration . despite limitations , laminoplasty should be considered as a primary procedure or as a revision procedure versus anterior approach in multilevel lesions because of effective decompression , preservation cervical alignment and minimum morbidity .", "laminoplasty has satisfactory results in failed anterior surgery , with a low incidence of complications ." ]

[ "population aging is the process by which older individuals become a proportionally larger share of the total population . it was the most distinctive global demographic event that the world witnessed in the past century and is an important event for the twenty - first century too . it was initially experienced by the more developed countries and has recently become apparent in the developing countries . population aging will be faced globally by all countries in this century , although at varying levels of intensity and time . according to the world health organization ( who ) , world 's elderly population i.e. , people 60 years of age and older is approximately 650 million at present and by 2050 , it is forecast to reach 2 billion . in 2008 , five out of the top ten causes of mortality worldwide , other than injuries , were non - communicable diseases ( ncds ) and expected to go up to seven out of ten by the year 2030 . by then about 76% of the deaths in the world will be due to ncds . government and the who have already recognized the huge burden of preventable disease , disability , death and distress caused by the ncds . the present international health agenda guided by who focuses on four conditions ( cardiovascular disease , diabetes , cancer and chronic respiratory disease ) responsible for most of the premature mortality and four lifestyle risk factors ( smoking , harmful alcohol use , lack of physical activity and high salt , high fat diets ) leading to above conditions . medications play crucial role in geriatric health care as they treat chronic diseases , alleviate pain and improve quality of life . age - related changes in drug disposition and pharmacodynamic responses have significant clinical implications , and increased use of a number of medications in elderly raises the risk of medicine - related problems that may occur . as medication use and the incidence of adverse drug outcomes increase with advancing age , it is important to ensure quality use of medicines in older people towards attaining a higher goal of healthy and active aging . but , use of drugs by the elderly and their clinical outcomes especially adverse drug reactions ( adrs ) have not been prominent research topic and continues to be given low priority in national and international public health arena , at least in a developing country like india . however , we feel that this probably needs more attention in india because we have not completely dealt with the scourge of communicable diseases yet . in addition , 70% of all older people now live in low- or middle - income countries , including india where sustainable pharmacovigilance systems has not developed as yet .", "the relationship between increased use of drugs and elderly is well established . consequently , increased use of medications in elderly increases the risk of adrs . studies from around the world have shown a definite correlation between increasing age and adr rate , at least for some medical conditions . although very few such studies are available in indian settings , harugeri et al . in a hospital setting found that the prevalence of adr - related hospital admissions was 5.9% , while in another such study in india , it was observed to be 6.7% . for india , harugeri et al . predicted that 18000 bed days in a given time would be due to adrs in elderly and total cost of hospital stay due to adrs is estimated to be us $ 4350 ( inr 200100 ) , that is us $ 80.5 per patient ( 108.7% of per capita per year expenditure on health ) . there has been much debate on whether advancing age by itself is a cause of increased risk of adrs but merely a marker for comorbidity , altered pharmacokinetics , and polypharmacy . gurwitz and avorn concluded that patient - specific physiological and functional characteristics are probably more important than any chronological measure in predicting both adverse and beneficial outcomes associated with specific drug therapies , while studies around the world have clearly shown that the risks of adrs ( including interactions ) is related to the number of medicines taken and sometimes due to inappropriate use of medicines . ( 1991 ) observed an exponential rather than the linear relation between the risks of adr and the number of medicines taken in 9000 elderly italian patients receiving 10 medicines . review of several studies by steward rb et al . found that the patients aged above 65 years use an average of two to six prescribed medications , and 1 - 3.4 non - prescribed medications . out of all the factors that are most consistently associated with adverse drug reactions , polypharmacy is considered to be the most important . thus , studies have correlated the integral association between old age and increased rate of adrs arising out of confounding association between age and polypharmacy contributed by age - related changes in pharmacodynamics and pharmacokinetics at least for some medical conditions .", "the classical pharmacological classification of adrs by rawlins and thompson divides adr into two major subtypes : type a reactions , which are dose - dependent and predictable , and unpredictable type b ( bizarre or idiosyncratic ) reactions . majority of adrs ( 80% ) causing admission or occurring in hospital setting are type a reactions . they are predictable and potentially avoidable in nature as they are related to accentuation of known pharmacological effects of the drug . drugs associated with type a reactions are generally with low therapeutic index and commonly used among elderly . the lists of medicines most likely to be used in the elderly include antibiotics , anticoagulants , digoxin , diuretics , hypoglycemic agents , antineoplastic agents and non - steroidal anti - inflammatory drugs ( nsaids ) and these are responsible for 60% of adrs leading to hospital admission and 70% of adrs occurring in hospital . type b adrs are usually uncommon , but rarely may sometimes cause serious toxicities . therefore , adrs in elderly are largely contributed by prescribing error e.g. , large doses of drugs without taking into account , the effect of age and frailty on drug disposition , especially renal and hepatic clearance . the other contributing factor may be because of not considering the increased pharmacodynamic sensitivity of the elderly to several commonly used drugs , e.g. , central nervous system and cardiovascular drugs . since only around 3000 subjects receive a medicine prior to marketing , it is not surprising that less frequent ( particularly type b ) adrs are often recognized only after marketing . the capacity of premarketing studies to recognize adrs is further reduced by the limited numbers of patients in the age group of 65 or older in trials and that even smaller numbers of the oldest old . in addition , long latency diseases like cancer are difficult to detect on account of the short duration of study .", "the latter has been defined in the literature in relative terms ( for example , the administration of an excessive number of drugs ) and in absolute terms , ranging from two to more than six simultaneous medications . in contrast to general population , the incidence of combination therapy is found to be greatest in the elderly . a drug combination may sometimes cause synergistic toxicity , which is greater than the sum of the risks of toxicity of either agent used alone . for example , the combination of corticosteroids and nsaids : the risks of development of nsaid - induced peptic ulcer in older patients may increases by 10% among elderly . however , concurrent use of corticosteroids and nsaids had shown a risk of peptic ulcer disease that was 15 times greater than that of non - users of either drug . similarly , the relative risk of hospitalization for hemorrhagic peptic ulcer disease in elderly patients ( above 65 years ) has been observed to be increased by manifolds on concurrent use of oral anticoagulants and nsaids , while the risks were lower when used alone . this suggests that there is certainly a need to recognize and consider the aspects of synergism of toxicity while prescribing medications in elderly . however , polypharmacy at times can effectively control certain disease condition e.g. , hypertension and epilepsy .", "respecting the individual needs of every individual patient is the preferred approach of prescribing in elderly . some of the steps that may be helpful in minimizing adrs in elderly may be : \n maintaining accurate record of all medications in use : may include asking patients to bring all medications to clinic including the use of over - the - counter and complementary medicines.number of medications ( prescribed and non - prescribed ) : monitoring to balance the need and avoid polypharmacy while minimizing under - use of vital drugs.individual doses : reducing the doses wherever appropriate and titrating them carefully from a low starting dose , if pharmacodynamic sensitivity is likely to be the problem.simple regimens of medication : choose the preparation suitable for the patient and minimize the dose whenever needed , but avoid advising the patient to break a single tablet into two or three equal pieces.ensuring safe management of medications by patients : involving patients in decisions on their therapy by educating the patient about important side effects and what to do if they occur . minimize hoarding of previously used and expired drugs.therapeutic drug monitoring is encouraged , but should not replace clinical observation . considering an adr as a possible cause for any new problem.utilizing available strategies and inter - disciplinary collaboration to enhance the quality use of medicines . \n maintaining accurate record of all medications in use : may include asking patients to bring all medications to clinic including the use of over - the - counter and complementary medicines . number of medications ( prescribed and non - prescribed ) : monitoring to balance the need and avoid polypharmacy while minimizing under - use of vital drugs . individual doses : reducing the doses wherever appropriate and titrating them carefully from a low starting dose , if pharmacodynamic sensitivity is likely to be the problem . simple regimens of medication : choose the preparation suitable for the patient and minimize the dose whenever needed , but avoid advising the patient to break a single tablet into two or three equal pieces . ensuring safe management of medications by patients : involving patients in decisions on their therapy by educating the patient about important side effects and what to do if they occur . considering an adr as a possible cause for any new problem . utilizing available strategies and inter - disciplinary collaboration to enhance the quality use of medicines .", "drugs are double - edged weapons and increased use of drugs by elderly increases the risk of adverse drug reactions causing increased morbidity and mortality . in addition , economic consequences of adrs constitute a problem of considerable magnitude . developing countries have rapidly aging population and the governments are seeking guidance in promoting healthy and active aging . however , strategies to increase opportunities for identifying adrs and related problems have not been emphasized in current policy responses in india to meet the increase in elderly population and chronic conditions . in addition , there is definite paucity of good quality research and data on adrs in india . further , growing pharmacotherapy with increase in the number of diseases in the elderly will require more timely and accurate drug safety data . pharmacoepidemiological studies that encompass large numbers of elderly drug users are needed to obtain this information as increased knowledge of the frequency and cost of adverse drug reactions is important in enabling more rational therapeutic decisions by individual clinicians and more optimal social policy . given quantitative information on medication risks , clinicians will be able to change the use of the drug ( prescribe for fewer patients , use safer alternatives when available , and use in lower doses for shorter duration ) or can take measures to minimize side effects ( prescribe prophylactic medications , increase monitoring for side effects , and intensify patient education ) . policy changes that can result from better data on drug toxicities include withdrawal of drug from the market , change in drug labeling , educational programs to physician and changes in academic curriculum of pharmacology . this will result in promoting and ensuring a good health of older people , which can be of great benefit to their families and communities . in the long run , more precise estimates of the true costs associated with adrs could stimulate development of prophylaxis and of alternative therapies ." ]

[ "day care or ambulatory anaesthesia is as old as the history of anaesthesia itself . in the last few decades , it has gained significant popularity mainly because of the enormous cost savings and has therefore been accepted by the hospitals , patients and the insurance companies alike . however , the quality and excellence of care needs to be defined and defining good care is a challenge . unanticipated admission , whatever the cause , is an indicator of the quality of care because it negates the basic goal of preventing hospitalisation and same day discharge . while day care surgery in india is limited to a few hospitals , there is a dearth of data on hospitalisation following such intervention . this study aimed to examine the incidence and factors associated with unanticipated admission following day care surgery at a tertiary level hospital in south india .", "patients belonging to american society of anesthesiologists ( asa ) physical status classes 1 and 2 , undergoing surgeries under general or regional anaesthetic techniques along with appropriate nerve blocks for post - operative pain relief were included . it was planned to use the median value of controls for continuous exposure variables ( such as time of anaesthesia and time of starting last case ) to define exposure status . we required 70 cases and 70 controls to detect an odds ratio ( or ) of 2.5 with a power of 80% and error of 0.05% . to permit adjustment for confounders , two controls per case were chosen , which required the number of subjects to be 53 cases and 106 controls . demographic characteristics , patients weight , pre - operative medical illness , personal habits , asa status , the diagnosis and surgical procedures , time since last meal , duration of anaesthesia and surgery , experience of the surgeon and anaesthesiologist , and intraoperative management ( techniques , drugs , monitoring , etc . ) were documented . the number of hours fasted was divided into 68 h , 911 h and > 11 h. the outcomes measured were the admission of patients following day care surgery , and the causes of unanticipated admissions . discharge of the patient was decided after both the surgeon and the anaesthesiologist cleared the patient . the admission of the patient to the hospital was also decided by the surgeon or the anaesthetist depending on the complication the patient had . those who need to stay overnight from the day care centre were considered as unanticipated admissions ( the centre functions from 7 am to 9 pm with the morning session from 7:30 am to 11:30 am and the afternoon session from 12:30 pm to 4:30 pm . the reasons for unanticipated admission were classified into four main groups : ( i ) anaesthetic reasons included nausea vomiting , giddiness , prolonged general anaesthesia and others , ( ii ) surgical reasons included pain , bleeding , complicated surgery requiring wound dressing , wound drainage or antibiotics , ( iii ) medical reasons such as fever , drug allergies and other complications , ( iv ) social reasons included patients or surgeons request . a nested case descriptive statistics in the form of frequencies , median and means , standard deviations and percentages were calculated . the chi - square test and or were calculated to determine which factors were associated with unanticipated admission . the or , their 95% confidence intervals ( cis ) and corresponding p values were calculated for all variables . for the statistically significant variables , the mantel haenszel or was calculated to identify confounding , if any . for analysing the different narcotics used , each narcotic was given a score using morphine as a reference ; 10 mg of morphine = 100 g of fentanyl = 75 mg of pethidine = 100 mg of tramadol . hence , a narcotic score of one equals 1 mg of morphine = 10 g of fentanyl = 7.5 mg of pethidine = 10 mg of tramadol . for example , if a patient received 100 g of fentanyl and 6 mg of morphine during the surgery , the patient would have a narcotic score of 16 . the equivalent narcotic dose was totalled and the narcotic score for each patient was then calculated . a narcotic score of 10 was used as the cut - off and the tests of significance done . data were analysed using the statistical package for social sciences ( spss ) version 13.0 ( spss inc .", "during the 3-month study , from the cohort of 776 patients , 63 patients with unanticipated admission formed the case group and were compared to twice the number of unhospitalised patients , which formed the control group . at the end of the day , after all the patients had been discharged or admitted from the day care centre , lots were drawn from the discharged group , which randomly selected controls . of these , anaesthetic complications accounted for 33.33% , surgical complications were 15.87% , medical were 6.35% and social reasons were 44.44% . social reasons included admission on request of the surgeon and admission on request of the patient or parents of a child . the reasons for anaesthetic admission were post - operative nausea and vomiting ( ponv ) , sweating and giddiness in the recovery room , prolonged general anaesthetic ( > 2 h ) , probable aspiration , urinary retention , a failed anaesthetic , which required switching to another technique and post - operative pain . the surgical reasons were bleeding ; complicated surgery needing wound drainage , dressings or antibiotics . medical causes were persistent high blood pressure needing treatment , fever , seizures and drug reactions . reasons for unanticipated admissions the orthopaedic surgery speciality had the maximum admissions ( 34.9% ) , followed by abdominal surgeries , 27% . ear nose and throat ( ent ) had 11.1% admissions ; vascular surgeries accounted for 3.17% whereas urology had none . the type of surgery and technique of anaesthesia among unanticipated admissions are shown in tables 2 and 3 . type of surgery requiring readmission technique of anaesthesia in those requiring readmission individual risk factors for admissions and or 's were calculated using univariate logistic regression [ table 4 ] . the possibility of confounding was investigated using stratified analysis and calculation of the mantel haenszel or . univariate analysis showing factors associated with unanticipated admissions the factors significantly associated with unanticipated admissions were the duration of anaesthesia , duration of surgery , experience of the surgeon , time of starting last case , hours of fasting and a high narcotics score . anaesthesia lasting more than 50 min and surgery lasting more than 35 min were at a higher risk of admission . patients whose surgery started after 3 pm were also at a significantly high risk of admission . the study found that patients operated on after 3 pm are 8 times at risk of being admitted than if their surgery started before 3 pm . it was found that those fasting shorter hours ( 68 h ) had 2.2 times greater risk of admission . intraoperative use of narcotics was analysed in both groups , and this was not statistically significant . ( p = 0.06 with an or of 0.84 and a 95% ci of 0.411.71 ) the dose of narcotic used during anaesthesia was analysed using the narcotic score and patients with a score of > 10 were 2.86 times at a greater risk of admission with a 95% ci of 1.177.09 . it was also found that patients operated on by consultant surgeons were 3.2 times more likely to be admitted but this was not analysed further as consultant surgeons operated upon almost 90% of patients . the above statistically significant variables were entered into a bivariate logistic regression model [ table 5 ] . anaesthesia time 50 min and surgery time 35 min were highly correlated and hence only anaesthesia time 50 min was entered into the model . the anaesthesia time 50 min ( p = 0.002 ; or : 3.18 ; 95% ci : 1.506.72 ) and starting of last case after 3 pm ( p = 0.002 ; or : 10.10 ; 95% ci : 2.4242.15 ) remained statistically significant for unanticipated admissions .", "the day care centre is an architecturally and functionally integrated independent unit with areas for admission , surgery , recovery and discharge . it consists of an admission area with a lounge for relatives , two operating theatres , and a four - bedded recovery room with adequate monitoring facilities , oxygen and suction apparatus and in addition a six bedded day surgery ward . the surgical disciplines using the day care centre include ent , orthopaedics , general surgery , vascular surgery and urology . unanticipated admissions following day care surgery are a quality marker of efficiency of ambulatory surgery services . the incidence of unanticipated admission in this study was 4.51% that compares favourably with other published reports , which document rates between 1.04% and 5.4% . patients were admitted for an average of 4.5 days however 70% of patients were admitted only for 1 day . the factors associated with unanticipated admissions identified by the study were long duration of anaesthesia and surgery , starting of last case after 3 pm , shorter hours of fasting and greater dose of narcotics used . . anaesthesia lasting longer than 50 min and surgery lasting longer than 35 min were significantly associated with an increased risk of admissions . the study has found that longer anaesthesia is associated with a 3.85 times greater and longer surgery has four times increased risk of admissions . this study documented that surgeries started after 3 pm had a higher risk of unanticipated admissions and is consistent with those reported in literature . fortier et al . have reported that completion of surgery after 3 pm was a significant factor . this may be because patients having surgery later in the day had less time to recover and be fit for discharge as compared to patients whose surgery was started earlier in the day . the use of intraoperative narcotics was statistically significant on the univariate analysis but after adjusting for confounders using bivariate analysis , it was not significant . the study showed that the incidence of ponv was one of the major anaesthetic risk factors for admission , which accounted for 51.14% of anaesthetic admissions . therefore , a comparison between the narcotic score and ponv was made , and a significant association was found . patients with a narcotic score of > 10 were nine times more likely to have ponv requiring admission . the ability to provide adequate pain relief without exacerbating ponv remains one of the major challenges for providers of outpatient anaesthesia and surgery . balanced analgesia techniques involving the use of opioids and other groups of analgesic drugs such as local anaesthetics and non - steroidal anti - inflammatory drugs are now being commonly used . post - operative pain is the most commonly reported complication of day care anaesthesia with up to 50% of patients experiencing wound pain . however , this study did not show that instead it demonstrated that the use of opiates can lead to ponv requiring admission . it was found that shorter fasting time of < 8 h induced a greater risk of unanticipated admission . the univariate analysis showed that shorter fasting time was at 2.2 times the risk of admission . the bivariate analysis showed that shorter fasting times had 1.9 times the risk of admission though not statistically significant . this group of patients may be the patients who are on the afternoon list starting at 12:30 pm , are allowed a light breakfast at 6 am and therefore have a higher risk of ponv . the duration of fasting and time of starting last case were stratified , and the mantel haenszel or calculated . since both the crude or and the mantel haenszel odd ratio were almost equal it was concluded that there was no confounding factor involved . the uncorrected incidence of unanticipated admission in our study was 8.11% , and this is because our day care facility was relatively new and the threshold level for admission was very low . surgeons request accounted for 36.5% of all cases when no real discernable reason could be made out . it may be that the surgeon suspects that he might have done a little more extensive procedure on the patient than anticipated , but does not fall under the category of complications . a small number ( 7.9% ) also included request for admission from the patient or parents of a child . the idea that patients can go home on the same day as the surgery is a novel one and one which patients find difficult to reconcile to and therefore request for admission . therefore , if both these groups are removed , the overall incidence works out to the value of 4.51% . our setup is part of a large tertiary hospital and in case of any apprehension , admission from the day care centre to the ward is relatively easy and more readily facilitated . the variables that were not significant were weight of the patient , distance travelled , pre - existing medical disease , and asa status , type of anaesthetic and experience of the anaesthetist . type of surgery and gender also had no detectable effect on admission , as evidenced in other studies . although it was expected that pre - existing medical disease , type of anaesthetic and type of surgery would be significant , it was not so in our study . a large sample size and doing asa 3 and 4 patients in the day care facility", "the factors associated with unanticipated admissions included longer duration of anaesthesia and surgery , later time of starting last case , shorter hours of fasting and the greater dose of narcotics used . these factors can guide decision making to facilitate improved efficiency of the day care centre . the low rates of medical causes of admissions reflect a good pre - anaesthetic assessment in terms of the suitability of patients .", "", "" ]

[ "the relationship between the clotting cascade and the promotion or inhibition of the anti - inflammatory response continues to be defined through basic research . the potential key role of proteins that were originally believed to be exclusively involved in coagulation in the inflammatory response provides an exciting potential mechanism(s ) for modification through the application of new therapies . the accompanying review by riewald and ruf outlines the available information on the possible steps involving some of the various proteins that are common to both coagulation and inflammation . the complexity of the multiple actions of the proteins in both inflammation and coagulation should excite the clinician with regard to potential new therapies that may be beneficial via activation of one or both of the concurrent pathways . however , before clinicians can administer new therapies that utilize new knowledge on the actions of coagulation cascade components , and hence improve the outcomes of their patients , several gaps in our current understanding must be addressed . this information is imperative if the clinician is to take basic knowledge ' to the bedside ' , where individual patients can benefit .", "administration of intrinsic or synthetic analogues of coagulation cascade components ( e.g. protein c , thrombin , and factor viia or xa ) , coagulation inhibitors ( e.g. heparin or analogues ) , or agonists or antagonists of the protease - activated receptors , in an attempt to alter the individual patient 's coagulation / inflammation balance , could theoretically produce responses ranging from beneficial to detrimental . knowledge of the ' most beneficial ' balance between augmenting or inhibiting the contribution of the clotting cascade components to inflammation would be required for determining the selection and dosing of potential new therapies .", "a safe assumption is that any new therapies that alter the intrinsic response to coagulation and inflammatory stimulants would also potentially produce detrimental effects on these , and potentially other , physiological responses . a simple example of such a potential for detrimental effects is the administration of protein c resulting in undesirable haemorrhage . this example illustrates that a broader knowledge of the impact of altering the coagulation/ inflammatory response will be required before clinicians can comfortably utilize new therapies in patient care .", "it is unlikely that any new therapies resulting from the new knowledge of the contribution of the clotting cascade to inflammation can be applied to all patients . it can be anticipated that certain patients would have contraindications to the new therapies or that dosages would need to be adjusted on the basis of pharmacokinetic or pharmacodynamic variables . the clinician will need to know what these contraindications and variables are before the new therapies can be used confidently . some , such as coagulation disorders , may be known and obvious , but any new strategies that could potentially alter the balance of a complex physiological response may be anticipated to be influenced by many , as yet unknown , factors in the individual patient . an example is the concurrent administration of heparin , which appears to antagonize the anti - inflammatory effect of antithrombin iii in septic patients . a more complete understanding of the impact of concurrent conditions , therapies and the patient 's genetic make - up on outcome will be required if we are to obtain the maximum benefit from new therapies .", "for any new therapy resulting from our expanded knowledge of the clotting cascade in the inflammatory response to be tailored to the needs of the individual patient , a method(s ) for rapidly and easily assessing the patient 's dynamic inflammatory response will be required . unless any new therapies have very benign toxicities , the need to assess the need , dosage and response to treatment will mandate sensitive and specific monitoring techniques . bedside or clinical laboratory techniques that could be applicable to most clinical environments would allow the benefit of any new therapies to be applied to the greatest number of patients . conversely , any new treatments that require complex , laborious monitoring techniques will have limited applicability .", "as our knowledge of the contribution of the intrinsic coagulation components increases , the development of many potential new therapies will hopefully emerge for clinical use . these may be totally new therapeutic entities or new strategies for using existing drugs or clotting factors . such developments will create the new dilemma for the clinician , namely that of trying to select between different treatment options for the individual patient . clinical trials outlining the potential anticipated benefit(s ) and the appropriate target patient population for each new therapeutic strategy will need to be completed . this will allow the clinician to ensure that the most appropriate strategy can be selected for the individual patient .", "the above - mentioned concerns aside , the clinician should be excited about the expanding knowledge of the role of coagulation cascade components in modifying the inflammatory response . such knowledge will hopefully result in new strategies and therapies to manage the septic patient .", "" ]

[ "myelofibrosis ( mf ) belongs to the category of myeloproliferative neoplasms ( mpns ) and may present as a primary disorder ( primary myelofibrosis [ pmf ] ) or evolve from polycythaemia vera ( pv ) or essential thrombocythaemia ( et ) to post - pv or post - et mf.1 it is characterised by the clonal proliferation of a pluripotent haematopoietic stem cell,2 in which the abnormal stem cell population releases several cytokines and growth factors into the bone marrow microenvironment , thus leading to an increase in bone marrow fibrosis , stromal changes , involvement of extramedullary organs such as the spleen and liver , and consequent clinical manifestations.3 myelofibrosis has an incidence of about 0.58 new cases per 100 000 person - years , but a higher prevalence of 6 per 100 000 person - years because of its chronic and disabling course.4 median age at diagnosis is 67 years , without any significant difference in distribution between the sexes . the diagnosis of mf is currently based on the world health organization 2016 criteria , which include the jak2v617f mutation that is detected in 50% to 60% of all cases.58 mutations in genes other than jak2 such as mpl mutations ( frequency : 5%10%)9,10 and somatically acquired mutations in the calr gene ( frequency : 15%20%)11,12 have also been described . however , about 10% of patients with mf do not develop any known mutation and are considered to have triple - negative mf.13 in addition to these 3 driver mutations , numerous other somatic mutations involving epigenetic processes ( ezh2 , tet2 , asxl1 , and dnmt3a ) , spliceosome machinery ( srsf2 , sf3b1 , and u2af1 ) , and disease evolution ( eg , tp53 , idh1/2 , and ikzf ) have been identified in mf.1416 some of these mutations , such as those in dntm3a17 or tet2,18 have not been shown to correlate with survival outcome . conversely , mutations in asxl1 , srsf2 , and ezh2 predicted short survival in a large cohort of patients . more specifically , a report by tefferi et al19 points to the calr/asxl1 + profile as the most detrimental mutation profile in pmf . the symptoms mainly include those associated with splenomegaly ( abdominal distension and pain , early satiety , splenic infarction , dyspnoea , and diarrhoea ) and constitutional symptoms such as fatigue , cachexia , pruritus , bone pain , weight loss , and fever ; these worsen patients role functioning and quality of life ( qol ) . median survival ranges from approximately 3.5 to 5.5 years,20,21 and the most frequent cause of death in patients with mf is transformation to acute myeloid leukaemia ( 20% ) , but most patients die because of other disease - related events , such as progression without transformation , infections , and thrombo - haemorrhagic complications.20 prognosis is currently based on 3 different prognostic scoring systems , which mainly refer to age , constitutional symptoms , anaemia , white blood cell counts , and percentage of peripheral blood blasts : international prognostic scoring system ( ipss ) , which is applicable at diagnosis20 ; dynamic international prognostic scoring system ( dipss)22 ; and dipss - plus , which can be applied at any time during followup . the last incorporates 3 additional independent risk factors : red blood cell ( rbc ) transfusion requirement , platelet counts of < 100 10/l , and an unfavourable karyotype ( table 1).23 until recently , mf has remained orphan of curative treatments : the only treatment that has a clearly demonstrated impact on disease progression is allogeneic haematopoietic stem cell transplantation ( allo - hsct ) , but treatment - related mortality is high and only a minority of patients are eligible for such intensive therapy.24 the previously used treatments were palliative and have only limited benefits in qol and symptom control . however , the discovery of jak2 mutations , which has established that dysregulation of the jak - stat signalling pathway is a major contributor to the pathogenesis of mpns , has also led to the development of small - molecule jak1/2 inhibitors , the first of which ( ruxolitinib ) has been approved for the treatment of mf in the united states and europe . in this article , we report on old and new therapeutic strategies that proved effective in early preclinical and clinical trials and subsequently in the daily clinical practice for patients with mf , particularly concerning the topics of anaemia , splenomegaly , iron overload ( io ) , and allo - hsct .", "the management of anaemia can be one of the most challenging aspects of treating patients with mf ( table 2 ) . blood transfusion is the standard therapy for symptomatically anaemic patients , and the transfusion target should be assessed individually . corticosteroids ( eg , prednisone 0.5 mg / kg / day ) may be temporarily effective in treating anaemia and constitutional symptoms and are usually used in combination with other therapies.25 erythropoiesis - stimulating agents ( esas ) are worth trying in mf patients with moderate , nontransfusion - dependent anaemia and a low serum erythropoietin level ( < 125 iu / l ) , although rapid spleen enlargement during treatment has occasionally been reported . response rates vary from 23% to 60% in different studies , with no clear evidence favouring darbepoetinalfa over conventional recombinant erythropoietins . furthermore , responses are usually short - lived ( < 1 year ) , and as no prospective randomised study of the value of esas has yet been published , they are not indicated in anaemic subjects with established transfusion dependency.26 if there are no contraindications , androgen preparations or danazol ( a semisynthetic attenuated androgen ) can be used . they have been shown to stimulate erythropoiesis in patients with refractory anaemia , leading to increased haemoglobin ( hb ) levels , reticulocytosis , and a decreased need for rbc transfusions27 ; however , documentation of their efficacy as single agents is largely restricted to retrospective studies . one of these reported responses in 11 of 30 patients with mf , including 8 with a complete response,28 with a lack of transfusion dependence and higher pretreatment hb levels predicting response . in another retrospective study , responses were observed in 17 of 39 patients with mf taking danazol , including 8 ( 21% ) with an increase in hb of 1.5 g / dl , hb levels of > 10 g / dl , and transfusion independence for 8 weeks.29 however , there were no identifiable patients characteristics ( such as transfusion dependency , baseline hb level , or cytogenetic results ) that influenced outcome . these findings have been confirmed in a recent series of 50 patients with mf30 ; the slightly lower rate of anaemia response ( 30% ) should be attributed to the use of more stringent response criteria.31 in terms of predicting response , the only pretreatment variable showing a trend for an association with response to danazol was transfusion dependency , with only 18.5% of the responders in this subgroup of patients against 43.5% in the subgroup not requiring transfusions . the main limitations of using danazol are toxicities , including fluid retention , increased libido , liver function test abnormalities , headache , and virilisation . all patients receiving danazol should therefore be monitored using monthly liver function tests during initial therapy and periodic liver ultrasound examinations to detect any hepatic malignancy . the antiangiogenic and immunomodulatory properties of thalidomide , lenalidomide , and pomalidomide make them potentially effective medical therapies for mf , with some responses in patients with anaemia , thrombocytopenia , and splenomegaly ; potential modifications to the bone marrow microenvironment ; and a possible reduction in bone marrow fibrosis . the combination of thalidomide and prednisone has been evaluated in 21 patients with mf , 62% of whom showed an anaemia response.32 however , the high incidence of neuropathy associated with thalidomide limits its usefulness . furthermore , because of the risk of thrombosis , prophylaxis with aspirin is recommended in all patients with a platelet count of > 50 10/l . this combination is therefore not usually selected for the first - line management of anaemia . a phase ii clinical trial ( nct00227591 ) assessed the therapeutic efficacy of lenalidomide combined with prednisone in 42 patients with mf . clinical improvements in anaemia and splenomegaly were observed in , respectively , 19% and 10% of the subjects . similar to thalidomide , lenalidomide was burdened by toxicity , including cytopenia ( at least 1 grade 34 event in 88% of patients ) and nonhaematologic toxicity ( at least 1 grade 34 event in 45% of patients).33 a second study of lenalidomide plus prednisone in 40 patients with intermediate - risk or high - risk mf led to an overall response rate based on international working group criteria of 30% for anaemia and 42% for splenomegaly , with a median time to response of 12 weeks . however , grade 3 and 4 adverse events ( aes ) were reported , mainly cytopenia.34 a recently updated report of this study after a median follow - up of 9 years35 showed that treatment responses improved over time , with 14 patients ( 35% ) responding overall . more specifically , 39% of the patients showed a response in terms of reduction in spleen size , and the overall anaemia response rate was 32% . however , there was no significant difference in baseline characteristics between the patients who responded and those who did not . an analysis combining the results of 3 phase ii trials indicated that lenalidomide - based therapy may be more effective than thalidomide - based therapy , and fewer patients treated with lenalidomide plus prednisone discontinued therapy due to toxicity than those receiving thalidomide - based therapy . in addition , there was no significant difference in the response to lenalidomide alone and lenalidomide plus prednisone ; however , response duration was significantly longer in patients who received lenalidomide plus prednisone.36 pomalidomide , a more potent immunomodulatory drug , has been evaluated in a multicentre , double - blind , placebo - controlled phase iii study ( nct01178281).37 however , the study failed to meet the primary endpoint as an equal proportion of patients with mf in the pomalidomide ( n = 152 ) and placebo arm ( n = 77 ) achieved an anaemia response ( 16% vs 16% , p = 1 ) . on the contrary , the platelet response was significantly better in patients who received pomalidomide ( 22% vs 0% ) .", "cytoreductive agents have been the treatment of choice for most mf patients with symptomatic splenomegaly ( table 3 ) . hydroxyurea ( hu ) , an s - phase cell cycle specific nucleotide - depleting agent that inhibits ribonucleotide reductase,38 is one of the most widely used medical therapies for patients with appreciably symptomatic splenomegaly,39,40 although it induces only modest responses at higher doses ( 12 g daily ) and mainly in subjects with nonmassive splenomegaly ( < 15 cm).45 although hu is generally well tolerated , the modest improvement in symptoms is temporary , and exacerbated cytopenia frequently limits treatment . in patients who do not respond to hu , it has been shown that the oral alkylating agents , melphalan and busulfan , improve splenomegaly and other disease symptoms , but they may also exacerbate cytopenia and possibly increase the frequency of leukaemic transformation . furthermore , they are mainly used in older patients as they are relatively manageable insofar as frequent laboratory monitoring is not required , unlike in the case of hu or other cytoreductive agents.41,46 in cases of massive refractory splenomegaly , it has been found that monthly courses of intravenous cladribine ( 2-chlorodeoxyadenosine ) lead to a response in up to 50% of patients , with severe but reversible cytopenia being the main toxicity.42 interferon - alfa ( standard and pegylated versions ) has proved to have only a minimal clinical effect in reducing splenomegaly , and therefore , its use is not generally recommended.43 hypomethylating agents , such as azacitidine and decitabine , have also been studied in mf , but currently play only a limited role in its treatment.47 more recently , thomas et al48 demonstrated that methotrexate ( mtx ) may act as an inhibitor of the jak - stat pathway and that this activity is likely to be specific and not related to a general effect on protein phosphorylation : the drug s in vitro activity was observed at a concentration equivalent to that used in patients taking low - dose mtx ( 525 mg / wk ) . what is important is that its efficacy in controlling haematologic parameters , systemic symptoms , and splenomegaly has been confirmed in vivo in 2 recent case reports.49 splenectomy is a palliative debulking measure used in patients with mpns . its indications are mainly symptomatic massive splenomegaly , symptomatic portal hypertension with oesophageal varices and/or bleeding , profound cachexia , transfusion - dependent anaemia , and/or severe hypercatabolic symptoms . removal of the spleen improves mechanical symptoms ( ie , early satiety and pain ) in most cases and is often followed by weight gain in cachectic patients , but it is usually not effective against other constitutional symptoms . improvements in anaemia and thrombocytopenia after splenectomy have been reported in , respectively , 50% and < 30% of patients . progressive hepatomegaly sometimes follows splenectomy , probably due to the migration of haematopoiesis , and a markedly enlarged liver is a contraindication to splenectomy . current data concerning an increased rate of leukaemic transformation after spleen removal are still discordant.44,50 however , given the high complication rate and limited benefit of splenectomy , appropriate patient selection is crucial.51 splenic radiotherapy , on a fractioned basis , at a daily dose of 0.4 to 1 gy , with weekly evaluation of spleen size and haematologic values until therapeutic effect is achieved or haematologic toxicity develops , can be used to treat mpns with an adequate platelet count ( > 50 10/l ) , as extramedullary haematopoiesis has proved to be considerably sensitive to external beam radiotherapy in patients with mf . however , it leads to only transient benefits and may exacerbate cytopenia , particularly thrombocytopenia.50 it also has to be remembered that radiation can also cause local fibrosis with splenic adhesions to surrounding tissues that make a subsequent splenectomy technically more complicated and increase the morbidity and mortality of the procedure . in general , traditional treatment options are limited and insufficient to address the morbidity and mortality associated with mf . however , as mentioned above , the discovery of mutations leading to constitutive activation of the jak - stat signalling pathway raises hope that mf may be cured by selective jak1/2 inhibitors , as happens in the case of chronic myeloid leukaemia treated with bcr - abl1 tyrosine kinase inhibitors . ruxolitinib ( jakavi ; novartis , basel , switzerland ) was the first jak1/2 inhibitor to become commercially available for the treatment of mf.52 in preclinical jak2v617f - positive mpn mouse models , it induced a considerable downregulation of jak - dependent proinflammatory cytokines , reduced mouse splenomegaly , and showed antiproliferative and proapoptotic activities . it is the only jak inhibitor approved in the united states for the treatment of splenomegaly in subjects with intermediate / high - risk mf and in europe for the treatment of splenomegaly and/or constitutional symptoms in patients with intermediate-2/high - risk mf.53 these approvals were based on the results of 2 phase iii randomised studies : comfort - i ( ruxolitinib vs placebo ) and comfort - ii ( ruxolitinib vs best available therapy [ bat]).54,55 the primary endpoint of both studies was a > 35% reduction in spleen volume after 24 ( comfort - i ) or 48 weeks of treatment ( comfort - ii ) , which was reached by , respectively , 41.7% and 28.5% of the patients treated with ruxolitinib , as against , respectively , 0.7% and 0% of the patients receiving placebo or bat ( p < .0001).54,55 overall , more than 90% of the patients enrolled in both studies experienced some reduction in spleen volume at some time during the follow - up , and the reduction remained stable in most of the patients after a median follow - up of 3 ( comfort - i ) and 5 years ( comfort - ii).56,57 the therapeutic success of ruxolitinib is not limited to reducing spleen volume because , unlike the drugs previously used to treat mf , it is efficacious in relieving constitutional symptoms ; reducing abdominal discomfort , appetite loss , itching , fatigue , and night sweats ; and improving the qol of most treated patients . as the drug s activity is independent of jak2 mutational status and not specific for the neoplastic clone , the response rate is similar in patients with and without the jak2v617f mutation because of its anti - jak1mediated effect . the uk , open - label , phase ii robust study evaluated its safety and efficacy in patients with mf , including those at intermediate-1 risk . the treatment was successful in 50% of the population as a whole and 57% of the intermediate-1risk patients . reduction in spleen length and symptoms was observed in all of the risk groups , and improvements in the myelofibrosis symptom assessment form total symptom score were seen in 80% of intermediate-1 , 72.7% of intermediate-2 , and 72.2% of high - risk patients.58 similarly , the phase iiib expanded - access jak inhibitor ruxolitinib in myelofibrosis patients ( jump ) trial for patients with mf without access to ruxolitinib outside of a clinical study found that the drug s safety and efficacy profile in intermediate-1risk patients was consistent with that in the study population as a whole and with that previously reported in intermediate-2risk and high - risk patients.59 the toxicity of ruxolitinib treatment is mainly haematologic due to the drug s interference with an essential pathway for haematopoiesis , as demonstrated in the comfort studies ; in both trials , thrombocytopenia was the dose - limiting toxicity , and anaemia was the most common haematologic ae . a number of studies have shown that ruxolitinib affects many cytokines and interferes with the immune process necessary for the pathogenesis of mpns , but it also affects the function of various immune cells and may therefore favour an increased incidence of opportunistic and nonopportunistic infections.60,61 for example , ruxolitinib impairs natural killer cell differentiation and function and inhibits dendritic cell activation and migration , and antigen - specific t - cell responses in a dose - dependent manner in vitro and in vivo . however , despite warnings about this increased risk,6264 a recent update of the jump study described a low incidence of infections : the all - grade infections observed in 1% of patients included nasopharyngitis ( 6.3% ) , urinary tract infection ( 6% ) , pneumonia ( 5.3% ) , bronchitis ( 4.2% ) , herpes zoster ( 3.6% ) , influenza ( 3% ) , upper respiratory tract infection ( 2.9% ) , cystitis ( 2.5% ) , gastroenteritis ( 1.8% ) , respiratory tract infection ( 1.8% ) , and oral herpes ( 1.6% ) . other infections included tuberculosis in 3 patients ( 0.3% ) and legionella pneumonia in 1 patient ( 0.1% ) . no hepatitis b reactivation was reported , and only 6 patients ( 0.5% ) discontinued treatment because of grade 3 pneumonia.59 the patients receiving ruxolitinib in the comfort - ii study experienced higher rates of viral and bacterial infection than those receiving conventional therapy , but most of the infections were grade 1 or 2 and did not lead to any dose reductions or the discontinuation of trial medication . furthermore , the rates of infection tended to decrease with longer exposure to the drug . however , as patients with mf are already predisposed to infections65 and the long - term risks of ruxolitinib treatment are still unknown , treated patients should be carefully monitored , and prophylaxis for herpes zoster or other infections should be considered on a case - by - case basis , depending on local risk . given its promising results , a further indication for ruxolitinib treatment is as a therapeutic bridge to allo - hsct . furthermore , an increasing number of reports appeared in the literature , describing the morphologic changes in the bone marrow occurring in ruxolitinib - treated patients , mostly focusing on modifications in bone marrow fibrosis degree.6670 by the beginning of 2014 , a number of other jak2 inhibitors were being tested : fedratinib,71 pacritinib,72 ly2784544,73 and momelotinib.74 however , the clinical trials of fedratinib and pacritinib were soon discontinued because of safety problems : wernicke encephalopathy ( fedratinib ) and bleeding ( pacritinib ) . momelotinib ( formerly known as cyt387 ) is a small - molecule , adenosine triphosphate its kinase profiling indicates that it has good selectivity over other jak family kinases ( jak3 , tyk2 ) and excellent selectivity over other tyrosine and serine / threonine kinases.75 the preclinical data provide a rationale for the use of momelotinib in bcr - abl1negative mpns , and a multicentre phase i / ii trial involving 166 patients with intermediate / high - risk mf showed that the drug is well tolerated at oral doses of 150 or 300 mg once daily or 250 mg twice daily and led to improvements in splenomegaly , constitutional symptoms , and transfusion requirement.74 of particular interest are the transfusion independence responses , which were observed in more than half of the rbc transfusion dependent subjects with a maximum transfusion - free period exceeding 2 years . in addition , the percentage of all subjects requiring rbc transfusions substantially decreased over the treatment period . more precisely , the overall anaemia response rate was 54% in transfusion - dependent patients with a median time to a confirmed anaemia response of 12 weeks ( range : 84293 days ) . as has been previously reported , treatment with momelotinib led to a rapid and sustained reduction in splenomegaly in approximately 31% of all cases , with a median time to response of 15 days , and the constitutional symptoms of most of the patients disappeared within 6 months . in terms of safety , about 20% of the patients experienced a first - dose effect ( dizziness , flushing , and hypotension ) that was self - limited . grade 3/4 haematologic and nonhaematologic aes were infrequent with the exception of thrombocytopenia , which occurred in approximately 17% of patients . grade 3/4 nonhaematologic laboratory aes included hyperlipasaemia ( 4% ) and increased liver enzymes ( grade 3 and 4 increase in aspartate aminotransferase in , respectively , 1% and < 1% of the patients ; a grade 3 increase in alanine aminotransferase in 2% ) . mainly , grade 1 treatment related sensory peripheral neuropathy was reported , but there were no treatment - related deaths . in brief , momelotinib seems to lead to a significant and lasting improvement in anaemia , splenomegaly , and constitutional symptoms at doses of 150 or 300 mg / day or 150 mg twice daily . the efficacy and aes of momelotinib will be further evaluated in 2 currently ongoing phase iii trials : a randomised bat - controlled study of mf patients with anaemia and thrombocytopenia previously treated with ruxolitinib and a randomised study comparing momelotinib and ruxolitinib in patients with mf ( nct02101268-nct01969838 ) . more recently , the efficacy and safety of 3 dose levels of a potent and selective oral jak1 inhibitor , incb039110 , have been evaluated in an open - label phase ii study , resulting in clinically meaningful symptom relief , modest spleen volume reduction , and limited myelosuppression.76 in particular , only 1 patient discontinued for grade 3 thrombocytopenia , whereas nonhaematologic aes were largely of grade 1 or 2 and most commonly represented by fatigue .", "nearly 40% of patients with mf are anaemic at the time of diagnosis , including 25% who are already transfusion dependent,77,78 and more than 60% will develop clinically significant anaemia during the course of follow - up.49 the clinical impact of io and its potential relationship to the heightened inflammatory response of patients with mf warrant consideration not only because potential liver dysfunction , cardiac disease , and other complications of io probably contribute to patient morbidity and mortality but also because the growing evidence of impaired haematopoiesis attributable to bone marrow haemosiderosis suggests a viable therapeutic target.79,80 each unit of rbc contains 200 to 250 mg of iron , and as the reticuloendothelial system can clear approximately 10 to 15 g ( corresponding to 50 rbc units ) , any excess is deposited in tissues and leads to organ damage.81 iron overload is a concern when treating patients with mf , which is why iron chelation therapy ( ict ) has been used to counteract its potentially negative effects . however , it has to be admitted that there is a lack of prospective , randomised , controlled trials of the use of ict in patients with mf . one small retrospective study of 10 patients with mf demonstrated an erythroid response in 40% of cases receiving oral ict with deferasirox ( dfx ) , thus allowing these patients to reduce their transfusion requirement ; it also revealed a trend towards better overall survival in the responding patients.82 other data coming from a number of reported case studies79,80,83,84 also indicate that ict improves anaemia and decreases transfusion dependence in patients with mf . finally , a recent retrospective , multicentre analysis of 28 patients with mf and io secondary to transfusion dependence found that 11 patients ( 42.3% ) achieved a stable and consistent reduction in ferritin levels ( < 1000 ng / ml ) , and 6 of 26 patients ( 23% ) showed a persistent ( > 3 months ) increase in hb levels to > 1.5 g / dl , with the disappearance of transfusion dependence in 4 cases . however , comparison of the baseline characteristics of the patients who achieved an erythroid response and those who did not achieve did not reveal any significant differences that could be considered predictive.85 deferoxamine ( desferal ) is a linear ligand that forms 1:1 complexes with iron that maintain a net charge , allow for membrane permeability , and provide access to intracellular iron stores86 that are then excreted primarily in urine.87,88 it is administered in the form of an intravenous or subcutaneous infusion , and because of its short plasma half - life , the efficacy of the treatment correlates with the duration of infusion , and it is only effective if administered at high doses between 5 and 7 times per week.89 when administered as a continuous 24-hour infusion for 6 to 7 days per week in patients with high - risk -thalassemia , it can reverse iron - induced cardiac dysfunction and increase long - term survival.90 however , treatment - related side effects include infusion site discomfort ( nearly 100% , with the development of local erythema or induration in some cases),91 visual changes ( 0%10% ) , generally transient auditory neurotoxicity ( 20%25%),92,93 increased serum creatinine levels ( 22% ) , vomiting ( 16% ) , abdominal discomfort ( 14% ) , constipation ( 14% ) , arthralgia ( 14% ) , nausea ( 11% ) , rash ( 5% ) , and diarrhoea ( 5%).94 deferasirox is an oral iron chelator frequently used in clinical practice in the united states and europe that has a long half - life of 8 to 16 hours and can be administered once daily.89 it forms a 2:1 complex with iron,95 which is then excreted largely in the bile and faeces ( much less in urine).96,97 unlike other iron chelators , it is thought that dfx also affects haematopoietic stem cell differentiation by means of a reactive oxygen species mediated mechanism , which may underlie the erythropoeitic response seen in some dfx - treated patients.95 the most frequently reported adverse effects are gastrointestinal toxicity ( 21%64% ) , diarrhoea ( 46% ) , abdominal pain ( 15%28% ) , nausea ( 24% ) , vomiting ( 21% ) , and constipation ( 10%).94,98101 patients have also been reported to experience renal dysfunction ( 10%64% , usually nonprogressive at the start of treatment and improving after a dose reduction ) , skin rash ( 4%39% ) , arthralgia ( 15%),94 and transaminitis ( 4%70%),81,98101 and there have been rarer reports of auditory neurotoxicity ( 1%6% ) as a potential side effect.100,101 it is not entirely clear whether ict can reverse the ill effects of io , and there are no completed studies that provide prospective evidence of a beneficial impact in terms of the restoration of normal haematopoiesis or outcomes in patients with mf . consequently , treatment decisions concerning the use of ict in patients with mf continue to be extrapolated from the data of myelodysplastic syndromes .", "allogeneic haematopoietic stem cell transplantation is still the only intervention that has been shown to be a potential cure for mf or a means of prolonging the survival of these patients . data from the most recent studies suggest that the expected 3-year progression - free survival rate is in the range of 40% to 50%.102 the adoption of reduced intensity conditioning regimens has recently made allo - hsct applicable to a larger proportion of patients.103 however , decisions concerning allo - hsct are based on inductive reasoning and require a considerable professional experience . key questions include patient selection , donor selection , pre- and posttransplant management , conditioning regimen , and prevention and management of post - transplant relapses . international prognostic scoring systems ( ie , ipss , dipss , and dipss - plus)20,22,23 are the most comprehensive means of risk stratification currently available to guide therapeutic decision making , although the influence of driver mutations and the acquisition of additional mutations during the natural course of the disease may further refine this process . all patients with mf aged < 70 years with ipss , dipss , or dipss - plus intermediate-2risk or high - risk disease and a reasonable performance status , and without any significant competing comorbid conditions , should be considered potential candidates for allo - hsct . patients aged < 65 years with intermediate-1risk disease should only be considered candidates if they present with refractory , transfusion - dependent anaemia or > 2% of peripheral blood blasts , or adverse cytogenetics ( as defined by the dipss - plus classification ) . finally , patients with low - risk disease should not undergo allo - hsct.104 individual transplant - specific prognostic factors should be considered in every candidate for allo - hsct to be able to make individualised decisions . in this context , the transplant - specific high - risk factors include a spleen extending more than 22 cm below the costal margin , having been transfused with more than 20 rbc units , having received a transplantation from an hla nonidentical donor , a poor performance status ( an eastern cooperative oncology group status of > 2 ) , a high comorbidity index ( a haematopoietic cell transplantation comorbidity index score of > 3 ) , and the presence of portal hypertension . completely matched rather than mismatched donors should be selected because , as reported in the european blood and marrow transplantation registry , the cumulative incidence of nonrelapsed mortality after 1 year is , respectively , 12% and 38% and is not different between hla - identical siblings and 10/10 matched unrelated donors ( 10% vs 13%).105 however , haploidentical related donors are an attractive alternative source of haematopoietic stem cells.106 it is important to note that peripheral blood is considered the most appropriate source of haematopoietic stem cells in the case of hla - matched sibling and unrelated donors . when splenectomy is performed before allo - hsct , it may facilitate disease eradication . some reports have also shown faster engraftment in splenectomised patients ; however , the pretransplant use of splenectomy remains controversial as no study has yet prospectively evaluated the effect of protocol - based splenectomy before transplantation . in the case of older patients and/or those with comorbidities , a less intense conditioning regimen is more appropriate , whereas patients with advanced disease and a good performance status should undergo a more intensified regimen.104 finally , in patients relapsing with constitutional symptoms or splenomegaly , jak1/2 inhibitor treatment is recommended but remains experimental . to address this question , ruxolitinib is being administered to eligible patients with mf for 60 days before definitive allo - hsct in a prospective multicentre phase ii study conducted by the myeloproliferative disorders research consortium ( nct01790295 ) .", "traditional mf treatments are primarily palliative and have proved to be inadequate to address the considerable morbidity and mortality associated with this disabling disease . more specifically , concerning anaemia , there have been various therapeutic attempts , but rbc transfusions still remain the most frequently used approach , even though io represents an increasingly frequent clinical challenge . considering instead splenomegaly , besides hu , ruxolitinib , as well as other investigational jak1/2 inhibitors , offers new hope for these patients as they have been shown to lead not only to significant reduction in splenomegaly but also to the palliation of disease - related symptoms . however , allo - hsct is still the only intervention that has evidence indicating it is potentially curative . obviously , in such a context , participation into a clinical trial should be encouraged whenever possible , with the purpose of making new drugs available ." ]

[ "a 45-year - old iranian woman was referred to the private clinic in the city of hamadan for implant consultation . her past medical history was not notable , and there was no evidence of systemic disease . she had no history of trauma to the mandible . in the extra - oral examination , intra - oral examination revealed normal oral mucosa , the absence of soft tissue expansion , and teeth of a normal color . all of the teeth were asymptomatic , with no pain or tenderness on percussion or palpation . the involved teeth were vital in an electric stimulation test . for assessment before implant insertion , cbct had been ordered . during evaluation of the implant insertion areas on promax3d cbct ( planmeca oy , helsinki , finland ) , a radiolucent - radiopaque mixed lesion located on the apices of the lower incisors was observed . on the axial , sagittal , and coronal cbct images , the extension of the lesion was observed from the mesial side of the right mandibular lateral incisor to the distal side of the left mandibular lateral incisor . it was a multifocal lesion in which solitary lesions were reached together and made a larger lesion . the total dimension of the lesion was about 16.6 mm in the mesiodistal direction and 6.9 mm in the longest superior - inferior direction . on the panoramic reconstructed cbct image , the lesion associated with the left mandibular lateral incisor was radiolucent , whereas the lesion on the apex of the left central incisor was mixed radiolucent - radiopaque and the lesion associated with the right central incisor was radiopaque with a radiolucent rim around the lesion of this tooth ( fig . the state of the lesion relative to the buccal and lingual cortical plates could be assessed , which might not be possible on the conventional radiographs . on the axial image , one of them was located at the mesial side of the right canine and the other between the left central and lateral incisors ( fig . cross - sectional images , the discontinuity of the lingual cortex was found at the area between the two central incisors on several consecutive sectional images ( fig . this cortical discontinuity was more obvious on the three - dimensional ( 3d ) cbct images ( fig . however , it should be considered that the cortical bone could be seen to have destruction on 3d images , even though it would have been thin without discontinuity on the cross - sectional images . on the digital periapical radiograph that was taken for periodontal ligament space widening was found , especially around the root of the left lateral incisor . based on the patient clinical and radiographic findings , a diagnosis of multifocal periapical cemento - osseous dysplasia was made .", "pcod is a specific lesion within this group of conditions that usually occurs in middle - aged black women.4 a systematic review of the literature on cod indicated an ethnic distribution of 59% , 37% , and 3% for blacks , asians ( japanese , chinese , and korean ) , and caucasians including indian cases , respectively , in case reports.8 zegarelli et al reported the incidence of pcod in the general population to be 2 - 3/1000.9 periapical cemento - osseous dysplasia generally does not cause cortical bone expansion or perforation.9 - 12 alsufyani and lam reviewed the clinical and radiographic characteristics of 118 patients with cod.13 they showed that 71.6% of 118 patients had no cortical expansion , 76% had intact lamina dura , and 93% had a normal periodontal ligament space . modern advances in imaging help the dentist to use the cbct with the appropriate field of view and spatial resolution ; therefore , the internal mineralized structure of the pathologic lesions can be investigated with a low radiation dose.14 axial cbct images clearly demonstrate the location and extension of the lesion . the expansion and perforation of the cortical plates can be evaluated on cbct even if they are slight . this report showed the discontinuity of the lingual cortex on some axial and cross - sectional cbct images . this characteristic of the lesion was an unusual feature among the cases of pcod reported up to now that may be due to its large size and needed to be checked in further regular follow - ups . this feature also could be found in an exaggerated fashion on the 3d cbct images . although 3d imaging could help the radiologist in diagnosing the lesion for the first look , it should be noted that it is not a reliable viewing modality for assigning the real status of the lesion in relation to its surrounding bone structures . in many cod cases that have been misdiagnosed and/or mismanaged , the lesions were identified in their early stages as a periapical rarefying osteitis such as periapical abscess , granuloma , or cyst , and unnecessary endodontic treatment was performed . therefore , vitality tests are especially important for differential diagnosis . in the radiolucent - radiopaque mixed stage and the radiopaque stage , the differential diagnosis might include chronic sclerosing osteomyelitis , cementoossifying fibroma , odontoma , cementoblastoma , and osteoblastoma.13 periapical cemento - osseous dysplasia is usually detected on routine radiological examinations . however , the differential diagnosis of our case could be calcifying cystic odontogenic tumor and cemento - ossifying fibroma . by using cbct discrimination of pcod from these lesions that exhibit similar internal calcification on conventional radiography high density mass in pcod which is centered in low density area is different from findings of calcifying cystic odontogenic tumor in which calcification is observed at or near the cyst wall.15 also , cemento - ossifying fibroma has more obvious concentric buccolingual expansion on multiplanar cbct image . unless pcod is symptomatic , treatment is usually not needed because development and maturation of the lesion is self - limiting . intervention may cause secondary infection of the cementum - like radiopacities , which may in turn induce osteomyelitis in these lesions.13 however , if pcod demonstrates unusual changes or becomes symptomatic , surgical intervention would then be needed.7 this case was considered as no treatment with only periodic follow - up check ." ]

[ "endodontically treated teeth often loose substantial tooth structure from previous \n caries , pre - existing restorations , and/or endodontic treatment , which reduce tooth bulk and thickness of healthy dentin \n resulting in increased chances of fracture under function . controversy exists as to whether endodontic procedures \n are the primary cause for loss of strength . panitvisai and messer ( 1995 ) reported that cuspal deflection \n increased with increasing the extension of cavity preparations and was greatest when \n endodontic access was incorporated into a preparation . it has been reported that \n endodontically treated teeth and their contralateral vital pairs exhibited similar \n biomechanical properties , such as punch shear strength , toughness , and load required for \n fracture . although the insertion of a post does not strengthen or reinforce endodontically treated \n teeth , it is basically used to provide sufficient retention of \n the core material which in turn is used to retain a fixed restoration . for the inserted post to perform its \n function , several variables must be put into consideration such as post length , \n diameter , geometric design , and surface configuration . additionally , special attention should be given to the \n material the post is made of in order to ensure adequate distribution of the absorbed \n stresses and to prevent root fracture during . regarding with consideration to the well - known success of \n metallic posts there are now many concerns regarding the associated inhomogeneous stress \n distribution , biological side effects due to microleakage and corrosion , and the \n influence of their dark color under an all - ceramic restorations . the introduction of non - metallic fiber reinforced composite ( frc ) posts helped improving \n stress distribution because their elastic modulus is similar to that of dentin as \n indicated by several clinical and laboratory studies . frc post systems showed more frequent favorable failure \n modes than did metal post systems . although fiber posts proved effective \n in withstanding compressive loads in posterior teeth , they behave differently in anterior teeth where non - axial biting \n forces prevail and where their flexural behavior becomes more effective . recent studies suggested that glass - fiber posts contributed to the reinforcement \n and strengthening of endodontically treated teeth under full coverage crowns . a ferrule or encircling band of cast metal around the remaining coronal surface can \n provide protective reinforcement to endodontically treated teeth by encapsulation of the \n remaining coronal structure and by resisting functional lever forces during mastication . \n a minimum 1 to 2 mm of ferrule height is necessary to achieve such protective \n effect . recent clinical \n studies reported that the ferrule structure have a direct influence on the clinical \n success rate of endodontically treated premolars restored with fiber posts and the \n failure events were due mainly to post debonding . an in \n vitro study reported that incomplete crown ferrule was associated with \n greater variation in load capacity after chewing simulation , while other studies found no effect of different \n ferrule heights in teeth restored with fiber posts and resin cores . the aim of this study was to evaluate the fracture resistance and failure pattern of \n endodontically treated mandibular premolars restored with different ferrule heights in \n combination with fiber posts and all - ceramic crowns . the null hypothesis was that \n different ferrule heights do not improve the fracture resistance or the failure pattern \n of the tested restorations .", "all \n external debris were removed with an ultrasonic scaler , and examined stereoscopically \n at 10x magnification to verify the absence of cracks , defects and dental caries . \n teeth were stored in a 0.5% chloramine t ( prolabo , paris , france ) in saline solution . \n buccolingual and mesiodistal coronal dimensions plus root length of all selected \n teeth were measured using a digital caliper ( digimatic calipers , mitsutoyo , tokyo , \n japan ) and only teeth with the following mean dimensions were selected : 14.1 mm root \n length , 7.3 mm buccolingual width , and 4.9 mm mesiodistal width . standardized root canal preparations were made using the following procedure : initial \n probing using no . 10 k - files ( flexo files , maillefer , ballaigues , switzerland ) ; the \n root canal length was established through direct observation of the file extruding \n from the apical foramen . the specimens were then prepared endodontically with a \n stepback procedure with size 45 ( flex r file ; union broach , york pa ) . after \n intermittent rinsing with 2.5% sodium hypochlorite solution , the endodontic treatment \n was completed using manual lateral condensation method ( ah plus , dentsply , de tray , \n konstanz , germany ) . after endodontic treatment , each root was thinly covered with a silicone impression \n material ( aquasil , dentsply ) to simulate thickness of periodontal ligament . all specimens were embedded in \n self - polymerized acrylic resin ( orthoresin , dentsply , degudent gmbh , postfach 1364 , \n d-63403 hanau , germany ) poured into a mold while maintaining 2 mm below the cervical \n line exposed . the teeth were embedded along their long axis using a surveyor ( ney \n surveyor ; dentsply ) . a new diamond \n point ( lot - nr 1599 , dfs dental and technical products , gmbh , germany ) was attached to \n the milling machine ( k9 milling apparatus-990 , kavo , germany ) for every group . the \n mrd gauged diamond had a self - limiting tip , which produced a 1-mm - deep chamfer and \n the margins and the angle of convergence were standardized . after preparation of the finish line , the coronal dentinal extension was modified \n accordingly ( figure 1 ) : group 1 ( control ) : 1 mm \n circumferential ferrule from the gingival margin without a fiber post ; group 2 : 1 mm \n circumferential ferrule with fiber post and resin core ; group 3 : non - uniform ferrule \n height ( 2 mm buccally and 1 mm lingually ) with fiber post and resin core ; group 4 : a \n non - uniform ferrule height ( 3 mm buccally and 2 mm lingually ) with fiber and resin \n core post ; group 5 : received no ferrule preparation with fiber post and resin \n core . schematic representation of the different tested groups in the control group , excess gutta - percha was removed to a depth of 2 mm from the \n coronal surface of the preparation , using a carbide bur ( 171l-012 , brasseler , usa ) . \n the coronal walls were etched with 36% phosphoric acid ( total etch , ivoclar - vivadent , \n schaan , liechtenstein ) for 15 s , washed with water spray and then gently air - dried . \n one coat of adhesive resin ( excite , ivoclar - vivadent ) was applied using a microbrush \n and light polymerized for 20 s ( astralis 10 , ivoclar - vivadent ) . a hybrid composite \n resin ( tetric ceram , ivoclar - vivadent ) was applied and light polymerized for 40 \n s. for the remaining groups , post space was created using no . 1 peeso reamer ( union \n broach co. , long island , ny , usa ) and corresponding calibrating drill ( frc postec \n plus , # 1 , ivoclar - vivadent ) leaving 4 mm of apical gutta - percha intact . a translucent \n glass fiber reinforced composite post ( frc postec plus # 1 ivoclar - vivadent , schaan , \n liechtenstein ) was used . each post was cut to a suitable length with a diamond bur so \n that it was covered with at least 2 mm of resin composite occlusally . post cementation was carried out with self - polymerized resin cement ( multilink , \n ivoclar vivadent ) following manufacturer s instructions . silane coupling agent \n ( monobond - s , ivoclar - vivadent ) was applied on the post surface for 60 s and then \n air - dried . after post cementation , the surrounding dentin surface was etched with 36% \n phosphoric acid ( total etch , ivoclar - vivadent ) for 15 s , washed with water spray and \n gently air - dried . one coat of adhesive resin ( excite , ivoclar - vivadent ) was applied \n using a microbrush and light polymerized for 20 s ( astralis 10 , ivoclar - vivadent ) . \n then core build - up was performed using hybrid composite resin ( tetric ceram , \n ivoclar - vivadent ) in 1-mm - thick increments and light polymerized ( astralis 10 ; \n ivocar - vivadent ) for 40 s until the core was restored to predetermined dimensions . \n the final layer was placed using a transparent matrix to allow for shape consistency \n between specimens . the dimensions of the prepared cores were confirmed with a \n measuring microscope with 30x magnification lens with precision of 5 um . a single - phase impression was made using polyvinylsiloxane impression material \n ( virtual , ivoclar - vivadent ) and master dies were fabricated with type 4 die stone \n ( jad stone , whip mix , louisville , kentucky , usa ) . a press ceramic ( e max , a3 , \n ivoclar - vivadent ) was selected to fabricate all - ceramic crowns of the restored \n specimens . crown dimensions were standardized by using a mold for the external shape \n of each specimen . the fitting surface of the crowns was pretreated with hydrofluoric \n acid ( ips ceramic etching gel , ivoclar - vivadent ) for 20 s , rinsed off , air dried , \n silanized for 60 s and air dried . dentine primer liquids were mixed and applied on \n the whole prepared tooth surface for 15 s. resin cement was dispensed from the \n automix syringe directly into the inner surface of the crowns which were seated and \n held in position under fixed load of 20 n ; excess resin was removed immediately with \n a micro brush . exposed margins were covered with glycerin gel and rinsed off after \n complete polymerization of the resin cement . the specimens were stored in distilled \n water at 37c for 7 days prior to testing . all specimens were subjected to cyclic loading according to the following regime : \n sinusoidal load between 50 and 200 n at a rate of 2 hertz . all specimens received \n 15,000 cycles and surface damage was prevented by insertion of a 0.5 mm silicon sheet \n between the occlusal surface of the ceramic crown and the loading indenter ( 3 mm \n diameter ) of the pneumatically activated loading machine . after completion of cyclic \n loading , a universal testing machine ( instron 8500 plus , instron , 100 royal st . \n canton , ma , usa ) was used to deliver a compressive load to the specimens at a \n crosshead speed of 1 mm / min at 45 degree angle to the long axis of the teeth ( root \n apex tilted lingually ) until failure . load - time curves were recorded using a \n universal testing machine s computer software . the \n failure load of the specimen was determined when the forceversus - time graph showed an \n abrupt change in load , indicating a sudden decrease in the specimen s resistance to \n compressive loading . after loading , the failure mode recorded for each specimen and classified as either \n favorable facture above the cement - enamel junction ( repairable ) or catastrophic \n fracture of the root below cement - enamel junction ( non repairable ) . these inspections \n were made using a stereomicroscope ( stereoscopic zoom microscope , smz-1000 , nikon , \n japan ) and during inspection , the teeth were trans - illuminated with a fiber optic \n cable . complete or partial debonding of the crown or of the post and core were also \n considered as favorable failure modes . data were analyzed statistically by one - way \n anova and tukey s post - hoc test was used for pair - wise comparisons \n ( =0.05 ) .", "all \n external debris were removed with an ultrasonic scaler , and examined stereoscopically \n at 10x magnification to verify the absence of cracks , defects and dental caries . \n teeth were stored in a 0.5% chloramine t ( prolabo , paris , france ) in saline solution . \n buccolingual and mesiodistal coronal dimensions plus root length of all selected \n teeth were measured using a digital caliper ( digimatic calipers , mitsutoyo , tokyo , \n japan ) and only teeth with the following mean dimensions were selected : 14.1 mm root \n length , 7.3 mm buccolingual width , and 4.9 mm mesiodistal width . standardized root canal preparations were made using the following procedure : initial \n probing using no . 10 k - files ( flexo files , maillefer , ballaigues , switzerland ) ; the \n root canal length was established through direct observation of the file extruding \n from the apical foramen . the specimens were then prepared endodontically with a \n stepback procedure with size 45 ( flex r file ; union broach , york pa ) . after \n intermittent rinsing with 2.5% sodium hypochlorite solution , the endodontic treatment \n was completed using manual lateral condensation method ( ah plus , dentsply , de tray , \n konstanz , germany ) . after endodontic treatment , each root was thinly covered with a silicone impression \n material ( aquasil , dentsply ) to simulate thickness of periodontal ligament . all specimens were embedded in \n self - polymerized acrylic resin ( orthoresin , dentsply , degudent gmbh , postfach 1364 , \n d-63403 hanau , germany ) poured into a mold while maintaining 2 mm below the cervical \n line exposed . the teeth were embedded along their long axis using a surveyor ( ney \n surveyor ; dentsply ) .", "a new diamond \n point ( lot - nr 1599 , dfs dental and technical products , gmbh , germany ) was attached to \n the milling machine ( k9 milling apparatus-990 , kavo , germany ) for every group . the \n mrd gauged diamond had a self - limiting tip , which produced a 1-mm - deep chamfer and \n the margins and the angle of convergence were standardized . after preparation of the finish line , the coronal dentinal extension was modified \n accordingly ( figure 1 ) : group 1 ( control ) : 1 mm \n circumferential ferrule from the gingival margin without a fiber post ; group 2 : 1 mm \n circumferential ferrule with fiber post and resin core ; group 3 : non - uniform ferrule \n height ( 2 mm buccally and 1 mm lingually ) with fiber post and resin core ; group 4 : a \n non - uniform ferrule height ( 3 mm buccally and 2 mm lingually ) with fiber and resin \n core post ; group 5 : received no ferrule preparation with fiber post and resin \n core .", "in the control group , excess gutta - percha was removed to a depth of 2 mm from the \n coronal surface of the preparation , using a carbide bur ( 171l-012 , brasseler , usa ) . \n the coronal walls were etched with 36% phosphoric acid ( total etch , ivoclar - vivadent , \n schaan , liechtenstein ) for 15 s , washed with water spray and then gently air - dried . \n one coat of adhesive resin ( excite , ivoclar - vivadent ) was applied using a microbrush \n and light polymerized for 20 s ( astralis 10 , ivoclar - vivadent ) . a hybrid composite \n resin ( tetric ceram , ivoclar - vivadent ) was applied and light polymerized for 40 \n s. for the remaining groups , post space was created using no . 1 peeso reamer ( union \n broach co. , long island , ny , usa ) and corresponding calibrating drill ( frc postec \n plus , # 1 , ivoclar - vivadent ) leaving 4 mm of apical gutta - percha intact . a translucent \n glass fiber reinforced composite post ( frc postec plus # 1 ivoclar - vivadent , schaan , \n liechtenstein ) was used . each post was cut to a suitable length with a diamond bur so \n that it was covered with at least 2 mm of resin composite occlusally . post cementation was carried out with self - polymerized resin cement ( multilink , \n ivoclar vivadent ) following manufacturer s instructions . silane coupling agent \n ( monobond - s , ivoclar - vivadent ) was applied on the post surface for 60 s and then \n air - dried . after post cementation , the surrounding dentin surface was etched with 36% \n phosphoric acid ( total etch , ivoclar - vivadent ) for 15 s , washed with water spray and \n gently air - dried . one coat of adhesive resin ( excite , ivoclar - vivadent ) was applied \n using a microbrush and light polymerized for 20 s ( astralis 10 , ivoclar - vivadent ) . \n then core build - up was performed using hybrid composite resin ( tetric ceram , \n ivoclar - vivadent ) in 1-mm - thick increments and light polymerized ( astralis 10 ; \n ivocar - vivadent ) for 40 s until the core was restored to predetermined dimensions . \n the final layer was placed using a transparent matrix to allow for shape consistency \n between specimens . the dimensions of the prepared cores were confirmed with a \n measuring microscope with 30x magnification lens with precision of 5 um . a single - phase impression was made using polyvinylsiloxane impression material \n ( virtual , ivoclar - vivadent ) and master dies were fabricated with type 4 die stone \n ( jad stone , whip mix , louisville , kentucky , usa ) . a press ceramic ( e max , a3 , \n ivoclar - vivadent ) was selected to fabricate all - ceramic crowns of the restored \n specimens . crown dimensions were standardized by using a mold for the external shape \n of each specimen . the fitting surface of the crowns was pretreated with hydrofluoric \n acid ( ips ceramic etching gel , ivoclar - vivadent ) for 20 s , rinsed off , air dried , \n silanized for 60 s and air dried . dentine primer liquids were mixed and applied on \n the whole prepared tooth surface for 15 s. resin cement was dispensed from the \n automix syringe directly into the inner surface of the crowns which were seated and \n held in position under fixed load of 20 n ; excess resin was removed immediately with \n a micro brush . exposed margins were covered with glycerin gel and rinsed off after \n complete polymerization of the resin cement . the specimens were stored in distilled \n water at 37c for 7 days prior to testing .", "all specimens were subjected to cyclic loading according to the following regime : \n sinusoidal load between 50 and 200 n at a rate of 2 hertz . all specimens received \n 15,000 cycles and surface damage was prevented by insertion of a 0.5 mm silicon sheet \n between the occlusal surface of the ceramic crown and the loading indenter ( 3 mm \n diameter ) of the pneumatically activated loading machine . after completion of cyclic \n loading , a universal testing machine ( instron 8500 plus , instron , 100 royal st . \n canton , ma , usa ) was used to deliver a compressive load to the specimens at a \n crosshead speed of 1 mm / min at 45 degree angle to the long axis of the teeth ( root \n apex tilted lingually ) until failure . load - time curves were recorded using a \n universal testing machine s computer software . the \n failure load of the specimen was determined when the forceversus - time graph showed an \n abrupt change in load , indicating a sudden decrease in the specimen s resistance to \n compressive loading . after loading , the failure mode recorded for each specimen and classified as either \n favorable facture above the cement - enamel junction ( repairable ) or catastrophic \n fracture of the root below cement - enamel junction ( non repairable ) . these inspections \n were made using a stereomicroscope ( stereoscopic zoom microscope , smz-1000 , nikon , \n japan ) and during inspection , the teeth were trans - illuminated with a fiber optic \n cable . complete or partial debonding of the crown or of the post and core were also \n considered as favorable failure modes . data were analyzed statistically by one - way \n anova and tukey s post - hoc test was used for pair - wise comparisons \n ( =0.05 ) .", "statistical analysis revealed no significant differences between the failure load of the \n tested groups and the control group restored without fiber post \n ( p<0.780 ) . although fracture resistance of the control group was \n comparable to that of the other groups that received fiber post , there was a higher \n catastrophic failure rate ( 70% ) in the control specimens in the form of vertical root \n fracture . the groups restored with fiber post , on the other hand , had almost complete \n favorable fracture in the form of cervical fracture above the cervical line , previous \n data are summarized in table 1 . failure load ( standard deviation ) and failure type of tested groups similar superscript letter indicates no significant difference between \n different test groups in all specimens , the cemented ceramic crown was fractured without evidence of debonding \n of either the crown or the cemented post . the internal surface of the fractured ceramic \n fragments demonstrated evidence of resin cement and part of the core material indicating \n cohesive fracture of the resin core .", "considering the results obtained in this study , different ferrule heights did not \n improve the fracture resistance or the failure pattern of the tested specimens . on the \n other hand , the use of fiber posts with a modulus of elasticity close to that of dentin \n changed the catastrophic failure type of the control group to almost complete favorable \n fracture for the other four groups . the \n dynamic cyclic loading program was intended to quickly screen any possible weakness in \n the cemented restorations . providing occlusal protection prevented generation of cone \n cracks in the brittle ceramic crowns which was the reason why all specimens survived \n without failure . longer periods of cyclic loading are required to shed light on the \n long - term performance of these restorations , but investigating this issue was not within \n the scope of this study . the results of the fracture resistance test showed that the amount of residual coronal \n structure ( ferrule height ) did not increase significantly the fracture resistance of \n endodontically treated teeth . these results are in agreement with those of previous \n studies ; while contrary \n results were reported by other authors . this could be \n explained by the fact that fiber posts transmitted the forces and distributed the \n loading stresses over a bigger surface area of the tooth structure similarly for all \n tested groups . these results may also be interpreted as the resin \n bonded fiber posts with resin composite core exerted a reinforcing effect by supporting \n the remaining tooth structure regardless of the ferrule design . these \n non - metallic post systems have gained widespread popularity in recent years because of \n other advantages such as their superior esthetics , ease of retrievability , and simple \n application technique , which allow the clinician to complete the procedure in a single \n short appointment . according to the results of the present study , specimens in the control group ( no fiber \n post ) revealed higher catastrophic failure rate compared to the other groups , which \n indicates that insertion of a fiber post may enhance the clinical performance of \n endodontically treated teeth even if the failure load remains relatively not \n effected . the presence of a uniform 1-mm - thick coronal structure \n ( group 2 ) resulted in the highest fracture resistance value , especially when compared to \n the control group , which is in agreement with the results of previous studies . a point of clinical relevance is that the fracture resistance of specimens with \n non - uniform coronal structure ( group 3 and 4 ) was lower than the specimens without a \n ferrule ( group 5 ) , with consideration to maintaining as much as possible of sound tooth \n structure . it could be advised to adjust the coronal structure evenly to provide a flat \n seat for the core build up material , which could improve the fracture resistance of \n endodontically , treated teeth . lithia disilicate - based all - ceramic crowns were used in this study because of its high \n flexural strength ( 400 mpa ) , easily etched using hydrofluoric acid , readily silanized \n and bonded with any suitable resin cement . it has also been reported that the mean \n chewing force of adults ranges between 7 to 15 kg , and the maximum biting force could \n reach up to 90 kg . as the fracture \n loads in all groups in the present study were found to be greater than the ordinary \n chewing force , and even greater than the maximum biting force , their mechanical strength \n could be considered satisfactory from a clinical point of view . in terms of the failure modes , the obtained results are in accordance with those of \n previous studies , showing that the application of fiber posts resulted in \n more favorable fracture patternswhile \n the specimens restored without posts showed a higher incidence of catastrophic failure . \n it could be postulated that specimens restored with fiber - reinforced post systems \n offered more homogenous stress distribution due to their modulus of elasticity close to \n that of dentin resulting in a better stress distribution that occurs at the post - dentin \n interface . this could explain why all favorable fractures were \n limited to the cervical portion of the root including the core - dentin interface , since \n the stresses were concentrated in the cervical area and the outer root surface . \n supporting this opinion is the cohesive fracture of the resin core material , which \n remained attached to the fractured segments of ceramic crowns , thus indicating good bond \n strength between the core build up material and the cemented ceramic crown . the limited \n number of specimens and the difficulty related to reproducing the complexity of \n functional loads in the oral environment may be some of the shortcomings of the present \n study . further investigations including finite element analysis and long - term cyclic \n loading studies are recommended to complement the present study .", "within the limitations of this study , it may be concluded that increasing the ferrule \n length did not improve the fracture resistance of endodontically treated teeth restored \n with glass ceramic crowns . insertion of a fiber post could reduce the percentage of \n catastrophic failure of these restorations under functional loads ." ]

[ "dichlorvos ( dimethyl-2 , 2-dichloro vinyl phosphate ) is an organophosphorous ( op ) insecticide with moderate human toxicity , used for insect control in food storage areas , greenhouses , barns and control of insects on livestock . parenteral dichlorvos administration with suicidal intention is rarely reported in the literature . in one case report , extensive muscle necrosis was reported following intramuscular injection of dichlorvos . in another case , following injection of dichlorvos subcutaneously in both wrists , a young patient developed compartment syndrome requiring fasciotomy . in both cases , i describe the case of a young female patient , who developed atypical signs of op poisoning following subcutaneous injection of dichlorvos .", "the present case report is about a 37-year - old , previously healthy female , who was admitted to our intensive care unit 18-h after alleged self - injection of 76% dichlorvos ( nuvos ) 3 ml in the upper left arm ( 3 times with a 1 ml insulin syringe ) . within an hour of the injections , she had normal body temperature with heart rate of 90/min , blood pressure 110/70 mmhg , respiratory rate 14/min and pulse oximeter showing 100% saturation on room air . no crackles were heard on chest auscultation . on the nervous system examination , she was jittery with slurred speech and normal cranial nerves . she had hypertonia , brisk tendon reflexes , bilateral sustained ankle clonus and bilateral extensor plantar reflex . local examination revealed a blister and a black necrotizing lesion over the anterior aspect of the left arm [ figure 1 ] . she was rapidly atropinized with incremental boluses of atropine ( total dose 12 mg ) in next 30 min ( targeting a dry mouth ) followed by infusion of 1.8 mg / h . pralidoxime infusion was started at 500 mg / h following a loading dose of 1000 mg over 20 min . intravenous clindamycin ( 600 mg q 8 h ) was administered empirically for presumed local wound infection . debridement of the wound showed predominant involvement of the subcutaneous tissue plane with minimal necrosis of the superficial fibers of biceps brachii . initial routine laboratory investigations were unremarkable except elevated total count ( 16200/mm ) and mild respiratory alkalosis . local skin necrosis with surrounding blisters her clinical course was complicated by respiratory arrest 9-h after hospital admission ( 27-h after the injection of dichlorovos ) leading to hypoxia and bradycardia . arterial blood gas analysis post resuscitation showed - ph 7.28 , po2 - 36 mmhg , pco2 - 54 mmhg , hco3 - 22 mmhg . serum choline esterase ( pseudo cholinesterase ) level of the same day showed a very low value of < 1 ku / she could be successfully weaned off from the ventilator on day 4 . on day 5 , while on atropine infusion she was found to be delirious . she was also noticed to have extrapyramidal manifestations including rigidity and left sided gaze preference .", "in this case , other than the unusual route of administration , a number of atypical manifestations were found . this includes relatively delayed respiratory failure and central nervous system ( cns ) manifestations with few muscarinic signs . two independent mechanisms are thought to be responsible for respiratory failure following op insecticide poisoning cholinergic cns depression in the early stage ( associated with other cholinergic features ) and late progressive neuromuscular transmission defect . second mechanism is part of the syndrome described as type ii paralysis by wadia et al . or intermediate syndrome by senanayake and karalliedde . our patient developed respiratory arrest 27-h after exposure to dichlorovos . in her clinical course she never had neck or proximal muscle weakness , though the clinical findings were not correlated electrophysiologically . usually cns signs are manifested early in the course in the presence of peripheral muscarinic signs . in a large series published on neurological manifestations of op compounds , 8 of 200 patients had pyramidal tract signs in the form of only hyper - reflexia manifesting within 24 h of exposure . all these patients were unconscious with florid cholinergic manifestations , including constricted pupils . in their original series of intermediate syndrome senanayake and karalliedde , observed hyperreflexia in one of their patients ( with flexor plantar reflex ) and even she had typical muscarinic signs . extrapyramidal signs of op poisoning are often transient and may be missed in a sick patient . in a taiwanese series cns manifestations ( both pyramidal tract and extrapyramidal ) were delayed and were associated with relatively scanty peripheral muscarinic signs . possible explanation for these atypical manifestations in our patient could be route specific ( in this case subcutaneous ) effect of op compound ( dichlorovos ) causing isolated delayed cns depression , with few peripheral cholinergic signs . animal experiments have shown route specific ( subcutaneous or intravenous ) cardiovascular and neuromuscular effect of op compounds in rats ." ]

[ "transesophageal echocardiography ( tee ) is considered to be safe and relatively noninvasive diagnostic tool,1 ) however severe complications have been reported . the incidence of major tee - related complications range from 0.2% to 0.5% and mortality is reported to be < 0.01%.2345 ) among these complications , problems related to insertion of tee probe take a large proportion , including perforation of hypopharynx and esophagus . for our knowledge , there have been reported only few cases of hypopharyngeal perforation , especially not been reported in asian population to date . we describe the clinical presentations and secondary complications associated with oropharyngeal injury with the case of a 74-year - old man who suffered a hypopharyngeal laceration after tee .", "a 74-year - old man was referred to our cardiovascular center for the evaluation and treatment of mitral regurgitation ( mr ) . he had been complaining of aggravation of dyspnea ( new york heart association functional class iv ) for the preceding 3 weeks , and atrial fibrillation and severe mr were detected from other clinic . the patient had medical history of hypertension and chronic obstructive pulmonary disease for 15 years , and received endovascular aneurysm repair for abdominal aortic aneurysm 8 years ago . the patient was admitted to the intensive care unit because of uncompensated heart failure and careful control of pulmonary edema with chronic kidney disease . the patient presented tachypnea and orthopnea before the tee procedure , less than minimal dose of sedative agent was administrated to lessen patient 's discomfort , 1 mg of lorazepam , 25 mg of fentanyl , intravenously . as we checked for the mental status , the insertion of tee probe was performed with the patient in left lateral decubitus position according to the following standardized technique : the probe was inserted through the midline and gently advanced to pass the first pharyngeal curvature corresponding to the base of the tongue . the probe was then extended , and the patient was asked to swallow , at which point the probe was further advanced to enter the esophageal inlet . when the probe has reached to the root of tongue , the patient suddenly changed his position form left decubitus to supine position and gave force to the neck , and resisted to probe insertion . the probe got lodged at right - side of hypopharyngeal area so that failed to advance . at second attempt , tee demonstrated severe eccentric mr with medial commissural prolapse due to chordae rupture ( a3-p3 commissure ) with left ventricular dilatation , mild tricuspid regurgitation ( fig . the physical examination revealed tenderness and crepitus on right anterolateral area of neck ( level iii ) 3 hours later after tee . iatrogenic hypopharyngeal or esophageal injury was suspected , antibiotic treatment with piperacillin / tazobactam was initiated and the patient was not allowed to eat or drink . computed tomography ( ct ) scan revealed subcutaneous emphysema without involvement of mediastinum , but the level of injury was not detected ( fig . fiberoptic nasolaryngoscopic examination identified edema of the right posterolateral wall of the hypopharynx and hypopharyngeal bruise but there was no evidence of rupture or perforation . laboratory analysis revealed an elevation of the white blood cell count ( 20.36 10/l ) and c - reactive protein ( crp ; 28.54 mg / dl ) . we tried to find any evidence of esophageal injury because treatment strategy would be different if the esophagus was involved . an ent specialist and a gi specialist agreed with hypopharyngeal injury without esophageal damage after multiple tests . we concluded the lesion was limited to the hypopharynx because the presence of hematoma at the right side of hypopharynx , consistent with the direction and the depth of the probe passage . further , there was no evidence of esophageal injury on serial follow - up multimodality imaging studies . after 5 days from the injury , the subcutaneous emphysema disappeared and the patient remained afebrile with improvement of the leukocyte count and crp ( fig . however painful neck mass around anterolateral area of neck was noticed ( level iii ) . the follow - up ct without contrast showed a right parapharyngeal and retropharyngeal abscess secondary to hypopharyngeal injury ( fig . yellowish fluid in the abscess was analyzed for cytology and revealed as acute inflammatory cells predominantly neutrophils . as the patient 's systemic status was stable with decrease of the leukocyte count and crp , the antibiotics ( piperacillin / tazobactam ) was maintained for 14 days with the drainage of abscess because no organisms were identified from the abscess fluid culture and repeated blood cultures . on 7th day after tee , second swallowing study was performed and no leakage was demonstrated ( fig . 4b ) , infectious parameters were continuously decreased , and follow - up fiberoptic nasolaryngoscopic examination demonstrated no evidence of perforation or rupture in hypopharyngeal cavity . after 14 days of antibiotic therapy , when the infection was controlled completely , the patient had successful mitral valve repair with tricuspid annuloplasty with st .", "the overall incidence of severe hypopharyngeal and esophageal complications from traditional tee is low.1)3)6 ) risk factors of hypopharyngeal and upper gastrointestinal complications have been reported in few studies . patient related risk factors include older age , short stature , presence of cervical spinal disease , chronic steroid use , presence of congestive heart failure.3)7)8 ) the presence of gastroesophageal pathology such as zenker 's diverticulum , esophageal stricture or obstructing mass , fibrosis secondary to prior chest radiation could be potential risk factor . anatomical variation like massive cardiomegaly1)9 ) or tracheoesophageal fistula may be correlated to increase the risk . procedure related risk factors include inexperience of the cardiologist , and resistance to prove insertion with poor cooperation . to avoid direct injury to the hypopharynx and upper esophagus during a blind insertion of probe , appropriate conscious sedation and local anesthetic spray direct visualization of the passage of the probe with direct laryngoscope could be recommended to minimize blind injury of throat . if there are procedural difficulties such as multiple attempts at passage of the tee probe or resistance during insertion , the examination should be stopped . in addition , indirect injury is also result from increased continuous pressure on the probe positioned in the upper esophagus , therefore , the exam should be stopped if the resistance is continuing . finally , it is very important to prevent sudden position change of the patient during the probe insertion . it needs pre - procedural enough education , adequate sedation , careful insertion of tee probe , and an experienced assistant . in our case , we assumed that the patient 's poor cooperation and insufficient sedation might cause the wrong direction of the tee probe and advancing force of tee probe into the throat had led the probe to get lodged into the right pyriform sinus . treatment of hypopharyngeal perforation depends on the cause , timing of diagnosis , and type of lesion.101112 ) in a study of hinojar et al.,10 ) 3 patients out of 7 patients were managed conservatively , whereas other 4 patients got surgical treatment . mostly in the former cases , the time duration to the diagnosis was less than 1 - 2 days and involvement of infection was limited to pharyngeal space . in current case , our patient complained pain in his throat and we detected subcutaneous emphysema within 3 hours after injury that may prevent aggravation of infection and lead good prognosis . it is important not only to understand possible complications of the procedure and to recognize the risk factors of pharyngeal and esophageal injury , but also to detect the complication as soon as possible if it occurred , to get better prognosis ." ]

[ "it has been reported that the prevalence and incidence of dementia in the united states have been either stable or even declining over the last 2 decades of the 1990s . this question is particularly relevant to the case of japan which is an economically advanced country like the us , but is believed to have a different level of vascular disease risk . studies conducted in the late 1980s and early 1990s reported that vascular dementia ( vad ) was more prevalent than alzheimer 's disease ( ad ) in japan , compared with the us and other western countries where ad is more prevalent than vad . in studies among japanese americans conducted in the early 1990s [ 4 , 5 ] , the prevalence ratio of ad to vad was higher than that reported among japanese in japan and more closely resembled that found in the caucasian population . this suggests that there might have been environmental factors that changed the risks of developing subtypes of dementia after japanese immigrated to the us . on the other hand , more recent studies conducted in the late 1990s suggest that the cross - national differences found in the past may have been due to differences in the diagnostic methods used [ 6 , 7 ] . standardization of diagnosis is one of the challenges of cross - national comparisons of dementia prevalence . there is an ongoing debate as to whether : ( 1 ) the higher proportion of vad found in the past studies in japan could be due to differences in diagnostic criteria used in japan and the us , ( 2 ) the similar ad / vad ratio with that of the us found in recent japanese studies could be due to decreased cerebrovascular disease incidence over the past decades in japan , or ( 3 ) there is no systematic time trend in ad / vad ratio in japan and the observed variation is due to regional differences within japan . despite a growing interest in the influence of vascular disease and its risk factors on alzheimer 's disease ( ad ) [ 812 ] , our aims in the current study are to : ( 1 ) summarize epidemiological studies of dementia in japan including relevant details of study protocols and diagnostic criteria , ( 2 ) compare age - specific prevalence of all - cause dementia among studies , and ( 3 ) assess the trends in ad versus vad over time . previous studies which concluded an increase in ad / vad over time in japan [ 1315 ] did not examine the diagnostic criteria used , nor did they examine age - specific ad / vad ratios .", " we selected dementia prevalence studies in japan that were designed to be representative of specific communities or prefectures with at least 500 study participants aged 65 and older , and whose age - specific prevalence ( for either 5- or 10-year age intervals ) for ad and vad was published between 1990 and 2009 in international journals , using medline with the search words japan , dementia , and prevalence . we used the former criterion ( n 500 ) in order to have a large enough sample size to allow meaningful between - cohort comparisons of dementia prevalence . eight studies met these criteria : the hisayama study [ 16 , 17 ] conducted at four time points , the okinawa study , the radiation effect research foundation adult health survey ( rerf - ahs , a.k.a hiroshima study ) , the tajiri project , and the ama - cho study . brief descriptions of each study cohort follow ( see also table 1 for further summary ) . hisayama is a rural community adjacent to the city of fukuoka , a major city of kyushu island . cross - sectional dementia prevalence was estimated 4 times , in 1985 , 1992 , 1998 , and 2005 [ 16 , 17 ] . random sampling was conducted to recruit study participants in the selected sites between 1991 and 1992 . in 1958 , the atomic bomb casualty commission began the adult health study ( ahs ) to survey the occurrence of illnesses and changes in physiological and biochemical function resulting from exposure to atomicbomb radiation . the original ahs cohort consisted of atomicbomb survivors and their controls , selected from residents in hiroshima and nagasaki . between 1992 and 1996 , those aged 60 and older who were residents of hiroshima and members of the ahs were examined . the tajiri project is a community - based study started in 1988 for the prevention of stroke , dementia , and bed - confinement in tajiri , an agricultural area in northern japan . in 1998 , all residents 65 years and older were targeted for the dementia prevalence study [ 6 , 20 ] . this study was conducted in the municipality of ama - cho , a rural island town in the northwestern part of japan . all residents as of the prevalence day of march 1 , 2008 were requested to participate in the dementia prevalence study . differences in overall dementia prevalence among 8 studies were examined using poisson regression models based on the number of dementia cases ( weighted numbers of cases for okinawa studies ) and the number of participants by 10 year age groups ( except the youngest age group where 5-year ages were used : 6569 , 7079 , 8089 , and 90 + ) to provide large enough sample sizes in each group for meaningful statistical comparisons , yet controlling for changing age composition over time . the okinawa 1992 study sample was used as a reference group because it was the largest and was conducted at the mid - point of assessment years among the 8 studies .", "\n table 1 gives a brief description of each study and the criteria used to define dementia and dementia subtypes . all assessments , except in the tajiri study , were based on multistage assessments , during which all participants were screened in phase 1 ( screening phase ) , and selected participants and controls from phase 1 received final diagnoses from physicians in phase 2 ( clinical assessment phase ) . the dementia diagnostic criteria used in japanese studies were either dsm - iii , dsm - iii - r , or dsm - iv . the diagnostic criteria used to define subtypes of dementia varied among the studies in japan . the following criteria were used to define vad : hachinski ischemic scores , ninds - airen , dsm - iv , and the alzheimer 's disease diagnostic and treatment centers ( addtc ) criteria . for ad , dsm - iii - r , dsm - iv , and nincds - adrda were used . the overall prevalence of dementia among those aged 65 and older ranged from 5.6% ( hisayama 1992 ) to 11.3% ( ama - cho 2008 ) ( table 1 ) . poisson regression models for dementia prevalence showed that compared with the okinawa 1992 study , hiroshima 1996 ( p = 0.0002 ) , tajiri 1998 ( p < 0.0001 ) , hisayama 2005 ( p < 0.0001 ) , and ama - cho 2008 ( p = 0.007 ) had a higher prevalence of all - cause dementia , controlling for sex and age groups ( table 2 ) . there were no difference between the okinawa 1992 study and hisayama studies conducted in 1985 , 1992 , and 1998 . no difference was found between men and women . as a post hoc analysis , we also ran poisson regression models using only the hisayama studies ( 4 time points ) . the results showed that compared with the all - cause dementia prevalence in 1985 , that of 2005 was higher ( coefficient : 0.32 , 95% ci : 0.010.64 , p = 0.04 ) controlling for sex and age groups ( not shown in table 1 ) . ad / vad ratios among those aged 65 and older are listed in the last column of table 1 . the okinawa ( 1992 ) , hiroshima ( 1996 ) , tajiri ( 1998 ) , and ama - cho ( 2008 ) studies used the same criteria for diagnoses of ad ( nincds - adrda ) and the ad / vad ratio among those aged 65 and older was 1.85 , 1.85 , 3.33 , and 4.12 for the above studies , respectively . the hisayama studies which conducted 4 cross - sectional studies using the same diagnostic criteria for subtypes of dementia also showed the increasing trend in the ratio of ad / vad , ranging from 0.52 in 1985 to 1.96 in 1998 , and 1.92 in 2005 . the tajiri project , which conducted an mri substudy to identify dementia etiologies , showed that the proportion of ad among total dementia cases differed largely depending on the criteria used : 62.5% ( ad / vad = 3.3 ) using ninds - airen criteria , and 40.6% ( ad / vad = 1.0 ) or 56.2% ( ad / vad = 2.3 ) depending on assessors using dsm - iv criteria . even though we selected studies with relatively large sample sizes ( n 500 ) , the number of cases was too small to conduct meaningful comparisons of age - specific ad / vad ratios for the age group 6570 ( < 5 for each case ) . therefore , we list age - specific prevalence of dementia and ad / vad ratios for the age groups 7079 , 8089 , and 90 and older in table 3 . the youngest age group examined here ( age 7079 ) had a prevalence of vad that was consistently higher than that of ad in japan ( i.e. , ad / vad < 1 ) except in more recent studies conducted in 2005 ( hisayama ) and 2008 ( ama - cho ) . except for these two recent studies ( hisayama 2005 and ama - cho 2008 ) ,", "eight major prevalence studies conducted in japan were reviewed in an attempt to identify trends in prevalence of all - cause dementia and subtypes of dementia , paying careful attention to diagnostic protocols . we found that compared with the okinawa 1992 study , studies conducted in later years ( 1994 ( hiroshima ) , 1998 ( tajiri ) , 2005 ( hisayama ) , and 2008 ( ama - cho ) ) had a higher prevalence of all - cause dementia , after controlling for age groups and sex . within 4 studies conducted in hisayama ( 1985 , 1992 , 1998 , and 2005 ) , we also found that the prevalence in 2005 was higher than that in 1985 , after controlling for age groups and sex . thus , the dementia prevalence seems to be increasing in japan , in contrast to the us where decreasing or stable prevalence of all - cause dementia has been reported . two diseases that could have high impact on the prevalence of dementia at national levels are cerebrovascular disease and type 2 diabetes , as shown by their relatively high population attributable risk % ( par% ) of dementia in the united states [ 12 , 28 ] . according to the national nutrition survey in japan , those with hemoglobin a1c values 6.0% ( possible type 2 diabetes ) were estimated to be 22.8% , 37.4% , and 40.9% among men aged 70 and older in year 1997 , 2002 and 2007 , respectively , and the comparative figures among women were 27.2% , 28.2% , and 34.6% . on the other hand , the decline in stroke incidence reached plateaus around the late 1990s after a continuous sharp decline beginning in 1960 , thus further declines in dementia due to stroke would not be expected after the 1990s . however , it is possible that the prevalence of small vessel cerebrovascular disease with resultant microinfarcts that would not be accounted for in these vascular disease statistics could play a latent or underappreciated role in causing or contributing to dementia . the increase in type 2 diabetes , the metabolic syndrome and its associated vascular complications ( risk factors for ad ) , with a plateau in declining trends in major stroke incidence , could have lead to an increase in dementia prevalence in recent years in japan . it is also possible that increasing public awareness of dementia in recent years is resulting in enhanced recognition of functional and cognitive declines that might previously have been dismissed as longer survival of those who suffered from stroke / tia due to advanced medical treatment could also increase the prevalence of dementia to some extent . unfortunately , autopsy confirmation in large proportions of the participants in these epidemiologic studies is not available , thus limiting conclusions as to more specific underlying etiologies . we found that okinawa had a lower overall prevalence of dementia compared with other cohorts except hisayama studies in 1985 , 1992 , and 1998 . these two regions ( okinawa and hisayama ) have had lower incidence of cerebrovascular diseases in comparison with other regions studied here . for example , the rate of cerebrovascular mortality , as a proxy of cerebrovascular disease incidence , declined sharply between 1975 and 2000 by over 65% in all regions and declined further between 2000 and 2005 by over 10% in all regions ( table 4 ) , with the above two regions constantly having lower rates than other regions . historically , salt consumption has been high in the northern part of japan because vegetables and marine products are cured with salt to preserve them during the longer winter months and consumed with processed white rice . this dietary pattern is believed to be one of the reasons of the higher prevalence of hypertension and large vessel cerebrovascular disease in the northern prefectures in japan . the low dementia prevalence in okinawa and hisayama ( except 2008 ) , which is located in the southern part of japan , could not only be due to a lower rate of vad resulting from lower cerebrovascular disease incidence , but also due to lower ad prevalence resulting from reduced vascular injuries [ 8 , 12 , 33 , 34 ] . vascular dementia ( vad ) was believed to be more prevalent than alzheimer 's disease ( ad ) in japan in the 1980s , in contrast to the us or other western countries , but studies conducted in the late 1990s and after showed patterns that were more similar to the us [ 13 , 15 , 35 ] . westernization of the dementia prevalence pattern could be partly due to the declining stoke incidence observed during the 1980s as described above . however , it could also be due to changes in diagnostic criteria used in japan . for example , in the tajiri study , patients received a diagnosis of possible ad with cvd by means of the ninds - airen criteria , provided that the vascular effect on dementia was considered to be too ambiguous to diagnose as vad , which lead to relatively high proportion of ad out of all dementia cases ( over 62% ) . the study also demonstrated the difficulty of obtaining consensus on the definition of vad , even for experienced neurologists using the same criteria ; two neurologists blinded to each other 's diagnosis did not agree when diagnosing vad versus ad under dsm - iv criteria : the proportion of vad out of total dementia cases ranged from 40.6% to 56.2% , depending on assessors . we expect that lack of imaging data may result in underdiagnosis of subcortical vascular brain injury ( e.g. , white matter hyperintensity , and silent brain infarcts , etc . ) and thus lead to underestimation of vad . however , more recent studies including the tajiri , hisayama ( 1998 ; 2005 ) , hiroshima and ama - cho studies used imaging data , and these tend to show higher ad / vad ratios ( i.e. , not higher vad prevalence ) compared with earlier studies . therefore , it is likely that changes in diagnostic criteria at least partly explain the higher proportion of diagnosed ad in recent years . in all studies except more recent studies conducted after 2000 , as age increased , the proportion of ad among the total dementia cases increased : the youngest age group examined ( age 7079 ) had a prevalence of vad that was consistently higher than that of ad in japan ( i.e. , ad / vad < 1 ) . on the other hand , among the older age groups , in fact , among the oldest age group ( age 90 ) , ad / vad ratios in japan were not necessarily lower than the us figures even among studies conducted in the early 1990s , ranging from 2.5 ( hisayama 1985 ) to 6.0 ( hisayama 1992 ) . in the aging , demographics , and memory study ( adams ) [ 36 , 37 ] , which is the first study in the us to calculate a nationally representative dementia prevalence , the age - specific ad / vad ratios were found to be 2.36 , 4.43 , and 4.79 for age group 7179 , 8089 , 90 and older , respectively , using dsm - iii - r and dsm - iv criteria for dementia and nincds - adrda criteria for ad , that is , the age - associated increase in ad prevalence seems to be more evident in japan than in the us . this could be partly due to the fact that the gender gap in life expectancy is larger in japan compared with us and the proportion of women increases more steeply as age increases in japan . for example , in 1990 , the life expectancy at age 65 was 18.9 years for women and 15.1 years for men in the us , that is , a gender gap of 3.8 years , while the comparative figure in japan was 20.0 years and 16.2 years , with the gender gap of 4.8 years . similarly , in 2008 , the life expectancy at age 65 was 19.8 years for women and 17.1 years for men in the us , with the gender gap of 2.7 years , while the comparative figure in japan was 23.6 years and 18.6 years , with the gender gap of 5.0 years . cerebrovascular disease is more common among men than women , and we expect a higher proportion of vad among men than women . a steeper age - associated increase in ad prevalence found in japan , therefore , could be due to a higher proportion of women among the older old age groups in japan . comparisons of age - specific ad / vad ratios between men and women could clarify this issue , but we were unable to do so due to the small sample size once we stratify prevalence by sex and age groups , especially among those aged 90 and older . however , at least among the younger two age groups ( ages 7079 ; 8089 ) , we see an increasing trend in the proportion of ad cases as age group goes up in both men and women ( data not shown ) . these results also suggest that it is important to consider the age / sex structure of samples when we compare the ad / vad ratio among different cohorts although incidence of dementia and its subtype would give a more accurate picture regarding the trend , there is a paucity of dementia incidence studies in japan . to our knowledge , only three incidence studies have been reported thus far : ( 1 ) the hisayama cohort , following their 1985 cohort for 7 years ; ( 2 ) the tajiri project , following a sub - sample of their 1998 cohort for up to 7 years ; ( 3 ) the hiroshima study ( radiation effects research foundation adult health study ) , following their 19921996 prevalence cohort until the year 2003 . the incidence of all - cause dementia was 19.3 per 1000 person - years for men and 20.9 for women in the hisayama study , 33.9 for men and 44.0 for women in the tajiri study , and 12.0 for men and 16.6 for women in the hiroshima study . the hisayama and hisorhisma studies reported significant gender differences in subtypes of dementia incidence : hisayama reported that the incidence of vad increased with age and was consistently higher than that of ad for men , while the incidence of ad was higher than that of vad for women age 75 years or older . the incidence of ad markedly increased after the age of 80 in either sex , but overall , vad was more common in the hisayama study . the hiroshima study also reported that probable ad showed the most remarkable increase with age , and probable vad was significantly lower among women . overall , ad was more common in this study , possibly because the hiroshima study was conducted later than the hisayama study , after a further decline in stroke incidence had occurred . in all 3 incidence studies , nincds - adrda criteria were used for ad and ninds - airen for vad . in japan , ad incidence and prevalence tend to increase with age more than vad and older old women predominantly have ad rather than vad . therefore , when aggregated , the overall prevalence of ad may become higher as more women survive in the oldest old age group . as we mentioned earlier , it is important to consider the age / sex structure of samples when examining trends in the ad / vad ratio . in conclusion , our systematic review shows that ( 1 ) there is an increasing trend in overall dementia in japan . although we can not confirm definitively from the current study , the possible explanation of the increase could be a shift in health conditions among the elderly in japan including the increase in diabetes mellitus in more recent years despite the plateau in decline in stroke incidence during the late 1990s ; ( 2 ) the similar ad / vad ratio found in recent studies in japan with that of the us could be due to a combination of at least 3 factors : ( a ) shifting diagnostic criteria ( more in line with us consensus diagnosis ) , ( b ) possible shifting in health conditions among the elderly in japan ( decline in stroke incidence , but increase in metabolic disease e.g. , type 2 diabetes , hyperlipidemia , and atherosclerosis ) , ( c ) an increase in the proportion of the oldest old who had an historically higher prevalence of ad ( as opposed to vad ) in japan , and ( d ) regional variations ( i.e. , a north - to - south gradient in vad ) possibly due to large difference in dietary patterns . the study limitations include relatively small sample sizes , especially for the oldest old group . the okinawa study took into account the potential dementia cases among those who were screened at phase 1 ( screening phase ) , but did not participate in phase 2 ( clinical assessment phase ) , using weights generated from phase 1 . however , as with most other epidemiological studies of dementia , there was no way of precisely estimating the frequency of dementia among those who did not participate in the screening phase . four japanese prevalence studies [ 15 , 4143 ] were not included in this study because the age - specific prevalence of ad and vad were not provided in the published articles . although it would be interesting to deconstruct the changes in all - cause - dementia prevalence and ad / vad ratios into the potential explanatory factors , different criteria used to define subtypes of dementia would not allow this type of quantitative assessment . one of the strengths of our study is that we could ascertain the detailed screening procedures and diagnostic criteria by contacting the investigators of the original studies . future studies could aid in monitoring changing prevalence patterns and their causes by including some of the following elements . first , as with hisayama studies , it would be ideal for studies to examine the prevalence of dementia and its subtypes repeatedly at the same locations using the same criteria . second , it would be helpful if future epidemiology studies would recruit more participants aged 90 and older ( e.g. , through aggressive age - stratified sampling protocols ) to improve estimates of prevalence in this age group . third , more comprehensive diagnostic criteria should be used for inter - cohort comparisons : as suggested by viswanathan and colleagues , ad and vad exist in a continuum of disease . it might be more meaningful if we could apply , for example , more specific clinicopathological criteria for mixed dementia [ 4450 ] than those currently used . increased use of standardized neuroimaging such as the alzheimer 's disease neuroimaging initiative ( adni ) might aid in the development of more specific and comparable criteria for the diagnosis of vad . finally , autopsy confirmation of the underlying potential causes of dementia in epidemiological studies would go a long way to help resolve these important uncertainties in the shifting patterns over time of the dementias ." ]

[ "chronic low back pain ( clbp ) refers to chronic pain around the lumbar vertebra sustained \n for over three months without serious pathological characteristics , regardless of the \n existence of sciatalgia1 . clbp causes pain \n and changes in the muscles , as well as decreases in contractile force and muscle activity . \n studies of therapeutic approaches to clbp pain reduction , muscular strength improvement , and \n spinal movement enhancement have investigated the effects of myofacial release , osteopathy , \n massage , lumbar stabilization exercises , and proprioceptive neuromuscular facilitation \n ( pnf)5,6,7 . among these therapeutic approaches , joint mobilization using pnf has a positive effect on \n pain , muscle strength , and range of motion ( rom)8 , \n 9 . it is applied as a passive movement by \n therapists10 , 11 . in particular , kaltenborn - evjenth orthopedic manual therapy \n ( keomt ) is an effective treatment for improving rom and pain . keomt is a safe and \n well - established procedure that slowly utilizes the convex - concave rule ( traction or gliding \n on the treatment side)10 , 12 . hindle et al . \n reported pnf is effective at improving rom and muscular strength13 . kim et al . reported that lumbar stabilization therapy \n using pnf for clbp significantly improved the thicknesses of the external oblique and \n multifidus muscles , and the functional level8 . in addition , pnf has been used to improve the muscular strength of \n athletes14 . this case study was a single patient with clbp and a lumbar transitional vertebra who has \n six lumbar vertebrae ( not five ) . a lumbar transitional vertebra is defined as a congenital \n malformation that appears as a deformation of the fifth lumbar ( l5 ) or first sacrum ( s1 ) \n vertebra15 . vergauwen reported that \n lumbar transitional vertebrae patients more commonly experience disc protrusion , \n degeneration , and spinal stenosis than patients without lumbar transitional vertebrae16 . therefore , the \n purpose of this study was to identify the effects of joint mobilization using keomt and pnf \n on a patient with clbp and a lumbar transitional vertebra .", "the subject was selected from among the patients of sarang hospital ( yongin , south korea ) . \n the subject \n agreed to participate in the study after receiving explanations regarding the purpose and \n procedures of the experiment , and signed an informed consent statement before participation . \n the protocol for this study was approved by the local ethics committee of the namseoul \n university of cheonan . computer \n tomography ( ct ) showed six lumbar vertebrae , which is one more lumbar vertebra than a normal \n person ( fig . the subject was aged \n 29 , and had a weight of 67 kg , a height of 158 cm , and a bmi of 26.90 . the initial symptom developed about two years earlier , and at the time of the \n study the subject was not receiving any medical or physical therapy . the major complaint of \n the subject was a numb feeling , especially in the hind part of the left leg . she also \n complained of a stinging pain during daily activities , such as lifting , lumbar twist , and \n flexion . the program consisted of a 40-min session , 3 days a week for 4 weeks ( october 131 , 2014 ) , \n during which joint mobilization was performed using keomt and pnf techniques . joint mobilization using keomt lasted 20 min , and it included lumbar segmental traction and \n lumbar segmental mobilization ( flexion , extension ) in a side - lying position . it was performed by a therapist who had \n completed a keomt spine advance course . the pnf exercise included shoulder flexion , abduction , and \n external rotation in a supine position , and dynamic reversal of the antagonist was \n performed17 , which indirectly exercised \n the abdominal muscle through irradiation of the shoulder muscle . it was performed by a \n therapist who had completed the pnf level i , ii courses . the subject was assessed for spinal motion , low back pain , and thickness of the multifidus . \n spinal motion was assessed using a spinal mouse ( idiag , swiss ) , which measures the spinal \n curvature , flexion , and extension ( thoracic and lumbar vertebrae ) . low back pain was \n assessed using a visual analogue scale ( vas ) and the oswestry disability index ( odi ) . the \n vas assesses subjective pain through a which has a possible range of 0 to 10 . the odi assesses low back pain , and has a possible range of 0 to \n 100% . it is composed of ten items , including pain severity , self - management , lifting , \n sitting , standing , sleeping , etc . the thickness of the multifidus was measured using ct ( general electric , \n korea ) . the multifidus muscles of the fourth lumbar vertebra ( l4)20 was scanned by a radiological thechnician at sarang \n hospital .", "the spinal curvature , flexion , and extension of thoracic and lumbar vertebrae were \n measured . in the thoracic vertebra , the rom of flexion increased from 14 to 20 , and the rom of \n extension increased from 1 to 4. in the lumbar vertebra , the angle of spinal curvature \n increased from 12 to 20. the rom in flexion increased from 33 to 47 , and the rom of \n extension increased from 2 to 7 ( table \n 1table 1.change of thoracic and lumbar movementvariablecurvature ( )flexion ( )extension ( )prepostprepostprepostthoracic2632142014lumbar1220334727 ) . the subject mentioned she was less uncomfortable in \n daily life , e.g. during face washing , dishwashing , hair washing , etc . the odi percentage \n score decreased from 48.88 to 24.44 ( table \n 2table 2.change of vas and odivariablevas ( score)odi ( % ) prepostprepost7.5348.8824.44 ) . the thickness of the multifidus was measured at the fourth lumbar vertebra ( left and \n right ) . the left multifidus increased from 572.09 to 662.09 mm , and the right \n multifidus increased from 479.84 to 530.90 mm ( table 3table 3.change of multifidus thicknessvariableprepostmultifidus ( mm)l : 572.09l : 662.09r : 479.84r : 530.90l : left ; r : right ) . 3.multifidus thickness on a ct ( post ) show the multifidus thickness on a ct . multifidus thickness on a ct ( pre ) multifidus thickness on a ct ( post )", "this study was a case study of a single patient with clbp and a lumbar transitional \n vertebra . the purpose of this study was to identify the effects of joint mobilization using \n keomt and pnf techniques in a patient with clbp and a lumbar transitional vertebra . the \n spinal motion , pain , and thickness of the multifidus were evaluated and compared between \n pre- and post - assessment . florentino et al . reported that most nurses possess at least one musculoskeletal disorder , \n among which low back pain is the most frequent ( 60.9%)21 . after the intervention , the angle of spinal curvature increased , and the roms of flexion \n and extension of the thoracic and lumbar vertebrae also increased , indication that joint \n mobilization using keomt and pnf had a positive effect on spinal motion . ko et al . reported \n that clbp patients in a thoracic joint mobilization group showed greater improvements in \n spinal motion and pain reduction than a william exercise group22 . our present results were similar , suggesting that joint \n mobilization has a positive effect on spinal motion . after the intervention , the vas score decreased \n from 7.5 to 3 , and the odi score decreased from 48.88% to 24.44% . orthopedic manual therapy \n has positive effects on the spinal function of clbp patients6 , especially items of self - management , such as bathing , dressing , and \n sleeping . reported pain reduction after joint mobilization using keomt was performed for \n osteoarthritic elderly people23 , and \n lpez et al . reported joint postero - anterior mobilization had an effect on the pain and rom \n of clbp patients9 . lee reported a pnf group demonstrated greater pain reduction and increased muscle activity \n than a ball training group , and jung reported pnf reduced the pain of clbp patients24 , 25 . . therefore , the results \n of previous studies agree with those of the present study . the spinal muscle contracts prior to \n motion and controls the movement28 . in \n particular , the multifidus muscle is important for lumbar stabilization . the superficial \n multifidus plays a role in spinal direction control , and after the intervention , the \n left multifidus increased from 572.09 to 662.09 mm , and the right multifidus was \n increased from 479.84 to 530.90 mm . kim et al . reported a pnf group showed \n greater increases in the thicknesses of the multifidus and external oblique muscles than a \n general physiotherapy group and a lumbar stabilization group8 . in addition , a resistance exercise using pnf not only reinforced \n muscular strength causing maximal muscular contraction , but it also stabilized the body \n position30 . these results indicate pnf \n has a positive effect on the thickness of the multifidus . according to our present results , joint mobilization using keomt and pnf had a positive \n effect on the spinal motion , pain , and thickness of the multifidus of a patient with clbp \n and a lumbar transitional vertebra . this study was a single subject case study , but it is \n meaningful in that it presented spinal motion , pain , and muscle activity in a patient with a \n lumbar transitional vertebra . a larger number of patients will need to be studied in the \n future ." ]

[ " to learn about the normal anatomy of the neural tube on mri to recognise the mr appearance of neural tube defects to understand the value of mri in assessing ntds", "technological developments in diagnostic imaging have improved the diagnosis and treatment of congenital anomalies immensely , and this progress is especially evident in neural tube defects ( ntds ) . ultrasonography allows accurate assessment of the neural tube . fetal magnetic resonance imaging ( mri ) complements ultrasonography , confirming the suspected anomaly and even detecting malformations that were not detected at ultrasonography . the additional information provided by mri may lead to changes in the management of the pregnancy and/or of the delivery [ 25 ] . in this article we describe the radiological , pathological and clinical features of the most common ntds , and finally emphasise an integrated clinical and radiological approach for accurate diagnosis .", "in our institution , all fetal mri studies are performed after ultrasonography and mri never constitutes the first imaging study of the fetus . none of the women or fetuses receives any special preparation . although it is important to be extremely careful when undertaking any procedure on a fetus , there is no evidence of associated risk to fetal development with fetal mri [ 68 ] . we use a 1.5-tesla scanner with a four - element phased - array body coil . a complete study requires between 12 and 15 sequences , so it takes about 2530 min . the fetal mri images are obtained using ultrafast sequences to minimise artefacts due to fetal movements . it seems that slow , rhythmic maternal respiration reduces fetal movements , so it is not necessary to acquire images with maternal breath - holding . t2-weighted single shot fast spin - echo ( ssfse ) or half - fourier single - shot turbo spin - echo ( haste ) images provide most of the information necessary for diagnosis . gradient echo sequences ( echo - planar imaging [ epi ] and true fast imaging with steady state precession [ fisp ] ) have greater ferromagnetic susceptibility , so they make it possible to identify bony and vascular structures [ 1 , 9 ] . both the head and spine must be studied in all three planes . even when the only indication for fetal mri is a suspected ntd , all the fetal structures should always be studied to rule out other possible anomalies .", "the first phase , gastrulation , begins in the 2nd to 3rd weeks of gestation ; in this phase , the two layers of the embryonic plate divide into three definitive layers ( the ectoderm , mesoderm and endoderm ) . in the second phase , neurulation , which takes place in the 3rd to 4th weeks of gestation , the cells that will become the notochord interact with the overlying ectodermic tissue , causing this tissue to thicken , fold over and fuse , thus forming the neural tube . the fusion begins in the medial dorsal zone of the embryo and progresses in a zipper - like fashion cranially as the rostral neuropore and caudally as the caudal neuropore . the closure of the two ends does not occur simultaneously : the cranial end closes before the caudal end . the final phase , secondary neurulation , takes place in the 5th to 6th weeks of gestation ; in this phase a secondary neural tube forms from the cells of hensen s node , which is a mass of totipotent cells located dorsally that intervene in the formation of the notochord and later migrate caudally to the presacral region . this secondary neural tube is initially solid ; it undergoes a process of retrogressive differentiation called canalisation in which it cavitates to form the medullary cone and the filum terminale . the interruption of this process at any point , whether in the cranial end or in the caudal end , will result in an ntd [ 11 , 12 ] . the spinal column and spinal cord are the same length until 1215 weeks gestation , after which the spinal column grows more than the spinal cord until the medullary cone is situated approximately at the level of the second lumbar vertebra , where it will be at birth and will remain without significant changes throughout life [ 11 , 12 ] .", "mri is an excellent method for evaluating the structures of the fetal head and spine . images can be obtained in any plane , regardless of the position of the fetus in the uterus . the cranial vault ( fig . 1a , b ) is seen as a hypointense structure in t2-weighted images , even early in gestation . 1a ) can also be identified in any plane , but their visualisation improves as gestation advances.fig . a sagittal and b coronal t2-weighted haste images of the fetal head show the osseous structures of the base of the skull ( arrows in a ) and bones of the cranial vault ( arrows in b ) . the vertebral bodies are hypointense with a band of higher intensity in the centre ( white arrows ) , the intervertebral spaces are hyperintense ( black arrows ) . d coronal t2-weighted haste image shows the vertebral pedicles as hypointense rounded structures on both sides of the spinal canal ( arrowheads ) . the interpedicular distance in the lumbar spine is slightly increased ( arrows ) ; this is a normal finding that should not be confused with spina bifida . e axial image at the level of l1l2 shows the medullary cone ( white arrow ) inside the spinal canal ( the asterisks mark the kidneys ) . f the medullary cone is no longer seen in this axial image of the spinal canal below the kidneys ; sometimes the nerve roots can be identified ( white arrows ) a , b normal anatomy of the neural tube . a sagittal and b coronal t2-weighted haste images of the fetal head show the osseous structures of the base of the skull ( arrows in a ) and bones of the cranial vault ( arrows in b ) . the vertebral bodies are hypointense with a band of higher intensity in the centre ( white arrows ) , the intervertebral spaces are hyperintense ( black arrows ) . d coronal t2-weighted haste image shows the vertebral pedicles as hypointense rounded structures on both sides of the spinal canal ( arrowheads ) . the interpedicular distance in the lumbar spine is slightly increased ( arrows ) ; this is a normal finding that should not be confused with spina bifida . e axial image at the level of l1l2 shows the medullary cone ( white arrow ) inside the spinal canal ( the asterisks mark the kidneys ) . f the medullary cone is no longer seen in this axial image of the spinal canal below the kidneys ; sometimes the nerve roots can be identified ( white arrows ) the vertebral bodies have low signal intensity on t2-weighted sequences and are clearly seen on sagittal images . the intervertebral spaces are hyperintense and are clearly depicted in the sagittal plane ( fig . the interpedicular distance should be constant throughout the spinal column , although it does increase slightly in the lumbar region and this widening should not be confused with an ntd ( fig . the posterior elements of the vertebrae are best seen in the axial plane ( fig . 1e , f ) . caution is warranted in the assessment of possible scoliosis or kyphosis , because the spinal column can be altered by the position of the fetus in the uterus ; these pseudoalterations are more common as gestation advances , resulting in proportionately less space within the uterine cavity ( fig . the spinal canal is hyperintense in t2-weighted sequences because it is filled with cerebrospinal fluid . although the spinal cord is well depicted in all three planes , it can probably be evaluated best in the axial plane ( fig . the position of the fetus within the uterus results in a certain degree of thoracolumbar kyphosis that displaces the spinal cord anteriorly in the thoracic spine , making it difficult to see because it is adjacent to the vertebral bodies ( fig . precaution should be taken to ensure that the spinal cord disappears below the fetal kidneys ( fig . 1e , f ) ; sometimes , small hypointense structures that correspond to nerve roots are seen distal to the medullary cone ( fig . it is important to evaluate the paravertebral soft tissues in mri studies , especially in fetuses with spina bifida or destructive processes or tumours that could affect these tissues . the skin and the paravertebral muscular structures are hypointense in t2-weighted sequences . the spinal canal should be closed posteriorly by soft tissues ( fig . 1c , e , f ) .", "ntds are a heterogeneous group of anomalies that result from the partial or total failure of the neural tube to close . ntds can affect the cranial region ( anencephaly ) or the spinal region ( spina bifida ) ; spinal ntds can be divided into open or closed defects , depending on whether they are covered by a layer of skin ( fig . 2neural tube defects the overall worldwide incidence of ntds is between one and ten per 1,000 live births [ 14 , 15 ] . the rate of ntds has varied widely over time and has a clear geographical distribution . the highest incidences have been reported in mexico , ireland , india and northern china [ 16 , 17 ] . a family history of ntds is absent in 9095% of cases , and ntds are reported in 3% of miscarriages . some genetic factors like single gene mutations ( meckel - gruber and roberts syndromes ) and chromosomopathies ( trisomies 13 and 18 , triploidy ) have been identified . some maternal factors ( hyperthermia , diabetes , hyperinsulinaemia , obesity , psychosocial or emotional stress [ 1823 ] ) and some environmental factors ( maternal medication with anticonvulsants like valproic acid and carbamazepine ) can increase the incidence of ntds . prenatal screening for ntds includes the measurement of diverse markers like acetylcholinesterase and alpha - fetoprotein in amniotic fluid and in maternal serum ( alpha - fetoprotein is a glycoprotein secreted by the liver and by the fetal yolk sac ) . a recent meta - analysis confirmed that measuring alpha - fetoprotein in maternal serum during the second trimester is useful in screening for ntds . nevertheless , this marker is only useful for detecting open ntds ; furthermore , alpha - fetoprotein levels are also elevated in a long list of fetal anomalies , including omphalocele , turner s syndrome , and sacrococcygeal teratoma , amongst others .", "it is the absence of a major portion of the brain , skull and scalp above the orbits . there are two subtypes : anencephaly , in which the cranial vault , cerebral hemispheres and diencephalic structures are replaced by amorphous neurovascular tissue , and exencephaly , in which the cranial vault is absent but relatively normal amounts of brain tissue , albeit abnormally developed , is present . some authors consider exencephaly an early stage of anencephaly , because the unprotected anomalous brain tissue located outside the cranial vault will eventually take on the appearance of anencephaly after being destroyed by the trauma induced by constant collision against the walls of the uterus . in both exencephaly and anencephaly , the base of the skull , the facial structures , and the orbits are present and are usually normal . mri is usually not used to evaluate fetuses with these conditions because ultrasonography usually detects this anomaly very early and mri is not required to confirm this diagnosis . fetal mri studies show the absence of osseous structures above the orbits and the absence of brain tissue or alterations in brain tissue when it is present . it is considered a lethal anomaly ,", "the specific name of the anomaly depends on the structures contained in the herniated sac ; for example , a meningocele contains meninges and cerebrospinal fluid , an encephalomeningocele contains meninges and brain tissue and an encephalomeningocystocele or encephalomeningohydrocele contains meninges , brain tissue , and part of the ventricular system ( fig . 3 ) . most encephaloceles occur along the midline in the occipital or frontal region , but they can also involve the anterior cranial fossa ( into the nasal sinuses ) or even the base of the skull ( into the sphenoid or ethmoid sinus).fig . 3encephalocele . a sagittal and b axial t2-weighted haste images show the protrusion of the occipital lobe and occipital horn of the ventricular system ( black arrows in a and b ) through a defect in the bone and soft tissues ( white arrows in a ) . c ultrasound image also shows the protrusion of the occipital lobe ( white arrows ) . d , e images of the same fetus at 31 weeks gestation show a decrease in the extruded encephalic component ( arrow in e ) and an increase in the associated meningeal component ( arrow in d ) encephalocele . a sagittal and b axial t2-weighted haste images show the protrusion of the occipital lobe and occipital horn of the ventricular system ( black arrows in a and b ) through a defect in the bone and soft tissues ( white arrows in a ) . c ultrasound image also shows the protrusion of the occipital lobe ( white arrows ) . d , e images of the same fetus at 31 weeks gestation show a decrease in the extruded encephalic component ( arrow in e ) and an increase in the associated meningeal component ( arrow in d ) encephaloceles are usually diagnosed by ultrasonography . mri s role is to specify the type of lesion , which is more important in smaller lesions and in those that affect the anterior cranial fossa or base of the skull . it is essential to evaluate the rest of the structures in the head and the neural tube , fundamentally the posterior fossa because it can be difficult to evaluate with ultrasonography . 3d ) as well as the presence of brain tissue inside the herniated sac in cases of encephalomeningocele ( fig . 3a , b , e ) . other anomalies like open spina bifida or ventriculomegaly that are often associated with encephaloceles are easy to evaluate with mri . the differential diagnosis for encephalocele is based on the size , content and location of the lesion . the main differential diagnosis for encephaloceles located in the occipital region is with cystic hygroma , whereas for those located in the frontal region , the differential diagnosis is with teratoma and haemangioma of the scalp . both teratomas and haemangiomas of the scalp are shown as slightly heterogeneous but well - defined solid masses with variable signal intensity ; haemangiomas may have areas of signal voiding due to their intense vascularisation . an encephalocele may form part of a syndrome like meckel - gruber syndrome and it can be associated with other anomalies like ventriculomegaly , spina bifida ( 715% of all encephaloceles ) , microcephaly , or cleft lip and/or cleft palate . the prognosis depends on the size , location and extent of the lesion as well as on whether other anomalies are present .", "iniencephaly is an ntd affecting the occipital bone combined with rachischisis of the cervicothoracic spine and retroflexion of the head ( fig . 4 ) . fetuses with iniencephaly have a variable defect in the occipital bone with an enlarged foramen magnum , the partial or total absence of cervicothoracic vertebrae with irregular fusion of those that are present and incomplete closure of the vertebral bodies and arches . these alterations result in significant shortening of the spine and of the fetus due to marked lordosis with hyperextension of the head . iniencephaly can be open ( associated with encephalocele ) or closed ( spinal anomaly without encephalocele ) .fig . the spine is short , the head is hyperextended , and there is a nuchal fold ( arrow ) . the spine is short , the head is hyperextended , and there is a nuchal fold ( arrow ) . b pathological specimen the differential diagnosis is with klippel - feil syndrome ( short neck and fusion of the cervical vertebrae ) . some authors believe that klippel - feil syndrome is a milder form of iniencephaly . the prognosis of iniencephaly in the neonatal period is dismal , so whether other anomalies are present is unimportant .", "spinal dysraphism is the result of a congenital vertebral defect due to the failure of the caudal neuropore to close that leads to the exposure of the contents of the medullary canal to the exterior . the defect usually involves the posterior vertebral elements , although it can also involve the vertebral body itself . the defect is usually located in the lumbosacral region , but it can occur at any level and it can even involve the entire spine . the absence of skin and muscle in these areas is due to the failure to induct the overlying ectodermal and mesodermal tissues . other theories postulate the existence of an unbalance in the production and reabsorption of cerebrospinal fluid during the embryonic period that leads to an excessive accumulation in the already closed neural tube ( hydromyelia ) , which in turn causes a secondary separation from the dorsal wall . spinal dysraphism comprises a wide spectrum of anomalies ; these can be divided into open and closed defects . rachischisis is the most severe form of spina bifida ; in this lethal condition , an extensive segment of the rachis is absent , resulting in extensive exposure of neural tissue . myelomeningocele and myeloschisis ( myelocele ) are the most common spinal dysraphism , accounting for 85% of all cases [ 12 , 32 ] . in these lesions , neural contents are exposed to the exterior through midline defects in the bone and skin [ 12 , 33 ] . when the spinal canal is directly exposed , the anomaly is called myeloschisis or myelocele ( fig . 5 ) , and when intramedullary structures lined with meninges protrude or herniate due to the expansion of the underlying subarachnoid space , it is called myelomeningocele ( fig . 6 ) . myelomeningocele is the most common open spinal dysraphism [ 32 , 35 ] . by definition , there must be a vertebral defect , the most common of which is the absence of the posterior vertebral arches ( figs . the main characteristic that allows myelomeningoceles to be differentiated from myeloschisis is the position of the neural placode , a remnant of the unfolded ( non - neurulated ) neural tube , with respect to the surface of the skin . in myelomeningocele , the neural placode protrudes behind the surface of the skin ( fig . 6a , b , f ) , whereas in myeloschisis it is at the same level ( fig . another , extremely rare type of open dysraphism is the hemimyelomeningocele or hemimyelocele : in this anomaly , diastematomyelia is associated with one of the above - mentioned anomalies in which one of the hemicords does not complete neurulation [ 32 , 36 ] . this finding is important because if diastematomyelia is not suspected , the surgical repair of the myelomeningocele will not include the repair of the tethered cord that is nearly always present in diastematomyelia [ 1 , 9 , 37].fig . a , b axial t2-weighted haste image of the fetal cranium shows the deformity of the frontal bones ( black arrows in a ) and the characteristic beaklike shape of the ventricular horns ( arrows in a ) . the posterior fossa deformity can also be seen : the cisterna magnum is absent and the foramen magnum is enlarged due to the descent of the structures of the posterior fossa toward the spinal canal ( arrows in b ) . c sagittal t2-weighted haste image shows a cutaneous defect or thinning in the lumbosacral region ( arrowhead ) with no mass protruding through the defect as well as an associated chiari malformation ( black arrow ) . d axial image at the level of the cutaneous defect shows the abnormally low neural placode within the spinal canal without expansion of the subarachnoid spaces a sagittal t2-weighted haste image shows a small cystic mass protruding at the thoracolumbar level ( black arrow ) . associated hydrocephalus ( asterisk ) and a chiari malformation ( white arrow ) are also seen . b axial t2-weighted haste image at the lumbosacral level shows the neural placode protruding outside the surface of the skin due to expansion of the adjacent subarachnoid space ( black arrow ) . c coronal image at the spinal level shows increased interpedicular distance at the level of the neural defect . d ultrasound image of a different patient shows a cystic mass protruding at lumbar level ( white arrows ) . a , b axial t2-weighted haste image of the fetal cranium shows the deformity of the frontal bones ( black arrows in a ) and the characteristic beaklike shape of the ventricular horns ( arrows in a ) . the posterior fossa deformity can also be seen : the cisterna magnum is absent and the foramen magnum is enlarged due to the descent of the structures of the posterior fossa toward the spinal canal ( arrows in b ) . c sagittal t2-weighted haste image shows a cutaneous defect or thinning in the lumbosacral region ( arrowhead ) with no mass protruding through the defect as well as an associated chiari malformation ( black arrow ) . d axial image at the level of the cutaneous defect shows the abnormally low neural placode within the spinal canal without expansion of the subarachnoid spaces . a sagittal t2-weighted haste image shows a small cystic mass protruding at the thoracolumbar level ( black arrow ) . associated hydrocephalus ( asterisk ) and a chiari malformation ( white arrow ) are also seen . b axial t2-weighted haste image at the lumbosacral level shows the neural placode protruding outside the surface of the skin due to expansion of the adjacent subarachnoid space ( black arrow ) . c coronal image at the spinal level shows increased interpedicular distance at the level of the neural defect . d ultrasound image of a different patient shows a cystic mass protruding at lumbar level ( white arrows ) . e pathological specimen . f sagittal diagrams of the anomaly open spina bifida is nearly always found together with chiari type ii malformation , which is an anomaly of the posterior fossa consisting of herniation of part of the cerebellum ( vermis and fourth ventricle ) and of the brainstem through the foramen magnum ( figs . this association is thought to be due to the collapse of the primitive fetal ventricular system ( brought about by the loss of cerebrospinal fluid through the spinal defect ) , which prevents the rhombencephalic vesicle ( from which the brainstem , fourth ventricle , and cerebellum are derived ) from expanding and results in deficient development of the posterior fossa and herniation . recent studies have reported worse prognoses for fetuses with greater cerebellar herniation , related to an increased incidence of seizures , vesical dysfunction , and dependency for ambulation . open spina bifida is accompanied by a collapse of the extra - axial subarachnoid spaces ( fig . 6a ) secondary to mechanical obstruction from the chiari malformation or to dysfunctional reabsorption of cerebrospinal fluid [ 38 , 40 ] in 75% of cases . this is why it is essential to evaluate the spine carefully to rule out spinal dysraphism when ventriculomegaly is detected at any gestational age . likewise , the shape of the ventricles is abnormal owing to the acute angle of the ventricular horns ( fig . 5a ) . as in ultrasonography , in mri both direct and the indirect signs of spina bifida at the level of the fetal cranium ( the lemon sign : special shape of the cranium due to deformity of the frontal bones [ fig . 5a ] and the banana sign : special shape of the posterior fossa secondary to displacement of the cerebellar hemispheres toward the cervical canal , which results in the obliteration of the cisterna magnum [ fig . other cranial anomalies , like the collapse of the subarachnoid space , a beak - shaped mesencephalic tectum , dysgenesis of the corpus callosum and subependymal heterotopias are all better seen on mri . the differential diagnosis will depend fundamentally on the contents and location of the spinal defect . the intracranial anomalies that accompany ntds can help in differentiating between these two entities , because teratomas are not usually accompanied by intracranial anomalies . distinguishing between open and closed spinal dysraphism is of the utmost importance because the long - term functional and neurological prognoses are notably better in cases of closed dysraphism than in cases of open dysraphism [ 39 , 41 ] . it is of the utmost importance to obtain an accurate and specific assessment of the anomaly due to the progressive incorporation of in utero treatments . latest trials in fetal surgery for myelomeningocele have shown a significant reduction of vp shunt placement , an improvement in the overall neuromotor function and a significantly reversed hindbrain herniation in those patients who underwent fetal repair compared with those who underwent postnatal surgery . this trial has also revealed that in utero therapy increases the risk of spontaneous rupture of membranes , oligohydramnios and preterm delivery . fetal mri provides a better overview for the neurosurgeon who is familiar with mri and not as much with ultrasound . specific details with respect to the level and magnitude of the defect can help the intra - uterine management of the spinal anomaly . the resolution of mri is less than ultrasound , but the diagnostic value of mri is less dependent on the fetal position . the term closed is more appropriate than occult , because cutaneous signs that raise suspicion of these anomalies are present in up to 50% of cases [ 34 , 43 ] . the soft tissues that cover the spine dorsally can be identified as a hypointense line on sagittal and axial t2-weighted images ( figs . , this line is interrupted at the level of the lesion ; this finding is essential for differentiating between open and closed dysraphism . closed dysraphism is not usually associated to cranial alterations like chiari malformation or ventriculomegaly [ 1 , 9 ] and does not manifest with elevated alpha - fetoprotein . a sagittal t2-weighted haste image shows an interruption in the posterior vertebral arches in the lumbar region ( arrow ) . a posterior fossa anomaly with an elevated vermis and dilation of the iv ventricle is also seen ( asterisk ) . b axial image at the lumbar level showing the cystic mass protruding through the spinal defect ( black arrow ) . two nerve roots ( white arrow ) can be seen arising from the non - neurulated neural placode inside the spinal defect . a sagittal t2-weighted haste image shows an interruption in the posterior vertebral arches in the lumbar region ( arrow ) . a posterior fossa anomaly with an elevated vermis and dilation of the iv ventricle is also seen ( asterisk ) . b axial image at the lumbar level showing the cystic mass protruding through the spinal defect ( black arrow ) . two nerve roots ( white arrow ) can be seen arising from the non - neurulated neural placode inside the spinal defect . d sagittal diagram of the anomaly there are three main types of closed spinal dysraphisms with masses . in the first , further subdivided into lipomyelomeningocele and lipomyeloschisis ( lipomyelocele ) ( fig . 8) , direct contact between the mesenchymal tissue and neural tube affects the differentiation of fatty tissue . clinically , these lesions are characterised by the presence of a lipomatous subcutaneous mass above the gluteal cleft . in these cases , it is important to note the point where the lipoma joins the neural placode to differentiate between a lipomyelomeningocele and lipomyeloschisis . the point of union in lipomyelomeningoceles is outside the neural canal due to the expansion of the subarachnoid space , whereas in lipomyeloschisis the lipoma joins the neural placode inside the neural canal after entering through a defect in the bone ( fig . a sagittal t2-weighted haste image shows a deformity of the spinal canal completely covered by soft tissues ( arrows ) . b coronal image showing the widening of the spinal canal at the lumbar level ( white arrows ) and abnormally low termination of the medullary cone ( black arrow ) below the kidneys . c ct study after birth shows the deformed , widened spinal canal ( arrowheads ) and soft - tissue calcification behind the bone defect ( white arrows ) . d sagittal t1-weighted mri image obtained after birth shows the abnormally low medullary cone , a lipomatous component within the spine ( white arrows ) , and soft - tissue calcification ( black arrow ) . e axial t1-weighted image showing spinal cord duplication ( black arrows ) and the lipomatous component within the spine ( asterisk ) . a sagittal t2-weighted haste image shows a deformity of the spinal canal completely covered by soft tissues ( arrows ) . b coronal image showing the widening of the spinal canal at the lumbar level ( white arrows ) and abnormally low termination of the medullary cone ( black arrow ) below the kidneys . c ct study after birth shows the deformed , widened spinal canal ( arrowheads ) and soft - tissue calcification behind the bone defect ( white arrows ) . d sagittal t1-weighted mri image obtained after birth shows the abnormally low medullary cone , a lipomatous component within the spine ( white arrows ) , and soft - tissue calcification ( black arrow ) . e axial t1-weighted image showing spinal cord duplication ( black arrows ) and the lipomatous component within the spine ( asterisk ) . g sagittal diagrams of the anomaly the second type is a meningocele with cutaneous lining . anterior meningoceles are much less common and tend to be located in the presacral region . the third type , myelocystocele ( fig . 7 ) , consists of the herniation of a segment of the spinal cord with a dilated ependymal canal within a meningocele ; these lesions can occur at any point in the spine . myelocystoceles are similar to myelomeningoceles ; the two entities are differentiated by the thickness of the wall of the herniated sac ( fig . 7b ) , the absence of the chiari malformation , and the absence of elevated alpha - fetoprotein levels [ 1 , 9 ] . simple lesions include intradural lipomas , filum terminale lipomas , tight filum terminale syndrome , persistent terminal ventricle , and dermal sinus . intradural lipomas are lipomas located within the spine that are contained within the dural sac . these lesions generally affect the lumbosacral region and are usually associated with the tethered cord syndrome . filum terminale lipomas or fibrolipomatous thickening of the filum terminale can be considered normal variants unless there is clinical evidence of a tethered cord . filum terminale lipomas are identified as linear thickening of the filum terminale that is hyperintense on t1-weighted sequences . the tight filum terminale syndrome is characterised by shortening and hypertrophy of the filum terminale and consequent cord tethering syndrome . persistent terminal ventricle consists of small linear cavities inside the medullary cone immediately above the filum terminale . a dermal sinus is an epithelial fistula that connects the neural tissue or the meninges with the surface of the skin . dermal sinuses are usually located in the lumbosacral region and are usually found together with an intraspinal dermoid cyst . clinically , they present with a small midline pit , a cutaneous nevus , an area of hyperpigmentation , or a capillary haemangioma . detecting all these findings prenatally is extremely difficult ; however , the fistulous tract can be identified using high resolution mri techniques . these patients require surgical repair after birth because the fistulous tract that communicates the skin with the neural tissue can predispose to infections of the neural contents . complex closed spinal dysraphisms can be divided into disorders of midline notochord integration and disorders of notochord malformation . disorders of midline notochord integration include enteric fistula , which is an abnormal connection between the digestive tract and the surface of the skin that may or may not be accompanied by a neurenteric cyst . neurenteric cysts are lined with epithelial mucosa similar to that of the gastrointestinal tract and are typically located in the anterior cervicothoracic region . 8) , which consists of a longitudinal splitting of the spinal cord into two hemicords . there are two types of diastematomyelia : in type 1 , both hemicords are wrapped in independent meningeal linings and are separated by an osseous or cartilaginous septum ; whereas in type 2 , the two hemicords share a common meningeal lining [ 32 , 48 ] . the septum in type 1 diastematomyelia can be seen as a hypointense linear structure within the spinal canal on t2-weighted sequences . caution should be taken not to confuse this septum with the spinal cord , as both structures have the same signal intensity . the soft tissues and the skin that cover these anomalies are usually intact unless they form part of a more complex anomaly . diastematomyelia is normally accompanied by vertebral anomalies like hemivertebrae or butterfly vertebrae , tethered cord , or open spina bifida ( hemimyelomeningocele or hemimyelocele ) . disorders of notochord malformation include caudal regression syndrome , which consists of the total or partial agenesis of the lumbar and sacral spine , probably secondary to a disturbance in the formation of the secondary neural tube . caudal regression syndrome is divided into two types : in type 1 , the medullary cone is high and ends abruptly ; in type 2 , the spinal cord is tethered and the medullary cone is low - lying [ 32 , 46 ] . caudal regression syndrome comprises a wide spectrum of anomalies ranging from sacral agenesis or dysgenesis to sirenomelia ( fusion of the lower limbs ) . some authors believe that type 1 and type 2 caudal regression actually represent two distinct entities . caudal regression can be found in association with other anomalies like omphalocele , bladder exstrophy , imperforate anus and spinal defects ( oeis complex ) ; vertebral anomalies , anal anomalies , cardiac anomalies , tracheoesophageal fistula , limb malformations , hydrocephalus ( vacterl - h ) ; and sacral agenesis , anal atresia and presacral teratoma or meningocele ( currarino triad ) . another disorder of notochord malformation is segmental spinal dysgenesis , which includes agenesis or dysgenesis of the thoracic or lumbar spine , alterations of the spinal cord and nerve roots , congenital paraparesis or paraplegia , and deformities in the lower limbs .", "their prenatal diagnosis can predict the viability of the fetus , has implications for family counselling about the pregnancy , and orients the prognosis and management of the newborn . ultrasonography remains the primary imaging test for the prenatal diagnosis of ntds , but sometimes it does not enable an accurate diagnosis so other diagnostic techniques are necessary . fetal mri has advanced rapidly in the last 25 years , developing from an experimental technique to become a fundamental tool in normal clinical practice in many centres around the world . mri s ability to detect complex anomalies that involve different organs has been widely reported . fetal mri should be restricted to centres with experienced staff and should never be considered a replacement for ultrasonography , which continues to be the technique of choice to evaluate fetal morphology ." ]

[ "patient acuity has been increasing , patient turnover is higher , and patients are frequently of advanced age with several comorbid disorders . limited resources and the pressure for higher efficiency can result in the suboptimal delivery of healthcare . during treatment within the healthcare system , a significant percentage of patients ( 316% ) suffer from adverse events through system errors- with 1565% of adverse patient events being attributed to communication failure . patient care can involve several health care providers with several transfers between providers . in this transition , poor or incomplete relay of patient data may result in errors , near misses and adverse events . standardized and thorough communication of critical information is an essential component of patient safety , . although individual us based handover guidelines , and handover tools have been developed , these practices are not widespread . a previous survey study observed that 31% of mds experienced daily clinical problems which they believed avoidable if provided with adequate hand - over processes . widespread us practice of verbal hand - over has been observed to be highly inefficient . the world health organization listed communication during patient care handovers as one of its high 5 patient safety initiatives . the joint commission international listed their 2nd national patient safety goal as to improve the effectiveness of communication among caregivers . there is a lack of studies on how anaesthesiologists hand over their patients , which is surprising given that anesthesiology is a specialty that has always aimed at placing patient safety as its top priority . the standards of postoperative care issued by the american society of anesthesiology does not state how handover should be performed nor what information it should include , leaving the handover process decision up to the individual clinician . studies analyzing anesthetic team handover in the recovery room observed that the majority of handovers were remarkably brief and insufficient- . in these studies , critical details such as the preoperative state of the patient , type of operation performed , amount and kinds of analgesics given and problems encountered during the case were either barely mentioned or underplayed . in some instances significant intraoperative events were completely disregarded . additionally , there were frequent distractions present at the time of the hand - over . there are no reported studies on handover practices performed by anesthesia providers when transition of care occurs intraoperatively . this preliminary pilot study was a qualitative rather than quantitative survey to highlight the scope of the current us intraoperative handover of patient information .", "this study had institutional approval ( wayne state university irb ) . due to the anonymity of the suvey content , this study used an online questionnaire format with 8 survey questions created using a computerized online survey program ( survey monkey , palo alto , ca , usa , ) . an e - mail with a link to the questionnaire was sent to anesthesia providers at all anesthesia residency programs nationwide ( 120 out the 132 us programs encompassing around 4500 residents and their attending academic mdas ) and a smaller survey selection of crnas ( 10 institutions about 300 crnas in the metropolitan area of detroit , mi ) . all questionnaires were anonymous and were only sent to us anesthesia providers working in an academic hospital setting with an associated residency program in anesthesiology . the only demographics of surveyed anesthesia health care providers obtained were for medical training level ( certified registered nurse anesthetist -crna , medical doctor of anesthesiology resident mdar , or medical doctor of anesthesiology mda ) .", "from all questionnaires received ( n = 216 ) , 87 ( 40.3% ) of respondents were mdas , 71 ( 32.9% ) were mdar , and 58 were crnas ( 26.9% ; table 1 ) . the response rate to this survey was low with a response from approximately 5% of the resident population in us anesthesia programs and approximately 20% of the crnas surveyed in the metropolitan detroit area . of all respondents , 108 ( 49.1 % ) stated that they did not have a handover protocol at the institution where they practiced ( table 1 ) . of the respondents who did have an institutional handover policy furrthermmore , 85.7% respondents reported not having a departmental standardized handover form ( table 2 ) . of all responders , 84.8% ( 173/204 ) had an experience where they had not received sufficient information during a patient handover . only 7.4% ( 15/203 ) of respondents had never experienced complications or mismanagement due to poor or incomplete handover . in comparison , 59.6% ( 121/203 ) reported rarely having complications , 30.5% ( 62/203 ) reported sometimes having complications and 2.5% ( 5/203 ) reported frequently having complications ( table 3 ) . respondents were asked to respond on the frequency in which they addressed the specific handover information such as allergies and medications , past medical history , intraoperative events ( anesthesia related and surgery related ) , postoperative plans ( extubation / icu , etc . ) , special concerns ( code status , jehovah 's witness , type and screen antibodies , airway information ( ie . h / o difficult intubation ) and significant diagnostic studies ( e.g blood lab , ekg , chest x - ray , stress tests , pulmonary function tests , etc . ) . for this specific handover information , the majority of providers frequently or always relayed information regarding patient allergies ( 89.2% ) , past medical history ( 99% ) , anesthesia related intraoperative events ( 99% ) , surgery related intraoperative events ( 91.7% ) , airway information ( 97.5% ) and significant diagnostic studies ( 84.2% ; fig . 1 ) . however , information about medications ( 31.4% ) , postoperative plan ( 19.1% ) , code status ( 75.4% ) , information about refusal of blood ( 21.1% ) and type and screen antibodies ( 49% ) were either sometimes , rarely or never included during handover . from the specific list of patient handover information factors , 80.5% ( 165/204 ) of responders stated that these factors would be sufficient for an effective , complete handover . on a scale from 15 , key - ( 1 = never , 2 = rarely , 3 = sometimes , 4 = frequently , 5 = always . mdar - medical doctor of anesthesiology resident , crna- certified registered nurse anesthetist , mda - medical doctor of anesthesiology . ponv : post - operative nauseaand vommitting ; mh : malignant hyperthermia ; iv : intravenous .", "this pilot study was a qualitative rather than quantitative survey to highlight the scope of the current problem of us intraoperative handover of patient information . poor transition of patient care from the operating room has a high potential for adverse patient outcomes . our study indicates that the current intraoperatvive handover processes among anesthesia providers do not have standard uniform practices , and there may be a high proportion of insufficient patient handover practices . these findings are surprising given that the anesthesiology specialty places patient safety as one of its top objectives and that all survey respondents practiced in an academic institution . major limitations of this study were the low response rate of 216 respondents and that due to annonymous nature of this survey the number of individual academic institutitions could not be determined . additionally , there is the possibility that there was a bias towards an increased proportion of responses from anesthesia providers who had prior poor handover experiences and were unsatisified with current practice . the lack of standardized handover process has resulted in substandard patient care in us healthcare setting , . , we hope that our study will stimulate a discussion of us handover practices in the anesthesia field . increased awareness in handover practices we believe that patient handover practices should be discussed and an optimal response would be the formation of an expert consortium with the aim to develop and implement standardized protocols ." ]

[ "slc / ccl21 , normally expressed in high endothelial venules and in t cell zones of spleen and lymph nodes , strongly attracts t cells and dendritic cells ( dc ) [ 1 - 8 ] . slc / ccl21 recruits both nave lymphocytes and antigen stimulated dc into t cell zones of secondary lymphoid organs , co - localizing these early immune response constituents that culminate in cognate t cell activation . the capacity to facilitate the co - localization of both dc and t cells forms a strong rationale for the use of slc / ccl21 in cancer therapy . in previous studies we have shown that the slc / ccl21-mediated anti - tumor responses are accompanied by the enhanced elaboration of ifn , ip-10/cxcl10 , mig / cxcl9 , gm - csf and il-12 , but decreased pge2 , vegf , il-10 , and tgf- at the tumor site . in addition , there was a marked increase in cd4and cd8cells secreting ifn and gm - csf as well as dc expressing cd11c infiltrating the tumors . mig / cxcl 9 and ip-10/cxcl10 are glutamine - leucine - arginine ( elr)-negative cxc chemokines that are potent chemoattractants for activated t cells [ 11 - 13 ] . these chemokines also have in common the ability to signal through a g protein - coupled receptor , cxcr3 , expressed on activated t lymphocytes . ip-10/cxcl10 , mig / cxcl9 and ifn are known to have potent anti - tumor activities in vivo [ 14 - 17 ] . both mig / cxcl9 and ip-10/cxcl10 are important for the anti - tumor activity mediated by ifn inducing cytokines such as il-12 . based on these findings we hypothesized that augmentation in ifn , mig / cxcl9 , and ip-10/cxcl10 would play an important role in the slc / ccl21-mediated anti - tumor response . here we show that the cytokines ifn , ip-10/cxcl10 and mig / cxcl9 serve as effector molecules in slc / ccl21-mediated anti - tumor responses .", "host antigen presenting cells ( apc ) are critical for the cross - presentation of tumor antigens . however tumors have the capacity to limit apc maturation , function and infiltration of the tumor site [ 21 - 24 ] . thus molecules that attract host apc and t cells could serve as potent agents for cancer immunotherapy . a potentially effective pathway to restore ag presentation is the establishment of a chemotactic gradient that favors localization of both activated dc and type 1 cytokine producing lymphocytes at the tumor site . slc / ccl21 , a cc chemokine expressed in high endothelial venules and in t cell zones of spleen and lymph nodes , strongly attracts naive t cells and dcs [ 1 - 8 ] . because dcs are potent apcs that function as principal activators of t cells , the capacity to facilitate the co - localization of both dc and t cells may reverse tumor - mediated immune suppression and orchestrate effective cell - mediated immune responses [ 9,10,25 - 27 ] . in addition to its immunotherapeutic potential , slc / ccl21 has been found to have potent angiostatic effects , thus adding further support for its use in cancer therapy . based on these dual capacities , we as well as others have begun pre - clinical evaluation of slc / ccl21 in several tumor models [ 9,10,25 - 27 ] . utilizing two transplantable murine lung cancer models , we have previously shown that the anti - tumor efficacy of slc / ccl21 is t cell - dependent . in both models recombinant slc / ccl21 administered intratumorally led to complete tumor eradication in 40 % of the treated mice . studies performed in cd4 and cd8 knockout mice also revealed a requirement for both cd4 and cd8 lymphocytes subsets for slc / ccl21 mediated tumor regression . consistent with these findings we found that slc therapy did not alter tumor growth in scid mice . in immune competent mice , intratumoral injection of slc / ccl21 led to a significant increase in cd4 and cd8 t lymphocytes as well as dc infiltrating the tumor and the draining lymph nodes . the cellular infiltrates were accompanied by an enhanced elaboration of il-12 , ifn , ip-10/cxcl10 and mig / cxcl9 at the tumor site . slc / ccl21 is documented to have direct anti - angiogenic effects ; the tumor reductions observed in this model could have been due to participation by t cells secreting ifn leading to inhibition of angiogenesis via mig / cxcl9 and ip-10/cxcl10 , as well as t cell - dependent immunity . both mig / cxcl9 and ip-10/cxcl10 are chemotactic for stimulated cxcr3-expressing activated t lymphocytes that could further amplify ifn at the tumor site . hence we postulated that in addition to ifn , ip-10/cxcl10 and mig / cxcl9 would also be important contributors to the tumor reduction in the context of slc / ccl21 therapy . to determine the importance of mig / cxcl9 , ip-10/cxcl10 and ifn in the slc / ccl21 mediated antitumor response , these cytokines were depleted in slc / ccl21-treated mice . anti - ip-10/cxcl10 , mig / cxcl9 and ifn antibodies each partially but yet significantly inhibited the anti - tumor efficacy of slc / ccl21 ( figure 1 * p < 0.01 compared to the control antibody group ) . neutralization of ifn caused a significant decrease in both mig / cxcl9 and ip-10/cxcl10 indicating that these chemokines are largely ifn dependent . thus , an increase in ifn at the tumor site of slc / ccl21-treated mice could explain the relative increases in ip-10/cxcl10 and mig / cxcl9 . the converse was also observed ; ifn production at the tumor site was found to be mig / cxcl9- and ip-10/cxcl10-dependent as indicated by the fact that neutralization of these cytokines caused a significant decrease in ifn(figure 2 ) . neutralization of any one of these cytokines caused a concomitant decrease in all three cytokines , thus indicating that ifn , mig / cxcl9 and ip-10/cxcl10 are interdependent in the slc / ccl21-mediated anti - tumor responses . based on these findings , we speculated that the decrease of ip-10/cxcl10 and mig / cxcl9 led to a decrease in ifn by limiting the influx of t cells producing ifn at the tumor site . because mig / cxcl9 and ip-10/cxcl10 are chemotactic for stimulated cxcr3 expressing activated t lymphocytes , we determined if neutralizing these chemokines in vivo in the slc / ccl21-treated mice would decrease the frequency of cxcr3 expressing t cells at the tumor sites . compared to slc / ccl21-treated mice receiving control antibody , flow cytometric evaluation of single - cell suspensions of non - necrotic tumors from slc / ccl21-treated mice receiving neutralizing antibodies to mig / cxcl9 , ip-10/cxcl10 and ifn showed 10 , 12 and 31 % decreases , respectively , in the gated cd3 cxcr3 t cell populations ( table 1 ) . the fact that neutralization of ifn was the most efficient at decreasing the total number of cxcr3-activated t cells may be due to the decrease in the ifn-dependent cxcr3 ligands mig / cxcl9 and ip-10/cxcl10 . individually , neutralizing mig / cxcl9 and/or ip-10/cxcl10 only led to a partial decrease in the total number of cxcr3-activated t cells . because mig / cxcl9 and ip-10/cxcl10 share the same receptor ( cxcr3 ) , one possible explanation of a partial decrease in cxcr3-activated t cells is that neutralization of one ligand may overexpose the receptor to the other ligand . furthermore , because murine slc / ccl21 binds cxcr3 receptor , slc / ccl21 may be recruiting cxcr3 t cells directly . an alternative explanation is that residual cytokines such as ifn - inducible t cell chemoattractant ( itac / cxcl11 ) present after in vivo neutralization of ifn , mig , ip-10 may have remaining activity and attract cxcr3 t cells . our results imply that all 3 cytokines , ifn , mig and ip-10 play interrelated roles in the recruitment of cxcr3-activated t cells in slc / ccl21-mediated anti - tumor responses . while the number of cd4 and cd8 cells remained unaltered , compared to slc / ccl21-treated mice receiving control antibody , mice administered neutralizing antibodies to mig / cxcl9 , ip-10/cxcl10 and ifn showed respective decreases of 38 , 28 and 16% in the number of cd11cdec205dc infiltrating the tumor ( table 1 ) . at present it is not clear why there is a decrease in dc following neutralization of mig / cxcl9 , ip-10/cxcl10 and ifn. a plausible explanation is that these cytokines may be involved in complex interactions with other molecules that are chemotactic for dc . further studies are required to delineate the mechanisms responsible for mig / cxcl9 , ip-10/cxcl10 and ifn mediated localization of dc at the tumor site . 5 days following tumor implantation , mice were treated intratumorally with recombinant murine slc / ccl21 ( 0.5 g ) 3x / week . one day before slc / ccl21 administration , mice were given the respective cytokine antibody by i.p . antibodies to : ip-10/cxcl10 , mig / cxcl9 and ifn significantly inhibited the antitumor efficacy of slc / ccl21 ( * p < 0.01 compared to the control antibody treated group ) . n = 8 mice group slc / ccl21-treated mice had a significant induction in ifn , mig / cxcl9 and ip-10/cxcl10 at the tumor site compared to diluent treated control tumor bearing mice ( p < 0.001 ) . assessment of cytokine production at the tumor site of slc / ccl21 treated mice receiving anti - ifn , anti mig / cxcl9 and anti ip-10/cxcl10 showed an interdependence of ifn , mig / cxcl9 and ip-10/cxcl10 : neutralization of any one of these cytokines in vivo caused a concomitant decrease in all three cytokines ( * p < 0.01 compared to the control antibody treated group ) . n= 8 mice per group neutralization of ip-10 , mig and ifn reduces the frequency of cd3cxcr3 t lymphocytes and cd11cdec205dc at the tumor site of slc / ccl21-treated mice single cell suspensions of non - necrotic tumor nodules from slc / ccl21 treated mice receiving neutralizing antibodies to p-10/cxcl10 , mig / cxcl9 , ifn , control ab and diluent treated tumor bearing mice were prepared . cell surface staining for t cell markers cd4 , cd8 , cd3 , and the chemokine receptor cxcr3 as well as dc markers cd11c and dec205 were evaluated by flow cytometry . cells were identified as lymphocytes or dc by gating on the forward and side scatter profiles ; 10,000 gated events were collected and analyzed using cell quest software . within the gated t lymphocyte population , intratumoral injection of slc / ccl21 led to an increase in the frequency of cd4 , cd8 , cd3cxcr3events compared to the diluent control ( * p < 0.001 ) . within the gated dc population , intratumoral injection of slc / ccl21 led to an increase in the frequency of cd11cdec205events compared to the diluent control ( * p < 0.001 ) . compared to slc / ccl21-treated mice receiving control antibody , mice receiving neutralizing antibodies to ip-10/cxcl10 , mig / cxcl9 , and ifn showed decrease in the gated cd3cxcr3 t cell as well as cd11cdec205 dc events ( * * p < 0.01 ) ( n = 8 mice per group ) .", "our results suggest that the anti - tumor properties of slc / ccl21 may be due to its chemotactic capacity in co - localization of dc and t cells as well as in part to the induction of key cytokines such as ifn , ip-10/cxcl10 and mig / cxcl9 .", "abs to murine ifn , recombinant ifn were obtained from pharmingen ( san diego , ca ) . abs to murine mig / cxcl9 , ip-10/cxcl10 and recombinant cytokine standards was purchased from r&d ( minneapolis , mn ) . polyclonal goat anti - murine mig / cxcl9 and anti - murine ip-10/cxcl10 specific anti - serum were produced and characterized as previously described . anti - mouse ifn monoclonal ( r4 - 462 , american type culture collection , rockville , maryland , md ) neutralizing antibody was purified by affinity chromatography from scid mice ascites , which was generated 34 weeks after intraperitoneal injection of 10r4 - 462 hybridoma cells per mouse . for flow cytometry , labeled antibodies ( fitc , pe , percp ) against the t cell surface markers to cd3 , cd4 , cd8 and against the dc markers , cd11c and dec 205 and the appropriate controls were purchased from pharmingen . a weakly immunogenic lung cancer , lewis lung carcinoma ( 3ll , h-2 ) obtained from atcc ( crl-1642 , llc ) was utilized for assessment of cytokines important for slc / ccl21 mediated anti - tumor responses in vivo . the cells were routinely cultured as monolayers in 25 cmtissue culture flasks containing rpmi 1640 medium ( irvine scientific , santa anna , ca ) supplemented with 10% fetal bovine serum ( fbs ) ( gemini bioproducts , calabasas , ca ) , penicillin ( 100 u / ml ) , streptomycin ( 0.1 mg / ml ) , 2 mm glutamine ( jrh biosciences , lenexa , ks ) and maintained at 37c in a humidified atmosphere containing 5% co2 in air . the cell lines were mycoplasma free and cells were utilized up to the tenth passage before thawing frozen stock cells from liquid n2 . for tumorigenesis experiments , injection in the right supra scapular area of c57bl/6 mice and tumor volumes were monitored three times each week . five day established tumors were treated with intratumoral injection of 0.5 g of recombinant murine slc / ccl21 ( pepro tech , rocky hill , nj ) or murine serum albumin ( utilized as an irrelevant protein for control injections ) were administered three times per week for two weeks as previously described . 24 h prior to slc / ccl21 treatment , and then three times a week , mice were injected i.p . with 1 ml / dose of anti - ip-10/cxcl10 , or anti - mig / cxcl9 , or 100 g / dose of purified monoclonal anti - ifn or appropriate control antibodies ( goat igg and rat igg ) at equivalent doses for the duration of the experiment . in response to these antibodies , there was a significant reduction of the respective cytokines in vivo ( figure 2 ) . mig / cxcl9 , ip-10/cxcl10 and ifn were quantified using a modification of a double ligand method as previously described . flow cytometric analyses for t cell and dc markers were performed on a facscan flow cytometer ( becton dickinson , san jose , ca ) in the university of california , los angeles , jonsson cancer center flow cytometry core facility . cells were identified as lymphocytes or dc by gating based on forward and side scatter profiles . 10,000-gated events were collected and analyzed using cell quest software ( becton dickinson ) . for staining , two or three fluorochromes ( pe , fitc , percp ) ( pharmingen ) were used to gate on the cd3 , cd4 and cd8 t lymphocyte population or cd11c dc in single cell suspensions from tumor nodule . for cxcr3 expression , t cells statistical analyses of the data in figures 1 , 2 and in table 1 were performed using the paired student t test .", "abs to murine ifn , recombinant ifn were obtained from pharmingen ( san diego , ca ) . abs to murine mig / cxcl9 , ip-10/cxcl10 and recombinant cytokine standards was purchased from r&d ( minneapolis , mn ) . polyclonal goat anti - murine mig / cxcl9 and anti - murine ip-10/cxcl10 specific anti - serum were produced and characterized as previously described . anti - mouse ifn monoclonal ( r4 - 462 , american type culture collection , rockville , maryland , md ) neutralizing antibody was purified by affinity chromatography from scid mice ascites , which was generated 34 weeks after intraperitoneal injection of 10r4 - 462 hybridoma cells per mouse . for flow cytometry , labeled antibodies ( fitc , pe , percp ) against the t cell surface markers to cd3 , cd4 , cd8 and against the dc markers , cd11c and dec 205 and the appropriate controls were purchased from pharmingen .", "a weakly immunogenic lung cancer , lewis lung carcinoma ( 3ll , h-2 ) obtained from atcc ( crl-1642 , llc ) was utilized for assessment of cytokines important for slc / ccl21 mediated anti - tumor responses in vivo . the cells were routinely cultured as monolayers in 25 cmtissue culture flasks containing rpmi 1640 medium ( irvine scientific , santa anna , ca ) supplemented with 10% fetal bovine serum ( fbs ) ( gemini bioproducts , calabasas , ca ) , penicillin ( 100 u / ml ) , streptomycin ( 0.1 mg / ml ) , 2 mm glutamine ( jrh biosciences , lenexa , ks ) and maintained at 37c in a humidified atmosphere containing 5% co2 in air . the cell lines were mycoplasma free and cells were utilized up to the tenth passage before thawing frozen stock cells from liquid n2 . for tumorigenesis experiments , injection in the right supra scapular area of c57bl/6 mice and tumor volumes were monitored three times each week . five day established tumors were treated with intratumoral injection of 0.5 g of recombinant murine slc / ccl21 ( pepro tech , rocky hill , nj ) or murine serum albumin ( utilized as an irrelevant protein for control injections ) were administered three times per week for two weeks as previously described . 24 h prior to slc / ccl21 treatment , and then three times a week , mice were injected i.p . with 1 ml / dose of anti - ip-10/cxcl10 , or anti - mig / cxcl9 , or 100 g / dose of purified monoclonal anti - ifn or appropriate control antibodies ( goat igg and rat igg ) at equivalent doses for the duration of the experiment . in response to these antibodies , there was a significant reduction of the respective cytokines in vivo ( figure 2 ) .", "mig / cxcl9 , ip-10/cxcl10 and ifn were quantified using a modification of a double ligand method as previously described .", "flow cytometric analyses for t cell and dc markers were performed on a facscan flow cytometer ( becton dickinson , san jose , ca ) in the university of california , los angeles , jonsson cancer center flow cytometry core facility . cells were identified as lymphocytes or dc by gating based on forward and side scatter profiles . 10,000-gated events were collected and analyzed using cell quest software ( becton dickinson ) . for staining , two or three fluorochromes ( pe , fitc , percp ) ( pharmingen ) were used to gate on the cd3 , cd4 and cd8 t lymphocyte population or cd11c dc in single cell suspensions from tumor nodule . for cxcr3 expression ,", "statistical analyses of the data in figures 1 , 2 and in table 1 were performed using the paired student t test .", "authors sh , lxz , mh , rkb and mdb contributed to the discussion of the article . authors rms and smd together with ss conceived of the study , participated in its design and drafted the manuscript .", "we thank kimberly atianzar for excellent technical assistance in conducting the elisa measurements . national institutes of health grant r01 ca78654 , ca85686 , p50 ca90388 , medical research funds from the department of veterans affairs , the research enhancement award program in cancer gene medicine and the tobacco - related disease research program of the university of california supported this work ." ]

[ "neonatal bacterial meningitis continues to be \n the most common serious infection of the central nervous system ( cns ) in \n newborns with high morbidity and mortality despite the availability of \n effective bactericidal antibiotics over the last sixty years [ 1 , 2 ] . this high morbidity and mortality are due to inadequate \n knowledge of the pathogenesis of this disease . \n e. coli is the most common gram - negative \n bacterium causing neonatal sepsis and meningitis . bacterial meningitis in \n newborns is due to hematogenous spread of the pathogen to the meninges . the \n most important issue in the pathogenesis of e. \n coli meningitis is how circulating pathogens cross the blood - brain barrier \n ( bbb ) , which is mainly composed of brain microvascular endothelial cells ( bmecs ) [ 3 , 4 ] . our \n previous studies showed that e. coli k1 invasion of human bmec was \n significantly greater with stationary - phase ( sp ) cultures than with \n exponential - phase cultures , suggesting that expression of e. coli k1 invasion - associated virulence \n genes is strongly regulated in a growth - phase - dependent manner . a nonsense mutation in the sp regulatory gene rpos was identified in e. coli k1 strains e44 and ihe3034 . \n complementation with the wild type e. coli k12 rpos gene \n significantly enhanced ihe3034 invasion of bmec , but failed to improve the invasion activity of another e. \n coli k1 strain e44 . these studies suggest that the growth - phase - dependent \n invasion of bmec by ihe3034 is affected by rpos and that e44 carries a \n loss - of - function mutation in the rpos gene . several virulence \n factors , including ibe ( termed after invasion of brain endothelial \n cells ) proteins [ 6 , 7 ] , ompa , yiijp , fimh , asla , and traj \n , have been identified in various strains of e. coli in the in vitro and in vivo models of the \n bbb as invasins . most of those \n invasion genes are present in the e. coli k-12 genome [ 4 , 16 ] . however , the ibea gene encoding a 50 kda protein has been found to be unique to some pathogenic e. coli k1 strains ( e.g. , c5 and rs218 ) , \n while laboratory strains of e. coli k-12 ( e.g. , dh5 and hb101 ) , as well \n as noninvasive e. coli ( e.g. , e412 ) , \n lack ibea . recently , vimentin has \n been identified as an ibea - binding protein on the surface of human bmec . using the ibea gene \n as a probe , we have identified a 20.3 kb genomic locus as a genetic island of meningitic e. coli containing ibea ( gima ) . this \n locus is situated between yjid and yjie , adjacent to the fim operon , and \n absent in nonpathogenic e. coli k12 \n strains . the first three operons \n ( ptnipkc , cgldtec , gcxkrci ) may \n be involved in energy metabolism and the last operon ( iberat ) contributes to e. \n coli k1 invasion of bmec . our previous work showed that gima - mediated \n invasion of human endothelial cells is regulated by carbon source . this is \n consistent with the observations by others that carbon source modulates \n expression of virulence factors in several pathogenic bacteria . ibea and ibet contribute \n to e. coli k1 invasion and adhesion \n [ 18 , 19 ] . our previous studies suggest that iber is a novel regulatory protein that is present in pathogenic e. coli k1 . it belongs to the \n ntrc / nifa family of transcriptional activators , carrying a sigma 54-interaction \n domain and showing significant \n sequence homology to various regulatory proteins for glycerol metabolism operon \n in citrobacter freundii ( p45512 ) , acetoacetate metabolism in e. coli k12 , \n sigma l - dependent transcription in b. \n subtilis ( p54529 ) , nif - specific regulation in herbaspirillum seropedicae , dhar transcription in e. coli k12 , and globe signal transduction \n in clostridium beijerinckii [ 4 , 20 ] . however , it is unknown how \n iber contributes to the pathogenesis of meningitic infection by modulating the \n virulence of the pathogen . as e44 carries a nonsense mutation in the rpos gene and exhibits strong invasion activity in the sp , there \n we speculated that iber is an rpos - like regulator in sp gene expression in e44 . in order to dissect the \n regulation of sp gene expression in e44 that is associated with the \n pathogenesis of e. coli meningitis , a comparative proteomic analysis of \n an iber deletion mutant ( br2 ) and its parent strain e44 our studies suggested that the iber gene was involved in \n regulating sp gene expression related to stress resistance and pathogenesis .", "the bacterial strain and plasmid vectors and their relevant \n characteristics are shown in table 1 . the mutant strains used in this study \n were derived from e44 , which is a rifampin - resistant strain derived from a \n neonatal meningitis isolate , e. coli k1 rs218 ( o18 : k1 : h7 ) [ 4 , 21 ] . sm10 ( pir ) , dh5 ( pir ) , and pcvd442 were used for making \n isogenic deletion mutants of iber and tnaa [ 6 , 10 , 11 ] . e. \n coli k12 strain mc4100 and its rpos \n\t\t\t\t\t insertion mutation tn10 mutant rh90 \n were used as positive and negative controls for rpos , respectively . plasmid \n pstyabb , which carries the gene for monooxygenase , was used for indole assay \n . e. coli strains were grown at 37c in luria broth ( lb ; 1% \n tryptone , 0.5% yeast extract , 0.5% nacl ) or brain heart infusion ( bhi , difco \n laboratories , detroit , mich , usa ) broth and were stored at 70c in lb plus 20% \n glycerol . when it was necessary , the medium was supplemented with ampicillin \n ( 100 g / ml ) and rifampin ( 100 g / ml ) for the positive selection of plasmids or \n bacterial strains ( table 1 ) . all genetic manipulations were done by using standard \n methods , as described elsewhere . plasmid dna was extracted by using a \n plasmid mini kit ( qiagen , calif , \n usa ) . dna fragments were purified and were extracted from agarose \n gel slices , using qiaquick gel extraction kit ( qiagen ) . competent e. coli cells were made in 10% glycerol \n and were transformed by electroporation as described previously [ 6 , 7 ] . to determine the role of the iber gene in the \n growth - phase - dependent e. coli k1 invasion of bmec , an isogenic deletion \n mutant of iber two pcr dna fragments , b ( 1.2 kb ) and r ( 1.0 kb ) , flanking a 1.8-kb \n region to be deleted were produced from two pairs of primers ( iber - s1/iber - b1 \n for b and iber - b2/iber - x2 for r , see table 2 ) . the two fragments were ligated \n to make a 2.2 kb fragment ( br ) that carries an iber internal deletion . \n the br fragment was subcloned between sali and xbai sites on pcvd442 , and \n the resulting recombinant plasmid was named pcbr2 . the mutants named br2 were \n obtained by mating e44 with sm10 pir that carries pcbr2 as described previously \n . we used pcr and dna sequencing to confirm the internal deletion in the iber deletion mutant br2 and the desired \n chromosomal gene iber of the mutant with primers iber - s1 and iber - x2 \n ( table 2 ) . amplification was done by using the following cycle profile : 35 \n cycles at 94c for 1 minute , 58c for 1 minute , and 70c for 1.5 minutes . for the tnaa in - frame deletion briefly , 2 pcr dna fragments , ftn5 ( 1.0-kb ) \n and ftn3 ( 1.4-kb ) , were made to flank a 1.3 kb region containing tnaa to \n be deleted , by using 2 primer pairs ( tn - s1/tn - b1 for ftn5 and tn - b2/tn - x2 for \n ftn3 , see table 2 ) . then the two fragments were ligated to make a 2.4 kb \n fragment ( ftn53 ) that carried a tnaa internal deletion . the ftn53 \n fragment was subcloned into pcvd442 between sali and xbai sites to get the \n suicide plasmid pctna2 . to get the tnaa in - frame deletion mutant , tna44 , \n conjugation and screening were carried out as described above . the tnaa gene deletion in the mutant tna44 \n was confirmed by pcr using the primers tn - s1 and tn - x2 ( table 2 ) . human bmecs were routinely cultured in rpmi 1640 medium \n ( mediatech , herndon , va , \n usa ) containing 10% heat inactivated fetal bovine serum , 10% nu - serum , 2 mm glutamine , 1 mm sodium pyruvate , essential amino acids , vitamins , penicillin \n g ( 50 g / ml ) , and streptomycin ( 100 g / ml ) at 37c in 5% co2 . \n the \n number of intracellular bacteria was determined on blood agar plates after the \n extracellular bacteria were killed by incubation of the monolayers with \n experimental medium containing gentamicin ( 100 g / ml ) for 1 hour . results were \n expressed as percent invasion ( 100 ( number of intracellular bacteria \n recovered)/(number of bacteria inoculated ) ) . briefly , e. \n coli strain e44 and the iber deletion mutant br2 were cultured \n in bhi medium overnight without agitation . the bacterial cells were harvested \n at the stationary - phase ( od = 2.53.0 ) by \n centrifugation at 6000 g for 10 minutes . denaturing protein extraction ( phenol \n extraction procedure ) was performed according to saravanan and rose . the lyophilized pellets were \n dissolved in rehydration buffer ( 7 m urea , 2 m thiourea , 4% chaps , 0.2% ph 310 biolytes , 1% \n dtt ; 1 mg dry pellets for 200 l buffer ) and shaken on vortex for 1 hour at \n room temperature . the first and second dimensions of the page were performed at \n least in triplicate ( to reduce the likelihood of differences based solely upon \n gel - to - gel variability ) according to the standard protocols developed and \n defined by bio - rad . solubilized total e. \n coli protein samples ( 200 l each ) were loaded on 11 cm immobilized ph \n gradient ( ipg ) strips ( ph 47 ) . \n rehydration / loading was done passively ( no voltage ) for 1 hour , followed \n immediately by 14 hours of active rehydration ( 50 v ) at 20c . isoelectric \n focusing of the ipg strips was performed at 20c using a 50 a current limit \n per strip to prevent damage to the strip and the instrument . electrophoresis \n was carried out as follows : step 1 , 250 v for 20 minutes ; step 2 , a rapid ramp \n to 8000 v ; step 3 , \n focusing at 8000 v for 55 000 vhr ; step 4 , \n hold at 400 v. due to latent ionic components in the sample the actual running \n voltage was only approximately 6500 v. after the first dimensional run was completed , the ipg \n strips were equilibrated in buffer i ( 6 m urea , 0.375 m tris - hcl ph 8.8 , 2% sds , \n 20% glycerol , and 2%dtt ) for 15 minutes and then in buffer ii ( 6 m urea , 0.375 m \n tris - hcl ph 8.8 , 2% sds , 20% glycerol , and 2%dtt ) for additional 15 minutes . \n the second dimension sds - page was performed with 15% resolving gels and 5% \n stacking gels ( 160 180 0.5 mm ) . the 2de gels were scanned at a 200 bpi resolution with \n typhoon scanner ( amersham biosciences , nj , usa ) , and analyzed with imagemaster \n 2d platinum version 6.0 ( ge healthcare bio - science , nj , usa ) . only those protein spots having \n differences in density of 1.5-fold or greater between the groups were chosen . \n moreover , all protein spots selected for analysis were shown to have \n significant difference in protein density ( mean sem , p < .01 ) by software of spss 10.0 . protein bands were excised from preparative coomassie blue - stained \n gels and washed several times with destaining solutions ( 25 mm nh4hco3 for 15 minutes and then with 50% acetonitrile containing 25 mm nh4hco3 for 15 minutes ) . gel pieces were then dehydrated with 100% acetonitrile , dried , \n and then incubated with a reducing solution ( 25 mm nh4hco3 containing 10 mm dithiothreitol ) for 1 hour at 56c and subsequently with an \n alkylating solution ( 25 mm nh4hco3 containing 55 mm \n iodoacetamide ) for 45 minutes at room temperature . after reduction and \n alkylation , gels were washed several times with the destaining solutions and \n finally with pure water for 15 minutes before being treated again with 100% acetonitrile . \n depending on the protein content , 2 - 3 l of 0.1 g/l modified \n trypsin ( promega , wiss , usa , \n sequencing grade ) in 25 mm nh4hco3 was added over the gel \n spots and incubated for 30 minutes . about 710 l of 25 mm nh4hco3 was then added to cover the gel spots and incubated at 37c overnight . the \n in - gel digestion products were extracted with formic acid / acetonitrile \n solutions followed by evaporation . samples were desalted using mziptip c18 \n pipette tips ( millipore , mass , usa ) before ms / ms analysis . the sample was \n resuspended in 10 l of 0.1% formic acid , injected via an autosampler ( surveyor , \n thermofinnigan , calif , \n usa ) and subjected to reverse phase liquid chromatography using thermofinnigan \n surveyor ms - pump in conjunction with a biobasic 18 100 0.18 mm reverse - phase \n capillary column ( thermofinnigan , calif , usa ) . mass analysis was done using a \n thermofinnigan lcq deca xp plus ion trap mass spectrometer equipped with a \n nanospray ion source ( thermofinnigan , calif , usa ) employing a 4 cm metal emitter ( proxeon , \n odense , denmark ) . spray voltage of the mass spectrometer was set to 2.9 kv and capillary temperature was set at 190c . the column \n equilibrated for 5 minutes at 1.5 l / min with 95% solution a and 5% solution b \n ( a , 0.1% formic acid in water ; b , 0.1% formic acid in acetonitrile ) followed by \n a linear gradient was initiated 5 minutes after sample injection ramping to 65% \n solution a over 45 minutes . solution a was increased to 80% over the \n subsequent 5 minutes and held at 80% for 5 minutes , after which the column was \n reequilibrated back to 5% solution a ( aqueous ) . a \n data - dependent acquisition mode was used where each of the top five ions for a \n given scan was subjected to ms / ms analysis . the protein identification was conducted with the ms / ms \n search software mascot 1.9 with confirmatory or complementary analyses using \n turbosequest as implemented in the bioworks 3.2 . e. coli genome \n sequences at the national center for biotechnology information ( ncbi ) were used \n as the primary search databases and searches were complemented with the ncbi \n nonredundant protein database . for \n determination of indole production , we followed the method of indole conversion \n into indigo as described previously [ 12 , 27 ] , with minor modifications . all \n strains e44 , br2 , tna44 , mg1655 , and rh90 were transformed with the pstyabb \n plasmid , which constitutively expresses the styab protein converting indole to \n indigo . the bacteria were incubated in m9 medium containing 0.4% glucose and \n 100 g / ml ampicillin overnight with shaking . then the bacteria were collected by \n centrifugation and resuspended to od600 = 0.2 in bhi medium supplied \n with 100 g / ml ampicillin , and incubated at 37c without shaking . to determine \n the indigo formation at different time points , the samples were read at 600 nm to determine the indigo concentration \n by comparison to a standard curve . bacteria were grown in bhi broth at 37c overnight without \n shaking , and collected by centrifugation . the number of cells was measured on \n the basis of their od at 600 nm . bacteria were suspended and diluted to 10 cells / ml in pbs for the following assays . for heat shock , 100 l of bacteria \n was heated at 54c for 3 minutes . for alkali endurance , the bacterial \n suspension was mixed with equal volume of tris buffer ( 1 m , ph = 10.0 ) and 8 \n volumes of water ( final concentration , 100 mm , ph 10.0 ) and incubated at 37c \n for 30 minutes . for acid endurance , 1/10 volume of the bacterial suspension was \n mixed with lb containing acetic acid ( final concentration , 90 mm , ph 2.8 ) and \n incubated at 37c for 20 minutes . for high osmolarity challenge , bacteria were \n mixed with an equal volume of 4.8 m nacl ( final concentration , 2.4 m ) and \n incubated at 37c for 1 hour . for oxidative stress , bacteria were harvested and \n resuspended in an equal volume of pbs containing 10 m h2o2 incubated at 37c for 30 minutes . after exposure to these stresses , bacteria \n were diluted in 0.9% saline and plated in duplicate on lb agar plates . the surviving rate with stress was \n calculated from the ratio of the bacterial number under stress condition to the \n bacteria number under nonstress condition . the surviving rate without stress was \n calculated from the bacteria number grown on plates .", "the gene iber in e. coli k1 e44 is predicted as \n the only regulatory protein present in the iberat operon in gima by \n bioinformatics approaches . to determine the role of iber gene in \n the growth - phase - dependent invasion of bmec by meningitic e. coli k1 , an isogenic in - frame deletion mutant of iber was \n made by chromosomal gene replacement with the recombinant suicide plasmid pcbr2 \n carrying a 2.2 kb dna fragment with iber internal deletion ( figure 1(a ) ) . \n the 2.2 kb dna fragment was generated by ligation of two pcr amplicons ( 1.2 and \n 1.0 kbs ) flanking the \n 1.8 kb iber coding region . the iber deletion mutant was obtained \n by mating e44 with sm10 pir carrying pcbr2 . the mutant colony morphology on lb \n agar plates and growth rate in lb broth were the same as the parent strain e44 . \n the deletion of iber was confirmed by colony pcr and dna sequencing \n ( figure 1(b ) ) . in order to examine the virulence phenotype of the iber deletion mutant , a comparative study of the invasiveness of e44 ( parent \n strain ) , br2 , and the complemented br2 was carried out . as shown in figure 1(c ) , \n the relative invasion rate of br2 was significantly reduced as compared to that \n of e44 and the plasmid pwks1030 carrying the iber gene was able to complement the noninvasive phenotype of br2 , \n suggesting that the iber gene contributes to the e. coli e44 \n invasion process . to determine the role of iber in regulating sp gene expressionof meningitic e. coli k1 , the wild type e. coli e44 and its iber deletion mutant br2 \n were cultured in bhi broth overnight . the total proteins of each strain were \n extracted from the cells as described in section 2 . the \n experiment was performed three times with two sets of independently grown \n cultures . only spots showing the same pattern in three independent runs were \n retained and quantified using the software imagemaster 2d platinum version 6.0 . \n figures 2(a ) and 2(b ) showed the protein patterns of e44 and br2 , respectively . \n all the upregulated spots and downregulated spots satisfying the criteria as \n mentioned above were marked on both the 2d maps . they were excised and \n identified by lc - ms / ms ( table 3 ) . eight protein spots were found to be \n differentially expressed in br2 \n as compared to its parent strain e44 . among them , 4 protein spots were \n significantly upregulated in br2 including elongation factor ef - tu ( tufb , spot u1 ) , \n glyceraldehyde-3-phosphate dehydrogenase a ( gapa , spot u2 ) , outer membrane protein 3a ( ompa , spot u3 ) , and alkyl hydroperoxide \n reductase ( ahpc , spot u4 ) , \n while 4 protein spots were of decreased abundance in br2 , including \n dihydrolipoamide dehydrogenase ( lpda , \n spot d1 ) , tryptophanase ( tnaa , \n spot d2 ) , and two isoforms of outer membrane protein c ( ompc , spot d3 , and d4 ) . figure 3(a ) showed the enlargements of \n each changed protein marked with black arrows and spot numbers . the relative \n ratios of each downregulated protein and upregulated protein were shown in figures \n 3(b ) and 3(c ) . we classified the proteins into two main categories on the \n basis of their roles in the sp growth of e. coli cells : ( a ) response to \n environmental modifications ( including tnaa , \n tufb , ompc , ompa , and ahpc ) \n and ( b ) central metabolism ( including lpda \n and gapa ) . since iber was hypothesized as an \n sp - regulator contributing to the growth regulation and virulence of e44 , its \n role in the invasion process and resistance to stress conditions should be \n further characterized . tnaa , a tryptophanase , degrades tryptophan , resulting in \n the formation of indole , which has been proposed to act as an extracellular \n signal in stationary phase cells of e. coli [ 28 , 29 ] . production of \n indole , via the enzymatic activity of tnaa , is also induced during biofilm \n formation . tnaa , which was \n controlled by rpos in other e. coli strains , is one of the most \n important transcriptional regulators for the gene expressions in sp cells . \n tufb ( ef - tu ) is responsible for binding and transporting the appropriate \n codon - specified aminoacyl - trna to the aminoacyl ( a ) site of the ribosome [ 32 , 33 ] . in addition to its function in translation elongation , elongation factor \n tu is implicated in protein folding and protection from stress like a chaperone \n molecule . ompc , as well as ompf , is a porin protein present on the \n outer membrane of e. coli , responding to the osmotic challenge . ompr , as \n a regulator , activates transcription of ompf and ompc , and \n changes the ratio of these two , so that the total level of porin proteins \n remains approximately constant [ 36 , 37 ] . ompf , which produces slightly wider \n pores ( 1.2 nm ) than does ompc , predominates at low osmotic strength , whereas \n ompc ( 1.1 nm ) predominates at high osmotic strength . in e. coli , \n the expression of ompc it has been proposed that the smaller pores formed by ompc could \n reduce the diffusion of larger hydrophobic and negatively charged molecules \n when bacteria encounter high osmolarity conditions as in the host compartments . \n presumably , this protein is very important for the stress resistance of e. \n coli in the stationary phase . in this study , the downregulation of ompc \n resulting from the iber deletion might decrease resistance to high \n osmolarity . in addition , it had been reported that ompc is involved in invasion \n of epithelial cells by crohn 's disease - associated e. coli strain lf82 and shigella flexneri [ 39 , 40 ] , suggesting \n that ompc might be involved in e44 invasion of the host tissue barriers . ompa \n is a major protein in the outer membrane of both pathogenic and nonpathogenic \n\t\t\t\t\t e. coli \n\t\t\t\t\t . as shown in our previous study , the ompa - deletion mutant of e44 was \n significantly more sensitive than that of its parent strain to sds , cholate , \n acidic environment , and high osmolarity . ompa is downregulated upon entry \n into sp by sigmae , which plays a central role in maintaining cell envelope \n integrity both under stress conditions and during normal growth [ 42 , 43 ] . we \n demonstrated here that ompa was upregulated in the iber mutant br2 ( figure 3 ) , suggesting that ompa expression is suppressed \n upon entry into sp by iber in a manner similar to sigmae . alkyl hydroperoxidase ( ahpc ) functions as a primary scavenger of endogenous h2o2 at a low ( 10 m ) concentration . all of ahpc , katg , \n and kate genes are known to participate in the antioxidant defense \n mechanism against h2o2-induced stress in e. coli . \n it has been reported that sp - inducible rpos regulates kate gene \n expression and oxyr regulates ahpc and katg genes [ 45 , 46 ] . our \n previous study has demonstrated that e. coli k1 rs218 had a nonsense \n mutation in its rpos gene , resulting in a negligible kate activity , but no obvious difference in katg . in this study , the \n increase in ahpc expression indicated that the iber deletion led to an increased oxidative stress in sp compared with the wild type \n strain , suggesting that iber is involved in the resistance to oxidative \n stress upon entry into sp . \n\t\t\t\t\t lipoamide \n dehydrogenase ( lpda ) , which is the same as dihydrolipoamide \n dehydrogenase ( dldh ) , makes up the e3 component of pyruvate dehydrogenase \n complex , 2-oxo glutarate dehydrogenase , and branched - chain 2-oxo acid \n dehydrogenase complexes . dldh has been identified as virulence factors \n contributing to the pathogenesis of bacterial infections caused by mycobacterium tuberculosis and streptococcus pneumoniae because it \n enhances their survival within the host cells [ 47 , 48 ] . as shown in figure 3 , \n lpda was downregulated in the iber deletion mutant br2 , suggesting that this enzyme might be involved in the \n virulence of meningitic e. coli k1 via enhancing the pathogen survival \n within the host . recently , gapa in e. \n coli has been identified as one of a few proteins , which harbors \n functionally important thiol groups against oxidative stress . as gapa is \n upregulated in br2 ( figure 3 ) , iber may be involved in the negative control of gapa in sp . in summary , all \n these proteins contribute to growth - related carbon source metabolism or stress \n resistance . they are associated with the sp regulation . among these proteins , tnaa is the most \n important one as it produces the signal molecule indole and is regulated by \n rpos . since e44 carries a loss - of - function mutation in its rpos gene , there should be alternative signaling pathway(s ) to complement the \n functional deficiency of rpos in this pathogenic e. coli strain . our proteomic analyses showed that the tnaa expression was significantly affected by iber , which might be functionally \n equivalent to rpos . therefore , our \n focus for further studies was placed on how tnaa is regulated by iber . to test our hypothesis that iber is an rpos - like regulator , \n the tnaa in - frame deletion mutant tna44 was generated with the same gene replacement approach that \n was used for the iber deletion mutant . tna44 was obtained by mating e44 with sm10 pir carrying the \n recombinant suicide plasmid pctna2 which contains the truncated tnaa gene . although overall growth rates did not \n differ between the mutants ( br2 and tna44 ) and their parent strain e44 ( figure 4(a ) ) , \n the invasive capability of tna44 ( 19% ) and br2 ( 35% ) was significantly reduced \n as compared to that of e44 ( 100% ) ( figures 4(c)-4(d ) ) . these data \n suggest that tnaa is an important downstream regulator that is required foriber - modulated e. coli k1 invasion . as our proteomics analysis had shown that tnaa expression was induced by iber in sp and the tnaa and iber deletion resulted in \n a deficiency in indole production in sp - cultures ( figure 4(b ) ) , we further tested \n whether the tnaa product indole , as an sp extracellular signal molecule , played \n a role in the process of invasion . indole is converted to indigo ( which is not \n further degraded in e. coli ) by several monooxygenases , thus providing \n an easy method for its determination . a plasmid pstyabb , carrying the gene \n for styrene monooxygenase , was used to monitor the indole production through \n its conversion to indigo . the plasmid was transformed into e. coli strains e44 , br2 , and tna44 , and the indole production was measured at \n different time points for these stains in bhi media ( figure 4(b ) ) . by contrast , \n the indole production was almost abolished in the tnaa deletion mutant \n and severely reduced in the iber deletion mutant ( figure 4(b ) ) . these \n results demonstrated that the indole production was controlled by iber through tnaa . to examine whether indole could compliment the noninvasive \n phenotype of tnaa and iber deletion mutants , indole was supplied in the bhi medium at 100 m to the tna44 \n and br2 sp cultures . the \n result showed that indole was able to significantly \n enhance the relative invasion rate of tna44 ( 19% to 69% ) and br2 ( 35% to 65% ) as compared to \n that of e44 , suggesting that indole could partly compliment the noninvasive phenotype of tna44 \n ( figure 4(c ) ) and br2 ( figure 4(d ) ) . lacour and landini have shown that the rpos gene in e. coli k12 strain \n mg1655 controls the production of indole , which acts as a signal molecule in sp \n cells , via regulation of tnaa , the indole - producing enzyme . as tnaa is \n regulated by iber in e44 , it is most likely that iber is a novel regulator to \n complement the functional deficiency of rpos in e44 . it has been reported that rpos is able to positively and \n negatively control expression of a large set of genes when bacteria enter into \n the sp [ 46 , 50 , 51 ] . during such \n transition , bacteria undergo physiological changes that allow their sp \n organisms to survive better in such insults as heat , high - osmotic environment , \n starvation , uv radiation , h2o2 , and acid than their \n exponential counterpart [ 50 , 52 ] . the loss of rpos resulted in the decrease of \n stress resistance and cell survival in the sp [ 5 , 53 ] . although our study \n showed that the loss of iber did not affect the growth rate in bhi \n medium , the survival rates of the iber deletion mutant br2 in the sp \n significantly decreased as compared to that of the wild type strain e44 even \n without any stress treatment ( figure 5(a ) ) . our proteomics analysis also \n revealed that the most significant proteomic changes in the iber deletion mutant were related to bacterial response to environmental \n modifications . for example , ahpc , as a primary scavenger of endogenous h2o2 , \n was upregulated in the iber deletion mutant , implying that the loss of iber resulted in the decreased survival rates of bacterial cells under an oxidative \n stress in the sp . ompc , as a porin protein , was downregulated in br2 , perhaps \n resulting in the decreased resistance to osmolarity stress . these results \n suggested that iber plays a regulatory role in response to stress \n conditions in e44 that carries a nonsense mutation in rpos . to examine \n the function of iber in response to stress environments , we performed \n several survival assays under different stress conditions , including heat shock \n ( 54c for 3 minutes ) , alkali endurance ( tris , ph = 10 for 30 minutes ) , acid \n endurance ( acetic acid , ph = 2.8 for 20 minutes ) , high osmolarity challenge ( 2.5 m nacl for 1 hour ) , and oxidative stress ( 10 m h2o2 for \n 30 minutes ) . in all the survival experiments , the wild type strain e44 showed \n higher survival rates than the iber deletion mutant , indicating that the iber gene is required for all these \n stress resistances ( figure 5(b ) ) . especially in the heat shock assay , the loss \n of iber resulted in over 95% cells death , indicating that iber played a vital role in temperature sensitivity in this strain . in the other \n stress treatments , the iber deletion also significantly reduced the \n survival rates ( more than 60% cell death ) of br2 as compared to that of the \n wild type strain e44 , suggesting that iber had a global regulatory role in the \n resistance to acid , alkali , high osmolarity and oxidative stress . in the \n survival assays for the e. coli control strain mg1655 , the rpos deletion mutant rh90 also decreased the survival levels in these five stress \n conditions , showing the similar patterns like iber in response to stress \n environments ( data not shown ) . combining the proteomics analysis and the stress \n survival studies , we conclude that iber is an rpos - like regulator to control \n gene expression of proteins that are critical for stress - resistance and cell \n survival in the sp in e44 , which carries a loss - of - function mutation in the rpos gene .", "currently , most e. coli meningitis studies are done with sp cultures in which the pathogen invasion of \n human bmec is significantly greater than the log phase cultures . in most \n strains of e. coli , rpos plays a \n central role in regulating the sp regulatory genes for protecting cells against \n starvation and stress damage . rpos , the major sp regulator , has also been shown \n to regulate the expression of microbial virulence genes in various bacteria \n including e. coli k1 ( o157 : h7 ) , salmonella \n typhimurium , shigella flexneri , yersinia enterocolitica , vibrio \n cholera , and borrelia burgdorfer , [ 5 , 53 , 54 ] . surprisingly , however , rpos was found to be inactive in meningitic \n strain e44 . the current proteomic studies may provide an answer to the \n long - standing question regarding the sp gene regulation in e44 . combining the \n proteomics analysis , virulence determination , and the stress survival studies \n of the iber mutant br2 , we have \n demonstrated for the first time that iber serves as an rpos - like regulator to \n control gene expression that is critical for stress - resistance and cell \n survival in the sp of e44 . iber is not a structural homologue of rpos as iber \n and rpos do not share any significant sequence homology . rpos ( also known as , \n , or katf ) is a global regulator in e. coli , which is the second principal subunit after the major factor . in e44 , however , iber appears not to be a master regulator on the \n basis of its genomic prevalence and functional spectrum . the prevalence of the \n gimalocus carrying iber is highly dependent on the origin \n of the strain and on the subgroup it belongs to ( a , b1 , b2 , and d ) ( 4 ) . in all \n the studies , where the presence of this locushas been analyzed , gima was found to be restricted to the b2 \n subgroup , a subgroup that includes strains with the highest virulence in mice \n and the highest level of virulence determinants ( 4 ) . our proteomic studies showed that a limited number \n of genes were regulated by iber , suggesting that iber is a regulator with a \n narrow functional spectrum . in other e. \n coli strains , either pathogenic or probiotic strains , functional \n heterogeneity of rpos in stress tolerance was widely observed [ 5 , 53 , 55 ] . \n those studies have shown that some e. \n coli strains can maintain their stress tolerance capability or \n significantly modulate their stress resistance phenotype independent of their rpos genotypes . such adaptation processes \n compromising the rpos - dependent stress responses may have significant impact on \n bacterial survival in environments , as well as in the host 's stomach and \n intestine [ 53 , 55 ] . iber , a regulator in the gima regulon , may contribute to \n bacterial virulence adaptation process in e44 to complement the functional \n deficiency of rpos . another significant finding of our proteomic studies is that \n iber in meningitic strain e44 is able to upregulate tnaa , which is controlled \n by rpos in other e. coli strains \n . the virulence determination of the tnaa mutant showed that tnaa and its product indole were required for e44 invasion \n of human bmec . the generation of indole , via the tryptophanase activity of \n tnaa , was also observed during the formation of biofilm in e. coli and other bacteria [ 28 , 56 ] . in addition to the initiation \n of indole - mediated signaling , tnaa ( tryptophanase ) is able to catabolize \n tryptophan , cysteine , and serine to pyruvate [ 29 , 56 ] . the three proteins \n significantly upregulated by iber are tnaa , lpda , and ompc , all of which are \n directly or indirectly involved in pyruvate metabolism . ompc , an \n osmotically regulated porin , may facilitate nutrient uptake . on the other \n hand , the three operons ( ptnipkc , cgldtec , and gcxkrci ) in the gima regulon may also directly or indirectly \n contribute to pyruvate metabolism by converting dihydroxyacetone , glycerol , and \n glycerate to pyruvate . it has been shown that the capability to catabolize \n carbon source is an important parameter in the ability to persist and compete \n in stationary phase . this raises the possibility that signaling by indole , \n which is regulated by iber via tnaa , may play a critical role in the pathways that \n prepare the pathogens for a nutrient - poor environment ( e.g. , cns ) when the \n carbon source becomes limited for energy production ." ]

[ "today , education has been assigned as an industry for human resource development for different walks of life . the students constitute the heart of the education system and they are the most affected ones by the strengths and weaknesses of the education system . the students form an identical subgroup compared to others in the society . some of the most common risks faced by a student during his / her college days are psychological , emotional , social , academic , and career risks . stress is a very familiar condition faced by the students when they are unable to bear the risks involved in higher education . the main sources of stress are academic and time concerns , fear of failure , classroom interactions , and economic issues . apart from this the parents have unlimited expectation from their children and therefore they impose their own desires on them . the impact of these influences results in a number of students reporting emotional problems , anxiety , stress , and other neurotic problems . they are often found in frightening , abusive , depressing , threatening , competitive , unpredictable , and confusing situations . the percentage of suicides is more among the college students compared to the other ones and these suicides majority of the college students strive and try to handle the stress in a positive way . whereas , some of the students do not know , the ways to cope up with their problems and ; therefore , adopt unhealthy ways . the coping could be at an emotional , cognitive , or social support seeking level . the emotional responsiveness grows out of the simple reflexes of planful emotional responsive behaviour , by the age of two or three years . kopp ( 1989 ) described five types of behaviour : visual or physical avoidance , distraction , self - soothing , problem - oriented , and care - eliciting . a coping style can be effective at one age but may be totally unsuitable at another age . in the similar way , a particular coping style may be totally appropriate in one situation while inappropriate in another . this may be determined to a large part of cultural expectations on the other hand , individual vulnerabilities set limits to ones coping . therefore , it is mandatory to understand that how coping ways adopted by college students differ from other students who experience the significant stress ; their perception of handling the psycho - social problems effectively , might help in the planning of intervention services . thus , the present study was made to understand the ways in which college students differ in coping with significant stress experienced by the students and to examine the different ways of coping strategies adopted by them .", "the present study examines the coping patterns adopted by the junior college students with respect to stress in the academic area , and to study the gender difference in coping patterns among junior college students . the universe considered for the study was , i puc and ii puc students , who were studying either in bachelor of arts , science , or commerce . in the investigation process , a coping checklist with 70 diverse coping pattern , prepared by rao et al . , was used . yesno format and they described a broad range of behavioural , emotional , and cognitive response that may be used to handle stress ; and a socio - demographic data sheet was also used . in order to compute the difference between the means of two groups ( male and female ) , frequency , percentage , and t - test were used ; and to compare the frequencies of certain variables in the two groups , chi - square was used .", "the study was conducted on i puc and ii puc college students . with regard to the socio - demographic characteristics of the college students , it was observed that majority of the students were aged between 1718 years , and number of females was slightly more than males . with respect to the religion , a majority of the students were hindu , and the least were islamic , compared to the students belonging to other religion ; because most of the people from islam do not tend to pursue higher education . with regard to birth order of the child , majority of the students were middle born . it was also noted that , a majority of the respondents spoke other languages at home than kannada . this proves that respondents families belong to various states , but they have settled here . it was seen that most of the students were from nuclear families , which is a very common trend in urban areas . with respect to education background , a majority of the students were from well - educated families , with their fathers being postgraduate and mothers being educated up to higher secondary . the studies also revealed that , the fathers of the respondents were businessmen , whereas mothers were housewives . however , approximately one - third of the respondents mothers were employed . the coping strategies adopted by college students with regard to stressful events , i.e. , academic area were assessed . the results revealed that most of the students ( approximately 90% ) used appraisal - focused coping strategies such as , going over the problem again and again , trying to understand it , to make the situation light , and refuse to get too serious about it . also , majority of the college students reported that they frequently adopt problem - solving coping strategies such as , knowing what has to be done , so doubling the efforts and trying harder to make things work , analyzing the problem bit by bit , seeking reassurance and emotional support from family members , and coming up with different solutions to the problem . in the current study , it has been observed that the students used a combination of appraisal - focused and problem - focused coping strategies . whereas , study by lazarus revealed that , problem - focused and emotion - focused coping strategies were used in virtually every stressful encounter . in the present study , it was found that the students used appraisal - focused coping strategies such as , analyzing the situation , cognitively redefining , and cognitively avoiding the situation . this proves that the students in adolescence stage were still confused and were not able to choose those coping strategies which were of positive approach to encounter any stress . the present study revealed that the students resorted to the coping strategies such as seeking sexual comfort ( 24% ) , taking analgesics or minor tranquilizers without medical advice ( 15% ) , to make themselves feel better by having a drink or two ( 10% ) , and to make themselves feel better by taking mood elevating drugs ( 10% ) . these findings were supported by the study by o. languhlin ( 1984 ) , who also reported that resorting to drugs , alcohol , tranquilizers , and sex are more characteristics of inefficient coopers . the findings by mccormack ( 1996 ) , stated that 23% to 36% of the students advocate drinking when under stress ; however , even a small percentage of students using this coping strategy may form a high risk group . in the current study , the sample comprised college students belonging to 1 puc and ii puc , who were still in adolescence stage and these students were not fully exposed to the evils of the society . in the study , distribution of the coping strategies adopted by the college students was examined with respect to their gender background . the results also revealed that the students irrespective of their gender , used combination of problem - focused and emotion - focused coping strategies . it was found that , out of 70 items , 16 significant responses were used by the students . the coping strategies adopted by female students were , talking to a friend who can do something about the problem , analyzing the problem bit by bit , consoling themselves that things are not that bad and could have been worse , visit places of worship , go on a pilgrimage ; while male students resorted to coping strategies such as , seeking reassurance and emotional support from family members , engage in vigorous physical exercises , talking to a friend who can do something about the problem , and taking a big chance or doing something very risky . it was observed that the female students used emotion - focused coping strategies and sought more social support than males . these findings were supported by the study done by frydenberg and lewis , ( 1991 ) and reported that females sought more social support and employed strategies related to , hoping for the best and wishful thinking , than males . also , hobfall , et al . , ( 1994 ) reported that when faced with problems of professional and interpersonal situations , support seeking was employed more by women than men . the findings by mike and thoits ( 1993 ) suggested that men experience a stoic style of responding to stressors and women have an emotional expressive style . the distribution of coping strategies adopted by college students was examined with respect to different faculties , such as arts , science , and commerce . it was observed that the students used a combination of appraisal - focused and problem - focused coping strategies . out of 70 responses , the frequently used coping strategies by the students belonging to different faculties were problem - focused , for example , pray to god,and knowing what has to be done , so doubling the efforts and trying harder to make things work , were displayed by more than 90% of the college students . majority ( 90% ) of the students belonging to science and arts faculties and 75% from commerce , used appraisal - focused coping strategies such as , console yourself that the things are not at all that bad , it could be worse , make light of the situation , refused to get too serious about it , refusing to believe that it happened . also , 43% of the students from commerce and science faculties used emotion - focused coping strategies , whereas 35% from arts faculty used emotional - focused coping strategies , such as , preparing themselves for the worst to come , feeling that other people are responsible for what has happened , and trying to feel better by eating / nibbling . overall , the total coping repertoires of students belonging to arts , science , and commerce faculties were 37 , 38 , and 35 , respectively . with respect to gender , the total coping repertoire for male and female students , were 36 and 37 , respectively . murthy ( 1995 ) found in her study of working women that they have a coping repertoire of approximately 21 . karen ( 2000 ) reported that the total coping repertoire of unsuccessful college students was 37 .", "the study was conducted on i puc and ii puc college students . with regard to the socio - demographic characteristics of the college students , it was observed that majority of the students were aged between 1718 years , and number of females was slightly more than males . with respect to the religion , a majority of the students were hindu , and the least were islamic , compared to the students belonging to other religion ; because most of the people from islam do not tend to pursue higher education . with regard to birth order of the child , majority of the students were middle born . it was also noted that , a majority of the respondents spoke other languages at home than kannada . this proves that respondents families belong to various states , but they have settled here . it was seen that most of the students were from nuclear families , which is a very common trend in urban areas . with respect to education background , a majority of the students were from well - educated families , with their fathers being postgraduate and mothers being educated up to higher secondary . the studies also revealed that , the fathers of the respondents were businessmen , whereas mothers were housewives . however , approximately one - third of the respondents mothers were employed .", "the coping strategies adopted by college students with regard to stressful events , i.e. , academic area were assessed . the results revealed that most of the students ( approximately 90% ) used appraisal - focused coping strategies such as , going over the problem again and again , trying to understand it , to make the situation light , and refuse to get too serious about it . also , majority of the college students reported that they frequently adopt problem - solving coping strategies such as , knowing what has to be done , so doubling the efforts and trying harder to make things work , analyzing the problem bit by bit , seeking reassurance and emotional support from family members , and coming up with different solutions to the problem . in the current study , it has been observed that the students used a combination of appraisal - focused and problem - focused coping strategies . whereas , study by lazarus revealed that , problem - focused and emotion - focused coping strategies were used in virtually every stressful encounter . in the present study , it was found that the students used appraisal - focused coping strategies such as , analyzing the situation , cognitively redefining , and cognitively avoiding the situation . this proves that the students in adolescence stage were still confused and were not able to choose those coping strategies which were of positive approach to encounter any stress . the present study revealed that the students resorted to the coping strategies such as seeking sexual comfort ( 24% ) , taking analgesics or minor tranquilizers without medical advice ( 15% ) , to make themselves feel better by having a drink or two ( 10% ) , and to make themselves feel better by taking mood elevating drugs ( 10% ) . these findings were supported by the study by o. languhlin ( 1984 ) , who also reported that resorting to drugs , alcohol , tranquilizers , and sex are more characteristics of inefficient coopers . the findings by mccormack ( 1996 ) , stated that 23% to 36% of the students advocate drinking when under stress ; however , even a small percentage of students using this coping strategy may form a high risk group . in the current study , the sample comprised college students belonging to 1 puc and ii puc , who were still in adolescence stage and these students were not fully exposed to the evils of the society . in the study , distribution of the coping strategies adopted by the college students was examined with respect to their gender background . the results also revealed that the students irrespective of their gender , used combination of problem - focused and emotion - focused coping strategies . it was found that , out of 70 items , 16 significant responses were used by the students . the coping strategies adopted by female students were , talking to a friend who can do something about the problem , analyzing the problem bit by bit , consoling themselves that things are not that bad and could have been worse , visit places of worship , go on a pilgrimage ; while male students resorted to coping strategies such as , seeking reassurance and emotional support from family members , engage in vigorous physical exercises , talking to a friend who can do something about the problem , and taking a big chance or doing something very risky . it was observed that the female students used emotion - focused coping strategies and sought more social support than males . these findings were supported by the study done by frydenberg and lewis , ( 1991 ) and reported that females sought more social support and employed strategies related to , hoping for the best and wishful thinking , than males . also , hobfall , et al . , ( 1994 ) reported that when faced with problems of professional and interpersonal situations , support seeking was employed more by women than men . the findings by mike and thoits ( 1993 ) suggested that men experience a stoic style of responding to stressors and women have an emotional expressive style . the distribution of coping strategies adopted by college students was examined with respect to different faculties , such as arts , science , and commerce . it was observed that the students used a combination of appraisal - focused and problem - focused coping strategies . out of 70 responses , the frequently used coping strategies by the students belonging to different faculties were problem - focused , for example , pray to god,and knowing what has to be done , so doubling the efforts and trying harder to make things work , were displayed by more than 90% of the college students . majority ( 90% ) of the students belonging to science and arts faculties and 75% from commerce , used appraisal - focused coping strategies such as , console yourself that the things are not at all that bad , it could be worse , make light of the situation , refused to get too serious about it , refusing to believe that it happened . also , 43% of the students from commerce and science faculties used emotion - focused coping strategies , whereas 35% from arts faculty used emotional - focused coping strategies , such as , preparing themselves for the worst to come , feeling that other people are responsible for what has happened , and trying to feel better by eating / nibbling . overall , the total coping repertoires of students belonging to arts , science , and commerce faculties were 37 , 38 , and 35 , respectively . with respect to gender , the total coping repertoire for male and female students , were 36 and 37 , respectively . murthy ( 1995 ) found in her study of working women that they have a coping repertoire of approximately 21 . karen ( 2000 ) reported that the total coping repertoire of unsuccessful college students was 37 ." ]

[ "dermatomyositis ( dm ) is an uncommon idiopathic inflammatory myopathy that primarily affects skeletal muscle and skin with well - characterized cutaneous findings . it has been well documented that dm carries an increased risk of malignancy and can present as a paraneoplastic syndrome to multiple types of underlying malignancies [ 3 , 4 ] . however , 1530% of cases of dm are manifestations of paraneoplastic syndromes of an underlying malignancy . here , we present a case of concurrent dm and breast cancer to highlight a rare presentation , progression and regression of symptoms , as well as key components of diagnosis and treatment .", "the patient is a 47-year - old polish premenopausal female who presented with complaints of a non - tender palpable left breast mass for 4 months at an outside institution . she underwent a diagnostic mammogram and ultrasound that reported a 2-cm irregular , hypoechoic mass at 12 o'clock . there was a 2.2-cm enhancing mass in the left breast at 12:00 that was consistent with the patient 's biopsy - proven malignancy ( fig . , she underwent a core needle biopsy , which revealed a poorly differentiated triple - negative invasive ductal carcinoma ( fig . there is a 1.9 1.4 cm irregular mass in the left breast at 1112:00 6 cm from the nipple . \n there was a 2.2 cm enhancing mass in the left breast at 12:00 that was consistent with the patient 's biopsy - proven malignancy . \n high power view of the left breast core biopsy ( b ) . left breast ultrasound . there is a 1.9 1.4 cm irregular mass in the left breast at 1112:00 6 cm from the nipple . the circled area revealed a 2-cm irregular mass with biopsy clip noted . left breast on mri . there was a 2.2 cm enhancing mass in the left breast at 12:00 that was consistent with the patient 's biopsy - proven malignancy . two weeks after the biopsy , she complained of new onset pruritic , erythematous rash on her anterior chest , face and back of the hands ( fig . she was complaining of diffuse myalgias , worse during menstruation . owing to her worsening symptoms which included cuticular hypertrophy of the hands with associated erythema over the metacarpophalangeal and proximal interphalangeal joints bilaterally ( fig . 5c ) , she was transferred to the bellevue hospital breast clinic and referred to the rheumatology clinic for management of her symptoms . initial laboratories revealed moderately elevated laboratory values ( table 1 ) . at this time , she was presumptively diagnosed with paraneoplastic dm secondary to invasive ductal carcinoma of the left breast and treated with 20 mg prednisone daily . her persistent and slowly progressing symptoms despite aggressive treatments prompted our decision to proceed with surgical intervention in hopes of preventing progression of her musculoskeletal manifestations . postoperatively , she experienced rapid improvement in both cutaneous and musculoskeletal manifestations with visible clearing of her rash and return of her strength . she was maintained on prednisone with excellent symptomatic control . on her 6-month visit , we noted resolution of most of her rash , periorbital edema as well as myalgias and muscle weakness ( fig . table 1laboratory values prior to the surgery , 3 weeks postoperatively and 6 weeks postoperatively.preop3 weeks postop6 weeks postopwhite blood cell ( 10)9.312.67.8creatine kinase ( u / l)2183302160aldolase ( u / l)17.45.3myoglobin247ast ( u / l)1177744alt ( u / l)539130 \n figure 5:image of patient with facial rash and periorbital edema that initially developed during her workup ( a ) . images of the worsening rash on her chest and hands that initially developed during her workup ( b and c ) . \n image of patient with facial rash and periorbital edema that initially developed during her workup ( a ) . images of the worsening rash on her chest and hands that initially developed during her workup ( b and c ) .", "dm typically presents with progressive , symmetrical , proximal muscle weakness and characteristic skin lesions such as helitrope rash , gottron 's papules , gottron 's sign , the v - sign and shawl sign . additional cutaneous manifestations that have become more commonly recognized include vasculopathic changes ( i.e. telangiectasias and livedo reticularis ) , cuticular overgrowth ( mechanic 's hands ) and poikiloderma . initial presentation follows a bimodal distribution between ages 515 and 4564 and tends to progress over a 3- to 6-month period before the patient will seek medical attention . contrary to this typical presentation , the above patient experienced rapid progression of symptoms over a much shorter period and predominately reported skin manifestations with subsequent rapid development of muscular deterioration . the diagnosis and classification of dm commonly follows the criteria set forth by bohan and peter in 1975 ( table 2 ) [ 1 , 2 ] . initial evaluation for suspected dm should include such investigations as serum creatine kinase , aldolase , aspartate aminotransferase , alanine aminotransferase and/or lactate dehydrogenase . serum creatine kinase is the most sensitive muscle enzyme in the acute phase of the disease as it is released in the serum during muscle damage . serum inflammatory markers ( e.g. erythrocyte sedimentation rate and c - reactive protein ) may also be elevated during the active phase of the disease . table 2bohan and peter criteria for diagnosis of dermatomyositis.individual criteria \n symmetric proximal muscle weaknessmuscle biopsy evidence of myositisincrease in serum skeletal muscle enzymescharacteristic electromyographic patternstypical rash of dermatomyositisdiagnostic criteria \n definitive5 plus any three of 14probably5 plus any two of 14possible5 plus any one of 14 bohan and peter criteria for diagnosis of dermatomyositis . symmetric proximal muscle weakness muscle biopsy evidence of myositis increase in serum skeletal muscle enzymes characteristic electromyographic patterns typical rash of dermatomyositis definitive5 plus any three of 14 probably5 plus any two of 14 possible5 plus any one of 14 previous studies have shown that up to 30% of dm patients had underlying malignancies [ 6 , 7 ] . malignancies in dm patients have been found to be highest in those over 45 years of age , commonly diagnosed within the first year of initial presentation , and most strongly associated with lung , ovarian , gastric , pancreatic and colorectal origin . malignancy can precede , occur concurrently or develop after the diagnosis of dm . in our patient , the symptoms of dm occurred 2 weeks following her diagnosis of breast cancer . the goals of therapy in patients with dm are to improve the patient 's ability to carry out activities of daily living by increasing muscle strength and improving myalgias as well as treating the extramuscular manifestations ( including rash and arthralgias ) . there has been report of variable influence of the treatment of the underlying malignancy on the clinical course of the dm [ 9 , 10 ] . in our patient , the complete surgical excision of the underlying breast cancer resulted in dramatic improvement in both her cutaneous manifestations and her musculosckeletal symptoms . given the high frequency of malignancy in patients with a diagnosis of dm , any woman over the age of 45 with newly diagnosed dm should prompt a thorough physical examination , including a breast examination , as well as further workup for other malignancies ( e.g. ovarian or colorectal cancer ) . early diagnosis of dm as a paraneoplastic syndrome allows for initiation of systemic therapy for symptom control and also treatment of the underlying malignancy itself , which may aid in control of the dm symptoms .", "" ]

[ "taken together , malaria ( caused by plasmodium species ) , human african trypanosomiasis ( hat , caused by trypanosoma brucei ) , chagas disease ( caused by t. \n cruzi ) , and leishmaniasis ( caused by leishmania species ) represent diseases with an estimated combined burden of \n over 87 million disability - adjusted life years . while progress has certainly been made toward the discovery \n of new hits , much work remains to translate these hits into promising \n chemical lead series that may be advanced for drug development . target \n repurposing , wherein inhibitors of human homologues of essential \n parasite proteins are assessed for efficacy against parasite cells . we have recently initiated the repurposing of \n a variety of kinase inhibitors for parasitic diseases and have also described the use of established human phosphodiesterase \n inhibitors as starting points for lead discovery . we have described the discovery of neu-617 ( 1 ) , a \n derivative of the approved human cancer drug lapatinib ( 2 ) , which acts as a potent , orally bioavailable growth inhibitor of t. brucei that showed a modest effect in a mouse model of \n bloodstream infection . based on the close phylogenetic relationship \n between the kinomes of the trypanosomatid parasites ( t. brucei , t. cruzi , and leishmania major ) , we hypothesized that all the pathogens \n would be susceptible to these inhibitors . we have therefore tested 1 , along with the other analogs synthesized during the course \n of our hit - to - lead optimization program , against the two other kinetoplastid \n parasites . based on our previous observation that related chemotypes \n show activity against plasmodium falciparum , we also screened this set of compounds against \n cultures of drug - sensitive and drug - resistant strains of malaria . \n in doing so , we noted differential structure activity relationships \n for these compounds growth inhibitory properties against each \n of the parasites , thus launching a multiparasite optimization campaign \n from the same lead series . in this paper , we describe these \n cross - pathogen assay results and \n outline our evaluation of replacements for the quinazoline scaffold \n of 1 for each of the parasites . we posit that such a \n cross - screening approach can be a highly fruitful method for identification \n of new protozoan parasite growth inhibitors .", "first , \n in order to ascertain antiparasitic activities of our 66 \n previously reported analogs , we measured \n their growth inhibitory activities against t. cruzi ( intracellular amastigotes ) , l. major ( promastigote \n and intracellular amastigote life stages ) , and p. falciparum ( d6 , drug sensitive strain ) . the structures of the most potent compounds \n for each parasite are shown in figure 1 and \n table 1 , and the complete set of screening \n data for these is tabulated in the supporting \n information ( tables s1s7 ) . program progression from 2 to four sem values within 50% . * % inh at \n 10 m . control compounds : t. brucei , suramin ; t. cruzi , benznidazole ; l. major , amphotericin b ; p. falciparum , chloroquine . from these \n experiments , we observed that 15 morpholinosulfonamide \n compounds were identified with activity against l. major promastigotes : seven of these were submicromolar inhibitors and \n two were also submicromolar against intracellular amastigotes ( the \n most relevant life stage for human infections of leishmaniasis ) . the \n des - fluoro analog neu-551 ( 3 ) showed the highest activity \n against promastigotes ( ec50 = 0.50 m ) . we initially \n tested compounds against t. cruzi at a single concentration \n and found that 32 compounds inhibited proliferation > 65% at 10 \n m \n concentrations ; of these 32 compounds , the homopiperazinyl sulfonamide - substituted \n tail was preferred ( neu-628 ( 4 ) , ec50 = 0.51 \n m ) . the active compounds against p. falciparum ( drug - sensitive d6 strain ) all contained a basic nitrogen at the \n end of the tail group with neu-627 ( 5 ) being the most \n potent with an ec50 of 27 nm . though we note that the number \n of headgroup replacement analogs tested was far smaller and less diverse \n than the tail variations , the lapatinib headgroup 3-chloro-4-((3-fluorobenzyl)oxy)aniline \n showed optimal potency against all of the parasites , except for both leishmania life stages . previous efforts focused on \n the head ( 4-benzyloxyanilines ) \n and tail ( denoted as r in figure 1 ) regions of lapatinib , while maintaining the central quinazoline \n scaffold ( highlighted in blue in figure 1 ) . \n thus , we planned a broader evaluation of other bicyclic aromatic replacements \n for the quinazoline scaffold that would test the important features \n of the chemotype for activity . these scaffold replacements were selected \n for exploration of the requisite nitrogen atom positioning in the \n heteroaromatic ring ( see the heterocycle precursors highlighted in \n figure 2 , dihalides 69 ) . in addition , the cyanoquinoline and thienopyrimidine scaffolds \n ( dihalides 1012 ) were selected in \n order to include other established tyrosine kinase inhibitor chemotypes . for a matched exploration of these scaffolds , we elected to maintain \n the four permutations of head / tail combinations that displayed the \n most potency in each parasite ( shown in figure 1 ) in the new analogs that we prepared . we first set out to synthesize \n the requisite dihalogenated scaffolds \n shown in figure 2 . the syntheses of 6- and \n 7-bromo-4-chloroquinolines 6a and 6b were \n carried out via the gould was devised to draw out essential interactions \n with either nitrogen of the quinazoline scaffold . the requisite cyanoquinoline template 12 was prepared \n using established protocols similar to that of the 4-chloroquinolines . though few examples of cinnoline or phthalazine \n based kinase inhibitors \n exist in the literature , we opted to prepare analogues utilizing both heterocycles \n to test the required positioning of the two nitrogen atoms on the \n scaffold . preparation of 6-bromo-4-chlorocinnoline 8a commenced with the bromination of o - aminoacetophenone 13 followed by diazotization of the amine and in situ cyclization to the 6-bromocinnolin-4(1h)-one 15 ( scheme 1 ) . we hypothesized that this \n side reaction occurred via chloride displacement under the acidic \n conditions of the reaction ( scheme s1 , see supporting \n information ) . a 10:1 product ratio of 8a to 8b could be achieved through the use of thf as solvent and \n 3 equiv of pocl3 . the regiomeric 7-bromo-4-chlorocinnoline 8c was prepared in a similar fashion starting instead with \n the acylation of 3-bromoaniline 16 to 2-amino-4-bromoacetophenone 17 , followed by diazotization and chlorination . reagents and conditions : ( a ) \n nbs , ch2cl2 , 10 c 23 \n c , o.n . ; ( b ) nano2 , aq . hcl , h2o , 75 c , \n o.n . ; ( c ) pocl3 , thf , reflux , 2 h ; ( d ) ( i ) bcl3 , ( ch2cl)2 , 0 c ; ( ii ) alcl3 , ch3cn , 80 c , o.n . ; ( iii ) aq . hcl , 80 c , \n 30 min ; ( b ) nano2 , aq . hcl , h2o , 75 c , \n o.n . ; ( c ) pocl3 , thf , reflux , 2 h. the 7-bromo-1-chlorophthalazine template 9a was synthesized \n as shown in scheme 2 . aryl bromination of phthalide 19 was carried out in acidic medium with nbs to produce a \n separable mixture of 4- and 6-bromophthalide 20 . benzylic \n bromination was achieved using a modification of an established procedure , and the resulting dibromides 21a , b were converted to the corresponding bromophthalazinone 22 upon treatment with hydrazine . as with 15 , 22a was converted to the dichlorinated side product 9b on treatment with neat pocl3 , though dilution \n minimized this side reaction . acetonitrile with 3 equiv of pocl3 provided a > 10:1 ratio of the desired chlorination product 9a . the 6-bromo-1-chlorophthalazine scaffold 9c could be synthesized in an identical manner starting with the commercially \n available 5-bromophthalide 20b . reagents \n and conditions : ( a ) \n nbs , h2so4 , cf3co2h , 23 \n c , 40 h ; ( b ) nbs , aibn , chcl3 , reflux , 1 h ; ( c ) n2h4 , i - proh , reflux , 1.5 h ; ( d ) pocl3 , ch3cn , reflux , 3 h. amination \n of the dihalogenated quinoline , isoquinoline , cyanoquinoline , \n and thienopyrimidine scaffolds was carried out by applying methods \n similar to those we previously reported ( scheme 3 ) . however , low yields ( 20% ) \n resulted when these conditions were applied to the cinnoline and phthalazine \n templates . switching the solvent to toluene and using 4 equiv of amine \n improved yields to 5478% . suzuki couplings using the requisite \n boronates and 57 mol % pd(pph3)4 or \n 1 mol % pd(oac)2 provided the final analogs . yields of \n the cinnoline or phthalazine products were drastically improved by \n switching to 2.5 mol % pdcl2(pph3)2 or 5 mol % pd(oac)2 with extended reaction times . a higher \n catalyst loading of pd(oac)2 was employed in lieu of pdcl2(pph3)2 in situations where the pph3o byproduct could not be separated from the products . reagents and \n conditions : ( a ) 1.1 equiv of amine , i - proh , reflux , o.n . ; ( b ) 4 equiv \n of amine , toluene , reflux , 2.5 h ; ( c ) 4 equiv of amine , toluene , 50 \n c , o.n . ; ( d ) arbpin , et3n , pd(oac)2 , 1:1 \n h2o / etoh , mw , 120 c , 13 h ; ( e ) arbpin , et3n , pdcl2(pph3)2 , 1:1 h2o / etoh , mw , 120 c , 1 h ; ( f ) arbpin , aq . na2co3 , pd(pph3)4 , 3:2 glyme / etoh , \n n2 , 85 c , 712 h. with this set of new analogs that are matched to the previously \n described antiparasitic agents , we set \n out measuring these analogs activities against t. \n brucei , t. cruzi , l. major , and p. falciparum , and counter - screened against \n host cells ( nih 3t3 and hepg2 cell lines ) using assays that we previously \n reported . a \n small number of compounds showed activity against nih 3t3 cells ; these \n are summarized in the supporting information , table s8 . all sem values \n within 25% unless \n noted otherwise . * % inh at 5 m .", "compound 1 remained the most potent t. brucei growth inhibitor among this set of analogs . a pair of quinoline - based \n compounds , 50 and 52 , each with a basic \n aliphatic amine on the tail group show double digit nanomolar potency \n ( 79 and 87 nm , respectively ) . the potency of these compounds seems \n to be driven by the aliphatic amine in the tail region rather than \n by the placement of nitrogen atoms in the scaffold , because the analogous \n isoquinoline analogue 58 is approximately equipotent \n ( 100 nm ) to 50 . the quinoline analogs 50 , 51 , and 52 displayed submicromolar potency \n against intracellular amastigotes \n of t. cruzi . most other analogs showed a complete \n loss of activity , perhaps due to issues with penetration into both \n the host cell and the parasite . ( with intracellular parasites , we \n note that compensating effects from interactions with host cell targets \n can not be ruled out . ) however , the 3-cyanoquinoline analogue 83 , shows a 5-fold improvement in potency over the matched \n original quinazoline analog 4 . in the headgroup region , \n the 3-fluoro substituent affords a 10-fold increase in potency over \n the matched des - fluoro analog ( cf . the quinoline 51 displayed a slight drop in potency \n compared with the quinazoline 4 , and the matched isoquinoline 59 is 10-fold less potent . taken together with the cyanoquinoline \n analog 83 , this data demonstrates the apparent importance \n of two h - bond acceptor motifs in the scaffold . in the case of l. major , 47 showed \n a 2.5-fold increase in potency from the matched quinazoline analogue 3 ( 0.20 versus 0.50 m respectively ) against the promastigote \n life stage of l. major . the corresponding isoquinoline \n compound 55 showed a complete loss in activity , reinforcing \n the essentiality of the n1 atom of the quinazoline . interestingly , \n there was no activity observed against the amastigote life stage of \n the parasite for 47 . in contrast , the 7-substituted quinoline 52 displayed submicromolar potency against both life stages \n ( 0.40 m against promastigotes and 0.89 m versus amastigotes ) . \n compared with the quinazoline compound 4 , the analogous \n cinnoline 68 displayed increased potency against amastigotes \n ( 0.24 m ) albeit with a significant decrease in potency against \n the promastigote form . this lack of correlation of compounds between \n promastigote and amastigote life stages of the parasite has been reported \n by us and others recently . other compounds displaying \n modest potency include 76 and 91 , both containing \n the n - methylhomopiperazinyl sulfonamide tail . in p. falciparum cultures , three isoquinoline \n compounds with a basic amine at the terminus of the tail region showed \n modest potency highlighted by 57 being nearly equipotent \n to the parent quinazoline 5 ( 40 vs 27 nm ) . though the \n matching quinoline 49 showed a complete loss in activity , \n its regioisomer 50 was slightly more active than 5 ( ec50 = 19 nm ) . the four quinoline analogs without \n a basic amine on the tail group were within 2-fold of 5 with 48 being the most potent with an ec50 = 16 nm . similarly , all four thienopyrimidine analogs with a basic \n tail group amine ( 8992 ) were potent , \n within 4-fold of 5 . among these compounds there was no \n preference for either thienopyridine isomer ; the n - methylpiperazinyl tail group was 2.5- to 4-fold more potent than \n the n - methylhomopiperazinyl tail on each scaffold . among the phthalazines , 74 and 76 , both \n with a basic nitrogen on the tail and substituted at the 6-position \n ( regiomeric to 5 ) were equipotent to 5 . \n also requiring a basic amine on the tail region , the cinnoline analogs \n with piperazinyl and homopiperazinyl moieties ( 6568 ) showed modest to high potency against p. falciparum d6 strain . excitingly , the 7-substituted isomers ( 66 and 68 ) were highly potent antiplasmodial agents ( 14 \n and 3 nm , respectively ) . since we observed that the most potent \n compounds against p. falciparum were 4-aminoquinolines \n ( similar to the prototypical \n antimalarial agent chloroquine ) , we tested them against drug resistant \n parasite strains w2 and c235 . we were gratified to observe that all \n of the compounds tested are similarly active against drug resistant \n strains of p. falciparum ( table s9 , supporting information ) , suggesting that despite the shared \n scaffold , these analogs likely display a mechanism of action or mechanism \n of resistance that differs from those of chloroquine . our studies \n demonstrate which of these scaffolds are the most promising \n for further optimization on a parasite - by - parasite basis . , it is clear that the quinoline scaffold \n is significantly active across all four pathogens . we note that cinnoline \n ( c ) and quinoline ( a ) generally provide the most potent antiplasmodial \n agents , and the 7-position substitutions are slightly favored in both \n of these templates . for t. brucei , the 7-substituted \n quinolines and 6-substituted isoquinolines appear optimal ( noting \n that , despite the differential numbering of the scaffolds , these two \n particular scaffolds present the same relative regiochemistry ) . analogous \n diagrams for the other pathogens are also provided in figure 3 ( and a diagram for leishmania promastigotes \n is in the supporting information ( figure \n s1 ) . a summary of the preferred bicyclic scaffold for each parasite \n is shown in figure 3e , noting that none appear \n to be markedly better than the others against leishmania intracellular amastigotes . bar chart showing range of potencies for each \n scaffold ( as labeled \n in tables 2 and 3 ) for \n ( a ) malaria , ( b ) t. brucei , ( c ) l. major ( amastigotes ) , and ( d ) t. cruzi . regiochemical \n information is shown by the suffix number ( e.g. , scaffold a-7 is the \n 7-substituted quinoline scaffold ) . quinolines are shown in blue , isoquinolines \n in green , cinnolines in yellow , phthalazines in orange , cyanoquinolines \n in red , thieno[3,2-d]pyrimidines in purple , thieno[2,3-d]pyrimidines in light gray , and quinazolines in dark gray . \n for all parasites except for t. brucei , we also \n note a preference for tail substituents with a basic amine present . \n considering only the most potent compounds ( ec50 0.1 m for the extracellular parasites t. brucei and p. falciparum ; ec50 1 m for the intracellular parasites l. major and t. cruzi ) , we note that the n - methylpiperizine and n - methylhomopiperazine are \n preferred among analogs that were tested , over the less - basic morpholine \n or nonbasic morpholinosulfonamide substituents ( table 4 ) . at this point , we can not discern whether this is an effect \n that is mediated by the biological target(s ) involved in proliferation \n inhibition , by parasite permeation , or by a combination of both ; this \n will be a matter for further investigation . potent compounds \n are ec50 0.1 m . potent compounds \n are ec50 1 m . we have previously observed that molecules bearing \n these head and \n tail combinations possess problematic physicochemical properties , \n likely due to the molecular size and lipophilicity . the intent of \n the present work was to explore the central scaffold functionality , \n rather than to address these shortcomings . nonetheless , we selected \n five representative compounds from among the most potent to be tested \n for their physicochemical properties ( table 5 ) . not unexpectedly , compounds tested were > 99% plasma protein \n bound \n with limited thermodynamic aqueous solubility ( < 1 m ) . such \n properties are undoubtedly a result of the high molecular weights \n and clogp values ; these issues remain the focus of ongoing efforts , \n which are now focused on specific scaffolds for each pathogen . in summary , through a cross - parasite \n screening campaign of existing \n quinazoline t. brucei proliferation inhibitors , we \n uncovered new hits against three other protozoan parasites . encouraged \n by that initial success , we focused on exploring the central heterocycle \n scaffold , an exercise that has uncovered additional highly potent \n compounds . scaffold variations have revealed heteroatom positioning \n essential for activity within this chemotype , while variations to \n regiochemical attachment points have introduced a new set of regioisomers \n with multiparasite potency . thus , we have established a new lead series \n for each of these protozoan parasites , which can be now advanced in \n parallel for drug discovery against four different parasitic diseases . \n with this in mind , further optimization of physicochemical properties \n and cellular selectivity of each is ongoing , with a specific focus \n on the head and tail regions .", "( st . louis , mo ) , fisher scientific , \n frontier scientific services , inc . ( newark , de ) , or matrix scientific \n ( columbia , sc ) and used as received . boronic acids and esters and \n aniline reagents were purchased , except for those whose syntheses \n are listed in the supporting information . reaction solvents were dried by passage through alumina columns \n on a purification system manufactured by innovative technology ( newburyport , \n ma ) . nmr spectra were obtained with varian nmr systems , operating \n at 400 or 500 mhz for h acquisitions as noted . lcms analysis \n was performed using a waters alliance reverse - phase hplc , with single - wavelength \n uv visible detector and lct premier time - of - flight mass spectrometer \n ( electrospray ionization ) . all newly synthesized compounds that were \n submitted for biological testing were deemed > 95% pure by lcms \n analysis \n ( uv and esi - ms detection ) prior to submission for biological testing . \n preparative lcms was performed on a waters fraction lynx system with \n a waters micromass zq mass spectrometer ( electrospray ionization ) \n and a single - wavelength uv yields reported \n for products obtained by preparative hplc represent the amount of \n pure material isolated ; impure fractions were not repurified . in a flame - dried \n 250 ml round - bottom flask were added 6-bromocinnolin-4(1h)-one ( 1.00 g , 4.44 mmol ) , anhydrous tetrahydrofuran ( 45 ml ) , and \n phosphorus oxychloride ( 1.25 ml , 13.41 mmol ) . the mixture was refluxed \n for 1 h at which point a deep green / blue solution had resulted . the \n solution was cooled to 0 c and was quenched by the dropwise \n addition of sat . the mixture was allowed \n to warm to room temperature and stir for an additional 1 h. water \n ( 50 ml ) was added , and the mixture was extracted with dichloromethane \n ( 3 100 ml ) . nahco3 ( 50 ml ) , washed with brine ( 50 ml ) , dried over \n na2so4 , concentrated on to silica , and purified \n by flash column chromatography using a gradient of 15% methanol \n in dichloromethane to yield an inseparable 10:1 mixture of 8a and 8b as a brown solid in 85% yield . h \n nmr ( 500 mhz , cdcl3 ) 9.36 ( s , 1 h ) , 8.43 ( d , j = 8.8 hz , 1 h ) , 8.36 ( d , j = 2.0 hz , \n 1 h ) , 7.98 ( dd , j = 9.3 , 2.0 hz , 1 h ) . lcms found \n 242.9 [ m + h ] . in a flame - dried \n 25 ml round - bottom flask were added 7-bromocinnolin-4(1h)-one ( 166 mg , 0.74 mmol ) , anhydrous tetrahydrofuran ( 7 ml ) , and \n phosphorus oxychloride ( 0.2 ml , 2.15 mmol ) . the mixture was refluxed \n for 1 h at which point a deep green / blue solution had resulted . the \n solution was cooled to 0 c and was quenched by the dropwise \n addition of sat . . the mixture was allowed \n to warm to room temperature and stir for an additional 1 h. water \n ( 12 ml ) was added , and the mixture was extracted with dichloromethane \n ( 3 25 ml ) . nahco3 ( 20 ml ) , washed with brine ( 20 ml ) , and dried \n over na2so4 to yield 8c as a dark \n brown solid in 92% yield . h nmr ( 500 mhz , cdcl3 ) 9.39 ( s , 1 h ) , 8.76 ( d , j = 2.0 hz , 1 \n h ) , 8.09 ( d , j = 9.3 hz , 1 h ) , 7.95 ( dd , j = 9.0 , 1.7 hz , 1 h ) . lcms found 242.9 [ m + h ] . in a \n flame - dried 25 ml round - bottom flask were added 7-bromophthalazin-1(2h)-one ( 205 mg , 0.91 mmol ) , anhydrous acetonitrile ( 9 ml ) , \n and phosphorus oxychloride ( 0.3 ml , 3.22 mmol ) . the mixture was refluxed \n for 2 h , then cooled to 0 c , diluted with dichloromethane ( 20 \n ml ) , and quenched with a dropwise addition of sat . after 1 h , the layers were separated \n and the aqueous was extracted with dichloromethane ( 2 30 ml ) . \n the combined organic layers were washed with sat . nahco3 ( 25 ml ) , washed with brine ( 20 ml ) , dried over na2so4 , and concentrated to yield 9a as an orange solid \n in 91% yield . h nmr ( 500 mhz , cdcl3 ) \n 9.45 ( s , 1 h ) , 8.498.51 ( m , 1 h ) , 8.10 ( dd , j = 8.8 , 2.0 hz , 1 h ) , 7.91 ( d , j = 8.8 hz , 1 h ) . \n lcms found 242.9 [ m + h ] . in a \n flame - dried 50 ml round - bottom flask were added 6-bromophthalazin-1(2h)-one ( 402 mg , 1.78 mmol ) , anhydrous acetonitrile ( 18 ml ) , \n and phosphorus oxychloride ( 0.5 ml , 5.36 mmol ) . the mixture was refluxed \n for 2 h , then cooled to 0 c , diluted with dichloromethane ( 40 \n ml ) , and quenched with a dropwise addition of sat . the biphasic mixture was stirred vigorously and allowed \n to warm to room temperature . after 1 h , the layers were separated , \n and the aqueous was extracted with dichloromethane ( 2 50 ml ) . \n the combined organic layers were washed with sat . nahco3 ( 40 ml ) , washed with brine ( 30 ml ) , dried over na2so4 , and concentrated to yield 29c as a yellow solid \n in 94% yield . h nmr ( 500 mhz , cdcl3 ) \n 9.39 ( s , 1 h ) , 8.178.21 ( m , 2 h ) , 8.10 ( dd , j = 8.8 , 2.0 hz , 1 h ) . in a 250 ml round - bottom \n flask were added 1-(2-amino-5-bromophenyl)ethanone \n ( 8.34 g , 39.0 mmol ) , water ( 30 ml ) , and conc . the mixture was cooled to 0 c in an ice bath \n and allowed to stir for 15 min until a suspension resulted . aqueous \n sodium nitrite ( 2 m , 20 ml , 40.0 mmol ) was then added dropwise with \n an addition funnel . the resulting solution was allowed to warm to \n room temperature over 1.5 h and was stirred at room temperature overnight , \n then refluxed for 6 h. the mixture was cooled to room temperature , \n water ( 200 ml ) was added , and the mixture was extracted with ethyl \n acetate ( 3 200 ml ) . the combined organic layers were then washed \n with brine ( 50 ml ) , dried over sodium sulfate , filtered , and concentrated \n onto silica . the crude product was then purified by flash column chromatography \n using a gradient of 110% methanol in dichloromethane to yield 15 as a dark brown solid in 82% yield . h nmr ( 500 \n mhz , dmso - d6 ) 14.09 ( br . s. , 1 \n h ) , 8.09 ( d , j = 2.2 hz , 1 h ) , 7.92 ( dd , j = 8.8 , 2.2 hz , 1 h ) , 7.79 ( s , 1 h ) , 7.71 ( d , j = 9.1 hz , 1 h ) . in a 50 ml round - bottom \n flask were added 1-(2-amino-4-bromophenyl)ethanone \n ( 712 mg , 3.33 mmol ) , water ( 3 ml ) , and conc . the mixture was cooled to 0 c in an ice bath and \n allowed to stir for 15 min until a suspension resulted . aqueous sodium \n nitrite ( 2 m , 1.84 ml , 3.68 mmol ) was then added dropwise with an \n addition funnel . the resulting solution was allowed to warm to room \n temperature over 1.5 h and was stirred at room temperature overnight , \n then refluxed for 6 h. the mixture was cooled to room temperature , \n water ( 35 ml ) was added , and the mixture was extracted with ethyl \n acetate ( 3 40 ml ) . the combined organic layers were then washed \n with brine ( 20 ml ) , dried over sodium sulfate , filtered , and concentrated \n onto silica . the crude product was then purified by flash column chromatography \n using a gradient of 2050% ethyl acetate in hexanes , then ethyl \n acetate to yield 18 as a light brown solid in 26% yield . h nmr ( 500 mhz , dmso - d6 ) \n 13.49 ( s , 1 h ) , 7.92 ( d , j = 8.8 hz , 1 h ) , 7.76 ( s , \n 1 h ) , 7.73 ( d , j = 2.0 hz , 1 h ) , 7.53 ( dd , j = 8.8 , 2.0 hz , 1 h ) . in a 100 ml round - bottom flask was dissolved isobenzofuran-1(3h)-one ( 4.01 g , 29.9 mmol ) in trifluoroacetic acid ( 14 ml , \n 182 mmol ) and sulfuric acid ( 6.5 ml , 122 mmol ) . n - bromosuccinimide ( 7.95 g , 1.49 mmol ) was added portionwise over \n 8 h , and the solution was stirred at room temperature for an additional \n 87 h. the solution was diluted with water ( 40 ml ) and ethyl acetate \n ( 40 ml ) . the organic layer was separated , \n and the aqueous layer was extracted with ethyl acetate ( 3 50 \n ml ) . the combined organic layers were washed with brine ( 25 ml ) , dried \n over na2so4 , and concentrated onto silica . the \n crude product was then purified by flash column chromatography using \n 1020% ethyl acetate in hexanes to yield 20a as \n white solid in 57% yield . h nmr ( 500 mhz , cdcl3 ) 7.98 ( d , j = 1.5 hz , 1 h ) , 7.77 ( dd , j = 8.3 , 1.5 hz , 1 h ) , 7.40 ( d , j = 8.3 \n hz , 1 h ) , 5.27 ( s , 2 h ) . lcms found 212.9 [ m + h ] . in a 50 ml round - bottom \n flask n - bromosuccinimide \n ( 958 mg , 5.38 mmol ) , 2,2-azobis(2-methylpropionitrile ) ( 75 \n mg , 0.46 mmol ) , and chloroform ( 23 ml ) . the mixture was refluxed for \n 2.5 h , then cooled to room temperature and quenched with sat . the organic layer was removed , washed with \n water ( 20 ml ) , washed with brine ( 15 ml ) , and concentrated onto silica . \n the crude product was purified by flash column chromatography using \n a gradient of 510% ethyl acetate in hexanes to yield 21a as a white solid in 61% yield . h nmr ( 500 \n mhz , cdcl3 ) 8.06 ( d , j = 1.5 hz , \n 1 h ) , 7.90 ( dd , j = 8.1 , 1.7 hz , 1 h ) , 7.52 ( d , j = 8.3 hz , 1 h ) , 7.37 ( s , 1 h ) . were \n added 5-bromoisobenzofuran-1(3h)-one ( 499 mg , 2.34 \n mmol ) , n - bromosuccinimide \n ( 421 mg , 2.37 mmol ) , 2,2-azobis(2-methylpropionitrile ) ( 38 \n mg , 0.23 mmol ) , and chloroform ( 10 ml ) . the mixture was refluxed for \n 2.5 h , then cooled to room temperature and quenched with sat . the organic layer was removed , washed with \n water ( 10 ml ) , washed with brine ( 5 ml ) , and concentrated onto silica . \n the crude product was purified by flash column chromatography using \n 10% ethyl acetate in hexanes to yield 21b as a white \n solid in 49% yield . h nmr ( 500 mhz , cdcl3 ) \n 7.747.83 ( m , 3 h ) , 7.36 ( s , 1 h ) . gcms found 289.8 \n [ m ] . in a 25 ml round - bottom flask was dissolved \n 3,6-dibromoisobenzofuran-1(3h)-one ( 143 mg , 0.49 \n mmol ) in ethanol ( 5 ml ) . hydrazine \n monohydrate ( 0.12 ml , 2.48 mmol ) was then added via a syringe , and \n the solution was refluxed for 1.5 h. the solution was cooled to room \n temperature , and ice water ( 15 ml ) was added to the reaction mixture . \n the precipitate was vacuum filtered and dried under a vacuum overnight \n to yield 22a as a white solid in 56% yield . h nmr ( 500 mhz , dmso - d6 ) 12.82 \n ( br . s. , 1 h ) , 8.39 ( s , 1 h ) , 8.30 ( d , j = 2.0 hz , \n 1 h ) , 8.11 ( dd , j = 8.5 , 2.2 hz , 1 h ) , 7.90 ( d , j = 8.3 hz , 1 h ) . in a 25 ml round - bottom flask was dissolved 3,5-dibromoisobenzofuran-1(3h)-one ( 302 mg , 1.04 mmol ) in ethanol ( 10 ml ) . hydrazine \n monohydrate ( 0.25 ml , 5.18 mmol ) was then added via a syringe , and \n the solution was refluxed for 1.5 h. the solution was cooled to room \n temperature , and ice water ( 30 ml ) was added to the reaction mixture . \n the precipitate was vacuum filtered and dried under a vacuum overnight \n to yield 22b as a white solid in 73% yield . h nmr ( 500 mhz , dmso - d6 ) 12.78 \n ( br . s. , 1 h ) , 8.33 ( s , 1 h ) , 8.23 ( d , j = 2.0 hz , \n 1 h ) , 8.12 ( d , j = 8.3 hz , 1 h ) , 8.00 ( dd , j = 8.3 , 2.0 hz , 1 h ) . to a solution of the appropriate \n aryl chloride ( 1 equiv ) in 2-propanol ( 0.15 m ) was added 3-chloro-4-((3-fluorobenzyl)oxy)aniline \n or 4-(benzyloxy)-3-chloroaniline ( 1.1 equiv ) . the formed precipitate was collected by vacuum \n filtration to obtain the desired products . to a solution of the appropriate \n aryl chloride ( 1 equiv ) in 2-propanol ( 0.15 m ) the combined organic layers were washed with water , washed with brine , \n dried over na2so4 , and concentrated . the crude \n products were purified by flash column chromatography to obtain the \n desired products . a solution of the appropriate 4-chlorocinnoline \n ( 1 equiv ) and 3-chloro-4-((3-fluorobenzyl)oxy)aniline \n or 4-(benzyloxy)-3-chloroaniline ( 4 equiv ) in toluene ( 0.1 m ) was \n refluxed for 2.5 h and cooled to room temperature . triethylamine ( 4 \n equiv ) was added , and the mixture was returned to reflux for an additional \n 30 min . the mixture was cooled back to room temperature , and the formed \n yellow precipitate was vacuum filtered , washed with ethyl acetate , \n concentrated onto silica , and purified by flash column chromatography . a solution of the appropriate 1-chlorophthalazine ( 1 equiv ) and \n 3-chloro-4-((3-fluorobenzyl)oxy)aniline or 4-(benzyloxy)-3-chloroaniline \n ( 4 equiv ) in anhydrous toluene ( 0.2 m ) was heated at 50 c overnight . \n the combined \n organic layers were washed with brine , dried over na2so4 , concentrated onto silica , and purified by flash column chromatography . synthesized by general procedure b. flash \n column chromatography : 2050% ethyl acetate in hexanes to yield 23 as a light brown solid in 90% yield . h nmr \n ( 500 mhz , dmso - d6 ) 8.99 ( s , 1 \n h ) , 8.63 ( s , 1 h ) , 8.46 ( d , j = 5.4 hz , 1 h ) , 7.80 \n ( d , j = 1.5 hz , 2 h ) , 7.437.51 ( m , 2 h ) , \n 7.277.36 ( m , 4 h ) , 7.19 ( td , j = 8.7 , 2.2 \n hz , 1 h ) , 6.80 ( d , j = 5.4 hz , 1 h ) , 5.26 ( s , 2 h ) . \n lcms found 456.8 [ m + h ] . synthesized by general procedure b. flash \n column chromatography : 2070% ethyl acetate in hexanes to yield 24 as a brown solid in 70% yield . h nmr ( 500 mhz , \n dmso - d6 ) 8.98 ( s , 1 h ) , 8.63 ( s , \n 1 h ) , 8.45 ( d , j = 5.4 hz , 1 h ) , 7.80 ( s , 2 h ) , 7.50 \n ( d , j = 7.3 hz , 2 h ) , 7.397.46 ( m , 3 h ) , \n 7.35 ( t , j = 7.3 hz , 1 h ) , 7.30 ( s , 2 h ) , 6.79 ( d , j = 5.4 hz , 1 h ) , 5.23 ( s , 2 h ) . synthesized by general procedure b. flash \n column chromatography : 2050% ethyl acetate in hexanes to yield 25 as a tan colored solid in 82% yield . h nmr \n ( 399 mhz , dmso - d6 ) 9.05 ( s , 1 \n h ) , 8.43 ( d , j = 5.1 hz , 1 h ) , 8.31 ( d , j = 8.8 hz , 1 h ) , 8.05 ( d , j = 2.2 hz , 1 h ) , 7.67 \n ( dd , j = 8.8 , 2.2 hz , 1 h ) , 7.417.52 ( m , \n 2 h ) , 7.257.37 ( m , 4 h ) , 7.18 ( td , j = 8.6 , \n 2.6 hz , 1 h ) , 6.76 ( d , j = 5.9 hz , 1 h ) , 5.25 ( s , \n 2 h ) . synthesized by general procedure b. flash \n column chromatography : 2050% ethyl acetate in hexanes to yield 26 as an off - white solid in 83% yield . h nmr ( 500 \n mhz , dmso - d6 ) 9.04 ( s , 1 h ) , 8.43 \n ( d , j = 4.9 hz , 1 h ) , 8.31 ( d , j = 9.3 hz , 1 h ) , 8.05 ( d , j = 2.0 hz , 1 h ) , 7.67 \n ( dd , j = 9.0 , 2.2 hz , 1 h ) , 7.49 ( d , j = 6.8 hz , 2 h ) , 7.397.46 ( m , 3 h ) , 7.35 ( t , j = 7.3 hz , 1 h ) , 7.30 ( s , 2 h ) , 6.75 ( d , j = 5.4 \n hz , 1 h ) , 5.23 ( s , 2 h ) . synthesized by general procedure b. flash \n column chromatography : 1030% ethyl acetate in hexanes to yield 27 as a pale red - brown solid in 97% yield . h nmr \n ( 500 mhz , dmso - d6 ) 9.24 ( s , 1 \n h ) , 8.80 ( s , 1 h ) , 8.07 ( d , j = 2.4 hz , 1 h ) , 8.02 \n ( d , j = 5.9 hz , 1 h ) , 7.82 ( dd , j = 8.8 , 1.5 hz , 1 h ) , 7.727.79 ( m , 2 h ) , 7.417.49 \n ( m , 1 h ) , 7.277.35 ( m , 2 h ) , 7.137.23 ( m , 3 h ) , 5.21 \n ( s , 2 h ) . synthesized by general procedure b. flash \n column chromatography : 1030% ethyl acetate in hexanes to yield 28 as a light red solid in 93% yield . h nmr ( 500 \n mhz , dmso - d6 ) 9.22 ( s , 1 h ) , 8.80 \n ( s , 1 h ) , 8.07 ( d , j = 2.4 hz , 1 h ) , 8.02 ( d , j = 5.9 hz , 1 h ) , 7.81 ( dd , j = 8.8 , 1.5 \n hz , 1 h ) , 7.737.78 ( m , 2 h ) , 7.48 ( d , j = \n 7.3 hz , 2 h ) , 7.40 ( t , j = 7.6 hz , 2 h ) , 7.33 ( t , j = 7.3 hz , 1 h ) , 7.21 ( d , j = 8.8 hz , \n 1 h ) , 7.15 ( d , j = 5.9 hz , 1 h ) , 5.18 ( s , 2 h ) . lcms \n found 439.2 [ m + h ] . synthesized by general procedure b. flash \n column chromatography : 1030% ethyl acetate in hexanes to yield 29 as a salmon colored solid in 91% yield . h nmr \n ( 500 mhz , dmso - d6 ) 9.27 ( s , 1 \n h ) , 8.45 ( d , j = 8.8 hz , 1 h ) , 8.08 ( dd , j = 12.0 , 2.2 hz , 2 h ) , 8.01 ( d , j = 5.4 \n hz , 1 h ) , 7.75 ( ddd , j = 13.8 , 9.2 , 2.4 hz , 2 h ) , \n 7.46 ( m , j = 5.9 hz , 1 h ) , 7.277.35 ( m , 2 \n h ) , 7.107.23 ( m , 3 h ) , 5.22 ( s , 2 h ) . synthesized by general procedure b. flash \n column chromatography : 1030% ethyl acetate in hexanes to yield 30 as a burnt orange solid in 81% yield . h nmr \n ( 500 mhz , dmso - d6 ) 9.24 ( s , 1 \n h ) , 8.45 ( d , j = 8.8 hz , 1 h ) , 8.10 ( d , j = 2.0 hz , 1 h ) , 8.05 ( d , j = 2.4 hz , 1 h ) , 8.01 \n ( d , j = 5.9 hz , 1 h ) , 7.76 ( dd , j = 9.0 , 2.2 hz , 1 h ) , 7.72 ( dd , j = 8.8 , 2.4 hz , \n 1 h ) , 7.48 ( d , j = 6.8 hz , 2 h ) , 7.41 ( t , j = 7.3 hz , 2 h ) , 7.34 ( t , j = 7.8 hz , \n 1 h ) , 7.21 ( d , j = 9.3 hz , 1 h ) , 7.13 ( d , j = 5.9 hz , 1 h ) , 5.19 ( s , 2 h ) . synthesized by general procedure c. flash \n column chromatography : 5% methanol in dichloromethane to yield an \n inseparable 10:1 mixture of 31 and dichloro side product \n as a vibrant yellow solid in 54% yield . h nmr ( 500 mhz , \n dmso - d6 ) 9.33 ( s , 1 h ) , 8.78 ( s , \n 1 h ) , 8.70 ( d , j = 1.5 hz , 1 h ) , 8.14 ( d , j = 8.8 hz , 1 h ) , 7.97 ( dd , j = 9.3 , 1.5 \n hz , 1 h ) , 7.54 ( d , j = 2.0 hz , 1 h ) , 7.48 ( td , j = 8.3 , 6.3 hz , 1 h ) , 7.40 ( dd , j = 8.8 , \n 2.4 hz , 1 h ) , 7.307.37 ( m , 3 h ) , 7.20 ( td , j = 9.3 , 2.0 hz , 1 h ) , 5.29 ( s , 2 h ) . synthesized by general procedure c. flash \n column chromatography : 5% methanol in dichloromethane to yield an \n inseparable 10:1 mixture of 32 and dichloro side product \n as a yellow solid in 68% yield . h nmr ( 500 mhz , dmso - d6 ) 9.32 ( s , 1 h ) , 8.78 ( s , 1 h ) , 8.71 \n ( d , j = 2.0 hz , 1 h ) , 8.14 ( d , j = 9.3 hz , 1 h ) , 7.97 ( dd , j = 9.0 , 1.7 hz , 1 h ) , \n 7.477.55 ( m , 3 h ) , 7.44 ( t , j = 7.6 hz , 2 \n h ) , 7.337.41 ( m , 3 h ) , 5.26 ( s , 2 h ) . synthesized by general procedure c. flash \n column chromatography : 5% methanol in dichloromethane to yield 33 as a brown solid in 55% yield with 84% purity . h nmr ( 500 mhz , dmso - d6 ) 9.43 \n ( s , 1 h ) , 8.76 ( s , 1 h ) , 8.41 ( d , j = 2.0 hz , 1 h ) , \n 8.35 ( d , j = 9.3 hz , 1 h ) , 7.90 ( dd , j = 9.0 , 2.2 hz , 1 h ) , 7.55 ( d , j = 2.4 hz , 1 h ) , \n 7.49 ( m , j = 6.3 hz , 1 h ) , 7.41 ( dd , j = 8.8 , 2.4 hz , 1 h ) , 7.317.37 ( m , 3 h ) , 7.20 ( td , j = 8.4 , 2.7 hz , 1 h ) , 5.29 ( s , 2 h ) . synthesized by general procedure c. flash \n column chromatography : 5% methanol in dichloromethane to yield 34 as a metallic bronze colored solid in 57% yield with 85% \n purity . h nmr ( 500 mhz , dmso - d6 ) 9.42 ( s , 1 h ) , 8.75 ( s , 1 h ) , 8.41 ( d , j = 2.0 hz , 1 h ) , 8.35 ( d , j = 8.8 hz , 1 h ) , 7.90 \n ( dd , j = 9.0 , 2.2 hz , 1 h ) , 7.54 ( d , j = 2.4 hz , 1 h ) , 7.51 ( d , j = 7.3 hz , 2 h ) , 7.43 \n ( t , j = 7.6 hz , 2 h ) , 7.40 ( dd , j = 8.8 , 2.4 hz , 1 h ) , 7.337.38 ( m , 2 h ) , 5.26 ( s , 2 h ) . synthesized by general procedure d. flash \n column chromatography : 520% ethyl acetate in dichloromethane \n to yield 35 as a yellow solid in 69% yield . h nmr ( 500 mhz , dmso - d6 ) 9.21 \n ( s , 1 h ) , 9.13 ( s , 1 h ) , 8.87 ( s , 1 h ) , 8.16 ( d , j = 2.4 hz , 1 h ) , 8.11 ( dd , j = 8.8 , 1.5 hz , 1 h ) , \n 7.99 ( d , j = 8.8 hz , 1 h ) , 7.81 ( dd , j = 8.8 , 2.4 hz , 1 h ) , 7.47 ( td , j = 7.9 , 6.1 hz , \n 1 h ) , 7.297.36 ( m , 2 h ) , 7.25 ( d , j = 9.3 \n hz , 1 h ) , 7.17 ( td , j = 8.7 , 2.2 hz , 1 h ) , 5.24 ( s , \n 2 h ) . synthesized by general procedure d. flash \n column chromatography : 520% ethyl acetate in dichloromethane \n to yield 36 as a light greenish brown solid in 78% yield . h nmr ( 500 mhz , dmso - d6 ) \n 9.20 ( s , 1 h ) , 9.14 ( s , 1 h ) , 8.88 ( s , 1 h ) , 8.15 ( d , j = 2.4 hz , 1 h ) , 8.13 ( dd , j = 8.5 , 1.7 hz , 1 h ) , \n 8.00 ( d , j = 8.8 hz , 1 h ) , 7.80 ( dd , j = 9.0 , 2.7 hz , 1 h ) , 7.50 ( d , j = 7.3 hz , 2 h ) , \n 7.42 ( t , j = 7.6 hz , 2 h ) , 7.35 ( t , j = 7.3 hz , 1 h ) , 7.27 ( d , j = 8.8 hz , 1 h ) , 5.21 \n ( s , 2 h ) . synthesized by general procedure d. flash \n column chromatography : 520% ethyl acetate in dichloromethane \n to yield 37 as a light brown solid in 64% yield . h nmr ( 500 mhz , dmso - d6 ) \n 9.42 ( s , 1 h ) , 9.09 ( s , 1 h ) , 8.62 ( d , j = 9.3 hz , \n 1 h ) , 8.33 ( d , j = 2.0 hz , 1 h ) , 8.19 ( d , j = 2.4 hz , 1 h ) , 8.16 ( dd , j = 9.0 , 2.2 \n hz , 1 h ) , 7.83 ( dd , j = 8.8 , 2.4 hz , 1 h ) , 7.47 ( td , j = 7.8 , 5.9 hz , 1 h ) , 7.32 ( m , j = 7.3 \n hz , 2 h ) , 7.25 ( d , j = 9.3 hz , 1 h ) , 7.17 ( td , j = 8.5 , 2.0 hz , 1 h ) , 5.24 ( s , 2 h ) . synthesized by general procedure d. flash \n column chromatography : 530% ethyl acetate in dichloromethane \n to yield 38 as a green - gray colored solid in 75% yield . h nmr ( 500 mhz , dmso - d6 ) \n 9.25 ( s , 1 h ) , 9.09 ( s , 1 h ) , 8.51 ( d , j = 8.8 hz , \n 1 h ) , 8.33 ( d , j = 2.0 hz , 1 h ) , 8.17 ( dd , j = 8.8 , 2.0 hz , 1 h ) , 8.14 ( d , j = 2.9 \n hz , 1 h ) , 7.78 ( dd , j = 9.0 , 2.7 hz , 1 h ) , 7.49 ( d , j = 6.8 hz , 2 h ) , 7.42 ( t , j = 7.6 hz , \n 2 h ) , 7.35 ( t , j = 7.3 hz , 1 h ) , 7.26 ( d , j = 8.8 hz , 1 h ) , 5.21 ( s , 2 h ) . synthesized by general procedure a , collected \n as a yellow solid in 80% yield . h nmr ( 400 mhz , dmso - d6 ) 9.03 ( s , 1h ) , 8.85 ( br , s , 1h ) , 8.23 \n ( d , j = 8.8 hz , 1h ) , 7.73 ( d , j = \n 8.8 , 1h ) , 7.59 ( d , j = 2.4 , 1h ) , 7.457.50 \n ( m , 1h ) , 7.307.39 ( m , 4h ) , 7.187.22 ( m , 1h ) , 5.30 \n ( s , 2h ) . synthesized by general procedure a , collected \n as a yellow solid in 52% yield . h nmr ( 500 mhz , dmso - d6 ) ppm 9.02 ( s , 1h ) , 8.82 ( br , s , 1h ) , \n 8.22 ( d , j = 9.0 hz , 1h ) , 7.72 ( d , j = 8.5 hz , 1h ) , 7.57 ( s , 1h ) , 7.5 ( d , j = 7.0 hz , \n 2h ) , 7.43 ( t , j = 7.5 hz , 2h ) , 7.35 ( m , 3h ) , 5.26 \n ( s , 2h ) . h nmr ( 400 mhz , dmso - d6 ) ppm \n 10.64 ( s , 1 h ) , 8.71 ( s , 1 h ) , 7.87 ( d , j = 2.9 hz , \n 1 h ) , 7.74 ( s , 1 h ) , 7.57 ( dd , j = 8.8 , 2.2 hz , 1 \n h ) , 7.47 ( m , 1 h ) , 7.31 ( m , 3 h ) , 7.19 ( td , j = 8.1 , \n 2.2 hz , 1 h ) , 5.28 ( s , 2 h ) . h nmr ( 500 mhz , dmso - d6 ) ppm \n 9.7 1 ( s , 1 h ) , 8.54 ( s , 1 h ) , 7.89 ( d , j = 2.0 hz , \n 1 h ) , 7.68 ( s , 1 h ) , 7.58 ( dd , j = 8.8 , 2.9 hz , 1 \n h ) , 7.49 ( d , j = 7.8 hz , 2 h ) , 7.42 ( t , j = 7.6 hz , 2 h ) , 7.35 ( t , j = 7.3 hz , 1 h ) , 7.26 \n ( d , j = 8.8 hz , 1 h ) , 5.23 ( s , 2 h ) . h nmr ( 500 mhz , dmso - d6 ) 9.80 ( s , 1h ) , 8.49 ( s , 1h ) , 8.12 \n ( s , 1h ) , 8.02 ( d , j = 2.4 hz , 1h ) , 7.67 ( dd , j = 2.7 , 9.03 hz , 1h ) , 7.437.49 ( m , 1h ) , 7.247.35 \n ( m , 3h ) , 7.18 ( dt , j = 2.4 , 8.6 hz , 1h ) , 5.24 ( s , \n 2h ) . h nmr ( 500 mhz , dmso - d6 ) ppm \n 9.94 ( s , 1 h ) , 8.49 ( s , 1 h ) , 8.19 ( s , 1 h ) , 8.02 ( d , j = 2.4 hz , 1 h ) , 7.68 ( dd , j = 8.8 , 2.4 hz , 1 h ) , \n 7.49 ( m , 2 h ) , 7.41 ( m , 2 h ) , 7.34 ( m , 1 h ) , 7.27 ( d , j = 9.3 hz , 1 h ) , 5.21 ( s , 2 h ) . lcms found 445.9 [ m + h ] . in a 25 \n ml microwave vial equipped with a stir bar were added aryl bromide \n ( 1 equiv ) , boronic ester ( 1.3 equiv ) , 1:1 water / ethanol ( 0.04 m ) , \n triethylamine ( 3 equiv ) , and palladium(ii ) acetate ( 0.01 m in acetone , \n 1 mol % ) . the vial was sealed with a septum , and the contents were \n irradiated to and held at 120 c with stirring for 1 h. the reaction \n mixture was cooled to room temperature , diluted with water ( 8 ml ) , \n and extracted with dichloromethane ( 3 8 ml ) . naoh ( 1 m , 2 5 ml ) , water ( 5 ml ) , \n and brine ( 5 ml ) . the crude product was \n purified by flash column chromatography . in a 25 \n ml microwave vial equipped with a stir bar were added aryl bromide \n ( 1 equiv ) , boronic ester ( 1.3 equiv ) , 1:1 water / ethanol ( 0.04 m ) , \n triethylamine ( 3 equiv ) , and bis(triphenylphosphine)palladium(ii ) \n chloride ( 2.5 mol % ) . the vial was sealed with a septum , and the contents \n were irradiated to and held at 120 c with stirring for 1 h. \n the reaction mixture was cooled to room temperature , diluted with \n water ( 8 ml ) , and extracted with dichloromethane ( 3 8 ml ) . \n naoh ( 1 m , 2 \n 5 ml ) , water ( 5 ml ) , and brine ( 5 ml ) . the organic layer was then \n dried over na2so4 and concentrated on to silica . \n the crude product was purified by flash column chromatography . in a 25 \n ml microwave vial equipped with a stir bar were added aryl bromide \n ( 1 equiv ) , boronic ester ( 1.3 equiv ) , 1:1 water / ethanol ( 0.04 m ) , \n triethylamine ( 3 equiv ) , and palladium(ii ) acetate ( 5 mol % ) . the \n vial was sealed with a septum , and the contents were irradiated to \n and held at 120 c with stirring for 3 h. the reaction mixture \n was cooled to room temperature , diluted with water ( 8 ml ) , and extracted \n with dichloromethane ( 3 8 ml ) . naoh ( 1 m , 2 5 ml ) , water ( 5 ml ) , and \n brine ( 5 ml ) . the crude product was \n purified by flash column chromatography . to a solution \n of the appropriate aryl iodide ( 1 equiv ) in 3:2 dimethoxyethane / ethanol \n ( 0.05 m ) 2 m na2co3 ( 6 equiv ) , and pd(pph3)4 ( 5 mol % ) . the mixture was purged with nitrogen and \n heated at 85 c for 7 h. the mixture was cooled to room temperature \n and filtered , and the filtrate was concentrated . the residue was dissolved \n in ethyl acetate , washed with water , washed with brine , dried over \n na2so4 , and purified by flash column chromatography . to a solution \n of the appropriate aryl bromide ( 1 equiv ) in 3:2 dimethoxyethane / ethanol \n ( 0.05 m ) 2 m na2co3 ( 6 equiv ) , and pd(pph3)4 ( 7 mol % ) . the mixture was heated at 85 c for \n 12 h , then cooled to room temperature , and the solvents were removed \n under reduced pressure . the residue was purified by silica column \n chromatography ( hexanes / ethyl acetate ) and then by reverse phase chromatography \n ( water / acetonitrile ) unless otherwise mentioned . synthesized by general procedure a. flash \n column chromatography : 25% methanol in dichloromethane , isolated \n as a yellow solid in 27% yield . h nmr ( 500 mhz , dmso - d6 ) ppm 9.10 ( br . s. , 1 h ) , 8.61 ( d , j = 2.0 hz , 1 h ) , 8.43 ( d , j = 5.4 hz , \n 1 h ) , 8.04 ( dd , j = 8.8 , 2.0 hz , 1 h ) , 7.92 ( d , j = 8.8 hz , 1 h ) , 7.457.52 ( m , 2 h ) , 7.39 ( t , j = 7.8 hz , 1 h ) , 7.297.37 ( m , 6 h ) , 7.20 ( td , j = 8.8 , 2.0 hz , 1 h ) , 7.00 ( dd , j = 8.1 , \n 1.7 hz , 1 h ) , 6.77 ( d , j = 5.4 hz , 1 h ) , 5.28 ( s , \n 2 h ) , 3.753.81 ( m , 4 h ) , 3.193.26 ( m , 4 h ) . lcms found \n 540.1 [ m + h ] . synthesized by general procedure a. flash \n column chromatography : 25% methanol in dichloromethane , isolated \n as a yellow solid in 24% yield . h nmr ( 500 mhz , dmso - d6 ) ppm 8.99 ( br . s. , 1 h ) , 8.47 ( d , j = 5.4 hz , 1 h ) , 8.41 ( d , j = 8.8 hz , \n 1 h ) , 8.12 ( d , j = 2.0 hz , 1 h ) , 7.88 ( dd , j = 8.8 , 1.5 hz , 1 h ) , 7.457.51 ( m , 2 h ) , 7.267.40 \n ( m , 7 h ) , 7.20 ( td , j = 8.8 , 2.4 hz , 1 h ) , 7.02 ( dd , j = 8.3 , 2.0 hz , 1 h ) , 6.76 ( d , j = 5.4 \n hz , 1 h ) , 5.27 ( s , 2 h ) , 3.743.82 ( m , 4 h ) , 3.203.27 \n ( m , 4 h ) . synthesized by general procedure a. flash \n column chromatography : 05% methanol in dichloromethane , isolated \n as a tan colored solid in 65% yield . h nmr ( 500 mhz , dmso - d6 ) ppm 9.14 ( s , 1 h ) , 8.78 ( d , j = 2.0 hz , 1 h ) , 8.47 ( d , j = 5.4 hz , \n 1 h ) , 8.17 ( d , j = 8.8 hz , 2 h ) , 8.11 ( dd , j = 8.8 , 2.0 hz , 1 h ) , 7.98 ( d , j = 8.8 \n hz , 1 h ) , 7.88 ( d , j = 8.3 hz , 2 h ) , 7.51 ( d , j = 7.3 hz , 2 h ) , 7.48 ( d , j = 1.5 hz , \n 1 h ) , 7.43 ( t , j = 7.6 hz , 2 h ) , 7.327.39 \n ( m , 3 h ) , 6.80 ( d , j = 5.4 hz , 1 h ) , 5.25 ( s , 2 h ) , \n 3.613.70 ( m , 4 h ) , 2.882.97 ( m , 4 h ) . synthesized by general procedure a. flash \n column chromatography : 25% methanol in dichloromethane , isolated \n as a tan colored solid in 63% yield . h nmr ( 500 mhz , dmso - d6 ) ppm 9.02 ( s , 1 h ) , 8.50 ( m , j = 5.4 hz , 2 h ) , 8.25 ( d , j = 1.5 hz , \n 1 h ) , 8.18 ( d , j = 8.8 hz , 2 h ) , 7.97 ( dd , j = 8.8 , 1.5 hz , 1 h ) , 7.87 ( d , j = 8.3 \n hz , 2 h ) , 7.51 ( d , j = 7.3 hz , 2 h ) , 7.47 ( d , j = 2.0 hz , 1 h ) , 7.44 ( t , j = 7.6 hz , \n 2 h ) , 7.36 ( m , j = 6.8 hz , 1 h ) , 7.307.34 \n ( m , 2 h ) , 6.79 ( d , j = 5.4 hz , 1 h ) , 5.24 ( s , 2 h ) , \n 3.623.70 ( m , 4 h ) , 2.902.97 ( m , 4 h ) . synthesized by general procedure a. flash \n column chromatography : 510% methanol in dichloromethane , isolated \n as a yellow solid in 40% yield . h nmr ( 500 mhz , dmso - d6 ) ppm 9.19 ( br . s. , 1 h ) , 8.78 ( d , j = 2.0 hz , 1 h ) , 8.47 ( d , j = 5.4 hz , \n 1 h ) , 8.16 ( d , j = 8.8 hz , 2 h ) , 8.12 ( dd , j = 8.8 , 2.0 hz , 1 h ) , 7.98 ( d , j = 8.8 \n hz , 1 h ) , 7.87 ( d , j = 8.8 hz , 2 h ) , 7.457.52 \n ( m , 2 h ) , 7.307.38 ( m , 4 h ) , 7.20 ( td , j = \n 8.7 , 2.7 hz , 1 h ) , 6.81 ( d , j = 5.4 hz , 1 h ) , 5.28 \n ( s , 2 h ) , 2.95 ( br . s. , 4 h ) , 2.352.43 ( m , 4 h ) , 2.15 ( s , \n 3 h ) . synthesized by general procedure a. flash \n column chromatography : 510% methanol in dichloromethane , isolated \n as a yellow solid in 33% yield . h nmr ( 500 mhz , dmso - d6 ) ppm 9.10 ( br . s. , 1 h ) , 8.50 ( d , j = 8.3 hz , 2 h ) , 8.25 ( d , j = 2.0 hz , \n 1 h ) , 8.16 ( d , j = 8.3 hz , 2 h ) , 7.97 ( dd , j = 8.8 , 2.0 hz , 1 h ) , 7.87 ( d , j = 8.3 \n hz , 2 h ) , 7.457.52 ( m , 2 h ) , 7.297.38 ( m , 4 h ) , 7.20 \n ( td , j = 8.5 , 2.0 hz , 1 h ) , 6.80 ( d , j = 5.4 hz , 1 h ) , 5.28 ( s , 2 h ) , 2.96 ( br . s. , 4 h ) , 2.40 ( br . then \n prep hplc : 595% acetonitrile in water , isolated as a yellow \n solid in 10% yield . h nmr ( 500 mhz , dmso - d6 ) ppm 8.77 ( d , j = 2.0 hz , 1 \n h ) , 8.46 ( d , j = 5.4 hz , 1 h ) , 8.27 ( s , 1 h ) , 8.078.15 \n ( m , 3 h ) , 7.97 ( d , j = 8.8 hz , 1 h ) , 7.92 ( d , j = 8.3 hz , 2 h ) , 7.457.52 ( m , 2 h ) , 7.307.38 \n ( m , 4 h ) , 7.20 ( td , j = 8.5 , 2.4 hz , 1 h ) , 6.80 ( d , j = 5.4 hz , 1 h ) , 5.28 ( s , 2 h ) , 3.36 ( m , j = 5.2 , 2.5 , 2.5 hz , 2 h ) , 3.33 ( t , j = 6.3 hz , \n 2 h ) , 2.532.57 ( m , 2 h ) , 2.47 ( m , j = 5.9 \n hz , 2 h ) , 2.22 ( s , 3 h ) , 1.74 ( quin , j = 5.9 hz , \n 2 h ) . synthesized by general procedure a. flash \n column chromatography : 520% methanol in dichloromethane , isolated \n as a brown solid in 32% yield . h nmr ( 500 mhz , dmso - d6 ) ppm 9.06 ( s , 1 h ) , 8.478.52 \n ( m , 2 h ) , 8.23 ( d , j = 2.0 hz , 1 h ) , 8.12 ( d , j = 8.3 hz , 2 h ) , 7.96 ( dd , j = 8.8 , 2.0 \n hz , 1 h ) , 7.91 ( d , j = 8.3 hz , 2 h ) , 7.457.52 \n ( m , 2 h ) , 7.297.37 ( m , 4 h ) , 7.20 ( td , j = \n 8.5 , 2.4 hz , 1 h ) , 6.79 ( d , j = 4.9 hz , 1 h ) , 5.27 \n ( s , 2 h ) , 3.39 ( m , j = 3.4 hz , 2 h ) , 3.313.35 \n ( m , 2 h ) , 2.63 ( br . s. , 2 h ) , 2.58 ( br . s. , 2 h ) , 2.29 ( br . s. , 3 \n h ) , 1.741.83 ( m , 2 h ) . synthesized by general procedure a. flash \n column chromatography : 3050% ethyl acetate in hexanes , isolated \n as a biege solid in 59% yield . h nmr ( 500 mhz , dmso - d6 ) ppm 9.27 ( s , 1 h ) , 8.71 ( s , 1 h ) , \n 8.06 ( d , j = 2.4 hz , 1 h ) , 8.03 ( dd , j = 8.3 , 1.5 hz , 1 h ) , 7.98 ( d , j = 5.4 hz , 1 h ) , \n 7.88 ( d , j = 8.8 hz , 1 h ) , 7.76 ( dd , j = 8.8 , 2.4 hz , 1 h ) , 7.47 ( td , j = 8.1 , 6.3 hz , \n 1 h ) , 7.40 ( t , j = 7.8 hz , 1 h ) , 7.297.36 \n ( m , 4 h ) , 7.23 ( d , j = 9.3 hz , 1 h ) , 7.157.21 \n ( m , 2 h ) , 7.02 ( dd , j = 8.3 , 2.0 hz , 1 h ) , 5.23 ( s , \n 2 h ) , 3.753.82 ( m , 4 h ) , 3.203.26 ( m , 4 h ) . synthesized by general procedure a. flash \n column chromatography : 3050% ethyl acetate in hexanes , isolated \n as an orange solid in 81% yield . h nmr ( 500 mhz , dmso - d6 ) ppm 9.21 ( s , 1 h ) , 8.56 ( d , j = 8.8 hz , 1 h ) , 8.13 ( d , j = 2.4 hz , \n 1 h ) , 8.11 ( d , j = 2.0 hz , 1 h ) , 8.00 ( d , j = 5.4 hz , 1 h ) , 7.94 ( dd , j = 8.8 , 1.5 \n hz , 1 h ) , 7.78 ( dd , j = 8.8 , 2.4 hz , 1 h ) , 7.47 ( td , j = 8.0 , 6.3 hz , 1 h ) , 7.357.41 ( m , 2 h ) , 7.307.35 \n ( m , 2 h ) , 7.28 ( d , j = 7.8 hz , 1 h ) , 7.207.25 \n ( m , 2 h ) , 7.18 ( td , j = 8.8 , 2.4 hz , 1 h ) , 7.03 ( dd , j = 8.1 , 2.2 hz , 1 h ) , 5.23 ( s , 2 h ) , 3.763.81 ( m , \n 4 h ) , 3.213.25 ( m , 4 h ) . lcms found 540.2 [ m + h ] . synthesized by general procedure a. flash \n column chromatography : 2050% ethyl acetate in hexanes , isolated \n as an orange solid in 55% yield . h nmr ( 500 mhz , dmso - d6 ) ppm 9.35 ( s , 1 h ) , 8.86 ( s , 1 h ) , \n 8.18 ( d , j = 8.8 hz , 2 h ) , 8.12 ( dd , j = 8.8 , 1.5 hz , 1 h ) , 8.04 ( d , j = 2.4 hz , 1 h ) , \n 8.03 ( d , j = 5.9 hz , 1 h ) , 7.96 ( d , j = 8.3 hz , 1 h ) , 7.90 ( d , j = 8.3 hz , 2 h ) , 7.76 \n ( dd , j = 9.3 , 2.9 hz , 1 h ) , 7.50 ( d , j = 6.8 hz , 2 h ) , 7.42 ( t , j = 7.3 hz , 2 h ) , 7.35 \n ( t , j = 7.3 hz , 1 h ) , 7.25 ( d , j = 9.3 hz , 1 h ) , 7.22 ( d , j = 5.9 hz , 1 h ) , 5.21 \n ( s , 2 h ) , 3.633.70 ( m , 4 h ) , 2.902.96 ( m , 4 h ) . synthesized by general procedure a. flash \n column chromatography : 3050% ethyl acetate in hexanes , isolated \n as an orange solid in 81% yield . h nmr ( 500 mhz , dmso - d6 ) ppm 9.26 ( s , 1 h ) , 8.65 ( d , j = 9.3 hz , 1 h ) , 8.25 ( d , j = 1.5 hz , \n 1 h ) , 8.16 ( d , j = 8.8 hz , 2 h ) , 8.12 ( d , j = 2.9 hz , 1 h ) , 8.018.07 ( m , 2 h ) , 7.88 ( d , j = 8.3 hz , 2 h ) , 7.78 ( dd , j = 9.0 , 2.7 \n hz , 1 h ) , 7.50 ( d , j = 6.8 hz , 2 h ) , 7.42 ( t , j = 7.3 hz , 2 h ) , 7.35 ( t , j = 7.3 hz , \n 1 h ) , 7.27 ( d , j = 5.9 hz , 1 h ) , 7.23 ( d , j = 9.3 hz , 1 h ) , 5.20 ( s , 1 h ) , 3.623.69 ( m , 4 \n h ) , 2.892.97 ( m , 4 h ) . synthesized by general procedure a. flash \n column chromatography : ethyl acetate , isolated as a cream colored \n solid in 53% yield . h nmr ( 500 mhz , cdcl3 ) \n ppm 8.118.14 ( m , 2 h ) , 7.797.89 ( m , 7 h ) , \n 7.54 ( dd , j = 8.8 , 2.4 hz , 1 h ) , 7.36 ( td , j = 7.8 , 5.9 hz , 1 h ) , 7.28 ( s , 1 h ) , 7.217.27 ( m , \n 2 h ) , 7.18 ( d , j = 5.9 hz , 1 h ) , 7.03 ( td , j = 8.3 , 2.4 hz , 1 h ) , 6.97 ( d , j = 8.8 \n hz , 1 h ) , 5.15 ( s , 2 h ) , 3.08 ( br . s. , 4 h ) , 2.49 ( t , j = 4.6 hz , 4 h ) , 2.28 ( s , 3 h ) . synthesized by general procedure a. flash \n column chromatography : ethyl acetate , isolated as a pale orange solid \n in 52% yield . h nmr ( 500 mhz , cdcl3 ) \n ppm 8.14 ( d , j = 5.9 hz , 1 h ) , 8.02 ( d , j = 8.8 hz , 1 h ) , 7.95 ( d , j = 2.0 hz , 1 h ) , 7.837.91 \n ( m , 5 h ) , 7.76 ( dd , j = 8.5 , 1.7 hz , 1 h ) , 7.50 ( dd , j = 8.8 , 2.4 hz , 1 h ) , 7.37 ( td , j = 7.8 , \n 5.9 hz , 1 h ) , 7.227.27 ( m , 2 h ) , 7.21 ( d , j = 5.9 hz , 1 h ) , 7.007.07 ( m , 2 h ) , 6.98 ( d , j = 8.8 hz , 1 h ) , 5.16 ( s , 2 h ) , 3.11 ( br . s. , 4 h ) , 2.52 ( t , j = 4.6 hz , 4 h ) , 2.29 ( s , 3 h ) . synthesized by general procedure a. flash \n column chromatography : 5% methanol in dichloromethane , isolated as \n an orange solid in 73% yield . h nmr ( 500 mhz , dmso - d6 ) ppm 9.36 ( s , 1 h ) , 8.85 ( s , 1 h ) , \n 8.098.14 ( m , 3 h ) , 8.05 ( d , j = 2.4 hz , 1 \n h ) , 8.02 ( d , j = 5.9 hz , 1 h ) , 7.917.97 ( m , \n 3 h ) , 7.77 ( dd , j = 8.8 , 2.9 hz , 1 h ) , 7.47 ( td , j = 8.1 , 6.3 hz , 1 h ) , 7.297.36 ( m , 2 h ) , 7.24 ( d , j = 9.3 hz , 1 h ) , 7.22 ( d , j = 5.4 hz , \n 1 h ) , 7.18 ( td , j = 9.3 , 2.0 hz , 1 h ) , 5.24 ( s , 2 \n h ) , 3.353.38 ( m , 2 h ) , 3.313.35 ( m , 2 h ) , 2.542.58 \n ( m , 2 h ) , 2.472.49 ( m , 2 h ) , 2.23 ( s , 3 h ) , 1.75 ( quin , j = 5.8 hz , 2 h ) . synthesized by general procedure a. flash \n column chromatography : 5% methanol in dichloromethane , isolated as \n a pale yellow solid in 68% yield . h nmr ( 500 mhz , dmso - d6 ) ppm 9.26 ( s , 1 h ) , 8.64 ( d , j = 8.8 hz , 1 h ) , 8.23 ( d , j = 1.5 hz , \n 1 h ) , 8.13 ( d , j = 2.4 hz , 1 h ) , 8.10 ( d , j = 8.3 hz , 2 h ) , 8.008.06 ( m , 2 h ) , 7.92 ( d , j = 8.3 hz , 2 h ) , 7.79 ( dd , j = 9.0 , 2.7 \n hz , 1 h ) , 7.47 ( td , j = 8.3 , 6.3 hz , 1 h ) , 7.297.35 \n ( m , 2 h ) , 7.27 ( d , j = 5.9 hz , 1 h ) , 7.22 ( d , j = 9.3 hz , 1 h ) , 7.18 ( td , j = 8.7 , 2.7 \n hz , 1 h ) , 5.23 ( s , 2 h ) , 3.36 ( m , j = 4.9 , 2.4 , 2.4 \n hz , 2 h ) , 3.313.35 ( m , 2 h ) , 2.532.58 ( m , 2 h ) , 2.462.49 \n ( m , 2 h ) , 2.23 ( s , 3 h ) , 1.75 ( quin , j = 5.8 hz , \n 2 h ) . synthesized by general procedure b. flash \n column chromatography : 210% methanol in dichloromethane , isolated \n as a yellow solid in 67% yield . s. , 1 h ) , 8.30 ( s , 1 h ) , 8.26 ( d , j = 4.9 hz , 1 h ) , 7.95 ( dd , j = 9.0 , 1.2 \n hz , 1 h ) , 7.487.59 ( m , 1 h ) , 7.327.41 ( m , 2 h ) , 7.29 \n ( t , j = 7.8 hz , 1 h ) , 7.177.24 ( m , 2 h ) , \n 7.087.17 ( m , 3 h ) , 7.02 ( td , j = 8.4 , 2.2 \n hz , 1 h ) , 6.876.94 ( m , 2 h ) , 5.13 ( s , 2 h ) , 3.763.82 \n ( m , 4 h ) , 3.093.16 ( m , 4 h ) . synthesized by general procedure b. flash \n column chromatography : 28% methanol in dichloromethane , then \n 50100% ethyl acetate in hexanes , isolated as a yellow solid \n in 38% yield . s. , 1 h ) , 8.31 ( d , j = 8.8 hz , 1 h ) , 7.96 ( d , j = 8.8 hz , \n 1 h ) , 7.387.50 ( m , 3 h ) , 7.237.35 ( m , 5 h ) , 7.15 ( d , j = 8.8 hz , 1 h ) , 7.06 ( m , j = 8.3 , 2.0 \n hz , 2 h ) , 5.24 ( s , 2 h ) , 3.903.96 ( m , 4 h ) , 3.273.32 \n ( m , 4 h ) . synthesized by general procedure a. flash \n column chromatography : 2% methanol and 18% acetone in dichloromethane , \n then 1% methanol in ethyl acetate , isolated as a yellow solid in 8% \n yield . s. , 2 h ) , 8.098.40 \n ( m , 4 h ) , 7.91 ( d , j = 7.8 hz , 2 h ) , 7.487.60 \n ( m , 3 h ) , 7.44 ( t , j = 7.6 hz , 3 h ) , 7.37 ( t , j = 7.3 hz , 2 h ) , 5.26 ( s , 2 h ) , 3.613.70 ( m , 4 \n h ) , 2.872.99 ( m , 4 h ) . synthesized by general procedure b. flash \n column chromatography : 28% methanol in dichloromethane , then \n 10100% ethyl acetate in dichloromethane , isolated as a yellow \n solid in 71% yield . s. , 1 h ) , 8.40 \n ( d , j = 8.8 hz , 1 h ) , 8.05 ( d , j = 8.3 hz , 2 h ) , 8.01 ( d , j = 8.8 hz , 1 h ) , 7.95 \n ( d , j = 8.3 hz , 2 h ) , 7.52 ( d , j = 7.3 hz , 2 h ) , 7.48 ( br . s. , 1 h ) , 7.43 ( t , j = \n 7.6 hz , 2 h ) , 7.36 ( t , j = 7.3 hz , 1 h ) , 7.30 ( d , j = 8.8 hz , 1 h ) , 7.17 ( d , j = 8.8 hz , \n 1 h ) , 5.25 ( s , 2 h ) , 3.773.82 ( m , 4 h ) , 3.073.12 ( m , \n 4 h ) . synthesized by general procedure a. flash \n column chromatography : 510% methanol in dichloromethane , then \n 1030% methanol in ethyl acetate , isolated as a yellow solid \n in 15% yield . h nmr ( 500 mhz , dmso - d6 ) 9.81 ( s , 1 h ) , 9.01 ( s , 1 h ) , 8.82 ( s , 1 h ) , 8.218.34 \n ( m , 4 h ) , 7.88 ( d , j = 8.3 hz , 2 h ) , 7.61 ( d , j = 2.0 hz , 1 h ) , 7.437.53 ( m , 2 h ) , 7.297.40 \n ( m , 3 h ) , 7.20 ( t , j = 8.8 hz , 1 h ) , 5.29 ( s , 2 h ) , \n 2.95 ( br . synthesized by general procedure b. flash \n column chromatography : 510% methanol in dichloromethane , isolated \n as a yellow solid in 50% yield . s. , \n 1 h ) , 8.39 ( d , j = 8.8 hz , 1 h ) , 7.938.04 \n ( m , 5 h ) , 7.48 ( br . s. , 1 h ) , 7.42 ( td , j = 8.1 , \n 5.9 hz , 1 h ) , 7.31 ( d , j = 7.8 hz , 2 h ) , 7.26 ( d , j = 9.8 hz , 1 h ) , 7.16 ( d , j = 8.8 hz , \n 1 h ) , 7.06 ( td , j = 8.5 , 2.0 hz , 1 h ) , 5.25 ( s , 2 \n h ) , 3.483.52 ( m , 2 h ) , 3.46 ( t , j = 6.3 hz , \n 2 h ) , 2.732.77 ( m , 2 h ) , 2.692.73 ( m , 2 h ) , 2.40 ( s , \n 3 h ) , 1.95 ( dt , j = 11.4 , 5.8 hz , 2 h ) . lcms found \n 618.1 [ m + h ] . synthesized by general procedure b. flash \n column chromatography : 210% methanol in dichloromethane , isolated \n as a yellow solid in 61% yield s. , 1 h ) , 8.62 ( s , 1 \n h ) , 8.31 ( br . s. , 1 h ) , 8.14 ( d , j = 8.8 hz , 1 h ) , \n 8.02 ( d , j = 8.3 hz , 2 h ) , 7.94 ( d , j = 8.8 hz , 2 h ) , 7.48 ( br . s. , 1 h ) , 7.387.45 ( m , 2 h ) , 7.237.33 \n ( m , 3 h ) , 7.16 ( d , j = 8.8 hz , 1 h ) , 7.06 ( td , j = 8.4 , 2.2 hz , 1 h ) , 5.25 ( s , 2 h ) , 3.473.50 ( m , \n 2 h ) , 3.45 ( t , j = 6.6 hz , 2 h ) , 2.702.74 \n ( m , 2 h ) , 2.662.70 ( m , 2 h ) , 2.38 ( s , 3 h ) , 1.891.96 \n ( m , 2 h ) . synthesized by general procedure b. flash \n column chromatography : 515% methanol in dichloromethane , isolated \n as a yellow solid in 52% yield . s. , \n 1 h ) , 8.39 ( d , j = 8.8 hz , 1 h ) , 7.938.04 \n ( m , 5 h ) , 7.48 ( br . s. , 1 h ) , 7.42 ( td , j = 8.1 , \n 5.9 hz , 1 h ) , 7.31 ( d , j = 7.8 hz , 2 h ) , 7.26 ( d , j = 9.8 hz , 1 h ) , 7.16 ( d , j = 8.8 hz , \n 1 h ) , 7.06 ( td , j = 8.5 , 2.0 hz , 1 h ) , 5.25 ( s , 2 \n h ) , 3.483.52 ( m , 2 h ) , 3.46 ( t , j = 6.3 hz , \n 2 h ) , 2.732.77 ( m , 2 h ) , 2.692.73 ( m , 2 h ) , 2.40 ( s , \n 3 h ) , 1.95 ( dt , j = 11.4 , 5.8 hz , 2 h ) . lcms found \n 632.1 [ m + h ] . synthesized by general procedure c. flash \n column chromatography : 4080% ethyl acetate in hexanes , then \n prep hplc 3050% acetonitrile in water , isolated as a yellow \n solid in 9% yield . h nmr ( 500 mhz , dmso - d6 ) 9.27 ( s , 1 h ) , 9.14 ( s , 1 h ) , 8.78 ( s , 1 h ) , \n 8.27 ( dd , j = 8.3 , 1.5 hz , 1 h ) , 8.16 ( d , j = 2.4 hz , 1 h ) , 8.09 ( d , j = 8.3 hz , \n 1 h ) , 7.82 ( dd , j = 9.0 , 2.7 hz , 1 h ) , 7.407.50 \n ( m , 2 h ) , 7.39 ( s , 1 h ) , 7.307.36 ( m , 3 h ) , 7.27 ( d , j = 8.8 hz , 1 h ) , 7.18 ( td , j = 8.7 , 2.2 \n hz , 1 h ) , 7.07 ( dd , j = 8.3 , 2.0 hz , 1 h ) , 5.25 ( s , \n 2 h ) , 3.763.82 ( m , 4 h ) , 3.223.27 ( m , 4 h ) . synthesized by general procedure c. flash \n column chromatography : 4080% ethyl acetate in hexanes , then \n prep hplc 3050% acetonitrile in water , isolated as a pale \n yellow solid in 14% yield . h nmr ( 500 mhz , dmso - d6 ) 9.24 ( s , 1 h ) , 9.16 ( s , 1 h ) , 8.62 \n ( d , j = 8.3 hz , 1 h ) , 8.308.36 ( m , 2 h ) , \n 8.21 ( d , j = 2.4 hz , 1 h ) , 7.84 ( dd , j = 9.0 , 2.7 hz , 1 h ) , 7.47 ( td , j = 7.8 , 5.9 hz , \n 1 h ) , 7.387.43 ( m , 2 h ) , 7.297.36 ( m , 3 h ) , 7.26 ( d , j = 9.3 hz , 1 h ) , 7.18 ( td , j = 8.7 , 2.2 \n hz , 1 h ) , 7.06 ( dd , j = 8.3 , 2.0 hz , 1 h ) , 5.25 ( s , \n 2 h ) , 3.753.83 ( m , 4 h ) , 3.213.28 ( m , 4 h ) . synthesized by general procedure c. flash \n column chromatography : 50100% ethyl acetate in hexanes , then \n prep hplc 3050% acetonitrile in water , isolated as a yellow \n solid in 9% yield . h nmr ( 500 mhz , dmso - d6 ) 9.36 ( s , 1 h ) , 9.18 ( s , 1 h ) , 8.93 ( s , 1 h ) , \n 8.36 ( dd , j = 8.3 , 1.5 hz , 1 h ) , 8.20 ( d , j = 8.3 hz , 2 h ) , 8.17 ( d , j = 8.3 hz , \n 1 h ) , 8.15 ( d , j = 2.9 hz , 1 h ) , 7.94 ( d , j = 8.3 hz , 2 h ) , 7.82 ( dd , j = 9.0 , 2.7 \n hz , 1 h ) , 7.50 ( d , j = 7.3 hz , 2 h ) , 7.42 ( t , j = 7.6 hz , 2 h ) , 7.35 ( t , j = 7.3 hz , \n 1 h ) , 7.30 ( d , j = 9.3 hz , 1 h ) , 5.22 ( s , 2 h ) , 3.633.69 \n ( m , 4 h ) , 2.902.98 ( m , 4 h ) . synthesized by general procedure c. flash \n column chromatography : 5100% ethyl acetate in hexanes , then \n prep hplc 3050% acetonitrile in water , isolated as a yellow \n solid in 23% yield . h nmr ( 500 mhz , dmso - d6 ) 9.28 ( s , 1 h ) , 9.19 ( s , 1 h ) , 8.70 ( d , j = 8.8 hz , 1 h ) , 8.45 ( d , j = 2.0 hz , \n 1 h ) , 8.41 ( dd , j = 8.5 , 1.7 hz , 1 h ) , 8.20 ( d , j = 2.4 hz , 1 h ) , 8.18 ( d , j = 8.3 hz , \n 2 h ) , 7.91 ( d , j = 8.3 hz , 2 h ) , 7.83 ( dd , j = 8.8 , 2.4 hz , 1 h ) , 7.50 ( d , j = 6.8 \n hz , 2 h ) , 7.42 ( t , j = 7.3 hz , 2 h ) , 7.35 ( t , j = 6.8 hz , 1 h ) , 7.27 ( d , j = 8.8 hz , \n 1 h ) , 5.21 ( s , 2 h ) , 3.633.69 ( m , 4 h ) , 2.912.97 ( m , \n 4 h ) . synthesized by general procedure \n b. flash column chromatography : 37% methanol in dichloromethane , \n then prep hplc 595% acetonitrile in water , isolated as an \n orange solid in 39% yield . s. , 1 h ) , 9.18 ( s , 1 h ) , \n 8.91 ( s , 1 h ) , 8.35 ( d , j = 7.3 hz , 1 h ) , 8.128.21 \n ( m , 6 h ) , 7.93 ( d , j = 8.3 hz , 2 h ) , 7.83 ( d , j = 6.8 hz , 1 h ) , 7.47 ( td , j = 8.3 , 6.3 \n hz , 1 h ) , 7.307.36 ( m , 2 h ) , 7.28 ( d , j = \n 8.8 hz , 1 h ) , 7.18 ( td , j = 8.7 , 2.2 hz , 1 h ) , 5.25 \n ( s , 2 h ) , 2.96 ( br . s. , 4 h ) , 2.352.43 ( m , 4 h ) , 2.15 ( s , \n 3 h ) . synthesized by general procedure \n b. flash column chromatography : 310% methanol in dichloromethane , \n then prep hplc 595% acetonitrile in water , isolated as a dull \n yellow solid in 28% yield . h nmr ( 500 mhz , dmso - d6 ) 9.28 ( s , 1 h ) , 9.20 ( s , 1 h ) , 8.70 \n ( d , j = 8.3 hz , 1 h ) , 8.47 ( d , j = 2.0 hz , 1 h ) , 8.42 ( dd , j = 8.5 , 1.7 hz , 1 h ) , \n 8.21 ( d , j = 2.9 hz , 1 h ) , 8.168.20 ( m , 3 \n h ) , 7.91 ( d , j = 8.3 hz , 2 h ) , 7.84 ( dd , j = 9.0 , 2.7 hz , 1 h ) , 7.48 ( td , j = 8.3 , \n 6.3 hz , 1 h ) , 7.307.36 ( m , 2 h ) , 7.27 ( d , j = 9.3 hz , 1 h ) , 7.18 ( td , j = 8.7 , 2.7 hz , 1 h ) , \n 5.25 ( s , 2 h ) , 2.96 ( br . s. , 4 h ) , 2.39 ( t , j = 4.6 \n hz , 4 h ) , 2.15 ( s , 3 h ) . synthesized by general procedure \n b. flash column chromatography : 510% methanol in dichloromethane , \n then prep hplc 595% acetonitrile in water , isolated as an \n orange solid in 29% yield . h nmr ( 500 mhz , meoh - d4 ) 8.94 ( s , 1 h ) , 8.73 ( s , 1 h ) , 8.25 \n ( s , 2 h ) , 8.20 ( dd , j = 8.5 , 1.2 hz , 1 h ) , 8.008.06 \n ( m , 3 h ) , 7.95 ( d , j = 8.3 hz , 2 h ) , 7.88 ( d , j = 2.4 hz , 1 h ) , 7.59 ( dd , j = 8.8 , 2.4 \n hz , 1 h ) , 7.38 ( td , j = 8.1 , 5.9 hz , 1 h ) , 7.28 ( d , j = 7.8 hz , 1 h ) , 7.23 ( d , j = 9.8 hz , \n 1 h ) , 6.997.06 ( m , 2 h ) , 5.18 ( s , 2 h ) , 3.603.66 ( m , \n 2 h ) , 3.47 ( t , j = 6.6 hz , 2 h ) , 3.223.28 \n ( m , 4 h ) , 2.77 ( s , 3 h ) , 2.142.21 ( m , 2 h ) . synthesized by general procedure \n b. flash column chromatography : 515% methanol in dichloromethane , \n then prep hplc 595% acetonitrile in water , isolated as a light \n yellow solid in 29% yield . h nmr ( 500 mhz , meoh - d4 ) 8.99 ( s , 1 h ) , 8.51 ( d , j = 8.3 hz , 1 h ) , 8.25 ( s , 1 h ) , 8.178.22 ( m , 2 h ) , 7.97 ( s , \n 4 h ) , 7.91 ( d , j = 2.9 hz , 1 h ) , 7.587.63 \n ( m , 1 h ) , 7.39 ( td , j = 7.8 , 5.9 hz , 1 h ) , 7.29 ( d , j = 7.8 hz , 1 h ) , 7.24 ( d , j = 9.3 hz , \n 1 h ) , 7.007.08 ( m , 2 h ) , 5.20 ( s , 2 h ) , 3.543.59 ( m , \n 2 h ) , 3.47 ( t , j = 6.6 hz , 2 h ) , 2.973.04 \n ( m , 4 h ) , 2.60 ( s , 3 h ) , 2.06 ( quin , j = 6.3 hz , \n 2 h ) . synthesized by general procedure d. flash \n column chromatography : 030% methanol in dichloromethane , isolated \n as a yellow solid in 20% yield . h nmr ( 400 mhz , dmso - d6 ) 9.91 ( br , s , 1h ) , 8.73 ( s , 1h ) , 8.55 \n ( s , 1h ) , 8.18 ( d , j = 8.8 hz , 1h ) , 7.98 ( d , j = 8.8 hz , 1h ) , 7.55 ( d , j = 2.4 hz , 1h ) , \n 7.457.50 ( m , 1h ) , 7.377.41 ( m , 1h ) , 7.307.35 \n ( m , 6h ) , 7.177.22 ( m , 1h ) , 7.02 ( d , j = 8.0 \n hz , 1h ) , 5.29 ( s , 2h ) , 3.763.79 ( m , 4h ) , 3.203.23 \n ( m , 4h ) . lcms found 565.0 [ m + h ] . synthesized by general procedure d. flash \n column chromatography : 020% ethyl acetate in hexanes , isolated \n as a yellow solid in 50% yield . h nmr ( 400 mhz , dmso - d6 ) 9.99 ( s , 1h ) , 8.87 ( s , 1h ) , 8.55 \n ( s , 1h ) , 8.24 ( d , j = 8.8 hz , 1h ) , 8.14 ( d , j = 8.0 hz , 2h ) , 8.01 ( d , j = 8.8 , 1h ) , \n 7.85 ( d , j = 8.4 hz , 2h ) , 7.467.51 ( m , 3h ) , \n 7.39 ( t , j = 7.2 hz , 2h ) , 7.297.34 ( m , 3h ) , \n 5.22 ( s , 2h ) , 3.603.63 ( m , 4h ) , 2.872.89 ( m , 4h ) . \n lcms found 611.1 [ m + h ] . synthesized by general procedure d. flash \n column chromatography : 030% methanol in dichloromethane , isolated \n as a yellow solid in 16% yield . h nmr ( 400 mhz , dmso - d6 ) 10.01 ( br , s , 1h ) , 8.89 ( s , 1h ) , \n 8.59 ( s , 1h ) , 8.27 ( d , j = 8.8 hz , 1h ) , 8.16 ( d , j = 8.0 hz , 2h ) , 8.05 ( d , j = 8.8 hz , 1h ) , \n 7.88 ( d , j = 8.0 hz , 2h ) , 7.55 ( br , s , 1h ) , 7.457.70 \n ( m , 1h ) , 7.317.35 ( m 4h ) , 7.177.21 ( m , 1h ) , 5.30 ( s , \n 2h ) , 2.95 ( br , s , 4h ) , 2.38 ( br , 4h ) , 2.14 ( s , 3h ) . synthesized by general procedure d. flash \n column chromatography : 030% methanol in dichloromethane , isolated \n as a yellow solid in 32% yield . h nmr ( 400 mhz , cdcl3 ) 8.71 ( s , 1h ) , 8.14 ( d , j = 8.8 \n hz , 1h ) , 8.08 ( d , j = 2.4 hz , 1h ) , 7.99 ( dd , j = 8.8 , 2.2 hz , 1h ) , 7.807.82 ( m , 2h ) , 7.66 ( d , j = 8.8 hz , 2h ) , 7.47 ( s , 1h ) , 7.41 ( d , j = 2 hz , 1h ) , 7.367.39 ( m , 1h ) , 7.23 ( s , 1h ) , 7.197.20 \n ( m , 1h ) , 7.17 ( d , j = 2 hz , 1h ) , 7.05 ( dd , j = 8.0,2.4 hz , 1h ) , 7.01 ( d , j = 8.8 hz , \n 1h ) , 5.19 ( s , 2h ) , 3.363.40 ( m , 4h ) , 2.562.62 ( m , \n 4h ) , 2.33 ( s , 3h ) , 1.811.85 ( m , 2h ) . synthesized \n by general procedure e , isolated as a yellow solid in 12% yield . h nmr ( 500 mhz , dmso - d6 ) \n ppm 9.68 ( s , 1 h ) , 8.59 ( s , 1 h ) , 8.01 ( d , j = 2.4 \n hz , 1 h ) , 7.94 ( s , 1 h ) , 7.67 ( dd , j = 8.8 , 2.4 hz , \n 1 h ) , 7.47 ( m , 1 h ) , 7.40 ( m , 1 h ) , 7.37 ( d , j = \n 7.8 hz , 1 h ) , 7.32 ( m , 2 h ) , 7.25 ( m , 2 h ) , 7.18 ( td , j = 9.3 , 2.4 hz , 1 h ) , 7.08 ( dd , j = 7.8 , 2.4 hz , \n 1 h ) , 5.25 ( s , 2 h ) , 3.78 ( m , 4 h ) , 3.23 ( m , 4 h ) , lcms found 547.0 , \n [ m + h ] . h nmr ( 500 mhz , dmso - d6 ) 9.64 ( s , 1h ) , 8.49 ( s , 1h ) , 8.18 \n ( s , 1h ) , 8.05 ( d , j = 2.93 hz , 1h ) , 7.71 ( dd , j = 2.44 , 8.79 hz , 1h ) , 7.447.50 ( m , 1h ) , 7.137.41 \n ( m , 7h ) , 7.04 ( dd , j = 1.95 , 8.30 hz , 1h ) , 5.25 ( s , \n 2h ) , 3.78 ( t , j = 4.7 hz , 4h ) , 3.21 ( t , j = 4.7 hz , 4h ) . synthesized \n by general procedure e , isolated as a yellow solid in 8% yield . h nmr ( 400 mhz , dmso - d6 ) \n ppm 8.61 ( s , 1 h ) , 9.83 ( s , 1 h ) , 8.15 ( m , 3 h ) , 7.98 ( s , 1 h ) , 7.88 \n ( d , j = 8.8 hz , 2 h ) , 7.65 ( m , 1 h ) , 7.49 ( m , 2 h ) , \n 7.42 ( t , j = 7.3 hz , 2 h ) , 7.35 ( m , 1 h ) , 7.27 ( d , j = 8.8 hz , 1 h ) , 5.23 ( s , 2 h ) , 3.65 ( m , 4 h ) , 2.94 ( m , \n 4 h ) . synthesized \n by general procedure e , isolated as a yellow solid in 40% yield . h nmr ( 500 mhz , dmso - d6 ) \n ppm 9.79 ( s , 1 h ) , 8.52 ( s , 1 h ) , 8.41 ( s , 1 h ) , 8.03 ( d , j = 2.0 hz , 1 h ) , 7.97 ( d , j = 8.3 hz , \n 2 h ) , 7.88 ( d , j = 8.3 hz , 2 h ) , 7.68 ( dd , j = 8.8 , 2.4 hz , 1 h ) , 7.49 ( d , j = 7.8 \n hz , 2 h ) , 7.42 ( t , j = 7.6 hz , 2 h ) , 7.35 ( t , j = 7.3 hz , 1 h ) , 7.29 ( d , j = 9.3 hz , \n 1 h ) , 5.22 ( s , 2 h ) , 3.65 ( m , 4 h ) , 2.94 ( m , 4 h ) . synthesized \n by general procedure e , isolated as a yellow solid in 36% yield . h nmr ( 400 mhz , dmso - d6 ) \n ppm 9.84 ( s , 1 h ) , 8.62 ( s , 1 h ) , 8.14 ( m , 3 h ) , 7.99 ( d , j = 2.2 hz , 1 h ) , 7.87 ( d , j = 8.8 hz , \n 2 h ) , 7.66 ( dd , j = 9.2 , 2.6 hz , 1 h ) , 7.47 ( m , 1 \n h ) , 7.32 ( m , 2 h ) , 7.26 ( d , j = 8.8 hz , 1 h ) , 7.19 \n ( td , j = 8.8 , 2.2 hz , 1 h ) , 5.26 ( s , 2 h ) , 2.95 ( m , \n 4 h ) , 2.38 ( m , 4 h ) , 2.14 ( s , 3 h ) . synthesized \n by general procedure e , isolated as a yellow solid in 25% yield . h nmr ( 500 mhz , dmso - d6 ) \n ppm 9.79 ( s , 1 h ) , 8.52 ( s , 1 h ) , 8.41 ( s , 1 h ) , 8.05 ( d , j = 2.4 hz , 1 h ) , 7.95 ( d , j = 8.3 hz , \n 2 h ) , 7.87 ( d , j = 8.3 hz , 2 h ) , 7.69 ( dd , j = 8.8 , 2.4 hz , 1 h ) , 7.47 ( m , 1 h ) , 7.32 ( m , 2 h ) , 7.28 \n ( d , j = 8.8 hz , 1 h ) , 7.18 ( td , j = 8.5 , 2.4 hz , 1 h ) , 5.24 ( s , 2 h ) , 2.95 ( m , 4 h ) , 2.37 ( m , 4 h ) , \n 2.14 ( s , 3 h ) . synthesized by general procedure e , isolated as a pale yellow solid \n in 4% yield . the product was separated by silica column chromatography \n ( dichloromethane / methanol ) and purified by hplc to obtain the formic \n acid salt . h nmr ( 500 mhz , dmso - d6 ) ppm 9.82 ( s , 1 h ) , 8.61 ( s , 1 h ) , 8.22 ( s , 1 h ) , \n 8.068.13 ( m , 3 h ) , 7.99 ( d , j = 2.4 hz , 1 \n h ) , 7.91 ( d , j = 8.8 hz , 2 h ) , 7.66 ( dd , j = 9.0 , 2.7 hz , 1 h ) , 7.47 ( td , j = 8.3 , \n 6.3 hz , 1 h ) , 7.297.36 ( m , 2 h ) , 7.26 ( d , j = 8.8 hz , 1 h ) , 7.18 ( td , j = 8.7 , 2.2 hz , 1 h ) , \n 5.26 ( s , 2 h ) , 3.35 ( dt , j = 5.1 , 2.3 hz , 2 h ) , 3.32 \n ( t , j = 6.1 hz , 2 h ) , 2.532.58 ( m , 2 h ) , \n 2.48 ( d , j = 5.9 hz , 2 h ) , 2.23 ( s , 3 h ) , 1.74 ( quin , j = 5.9 hz , 2 h ) . synthesized by general procedure e , isolated as a pale yellow solid \n in 10% yield . the product was separated by silica column chromatography \n ( dichloromethane / methanol ) and purified by hplc to obtain the formic \n acid salt . h nmr ( 500 mhz , cdcl3/cd3od ) ppm 8.46 ( s , 1 h ) , 8.10 ( s , 1 h ) , 7.89 ( m , 5 h ) , 7.60 \n ( m , 1 h ) , 7.39 ( m , 1 h ) , 7.28 ( d , j = 7.8 hz , 1 h ) , \n 7.24 ( d , j = 9.3 hz , 1 h ) , 7.04 ( m , 2 h ) , 5.20 ( s , \n 2 h ) , 3.57 ( m , 2 h ) , 3.45 ( t , j = 6.6 hz , 2 h ) , 3.05 \n ( m , 4 h ) , 2.63 ( s , 3 h ) , 2.08 ( m , 2 h ) ." ]

[ "\n acute appendicitis is considered as the most frequent cause of acute abdomen in young patients with a slight predominance in males . although its clinical diagnosis is simple , 20 - 30% of appendicitis cases are reported to be gangrenous or perforated because of delayed diagnosis , which can lead to increased morbidity and mortality . \n \n additionally , up to 10% of patients especially older ones , immunocompromised patients , and pregnant women are diagnosed with atypical presentations such as appendiceal mass which requires long hospital admissions , intravenous antibiotics , and often needs percutaneous drainage . \n \n using colonoscopy for the diagnosis and treatment of asymptomatic acute appendicitis and appendiceal abscess are rare . in unusual appendicitis cases , especially in the presence of abdominal comorbidities , colonoscopy is used ; although colonoscopy is not considered as the first line intervention because of complications risk such as bleeding or perforation . furthermore non - invasive tests such as ultrasonography and computed tomography with more sensitivity can be used . we report an atypical case of appendiceal abscess , which was diagnosed during colonoscopy . \n", "\n a 30-year - old man referred for evaluation to our center with epigastric pain from three days prior to his evaluation . the pain was nonspecific and colicky distributed in periumblical region , did not radiate to any site and was unrelated to bowel movements . he had experienced also nausea , anorexia and intermittent vomiting . \n \n there was a history of marijuana and alcohol usage from several years ago . upon physical examination , he was ill with restlessness . other laboratory values such as hemoglobin , platelets , serum amylase , erythrocyte sedimentation rate , aspartate aminotransferase , alanine aminotransferase , alkaline phosphatase , and electrolytes were normal . \n \n his workup on admission including ; chest x - ray , abdominal x - ray , and abdominal ultrasonography were reported normal . an upper gastrointestinal endoscopy was performed after four days of admission that was normal . \n \n within second week after admission , the appendiceal orifice was discovered in the floor of cecum which was draining pus into the lumen ( figure 1 ) . \n purulent discharge from the appendiceal orifice before ( up ) and after ( down ) pressing by forceps ( arrow ) \n result of the biopsies of the mucosa at the base of the appendix showed mild nonspecific inflammation with some necrotic materials and staphylococcus organism . the biopsies of the mucosa at terminal ileum , left and right colon demonstrated mild nonspecific inflammation . \n \n a second abdominal ultrasonography was performed that showed a fluid collection ( about 70 40 mm ) in favor of appendiceal abscess in right lower quadrant ( figure 2 ) . the patient was scheduled for spiral abdomen - pelvic computed tomographic scan which showed a hypodense well defined collection with air fluid level ( about 70 40 30 mm ) in right lower quadrant . the collection was extended to pelvic cavity associated with inflammation of the surrounding fat in favor of appendiceal abscess ( figure 3 ) . \n ultrasonography showing a fluid collection in favor of appendiceal abscess computed tomographic scan showing a hypodense well defined collection with air fluid level associated with inflammation of surrounding fat in favor of appendiceal abscess ( arrow ) . \n one week after antibiotic therapy a third abdominal ultrasonography was performed that showed a smaller fluid collection ( about 40 15 mm ) around the appendix . three weeks after antibiotic therapy the patient was asymptomatic with normal white blood cell count . on the 5th week after antibiotic therapy , exploratory laparotomy did not show any mass or collection in the appendiceal region and elective appendectomy was performed . after 3 months of follow - up the patient was well without any complaint or physical finding . \n", "\n acute appendicitis is one of the most frequent causes of acute abdomen . despite the use of scores in the radiological evaluation , and laparoscopic advances , in a cohort study of patients with appendiceal abscess or phlegmon due to acute appendicitis concluded that initial conservative treatment should be considered . \n \n colonoscopy is reported as a diagnostic and therapeutic approach for delayed or atypical presentations of acute appendicitis . our patient is one of these unusual cases among whom complicated acute appendicitis was incidentally diagnosed by colonoscopy . \n \n although the appendiceal orifice is routinely examined during colonoscopy , however there are only few published reports describing acute appendicitis diagnosis in the appendiceal orifice . \n \n in a review article , khawaja fi recommended that colonoscopy should only be done in selected patients with atypical appendicitis or uncertain diagnosis of appendiceal perforation . \n \n benatta ma reported an atypical case of pericecal appendiceal abscess diagnosed and treated at colonoscopy , while initial presentation was without any suggestive symptoms of appendicitis . \n \n wade ad et al reported an atypical case of appendicitis in a patient with ulcerative colitis diagnosed during colonoscopy . in this report christoffersen mmw et al reported an atypical case of periappendicular abscess diagnosed and treated at colonoscopy , while the patient was admitted for colonoscopy polyp control without any suggestive symptoms . \n \n kawahara y et al reported a case of appendiceal abscess with draining pus from appendiceal into the lumen diagnosed at colonoscopy and ct scan . in this report because of spontaneous drainage of abscess into the lumen , the appendiceal abscess had resolved by the time of surgery . \n \n kapral c et al . reported a case of pericecal abscess that treated by drainage at colonoscopy and antibiotic therapy . they intubated the appendix by sphincteroltomy catheter which was placed into the abscess cavity . \n \n petro m reported a case of the earliest stage of acute appendicitis in an asymptomatic patient undergoing colonoscopy for evaluation of colorectal cancer . \n \n for evaluation of the role of colonoscopy in the diagnosis of atypical appendicitis , a retrospective study in 21 patients performed by chang hs et al . some of acute appendicitis cases are reported to be complicated , due to delayed diagnosis . this unusual case highlights a patient with an appendiceal abscess diagnosed by colonoscopy . because of spontaneous drainage of abscess into the lumen of colon and antibiotic therapy , although the diagnostic and therapeutic role of colonoscopy in these patients is uncertain , however , it s use can be selected in special situations in the future . \n", "" ]

[ "they possess binding sites specific to carbohydrates and have the capacity to interact with molecules of biological fluids and those present in cellular surfaces . lectins can substitute natural linkers and activate cellular responses through different roads of intracellular signalling or endocytosis of formed compounds [ 3 , 4 ] . camaratu or camaratuba bean ( cratylia mollis ) is forage of the northeast semi - arid region from brazil . molecular forms of c. mollis seed lectin ( cramoll 1 , cramoll 2 , cramoll 3 , and cramoll 4 ) have been highly purified and characterized ( de souza et al . , cramoll 1 , cramoll 2 , and cramoll 4 specifically bind glucose / mannose , while cramoll 3 is a galactose - specific glycoprotein . preparations containing isoforms ( cramoll 1,4 ) and isolectins ( cramoll 1,2,3 ) , as well as cramoll 1 , have been studied in structural analyses and for the most several biotechnological applications ( de souza et al . , 2003 ) [ 612 ] . the use of nuclear technique for the evaluation of biomolecules and medicines although old is not widely used even nowadays . since the discovery of the element technetium , in 1947 scintigraphy imaging provides a dimensional method for exactly locating gamma emitters in a noninvasive procedure under in vivo conditions . for the characterization of drugs , and biomolecules , molecular imaging techniques are extremely helpful to follow biodistribution in experimental animal studies . in this study , the isolectins cramol 1,4 were radiolabeled with tc-99 m for the evaluation of the biodistribution and in order to forecast a possible use as radiopharmaceutical in healing process .", "the labeling processes were made using 150 l of cramol ( isoform 1,4 ) solution incubated with stannous chloride ( sncl2 ) solutions ( 80 l / ml ) ( sigma - aldrich ) for 20 minutes at room temperature . then , this solution was incubated with 100 ci ( approximately 300 l ) of technetium-99 m ( ipen / cnen ) for other 10 minutes in order to label the cramol 1,4 ( here just called cramol ) with tc-99 m . in order to characterize the labeled cramol , thin - layer chromatography ( tlc ) was made using paper whatman no . the tlc was performed using 2 l of a labeled sample in acetone ( proquimios ) as a mobile phase . the radioactivity of the strips was verified in a gamma counter ( packard , cobra ii ) as described in table 1 . the institutional review board and the animal ethics committee approved the study protocol for this study . the labeled samples ( 3,7 mbq/0,2 ml ) planar images were obtained 1 hour after injection at a millennium gamma camera ( ge healthcare , cleveland , usa ) . counts were acquired for 5 min in a 15% window centered at 140 kev ( figure 1 ) . then , animals were sacrificed , their were organs removed and weighted , and the radioactivity uptake was counted in a gamma counter ( packard - cobra ii ) . results were expressed as the percentage of injected dose per organ and percent of injected dose per gram of tissue ( table 2 , figures 2 and 3 ) .", ", the results showed that the acetone can be used for this purpose . in a triplicate test , the free pertechnetate was eluted to the top of the chromatograms , and the cramol stayed in the bottom . moreover , the results observed in the chromatogram elucidated the question about the efficacy of the labeling process , corroborating that the cramol was efficiently labeled with tc-99 m . tc - cramol scintigraphy 1 h after injection shows liver , kidneys , and bladder . as we can see , the great part of the lectin was processed by the liver . this is absolutely normal especially for injectable drugs , since almost all the drugs are first processed by the hepatic system ( figure 2 ) . otherwise , when dissecting , weighting and counting the organs , a suspicious data appeared . as a protein , we were expecting that its clearance would be made by the kidney , and in fact , it occurred . however , the rate between the bowel and the kidney is over the double . in this case , the clearance time would be reduced and the reabsorption of the drug could be facilitated by the microvilli of the bowel . in this case a dosage error could occur or even a toxic reaction due its accumulation in the bowel . in both cases , further studies should be made to clarify this mechanism and the relevance of that information in a developed drug based on lectin similar to the cramol 1,4 . it is interesting to notice , analyzing both figures 1 and 2 , that the lectin can not pass the hematoencephalic barrier . and in this case , the lectin does not represent a risk for the brain function .", "the radiolabeling of the cramol showed that this lectin has an uncommon behavior specially related to the clearance mechanism that we believe must be more studied . it also showed that the nuclear technique can be very helpful for the development of drugs and medicines ." ]

[ "the comingling of swine from numerous premises with varied management practices and their interaction with large numbers of exhibitors and visitors make agricultural fairs an ideal setting for the intra- and inter - species transmission of influenza a viruses ( iavs ) between swine and human populations . the frequency with which intra- and inter - species iav transmission occurs in these settings is likely due to a myriad of factors , including but not limited to , management practices , iav strain , and animal and/or human population immunity . swine is a host species in which reassortment of iav genomic segments may lead to emergent novel strains , since they are susceptible to infection from swine , human and avian influenza a viruses . for this reason , limiting the bidirectional zoonotic transmission of these viruses at agricultural fairs is important for public and animal health . the association between human and swine influenza was reported after respiratory disease similar to the human disease was noted in pigs during the 1918 human spanish flu pandemic . iav subsequently became established in the united states swine population with the relatedness of the swine and human viruses being established in 1931 . for nearly 80 years , classical swine influenza h1n1 virus was the dominant endemic iav strain in the north america swine population . in 1998 , triple reassortant h3n2 iavs containing polymerase basic 1 ( pb1 ) , hemagglutinin ( ha ) and neuraminidase ( na ) gene segments from human iav lineages , polymerase basic 2 ( pb2 ) and polymerase acidic ( pa ) genes from avian lineages , and nucleoprotein ( np ) , matrix ( m ) and non - structural ( ns ) gene segments from swine lineages , emerged in north american swine . subsequently , this lineage became established in us and canadian swine herds and has resulted in an increased rate of genetic and antigenic change among swine - origin iavs . reported cases of humans contracting iav infections directly or indirectly from pigs have been historically sporadic and these variant iavs showed limited capability for sustained human - to - human transmission . however , the emergence of the influenza a(h1n1)pdm09 virus , a strain containing gene segments from north american and european swine lineages , illustrated the pandemic potential of swine lineage iavs crossing the species barrier to humans . while a(h1n1)pdm09 rapidly spread worldwide and became endemic in the human population , sequencing of this virus has to date failed to elucidate any virulence or adaptation markers that would explain its human - to - human transmission efficiency , highlighting our inability to predict iavs with pandemic potential . while the origin of the a(h1n1)pdm09 virus remains unknown , the virus was introduced into the north american swine population in 2009 and has since reassorted with other swine - origin iavs . epidemiological data show that zoonotic transmission of iav from swine to humans has been documented at unprecedented levels in recent years . more than 320 human cases of infection with variant iavs were reported to the centers for disease control 20112012 and likely thousands more h3n2v cases went unreported during those years . these zoonotic iavs contained seven genes from contemporary north american swine lineage iav and one gene ( m ) derived from the h1n1pdm09 virus . the majority of the cases were epidemiologically linked to swine exposure occurring at agricultural fairs across several states . within ohio , 107 h3n2v cases documented during 2012 resulted in eleven hospitalizations and one fatality . we recovered iav from exhibition swine at 10 of 40 ( 25% ) ohio fairs sampled during 2012 . genomic analyses of h3n2 iav isolates recovered from pigs at one agricultural fair in the state during 2012 demonstrated > 99% nucleotide similarity to h3n2v isolates recovered from concurrent human cases , providing molecular confirmation of zoonotic iav transmission . this record number of variant influenza a cases created the need for a one health ' effort to minimize intra- and bidirectional inter - species iav transmission at swine exhibitions . the reason to prevent iav infections among swine at fairs is clear ; however , the paucity of scientific evidence makes it difficult for veterinary officials to make sound recommendations to protect public and animal health . in the present study , we investigate fair specific risk factors contributing to the emergence of influenza a virus in exhibition swine that could be altered to mitigate the risk of iav transmission in these settings .", "as part of an ongoing active iav surveillance project , swine nasal swabs and associated metadata about management practices were collected at 40 ohio fairs in 2012 . sample size was selected to provide a 95% probability of detecting iav infection if greater than 15% of the pigs at each fair were infected . all pigs sampled in this study were from junior fair market swine shows occurring at agricultural fairs . for the outcome of interest , a fair was considered positive if viable iav was recovered from one or more pigs at the fair . data collection focused on fair level variables possibly contributing to the presence or absence of iav in the pigs at each exhibition . junior fair shows are limited to local exhibitors approximately nine years of age through 19 years of age participating in 4-h , ffa or another youth organization , whereas open - class shows are generally open to all participants regardless of age , affiliation or residence . classification of swine included market swine ( pigs bred , raised and intended for food purposes ) and breeding swine ( gilts , sows and/or boars being raised for breeding purposes ) . terminal swine shows are those in which all participating livestock are consigned to harvest immediately following the exhibition and partial terminal shows usually require the champion animals to be harvested following the exhibition and other pigs may or may not go to harvest . to account for the variability of arrival and departure procedures among fairs enrolled in this study , the length of the swine exhibition was defined as the number of days between the required arrival deadline for the pigs and the day the pigs were sampled . study team members calculated the area per pig ( ft / pig ) from the recorded size of the pens and the number of pigs per pen . while on the fairgrounds , study team members also documented if there was an easily identifiable and operational hand - wash and/or hand - sanitizer station within close proximity to the swine barn(s ) . these sanitation stations were used by study team members to determine if they were functional . additional variables included the number of pigs at the fair , number of swine exhibitors , fair attendance ( number of people ) and vaccine requirements , all of which were reported to the study team by the fair organizers . fair officials also reported if there was a commingling event , such as a pre - fair animal identification or weighing session , during the weeks or months prior to the fair . exhibition directors also reported if there were other pigs besides the exhibition swine on the fairgrounds ( i.e. , petting zoo , pig races , educational displays ) . the commercial swine inventory was retrieved from united states department of agriculture 's 2007 census of agriculture . the county human population was defined as the value reported in the 2010 us census report . weather data were collected from the national weather service 's weather station nearest to each fairground . data were analyzed using stata version 11.1 ( statacorp , college station , tx , usa ) . univariate analysis was performed to calculate unadjusted odd ratios to identify factors contributing to the presence of iav in pigs at fairs . exact logistic regression was used for multivariable modeling using a forward stepwise model building approach .", "influenza a virus was recovered from pigs at 10 of the 40 fairs included in the investigation . the presence or absence of iav infection among the pigs at the fairs could not be associated with county population , county swine inventory and number of people attending the fair ( table 1 ) . all iav - positive fairs and 27 of 30 ( 90% ) negative fairs were mixed sex ( barrows and gilts ) market swine exhibitions . the average space per pig at the studied fairs was 12.8 ft / pig . properly functioning hand - wash and/or hand - sanitizer stations were available at 25 of 40 ( 62.5% ) fairs . average daily mean temperature was almost 4 c higher for fairs with iav - positive pigs ( table 1 ) . pre - fair tag - in and/or weigh - in events were rather common with 23 out of 40 ( 57.5% ) of the enrolled fairs holding one of these events . for every increase of 20 pigs at a fair , the odds ratio of iav infection in the pigs increased by 1.27 times ( table 2 ) .", "the results of the current study provide the first look at fair - level risk factors associated with iav infections in swine at agricultural fairs . while it is likely impossible to completely prevent iav transmission at swine exhibitions , these data can be used to develop and evaluate mitigation strategies to reduce the impact of intra- and inter - species iav infections at swine exhibitions . just like all other agriculture biosecurity programs , mitigation strategies which are practical , user - friendly , low cost and do not dramatically alter the fair experience for exhibitors and visitors are most likely to be considered , implemented and maintained . not surprisingly , larger pig shows appear to be more likely to have iav - infected pigs than smaller swine exhibitions ( table 2 ) . larger swine exhibitions tend to also have open - class and breeding swine shows in addition to junior market shows . while open - class shows were common among our studied fairs ( 16 of the 40 ) , only 5 of the 40 ( 12.5% ) fairs in this study had a breeding show ; 4 of those 5 ( 80% ) fairs had iav - infected pigs at the fair . the small number of fairs with breeding shows in this study makes analysis of this risk factor problematic ; however , the finding is enough to warrant concern given that breeding swine are intended to leave the exhibition and enter a herd for progeny production . this fair - to - farm movement of pigs is a disease introduction risk for the receiving herd and a potential method to disseminate iav strains across a larger geographic area . previous research has shown that environmental stressors ( heat , lack of space , noise ) on pigs can affect the course of various diseases in commercial swine operations . the average space per pig at the studied fairs was well above 68 ft / finishing pig common throughout the swine industry . the results indicate that heat stress could be a contributing factor to iav infections in exhibition swine ; however , caution must be used when interpreting this result because the vast majority of the fairs with iav - positive pigs occurred in a 4-week period during the middle of summer . this trend of mid - summer iav activity in ohio 's exhibition swine was also observed in the previous three years and could be more related to animal and/or people movement between these fairs than the weather . environmental temperature failed to meet the selection criteria for inclusion in the final multivariable model . while the majority of fairs had hand hygiene stations , their presence at fairs was not linked to the occurrence of iav among pigs at the respective fairs . the large number of h3n2v infections linked to swine exposure at agricultural fairs during 2012 suggests that hand hygiene stations also had minimal impact on zoonotic transmission of iav in these settings . however , hand hygiene stations are critically important in protecting human health by controlling zoonotic diseases transmitted via direct contact at these venues . this would limit the time for iav to spread among susceptible pigs and decrease the time humans are exposed to iav - infected pigs . the length of the exhibitions in the current study was similar between iav - positive and -negative fairs . active recruitment of fairs with more diverse management practices is needed to study the impact of a shortened swine exhibition . no matter the length of the exhibition time , the disposition of the pigs following the show must be considered . the majority of fairs in this study ( 65% ) had terminal junior market shows . the practice of having a terminal show was not associated with decreased odds of iav ; however , sending all the pigs to harvest at the end of each fair is expected to help protect subsequent fairs by decreasing the potential for fair - to - fair spread of iav . mandated vaccinations were almost non - existent with only one fair in the current study requiring the pigs be vaccinated for erysipelothrix rhusiopathiae prior to the fair ; no fairs required the pigs to receive iav vaccination before arrival . use of iav vaccine in exhibition swine to decrease the risk of iav infections in swine and humans has been one of the most debated topics following the h3n2v outbreak of 2012 . there are currently several commercially available swine influenza vaccines in the united states , all of which are universally indicated to reduce clinical signs of disease in pigs but appear to have limited efficacy against 2012 h3n2v strains . although their impact on intra- and inter - species transmission dynamics remains unclear , it is expected that iav vaccines will impart at least partial immunity to circulating strains of iav , which should decrease viral shedding during a fair . an unintended consequence of iav vaccine use may be vaccine - associated enhanced respiratory disease , which has been reported in swine vaccinated with swine influenza virus vaccines that are mismatched to circulating strains . furthermore , decrease of clinical signs may hamper recognition and response to active iav infections in exhibition pigs . some of the major pitfalls of mandated iav vaccination lie with the practical application of vaccines in this setting . the logistics of vaccine distribution to swine exhibitors prior to the fair becomes difficult because most exhibition swine are raised by youth exhibitors in small , dispersed herds ( < 10 pigs per herd ) . commercial vaccines are usually sold in 50 doses per bottle adding to the cost per vaccinated pig in these small herds . because youth exhibitors and their family members may not be proficient at administering vaccines , agriculture education advisors often volunteer to assist the youth with this task , a practice that is time - consuming and increases the risk of infectious agents being transmitted farm to farm . additionally , problematic is that most iav vaccines labeled for swine require a booster dose given 24 weeks later to provide optimal protection , which can be difficult for youth exhibitors and their family members to accomplish . tagging or weighing events are frequently used as a way for exhibitors to declare ownership of their pig(s ) prior to the fair . these pre - fair events could provide an opportunity for mass vaccination of pigs prior to the fair , but the application of such events can facilitate disease spread between animals . even in properly vaccinated pigs , the immunity stimulated by current iav vaccines the strains used for commercial swine influenza vaccines are irregularly updated and the constant genetic and antigenic change occurring in contemporary swine - origin iavs makes viral antigens unpredictable and difficult vaccine targets . the reason for the increase in the number of reported h3n2v cases during 20112013 remains unclear , but the strain of iav is thought to be a major contributing factor . the swine - origin h3n2 iav isolates recovered from these human cases contains the matrix gene from the a(h1n1)pdm09 virus , a recently emerged genomic constellation that increases replication and transmission in cell culture and animal models . epidemiological data modeling indicate that children are most susceptible to h3n2v , likely due to lack of strain - specific immunity . additionally , current seasonal trivalent inactivated iav vaccine provides little to no protection against h3n2v strains . the limited ability for human - to - human transmission of h3n2v has minimized the impact of these recent zoonotic transmission events , but the outbreak has illustrated the importance of swine exhibitions in zoonotic iav transmission . it is nearly impossible to predict the iav strain that will infect the swine at fairs because iav reassortment events and novel strain generation frequently occur in modern swine populations . agricultural fairs provide a pathway for human exposure to these ever changing viruses ; thus , blanket iav prevention , without regard for strain , is needed for swine at fairs to decrease zoonotic iav transmission and protect public health . while iav can infect pigs at any fair , the data presented here indicate that special attention should be paid to large pig shows where the likelihood of iav among the pigs is much higher . the results presented herein are based on one year of data from a limited geographic area of the united states . additional assessments of swine exhibitions in multiple states across several years are needed to provide more comprehensive evaluations of risk factors contributing to the problem . these data provide a critical first step toward developing effective iav mitigation strategies in swine populations that benefit fairs , exhibitors , visitors and the swine industry . this information will serve as a baseline for measuring the acceptance and effectiveness as mitigation strategies are developed and implemented ." ]

[ "", "turmeric ( curcuma longa l. ) of family zingiberaceae is industrially as well as pharmaceutically important crop extensively cultivated in india . it is a vegetatively propagated , polyploid crop commonly known as golden spice . because of its multipurpose use as food preservative , spice , therapeutic agent and natural dye , it is acquiring more importance in cosmetics , food and pharmaceutical industries , . in turmeric number of cultivars has been developed with different characteristics like high curcumin content , high essential oil content , rhizome yield and disease tolerance etc . but their asexual mode of reproduction and poor genetic makeup has creates confusion towards authentic identification . single nucleotide polymorphism ( snp ) study could be useful to solve these problems by comparing sequence of each variety with each other . in this current study , we conducted reference based transcriptome assembly of suvarna , a well - known turmeric cultivar which could latter on used to get potential snps by comparing with other varieties towards proper identification .", "fresh mature rhizomes of suvarna variety has been collected from centre for biotechnology , siksha o anusandhan university , bhubaneswar , india . these rhizomes were washed properly with distilled water and suspended in rna later solution for further analysis . rna extraction and library preparation has been done by using illumina truseq rna library tool kit . 75 bp paired - end sequencing has been done using illumina nextseq500 sequencing platform which developed5 gb of raw data . we have precisely given detail information about the reference based transcriptome assembly of suvarna cultivar ( table 1 ) . the transcriptome assembly of suvarna developed 42994 numbers of transcripts , with median transcript length 773 and n50 value 1216 . we annotated the transcripts using various databases like go , kegg , kog , plantcyc etc . as per our understanding transcriptome analysis of cultivar suvarna has been done for the first time and this result could be efficiently used for development of markers such as ssrs and snps for identification of suvarna from its closely similar turmeric cultivars .", "fresh mature rhizomes of suvarna variety has been collected from centre for biotechnology , siksha o anusandhan university , bhubaneswar , india . these rhizomes were washed properly with distilled water and suspended in rna later solution for further analysis .", "rna extraction and library preparation has been done by using illumina truseq rna library tool kit .", "75 bp paired - end sequencing has been done using illumina nextseq500 sequencing platform which developed5 gb of raw data . we have precisely given detail information about the reference based transcriptome assembly of suvarna cultivar ( table 1 ) . the transcriptome assembly of suvarna developed 42994 numbers of transcripts , with median transcript length 773 and n50 value 1216 . we annotated the transcripts using various databases like go , kegg , kog , plantcyc etc . as per our understanding transcriptome analysis of cultivar suvarna has been done for the first time and this result could be efficiently used for development of markers such as ssrs and snps for identification of suvarna from its closely similar turmeric cultivars ." ]

[ "the sense of coherence ( soc ) , which was proposed by antonovsky is based on the salutogenic model of health . the soc is composed of three factors ; ( 1 ) the stimuli derived from internal and external environments in the course of living are structured , predictable , and explicable ( comprehensibility ) ; ( 2 ) resources are available to meet the demands posed by these stimuli ( manageability ) ; and ( 3 ) such demands are challenges , worthy of investment and engagement ( meaningfulness ) . antonovsky defined the soc as a personality dimension that is hypothesized to influence stress recognition style , facilitate stress management , and contribute to overall well - being . people with a strong soc have a high ability to cope with stress and maintain good physical and mental health . to the best of our knowledge , six studies have investigated the association between soc , job stress , and mental health . findings from these studies suggest that soc modified the effect of job stress on mental health . to the best of our knowledge , only four studies have investigated the relationship between the soc and depressive symptoms , one used the brief job stress questionnaire and the other three used general health questionnaire . these studies suggested that a weak soc was a strong predictor of mental distress , including depressive symptoms . nurses are exposed to high - stress work environments , including irregular work schedules , shift work , and interaction with patients and other hospital staff members . therefore , preventing mental distress , including depressive state , is an important issue for nurses . the aim of this study was to investigate the relationship between depressive state , job stress , and soc among nurses in japanese general hospital .", "in february 2013 , supervisors distributed a questionnaire to all nurses ( n = 710 ) in a general hospital with 611 beds in an urban area in japan . nurse specialties included intensive care , pediatrics , surgery , oncology , and emergency medicine . an explanation of the nature of the survey accompanied the questionnaire , which was anonymous and voluntary . the study was approved by both the local direction board and the committee for the prevention of physical disease and mental illness among health care workers at the general hospital . the questionnaire collected data on age , hours of work ( full - time or part - time ) , shift work , overtime hours per week , and job rank ( manager , middle manager or staff nurse ) . we measured job stress using the japanese version of the effort - reward imbalance ( eri ) scale ( 23 items ) translated by tsutsumi et al . the eri consists of three subscales ; effort ( 6 items ) , reward ( 11 items ) and over - commitment ( 6 items ) . the reward subscale is further divided into three subgroups : esteem , job security , and promotion . the eri model indicates that job stress is related to high effort with low reward . four eri ratios ( eri , effort - esteem imbalance , effort - promotion imbalance , and effort - job security imbalance ) were calculated based on the total scores according to tsutsumi et al . the soc scale consisted of 29 items assessing comprehensibility , manageability , and meaningfulness . scores for each item ranged from 1 to 7 points , and the total score was calculated as the soc score . we measured depressive state using the k6 short screening questionnaire that was developed in accordance with the world health organization translation guidelines . the k6 consists of six items on depression and anxiety , each of which is measured on a 5-point scale ( 0 - 4 ) . higher scores indicate a more depressive state . the k6 was translated into japanese and showed good validity with the diagnostic and statistical manual of mental disorders , fourth edition , mood , and anxiety disorders in a community sample . we used pearson 's correlation to investigate the relationship among age , work related - factors , job stress , soc , and depressive state . to examine factors with a significant effect on depressive state , stepwise multiple regression analyses were conducted with the k6 total score as the dependent variable and variables related to the depressive state as independent variables .", "completed questionnaires were returned by 420 out of 710 nurses ( response rate , 59.2% ) . male nurses were excluded from the analysis because only 28 of the 42 ( 66.7% ) male nurses responded . subjects with missing values for job stress , soc , or depressive state were also excluded ( n = 43 ) . the final sample for analysis consisted of 348 female nurses ( 52.1% ) , including nurses who were managers and middle managers . overtime was reported in hours per week , which was voluntary but limited to 45 h / month . shift work categories included : no shift work , shift work with rotation to night shift , or characteristics of study subjects table 2 shows the pearson 's correlation coefficients between age , overtime hours , eri ratios , soc , and the depressive state . depressive state moderately correlated with three eri ratios , over - commitment , and soc . pearson 's coreration between work environments , eri ratios , over - commitment , soc and depressive state table 3 shows the influence of work - related factors , eri ratios , and soc on depressive state . soc , over - commitment , effort - esteem ratio , and age were significantly correlated with depressive state ( = 0.46 , p < 0.001 ; = 0.27 , p < 0.001 ; = 0.16 , p < 0.001 , = 0.10 , p < 0.01 , respectively ) . the coefficient of multiple determination ( r ) was 0.56 ( f = 106.56 p < 0.001 ) .", "we found that soc , over - commitment , effort - esteem ratio , and age were predictors of depressive state among female nurses in the general hospital . the soc was inversely associated with depressive state , which was similar to previous studies . the present findings contribute to the literature investigating the relationship between depressive state , job stress , and soc . strength of our study is that we investigated the independent contribution of three ratios of eri ( effort - esteem , effort - job security , and effort - promotion ) , over - commitment , and soc to the depressive state . according to our previous study , the present findings suggest that a depressive state of nurses was associated with not only job stress but also both over - commitment and soc . age correlated positively with soc [ table 2 ] , which was also similar to a previous study by harri who suggested that soc tends to increase with age . previous studies suggested that an increasing soc of workers may reduce negative job stress responses and mental health problems . intervention support enhancing the soc could be effective in preventing nurses from experiencing a depressive state . first , the sample size was small and included nurses from only one general hospital .", "our findings provide insight into some factors associated with a depressive state among nurses in a general hospital . from a practical perspective , the influence of soc on a depressive state should be considered for health care professionals . intervention support such as group cognitive psychotherapy to strengthen comprehensibility , manageability , and meaningfulness may help nurses cope better with job stress and reduce their risk of depression ." ]

[ "huntington 's disease ( hd ) is an autosomal dominant , progressive neurodegenerative disorder characterized by chorea , subcortical dementia and psychiatric symptoms . the causal hd gene has been identified as it15 , which has cag repeats in the open reading frame ( orf , in exon 1 ) just following the 5end of the gene . it leads to the translation of a protein , huntingtin , whose function is unknown . huntingtin forms intraneuronal inclusion bodies which lead to neuronal dysfunction followed by neuronal death due to apoptosis . the therapeutic strategies for hd are diverse , ranging from the classical drug therapies to the modern molecular strategies . one of the treatment options is the use of drugs with neuroprotective potential , like lithium . lithium has demonstrated diverse molecular effects reversing well - described pathophysiological changes such as increased oxidative stress , apoptosis , inflammation , environmental stress , glial dysfunction , neurotrophic factor deficiency , excitotoxicity as well as mitochondrial and endoplasmic reticulum disruption . lithium acts by inhibiting a protein- kinase called glycogen synthase kinase 3 ( gsk3 ) that has important actions on the intracellular signal transmission by protein phosphorylation . inhibition of this enzyme appears to have a neuroprotector effect in neurodegenerative diseases such as amyotrophic lateral sclerosis , spinocerebellar ataxia type 1 and huntington 's disease . we report three patients with huntington 's disease , who showed good response to treatment with low dose lithium .", "mrs . a , a 48-year - old homemaker , presented in 2008 with a three - year history of involuntary movements of the trunk and the hands , which had worsened over the previous 7 - 8 months . family history was not available . on examination , ocular saccades were slow ; she had generalized choreiform movements involving hands legs , lips and the trunk ; dystonia of hands and feet and ataxic gait . a genetic analysis for huntington 's disease was performed after obtaining written informed consent which showed cag repeat expansion . patient was started on lithium 150 mg , once daily , along with carbamazepine 200 mg twice a day . patient is on regular follow up for the last four years and is maintaining the same improvement . b , a 58-year - old male , presented in 2001 with a history of abnormal movements . , the movements were disabling , irregular , would worsen with anxiety and disappear during sleep . patient had a significant family history of hd ; involving both parents and 7 out of 9 siblings , totally 9 affected first - degree relatives . on examination , patient was noted to have severe generalized chorea involving the hands , legs , trunk and the neck . patient was admitted in 2009 with a worsening of movements over the previous 6 months and weight loss of about 6 kg . all investigations including prostate specific antigen and chest x - ray were normal and the weight loss was attributed to nutritional causes . family members reported that the patient was able to eat well and had no behavioral symptoms . the patient has been on follow up for the last three years and maintains status quo . c , a 51-year - old lady presented in 2002 with history of psychiatric symptoms for the previous 8 years . onset was sudden with symptoms of being anxious , accusing the family members of neglect , and being violent toward family members . patient also had history of non - rhythmic quasi - purposive movements of hands which she attributed to anxiety . family history revealed that her mother had movement disorder and an early death . on examination , patient c had choreic movements of the limbs , anxiety and depressive symptoms . a diagnosis of hd was made which was confirmed by genetic analysis , which showed expanded cag repeats in the huntingtin 's locus . patient was initially started on carbamazepine 400 mg and clonazepam 4 mg / day . over the next one year , patient developed psychotic symptoms like delusions of reference and persecution toward her family members and was also started on quetiapine up to 300 mg . two years later , patient had sudden deterioration in symptoms with worsening of chorea and onset of cognitive decline memory disturbances and apraxia , which made her completely dependent for all activities of daily living . during this time , she also developed significant mood swings . for the last 3 years , patient has been on a combination of lithium 300 mg , carbamazepine 800 mg , quetiapine 300 mg and clonazepam 2 mg / day . patient 's husband reported no further deterioration over 3 years in cognition or movements in the patient . however , she continued to be dependent on husband for activities of daily living and eventually died due to cardiac arrest .", "mrs . a , a 48-year - old homemaker , presented in 2008 with a three - year history of involuntary movements of the trunk and the hands , which had worsened over the previous 7 - 8 months . family history was not available . on examination , ocular saccades were slow ; she had generalized choreiform movements involving hands legs , lips and the trunk ; dystonia of hands and feet and ataxic gait . a genetic analysis for huntington 's disease was performed after obtaining written informed consent which showed cag repeat expansion . patient was started on lithium 150 mg , once daily , along with carbamazepine 200 mg twice a day . patient is on regular follow up for the last four years and is maintaining the same improvement .", "b , a 58-year - old male , presented in 2001 with a history of abnormal movements . , the movements were disabling , irregular , would worsen with anxiety and disappear during sleep . patient had a significant family history of hd ; involving both parents and 7 out of 9 siblings , totally 9 affected first - degree relatives . on examination , patient was noted to have severe generalized chorea involving the hands , legs , trunk and the neck . patient was admitted in 2009 with a worsening of movements over the previous 6 months and weight loss of about 6 kg . all investigations including prostate specific antigen and chest x - ray were normal and the weight loss was attributed to nutritional causes . family members reported that the patient was able to eat well and had no behavioral symptoms . the patient has been on follow up for the last three years and maintains status quo .", "c , a 51-year - old lady presented in 2002 with history of psychiatric symptoms for the previous 8 years . onset was sudden with symptoms of being anxious , accusing the family members of neglect , and being violent toward family members . patient also had history of non - rhythmic quasi - purposive movements of hands which she attributed to anxiety . family history revealed that her mother had movement disorder and an early death . on examination , a diagnosis of hd was made which was confirmed by genetic analysis , which showed expanded cag repeats in the huntingtin 's locus . patient was initially started on carbamazepine 400 mg and clonazepam 4 mg / day . over the next one year , patient developed psychotic symptoms like delusions of reference and persecution toward her family members and was also started on quetiapine up to 300 mg . two years later , patient had sudden deterioration in symptoms with worsening of chorea and onset of cognitive decline memory disturbances and apraxia , which made her completely dependent for all activities of daily living . during this time , she also developed significant mood swings . for the last 3 years , patient has been on a combination of lithium 300 mg , carbamazepine 800 mg , quetiapine 300 mg and clonazepam 2 mg / day . patient 's husband reported no further deterioration over 3 years in cognition or movements in the patient . however , she continued to be dependent on husband for activities of daily living and eventually died due to cardiac arrest .", "huntington 's disease ( hd ) is an autosomal dominant progressive neurodegenerative disorder caused by an expanded polyglutamine ( poly q ) tract within huntingtin protein and is characterized by neuronal loss mainly in the striatum and the cortex . genetically , hd is caused by a mutation in the gene located on chromosome4p 16.3 . the disease - causing mutation in the first exon of huntingtin ( htt ) gene is the expansion of a polymorphic cag repeat that is completely penetrant once it has reached 40 triplets . neuropathologically , the mutant huntington protein ( mhtt ) abnormally interacts with a variety of proteins and accumulates in the neuronal nucleus forming an inclusion body which is the hallmark of hd and leads to eventual cell death . in addition to the well - documented use of lithium as a mood stabilizing drug , primarily in the treatment of bipolar disorder , recent in vitro and in vivo studies in animal models have increasingly indicated that lithium can be used in the treatment of chronic neurodegenerative diseases like huntington 's disease . various pharmacological and gene manipulation studies support the notion that lithium 's main mechanisms of action may be its ability to inhibit gsk3[68 ] as well as induce brain - derived neurotrophic factor - mediated ( bdnf ) signaling , leading to enhanced cell survival by alteration of a wide variety of downstream effectors . lithium is shown to promote the action of anti - apoptotic proteins , such as heat - shock protein ( hsp ) , insulin like growth factor ( igf ) , vascular endothelial growth factor ( vegf ) and other neurotrophic factors . lithium can directly or indirectly modulate proteins involved in neuronal survival / differentiation which may account for its neuroprotective effects.[1012 ] by inhibiting n - methyl - d - aspartate receptor - mediated calcium influx , lithium also contributes to calcium homeostasis and suppresses calcium - dependent activation of pro - apoptotic signaling pathways . lithium is found to enhance autophagy of toxic aggregates in huntington 's disease in various models of hd . it acts by increasing mtor - independent autophagy by inhibiting inositol monophosphatase ( impase ) and reducing inositol and ip3 levels . induction of autophagy by lithium leads to enhanced clearance of mutant huntingtin fragments associated with huntington 's disease ( hd ) . these mechanisms might allow therapeutic doses of lithium to protect neuronal cells from diverse insults that would otherwise lead to massive cell death . lithium also stimulates proliferation of stem cells , including neuronal and astroglial progenitor cell proliferation in the sub ventricular zone , hippocampus , striatum and forebrain protecting against apoptosis . the stimulation of endogenous neural stem cells and neurogenesis may explain why lithium increases brain cell density and volume in patients with bipolar disorder . in this report , we have described the use of lithium to prevent the progression of the huntington 's disease . all patients reported here were started on low doses of lithium after explaining the rationale , possible side - effects and off label use of the drug . the patients were on regular follow up and reported no worsening of either psychiatric symptoms or choreic movements for a significant period . in these patients , lithium was started in order to alleviate the distress caused by the choreic movements and mood swings . though rating of the movements was not done , there appears be some benefit in prescribing lithium to patients with huntington 's disease for slowing the progression of chorea and preventing mood swings . this report signifies the use of lithium as a neuroprotective agent . it may be beneficial to explore the possibility of use of other psychotropic drugs in the treatment of neurodegenerative disorders" ]

[ " walking ability is impaired in patients with peripheral arterial disease ( pad ) due to decreased blood flow to the skeletal muscle tissue used during walking . it has been demonstrated that walking distance is associated with the degree of impairment in the affected leg as measured by the ankle - brachial index ( abi ) and the time to onset of claudication pain [ 16 ] . likewise , it has been shown that walking exercise in patients with pad prolongs the onset of claudication pain thus allowing the patient to walk longer but does not change the abi [ 79 ] . recently , several investigators have used near - infrared spectroscopy ( nirs ) to dynamically study the effect of walking on oxygen desaturation of the gastrocnemius muscle of the impaired leg during exercise [ 2 , 1014 ] . investigators noted a marked decline in skeletal muscle tissue oxygenation ( sto2 ) during walking exercise [ 2 , 1014 ] . gardner et al . also identified that the rate of decline in calf muscle sto2 was significantly associated with initial claudication time and absolute claudication time in patients with pad . three of the above studies examined the changes in tissue oxygenation , using nirs , in patients with pad before and after an exercise training program [ 1214 ] . used a pretest - post - test design and reported greater exercise duration and lower mean exercise sto2 in 15 patients after a 3-month treadmill and calf exercise training program . studied 55 patients with pad who were given the option to participate in a structured or unstructured home exercise program for 34 2 weeks . at the end of the study , those patients in the structured exercise program had an increased oxyhemoglobin area under the curve when compared to baseline ; similar changes were not identified in the unstructured exercise group . lastly , tew et al . studied calf - tissue oxygenation and treadmill walking response time after randomization to 12 weeks of arm - crank ergometry or a control group in 57 patients with intermittent claudication . investigators identified that walking distance and time to nadir sto2 increased in those assigned to arm - cranking and there were no changes in the control group . no studies however compared leg muscle responses after a traditional walking program compared to a walking - with - poles program of rehabilitation in patients with claudication . the purpose of this study was to determine if there were differences in calf muscle sto2 parameters before and after 12 weeks of a traditional walking program versus a walking - with - poles exercise program . we reasoned that by using the poles to offload the legs , patients would have less claudication pain and be able to walk longer distance thus achieving a greater training effect . we hypothesized that the calf muscle tissue deoxygenation would be less in both groups after 12 weeks of exercise training than at baseline and that the decrease would be greater in those patients assigned to the walking - with - poles group . these data represent a subanalysis of data from a larger clinical trial comparing traditional walking to walking with poles .", "patients with pad were screened and recruited to participate in a randomized clinical trial designed to compare the effects of a traditional walking training program versus walking - with - poles exercise training program . a total of 2296 patients were screened for eligibility , 146 enrolled in the study . patients were recruited using radio and newspaper advertising , posted fliers , and letters of invitation sent to patients at the university and va hospitals . for the purposes of this analysis , we included only those participants with an abi of 0.90 ( n = 91 patients ) . of those 91 patients , 3 did not have sto2 analyses on their baseline progressive treadmill test due to equipment malfunction and 3 had questionable data resulting in a final sample of 85 patients . of those 85 patients , 45 were assigned to the walking - with - poles group and 40 patients were assigned to the traditional walking group . the major study was a randomized clinical trial to examine the effects of a traditional walking program compared to walking with poles on walking endurance and perceived physical function in patients with pad . our primary outcome focused on changes the patients realized walking on the constant work rate treadmill test whereas this analysis used data from the progressive treadmill test . at two minutes on the constant work rate test , the speed and incline increased to 85% of the patient 's workload on the progressive treadmill test resulting in a sudden decline in sto2 . due to the gentle nature of the progressive treadmill protocol used , we were able to detect more subtle changes in sto2 and onset of claudication pain . patients were randomized using computer - generated permuted blocks and group assignment was managed by the study statistician . the training programs for both groups were identical except that one group exercised with poles and the other group did not . patients assigned to the walking - with - poles group received training on the use of the poles prior to beginning the exercise program . additionally , patients were coached on proper poling mechanics during the training period if needed . the training program incorporated interval training whereby exercise consisted mostly of low - to - moderate intensity training at the start of the program and progressed to moderate - to - high intensity . exercise intensity was determined by heart rate associated with a percentage of oxygen uptake obtained during the metabolic exercise treadmill tests . exercise duration and intensity was adjusted every three weeks . during the first weeks , patients walked for 30 minutes ( 20% light intensity , 60% moderate intensity , and 20% hard intensity ) . by weeks 1012 , patients walked for 55 minutes ( 10% light intensity , 45% moderate intensity , and 45% hard intensity ) . light intensity was defined as 2544% peak vo2 , moderate intensity was 4559% peak vo2 , and hard intensity was 6084% vo2 peak . the program was designed so that patients walked on the treadmill two days / week and outdoors or in the hospital corridors one day / week . the exercise interval was adjusted based on the patient 's pain tolerance . for example , some patients could only walk for one to two minutes at the higher intensities . in order for them to achieve 20% total time at the harder intensities , demographic information , height , weight , comorbid conditions , and medication history were obtained from the patient and reviewed in the patient medical record . the abi was measured in the more severely affected leg at baseline and 12 weeks after training . the location of the signal was recorded and used consistently throughout the study for that individual subject . after the patient rested comfortably in a supine position for 15 minutes , doppler ultrasound was used to measure the systolic pressure in the right and left arms and in the ankle of the most severely affected leg . the arm with the highest systolic pressure patients were tested using a gentle treadmill protocol that was developed for patients with pad [ 6 , 16 ] . increases in percent grade occurred every 30 seconds , and , after the first 6 minutes , speed increased every 3 minutes . initial claudication time was defined as the time during the treadmill test when the subject experienced pain in the affected leg . the absolute walking time was defined as the time walked by the patient on the progressive treadmill test . peak oxygen uptake was measured using the medgraphics cpx / d system ( medical graphics corp , st . the metabolic cart was calibrated using a 3 l syringe prior to each test and the analyzers were calibrated using references gasses and room air . patients breathed through a mouthpiece and their nose was clipped with a standard nose clip . oxygen uptake was averaged over 30 s and the highest value at peak exercise was recorded . skeletal muscle tissue oxygenation was measured prior to , during , and after exercise using the nirs spectrometer ( inspectra 325 , hutchinson technology , inc . , a 25 mm probe attached to an optical cable was used to noninvasively measure the percentage of hemoglobin oxygen saturation of the tissue beneath the near - infrared light . the inspectra machine was calibrated prior to each test according to known high and low reference standards . the nirs probe was attached to the medial section of the gastrocnemius muscle of the patient 's most severely affected leg . the probe was placed into a specially designed adhesive housing unit to reduce ambient light . the probe was then secured to the leg to avoid excessive motion and possible tripping . the sto2 values used in this analysis were the sto2 value recorded after 2 minutes of standing prior to exercise ( sto2 rest ) , time walked when the patient reached the nadir sto2 value ( time to nadir sto2 value ) , sto2 value at peak exercise ( sto2 peak ) , and absolute and relative drop in sto2 ( absolute drop in sto2 = rest sto2 minimal sto2 value , relative drop in sto2 = [ rest sto2 nadir sto2 value]/rest sto2 ) . ratings of perceived leg pain were obtained every minute using the borg ratio scale . the initial claudication time is the time that patients either notified the staff of the onset of pain or the time they first reported pain when asked every minute . the two groups were compared at baseline using the t - test for independent samples and mann whitney u test . regression analyses were used to compute the initial decline in slopes for sto2 values ( sto2 value regressed over time ) . pearson r correlations were completed to examine relationships between the variables . paired t - tests independent t - tests were used to examine differences between groups . intent - to - treat analyses using the baseline value carried forward were completed for the comparisons between groups .", "the sample consisted of primarily older ( age = 69.4 9.2 years ) men . over one - third of the patients were current smokers , half were diabetic , and the majority of patients received treatment for hypertension and dyslipidemia ( table 1 ) . patients were generally unfit with a peak oxygen uptake of 14.3 2.9 ml kg min. the walking - with - poles group was older than the traditional walking group . calf muscle oxygenation decreased from 56 17% prior to the treadmill test to 16 18% at peak exercise ( 71% relative decline from rest to peak exercise ) . patients walked 4.45 3.67 minutes before experiencing claudication pain and 4.39 3.99 minutes when the sto2 reached its nadir value . there was no difference between the time elapsed when the sto2 reached its nadir value and pain onset ( p = .87 ) . although all patients reported claudication pain , exercise was not limited by claudication pain for all patients . therefore , we examined the onset of claudication pain and time to nadir sto2 for those whose exercise was limited by claudication pain only ( n = 72 ) . patients walked 3.35 2.57 minutes before experiencing claudication pain and 3.67 3.49 minutes when the sto2 reached its nadir value . there was no difference between the time elapsed when the sto2 reached its nadir value and pain onset ( p = .40 ) . after exercise , the time for the sto2 to return to half of its resting value was 1.3 1.3 min and 2.2 2.1 minutes to return to resting values . the initial claudication time and absolute walking time were not associated with the sto2 values at rest ( table 2 ) but were moderately related to the time elapsed prior to reaching the nadir sto2 value ( r = .42 , p < .001 ; r = .58 , p = .001 , resp . ) . there was also a small to moderate relationship between onset of claudication pain and the exercise slope decline in sto2 ( r = .28 , p = .011 ) . relationships were similar between initial claudication time and absolute walking time and the time elapsed prior to reaching the nadir sto2 values when the analysis was restricted to those whose exercise was limited by claudication ( r = 48 , p .001 and r = .47 , p < .001 ) . data comparing groups after exercise training were analyzed using intent - to - treat analysis for all patients . the change in time elapsed prior to reaching nadir sto2 values between baseline and 12 weeks was related to the change in absolute walking time between baseline and 12 weeks ( r = .65 , p < .001 ) and initial claudication time at 12 weeks ( r = .33 , p = .002 ) . analysis of covariance was completed to compare the groups with age as the covariate since there was a difference in age at baseline ( table 3 ) . the change in the time elapsed prior to reaching nadir sto2 values ( p = .002 ) and absolute walking time ( p = .002 ) were greater in the traditional walking group when compared to the walking - with - poles group . there was , however , no difference in the change in initial claudication time between the two groups ( p = .38 ) . when the analyses were restricted to those who completed the exercise training only ( n = 71 ) , the change in time elapsed prior to reaching nadir sto2 values between baseline and 12 weeks was related to the change in absolute walking time between baseline and 12 weeks ( r = .57 , p < .001 ) and initial claudication time at 12 weeks ( r = .32 , p = .004 ) . data from a sample patient are depicted in figure 1 . recovery time was unchanged when baseline and 12-week values were compared ( baseline = 2.45 2.17 min , 12 wk = 2.19 1.94 min , p = .81 ) . after 12 weeks of exercise training , within - group changes in initial claudication time , absolute claudication time and time elapsed prior to reaching nadir sto2 values increased ( table 4 . ) the time elapsed prior to reaching nadir sto2 values increased more in the traditional walking group when compared to the walking - with - poles group ( walking group = 4.01 5.13 minutes , walking - with - poles group = .89 3.56 minutes , p = .009 ) . similarly , absolute walking time increased more in the traditional walking group than in the walking - with - poles group ( walking group = 3.97 3.14 minutes , walking - with - poles group = 2.24 2.41 minutes , p = .017 ) . there was no difference between the two groups in initial claudication time ( walking group = 1.16 3.64 minutes , walking - with - poles group = .85 3.46 minutes , p = .69 ) . since there was a significant difference in age between the two groups , age no differences in recovery time were noted between the traditional walking and walking - with - poles groups at the 12-week follow - up time period ( traditional walking recovery time = 1.26 1.43 min , walking with poles = 1.41 1.76 min , p = .70 ) . no significant differences were identified in peak oxygen consumption or abi within or between the two groups from baseline to 12 weeks using intent - to - treat analysis or restricting the analysis to those who completed the training only .", " there are three major findings of this study : ( 1 ) the time elapsed before reaching nadir sto2 values is associated with initial claudication time and absolute walking time , ( 2 ) there was no difference in the time associated with the nadir of sto2 and the onset of claudication pain , and ( 3 ) the time to nadir sto2 of the gastrocnemius muscle was greater after 12 weeks of exercise training in the traditional walking group when compared to the walking with poles group . as bauer notes , during higher work rates and apparent blood flow limitation , muscle oxygen desaturation becomes more rapid in pad subjects . thus , one would expect that oxygen desaturation would be associated with onset of claudication and walking duration . our findings reflect these assumptions and were similar to those reported by gardner et al . , that is , shorter time to reach nadir sto2 values were associated with shorter initial claudication time and total walking duration . second , in gardner 's study , relationships between initial claudication time ( r = .339 ) , absolute walking time ( r = .68 ) and measured time to minimal exercise sto2 were similar to our relationships between initial claudication time ( r = .42 ) , absolute walking time ( r = .58 ) and measured distance to nadir sto2 . these findings suggest that our sample patients were similar to patients in other studies [ 2 , 19 ] . exercise - associated decline in sto2 of the gastrocnemius muscle was less after 12 weeks of exercise training when compared to baseline . wang and colleagues recently demonstrated in 17 subjects with pad who completed a 24-week walking program that an increase in the number of capillaries in contact with type iix and iia calf muscle fibers was related to an improved pain - free walking time ( r = .69 and r = .62 , p < .05 ) . investigators hypothesized that the ratio of capillaries to muscle fibers affects oxygen supply thus delaying the mismatch between supply and demand . both report greater exercise sto2 area under the curve postexercise training when compared to preexercise training . in our study , an increase in the time to nadir sto2 values was associated with delayed initial claudication time and improved absolute walking time . our findings provide further evidence that walking exercise improves tissue muscle oxygenation in patients with pad . likewise , our findings support the possibility that the onset of claudication and walking duration are linked by the decline in tissue oxygenation . the onset of claudication and the time elapsed prior to reaching the nadir sto2 values were nearly identical . thus , the patient 's perception of pain is a good indicator of sto2 in the calf muscle . exercise - induced decline in gastrocnemius muscle sto2 was less in patients assigned to the traditional walking program than in patients assigned to the walking - with - poles exercise training program . we had originally hypothesized that a walking training program with poles for patients would be advantageous because the poles would offload the legs during periods of claudication allowing additional walking exercise . indeed , oakley et al . investigated the immediate effects of walking with nordic poles on 20 patients with pad and found that claudication distance increased from 77 m without the poles to 130 m with the poles ( p < .0001 ) and the level of claudication pain also decreased ( p = .0002 ) . our group has also previously reported that patients had decreased calf pain when walking with poles . oakley et al . compared muscle histology of 36 patients randomly assigned to 12 weeks of treadmill training , strength training or control . after the 12 weeks , only the treadmill group had histological changes in the muscle . the increase in muscle ischemia with treadmill training was associated with a marked increase in muscle damage . hiatt suggests that skeletal muscle dysfunction and associated muscle metabolic state can be ameliorated with treadmill exercise training . tew et al . provides evidence that even when the exercising muscle is not the calf muscle , tissue oxygenation can improve . clearly , the patients assigned to the traditional walking group experienced a prolonged exercise time before experiencing claudication pain , prolonged their absolute walking time and increased the amount of time exercising until reaching nadir values . in the walking - with - poles group , there were no changes over time when an intent - to - treat approach was used . however , when the analysis was restricted to those who completed the training program only , there was a difference in absolute walking time and a trend toward increasing time to initial claudication pain onset as well as nadir sto2 . the explanation for these findings may be that leg metabolic changes in the calf muscle occurred to a greater extent in those assigned to the walking - with - poles group or we may not have had enough statistical power to detect changes that were present . another explanation for this finding may be that the intensity of our training program was based on oxygen uptake associated with heart rate response to exercise . with the addition of the upper body to the exercise regime for patients assigned to the walking - with - poles group thus , the work accomplished by the leg muscles may have been less even though overall exercise intensity was consistent between the two groups of patients . both groups trained on the treadmill and outdoors . patients assigned to the walking with poles group were unable to use the handrails on the treadmill for balance ; added anxiety may have increased the cardiovascular response thus keeping the overall work accomplished lower in some patients . first , although age was not a contributing factor to the differences between the groups , the walking - with - poles group was older than the traditional walking group . we can not exclude that the differences in exercise tolerance and willingness to push limits may differ between someone who is 67 years old ( mean age for walking group ) and someone who is 72 years old ( mean age for walking - with - poles group ) . this five - year age difference may have influenced our outcomes in ways that we did not measure . next , the sample was primarily men and thus can not be generalized to women . additionally , in order to include only those with compressible vessels , we excluded 17 patients who were initially randomized to our study . lastly , although all of our patients experienced claudication pain , not all patients stopped exercise due to claudication pain . including patients that did not stop exercise due to claudication pain additional studies examining different walking intensities in patients with peripheral arterial disease should be tested . further , it may be that use of walking poles early in the rehabilitative effort may augment traditional walking training later by assisting patients to train longer early on .", "in summary , we conclude that there is a significant decline in sto2 in the gastrocnemius muscle during walking exercise in patients with peripheral arterial disease reflecting muscle tissue ischemia . contrary to our hypothesis , after 12 weeks of exercise training , absolute walking time and time to reach nadir muscle tissue oxygenation were prolonged in the patients assigned to the traditional walking program more than those assigned to a walking - with - poles exercise training program reflecting greater tissue perfusion and enhancement of arteriovenous oxygen extraction . the precise mechanism for these differences remains unknown but these findings may provide some insight to tissue adaptations to exercise stimulus and may therefore be useful to pad rehabilitation programs ." ]

[ "access to automated dna sequencing technology has made possible the rapid generation and analysis of gene transcripts expressed in organisms via expressed sequence tags ( ests ) . this information has helped to identify those genes expressed in particular stages of development and in specialized tissues or organs . novel gene products and target leads for therapeutic intervention can also be gleaned rapidly from ests . a more detailed understanding of the molecular interactions between symbionts , whether pathogenic or mutualistic , is also possible with this approach . for a sequence isolated from interacting symbionts , determining its cellular role ( or roles ) we refer to this challenge as ' the problem ' : given a sequence x expressed in an interaction between species a and b , did x originate from a or b ? various solutions are readily conceived , each with merits and faults . here , we show that a comparative lexical analysis of word counts ( specifically , hexamer frequencies ) , previously used to detect library contamination in sequencing projects , provides a powerful computational basis to infer a transcript 's species of origin . experimentally , one can attempt to solve the problem by hybridizing a clone ( as probe ) to genomic dna ( target ) from both species and determining to which target the probe hybridizes . however , if a sequence is highly conserved in the two taxa , hybridization stringency conditions can influence the outcome considerably . for high - throughput est sequence analysis , source verification by hybridization is impractical in terms of time and reagents . as an alternative to in vitro hybridization , several computational solutions are possible . were the genome sequence of both species completely determined , one could simply use sequence similarity searching . however , most plant hosts and their microbial symbionts have little or no genomic sequence data available , which makes this approach very unreliable . strong similarity to a sequence from one organism does not preclude the possibility that a similar sequence is present in the other species . exploiting this fact may seem a viable solution to the problem , as it has proven suitable for predicting the presence of introns among exons in genomic dna . however , it really is not practical , because of the need to know the reading frame for translation of a messenger rna into an amino acid . est data are of notoriously unreliable quality , sometimes having a large proportion of ambiguous bases , and sometimes having single base - pair insertions or deletions , which disrupt a reading frame . word counting is less prone to these sources of error , and uses information intrinsic to biases in codon usage by counting codon pairs as hexamers in a sliding window , whereas codons are read in non - overlapping , tiled windows . an intuitive approach to the problem that examines sequence composition is to compare the guanine and cytosine ( gc ) base content of a sequence with other sequences from the species being studied . when two species ' genomes have different gc content , this method can be very useful . in a recent investigation , for instance , sequences from the stramenopile plant pathogen phytophthora sojae and its soybean ( glycine max ) host showed a 20% difference in mean gc content . the origin of a number of sequences could readily be identified this way , but a large proportion could not , because of considerable overlap in the distributions ' tails . counting frequencies of gc is simple word counting , where the word size k is 1/2 : only two semi - words , g / c and a / t are counted . an alternative approach to determining the origin of a sequence is suggested by previous work on analysis of word counts , or k - tuple frequencies , which was intended as a means of evaluating a library for contamination when sequencing from a single model organism . the word - counting method provides distinct advantages over other computational methods . unlike sequence - similarity searching , it does not require that the full protein - coding content of both genomes be known for reasonable inferences to be made . further , word counting is sensitive to biases in codon usage and gc content commonly observed when comparing taxa , but does not require knowledge of the reading frame for amino - acid translation . that is , the underlying differences between the two organisms that result in base composition or codon usage biases can also be detected by counting words . unlike gc analysis , lexical analysis establishes a clear threshold above or below which we can infer the species of origin , and a confidence level for an inference can readily be assigned . dunning 's likelihood - ratio test of word dissimilarities also has the appealing property of being non - parametric , having no assumption of normality for the underlying frequency distribution , which makes it statistically powerful . dunning demonstrated that unreliable results can be obtained from parametric tests , such as , particularly in such cases as lexical analysis . in the experiments detailed below , we first validate the word - counting method on sequences whose origin and function are known , then compare it with ability to diagnose the origin of sequences with distributions of gc content . we examine sequences from pathogenic interactions between species from the genus phytophthora and the plant hosts g. max and medicago truncatula , then apply the word - counting approach to sequences from two microbial mutualists in association with m. truncatula , the arbuscular mycorrhizal zygomycete glomus versiforme , and the nitrogen - fixing bacterium sinorhizobium meliloti .", "validation sequence accession numbers , gene names , and comparison results appear in table 1 . the word - counting method was generally quite reliable when tested against sequences of known origin , being wrong in 3 cases out of 50 ; a phosphate transporter from g. versiforme and two in planta - induced genes from phytophthora infestans were misidentified as plant sequences . this indicates a failure rate of 6% - all false negatives under the null hypothesis that a transcript originates from the plant host . performance of the method was not influenced by whether the isolated source of a sequence was an mrna or dna molecule , as indicated by the column labeled ' mrna ? ' . distributions of gc content are approximately normal in two of three cases studied , those of axenic p. sojae cultures ( figure 1 ) . for sequences from infected plant cultures , roughly 25% of a total of 927 infected g. max sequences contain less than 50% gc ; most of these are likely to be plant transcripts . this is a considerably greater number than for axenic p. sojae cultures , in which fewer than 5% of mycelia and zoospore isolates contain less than 50% gc . several properties of cumulative distribution functions warrant comment , to help explain similar plots from word dissimilarity comparisons ( figures 1b,2a ) . the median of a distribution occurs where the function reaches a cumulative probability of 0.5 . medians from all three p. sojae libraries are similar , varying by less than 4% gc ( figure 1b ) . other moments of the distributions are readily apparent ; the variance is inversely related to the slope at the median value of the function . a useful property of cumulative distribution functions is that any point on the y axis gives the integrated area ( cumulative probability ) under the curve . we use this property to establish experiment - wide false - positive and false - negative rates ( figure 2a ) . in this case , calibration curves from hexamer dissimilarity tests , shown in figure 2b as solid black lines for plant and dashed black lines for stramenopile training sequences are approximately normal . the medians differ considerably , with only about 10% percent overlap in the two distributions ' tails about the neutral t - value of zero . superimposed are comparison curves from p. sojae test sets ( figure 2b ) , which parallel the gc content curves in figure 1b but show slightly less variance . axenic sequences are clearly more like stramenopiles ( b1 ) than plants ( a1 ) in hexamer composition , with all but a small percentage having positive t values . plant - like sequences are as abundant in the mixed library as detected by gc content , about 23% . as expected , the two methods agree , having positively correlated values for gc and t ( r = 0.852 , p < 10 , v = 2,641 ) . looking in more detail at the paired dissimilarity values ( figure 3 ) , the magnitudes of dissimilarity are also apparent , with longer sequences having larger dissimilarity values . blastx similarity searches against the protein sequences in nr , a non - redundant library of proteins revealed that none of the 12 plant - like mycelial transcripts significantly resemble known proteins ( e > 10 ) . among the top ten most plant - like transcripts from the infected g. max library , three had no significant matches , four matched putative arabidopsis thaliana proteins , and three matched known g. max proteins : cytochrome p450 ( accession af022460 , e < 10 ) , methylglyoxalase ( accession p46417 , e < 10 ) , and a ripening related protein ( accession af127110 , e < 10 ) . thus , the majority of the most plant - like transcripts in the infected soybean library strongly resemble characterized plant sequences . analysis results from all p. sojae and mixed - culture transcripts are available as additional data files , grouped by the library from which transcripts were sequenced . figure 4 shows that calibration curves from comparing plant and microbial symbiont training sets have good separation and minimal overlap ( about 10% ) in two of three cases , but not for training set b2 , comprised of zygomycetes and chytridiomycetes , which overlaps considerably with plants ( figure 4b ) . when comparing between plants and bacteria , the error rates are = 0.052 and = 0.084 , much lower than when comparing plants ( a2 , medicago ) with fungi ( b2 , zygomycetes and chytridiomycetes ) . error rates for comparing stramenopiles and p. infestans ests with plants are as in figure 2 ( = 0.088 , = 0.032 ) . also shown in figure 4 all resemble calibration curves from plant sequences , having similar medians and slightly less variance than the plant calibration curves . comparison curves show that the great majority of test sequences are more plant - like than otherwise , with 20% or less resembling microbial symbionts more closely than plants . a greater proportion of microbial sequences is present in the m. truncatula - g . versiforme interaction library ( 20% , figure 4b ) than in the p. medicaginis - infected m. truncatula library ( 5% , figure 4a ) . however , long 's root - hair enriched library ( mtrhe ) had a greater proportion of putative microbial sequences present ( 7% and 25% ) than any of the libraries isolated from symbiont - associated cultures . the axenic and nodulating root libraries had the smallest portion of putative microbial transcripts ( < 2% , figure 4c ) , with the axenic library closely resembling nodulating root libraries . the method of preparing a library can affect the proportion of plant and non - plant sequences , as discussed below . paired dissimilarity values in figure 5 show in greater detail which sequences are more or less like plant and symbiont . considerable variation in the degree of dissimilarity to both training sets is clear , largely due to variation in the length of sequences within test sets . d(b ) in figure 4 , most sequences lie above the identity function , and resemble the plant host more closely than the microbial symbiont . mycorrhizal test sequences are more difficult to differentiate than sequences from the rhizobacterial or pathogenic associations , as seen by the diminished variation about the identity function in mycorrhizal comparisons ( figure 5b ) , contrasted with comparisons from pathogen - infected and nodulating root libraries ( figures 5a and c , respectively ) . analysis results from all m. truncatula and mixed - culture transcripts are available as additional data files , grouped by the library from which transcripts were sequenced , and sorted from the least plant - like transcripts to the most plant - like .", "clearly , the word - counting approach provides a reliable solution to the problem of source identification with known confidence , and has several significant advantages . the reliability of the method is best justified in terms of the favorable validation test results , and is further corroborated by agreement with an analysis of gc content . in test cases where the correct answer is known a priori , results were correct within error rates expected from overlap in training sets . ( recall that = 0.088 for comparisons between plants and stramenopiles , and = 0.052 for comparisons between plants and bacteria . ) unlike gc content , the problem is clearly resolved by word counting with a threshold value of t = 0 , and with statistical rigor , because false - positive and false - negative rates for a set of comparisons are readily computed from cumulative distributions of dissimilarity between two training sets . optimal statistical power ( minimal false - negative rate ) is ensured when using a likelihood - ratio test statistic , as demonstrated by the pearson - neyman theorem . rather , it is sufficient that the training set be related to , but not necessarily congeners of , the species from which sequences are being compared . sequences from several species of the genus phytophthora were correctly distinguished from plant and bacterial sequences , and three genes from agrobacterium tumefaciens were correctly identified as representing a bacterial sequence . however , several caveats warrant prudence . transcribed sequences that do not encode proteins , but rather catalytic single - stranded rnas such as transfer and ribosomal rnas , should be treated independently because they are more highly conserved across taxa than messenger rnas . also , filtering or trimming of low - complexity repeat regions , such as poly(a ) or poly(t ) tracts , is helpful because comparison results can be influenced by the abundance of a single hexamer . early in our investigations , using one set of training sequences obtained from directionally cloned p. it eventually became clear that , as the p. infestans sequences were all single - pass reads from the 5 ' end of a clone generated with the t3 primer , few sequences complementary to the 3 ' end of the mrna sequence were present in the training set . large amounts of the poly(t ) hexamer would be expected when sequencing reverse complements of mrnas obtained from 3 ' sequences generated with the t7 primer . as a result , any sequence that contained a poly(t ) tract tended to resemble the plant sequences . further , because the error rates for an inference depend on the degree to which calibration curves overlap , the best results are obtained where overlap is minimal . despite these caveats , word counting presents a viable solution to the problem . the p. sojae - infected g. max library provides a clear example of contrast in both hexamer composition and gc content , resulting in readily diagnosed origins . for clear separation between the two species to appear , the two must differ in composition and a detectable proportion of transcripts from each species must be present in the library . to be detectable , the proportion of transcripts present from a particular species must be greater than the error rate obtained from calibration curves . though these criteria are true for the infected g. max library ( t < 0 for < 25% of 927 transcripts ) , they do not appear to be true for the m. truncatula libraries we analyzed ( t < 0 for 8099% of 8903,017 transcripts ) . in the p. medicaginis interaction library the p. sojae - infected library was prepared two days after infection , using a susceptible plant host strain , so as to maximize the number of pathogen transcripts present in the host tissue . medicaginis - infected library was prepared ten days after infection and individual plants varied in their degree of susceptibility ( c. vance , unpublished data ) . plants were also inoculated in a different manner : ground mycelia were dissolved in sterile water and incubated , and the resulting inoculum was pipetted onto the soil surface , rather than the plant . these differences in how tissues were cultured prior to library preparation could have produced the disparate abundance of plant transcripts , though both libraries were prepared from plant tissues infected with phytophthora . for mycorrhizal root libraries , we might explain the relative lack of symbiont sequences as resulting simply from a relative lack of transcripts in the host tissue . we might therefore expect that most of the transcripts therein originate from the plant host . confounding this result , the error rates in this comparison are the greatest among all the comparisons we performed , most likely because the evolutionary distance between fungi ( zygomycetes and chytridiomycetes ) and plants is the least among comparisons . also , zygomycete protein - coding sequences are rare in genbank , which resulted in a small training set for these fungi , and may have amplified any biases . the high false - negative rate probably led to a failure to detect some symbiont transcripts . in nodulating root libraries , we do not expect to observe an abundance of bacterial transcripts , because bacteria generally do not form polyadenylated mrnas . as the protocols used to extract and purify mrnas from tissue lysate for the libraries cited in this study all relied on the presence of polyadenylation sites the abundance of putative microbial symbiont transcripts among sequences from a pure plant root library is difficult to interpret . the predicted portion of microbial transcripts was greater in the axenic root - hair enriched library than in mixed cultures . error rates were greatest for comparisons between training sets from plant and pooled zygomycete and chytridiomycete sequences . the 13% false - positive rate does not completely explain why about 15% of root - hair enriched transcripts resemble fungal hexamer composition more closely than plants , and warrants further study . care had been taken to avoid contaminating plant tissue cultures by culturing seedlings in covered plates . because of concern that ethylene accumulation in covered plates could improperly stimulate nodulation - related gene expression , seedlings were treated with ag2so4 , an inhibitor of the plants ' response to ethylene . inhibition of the ethylene response could have resulted in synthesis of transcripts that are uncharacteristic of plant roots . analysis of another axenic root - hair enriched library , particularly one provided a carbon source to identify potential contaminants , and not treated with an inhibitor of ethylene response , would be an informative test . the transcripts identified as most and least like plant or symbiont might also be studied in more detail as candidate participants in symbiosis . symbiotic interactions , whether pathogenic or mutualistic , present novel challenges to both plant hosts and the biologists who study them . computational approaches , in concert with experimental verification , can help resolve these challenges .", "to characterize hexamer frequencies in plant hosts and their microbial symbionts , we collected sets of training sequences from public databases and edited them for quality . training sets were chosen to be representative of , but obtained independently from , taxa participating in symbiotic associations for which a diagnosis of origin would be made . because the species being compared are represented unevenly in public sequence databases , taxa were chosen so that roughly the same number of genes were analyzed in each training set , rather than simply to maximize the numbers of species or sequences present . training sets represent protein - coding sequences from three taxonomic groupings : plants ( a1 , medicago and glycine spp . ) , either fungi ( b2 , zygomycetes and chytridiomycetes ) or stramenopiles ( b1 ) , including ests from p. infestans , and bacteria ( b3 , rhizobium , sinorhizobium and bradyrhizobium ) . we performed pairwise comparisons with two different , taxon - specific training sets ( a and b ) to infer the origin of a transcript . training sets were obtained by querying the genbank database using the entrez retrieval tool . a preliminary query by taxon name obtained all available nucleotide sequences from that taxon , then the limits option excluded ests , stss ( sequence - tagged sites ) , gsss ( genome survey sequences ) , working draft sequences , and patented sequences from the query set . organellar ( mitochondrial and chloroplast ) dna was also excluded via the limits option . a query term to require that a sequence contain a protein - coding region ( cds ) was also added , which excluded ribosomal and transfer rna sequences . the results consisted of all sequences that contain a nuclear protein - coding sequence available for that taxon at the time of the query . ( changing slightly the composition of training sets between those dates did not notably affect the experimental outcome . ) following a previously established protocol , we used a resampling procedure to evaluate the degree of overlap between distributions of hexamer composition obtained from comparing two training sets . in this protocol , we resampled each training set 40 times by random partitioning into training ( for hexamer counts ) and test calculation pools . to control for any bias introduced by length variation , a program randomly clipped 300 nucleotide fragments for word counting . as a result , one random 300 nucleotide fragment from each training sequence was present in the training set during a single resampling replicate ; independent replicates contained different , randomly chosen training sequences and 300 nucleotide fragments . values of the test statistic from 40 resampled replicates were pooled for calibration purposes . as with the original protocol , we pooled the resulting test statistic distributions , normalized them as cumulative distributions , and then evaluated them for overlap . we call the resulting comparisons ' calibration curves ' , as they are not used directly to make inferences , but rather indirectly , to evaluate the degree of separation in hexamer counts from different taxa . overlap of calibration curves should be minimal to yield the most statistically powerful results possible . due to considerable overlap of calibration curves between taxonomically general , inclusive training sets ( that is , all eudicots , all fungi and miscellaneous eukaryotes , and all eubacteria , data not shown ) , we opted to work with specific training sets that included only the most species - specific sequences available , while maintaining approximately equal sample sizes across taxa . the most challenging case was that of the arbuscular mycorrhizal fungi , for which very few protein - coding sequences are available . to increase the amount of data in this training set ( b2 ) without biasing sample sizes , we pooled sequences from all species in the zygomycetes with all available chytridiomycete coding sequences , and compared this training set with a set from a single plant genus , medicago ( a2 ) . we chose this option , rather than including an arbitrary subset of sequences from the ascomycetes and basidiomycetes , because zygomycetes and chytridiomycetes have diverged from their common ancestor less recently than the ascomycetes and basidiomycetes , based on 18s ribosomal rna sequence data . that is , the ascomycetes and basidiomycetes are more highly derived from the common fungal ancestor than zygomycetes and chytridiomycetes , which resemble more closely the ancestral state in modern lineages . starting with a full set of sequences , we filtered for high - quality sequences by trimming regions having extensive ambiguous bases ( n - rich ) and poly(a ) or poly(t ) regions . thus , we trimmed poly(a ) and poly(t ) sites to minimize the cases in which a test sequence resembles one training set more closely than the other , simply by virtue of having an abundance of the hexamer aaaaaa or tttttt . similarly , test results obtained from short or n - rich sequences can be difficult to interpret . we allowed no more than one n per hexamer and trimmed poly(a ) or poly(t ) tracts longer than 13 nucleotides . to accommodate for possible sequence chimeras , those sequences found to contain an internal poly(a ) or poly(t ) segment longer than 13 nucleotides were partitioned into two fragments , and the longer of the two fragments was used in analysis , provided its length was at least 300 nucleotides . after trimming , we screened all remaining sequences of 300 nt or longer for similarity to escherichia coli using blastn . all blast searches used default parameters and low - complexity filtering with the programs dust or seg . the decision to exclude non - coding rna sequences from training sets was informed by the appearance of bimodal distributions of hexamer frequencies and a large degree of overlap between calibration curves ( data not shown ) , likely a result of divergent evolutionary rates between protein - coding and non - coding sequences . chloroplast and mitochondrial sequences were eliminated to avoid complications due to variation in codon usage between nuclear and organellar genomes . table 2 summarizes counts of sequences and nucleotides in training sets before and after trimming and screening . to test the validity of word counting as a solution to the problem , we identified a set of 50 gene sequences from plants ( m. truncatula and g. max ) , oomycetes ( phytophthora ) , zygomycetes ( glomus versiforme ) , and bacteria ( sinorhizobium meliloti and agrobacterium tumefaciens ) , for which the function and origin have been characterized experimentally . we chose genes known to play a role in plant - microbe interactions , as well as genes that are found across taxa . we withheld these sequences , and partial transcripts of the same genes , from training sets prior to comparative lexical analysis , and calculated hexamer dissimilarities for each of the three training sets as described below . to diagnose the species of origin for sequences expressed in symbiotic cultures , we collected sequences generated by distinct est sequencing projects from the genbank database . sequences from pathogenic interactions originated from cultures of a species from the genus phytophthora with its plant host , such as p. sojae and soybean ( g. max ) isolated from inoculated hypocotyls two days after infection and p. medicaginis and m. truncatula isolated from infected roots 10 days after infection ( c. vance , unpublished data ) . sequences expressed during mutualistic interactions were obtained from cultures with m. truncatula and mycorrhizal ( glomus versiforme ; m.j . harrison , unpublished data ) or rhizobacterial ( s. meliloti ; k. vandenbosch , unpublished data ) endosymbionts several days after inoculation . sequences expressed in pure , axenic cultures from p. sojae mycelia and zoospores and from sterile , uninoculated m. truncatula roots provided a basis for comparison in which no foreign transcripts were expected . to maximize the reliability of diagnostic comparisons , we screened test sequences for high quality as for training sequences , and for low similarity to e. coli , chloroplast and mitochondrial genes , and non - coding rna transcripts ( ribosomal and transfer rnas ) . independent blastn comparisons identified sequences having very high similarity ( e < 10 ) to vector sequences or moderately high similarity ( e < 10 ) to non - nuclear or non - coding sequences obtained from genbank . we wrote a perl program ( countgc.pl ) that calculates the gc base content of a sequence as the portion of guanine and cytosine residues among all unambiguous ( non - n ) nucleotides in a sequence . the hist method in r , version 1.1.1 aggregated continuous percentages into discrete histogram bins , using bin sizes of 2% difference in gc , with inclusive lower bin boundaries and exclusive upper bounds ; the lm method tested for linear correlation of the dissimilarity test statistic t with gc . used a likelihood - ratio test to determine whether word frequencies from a particular sequence more closely resemble the frequency distribution of control data sets from the taxon being sequenced or a distantly related outgroup . they computed a test statistic t(a , b , x ) for each sequence x as the difference of log - likelihood ratio dissimilarity measures , d(a , x ) = -2log(a , x ) , for two data sets , a control set a and an outgroup b , such that t(a , b , x ) = d(a , x ) - d(b , x ) . a negative value for t indicates that the sequence more closely resembles words from a ; conversely , a positive value indicates a likely contaminant related to b. ( dissimilarity is conceptually related to distance . however , dissimilarity does not measure distance because it does not possess the mathematical properties of a distance metric . ) unlike the calculation of calibration curves , in which 300-nucleotide subsequences are randomly resampled , hexamer dissimilarity is measured over the whole length of a test sequence when inferring a transcript 's origin . originally , the investigators used the null hypothesis that no difference exists for dissimilarity measures between the two data sets , or that t(a , b , x ) = 0 . tested two alternative hypotheses : that t < 0 , being more like a , or t > 0 , like b. lexical analysis using pentamers or heptamers yields similar error rates and very highly correlated values for the test result ( not shown ) . because white et al . reported the best results were obtained using hexamers , and because a word size of six nucleotides corresponds to the size of a dicodon , we chose to analyze hexamer frequencies . to use longer words requires more training data , because the number of possible words increases exponentially with increasing word size . use of shorter words may be adequate for some applications and will be investigated in future work . though we used white 's word - counting methods , we did make slight modifications . we simplified one program ( called hybridize ) to compute individual dissimilarity values , rather than paired differences ; a patch that details how to modify the c program is available ( see hyb2dis.txt in additional data files ) . more importantly , we amended the null hypothesis and interpreted calibration curves to test for statistically significant dissimilarity differences . though the likelihood - ratio test statistic indicates the magnitude of similarity to a or b , we do not know what values for t are significant with known confidence . when testing hypotheses , one can make two types of error : type i , or false positives , and type ii , false negatives . the false - positive rate is denoted and false - negative rate . we determine and from overlap in the calibration curves . inferring error rates from calibration curves is justified because we know the correct answer and determine the error rate via resampling , as with bootstrap methods to infer error rates or confidence intervals . we are interested in knowing from which of two organisms a sequence originated , and are reasonably confident that it came from either one or the other . thus , we assume it came from one and test whether we have evidence to refute this assumption . the null hypothesis here is that sequence x is from a. alternatively , it might be from b. evaluating the calibration curve overlap at t = 0 quantifies the associated error rates . the cumulative distribution function ( cdf ) of taxon b specifies where cdfb intersects 0 ; the cdf from a specifies as 1-cdfa(0 ) . we can thus resolve the problem with known confidence p : p ( t > 0 ) = . all other computations were performed as described previously . software used for lexical analysis was obtained via anonymous ftp from the tigr software ftp site .", "to characterize hexamer frequencies in plant hosts and their microbial symbionts , we collected sets of training sequences from public databases and edited them for quality . training sets were chosen to be representative of , but obtained independently from , taxa participating in symbiotic associations for which a diagnosis of origin would be made . because the species being compared are represented unevenly in public sequence databases , taxa were chosen so that roughly the same number of genes were analyzed in each training set , rather than simply to maximize the numbers of species or sequences present . training sets represent protein - coding sequences from three taxonomic groupings : plants ( a1 , medicago and glycine spp . ) , either fungi ( b2 , zygomycetes and chytridiomycetes ) or stramenopiles ( b1 ) , including ests from p. infestans , and bacteria ( b3 , rhizobium , sinorhizobium and bradyrhizobium ) . we performed pairwise comparisons with two different , taxon - specific training sets ( a and b ) to infer the origin of a transcript . training sets were obtained by querying the genbank database using the entrez retrieval tool . a preliminary query by taxon name obtained all available nucleotide sequences from that taxon , then the limits option excluded ests , stss ( sequence - tagged sites ) , gsss ( genome survey sequences ) , working draft sequences , and patented sequences from the query set . organellar ( mitochondrial and chloroplast ) dna was also excluded via the limits option . a query term to require that a sequence contain a protein - coding region ( cds ) was also added , which excluded ribosomal and transfer rna sequences . the results consisted of all sequences that contain a nuclear protein - coding sequence available for that taxon at the time of the query . ( changing slightly the composition of training sets between those dates did not notably affect the experimental outcome . ) following a previously established protocol , we used a resampling procedure to evaluate the degree of overlap between distributions of hexamer composition obtained from comparing two training sets . in this protocol , we resampled each training set 40 times by random partitioning into training ( for hexamer counts ) and test calculation pools . to control for any bias introduced by length variation , a program randomly clipped 300 nucleotide fragments for word counting . as a result , one random 300 nucleotide fragment from each training sequence was present in the training set during a single resampling replicate ; independent replicates contained different , randomly chosen training sequences and 300 nucleotide fragments . values of the test statistic from 40 resampled replicates were pooled for calibration purposes . as with the original protocol , we pooled the resulting test statistic distributions , normalized them as cumulative distributions , and then evaluated them for overlap . we call the resulting comparisons ' calibration curves ' , as they are not used directly to make inferences , but rather indirectly , to evaluate the degree of separation in hexamer counts from different taxa . overlap of calibration curves should be minimal to yield the most statistically powerful results possible . due to considerable overlap of calibration curves between taxonomically general , inclusive training sets ( that is , all eudicots , all fungi and miscellaneous eukaryotes , and all eubacteria , data not shown ) , we opted to work with specific training sets that included only the most species - specific sequences available , while maintaining approximately equal sample sizes across taxa . the most challenging case was that of the arbuscular mycorrhizal fungi , for which very few protein - coding sequences are available . to increase the amount of data in this training set ( b2 ) without biasing sample sizes , we pooled sequences from all species in the zygomycetes with all available chytridiomycete coding sequences , and compared this training set with a set from a single plant genus , medicago ( a2 ) . we chose this option , rather than including an arbitrary subset of sequences from the ascomycetes and basidiomycetes , because zygomycetes and chytridiomycetes have diverged from their common ancestor less recently than the ascomycetes and basidiomycetes , based on 18s ribosomal rna sequence data . that is , the ascomycetes and basidiomycetes are more highly derived from the common fungal ancestor than zygomycetes and chytridiomycetes , which resemble more closely the ancestral state in modern lineages . starting with a full set of sequences , we filtered for high - quality sequences by trimming regions having extensive ambiguous bases ( n - rich ) and poly(a ) or poly(t ) regions . thus , we trimmed poly(a ) and poly(t ) sites to minimize the cases in which a test sequence resembles one training set more closely than the other , simply by virtue of having an abundance of the hexamer aaaaaa or tttttt . similarly , test results obtained from short or n - rich sequences can be difficult to interpret . we allowed no more than one n per hexamer and trimmed poly(a ) or poly(t ) tracts longer than 13 nucleotides . to accommodate for possible sequence chimeras , those sequences found to contain an internal poly(a ) or poly(t ) segment longer than 13 nucleotides were partitioned into two fragments , and the longer of the two fragments was used in analysis , provided its length was at least 300 nucleotides . after trimming , we screened all remaining sequences of 300 nt or longer for similarity to escherichia coli using blastn . all blast searches used default parameters and low - complexity filtering with the programs dust or seg . the decision to exclude non - coding rna sequences from training sets was informed by the appearance of bimodal distributions of hexamer frequencies and a large degree of overlap between calibration curves ( data not shown ) , likely a result of divergent evolutionary rates between protein - coding and non - coding sequences . chloroplast and mitochondrial sequences were eliminated to avoid complications due to variation in codon usage between nuclear and organellar genomes . table 2 summarizes counts of sequences and nucleotides in training sets before and after trimming and screening . to test the validity of word counting as a solution to the problem , we identified a set of 50 gene sequences from plants ( m. truncatula and g. max ) , oomycetes ( phytophthora ) , zygomycetes ( glomus versiforme ) , and bacteria ( sinorhizobium meliloti and agrobacterium tumefaciens ) , for which the function and origin have been characterized experimentally . we chose genes known to play a role in plant - microbe interactions , as well as genes that are found across taxa . we withheld these sequences , and partial transcripts of the same genes , from training sets prior to comparative lexical analysis , and calculated hexamer dissimilarities for each of the three training sets as described below .", "to characterize hexamer frequencies in plant hosts and their microbial symbionts , we collected sets of training sequences from public databases and edited them for quality . training sets were chosen to be representative of , but obtained independently from , taxa participating in symbiotic associations for which a diagnosis of origin would be made . because the species being compared are represented unevenly in public sequence databases , taxa were chosen so that roughly the same number of genes were analyzed in each training set , rather than simply to maximize the numbers of species or sequences present . training sets represent protein - coding sequences from three taxonomic groupings : plants ( a1 , medicago and glycine spp . ) , either fungi ( b2 , zygomycetes and chytridiomycetes ) or stramenopiles ( b1 ) , including ests from p. infestans , and bacteria ( b3 , rhizobium , sinorhizobium and bradyrhizobium ) . we performed pairwise comparisons with two different , taxon - specific training sets ( a and b ) to infer the origin of a transcript . training sets were obtained by querying the genbank database using the entrez retrieval tool . a preliminary query by taxon name obtained all available nucleotide sequences from that taxon , then the limits option excluded ests , stss ( sequence - tagged sites ) , gsss ( genome survey sequences ) , working draft sequences , and patented sequences from the query set . organellar ( mitochondrial and chloroplast ) dna was also excluded via the limits option . a query term to require that a sequence contain a protein - coding region ( cds ) was also added , which excluded ribosomal and transfer rna sequences . the results consisted of all sequences that contain a nuclear protein - coding sequence available for that taxon at the time of the query . ( changing slightly the composition of training sets between those dates did not notably affect the experimental outcome . ) following a previously established protocol , we used a resampling procedure to evaluate the degree of overlap between distributions of hexamer composition obtained from comparing two training sets . in this protocol , we resampled each training set 40 times by random partitioning into training ( for hexamer counts ) and test calculation pools . to control for any bias introduced by length variation , a program randomly clipped 300 nucleotide fragments for word counting . as a result , one random 300 nucleotide fragment from each training sequence was present in the training set during a single resampling replicate ; independent replicates contained different , randomly chosen training sequences and 300 nucleotide fragments . values of the test statistic from 40 resampled replicates were pooled for calibration purposes . as with the original protocol , we pooled the resulting test statistic distributions , normalized them as cumulative distributions , and then evaluated them for overlap . we call the resulting comparisons ' calibration curves ' , as they are not used directly to make inferences , but rather indirectly , to evaluate the degree of separation in hexamer counts from different taxa . overlap of calibration curves should be minimal to yield the most statistically powerful results possible . due to considerable overlap of calibration curves between taxonomically general , inclusive training sets ( that is , all eudicots , all fungi and miscellaneous eukaryotes , and all eubacteria , data not shown ) , we opted to work with specific training sets that included only the most species - specific sequences available , while maintaining approximately equal sample sizes across taxa . the most challenging case was that of the arbuscular mycorrhizal fungi , for which very few protein - coding sequences are available . to increase the amount of data in this training set ( b2 ) without biasing sample sizes , we pooled sequences from all species in the zygomycetes with all available chytridiomycete coding sequences , and compared this training set with a set from a single plant genus , medicago ( a2 ) . we chose this option , rather than including an arbitrary subset of sequences from the ascomycetes and basidiomycetes , because zygomycetes and chytridiomycetes have diverged from their common ancestor less recently than the ascomycetes and basidiomycetes , based on 18s ribosomal rna sequence data . that is , the ascomycetes and basidiomycetes are more highly derived from the common fungal ancestor than zygomycetes and chytridiomycetes , which resemble more closely the ancestral state in modern lineages .", "starting with a full set of sequences , we filtered for high - quality sequences by trimming regions having extensive ambiguous bases ( n - rich ) and poly(a ) or poly(t ) regions . thus , we trimmed poly(a ) and poly(t ) sites to minimize the cases in which a test sequence resembles one training set more closely than the other , simply by virtue of having an abundance of the hexamer aaaaaa or tttttt . similarly , test results obtained from short or n - rich sequences can be difficult to interpret . we allowed no more than one n per hexamer and trimmed poly(a ) or poly(t ) tracts longer than 13 nucleotides . to accommodate for possible sequence chimeras , those sequences found to contain an internal poly(a ) or poly(t ) segment longer than 13 nucleotides were partitioned into two fragments , and the longer of the two fragments was used in analysis , provided its length was at least 300 nucleotides . after trimming , we screened all remaining sequences of 300 nt or longer for similarity to escherichia coli using blastn . all blast searches used default parameters and low - complexity filtering with the programs dust or seg . the decision to exclude non - coding rna sequences from training sets was informed by the appearance of bimodal distributions of hexamer frequencies and a large degree of overlap between calibration curves ( data not shown ) , likely a result of divergent evolutionary rates between protein - coding and non - coding sequences . chloroplast and mitochondrial sequences were eliminated to avoid complications due to variation in codon usage between nuclear and organellar genomes . table 2 summarizes counts of sequences and nucleotides in training sets before and after trimming and screening .", "to test the validity of word counting as a solution to the problem , we identified a set of 50 gene sequences from plants ( m. truncatula and g. max ) , oomycetes ( phytophthora ) , zygomycetes ( glomus versiforme ) , and bacteria ( sinorhizobium meliloti and agrobacterium tumefaciens ) , for which the function and origin have been characterized experimentally . we chose genes known to play a role in plant - microbe interactions , as well as genes that are found across taxa . we withheld these sequences , and partial transcripts of the same genes , from training sets prior to comparative lexical analysis , and calculated hexamer dissimilarities for each of the three training sets as described below .", "to diagnose the species of origin for sequences expressed in symbiotic cultures , we collected sequences generated by distinct est sequencing projects from the genbank database . sequences from pathogenic interactions originated from cultures of a species from the genus phytophthora with its plant host , such as p. sojae and soybean ( g. max ) isolated from inoculated hypocotyls two days after infection and p. medicaginis and m. truncatula isolated from infected roots 10 days after infection ( c. vance , unpublished data ) . sequences expressed during mutualistic interactions were obtained from cultures with m. truncatula and mycorrhizal ( glomus versiforme ; m.j . harrison , unpublished data ) or rhizobacterial ( s. meliloti ; k. vandenbosch , unpublished data ) endosymbionts several days after inoculation . sequences expressed in pure , axenic cultures from p. sojae mycelia and zoospores and from sterile , uninoculated m. truncatula roots provided a basis for comparison in which no foreign transcripts were expected . to maximize the reliability of diagnostic comparisons , we screened test sequences for high quality as for training sequences , and for low similarity to e. coli , chloroplast and mitochondrial genes , and non - coding rna transcripts ( ribosomal and transfer rnas ) . independent blastn comparisons identified sequences having very high similarity ( e < 10 ) to vector sequences or moderately high similarity ( e < 10 ) to non - nuclear or non - coding sequences obtained from genbank .", "we wrote a perl program ( countgc.pl ) that calculates the gc base content of a sequence as the portion of guanine and cytosine residues among all unambiguous ( non - n ) nucleotides in a sequence . the hist method in r , version 1.1.1 aggregated continuous percentages into discrete histogram bins , using bin sizes of 2% difference in gc , with inclusive lower bin boundaries and exclusive upper bounds ; the lm method tested for linear correlation of the dissimilarity test statistic t with gc .", "white et al . used a likelihood - ratio test to determine whether word frequencies from a particular sequence more closely resemble the frequency distribution of control data sets from the taxon being sequenced or a distantly related outgroup . they computed a test statistic t(a , b , x ) for each sequence x as the difference of log - likelihood ratio dissimilarity measures , d(a , x ) = -2log(a , x ) , for two data sets , a control set a and an outgroup b , such that t(a , b , x ) = d(a , x ) - d(b , x ) . a negative value for t indicates that the sequence more closely resembles words from a ; conversely , a positive value indicates a likely contaminant related to b. ( dissimilarity is conceptually related to distance . however , dissimilarity does not measure distance because it does not possess the mathematical properties of a distance metric . ) unlike the calculation of calibration curves , in which 300-nucleotide subsequences are randomly resampled , hexamer dissimilarity is measured over the whole length of a test sequence when inferring a transcript 's origin . originally , the investigators used the null hypothesis that no difference exists for dissimilarity measures between the two data sets , or that t(a , b , x ) = 0 . white et al . tested two alternative hypotheses : that t < 0 , being more like a , or t > 0 , like b. lexical analysis using pentamers or heptamers yields similar error rates and very highly correlated values for the test result ( not shown ) . because white et al . reported the best results were obtained using hexamers , and because a word size of six nucleotides corresponds to the size of a dicodon , we chose to analyze hexamer frequencies . to use longer words requires more training data , because the number of possible words increases exponentially with increasing word size . use of shorter words may be adequate for some applications and will be investigated in future work . though we used white 's word - counting methods , we did make slight modifications . we simplified one program ( called hybridize ) to compute individual dissimilarity values , rather than paired differences ; a patch that details how to modify the c program is available ( see hyb2dis.txt in additional data files ) . more importantly , we amended the null hypothesis and interpreted calibration curves to test for statistically significant dissimilarity differences . though the likelihood - ratio test statistic indicates the magnitude of similarity to a or b , we do not know what values for t are significant with known confidence . when testing hypotheses , one can make two types of error : type i , or false positives , and type ii , false negatives . the false - positive rate is denoted and false - negative rate . we determine and from overlap in the calibration curves . inferring error rates from calibration curves is justified because we know the correct answer and determine the error rate via resampling , as with bootstrap methods to infer error rates or confidence intervals . we are interested in knowing from which of two organisms a sequence originated , and are reasonably confident that it came from either one or the other . thus , we assume it came from one and test whether we have evidence to refute this assumption . the null hypothesis here is that sequence x is from a. alternatively , it might be from b. evaluating the calibration curve overlap at t = 0 quantifies the associated error rates . the cumulative distribution function ( cdf ) of taxon b specifies where cdfb intersects 0 ; the cdf from a specifies as 1-cdfa(0 ) . we can thus resolve the problem with known confidence p : p ( t > 0 ) = . all other computations were performed as described previously . software used for lexical analysis was obtained via anonymous ftp from the tigr software ftp site .", "the following files are available for download : countgc.pl : perl script used to compute gc content of sequences analyzed . hyb2dis.txt : patch file that converts white 's hybridize program to compute individual dissimilarity values . training sets ( glycinemedicago.txt,rhizobia.txt , stramenopiles.txt , zygochytrid.txt ) : fasta - formatted text files that contain the sequences used for calibration and comparison . test sets ( psojaeha.txt , psojaemy.txt , psojaezo.txt , mtrhe.txt , dsir.txt , mham.txt , kv0.txt , kv2.txt , kv3.txt ) : fasta - formatted text files containing transcripts analyzed , edited for quality . test results ( psojaeha.dat , psojaemy.dat , psojaezo.dat , mtrhe-a1b1.dat , mtrhe-a2b2.dat , dsir.dat , mham.dat , kv0.dat , kv2.dat , kv3.dat ) : text files that contain transcript analysis results , sorted from least to most plant - like .", "fasta - formatted text files containing transcripts analyzed , edited for quality . text files that contain transcript analysis results , sorted from least to most plant - like .", "we thank callum bell , mark gijzen , maria harrison , tom kepler , deb samac , and bruno sobral for valued discussions and feedback . comments from b. m. tyler and an anonymous reviewer on an earlier version of this work greatly enhanced its presentation .", "distribution of gc content in pure and mixed - culture libraries . ( a ) probability densities for histogram bin sizes of 0.02 ( 2% ) in base content . ( a ) calculation of statistical parameters from cdfs a and b. overlap in the upper tail of cdfa with cdfb and the lower tail of cdfb with cdfa are likely regions for error . we find the false - positive rate where 1 - cdfa intersects 0 [ cdfa(0)= 1 - ] , and the false - negative rate where cdfb crosses 0 . also shown are the medians ( ) for each distribution , where cdf( ) = 0.5 . , solid black line ) and stramenopile plus p. infestans est ( b1 , dashed black line ) training sequences . superimposed distributions of test results show dissimilarity differences for infected g. max ( green ) and axenic p. sojae mycelial and zoospore sequences ( blue and cyan , respectively ) . each point corresponds to an expressed tag from either ( a ) infected g. max or ( b ) axenic p. sojae mycelial or ( c ) zoospore sequences , compared with plant ( a1 ) and stramenopile plus p. infestans est training sequences ( b1 ) . the identity function indicates equal dissimilarity to both training sets , t = d(a ) - d(b)= 0 . calibration curves compare plant training sets ( a1 and a2 , solid black lines ) with one of three microbial symbiont training sets ( broken black lines ) : ( a ) stramenopile and p. infestans est sequences ( b1 ) ; ( b ) pooled zygomycete and chytridiomycete coding sequences ( b2 ) ; and ( c ) sequences from the genera rhizobium , sinorhizobium and bradyrhizobium ( b3 ) . cumulative distributions of test results from m. truncatula axenic and microbial symbiont mixed cultures appear in each panel ( colored lines ) . each point indicates the dissimilarity of a test sequence compared with a plant training set ( a1 or a2 ) and one of three microbial symbiont training sets : ( a ) stramenopile and p. infestans est sequences ( b1 ) ; ( b ) pooled zygomycete and chytridiomycete coding sequences ( b2 ) ; and ( c ) sequences from the genera rhizobium , sinorhizobium and bradyrhizobium ( b3 ) . sequences from m. truncatula axenic ( green ) and microbial symbiont mixed culture libraries are represented in each panel . number of sequences ( n ) and nucleotides ( nt ) , as raw , trimmed ( removed n - rich regions , poly(a ) and poly(t ) sites ) , and screened sequences ( removed ribosomal , chloroplast , and mitochondrial dna and remaining sequences shorter than 300 nucleotides ) . number of est sequences ( n ) and nucleotides ( nt ) as raw , trimmed ( limited lengths of n - rich regions , poly(a ) and poly(t ) sites ) , and screened ( removed ribosomal , chloroplast , and mitochondrial dna , and remaining sequences shorter than 300 nt ) sequences ." ]

[ "the transition - metal - catalyzed \n amination of aryl halides has become \n one of the most powerful methods to construct arylamines . the development of methods to couple aryl halides \n with amines has been studied extensively in the past decade . palladium - catalyzed reactions occur with a broad scope of both coupling \n partners , high functional group tolerance , and good selectivity for \n monoarylation of the amine nucleophile . both the palladium metal and the \n ligands used for this reaction are costly , and the ligand is difficult \n to recycle . for these types of reasons , much interest has been \n paid recently \n to develop reactions catalyzed by first - row metal complexes that are \n typically catalyzed by precious metals . for example , copper complexes \n have been studied extensively for the coupling of aryl iodides , and \n to a lesser extent aryl bromides , with nitrogen nucleophiles . yet , the scope of such coupling with electron - rich \n bromoarenes , ortho - substituted bromoarenes , unactivated aryl chlorides , \n and heteroaryl halides is limited . many of the first - row metals \n are more electropositive than those \n of the second row and form electron - rich low - valent species . indeed , \n nickel complexes have been shown to catalyze the amination of aryl \n chlorides and phenol derivatives ( scheme 1 ) . such nickel - catalyzed amination reactions could be more practical \n than palladium - catalyzed amination reactions on large scale because \n the metal is much less expensive , and much simpler ligands on the \n nickel center are needed for the catalyst to react with aryl chlorides . \n for example , hidai showed over 40 years ago that ni(pph3)4 adds phenyl chloride at room temperature to form ( pph3)2ni(ph)(cl ) , whereas pd(pph3)4 does not react with aryl chlorides . however , the scope of the nickel - catalyzed amination of aryl halides \n has been limited to the coupling of secondary alkylamines and arylamines . primary alkylamines , one of the most significant classes of amines \n for such cross coupling , have been shown to couple only with activated \n aryl chlorides . in addition to the limitations on the scope of the coupling \n of \n aryl halides with amines , the mechanism of the coupling of aryl halides \n with amines catalyzed by nickel complexes has not been studied . many \n papers cite the potential of ni(i ) intermediates , either as part of a one - electron redox event or as part \n of a mechanism involving ni(i ) and ni(iii ) intermediates . in contrast , \n the mechanism for the palladium - catalyzed amination of aryl electrophiles \n has been studied in detail , including the kinetic behavior of the \n catalytic reaction and stoichiometric reactions of isolated intermediates . such studies have not been conducted on nickel - catalyzed couplings \n to form c n bonds , but are particularly important if one is \n to determine how to create catalysts of nickel that are as long - lived \n as those of palladium and that react with similarly broad scope . here , we present the first nickel - catalyzed amination of unactivated \n aryl chlorides with primary aliphatic amines . the reaction occurs \n with aryl and heteroaryl chlorides and bromides catalyzed by a single - component \n binap - ligated nickel(0 ) precursor . kinetic studies have been conducted \n on the reaction , and studies on the relative rates of the reaction \n with various isolated nickel complexes have been conducted . these \n studies rule out a catalytic cycle occurring through a ni(i ) halide \n intermediate and are consistent with a ni(0)/ni(ii ) catalytic cycle \n for the amination of aryl chlorides and aryl bromides , which react \n with different ni(0 ) species .", "we initiated our studies \n of nickel - catalyzed amination of aryl \n chlorides with primary aliphatic amines by studying the reaction between \n 3-chloroanisole and octylamine . we investigated nickel complexes generated \n in situ from ni(cod)2 and various phosphine ligands as \n catalysts . these reactions were conducted \n with naobu as base in toluene at 50 c . \n reactions catalyzed by the combination of ni(cod)2 and \n monophosphines , such as pph3 and pcy3 , afforded \n only trace amounts of the desired amine product ( entries 14 ) . \n similar results ( < 5% conversion and < 2% yield ) were obtained \n for reactions catalyzed by the combination of ni(cod)2 ( 1 \n mol % ) and dppe , dppp , or dppb ( 1 or 2 mol % ) ( entries 510 ) . \n however , reactions catalyzed by the combination of ni(cod)2 and dppf or binap gave significant amounts of product ( 1667% , \n entries 1114 ) . in particular , the reaction catalyzed by the \n single component catalyst ( binap)ni(-nc - ph ) afforded \n the product in 92% yield ( entry 15 ) . an explanation for the high activity \n of this catalyst will be revealed during the presentation of our mechanistic \n studies . conditions : 3-chloroanisole \n ( 0.400 \n mmol ) , octylamine ( 0.600 mmol ) , naobu \n ( 0.600 mmol ) , 24 h. conversion and yield were determined by gc analysis \n using dodecane as internal standard . [ ni ] = ( binap)ni(-nc - ph ) . with an active catalyst in hand and reliable \n conditions identified for this ni - catalyzed amination , we studied \n the scope of aryl chlorides that undergo these amination reactions , \n and the results are summarized in table 2 . \n in general , a range of electron - rich ( 2a2e ) , electron - neutral ( 2h ) , and electron - deficient \n ( 2i2l ) aryl chlorides coupled with \n octylamine in high yields ( 7696% ) under the developed conditions \n with 1 mol % of nickel complex 1 . for very electron - rich \n aryl chlorides , 4 mol % of the catalyst was required to obtain modest \n to good yields ( 2f and 2 g ) . for these two \n reactions , aryl chlorides were not fully converted , and only trace \n amounts ( < 5% ) of biaryl compounds were detected by gc analysis . \n mono - ortho - substituted aryl chlorides reacted in \n high yields ( 2a , 2c2e , 2h , and 2j ) . however , di - ortho - substituted aryl chlorides , such as 2-chloro-1,3-dimethylbenzene , \n did not couple with octylamine under the developed conditions . conditions : arcl ( 0.400 mmol ) , octylamine \n ( 0.600 mmol ) , ( binap)ni(-nc - ph ) ( 4.0 mol , \n 1 mol % ) , naobu ( 0.600 mmol ) , toluene \n ( 1 ml ) ; temperature , 50 c ; reaction time , 24 h. ( binap)ni(-nc - ph ) \n ( 16.0 mol , 4 mol % ) . the scope of primary amines was studied by conducting the amination \n reactions of 3-chloroanisole catalyzed by 2 mol % complex 1 . the results of this study are summarized in table 3 . in general , a variety of primary aliphatic amines underwent \n this amination process in good to excellent isolated yields ( 7596% ) . conditions : 3-chloroanisole ( 0.400 \n mmol ) , primary amine ( 0.600 mmol ) , ( binap)ni(-nc - ph ) \n ( 8.0 mol , 2 mol % ) , naobu ( 0.600 \n mmol ) , toluene ( 1 ml ) ; temperature , 50 c ; reaction time , 24 \n h. ( binap)ni(-nc - ph ) \n ( 16.0 mol , 4 mol % ) . the steric bulk of the alkyl group of the primary amines significantly \n influenced the yields of these reactions . the reactions of an amine \n containing a primary alkyl group ( 2 m ) afforded the product \n in higher yield than the reactions of amines containing a secondary \n alkyl group ( 2n and 2o ) , although the primary \n amines containing a secondary alkyl group still coupled with aryl \n chlorides in good yield . however , the amination of 3-chloroanisole \n with primary amines containing a tertiary alkyl group , for example , tert - butylamime and amylamine , gave only trace amounts of \n the desired products . amines containing aryl ( 2p ) , heteroaryl \n ( 2q and 2r ) , allyl ( 2s ) , and \n cyano ( 2 t ) groups reacted in high yields ( 9096% ) . \n primary amines bearing 1,3-dioxolane ( 2u and 2v ) and morpholine ( 2w ) moieties also reacted in high \n yields ( 8388% ) . the reaction of n - isopropylethylenediamine , \n a substrate containing both a primary and a secondary amine , occurred \n selectively with the primary amine , leaving the secondary amine intact \n ( 2x ) . nitrogen - containing heterocycles containing \n amino substituents \n are of particular importance for pharmaceutical applications . however , \n the c n coupling reactions between nitrogen - containing heteroaryl \n electrophiles and primary amines are challenging , presumably because \n of the coordinating properties of both pyridines and primary amines . \n nickel catalysts have been reported for the amination of heteroaryl \n chlorides , but the amine nucleophiles are limited to secondary amines . cross - coupling reactions between nitrogen - containing \n heteroaryl \n chlorides and primary amines catalyzed by 2 mol % of complex 1 are summarized in table 4 . the scope \n of heteroaryl chlorides that underwent this amination reaction encompassed \n a range of 2-pyridyl ( 3a3f ) , 3-pyridyl \n ( 3g3l ) , and 4-pyridyl ( 3m3p ) chlorides containing electron - donating groups \n ( me and ome ) and electron - withdrawing groups ( cn and cf3 ) . in general , these reactions afforded the corresponding heteroaryl \n alkylamine in good to excellent isolated yields ( 5796% , average \n yield : 81% ) . this amination also occurred in high yields with 2-chloroquinoline \n ( 3q ) and 2-chloropyrazine ( 3r ) . the scope of primary amines that underwent reactions with chloropyridines \n was similar to that of the reactions of 3- chloroanisole described \n in table 3 . conditions : 3-chloroanisole ( 0.400 \n mmol ) , primary amine ( 0.600 mmol ) , ( binap)ni(-nc - ph ) \n ( 8.0 mol , 2 mol % ) , naobu ( 0.600 \n mmol ) , toluene ( 1 ml ) ; temperature , 50 c ; reaction time , 24 \n h. ( binap)ni(-nc - ph ) \n ( 16.0 mol , 4 mol % ) . compared \n to the well - established palladium - catalyzed amination of aryl bromides , \n the nickel - catalyzed amination of aryl bromides has been less studied , \n and conditions for coupling of aryl bromides with amines by nickel \n catalysts have not been identified . only two examples of nickel - catalyzed \n amination of aryl bromides have been published , and these two reactions occurred in poor yields ( eqs 1 and 2 ) . having identified conditions \n for the nickel - catalyzed amination of aryl chlorides , we tested these \n conditions for the coupling of aryl bromides with primary amines . the amination of aryl bromides catalyzed by benzonitrile complex 1 in toluene with naobu base \n occurred in good yields in some cases , but the scope of the reaction \n was limited . bromobenzene and 4-bromobenzotrifluoride reacted with \n octylamine in high gc - yields ( 98% and 94% , repectively ) under conditions \n listed in table 2 with 3 mol % of complex 1 ( eq 3 ) . however , 3-bromoanisole coupled \n with 2-(1,3-dioxolan-2-yl)ethan-1-amine in only 55% gc - yield , whereas \n the reaction of the same amine with 3-chloroanisole afforded the desired \n product in 87% isolated yield ( eq 4 ) . this \n limited scope for the amination of aryl bromides may stem from the \n faster thermal decomposition of arylnickel(ii ) bromide species to \n nickel(i)3 bromide , relative to the rate of decomposition \n of arylnickel(ii ) chloride species . the \n catalyst precursor employed in this study is a single - component nickel(0 ) \n complex ( binap)ni(-nc - ph ) ( 1 ) . previously , \n we reported the synthesis of this nickel complex by substitution of \n the 1,5-cyclooctadiene ( cod ) in ni(cod)2 by binap , and \n benzonitrile . to avoid using the thermally \n labile , air- and moisture - sensitive ni(cod)2 , we developed \n a new synthesis ( scheme 2 ) of this complex \n starting from the air - stable nickel precursor ( dme)nicl2 . reaction of ( dme)nicl2 with 1 equiv of binap in thf \n at 50 c afforded ( binap)nicl2 , which was then reduced \n by zinc metal in the presence of cod . p nmr analysis \n of this reaction indicated a clean formation of ( binap)ni(cod ) . the \n byproduct zncl2 was removed by washing the reaction mixture \n with degassed aqueous naoh . at this stage , the residue was \n suspended in toluene and then allowed to react with benzonitrile . \n arylnickel halide complexes are important intermediates \n in nickel - catalyzed cross - coupling reactions . in general , arylnickel \n halides ligated by monophosphines are synthesized by oxidative addition \n reactions of aryl halides to ni(pr3)x ( r = alkyl or aryl ) , but arylnickel \n halides ligated by bisphosphines are prepared by ligand substitution \n reactions between monophosphine - ligated arylnickel halide complexes \n with bisphosphines . the direct oxidative \n addition of aryl halides to bisphosphine - ligated ni(0 ) has rarely \n been investigated , mainly due to the lack of bisphosphine - ligated \n ni(0 ) precursors that can react with aryl halides at ambient temperature . \n recently , we reported the synthesis of binap - ligated arylnickel halide \n complexes by reactions of aryl halides with ( binap)ni(cod ) in the \n presence of catalytic amounts of benzonitrile , and we identified ( binap)ni(-nc - ph ) as the active ni(0 ) species . in our communication on the nickel - catalyzed asymmetric -arylation \n of ketones , we reported the single reaction of electron - deficient \n 4-chlorobenzotrifluoride with this newly defined ni(0 ) precursor 1 and no isolation of the products . here we show the results \n of the reactions of complex 1 with electronically varied \n aryl chlorides . electron - neutral and electron - deficient aryl \n chlorides reacted smoothly with ni(0 ) complex 1 in thf \n at room temperature to afford the arylnickel(ii ) chloride complexes 47 in 7689% isolated yields ( eq 5 ) . these complexes are stable in the solid state \n at ambient temperature for at least six months without noticeable \n decomposition . however , upon standing in thf solution at room temperature \n for about 48 h , they fully decomposed to [ ( binap)ni(-cl)]2 ( 8) with concomitant release of biaryls , as \n detected by gc - ms analysis . however , the reaction \n of electron - rich 4-chloroanisole with complex 1 in thf \n did not form the arylnickel chloride complex resulting from simple \n oxidative addition , as determined by p nmr spectroscopy . \n instead , p nmr signals corresponding to two mutually trans phosphine resonances ( doublets at 24.2 and 14.4 ppm \n with jpp = 352 hz ) were observed . 56single - crystal x - ray diffraction of the isolated \n material ( figure 1 ) showed that this product \n is complex 9 ( eq 7 ) . complex 9 contains a coordinated monophosphine ligand ph2p(c6h4 - 4-ome ) and a six - membered nickelacyclic \n structure . nickelacyclic complex 9 contains a small dihedral \n angle between the two naphthyl groups of 63 , and the nickel \n center consists of a distorted square planar geometry . complex 9 is formed by p c bond cleavage of the binap backbone \n after the initial formation of binap - ligated arylnickel chloride complex \n ( binap)nicl(c6h4 - 4-ome ) . c \n bond cleavage of the binap backbone \n in a binap - ligated phenylpalladium bromide complex was reported by \n our group previously . all the ellipsoids are \n drawn at the 50% probability and all the \n hydrogen atoms are omitted for clarity . complex 9 was tested as a catalyst for the amination \n of 4-chloroanisole with octylamine under the conditions described \n in table 2 . only trace ( < 5% by gc analysis ) \n amounts of the amination product were formed . thus , the formation \n of catalytically inactive complex 9 by the reaction of \n 4-chloroanisole and nickel precursor 1 explained the \n high catalyst loading required for the amination of electron - rich \n 4-chloroanisole . the oxidation state of the nickel intermediates \n in the \n amination of aryl halides with amines has been ambiguous , and pathways \n involving both ni(0)/ni(ii ) and ni(i)/ni(iii ) couples have been proposed \n for these reactions . with isolated , binap - ligated \n ni(0 ) , ni(i ) halide , and arni(ii ) halide complexes in hand , we were \n able to assess precisely the competence of these complexes to be intermediates \n in the amination reactions . to do so , we conducted the reaction \n of the isolated ( binap)nicl(c6h4 - 4-cf3 ) ( 7 ) with octylamine and naobu in the presence of 1 equiv of binap to trap a ni(0 ) product \n ( a , scheme 3 ) . this reaction afforded n - octyl-4-(trifluoromethyl)aniline in quantitative yield \n in less than 5 min at room temperature , as indicated by f nmr spectroscopic analysis . in addition , we conducted the amination \n reaction of 4-chlorobenzotrifluoride with octylamine in the presence \n of naobu catalyzed by 2 mol % of ( binap)nicl(c6h4 - 4-cf3 ) at room temperature ( b , scheme 3 ) . full conversion of 4-chlorobenzotrifluoride was \n achieved in 2 h , and this reaction afforded n - octyl-4-(trifluoromethyl)aniline \n in 91% isolated yield . the same reaction catalyzed by 2 mol % of [ ( binap)ni--cl]2 did not afford any amination product ( c , scheme 3 ) . these results show clearly that the binap - ligated \n arylnickel(ii ) chloride compound is kinetically and chemically competent \n to be an intermediate in the catalytic process and the binap - ligated \n nickel(i ) halide is not . to identify the resting \n state of the catalyst in this nickel - catalyzed \n amination reaction , we monitored by p{h } \n nmr spectroscopy the reaction of 4-chlorobenzotrifluoride with octylamine in the presence of naobu catalyzed by 2 mol % of ( binap)ni(-nc - ph ) \n ( 1 ) at room temperature . during the first 50% conversion \n of 4-chlorobenzotrifluoride , however , during the second 50% conversion , a new species \n corresponding to a p{h } nmr resonance at \n 31.7 ppm gradually accumulated . this new species is ( binap)2ni , as determined by independently preparing this complex \n by reduction of ( dme)nicl2 with zn metal in the presence \n of 2 equiv of binap in thf and comparing the p nmr chemical \n shift . to test the catalytic activity of ( binap)2ni for this amination process , we conducted the reaction of 4-chlorobenzotrifluoride \n with octylamine catalyzed by 5 mol % of ( binap)2ni in the \n presence of naobu at room temperature . this reaction did \n not afford detectable amounts of the amination product ( a , scheme 4 ) . this result is consistent with the early report \n that ( binap)2ni does not undergo oxidative addition with \n aryl chlorides or bromides at ambient temperatures . the same reaction catalyzed by 5 mol % ( binap)2ni in \n the presence of a catalytic amount of phcn ( 30 mol % ) afforded the \n amination product in 84% yield in 20 h ( b , scheme 4 ) . for comparison , we conducted the same reaction catalyzed \n by only 2 mol % ( binap)ni(-nc - ph ) . this reaction \n afforded the amination product in almost quantitative yield in 2 h \n at room temperature ( c , scheme 4 ) . thus , ( binap)ni(-nc - ph ) is a more active catalyst than the combination of \n ( binap)2ni and phcn . to assess the origin of the \n effect of benzonitrile on the rate \n of the catalytic reaction , we performed the reaction of ( binap)2ni with benzonitrile and the reaction of ( binap)ni(-nc - ph ) with binap . the reaction of ( binap)2ni \n with 10 equiv of benzonitrile did not form detectable amounts of ( binap)ni(-nc - ph ) , as determined by p nmr spectroscopy \n ( d , scheme 4 ) . the reaction of ( binap)ni(-nc - ph ) with 1 equiv of binap afforded ( binap)2ni quantitatively at ambient temperature ( e , scheme 3 ) . based on these stoichiometric reactions and the catalytic \n reactions in scheme 3 , we conclude that the \n formation of ( binap)2ni is reversible in the presence of \n benzonitrile , but the equilibrium lies largely on the side of ( binap)2ni and free nitrile . the formation of bis(amine)-ligated palladium complexes \n was reported \n as one possible pathway for deactivation of the catalyst in the palladium - catalyzed \n amination of aryl halides . formation of \n analogous bis(amine ) complexes of nickel was proposed to explain the \n much lower reactivity of primary aliphatic amines than that of cyclic \n secondary aliphatic amines and anilines in the nickel - catalyzed amination \n reaction . however , these bis(amine)-ligated \n nickel complexes have never been prepared or characterized . in the \n nickel - catalyzed amination of aryl chlorides with primary amines catalyzed \n by ( binap)ni(-nc - ph ) , we observed the formation \n of ( binap)2ni . the stoichiometry of this conversion indicates \n that there are nickel complexes lacking binap ligand in the reaction \n mixture . thus , we studied the ligand substitution reactions between \n primary aliphatic amines and binap - ligated ni(0 ) and binap - ligated \n ni(ii ) complexes . the reaction of ( binap)ni(-nc - ph ) with 50 equiv of n - butylamine in toluene \n did not form any new nickel species , and free binap was not detected \n by p nmr spectroscopy ( a , scheme 5 ) . this result is consistent with the affinity of the electron - rich \n ni(0 ) center for softer , -accepting ligands . however , the reaction of ( binap)nicl(c6h4 - 4-cn ) with 50 equiv of n - butylamine afforded \n free binap and trans-(n - butylamine)2nicl(c6h4 - 4-cn ) ( 10 ) ( b , \n scheme 5 ) . complex 10 was isolated \n in 76% yield . with the bis(amine)-ligated complex 10 in hand , we \n tested its potential to serve as an intermediate in the amination \n reaction . we conducted the reaction of 10 with 2 equiv \n of naobu in the presence or in the absence \n of 1 equiv of binap ( c , scheme 5 ) . this result \n indicates that the formation of bis(amine)-ligated nickel complexes \n is one possible pathway for decomposition of the nickel catalyst . after identifying the resting state of the nickel catalyst and \n possible paths for catalyst deactivation , we sought to identify the \n rate - limiting step for this nickel - catalyzed amination process . to \n do so , we measured the dependence of the initial rates of the amination \n reaction on the concentrations of each reagent under conditions in \n which the other reagents were present in large excess . we chose \n the reaction of 4-chlorobenzotrifluoride with octylamine in the presence \n of naobu for the kinetic studies because \n this reaction occurred at ambient temperature , and we were able to \n monitor the reaction conveniently by both p and f nmr spectroscopy . furthermore , no background nucleophilic \n aromatic substitution reaction was observed for this aryl chloride \n and octylamine in the presence of naobu . for the initial rates to be a valid method for kinetic \n analysis \n of this reaction , all reagents must be soluble in the reaction medium , \n and no induction period can be present . the single - component catalyst \n precursor 1 is only marginally soluble in the reaction \n medium . thus , we used ( binap)nicl(c6h4 - 4-cf3 ) ( 7 ) as the source of nickel for our kinetic \n experiments because it dissolves in seconds once mixed with other \n reagents . benzonitrile was added to the reaction mixture to trap the \n binap - ligated ni(0 ) species to form ( binap)ni(-nc - ph ) , \n which had been identified as the catalyst resting state . in the absence \n of benzonitrile , the irreversible formation of ( binap)2ni occurs quickly . benzonitrile ( 10 equiv relative to complex 7 ) was added so that catalyst decomposition was not observed \n by p nmr spectroscopy over the time of the reaction . the kinetic behavior was assessed for the coupling of 4-chlorobenzotrifluoride \n with octylamine catalyzed by the combination of complex 7 in the presence of phcn and naobu at \n room temperature ( eq 8) . the initial rates were \n measured by f nmr spectroscopy using 4-ocf3-anisole as the internal standard . the rate of the amination reaction \n was determined by measuring the formation of n - octyl-4-(trifluoromethyl)aniline \n with respect to time . the plots of concentrations of n - octyl-4-(trifluoromethyl)aniline vs time at various concentrations \n of each reagent are shown in figures s1s5 in the supporting information . the plots of the initial \n rates of the reaction vs the concentrations of the catalyst , aryl \n chloride , and benzonitrile are shown in figure 2.8 the kinetic analysis showed that this nickel - catalyzed \n amination reaction of aryl chlorides is first order in the nickel \n catalyst , first order in aryl chloride , and inverse first order in \n phcn . the remaining reagents , naobu and \n amine , did not affect the initial rate of the reaction . these data \n indicate that oxidative addition of the aryl chloride to ( binap)ni(0 ) , \n formed by reversible dissociation of phcn from the catalyst resting \n state ( binap)ni(-nc - ph ) , is the turnover - limiting \n step in the amination reaction . plots of initial rates vs concentration \n of catalyst , aryl chloride , \n and benzonitrile for the amination of 4-chlorobenzotrifluoride ( 0.101.0 \n m ) with n - octylamine ( 0.30 m ) catalyzed by ( binap)nicl(c6h4 - 4-cf3 ) ( 0.00600.018 m ) in \n the presence of benzonitrile ( 0.0900.180 m ) and naobu ( 0.30 m ) at room temperature . the mechanism of palladium - catalyzed cross - coupling reactions with \n aryl halides as electrophiles has been extensively studied . these \n studies reveal that the halide identity has a dramatic effect on the \n mechanism for the oxidative addition of aryl halides to pd(0 ) species . \n the additions of the less reactive aryl chlorides occurs through lower - coordinated \n pd(0 ) intermediate than the additions of more reactive aryl iodides . however , such mechanistic data has not been \n gained for the nickel - catalyzed amination of aryl halides . for the \n nickel - catalyzed enantioselective -arylation of ketones , we \n found that aryl chlorides react in much higher yields and with much \n higher enantioselectivities than aryl bromides , and we attributed \n this dramatic effect of halide on the reaction yield and enantioselectivity \n to the faster decomposition of the arylnickel(ii ) bromide intermediate \n relative to the arylnickel(ii ) chloride intermediate to their corresponding \n ni(i ) halide complexes . because \n the ni(0 ) complex 1 ligated by binap and phcn catalyzes \n the amination of both aryl chlorides and aryl bromides , we can compare \n directly the kinetics and mechanism of the amination reactions of \n aryl chlorides and aryl bromides catalyzed by this nickel system . \n to do so , we conducted kinetic experiments on the amination of aryl \n bromides that were similar to those we conducted on the amination \n of aryl chlorides . we monitored by p nmr spectroscopy \n the reaction of \n 4-bromobenzotrifluoride with octylamine catalyzed by ( binap)ni(-nc - ph ) in the presence of naobu at room temperature . as was the case in the reactions of chloroarenes , \n ( binap)ni(-nc - ph ) was identified as the resting \n state of the catalyst in the reaction of 4-bromobenzotrifluoride with \n octylamine . kinetic studies were conducted on the reaction of \n 4-bromobenzotrifluoride \n with octylamine catalyzed by ( binap)nibr(c6h4 - 4-cf3 ) ( 11 ) in the presence of added phcn \n ( eq 8) . the initial rates were measured for \n various concentrations of each reagent while keeping the other reagents \n in excess . the plots of concentrations of n - octyl-4-(trifluoromethyl)aniline \n vs time at various concentrations of each reagent are shown in figures s7s11 . the plots of the initial \n rates of the reaction vs the concentrations of the catalyst , aryl \n chloride , and benzonitrile are shown in figure 3 . plots of initial rates \n vs concentration of catalyst , aryl bromide , \n and benzonitrile for the amination of 4-bromobenzotrifluoride ( 0.100.80 \n m ) with n - octylamine ( 0.30 m ) catalyzed by ( binap)nicl(c6h4 - 4-cf3 ) ( 0.00600.018 m ) in \n the presence of benzonitrile ( 0.0900.180 m ) and naobu ( 0.30 m ) at room temperature . like the amination of 4-chlorobenzotrifluoride , the amination \n of \n 4-bromobenzotrifluoride with octylamine is first order in the nickel \n catalyst , first order in aryl halide , zero order in naobu , and zero order in amine . in contrast to the reaction \n of 4-chlorobenzotrifluoride , which is inverse first order in phcn , \n the amination of 4-bromobenzotrifluoride is zero order in phcn . this \n order in phcn , in combination with the first order in aryl bromide , \n indicates that the bromoarene reacts directly with ( binap)ni(-nc - ph ) during the turnover - limiting step of the amination \n of the bromoarene without dissociation of phcn . the different reactivities \n of aryl halides with binap - ligated nickel complexes of different coordination \n numbers parallels a trend in oxidative addition to pd(0 ) complexes \n noted in the introduction to this section . based on the stoichiometric reactions of \n the isolated binap - ligated arylnickel halides with primary amines \n in the presence of base and the conducted kinetic studies , we propose \n a catalytic cycle depicted in scheme 6 for \n the nickel - catalyzed amination of aryl chlorides and aryl bromides \n reported in this paper . the observed first order rate - dependence on \n the concentrations of both the catalyst and aryl halides indicates \n that the oxidative addition of aryl halides to binap - ligated ni(0 ) \n species to form ( binap)niar(x ) ( x = cl or br ) is the turnover - limiting \n step for both amination processes . this binap - ligated arylnickel(ii ) \n halide complex subsequently reacts with primary amine and naobu to form an arylnickel amido complex , followed \n by reductive elimination of the n - alkyl aniline product \n in the presence of phcn to regenerate ( binap)ni(-nc - ph ) , which was confirmed as the catalyst resting state . interestingly , different rate - dependences on the concentration \n of phcn were observed for this nickel - catalyzed amination of aryl \n chlorides and aryl bromides . the reaction of aryl chlorides is inverse \n first order in phcn , whereas the reaction of aryl bromides is zero \n order in phcn . these reaction orders indicate that aryl chlorides \n and aryl bromides react with different nickel(0 ) species . the aryl \n chlorides react after reversible dissociation of phcn from ( binap)ni(-nc - ph ) to form the lower - coordinate nickel(0 ) species ( binap)ni(0 ) \n and ultimately the binap - ligated arylnickel(ii ) chloride complex . \n however , the aryl bromides react directly with ( binap)ni(-nc - ph ) to form binap - ligated arylnickel(ii ) bromide complex \n and the nitrile dissociates during or immediately after the oxidative \n addition process . one could imagine the zero - order dependence on added \n phcn could indicate that dissociation of this ligand is rate limiting , \n but the first - order dependence of the reaction on the aryl bromide \n is inconsistent with this proposal . in addition to the steps \n within the catalytic cycle that form the \n arylamine product , there are several pathways that generate catalytically \n inactive nickel species . first , the reaction of ( binap)niar(cl ) with \n amine rnh2 forms the catalytically inactive ( rnh2)2niar(cl ) and free binap . the released free binap in \n the reaction mixture traps the ( binap)ni(0 ) fragment generated by \n dissociation of phcn from ( binap)ni(-nc - ph ) or \n reductive elimination of n - alkyl aniline from the \n binap - ligated arylnickel(ii ) amido complex to form ( binap)2ni . ( binap)2ni does not undergo oxidative addition of \n the aryl halide and does not catalyze the amination reaction . second , thermal decomposition of ( binap)niar(x ) \n ( ar = electron - neutral and electron - rich aryl groups ) affords the \n catalytically inactive [ ( binap)ni(-x)]2 with concomitant \n formation of biaryl . c bond cleavage of the binap backbone is a potential \n pathway for the deactivation of the nickel catalyst . indeed , this \n complex was observed to accumulate ( approximately 6.4 mm of the 16 \n mm concentration of initial catalyst ) during the reaction of 4-chloroanisole \n with octylamine . to gain \n information on the \n relative rates of the amination of aryl chlorides and aryl bromides \n and the effect of temperature and concentration of phcn on the selectivity \n of the amination reaction for an aryl chloride versus an aryl bromide , \n we conducted a series of reactions with an aryl halide containing \n both chloride and bromide and a mixture of aryl halides in the presence \n of various amounts of phcn at room temperature or 50 c . the amination of 1-bromo-4-chlorobenzene with \n octylamine catalyzed \n by 3 mol % of ( binap)ni(-nc - ph ) at 50 c occurred \n selectively at the c br bond , and the product of the reaction \n at the c cl bond was not detected by gc - ms analysis . ( a , scheme 7 ) . however , side - by - side reactions of chlorobenzene \n and bromobenzene under the same conditions occurred in the same gc \n yield ( 98% ) ( b , scheme 7 ) . the amination \n of equal amounts of 1-bromo-4-butylbenzene and 4-chlorotoluene \n with octylamine catalyzed by 3 mol % of ( binap)ni(-nc - ph ) was conducted at both room temperature and 50 c ( c , \n scheme 7 ) . at both temperatures , these reactions \n occurred in similar yields , but with different selectivity . at room \n temperature , 1-bromo-4-butylbenzene was converted selectively over \n 4-chlorotoluene , and a product ratio of 3:1 was obtained . however , \n at 50 c , 1-bromo-4-butylbenzene and 4-chlorotoluene converted \n equally . br \n bond in 1-bromo-4-chlorobenzene ( a , scheme 7 ) , the decreased selectivity for amination of the c br bond \n over the c cl bond in different haloarenes might stem from \n irreversible or nearly irreversible binding of the haloarene to ni(0 ) \n to form an arene -complex prior to cleavage of the carbon halogen \n bond . this preferential intramolecular oxidative addition has recently \n been observed for the ni - catalyzed kumada cross - coupling reactions \n that are part of chain - growth polymerizations . to evaluate the effect of phcn on the selectivity \n between the amination \n of an aryl chloride and an aryl bromide , we conducted the amination \n of equal amounts of 1-bromo-4-butylbenzene and 4-chlorotoluene with \n octylamine catalyzed by 3 mol % of ( binap)ni(-nc - ph ) \n in the presence of 0.9 equiv of phcn ( relative to octylamine ) ( d , \n scheme 6 ) . because our kinetic studies revealed \n different dependences of the reaction rate on phcn for this nickel - catalyzed \n amination ( inverse first order and zero order on phcn for the reaction \n of aryl chloride and aryl bromide , respectively ) , we considered that \n an increased selectivity for the conversion of aryl bromide over aryl \n chloride would be observed for reactions conducted with higher concentrations \n of phcn than for reactions conducted with lower concentrations of \n phcn . consistent with this prediction , the selectivity was higher \n ( 30:1 \n for the reaction at room temperature and 9:1 for the reaction at 50 \n c ) for the amination of 1-bromo-4-butylbenzene versus the amination \n of 4-chlorotoluene for reactions run with higher concentrations ( from \n 0.004 to 0.18 m ) of benzonitrile at both room temperature and 50 c \n for 24 h. these data show that the difference in ni(0 ) species that \n adds the different aryl halides can be used to beneficially affect \n selectivity . several first - row metal complexes catalyze cross \n coupling reactions , \n and many catalyze the coupling of certain classes of chloroarenes . \n however , no first row metal complex has been shown to catalyze the \n coupling of primary alkylamines with unactivated chloroarenes . copper \n complexes couple bromoarenes and iodoarenes with primary amines , but \n they do not catalyze the coupling of chloroarenes with primary amines . previously , the combination of ni(cod)2 and dppf was \n shown to couple an electron - poor chloroarene with a primary amine , \n but this catalyst did not couple unactivated chloroarenes with primary \n amines . a set of preliminary studies \n we conducted have shown that the complexes ( dppf)ni(cod ) or ( dppf)2ni generated in situ by the reaction of ni(cod)2 and dppf do not add aryl chlorides at ambient temperature , and the \n reaction of chloroarenes with ( dppf)ni(cod ) or ( dppf)2ni \n at elevated temperatures forms ( dppf)ni(i)cl and biaryl . this \n formation of ( dppf)2ni(0 ) and ( dppf)ni(i)cl at \n the elevated temperatures required for oxidative addition of chloroarene \n to occur , likely prevented productive coupling reactions with unactivated \n chloroarenes . these observations further illustrate the importance \n of the nitrile - ligated precursor with the general formula l2ni(-nc - ph ) . nickel complexes of n - heterocyclic carbenes have \n been shown to couple aryl chlorides and sulfonates with secondary \n amines and with arylamines , but not primary alkylamines . mechanistic \n studies on the reactions of secondary amines catalyzed by the complexes \n of n - heterocyclic carbenes are too limited to determine \n the origin of their lack of reactivity with primary amines , but recent \n studies have shown that the arylnickel halide complexes containing \n hindered n - heterocyclic carbenes are not formed by \n the reaction of ( imes)2ni(0 ) with chlorobenzene , bromobenzene , \n and iodobenzene . instead , ni(i ) species \n are formed , and this formation of ni(i ) complexes could either constitute \n the pathway for catalyst decomposition or a mechanism for reaction \n with this catalyst involving odd - electron nickel intermediates .", "we have shown that nickel complexes containing \n common aryl bisphosphine \n ligands can catalyze the coupling of aryl chlorides and bromides with \n primary amines . in particular , we have shown that the mixed ni(0 ) \n species ( binap)ni(-nc - ph ) containing one bisphosphine \n and one side - bound nitrile is a particularly active catalyst for the \n coupling of chloroarenes with primary amines and is more active than \n the related ( binap)2ni catalyst . a range of electronically \n varied aryl halides and nitrogen - containing heteroaryl chlorides , \n including pyridine , quinoline , and isoquinoline derivatives , couple \n with a variety of aliphatic primary amines in high isolated yields . \n several aspects of the current system lead to the ability of this \n first - row metal system to catalyze this class of amination reaction . \n in general , we attribute the high yields for these amination reactions \n to the facile oxidative addition of aryl chlorides and heteroaryl \n chlorides to the ( binap)ni(-nc - ph ) precatalyst \n at ambient temperatures . detailed studies on the mechanism of \n the amination reaction the following conclusions about the mechanism of this \n coupling process have been drawn from these studies : ( 1 ) the \n oxidative addition of aryl chlorides to ( binap)ni(-nc - ph ) , together with the stoichiometric reactions of ( binap)niar(cl ) \n with primary aliphatic amines in the presence of base , support a reaction \n pathway involving a ni(0)/ni(ii ) couple in the catalytic cycle . ( 2 ) the oxidative addition of aryl chlorides and heteroaryl chlorides \n to the single - component nickel precursor ( binap)ni(-nc - ph ) at ambient temperatures prevents the formation of inactive \n ni species . ( 3 ) ni(i ) intermediates , which have been observed \n in oxidative \n addition studies to phosphine - ligated ni(0 ) complexes , appear to result \n from decomposition of the ni(ii ) product of oxidative addition as \n opposed to forming from one - electron pathways for oxidative addition \n to ni(0 ) . ( 4 ) the reaction of ( binap)ni(-nc - ph ) with electron - rich \n aryl chlorides , such as 4-chloroanisole , leads to the p c bond \n cleavage of the backbone of binap and forms the nickel complex 9 containing two monophosphine ligands . the formation of the \n catalytically inactive complex 9 explains the high catalyst \n loading required for the amination of electron - rich aryl chlorides . ( 5 ) mechanistic and kinetic studies revealed that the turnover - limiting \n step of these nickel - catalyzed amination reactions of aryl chlorides \n is oxidative addition of the aryl chloride to ( binap)ni(0 ) , which \n is formed by dissociation of phcn from the catalyst resting state \n ( binap)ni(-nc - ph ) . ( 6 ) mechanistic and kinetic \n studies imply that the turnover - limiting \n step of the reactions of aryl bromides is also oxidative addition , \n but that aryl bromides react with a different nickel species , of composition \n ( binap)ni(-nc - ph ) containing a bound nitrile . ( 7 ) the formation of catalytically inactive bis(amine)-ligated \n ni(ii ) species ( rnh2)2niar(cl ) , ni(i ) species \n [ ( binap)ni(-cl)]2 , and bis - binap - ligated ni(0 ) species \n ( binap)2ni are the major pathways for catalyst inactivation . further studies to improve the lifetime of the ni - bisphosphine \n catalysts , to determine the mechanism by which the phosphine - ligated \n ni(i ) species form as a means to prevent this detrimental path , and \n to determine if ni(i ) complexes are generated during oxidative addition \n of haloarenes will be the subject of future work ." ]

[ "children diagnosed with jia were referred by pediatricians to our immuno - ophthalmology unit for ophthalmic examination . children 10 years old or younger presenting to our clinic with intraocular inflammation were referred for pediatric consult to verify a possible jia association . included in this study is a cohort of 172 children with jia who were examined with the slit lamp at least on three consecutive visits and followed for a minimum of 3 years and a maximum of 15 years after the original referral visit . at the time of initial examination all were diagnosed by pediatricians as having jia either prior to their initial ophthalmic examination ( 152 patients ) or after pediatric consult was sought following the initial detection of intraocular inflammation ( 20 patients ) . all 172 children fulfilled the criteria for the diagnosis of jia : children with arthritis of at least 3 months duration , less than 16 years old at the time of first arthritic manifestation and without any other detectable cause for the arthritis . history of possible systemic disease and ocular manifestations were carefully reviewed with the patients and parents . all patients underwent an ocular examination which included assessment of the visual acuity using the snellen charts or the illiterate e charts and/or familiar pictures for the young verbal children . in a few of the very young and pre - verbal children , the pattern of fixation for near and distance and the elicitation of optokinetic nystagmus were used to assess their visual functions ( benezra and rose 1990 ) . slit lamp biomicroscopy , thorough fundus examination and assessment of refractive errors in both eyes were performed in all cases . the intraocular pressure ( iop ) using the goldman applanation tonometer was obtained in cooperative children . in a few of the very young children with early ocular complications the iop assessment , fundus examination and refraction data ocular movement abnormalities , the presence or absence of strabismus and the binocular functions were also routinely assessed . ocular medical treatment consisted on instillations of corticosteroids and cycloplegic eye drops when the intraocular inflammation was confined to the anterior segment . the frequency of eye drops instillations in these cases was arbitrarily modulated for every affected eye according to the intensity of inflammatory reaction in the aqueous humor as assessed at the slit lamp . systemic corticosteroids ( up to 1.0 mg / kg / day ) and/or methotrexate ( up to 25 mg once a week ) were prescribed if the intermediate and posterior segments demonstrated active inflammatory process or at the advice of the treating rheumatologist for the control of severe arthritic manifestations . complete blood count ( cbc ) , sedimentation rate ( esr ) , c reactive protein ( crp ) , urine culture , kidney and liver function tests were performed in all cases . according to the clinical observations and the results of these routine preliminary examinations , a tailored individual more arduous battery of tests the type of intraocular inflammation ( uveitis ) was classified according to the anatomical site of the major inflammatory manifestations following the intraocular inflammation society guidelines ( forrester et al 1998 ; benezra et al 2000 ) . the intraocular inflammation was further subdivided to whether the disease was strictly ocular or it was associated with a systemic disease . systemic disease associations were determined according to established sets of criteria ( bloch - michel and nussenblatt 1987 ; weiner and benezra 1991 ; dollfus 1998 ; forrester et al 1998 ; benezra et al 2000 ; benezra et al 2005 ) .", "history of possible systemic disease and ocular manifestations were carefully reviewed with the patients and parents . all patients underwent an ocular examination which included assessment of the visual acuity using the snellen charts or the illiterate e charts and/or familiar pictures for the young verbal children . in a few of the very young and pre - verbal children , the pattern of fixation for near and distance and the elicitation of optokinetic nystagmus were used to assess their visual functions ( benezra and rose 1990 ) . slit lamp biomicroscopy , thorough fundus examination and assessment of refractive errors in both eyes were performed in all cases . the intraocular pressure ( iop ) using the goldman applanation tonometer was obtained in cooperative children . in a few of the very young children with early ocular complications the iop assessment , fundus examination and refraction data ocular movement abnormalities , the presence or absence of strabismus and the binocular functions were also routinely assessed .", "ocular medical treatment consisted on instillations of corticosteroids and cycloplegic eye drops when the intraocular inflammation was confined to the anterior segment . the frequency of eye drops instillations in these cases was arbitrarily modulated for every affected eye according to the intensity of inflammatory reaction in the aqueous humor as assessed at the slit lamp . systemic corticosteroids ( up to 1.0 mg / kg / day ) and/or methotrexate ( up to 25 mg once a week ) were prescribed if the intermediate and posterior segments demonstrated active inflammatory process or at the advice of the treating rheumatologist for the control of severe arthritic manifestations .", "complete blood count ( cbc ) , sedimentation rate ( esr ) , c reactive protein ( crp ) , urine culture , kidney and liver function tests were performed in all cases . according to the clinical observations and the results of these routine preliminary examinations , a tailored individual more arduous battery of tests", "the type of intraocular inflammation ( uveitis ) was classified according to the anatomical site of the major inflammatory manifestations following the intraocular inflammation society guidelines ( forrester et al 1998 ; benezra et al 2000 ) . the intraocular inflammation was further subdivided to whether the disease was strictly ocular or it was associated with a systemic disease . systemic disease associations were determined according to established sets of criteria ( bloch - michel and nussenblatt 1987 ; weiner and benezra 1991 ; dollfus 1998 ; forrester et al 1998 ; benezra et al 2000 ; benezra et al 2005 ) .", "of the 172 children with jia , 152 were referred by pediatricians for ocular examination after the diagnosis of jia was ascertained . in 20 children , intraocular inflammation was the presenting symptom while jia disease was established later by a pediatrician . of the 152 children with the presenting symptom of arthritis , 18 ( 11.8 % ) had the systemic type of jia , 87 ( 57.2% ) had the pauciarticular type and 47 ( 30.9% ) had the polyarticular type . of the 152 children presenting with all types of jia arthritic manifestations , in 14 children ( 9.2% ) , the intraocular inflammation ( uveitis ) was diagnosed during the first ophthalmic examination ( 12/14 had clinical evidence for the pauciarticular type of jia ) . all these 14 children had a recent history ( 3 to 9 months ) of arthritic disease . ten additional children developed uveitis less than three years of the initial ocular examination and , in 7 children the uveitis was detected 3 to 7 years later ( table 1 ) . among the 20 children presenting initially with uveitis , 19 developed clinical manifestations compatible with the pauciarticular type of jia . a systemic type of jia was confirmed two months after the diagnosis of uveitis in one out of these 20 children ( table 2 ) . thus , out of a total of 172 children with jia , 51 children had an associated intraocular inflammation ( uveitis ) . thirty nine of these 51 children ( 76.5% ) had the pauciarticular type of jia . in 32 of these 39 children ( 82% ) , the uveitis was either the presenting symptom or it was detected during the initial ophthalmic examination . on initial examination , the intraocular inflammation processes were confined to the anterior segment in 45 of the 51 ( 88.2% ) affected children . in 5 of the affected children ( 9.8% ) , a few cells were also observed in the anterior vitreous and in one child ( 2% ) , a marked vitritis with peripheral retinal vasculitis was observed in one eye . on further follow up however , only in 4 out of the 51 patients ( 7.8% ) , the inflammatory processes remained strictly confined to the anterior segment . thus , with time , a tendency towards the involvement of the intermediate and posterior segments was observed . on last ophthalmic examination ( 3 to 15 years after initial diagnosis ) , in 22 patients ( 43.1% ) the inflammatory signs were detected in all eye segments ( pan uveitis ) and in 24 children ( 47% ) , the inflammatory reaction involved the anterior and intermediate segments . when the intraocular inflammation was initially diagnosed , it was uniocular in 29 of the 51 children ( 56.9% ) . on further follow up , the intraocular inflammation remained uniocular only in 8 of the 51 patients ( 15.7% ) while in 43 children ( 84.3% ) there was involvement of both eyes . when both eyes were affected , the intensity of intraocular inflammation was unequal in the majority of patients . the eye with more severe inflammation showed invariably a poorer visual acuity and more prominent secondary ocular complications . the ocular complications observed in the 94 affected eyes of the 51 children are illustrated in table 3 . more severe and early complications were observed in girls manifesting the intraocular inflammatory processes when 4 years of age or younger . in 46 of the 94 eyes with uveitis ( 48% ) , a band - shaped keratopathy developed . in most , the keratopathy was mild and did not interfere with vision . in 5 eyes ( 5.3% ) , the keratopathy was dense , encroached on the visual axis and affected the visual acuity . an increased iop above 24mmhg and possible development of glaucoma was detected in 24 of the 94 , ( 25% ) affected eyes . medical treatment consisting of beta blockers and carbonic anhydrase inhibitor drops along with a decrease in the instillation frequency of corticosteroid eye drops induced a decrease of iop below 20 mmhg in all cases . lens opacity interfering with the visual acuity ( cataract ) was recorded in 56 of the 94 affected eyes ( 59.6% ) . in eyes developing severe lens changes ( dense cataract ) accompanied by band keratopathy , marked impairment of the visual functions interfering with the daily activity and/or inducing amblyopia it was assessed that the lens opacity and/or the ensuing amblyopia were the main cause for the decrease of vision to a level lower than 0.05 ( 6/120 or 20/400 ) ( table 4 ) . twenty nine of these eyes underwent lensectomy combined with anterior vitrectomy while in one case , the parents declined surgical intervention . an intraocular lens ( iol ) was implanted in 19 eyes ( pseudophakia ) while 10 eyes remained aphakic . glasses or contact lenses were prescribed for the correction of aphakia in these 10 eyes .", "the reported incidences of this association vary markedly with lower incidences and less severe ocular disease being reported more recently ( sherry et al 1991 ; oren et al 2001 ; sim et al 2006 ; saurenmann et al 2007 ) . a close look at these published differences reveals that the severity of ocular affection in the various studies is probably associated with population selection and referral trends in specific medical environments . it appears that the severity of ocular complications is higher when the study authors are ophthalmologists . this tendency is increased further when the papers originate from tertiary clinics specializing in uveitis and surgery of its complications . noteworthy is the fact that 20 of the 51 children with jia and uveitis in our cohort presented with severe intraocular inflammation . the diagnosis of jia was made only after these children were referred specifically for pediatric examination to assess the possible presence of jia . in most of these 20 children thus , a study regarding the incidence of uveitis in jia carried out by pediatricians will not include these children biasing the incidence as well as the severity of ocular inflammation . concomitant with other reports ( sim et al 2006 ; grassi et al 2007 ; henligenhaus et al 2007 ) , we observed in our present study that the highest associated incidence of arthritis and ocular manifestations is found in the group of children with the pauciarticular type . we have also noted that , in many cases , the articular and ocular clinical disease severity do not parallel . in many children , we observed severe ocular exacerbations during quiescent periods of arthritic manifestations and vice versa . an interesting aspect of our study is the observation that during the initial phase of the ocular disease , the inflammation is strictly restricted to the anterior segment . later during the follow up however , the intermediate and posterior segments become involved in the intraocular inflammatory processes . these observations may result from a spill over of the chronically stimulated inflammatory cells from the anterior segment to the posterior structures dragging them to react following the release of inflammatory cytokines . the major points of clinical interest which can be derived from our study are : \n thirty nine of the 51 children with uveitis in our study group ( 76.5% ) had the pauciarticular type of jia.the majority of children with pauciarticular jia developing intraocular inflammation harbor signs of ocular disease either before or shortly after the development of arthritic manifestations.most children with polyarticular or systemic jia types do not present signs of intraocular inflammation during the first three years following the initial arthritic manifestations.the potential for a child with jia to develop de novo ocular inflammation , at any time during the ophthalmic follow up , is low . the majority of children within all jia types who devolop an associated uveitis harbor ocular signs on initial examination . therefore , frequent ophthalmic visits for all children with jia seems unjustified.nearly all children presenting with ocular disease and developing later jia characteristics , had a mild arthritis involving only one or two joints . thirty nine of the 51 children with uveitis in our study group ( 76.5% ) had the pauciarticular type of jia . the majority of children with pauciarticular jia developing intraocular inflammation harbor signs of ocular disease either before or shortly after the development of arthritic manifestations . most children with polyarticular or systemic jia types do not present signs of intraocular inflammation during the first three years following the initial arthritic manifestations . the potential for a child with jia to develop de novo ocular inflammation , at any time during the ophthalmic follow up , is low . the majority of children within all jia types who devolop an associated uveitis harbor ocular signs on initial examination nearly all children presenting with ocular disease and developing later jia characteristics , had a mild arthritis involving only one or two joints . from our present study observations , it can be concluded that rigorous and very frequent ophthalmic exams for jia children are not obligatory if during the first ophthalmic examination ocular inflammatory signs are not detected . furthermore , from our experience , a rigorous time frame for regular follow up visits for these children as suggested ( rosenberg and oen 1986 ) seems unnecessary and , in our opinion , may be counterproductive for the following reasons : ( a ) uveitis may be detected during the ophthalmic examination only if the inflammatory signs are already present , ( b ) there are no predictive signs for the potential development of intraocular inflammation in these children , and ( c ) an intraocular inflammation may develop 24 or 48 hours after the regular periodic visit . in these cases , parents may be reluctant to seek again ophthalmic consultation ( even if they suspect a problem ) until serious complications develop . therefore , education of the parents about the ocular disease , its potential evident signs and symptoms should be the main line of conduct for follow up instead of regular frequent ophthalmic visits . a drop of vision affecting the child s daily behavior can be noticed by parents . also , parents can be taught to perform a visual acuity test at home when playing with the child . these measures in our experience are more effective , practical , easily carried out and have the highest possible cost / benefit ratio . in this study we confirm , as published earlier ( benezra and cohen 2000 ) and also reported by others ( wolf et al 1987 ; akduman et al 1997 ; woreta et al 2007 ) that , severe complications with loss of vision are still to be feared in children with jia who are developing uveitis . most severe ocular complications have been observed in children 4 years of age or younger who presented first with ocular disease or had an ocular involvement detected during the initial ophthalmic examination . if not treated early , loss of vision may ensue in these cases even if successful control of the intraocular inflammation is achieved but proper anti amblyopic measures are not applied early . last but not least , in the management of jra associated ocular inflammation , surgery should be considered despite the potential for complications . in properly selected cases , early surgery may even be considered in children with severe visual impairment in one eye due to band keratopathy , seclusion of the pupil by inflammatory membranes and/or dense cataract . in these cases , adequate surgical procedure of the cataract combined with intraocular lens implantation is to be considered and can result in good restoration of vision ( benezra and cohen 2000 ; khotaniemi and penttila 2006 ) ." ]

[ "increasing cytosolic calcium ion ( ca ) concentration is essential for the contraction of smooth muscle cells . the increase results from the influx of ca through the plasma membrane and release of ca from intracellular stores , mainly the sarcoplasmic reticulum ( sr ) [ 14 ] . phenylephrine ( pe ) or angiotensin ii ( ang ii ) induces receptor - coupled g protein - induced phosphoinositide 3-kinase ( pi3k ) and phospholipase c ( plc ) activation , resulting in ca - dependent vasoconstriction in smooth muscle cells [ 510 ] . pi3k activity facilitates the production of 3-phosphorylated phosphoinositides such as phosphatidylinositol 3-phosphate ( pi(3)p ) , phosphatidylinositol ( 3,4)-bisphosphate ( pi(3,4)p2 ) , and phosphatidylinositol ( 3,4,5)-triphosphate ( pi(3,4,5)p3 ) [ 11 , 12 ] . among these , pi(3,4,5)p3 stimulates the l - type ca channel ( 12 ) , a voltage - dependent ca channel that plays an important role in the regulation of vascular tone [ 5 , 12 , 13 ] . activated plc is an effector in the stimulation of ca release from the endoplasmic reticulum ( er ) or the sr [ 1416 ] . plc hydrolyzes phosphatidylinositol 4,5-bisphosphate ( pip2 ) into diacylglycerol ( dag ) and inositol ( 3 , 4 , 5)-triphosphate ( ip3 ) . the latter is released as a soluble structure into the cytosol , where it binds to ip3 receptors in the sr [ 15 , 17 ] . this binding process increases the cytosolic ca concentration and smooth muscle constriction [ 15 , 16 ] . the herb cinnamomi ramulus ( cr ) has traditionally been used in asia and europe to treat maladies involving blood circulation and inflammation . in one study , an aqueous extract of cr ameliorated sucrose - induced blood pressure elevation in spontaneously hypertensive rats . recently , we reported that cr ethanol extract ( cre ) reduces vascular contraction through the inhibition of voltage - dependent ca channels . the present study explored the suggestion that the vasodilatory effect of cre is related to ca - dependent mechanisms in rat aorta .", "all animals were provided with food and water ad libitum and allowed to adapt to the experimental conditions ( temperature , 21 2c ; humidity , 5060% ) for 1 week . rabbit polyclonal antibodies against phosphorylated plc ( pplc ) , -actin , and anti - rabbit secondary antibody were purchased from santa cruz biotechnology ( santa cruz , calif , usa ) . pi3k / p85 antibody was purchased from cell signaling technology ( beverly , mass , usa ) . pe , ang ii , verapamil , nifedipine , fpl64176 , 2 , 4 , 6-trimethyl - n-(meta-3-trifluoromethyl - phenyl)-benzenesulfonamide ( m-3m3fbs ) , u73122 and caffeine were purchased from sigma - aldrich ( st . louis , mo , usa ) . cr ( twigs of cinnamomum cassia blume ) collected in china in november 2009 was purchased from humanherb ( gyeongsan , korea ) . a voucher specimen ( cre08 ) has been deposited in the college of oriental medicine , dongguk university . dried cr ( 100 g ) was extracted with 500 ml of 70% ethanol by heating at 75c for 3 h. the extract was filtered through whatman filter paper ( whatman international , maidstone , uk ) to remove the insoluble materials . after filtration , the extracts were concentrated by rotary evaporation using a model vv2000 apparatus ( heidolph , walpersdorfer , germany ) at a temperature of 75c and then dried using a model fd8508s freeze dryer ( ilshin , busan , korea ) . the ec50 value of 0.1 mg / ml cre was used in all experiments . in a previous research , cinnamaldehyde and coumarin also , cinnamaldehyde was known as major active compound of cr for vasodilation , antitumor , and antifungal activity . all procedures were performed according to protocols approved by the institutional animal care and use committee of dongguk university . briefly , rats were sacrificed and their thoracic aortas were immediately excised and immersed in ice - cold krebs solution ( 115.0 mm nacl , 4.7 mm kcl , 2.5 mm cacl2 , 1.2 mm mgcl2 , 25.0 mm nahco3 , 1.2 mm kh2po4 , and 10.0 mm dextrose ) . the aortas were cleaned of all adherent connective tissue and cut into 3 mm long ring segments . endothelium was removed from the internal surface of each segment by gentle rubbing with forceps . one triangle was anchored to a stationary support and the other was connected to a ft03 isometric force transducer ( grass , quincy , mass , usa ) . each vessel ring was incubated in a water - jacketed organ bath ( 10 ml ) that was maintained at 37c and aerated with a mixture of 95% o2 and 5% co2 . each ring was stretched passively by imposing the optimal resting tension of approximately 2.0 g , which was maintained throughout the experiment . each endothelium - free aortic ring was allowed to equilibrate in the organ bath for at least 50 min before the experiment involving the contractile response to 5 m ang ii , 1 m pe , 10 m fpl64176 , 5 g / ml m-3m3fbs , or 30 mm caffeine . endothelium - free rings were used because preliminary experiments ( data not shown ) established that cre relaxes vascular constriction in an endothelium - independent manner . the denudation of endothelium was assessed by treating the rings with 1 m acetylcholine . isometric tension was recorded using a powerlab/8sp computerized data acquisition system ( adinstruments , castle hill , nsw , australia ) . the influence of cre on extracellular ca influx was studied in ca - free krebs solution . after equilibration of the ring in ca - free krebs solution containing 60 mm kcl , cumulative doses of cacl2 were added ( 0.3 , 0.6 , 1 , 1.5 , 2.5 , 5 , and 10 mm , in order ) with preincubation of cre in organ bath . the cacl2 dose - dependent maximum constriction of the aortic ring with 60 mm kcl in ca - free krebs solution was expressed as 100% . to determine the influence of cre on ca influx through the l - type ca channel , aortic rings were pretreated with nifedipine or verapamil before pe contraction , and were preincubated with cre before contraction by fpl64176 . to investigate the inhibitory effect of cre on intracellular ca release by pe in ca - free conditions , and by caffeine in normal krebs solution , the transient contraction of cre preincubated aortic rings was measured . to further investigate the relationship with the plc pathway , aortic rings were constricted with m-3m3fbs , and were preincubated with u73122 prior to contraction by pe . a previously described protocol was used for preparation of protein extract with some modifications . briefly , endothelium - free aortic rings were contracted with 1 m pe or 5 g / ml m-3m3fbs , and then treated with cre for 30 min . the aortic rings were quick frozen by immersion in acetone containing 10% trichloroacetic acid ( tca ) and 10 mm dithiothreitol ( dtt ) precooled to 80c . when used , recovered samples were homogenized in buffer containing 320 mm sucrose , 50 mm tris , 1 mm edta , 1% triton x-100 , 1 mm dtt , and the following protease inhibitors : leupeptin ( 10 g / ml ) , trypsin ( 10 g / ml ) , aprotinin ( 2 g / ml ) , or phenylmethylsulphonyl fluoride ( 100 g / ml ) . the protein samples were electrophoresed and the resolved proteins were transferred to a nitrocellulose membrane . the membrane was incubated with primary antibodies and then treated with horseradish peroxidase - conjugated anti - rabbit igg as a secondary antibody . all bands were detected using an enhanced chemiluminescence system ( amersham biosciences , buckinghamshire , uk ) . each set of experiments was done at least three times and results are presented as the mean sd . the statistical significance of differences between mean values was assessed with student 's t - test or anova .", "ang ii increases the intracellular ca concentration in vascular smooth muscle cells through a sequence of events following activation of ang ii type 1 receptor and l - type calcium channels [ 6 , 7 ] . pe- or ang ii - induced contraction was significantly dilated by 53.6 7.8% and 66.0 5.4% , respectively , as compared to maximal tension ( figure 1 ) , indicating that that cre - mediated vasodilation may be related to decreased intracellular ca concentration . to determine the influence of cre on ca influx , the change of contraction was measured by adding cacl2 in an accumulative manner ( 0.3 , 0.6 , 1 , 1.5 , 2.5 , 5 , and 10 mm , in order ) before and after cre pretreatment in ca - free krebs solution containing 60 mm kcl . the vasoconstriction rate at the aforementioned cacl2 concentrations were 7.7 8.1% , 23 16% , 44 16.7% , 59 17% , 72 14% , 88.4 9.4% , and 100% , respectively , ( the latter represents the maximum contraction value of the aortic ring , achieved at 10 mm cacl2 ) . these contractions were significantly reduced by 1.9 2.2% , 5.8 4.1% , 8.3 6.3% , 11.4 4.4% , 22.3 1.9% , 24.8 6.2% , and 29.7 3.8% ( same respective cacl2 concentrations ) with cre - pretreatment ( figure 2 ) . to discern the effect of cre on the l - type calcium channel , the influence of the l - type calcium channel blocker nifedipine ( 100 m ) or verapamil ( 1 m ) , and the l - type calcium channel activator fpl64176 ( 10 m ) on vasorelaxation of cre against pe - induced contraction of aortic rings was measured . pretreatment of aortic rings with nifedipine or verapamil significantly inhibited the relaxant effect of cre ( figure 3(a ) ) . previous studies have shown that fpl64176 increases extracellular ca entry , thereby enhancing the cytosolic ca concentration [ 23 , 24 ] . presently , fpl64176 induced contraction , which plateaued at 3.75 0.22 g in 30 min , was inhibited by 2.4 0.1 g with preincubation of cre ( figure 3(b ) ) . to assess whether cre is involved in ca release - mediated vasoconstriction from intracellular stores , the transient contraction by pe or caffeine was examined in cre preincubated aortic rings . preincubation reduced the magnitude of contraction by pe from 0.32 0.6 g to 0.1 0.6 g ( figure 4(a ) ) . the transient contraction induced by 30 mm caffeine was also reduced by cre pretreatment ( figure 4(b ) ) . to evaluate whether the relaxant effect of cre was involved in the plc pathway , the plc pathway inhibitor u73122 and activator m-3m3fbs were used . u73122 pretreatment significantly inhibited the relaxant effect of cre on pe - induced contraction from 56.9 2.7% to 8.5 1.3% ( figure 5(a ) ) . m-3m3fbs ( 5 g / ml)-induced contraction was relaxed significantly with cre treatment ( figure 5(b ) ) . pi3k is directly activated by g - protein for generation of pip3 , which eventually stimulates l - type calcium channels in vascular myocytes [ 5 , 12 ] . , ip3 stimulates intracellular ca release from the sr for vasoconstriction [ 15 , 17 ] . presently , pe and m-3m3fbs increased the expression levels of pi3k ( 4.5 0.38 and 2.0 0.32 , resp . ) and pplc ( 4.1 0.30 and 2.5 0.14 , resp . ) , which were significantly decreased by cre . pe - induced pi3k expression was decreased by 2.8 0.70 at 50 g / ml and by 0.2 0.6 at 100 g / ml . pplc expression was also decreased by 2.0 0.30 at 50 g / ml and by 1.8 0.1 at 100 g / ml ( figure 6(a ) ) . m-3m3fbs - induced pi3k expression was downregulated by 0.6 0.1 at 50 g / ml and by 0.5 0.2 at 100 g / ml , and pplc expression was decreased by 1.4 0.1 at 50 g / ml and by 0.3 0.1 at 100 g / ml ( figure 6(b ) ) .", "its bark and twig are known as cinnamomi cortex ( cc ) and cinnamomi ramulus ( cr ) , respectively . cc inhibits helicobacter pylori and ameliorates sucrose - induced blood pressure elevation in spontaneously hypertensive rats . furthermore , cre exerts an endothelium - independent vasodilatory response through inhibition of voltage - dependent ca channels . the present study investigated the vasodilatory effect of cre resulting from the inhibition of both ca influx and release in rat aorta . pe or ang ii stimulate plc isoforms to generate ip3 through the activation of g proteins , causing release of activator ca from sr [ 9 , 10 , 1416 ] . presently , cre markedly and similarly relaxed aortic rings that were precontracted with pe or angii . these results suggest that cre - mediated vasodilation may be involved in the regulation of ca mobilization . to assess this , firstly , whether cre actually inhibits extracellular ca influx or not , we measured the tension of aortic rings by accumulative addition of cacl2 in ca - free krebs solution containing 60 mm kcl . preincubation with cre significantly reduced rat aortic contraction by addition of cacl2 , , indicating inhibition of ca influx . nifedipine ( 100 m ) and verapamil ( 1 m ) pretreatment inhibited the vasodilative effect of cre on pe - induced constricted aortic rings from 54.9 4.1% to 15.3 2.1% and 13.9 5.2% , respectively . in addition , preincubation with cre reduced the contraction of aortic ring by 10 m fpl64176 . these results support the suggestion that the vasodilative effect of cre is related to the inhibition of l - type calcium channel in the cell membrane . the sr is the major source of ca release into the cytosol [ 1 , 16 , 17 ] . this ca release is induced by the ip3 second messenger , which is generated by plc activation . ca release from the sr is considered to be the initial mechanism in agonists such as pe- and ang ii - induced vasoconstriction [ 6 , 17 ] . pe - induced transient constriction is dependent on ca release from the sr through the ip3 signal pathway in ca - free krebs solution ; however , caffeine is dependent on ca - induced ca release from the sr [ 27 , 28 ] . to demonstrate the effects of cre on ca release from the sr , transient contractions induced by pe in ca - free krebs solution and induced by caffeine in normal krebs solution were investigated . cre significantly reduced the magnitudes of transient contraction by pe and caffeine , suggesting cre inhibits ca release from the sr by blocking the ip3-induced ca release and ca - induced ca release mechanisms . pretreatment with the plc inhibitor u73122 significantly reduced the vasorelaxation of cre on pe - induced vasoconstriction , and cre relaxed m-3m3fbs - induced vasoconstriction . additionally , we analyzed the expression levels of the intracellular signaling regulator proteins pi3k and plc . pi3k generates various 3-phosphorylated phosphoinositides through activation by g - proteins , especially pi(3,4,5)p3 stimulates the l - type ca channel that plays an important role in the regulation of vascular tone [ 8 , 11 , 12 ] . on the other hand , plc formats the two potent second messengers ip3 and dag especially , ip3 induces the activation of ip3 receptor on the sr membrane , opening a calcium channel , resulting in the release of ca into the cytosol [ 14 , 17 ] . presently , pe- or m-3m3fbs - induced phosphorylation of plc and upregulation of pi3k / p85 protein expression were inhibited by cre ( figure 6 ) . the collective data supports the idea that cre dilates vascular contraction through the inhibition of both ca influx via the l - type ca channel and ip3-induced ca release from the sr . in conclusion , the data supports the vasorelaxation of cre through the inhibition of ca influx and ca release . therefore , cre may be useful as a drug for the treatment and prevention of high blood pressure associated with ca - dependent contraction of smooth muscle ." ]

[ "after an information campaign in horse journals and at meetings , 278 samples of maple tree leaves , sprouts , and seeds collected by horse owners in 2014 were sent to utrecht university ( uu ) and rikiltwageningen ur ( figs 1 , 2 , 3 ) . the samples were taken from the ground , packed in plastic , and immediately sent to the laboratory where they were stored at 20c within 24 hours of collection . they were classified by an experienced botanist at the species level ( acer pseudoplatanus , acer platanoides , or acer campestre ) on the basis of the samples and accompanying photographs sent by owners . sprouts were only used in this study upon positive classification by means of accompanying leaves , seeds or both . the minimum amount of material was 50 g for seeds and sprouts and 100 g for leaves . owners were asked to complete a questionnaire with information about date of collection , address of the pasture , species of maple tree ( in their opinion ) , signalment ( name , breed and age ) of the horse(s ) , and presence of disease ( am ) in horses that were grazed in the pastures where the material was collected . if the pasture had contained horses with am , details about the disease ( including date of onset and the final outcome ) , laboratory results and name of the veterinarian were provided . inclusion criteria to confirm am were recumbency , dark colored urine , high serum activity of creatine kinase ( ck , either too high to measure in practice , or > 100,000 iu / l in a laboratory ) and postmortem examination , which was performed in 4 cases . exclusion criterion for am was lack of ck analysis unless postmortem examination was performed . the geographic location of the pastures where the acer seeds , sprouts and leaves were sampled . \n a , b , c leaves of acer pseudoplatanus , acer campestre and acer platanoides . hypoglycin a was measured using a newly validated method based on liquid chromatography coupled to tandem mass spectrometry ( lc ms / ms).1 \n seed samples ( 50 g , as received ) were ground in a retsch mill , and leaf samples ( 50100 g ) were cryogenically milled into a powder , using liquid nitrogen . one gram of homogenized sample material was extracted with 10 ml of milliq water ( mechanical shaker , 1 h ) . after centrifugation ( 5000 g , 10c , 10 min ) , 10 l of the clear extract was injected into an lc ms / ms system , acquiring 2 transitions ( m / z 142.174.1 and 142.196.0 ) . hypoglycin a was identified based on matching retention time and ion ratio of the 2 transitions , against an analytical reference standard ( shypoglycin a2 ) dissolved in milliq water . ( residuals < 20% ) between the concentration of hypoglycin a and the msresponse was obtained in the range 0.012 mg / l , corresponding to 0.120 mg / kg in nondiluted extract and 102000 mg / kg for 100fold diluted extracts . the accuracy of the method was determined as the recovery obtained after spiking known amounts of hypoglycin a to blank leaf ( 1 mg / kg ) and seed ( 10 mg / kg ) samples in 5fold dilutions . the corresponding repeatabilities ( relative standard deviation , rsd ) were 11% and 7% , respectively . the rsd obtained for repetitive analysis ( n = 5 ) of a homogenized seed sample containing hypoglycin a at a concentration of 194 mg / kg was 8% . recoveries obtained for hypoglycin a in spiked seed samples ( 10 mg / kg ) concurrently analyzed with the study samples were consistent with those of the validation and in the range of 7395% . samples with incomplete questionnaire data on relevant facts , such as address and obtainable data about the disease if present , were excluded from further statistical analysis ( 9 samples ) . if multiple samples from 1 pasture were submitted , which happened often , the mean result of the analyses per sample type ( sprout , seed or leaf ) were counted as 1 result in further statistical analysis . samples that could not be unambiguously assigned to an acer species ( 6 ) , samples that were not fresh ( 17 ) , and samples that contained material other than seeds , sprouts and leaves ( 10 ) also were excluded from the study . this approach resulted in 143 usable samples , 30 from the spring and 113 from the autumn of 2014 . the samples were grouped by whether they came from pastures grazed by healthy horses or horses with am ( nonam versus am pastures ) . mean concentrations of hypoglycin a were compared for the type of sample ( seed versus sprout versus leaf ) , season ( spring versus autumn ) and disease status for the pasture ( nonam versus am ) . statistical analysis was performed using univariate generalized linear models with multiple comparisons , corrected with a posthoc bonferroni test.3 \n control for normal distribution was performed .", "after an information campaign in horse journals and at meetings , 278 samples of maple tree leaves , sprouts , and seeds collected by horse owners in 2014 were sent to utrecht university ( uu ) and rikiltwageningen ur ( figs 1 , 2 , 3 ) . the samples were taken from the ground , packed in plastic , and immediately sent to the laboratory where they were stored at 20c within 24 hours of collection . they were classified by an experienced botanist at the species level ( acer pseudoplatanus , acer platanoides , or acer campestre ) on the basis of the samples and accompanying photographs sent by owners . sprouts were only used in this study upon positive classification by means of accompanying leaves , seeds or both . the minimum amount of material was 50 g for seeds and sprouts and 100 g for leaves . owners were asked to complete a questionnaire with information about date of collection , address of the pasture , species of maple tree ( in their opinion ) , signalment ( name , breed and age ) of the horse(s ) , and presence of disease ( am ) in horses that were grazed in the pastures where the material was collected . if the pasture had contained horses with am , details about the disease ( including date of onset and the final outcome ) , laboratory results and name of the veterinarian were provided . inclusion criteria to confirm am were recumbency , dark colored urine , high serum activity of creatine kinase ( ck , either too high to measure in practice , or > 100,000 iu / l in a laboratory ) and postmortem examination , which was performed in 4 cases . exclusion criterion for am was lack of ck analysis unless postmortem examination was performed . the geographic location of the pastures where the acer seeds , sprouts and leaves were sampled . \n a , b , c leaves of acer pseudoplatanus , acer campestre and acer platanoides .", "hypoglycin a was measured using a newly validated method based on liquid chromatography coupled to tandem mass spectrometry ( lc ms / ms).1 \n seed samples ( 50 g , as received ) were ground in a retsch mill , and leaf samples ( 50100 g ) were cryogenically milled into a powder , using liquid nitrogen . one gram of homogenized sample material was extracted with 10 ml of milliq water ( mechanical shaker , 1 h ) . after centrifugation ( 5000 g , 10c , 10 min ) , 10 l of the clear extract was injected into an lc ms / ms system , acquiring 2 transitions ( m / z 142.174.1 and 142.196.0 ) . hypoglycin a was identified based on matching retention time and ion ratio of the 2 transitions , against an analytical reference standard ( shypoglycin a2 ) dissolved in milliq water . quantification was performed by multilevel calibration . a consistent linear relationship ( residuals < 20% ) between the concentration of hypoglycin a and the msresponse was obtained in the range 0.012 mg / l , corresponding to 0.120 mg / kg in nondiluted extract and 102000 mg / kg for 100fold diluted extracts . the accuracy of the method was determined as the recovery obtained after spiking known amounts of hypoglycin a to blank leaf ( 1 mg / kg ) and seed ( 10 mg / kg ) samples in 5fold dilutions . the corresponding repeatabilities ( relative standard deviation , rsd ) were 11% and 7% , respectively . the rsd obtained for repetitive analysis ( n = 5 ) of a homogenized seed sample containing hypoglycin a at a concentration of 194 mg / kg was 8% . recoveries obtained for hypoglycin a in spiked seed samples ( 10 mg / kg ) concurrently analyzed with the study samples were consistent with those of the validation and in the range of 7395% .", "samples with incomplete questionnaire data on relevant facts , such as address and obtainable data about the disease if present , were excluded from further statistical analysis ( 9 samples ) . if multiple samples from 1 pasture were submitted , which happened often , the mean result of the analyses per sample type ( sprout , seed or leaf ) were counted as 1 result in further statistical analysis . samples that could not be unambiguously assigned to an acer species ( 6 ) , samples that were not fresh ( 17 ) , and samples that contained material other than seeds , sprouts and leaves ( 10 ) also were excluded from the study . this approach resulted in 143 usable samples , 30 from the spring and 113 from the autumn of 2014 . the samples were grouped by whether they came from pastures grazed by healthy horses or horses with am ( nonam versus am pastures ) . mean concentrations of hypoglycin a were compared for the type of sample ( seed versus sprout versus leaf ) , season ( spring versus autumn ) and disease status for the pasture ( nonam versus am ) .", "statistical analysis was performed using univariate generalized linear models with multiple comparisons , corrected with a posthoc bonferroni test.3 \n control for normal distribution was performed . a p value of .05 was set as statistically significant .", "in total , 143 of the collected samples ( 93 seed samples , 14 sprout samples , and 36 leave samples ) from a total of 81 locations were included ( fig 1 ) . none of the acer platanoides ( n = 11 ) and acer campestre ( n = 13 ) samples ( 29 samples of seeds , 11 of leaves and 1 of sprouts ) contained detectable concentrations of hypoglycin a. in contrast , most acer pseudoplatanus leaves , seeds , and sprouts contained the toxin . in 2 samples of seeds and 6 samples of leaves , no hypoglycin a was found ( ie , concentration below limit of quantification [ 1 mg / kg for leaves and 10 mg / kg for seeds ] ) . the factor season was not statistically significant ( p = .841 ) and was excluded from further statistical analysis . the mean sd concentrations of hypoglycin a in the samples are presented in table 1 . hypoglycin a concentrations differed significantly among the sample types ( seeds and sprouts , p < .001 ; seeds and leaves , p < .001 ; sprouts and leaves , p = .000 ) . concentrations were significantly higher in seeds from the am group than in seeds from the nonam group ( seeds , 856 677 versus 456 358 mg / kg ; p = .039 ) . in sprouts , ( 1365 795 mg / kg versus 1097 310 , p = .493 ) and leaves ( 31 49 versus 37 34 mg / kg , p = .819 ) this was not the case and when values for all seeds , sprouts , and leaves were combined the difference between nonam and am was not significant either ( p = .127 ) ; ( table 1 ) . the concentration ( mg / kg ) of hypoglycin a in samples of acer pseudoplatanus taken from pastures or paddocks grazed by healthy horses and horses with atypical myopathy ( am ) concentration significantly different between pastures used by healthy and am horses ( p = 0.039 ) . there were 16 horses ( providing 29 samples ) with am of which 11 died and 5 survived . there was no relationship between the concentration of hypoglycin a in the samples and outcome of the disease ( p = .250 ) .", ", acer negundo ( box elder tree ) and acer pseudoplatanus ( sycamore maple ) have been associated with am.15 , 17 \n the species acer campestre ( hedge maple ) and acer platanoides ( norway maple ) did not contain detectable hypoglycin a concentrations , and thus it is probably safe , in terms of am , to grow these species in or around pastures and paddocks . in 1973 , semiquantitative measurements ( notdetected , trace , weak , moderate , and strong ) also indicated that these tree species were free of hypoglycin a.18 \n the most common maple tree in the netherlands is acer pseudoplatanus . we found that the leaves , sprouts , and seeds contained measurable concentrations of hypoglycin a. although hypoglycin a concentrations were significantly lower in seeds collected from pastures grazed by healthy horses than in samples from pastures grazed by am horses , concentrations were too variable to allow predictions to be made as to whether or not the presence of an individual tree would be a threat to horses grazing in its vicinity . our results are consistent with a study that found hypoglycin a concentrations in seeds to be highly variable among trees on the same or different farms.17 hypoglycin a concentrations in our study were similar to those previously reported.17 in the previous study , a mean concentration of 690 mg / kg was found with variation between 40 and 2810 mg / kg and in our study a mean of 856 mg / kg with variation between 25 and 3683 mg / kg was found . the question arises as to why not all horses grazing pastures containing or surrounded by acer pseudoplatanus develop am . the most likely explanation might relate to differences in the amount of seeds , sprouts , and leaves ingested , other components of the diet , and the sensitivity of the individual horse . the availability of seeds , leaves , and sprouts largely is determined by the season and weather , with changes in wind and temperature loosening the attachment of leaves and seeds.6 , 10 , 15 , 19 indeed , inclement weather or high winds have been reported to precede clinical signs of am.6 , 12 , 15 strong winds can disperse leaves and seeds over a long distance , perhaps depositing them in pastures that do not contain acer trees . all of these factors could explain why acer trees are not always found in the paddock or pastures grazed by horses with am.8 \n our results suggest that , per kilogram , sprouts are most dangerous to horses , followed by seeds , with leaves being potentially least harmful . data show that there are more cases of am in autumn than in spring.8 because sprouts are more common in spring and seeds are more common in autumn , it would appear that horses eat more seeds than sprouts either because more seeds are available or because they prefer seeds to sprouts . however , whether horses eat seeds or sprouts is to a large extent determined by the availability of other feedstuff.20 in general , spring pasture contains more and better grass than autumn pasture , and thus horses may have less reason to eat other feedstuff.20 \n the finding that the concentration of hypoglycin a is high in sprouts suggests that horse owners should be alert to the presence of acer sprouts in pastures . owners should be advised to mow areas of pasture with maple sprouts and to remove the mown material . a factor that needs further investigation is tree stress.20 , 21 tree stress or abiotic stress may increase the hypoglycin a concentration in seeds . several owners who sent in samples did not return the questionnaire or did not complete it fully . moreover , if there was doubt ( after consultation with the owner 's veterinarian ) about whether a horse suffered from am or not , data for samples collected from that horse 's paddock or pasture were not used . results of the samples of 1 type ( seed , sprout , or leaf ) originating from 1 pasture were pooled and the mean concentration of these was treated as 1 sample . because toxin concentrations are highly variable among trees on the same farm , it would have been better to have taken more samples of all materials . the seeds were fresh frozen and not desiccated before freezing and changes in toxin concentrations as a result of artificial freezing could have occurred in the spring samples in the same fashion as occurs naturally in autumn . ideally all cases would have been confirmed by analyzing blood or urine for madd or toxin or toxin metabolites . because doing so was not always possible , the described inclusion criteria were used to make the diagnosis . in conclusion , it is important to know the tree species when giving advice regarding the toxicity of maple trees and the potential risk for horses , because some acer species contain hypoglycin a and others do not . unfortunately , the amount of hypoglycin a in seeds is so variable that a reliable prediction of the occurrence of am can not be made for individual farms . therefore , it is not worthwhile to measure hypoglycin concentrations in individual seed samples in order to predict am risk . however , in all cases in which no hypoglycin a was found , no clinical signs of am were observed . thus , the most important recommendation is that owners should prevent horses from eating seeds , sprouts , leaves , or any combination of these from acer pseudoplatanus ( sycamore maple ) , whereas the seeds of acer campestre ( hedge maple ) and acer platanoides ( norway maple ) appear to be safe for horses . steps to prevent the ingestion of toxin include moving the horse to a safer pasture , decreasing the size of the pasture ( away from the trees ) , blowing away seeds and leaves , or mowing and removing sprouts .", "" ]

[ "cell migration requires the rearrangement of adhesions and cytoskeleton in response to extracellular stimuli to form a leading edge that allows directed locomotion . in most cell types , migration - related adhesive structures are composed of integrin heterodimers and intracellular associated proteins clustered in plaques termed focal complexes and their more mature variant , focal adhesions . in addition to these adhesive structures , dcs also assemble distinctive adhesions named podosomes that are characteristic of cells of the myeloid lineage including macrophages and osteoclasts [ 4 , 5 ] . the molecular composition of podosomes is similar to that of focal complexes and focal adhesions . however , they have a unique organization with actin filaments bundled in discrete foci forming a conical core containing distinctive elements such as gelsolin , cortactin , the actin - nucleating factor arp 2/3 complex , and the scaffolding protein wasp surrounded by a ring of integrins and integrin - associated proteins [ 4 , 5 ] . wasp is an essential component of podosomes , where it activates the arp2/3 complex inducing actin polymerization . wip has also been detected in the core of podosomes in endothelial cells expressing egfp - wip , and although there is evidence indicating that wip plays a major role in regulating the activity of wasp family proteins and the dynamics of actin filaments [ 8 , 9 ] , it remains unknown how wip participates in the assembly of podosomes . to study the role of wip in podosome formation , the distribution of f - actin and vinculin was examined in wild - type and wip dcs by confocal microscopy . as expected , podosomes were grouped in clusters in wild - type dcs ( figures 1a and 1c ) . those few podosomes formed in wip dcs displayed an abnormal structure having less discrete actin cores and disorganized vinculin rings around f - actin ( figure 1d ) . large focal contacts containing vinculin comprised the most striking adhesion structures in wip dcs ( figures 1b and 1e ) , replacing podosomes as the major points of contact with the substratum . the critical involvement of wip in dc podosome formation is also supported by the presence of endogenous wip in the core of podosomes in wild - type cells ( figure 1f ) . our data suggest that the key role of wip in podosome formation is in the organization of f - actin and the clustering of integrins and associated proteins . the absence of wip had a profound effect on the organization of f - actin within dcs . while the bulk of f - actin in wild - type dcs was associated with the core of podosomes ( table 1 , see figure s1a in the supplemental data available online ) , in wip dcs it distributed among various anomalous structures including actin cables ( table 1 , figure s1b ) , large fused actin aggregates , commonly with a circular shape ( table 1 , figure s1c ) , and extensive membrane ruffles ( table 1 , figure s1d ) . clustering of podosomal integrins and the integrin - associated proteins paxillin and talin was also affected . in wild - type dcs , 2-integrins formed rings around the f - actin cores of podosomes ( figure s2a ) as previously described . in contrast , wip dcs failed to cluster 2-integrins into rings , and instead they formed small integrin - containing focal contacts scattered through the basal surface and around the periphery of the cell ( figure s2b ) or large plaques associated with anomalous actin - rich aggregates ( figure s2c ) . facs analysis showed that wild - type and wip dcs expressed equivalent levels of 1- and 2-integrins ( figure s3 ) , indicating that wip does not affect integrin expression . paxillin and talin , which normally array around the podosome core in wild - type dcs ( figures s2d and s2 g ) , in wip dcs localized to focal adhesions ( figures s2e and s2h ) containing 1 integrins ( data not shown ) or formed amorphous clusters colocalizing with the anomalous actin aggregates ( figures s2f and s2i ) . the shift of adhesion composition and structure from podosomes ( short half - life in the range of 30 s to 5 min ) to large focal contacts ( long half life in the range of 30 to 60 min ) in wip dcs had a negative impact on adhesion turnover ( figure 1 g ) . as previously described , interference reflection microscopy ( irm ) analyses showed podosomes in wild - type dcs rapidly assembled and disassembled , giving a high turnover index ( figure 1 g ) . in wip dcs , although multiple transient and unstable lamellar protrusions were developed at the cell periphery , the major adhesion sites in contact with the substratum were highly stable with a significantly lower turnover index compared to wild - type ( figure 1 g ) . interestingly , we found a decrease in podosome turnover in wild - type dcs plated on fibronectin ( fn ) and icam-1 , indicating that integrin ligands promote podosome stability ( figure 1 g ) . this stability of adhesion on integrin ligands correlates with an increase in the percentage of wild - type dcs with well - defined podosomes and small focal contacts ( figure 1a ) and accumulation of podosomal f - actin , integrins , and associated proteins ( data not shown ) . in contrast , no significant differences were detected in turnover index of adhesions between wip dcs plated on different substrata ( figure 1 g ) . the presence of integrin ligands failed to induce major changes in the composition of adhesions of wip dcs ( figure 1b ) except for an increase in the size of the focal adhesions . taken together , our data indicate that wip plays a key role in regulating dc adhesion structure and dynamics on biologically relevant substrata , processes crucial for the migratory capacity of cells . stabilization of the leading edge in the direction of dc movement is provided by podosomes [ 13 , 14 ] . migrating wild - type dcs clearly polarized , forming a patent leading edge , with the rear of the cell retracting at a similar rate , allowing net translocation of the cell body . in contrast , wip dcs failed to develop a major leading front and instead formed multiple simultaneous and unstable lateral lamellae and ruffles ( figures 2a2e ; movies s1 and s2 ) . cortactin is an arp2/3 activator that plays a major role in the formation of podosomes [ 15 , 16 ] , establishment of cell polarization , and also generation of cellular cortical protrusions . it has been proposed that cortactin synergises with the wasp family of proteins to induce actin polymerization , and it is thought that the actin filament meshwork triggered by the n - wasp / cortactin pair may have a different organization from actin meshworks triggered by n - wasp or cortactin alone . importantly , wip has been shown to interact with cortactin and induce cortactin - mediated actin polymerization . our results show that in the absence of wip , cortactin is displaced from podosome cores where it normally colocalizes with f - actin ( figure 2f ) and is instead associated with random lamellar protrusions and ruffles over the cell periphery ( figure 2 g ) . in addition , we found there was a higher proportion of cortactin associated with the cytoskeletal fraction ( triton insoluble ) in adherent wip dcs compared to wild - type dcs ( figure 2h ) . taken together , these results show that in the absence of wip , association of cortactin with the cytoskeleton is deregulated and associated with the formation of random cortical protrusions and loss of dc polarity . this suggests that the wasp / wip complex may couple with cortactin to induce a type of meshwork of actin filaments and associated proteins that allow the clustering of 2-integrins during the assembly of podosomes and dc polarization . in the absence of wip , cortactin can not be recruited to form a complex with wasp , discrete actin foci in podosomes fail to form , and instead , cortactin codistributes with actin filaments at the cell margin , resulting in the random protrusions and reduced motility ( data not shown ) observed in wip dcs . we have previously shown that wasp dcs display equivalent anomalies in 2-integrin clustering and focal contact formation to that observed in wip dcs . also we find here that like wasp dcs , wip dcs fail to polarize and form and stabilize consistent leading edges . recently , it has been proposed that wip contributes to the stabilization of wasp expression and the regulation of wasp - mediated actin rearrangement [ 8 , 22 ] . we find here that wip dcs express low levels of wasp at the protein level ( figure 3a ) , as recently described for wip t - lymphocytes . levels of wip expression were not affected by the lack of wasp in wasp dcs ( figure 3b ) . since mrna levels of wasp in wip dcs were comparable to those of wild - type dcs ( figure 3c ) the levels of expression of the wip binding partners cortactin , nck , and crkl was not affected in wip dcs ( figure s4 ) . it has been predicted that wip may prevent the exposure of wasp family proteins to proteases , because the 25-residue wasp binding motif from wip wraps around the wip binding domain of n - wasp . wasp , but not n - wasp , is a substrate for the protease calpain in platelets , and we have recently found that calpain also cleaves wasp in migrating dcs . our present results show that wip prevents wasp cleavage by calpain in dcs since inhibition of this protease in wip dcs resulted in major recovery of wasp expression ( figures 3d and 3e ) . this suggests that wip may play a crucial role in regulating the accessibility of wasp for calpain cleavage , which takes place during dissolution of podosomes . a role for wip in the maintenance of wasp levels is also suggested by recent findings showing that in was patients , mutations that prevent wasp binding to wip result in diminished expression of wasp [ 24 , 25 ] . we suggest that the low levels of wasp in these was patients may be the result of extensive calpain - mediated cleavage because of failure of wasp - wip interaction . surprisingly , the recovery of wasp levels in wip dcs by treatment with calpain inhibitors was not sufficient to induce podosome formation , and large focal contacts remained the major adhesion structures ( figure 4a ) . in addition , forced expression of egfp - wasp in wip dcs treated with calpain inhibitors alone or in conjunction with proteasome inhibitors failed to restore podosome formation , and egfp - wasp remained diffusely distributed in the cytoplasm or associated with anomalous f - actin aggregates that could contain vinculin forming abnormal plaques colocalizing with f - actin ( figure 4b , top and middle ) . this contrasts with the observed recovery of podosome formation and dynamics in wasp dcs ( where wip levels are normal ) after the expression of egfp - wasp ( figure 4b , bottom ) [ 11 , 13 ] . we excluded the possibility that wip binding is essential for the intrinsic actin polymerizing activity of wasp because specific wasp mutants ( wasp a134 t and wasp r138p ) that interrupt wip binding [ 24 , 27 ] showed an actin polymerizing activity equivalent to wild - type wasp ( figure 4d ) . these results indicate that wip not only protects wasp from calpain cleavage but also facilitates the localization of wasp to sites of actin polymerization and the organization of integrins , vinculin , and other integrin - associated proteins in circular clusters . the mechanisms by which wip regulates wasp activity to allow podosome formation are yet to be fully elucidated . it is possible that wasp / wip interactions may directly facilitate the recruitment of wasp to cell - surface receptors . alternatively , wip may facilitate the bridging of wasp to these receptors by mediating the interaction with other adaptor proteins or may regulate the function of regulatory proteins such as kinases , known to affect wasp activity [ 30 , 31 ] . our data show that wip by itself is not sufficient to promote podosome assembly because wasp dcs , which express normal levels of wip , also lack podosomes and assemble large focal contacts and disorganized actin clumps instead . it is tempting to speculate that the cellular responses ( of dc ) to external soluble ligands such as chemoattractants would recruit wasp / wip complexes coupled to integrin - associated proteins to trigger the assembly of podosomes at appropriate sites in the developing leading edge of the cell . these complexes would provide a cytoskeletal platform that regulates the accurate clustering and activation of 2-integrins , facilitating their function . taken together , our results suggest that wasp and wip work as a functional unit in a cellular context as has been previously proposed [ 8 , 9 ] to regulate podosome formation and dynamics during the establishment of cell polarity as seen in the chemotactic response to extracellular stimuli . in summary , we have shown that in dcs wip is essential for podosome formation and cell polarity by preventing the extensive degradation of wasp by calpain and by facilitating the recruitment of wasp to discrete foci to form the core of podosomes . the tight coupling between wasp and wip is therefore a key contributor to normal podosome dynamics and likely of major importance to the cell trafficking behavior of dcs ." ]

[ "ventriculoperitoneal ( vp ) shunting is commonly utilized as a diversion procedure for patients with hydrocephalus . multiple techniques for initial placement of the catheters have been described , including conventional minilaparotomy , peel - away introducer sheaths , as well as full laparoscopic approaches . vp shunts fail for a variety of reasons , including failure secondary to disconnection of abdominal tubing with migration of the tubing , most commonly further into the peritoneal cavity ; this occurs in 2.5% to 4% of shunts placed according to current published series . initial shunt failure rates continue to be high , with a reported failure rate of 31% at 6 months and an infection rate of 7% . common presenting features of shunt failure include headache , mental status changes , and vomiting . laparoscopy avoids laparotomy and may provide improved confirmation of shunt functionality and placement at the time of revision .", "a 31-year - old obese female was initially treated for pseudotumor cerebri with placement of a lumbar peritoneal shunt in 2003 . after 5 failed revisions for nonfunction , a ventriculoperitoneal shunt was placed in september 2007 . the patient subsequently presented 11 days postoperatively with headaches , dizziness , and formation of a seroma in her right upper quadrant . ct scan revealed the vp catheter tubing coiled in the subcutaneous tissue of the right upper quadrant . four 5-mm titanium clips were placed on the catheter in an attempt to prevent repeated migration of the tubing . one month later , the patient presented with recurrence of headaches , nausea , and right upper quadrant abdominal pain . ct scan was again obtained , revealing that the shunt tubing had migrated back into the subcutaneous tissue ( figure 1 ) . a laparoscopic approach was again utilitzed for retrieval and attempted improved fixation of the vp shunt . adhesions were taken down at the original entry site of the shunt , revealing a 2-cm fascial defect in the abdominal wall with the shunt tubing coiled within it ( figure 2 ) . the tubing was brought down through the defect out of the subcutaneous space and into the peritoneal cavity ( figure 3 ) . one port was upsized to 10 mm , and the tubing was externalized through the port and secured to a 3-cm x 10-cm piece of ptfe mesh with 30 prolene sutures ( figure 4 ) . csf flow was confirmed , and the tubing attached to the mesh was reintroduced into the peritoneal cavity . the mesh was secured to the abdominal wall by using spiral tacks and 0 gore - tex sutures ( figure 5 ) . the separate 2-cm fascial defect was repaired with a 10-cm x 10-cm piece of ptfe mesh placed as an onlay with the vp shunt exiting from its inferior border . it was secured with spiral tacks and 0 gore - tex sutures for transabdominal fixation ( figure 6 ) . the patient was seen in follow - up 7 months postprocedure and reported no recurrence of her symptoms .", "traditionally , laparotomy was necessary for both peritoneal shunt placement as well as subsequent shunt revisions . the advent of laparoscopy has afforded a minimally invasive approach that has resulted in decreased patient morbidity related to shunt placement . retrieval and repositioning of a displaced vp shunt in the peritoneal cavity using laparoscopic techniques has been previously described . in the present case , our subsequent laparoscopic approach utilized ptfe mesh , well described in the use of laparoscopic ventral hernia repair , to fixate the tubing to the abdominal wall to prevent further tubing migration . this approach also allowed us to simultaneously repair the fascial defect associated with the shunt entry site into the peritoneal cavity , allowing us to reap the benefits of decreased recurrence and decreased patient morbidity associated with this technique . the technique described was well tolerated without complication and resulted in improvement of clinical symptoms ." ]

[ "ventilator - associated pneumonia ( vap ) is defined as pneumonia occurring more than 48 hours after patients have been intubated and received mechanical ventilation . vap is the most common nosocomial infection in the intensive care unit ( icu ) with an incidence ranging from 8% to 28% in intubated mechanically ventilated patients . ventilator - associated pneumonia complicates the course of patients receiving mechanical ventilation inspite of major advances in techniques for its diagnosis and treatment . in the absence of a gold standard , vap is assumed to be diagnosed more accurately by bronchoscopic sampling and microbiological cultures of the lower respiratory tract . bronchoscopy , being invasive , is not uncommonly associated with complications , especially in patients on high respiratory supports . this has paved the way for less invasive tests such as endotracheal aspirates ( eta ) and quantitative eta cultures with a threshold of 10 to 10 bacteria per milliliter of exudates that is considered as optimal for the microbiological confirmation of vap.[46 ] the american thoracic society ( ats ) guidelines recommend that quantitative cultures can be performed on eta or samples collected either bronchoscopically or nonbronchosopically . more importantly , recent small trials have repeatedly shown that there is no advantage of bronchoscopic cultures over quantitative eta cultures when mortality was considered as the end - point further strengthening the case for quantitative eta as a diagnostic tool.[811 ] detection of causative organisms and their antibiotic susceptibility is crucial for diagnosis of vap in order to initiate the appropriate antibiotic treatment thereby reducing the adverse effects of inadequate antibiotic treatment on the patient prognosis . hence , the present study is undertaken to isolate , identify and quantitate bacteria and to perform the antibiotic susceptibility testing from the endotracheal aspirates of the clinically suspected patients of vap .", "the prospective study was carried out during the period from january 2010 to december 2010 in department of microbiology and medical intensive care unit ( micu ) on 54 patients with clinical suspicion of ventilator - associated pneumonia . the approval of the institutional review board was obtained during the planning phase of the study and each patient ( or his / her caregivers ) gave informed consent prior to participation in the study . all the patients 18 years and above who were under mechanical ventilation for more than 48 hours and clinically suspected of having contracted vap were included in this study . the diagnosis of vap was established using clinical pulmonary infection score ( cpis ) , which was evaluated on a daily basis until the patient was on ventilator support . clinically diagnosed ventilator - associated pneumonia were observed and clinical parameters were recorded from their medical records and bedside charts . endotracheal aspirate ( 1 ml ) was collected under aseptic precaution after 48 hours of intubation whenever patient was suspected to have developed vap in micu . the eta was collected using a 22-inch ramson 's 12 f suction catheter with a mucus extractor , which was gently introduced through the endotracheal tube for a distance of approximately 25- 26 cm . chest vibration or percussion for 10 min was used to increase the retrieved volume ( 1 ml ) in case the patient produced very little secretions . only 1 eta sample was collected from each patient and was immediately taken to the laboratory for prossessing . the aspirate specimens showing presence of < 10 squamous epithelial cells per low power field or organisms seen under oil immersion in the entire field on gram stain were included in the study . samples were homogenized by vortexing for 1 min and centrifuged at 3000 rpm for 10 min . 1 ml of sample was diluted in 10 ml of 0.9% sterile saline solution with final log dilutions of 10 , 10 , 10 , 10 , 10 , 10 . the samples were then plated on sheep blood agar ( sba ) , chocolate agar ( ca ) , and macconkey agar ( ma ) by using 4 mm nichrome wire loop ( hi - media , mumbai , india ) , which holds 0.01 ml of solution . all plates were incubated overnight at 37c and chocolate agar plates at 37c in 5% co2 incubator . growth of any organism below the threshold was assumed to be due to colonization or contamination . organisms were identified and the antimicrobial susceptibility tests of the following drugs were determined by the kirby - bauer disc diffusion method : erythromycin ( e ) ( 15 g ) , clindamycin ( cd ) ( 10 g ) , cotrimoxazole ( co ) ( 25 g ) , cephalexin ( cp ) ( 5 g ) , linezolid ( lz ) ( 30 g ) , doxycycline ( do ) ( 30 g ) , ciprofloxacin ( cip ) ( 5g ) , ceftazidime ( caz ) ( 30 g ) , amoxyclav ( amc ) ( 30 g ) , vancomycin ( va ) ( 30 g ) , amikacin ( ak ) ( 30 g ) , imipenem ( i ) ( 10 g ) , cefotaxime ( ce ) ( 30 g ) , piperacillin - tazobactam ( pt ) ( 100 g/10 g ) ( hi - media laboratories , mumbai ) . escherichia coli atcc 25922 and pseudomonas aeruginosa atcc 27853 were used as quality control strains . isolates showing reduced susceptibility to either ceftazidime ( 30 g ) or cefotaxime ( 30 g ) discs were considered asscreen positive for ampc beta lactamases and selected for detection of plasmid - mediated ampc by the ampc disc test . as per clsi 2011 guidelines , when using the new interpretive criteria , routine esbl testing is no longer necessary before reporting results ( ie , it is no longer necessary to edit results for cephalosporins , aztreonam , or penicillins to resistant ) . isolates showing reduced susceptibility to imipenem were selected for detection of metallo - beta lactamases ( mbl ) enzymes by imipenem - edta combined disc method .", "all the patients 18 years and above who were under mechanical ventilation for more than 48 hours and clinically suspected of having contracted vap were included in this study . the diagnosis of vap was established using clinical pulmonary infection score ( cpis ) , which was evaluated on a daily basis until the patient was on ventilator support . clinically diagnosed ventilator - associated pneumonia were observed and clinical parameters were recorded from their medical records and bedside charts .", "endotracheal aspirate ( 1 ml ) was collected under aseptic precaution after 48 hours of intubation whenever patient was suspected to have developed vap in micu . the eta was collected using a 22-inch ramson 's 12 f suction catheter with a mucus extractor , which was gently introduced through the endotracheal tube for a distance of approximately 25- 26 cm . chest vibration or percussion for 10 min was used to increase the retrieved volume ( 1 ml ) in case the patient produced very little secretions . only 1 eta sample was collected from each patient and was immediately taken to the laboratory for prossessing . the aspirate specimens showing presence of < 10 squamous epithelial cells per low power field or organisms seen under oil immersion in the entire field on gram stain were included in the study . samples were homogenized by vortexing for 1 min and centrifuged at 3000 rpm for 10 min . 1 ml of sample was diluted in 10 ml of 0.9% sterile saline solution with final log dilutions of 10 , 10 , 10 , 10 , 10 , 10 . the samples were then plated on sheep blood agar ( sba ) , chocolate agar ( ca ) , and macconkey agar ( ma ) by using 4 mm nichrome wire loop ( hi - media , mumbai , india ) , which holds 0.01 ml of solution . all plates were incubated overnight at 37c and chocolate agar plates at 37c in 5% co2 incubator . growth of any organism below the threshold was assumed to be due to colonization or contamination . organisms were identified and the antimicrobial susceptibility tests of the following drugs were determined by the kirby - bauer disc diffusion method : erythromycin ( e ) ( 15 g ) , clindamycin ( cd ) ( 10 g ) , cotrimoxazole ( co ) ( 25 g ) , cephalexin ( cp ) ( 5 g ) , linezolid ( lz ) ( 30 g ) , doxycycline ( do ) ( 30 g ) , ciprofloxacin ( cip ) ( 5g ) , ceftazidime ( caz ) ( 30 g ) , amoxyclav ( amc ) ( 30 g ) , vancomycin ( va ) ( 30 g ) , amikacin ( ak ) ( 30 g ) , imipenem ( i ) ( 10 g ) , cefotaxime ( ce ) ( 30 g ) , piperacillin - tazobactam ( pt ) ( 100 g/10 g ) ( hi - media laboratories , mumbai ) . escherichia coli atcc 25922 and pseudomonas aeruginosa atcc 27853 were used as quality control strains . isolates showing reduced susceptibility to either ceftazidime ( 30 g ) or cefotaxime ( 30 g ) discs were considered asscreen positive for ampc beta lactamases and selected for detection of plasmid - mediated ampc by the ampc disc test . as per clsi 2011 guidelines , when using the new interpretive criteria , routine esbl testing is no longer necessary before reporting results ( ie , it is no longer necessary to edit results for cephalosporins , aztreonam , or penicillins to resistant ) . isolates showing reduced susceptibility to imipenem were selected for detection of metallo - beta lactamases ( mbl ) enzymes by imipenem - edta combined disc method .", "endotracheal aspirate ( 1 ml ) was collected under aseptic precaution after 48 hours of intubation whenever patient was suspected to have developed vap in micu . the eta was collected using a 22-inch ramson 's 12 f suction catheter with a mucus extractor , which was gently introduced through the endotracheal tube for a distance of approximately 25- 26 cm . chest vibration or percussion for 10 min was used to increase the retrieved volume ( 1 ml ) in case the patient produced very little secretions . only 1 eta sample was collected from each patient and was immediately taken to the laboratory for prossessing .", "the aspirate specimens showing presence of < 10 squamous epithelial cells per low power field or organisms seen under oil immersion in the entire field on gram stain were included in the study . samples were homogenized by vortexing for 1 min and centrifuged at 3000 rpm for 10 min . 1 ml of sample was diluted in 10 ml of 0.9% sterile saline solution with final log dilutions of 10 , 10 , 10 , 10 , 10 , 10 . the samples were then plated on sheep blood agar ( sba ) , chocolate agar ( ca ) , and macconkey agar ( ma ) by using 4 mm nichrome wire loop ( hi - media , mumbai , india ) , which holds 0.01 ml of solution . all plates were incubated overnight at 37c and chocolate agar plates at 37c in 5% co2 incubator . growth of any organism below the threshold was assumed to be due to colonization or contamination . organisms were identified and the antimicrobial susceptibility tests of the following drugs were determined by the kirby - bauer disc diffusion method : erythromycin ( e ) ( 15 g ) , clindamycin ( cd ) ( 10 g ) , cotrimoxazole ( co ) ( 25 g ) , cephalexin ( cp ) ( 5 g ) , linezolid ( lz ) ( 30 g ) , doxycycline ( do ) ( 30 g ) , ciprofloxacin ( cip ) ( 5g ) , ceftazidime ( caz ) ( 30 g ) , amoxyclav ( amc ) ( 30 g ) , vancomycin ( va ) ( 30 g ) , amikacin ( ak ) ( 30 g ) , imipenem ( i ) ( 10 g ) , cefotaxime ( ce ) ( 30 g ) , piperacillin - tazobactam ( pt ) ( 100 g/10 g ) ( hi - media laboratories , mumbai ) . escherichia coli atcc 25922 and pseudomonas aeruginosa atcc 27853 were used as quality control strains . isolates showing reduced susceptibility to either ceftazidime ( 30 g ) or cefotaxime ( 30 g ) discs were considered asscreen positive for ampc beta lactamases and selected for detection of plasmid - mediated ampc by the ampc disc test . as per clsi 2011 guidelines , when using the new interpretive criteria , routine esbl testing is no longer necessary before reporting results ( ie , it is no longer necessary to edit results for cephalosporins , aztreonam , or penicillins to resistant ) . isolates showing reduced susceptibility to imipenem were selected for detection of metallo - beta lactamases ( mbl ) enzymes by imipenem - edta combined disc method .", "this prospective study was done in the period from january 2010 to december 2010 in our hospital icu . the meansd age of patients was 46.418.45 years ( range 18 to 86 years ) , having a predominance of male population . bimodal distribution of age was observed with the first peak between 18 - 28 years of age group and second peak at around 59 years of age(28.89% ) . distribution of total number of cases was done depending on the duration of mechanical ventilation into early - onset vap developing within 4 days of intubation and late - onset vap developing after 4 days of intubation . the percentage of patients with early onset vap was 39.62% and late onset vap was 60.38% . in our study , acinetobacter baumannii caused predominantly bilateral and right sided pneumonia whereas pseudomonas aeruginosa caused more of bilateral bronchopneumonia [ table 1 ] . chest x - ray finding in relation to the organism isolated of 53 patients diagnosed as vap based on a cpis score of more than six , 51 ( 96.23 % ) patients had monomicrobial infection and 2 ( 3.77% ) had polymicrobial infection . among the 27 isolates of acinetobacter baumannii , 1 ( 3.70% ) was resistant to all group of antibiotics tested in the study , including carbapenems . other 25 ( 92.59% ) isolates of acinetobacter baumannii were resistant to cotrimoxazole , ciprofloxacin and amikacin , 24 ( 88.89% ) to imipenem , 23 ( 85.18% ) to ceftazidime , 11 ( 40.74% ) to doxycycline , 10 ( 37.04% ) to piperacillin - tazobactam . all the 27 ( 100% ) isolates of acinetobacter baumannii were multidrug resistant ( mdr ) i.e. resistant to three or more class of antibiotics . pseudomonas aeruginosa was resistant to gentamicin ( 100% ) , aztreonam ( 88.23% ) , ciprofloxacin and amikacin ( 82.35% ) , imipenem ( 47.06% ) , ceftazidime ( 35.29% ) and piperacillin - tazobactam ( 23.53% ) . figure 1 shows that late - onset vap was more common than early - onset vap . among the early onset vap common organisms isolated were acinetobacter baumannii , pseudomonas aeruginosa , klebsiella pneumoniae , citrobacter freundii and staphylococcus aureus while in case of late onset vap common organisms were acinetobacter baumannii , pseudomonas aeruginosa and methicillin - resistant staphylococcus aureus . organisms causing vap ( early and late onset vap ) eight ( 47.06% ) of the 17 pseudomonas aeruginosa isolates were mbl producers . among 27 isolates of acinetobacter baumannii , 12 ( 44.44% ) were ampc producers while 14 ( 51.85% ) were mbl producing strains . the co - existence of ampc and mbl was reported in 9 ( 33.33% ) isolates of acinetobacter baumannii and 2 ( 11.76% ) isolates of pseudomonas aeruginosa [ figure 2 ] . different enzymes produced by the isolated strains in the present study it was found that the mortality rate was 45.28%.rate of mortality was less in early - onset vap ( 23.80% ) as compared to late onset vap group ( 59.37% ) and the difference was found to be statistically significant ( x1=6.473 ; df=1 ; p=0.011 ) .", "out of 53 cases of ventilator - associated pneumonia , 16 ( 30.19% ) were female and 37 ( 69.81% ) were male . aetiological agents widely differ according to the population of the patients in the intensive care unit , duration of hospital stay and prior antimicrobial therapy . the increase of acinetobacter baumannii ( 49.09% ) infections is due to its great resistance to the environment which enables it to spread , its limited virulence and its extraordinary ability to develop resistance to all the antimicrobials and spread by aerosols . one of them was methicillin - resistant staphylococcus aureus ( mrsa ) , but mrsa is generally associated with late onset vap . this may be due the fact that this case showed mixed infection with predominant organism being citrobacter freundii ( 1.8 10 cfu / ml ) while mrsa was showing 2.1 10 cfu / ml in quantitative cultures . secondly , the patient had history of prior antibiotic therapy which increases risk of mrsa . found x - ray pattern in acinetobacter baumannii vap is non - specific . in half of the cases it causes lung infiltration and a diffuse bilateral pattern some enzymes of pseudomonas aeruginosa have invasive properties , causing thrombosis of pulmonary vessels and pulmonary infarction ; this produces nodular bilateral lesions , predominantly in inferior lobes , and it is such a characteristic image that it should make the presence of pseudomonas aeruginosa suspected . the antibiotic resistance pattern of nonfermenters was almost the same in both early- and late - onset vap . many of the early - onset vap cases had the risk factors such as prior antibiotic therapy and current hospitalization for five days or more for infection with mdr pathogens . that could be the reason for almost similar susceptibility pattern of the isolates from early- and late - onset vap . even the american thoracic society guidelines support the same reasoning by suggesting that patients with early - onset vap who have received prior antibiotics or who had the prior hospitalization within the past 90 days are at greater risk for colonization and infection with mdr pathogens and should be treated similarly to patients with late - onset vap . ampc beta - lactamases hydrolyze cephamycins and are not inhibited by commercially available beta - lactamase inhibitors . bacteria , mostly klebsiella pneumoniae and e. coli , producing plasmid - mediated ampc beta - lactamases have been responsible for nosocomial outbreaks of infection and colonization . twelve ( 44.44% ) out of 27 isolates of acinetobacter baumannii have shown production of ampc beta lactamase enzyme , and no other enterobacteriaceae showed production of ampc beta lactamase . presently , there is concern about the acquisition of plasmid - mediated metallo - beta lactamases active against carbapenems , penicillins and cephalosporins . in this study , 14 ( 51.85% ) isolates of acinetobacter baumannii and 8 ( 47.06% ) isolates of pseudomonas aeruginosa were plasmid - mediated metallo - beta lactamases enzyme producing strains detected by imipenem - edta combined disc method which corresponds to a study were metallo - beta lactamases were produced by 21.74% of acinetobacter spp . and 50% of pseudomonas aeruginosa . early - onset vap in our study was found to be 39.62% while in various study it was found to be around 40% . the low incidence of early onset vap in our study may be due to antibiotic use before admission to the icu . studies have shown that previous antibiotic use decreases early - onset vap but markedly increases multidrug - resistant ( mdr ) pathogens , which is also reflected in our study . in the present study , it was found that the mortality rate was 45.28% which was in accordance with previous studies such as those by gupta a et al .", "the bacteriological approach for the management of vap avoids the problem of overtreatment by separating colonizers from infecting pathogens . this study showed that quantitative culture of eta is a useful test for early diagnosis of vap . the antibiotic susceptibility pattern of these isolates will also help the clinicians to choose the appropriate antimicrobial agents for prophylactic as well as treatment purposes ." ]

[ "alpha1-adrenergic receptors ( 1-ars ) are a heterogeneous family of g - protein - coupled receptors that present in most human and animal tissues , and there are considerable variations in the expression levels of 1-ar subtypes in various tissues of different species [ 14 ] . 1-ars play important roles in regulating physiological and pathological responses mediated by catecholamines , particularly in the cardiovascular and urinary systems . in addition to mediating catecholamine - induced vasoconstriction , the 1-ars in vascular wall have been shown to promote proliferation and hypertrophy of arterial smooth muscle cells and adventitial fibroblasts [ 5 , 6 ] . in the urinary system , the demonstration of 1-ar expression in human prostate , bladder muscle , and smooth muscles has led to the treatment of bladder outlet obstruction and ureteral stones , via blocking these receptors [ 7 , 8 ] . of the three 1-ar subtypes ( 1a , 1b , and 1d ) , the 1d - ar has been the least studied due to difficulties in obtaining significant expression levels and poor coupling to membrane signals due to its intracellular localization [ 911 ] . however , recent experiments performed in 1d - ar knockout models suggest that this 1-ar subtype plays an important role in the overall regulation of blood pressure . additionally , armenia et al . reported that 1a- and 1d - ars are the major functional subtypes of renal 1-ars in both normal and streptozotocin - induced diabetic sprague - dawley rats . using in situ hybridization , kurooka et al . identified the gene expression of all three 1-ar subtypes in human kidney cortex they found that intense 1-ar mrna staining was apparent especially in the smooth muscle of arterial walls , whereas weak staining of each of the 1-ar mrnas was observed in the glomeruli and renal tubules . more recently , the presence and distribution of subtypes in human renal pelvis and calyces were evaluated , and 1d - ar was most dense in both followed by 1a and 1b . however , the expression and distribution patterns of 1d - ar in normal and diabetic rat kidneys remain unknown . in the present study , we examined mrna levels of three 1-ar subtypes in the kidney cortex of normal zucker lean ( zl ) and zucker diabetic ( zd ) rats by microarray and real - time pcr analyses . confocal immunofluorescence microscopy was performed to evaluate the distribution of 1d - ar in the kidney of zucker rats . furthermore , we investigated whether activation of peroxisome proliferator - activated receptor- ( ppar ) or ppar , known renoprotective intervention in animal models of type 2 diabetes , would affect renal expression of 1-ar subtypes .", "six - week - old male zucker lean ( zl ) and zucker diabetic fatty ( zd ) rats were purchased from charles river laboratories ( wilmington , ma , usa ) . rats were housed in a temperature - controlled room with a 12 : 12-hour light - dark cycle and free access to purina 5008 rat chow and water . blood glucose was monitored using the accu - chek glucometer by tail - vein blood sampling . in a previous study in which we characterized the time course of blood glucose in this model , we showed that blood glucose of the zd rats began to increase at week 8 , reached a peak at week 12 , and remained at this higher level thereafter . the rats were housed in the animal care facility at the morehouse school of medicine that is aaalac accredited . all animal protocols were approved by the institutional animal care and use committee and were in accordance with the requirements stated in the national institutes of health guide for the care and use laboratory animals . for fenofibrate treatment , 12-week - old zucker rats were divided into 3 experimental groups : vehicle- ( 0.5% carboxymethylcellulose ig ) treated zl , vehicle - treated zd , or fenofibrate- ( 150 mg / kg / day ig ) treated zd ( f - zd ) rats for 10 weeks . for rosiglitazone treatment , 12-week - old zd animals were treated with rosiglitazone ( 10 mg / kg / day in drinking water ) or vehicles for 8 weeks . glomeruli were isolated from the kidney cortex of zl and zd rats at the age of 7 , 12 , and 2022 weeks , respectively , by a modified procedure as described previously . briefly , the rats were anesthetized and the kidneys were rapidly removed and placed in hanks ' balanced salt solution ( hbss ) at ph 7.4 . the renal cortex was dissected and cut into small pieces with a surgical blade . glomeruli were isolated by passing the tissues successively through calibrated sieves ( pore size : 200 , 125 , and 65 m ) and rinsed with hbss . isolated glomeruli , collected on the 65 m sieve , were resuspended in hbss . total rna was prepared from isolated glomeruli or kidney cortex by using ultrapure trizol reagent according to the manufacturer 's instructions ( gibco - brl , grand island , ny ) . the quality of the rna samples was assessed using the agilent 2100 bioanalyzer ( g2938a ) . seven hundred and fifty nanograms of total rna per sample were used for crna synthesis and amplification . cyanine-3-(cy3- ) labeled crna was purified and hybridized to agilent whole rat genome 44k oligo microarray chips ( p / n g2519f-14870 , agilent technologies ) according to the manufacturer 's instructions . the processed microarrays were scanned with the agilent g2565ba dna microarray scanner ( p / n g2505-a ) . the scanned images were analyzed with agilent feature software ( version 9.5.1.1 ) using default parameters . the resulting text files were loaded into the agilent genespring gx software ( version 7.3 ) for further analysis . significantly differentially expressed -adrenergic receptor genes among zl , zd , and f - zd groups were identified by a threshold of 2 fold change and p 0.05 . reverse transcription was performed on equal amounts of total rna by using random hexanucleotide primers to produce a cdna library for each sample . real - time pcr reactions were run on an icycler iq real - time pcr detection system by using taqman universal pcr master mix ( applied biosystems , p / n 4304437 ) . 1a- , 1b- , and 1d - ar and -actin gene - specific taqman probe and primer sets were obtained from applied biosystems as assays - on - demand ( aod ) gene expression products . the aod identification numbers were rn00567876 for 1a - ar , rn01471343 for 1b - ar , rn00577931 for 1d - ar , and 4331182 for rat -actin each sample was run in triplicate , and the comparative threshold cycle ( ct ) method was used to quantify fold increase ( 2 ) compared with controls . for immunofluorescent staining , 5 m thick cryostat sections of oct - embedded kidney samples were used . to study the localization of 1d - ar in the rat kidney , the sections were incubated with a mixture of two antibodies overnight : rabbit anti-1d - ar antibody ( 1 : 100 , sigma - aldrich , st . louis , mo ) , mouse anti--smooth muscle actin ( -sma , 1 : 100 , santa cruz biotechnology , dallas , tx ) , or goat anti - kidney injury molecule-1 ( kim-1 , 1 : 100 , r&d systems , minneapolis , mn ) . as a negative control , the sections were exposed to nonimmune igg ( in replacement of primary antibodies ) with the same secondary antibodies , and no specific staining occurred . comparisons among multiple groups were performed by one - way anova and newman - keuls post hoc test .", "we performed microarray analysis to assess gene expression levels of -adrenergic receptor subtypes in the kidney cortex of 22-week - old normal zl ( blood glucose : 108 8 mg / dl ) and diabetic zd ( blood glucose : 425 35 mg / dl ) rats . the expression profile of each experimental group was determined in three animals per group . table 1 shows gene expression levels of 1- and 2-adrenergic receptor subtypes detected in rat kidney tissue . the rank order of expression levels of the three 1-ar mrnas in normal rat kidney cortex was 1b > 1d > 1a . among these genes compared to normal zl controls , renal cortical 1d - ar gene was increased by 553% in 22-week - old zd rats ( table 1 ) . to verify the relative transcript levels of 1a- , 1b- , and 1d - ar subtypes derived from the microarray experiment , we performed quantitative real - time pcr ( qpcr ) assay . the relative expression levels of 1a- , 1b- , and 1d - ar mrnas normalized against -actin in rat kidney cortex are shown in figure 1 . in consistency with the microarray results , qpcr analysis showed that renal cortical 1d mrna was increased by 16-fold in 22-week - old zd rats compared to zl controls . we have previously shown that ppar activation protects against kidney injury in zucker diabetic fatty rats [ 15 , 17 ] . here , we further examined the effect of ppar activation on the expression level of 1-ar mrnas in the diabetic kidneys . gene microarray analysis revealed that ppar activation inhibits the upregulation of 1d gene in the diabetic kidneys . chronic administration of fenofibrate , a ppar agonist , resulted in a decrease in 1d - ar mrna by 64% compared to vehicle - treated zd animals ( table 1 ) . qpcr analysis confirmed a reduction of 1d - ar mrna in the kidney of f - zd rats ( figure 1 ) . in contrast , both microarray and qpcr analyses indicated that mrna expression of 1a- and 1b - ar subtypes was not affected by fenofibrate in the diabetic kidneys . additionally , the effect of ppar activation on gene expression of 1-ar subtypes was examined in the zd rats after rosiglitazone treatment . compared to vehicle - treated zd rats , renal cortical 1d - ar mrna was significantly lower when rosiglitazone was administered for 8 weeks ( figure 2 ) . similar to ppar activation , 1a- and 1b - ar mrna expression in the diabetic rats was not affected by rosiglitazone treatment . in a previous study , we showed that blood glucose levels were not different between normal zl and diabetic zd rats at the age of 7 weeks . blood glucose of the zd rats began to increase at week 8 , reached a peak at week 12 , and remained at this higher level thereafter . to analyze the temporal pattern of renal expression of 1d - ar receptors , renal cortical and glomerular 1d - ar mrna levels were compared in the zucker rats at the ages of 7 , 12 , and 2022 weeks . as shown in figure 3 , zd rats at week 7 had slightly lower 1d - ar mrna level in the glomeruli compared to their zl littermates , whereas renal cortical 1d - ar mrnas were not different between the two groups . at the age of 12 , both renal glomerular ( 2.4-fold ) and cortical ( 1.7-fold ) 1d - ar mrna levels were significantly higher in the zd animals , which were further increased by 3.4-fold and 12.9-fold , respectively , at the age of 2022 weeks . we performed immunofluorescence staining to correlate 1d - ar gene expression results with its protein level and distribution in the kidney of zucker animals . as expected , 1d - ar protein was clearly detected in the renal arteries and arterioles in both normal and diabetic animals ( figure 4 ) . the intense staining was primarily in the smooth muscle of renal arterial walls as evidenced by its colocalization with -sma . in normal zl rats , weak 1d - ar staining was also detected in the glomeruli , whereas there was no obvious staining in the renal tubules ( figure 4 ) . in consistency with the mrna expression results , immunofluorescence staining identified increased 1d - ar signal in the glomeruli of diabetic rats , which was partially colocalized with -sma ( figure 4 ) . intense tubulointerstitial staining of 1d - ar was apparent in the diabetic kidneys . as shown in figure 5 , 1d - ar was expressed in both tubular epithelial cells and activated interstitial fibroblasts , which was positive for -sma staining . to further characterize 1d - ar expression in renal tubules of diabetic animals , we performed double staining for 1d - ar and kim-1 , a sensitive tubular injury marker . dual labeling revealed a spatial relationship between kim-1 and 1d - ar in the diabetic kidneys . as shown in figure 6 , virtually all dilated tubules expressing 1d - ar were also kim-1-positive , suggesting that 1d - ar was expressed in the injured dedifferentiated proximal tubules . in these tubules , 1d - ar expression was predominantly cytoplasmic , whereas kim-1 staining was prominent at the apical membrane .", "in this study , the expression and distribution of 1d - ar mrna and protein were determined by the gene microarray , qpcr , and confocal immunofluorescence analyses . although mrna expression of all three 1-ar subtypes ( 1b > 1d > 1a ) was detected in rat kidney cortex , only 1d - ar gene was massively upregulated in the diabetic animals . moreover , diabetes - related increase in 1d - ar mrna was inhibited when the zd rats were treated with fenofibrate or rosiglitazone . immunostaining for 1d - ar confirmed that intense 1d - ar staining was apparent especially in the smooth muscle of arterial walls in both normal and diabetic kidneys . weak 1d - ar protein staining was detected in the glomeruli of normal zl controls , but there was no obvious staining in the normal tubular epithelium . in consistency with the gene expression results , 1d - ar protein was significantly increased in the glomeruli and proximal tubules of diabetic animals . the expression of 1-ar subtype mrnas has previously been studied in various animal and human organs , and the predominant subtype mrna expressed differs among species and organs . for example , kurooka et al . reported that 1a - ar gene was detected more than 1b - ar or 1d - ar in human kidney cortex . in contrast , karabacak et al . recently evaluated 1-ar subtype protein expression in human renal pelvis and calyx tissues and found that 1d - ar was most dense in both followed by 1a- and 1b - ar subtypes , respectively , where the rate of 1b - ar was significantly lower than the other two . in the rat kidney , it was reported that the 1b - ar is predominant when detected by a radioligand binding assay and rnase protection assay . in consistency with these findings , we confirmed the expression of all three 1-ar subtype mrnas ( 1b > 1d > 1a ) in rat kidney cortex by microarray and qpcr analyses . of the three 1-ar subtypes , the 1d - ar has been the least studied due to difficulties in obtaining significant expression levels and poor coupling to membrane signals due to its intracellular localization [ 911 ] . however , recent experiments performed in 1d - ar knockout models suggest that this 1-ar subtype plays an important role in the overall regulation of blood pressure . moreover , armenia et al . reported that 1a- and 1d - ars are the major functional subtypes of renal 1-ars in both normal and streptozotocin - induced sprague - dawley rats . interestingly , among the three 1-ar subtypes detected in rat kidney cortex , we found that 1d - ar mrna was markedly increased by 16-fold in the diabetic kidneys . additionally , diabetes - associated upregulation of 1d - ar mrna expression was inhibited when the diabetic animals were treated with ppar agonists , known renoprotective interventions . therefore , previous evidences and present results strongly suggest that 1d - ar may play an important role in renal physiology and/or pathophysiology . diabetic nephropathy is characterized by a series of ultrastructural changes , including glomerular and tubular hypertrophy , mesangial expansion , glomerulosclerosis , and tubulointerstitial fibrosis . we have previously demonstrated a progressive loss of renal function in the diabetic animals as evidenced by an increase in urinary protein to creatinine ratio in the zd rats between the ages of 7 and 20 weeks . in the current study , we further observed a gradual increase in cortical and glomerular 1d - ar mrna expression during disease progression in the diabetic animals . we speculate that increased 1d - ar may play a role in the development of diabetic renal hypertrophy and fibrosis . in fact , a role for 1d - ar in vascular hypertrophy and remodeling has been suggested by a recent report that a decrease in the lumen area and an increase in the wall thickness of arteries in hypoxic pulmonary hypertension were strongly inhibited in 1d - ar knockout mice . in this study , we evaluated the expression and distribution of 1d - ar protein in the kidneys of zl and zd rats by immunofluorescence staining . as expected , intense 1d - ar staining was apparent especially in the smooth muscle of arterial walls in both normal and diabetic kidneys . compared to low expression level of 1d - ar protein in the glomeruli of normal zl controls , zd rats demonstrate a significant increase in 1d - ar signal . moreover , zd kidneys displayed strong tubulointerstitial 1d - ar signal within fibrotic areas . a colocalization of 1d - ar with -sma indicates that 1d - ar expressing interstitial cells are myofibroblasts . future work in the field could be necessary to establish the exact role of 1d - ar in activation and proliferation of renal interstitial fibroblasts . another interesting novelfinding in our set of data reported here is the 1d - ar expression in tubular epithelial cells of diabetic kidneys . although there was no obvious staining in the normal tubules , 1d - ar staining was apparent in the dilated tubules in the fibrotic areas . to further characterize 1d - ar expression in renal tubules of diabetic animals , the spatial relationship between tubular 1d - ar and kim-1 , a tubular injury marker , the selective increased expression by dedifferentiated epithelial cells and activated interstitial fibroblasts supports the potential importance of 1d - ar in renal tubulointerstitial injury . moreover , recent studies on the pulmonary circulation suggest that catecholamines may participate in the excessive muscularization and fibrosis of the arteries through erk1/2 signaling pathway in hypoxic pulmonary hypertension [ 5 , 2022 ] . therefore , further studies are warranted to evaluate the functional consequences of 1d - ar induction in diabetic kidney injury . in summary , the current study highlights mrna expression of the three 1-ar subtypes in rat kidney cortex . an increase in renal expression of 1d - ar mrna and protein was associated with glomerular and tubulointerstitial injury in diabetic nephropathy . chronic treatment with ppar agonists prevents the increase in 1d - ar mrna in the diabetic kidneys . these findings may provide new insights into the prevention and early management of diabetic kidney disease ." ]

[ "while the occurrence of dental caries has decreased during the last decades , researchers had focused on non - carious lesions , including erosion \n . dental erosion is an acid - induced tooth loss not involving microorganisms caused by external and/or internal acids \n . recent studies indicate a meaningful increase in dental erosion prevalence , especially in dentin , due to modifications in diet , lifestyle and socioeconomic status \n\n\n\n\n . early signs of erosive tooth loss have been found in children and young people \n\n\n . considering that the modification in population habits and the decrease of acid exposure are very tough , alternatives to reduce the progression of tooth erosive loss have been investigated . naf is one of the most tested fluoride salt , whose mechanism of action against erosion is based on the deposition of caf2-like layer on the surface promoting an additional barrier that inhibits the contact of the acid with the tooth \n\n\n\n\n . however , the anti - erosive effect of naf on dentin is limited since its effect is only seen when the demineralized organic matrix ( dom ) is preserved \n\n\n . nevertheless , some loss of the dom by enzymatic activity is expected in the clinical situation , especially in patients with eating disorders \n . therefore , the use of other fluoride salts is likely to supply the lack of action of conventional fluoride ( naf ) on dentin , and consequently , it could be more effective against erosion . accordingly , titanium tetrafluoride ( tif4 ) has been widely studied against tooth erosive demineralization since 1997 \n , demonstrating the enamel erosion - inhibiting effect \n\n\n\n\n\n\n\n\n . on the other hand , generally , tif4 has a similar effect as naf on the prevention of dentin erosion when it is applied as varnish \n\n\n , or a better effect than naf when applied as high f concentrated solution \n\n\n . therefore , the protective effect of tif4 on dentin erosion is still in debate . considering that the application of professional fluoride , such as varnish , is not often done , patients at high risk of erosion would benefit from other alternatives to increase the frequency of fluoride exposure . accordingly , the daily application of mouthrinses with low concentration of f , as those containing sncl2/amf / naf marketed in europe ( erosion protection ) , has shown some protective effect against enamel and dentin erosion in vitro and in situ \n\n\n\n . therefore , the use of low concentrated tif4 mouthrinse by the patient could be a good alternative ; however , there is a clinical limitation due to the low ph of the solution , which might cause some side effects in oral cavity , since it has cytotoxic effect on fibroblasts \n . this study hypothesized that the formulation of an experimental solution containing both naf and tif4 would increase the ph , allowing its use in the clinical situation without losing its protective effect against dentin erosion compared to tif4 alone and the commercial solution erosion protection . the null hypothesis is that there is no significant difference in the protective effect against dentin erosive loss among the tested fluoride mouthrinses .", "ninety dentin samples , which were stored in 0.1% thymol/0.9 % nacl solution during the preparation phase , were cut from bovine dental roots . the root was separated from the crown using a water - cooled diamond saw and a cutting machine ( isomet low speed saw , buehler , lake bluff , il , usa ) , and embedded in pre-30 self - polymerized acrylic resin in cylindrical shape to facilitate the handling . thereafter , they were serially flattened with water - cooled abrasive discs ( 320 , 600 , and 1200 grades of al2o3 papers ; buehler , lake bluff , il , usa ) , and finally polished with felt paper wetted with a diamond solution ( 1 m thickness of particles ; buehler , lake bluff , il , usa ) on a rotating polishing machine ( arotec sa ind . after polishing , the samples were cleaned in an ultrasonic device with deionized water for 2 min . the reference areas on the polished dentin surface were marked with two parallel lines made with a scalpel blade , 1.0 mm apart . small drilling was also done on the outer area of the dentin surface to allow the correct position of the sample in the profilometric system . prior to the experiment , the baseline profile was measured and two layers of nail varnish ( colorama , com . , so paulo , sp , brazil ) were applied on 2/3 of the control surface ( sound surfaces ) , leaving only 1/3 central of the exposed dentin ( 1.0 mm x 5 mm ) . dentin samples were randomly allocated to each of the six treatment groups ( n=15 ) : 1 ) commercial sncl2/naf / amf solution ( 800 ppm sn , 500 ppm f , ph 4.5 , erosion protection , gaba int . ag , basel , switzerland , positive control ) ; 2 ) experimental 0.0815% tif4 solution ( 315 ppm ti , 500 ppm f , ph 2.5 ) ; 3 ) experimental 0.105% naf solution ( 500 ppm f , ph 4.5 adjusted with phosphoric acid ) ; 4 ) experimental 0.042% naf+0.049% tif4 solution ( naf- 190 ppm f , tif4 190 ppm ti and 300 ppm f , ph 4.4 ) ; 5 ) experimental 0.063% naf+0.036% tif4 solution ( naf 285 ppm f , tif4 140 ppm ti and 220 ppm f ; ph 4.5 ) ; 6 ) no treatment ( untreated , negative control ) . all solutions had approximately 500 ppm f based on the calculation obtained from the salts concentrations diluted in deionised water , and their ph was measured using a ph electrode . the experimental fluoride solutions were prepared using the analytical grade reagents from sigma - aldrich ( st . the fluoride treatments were performed twice a day ( immediately after the first and the last erosive challenges of the day ; v=0.5 ml / sample ) for 1 min , during 7 days of erosive challenges . erosive challenges took place by immersion in a freshly opened bottle of soft drink ( sprite zero , coca - cola company spal , porto real , rj , brazil , ph 2.6 , 30 ml / sample ) four times a day for 90 s each , at 25c . then , the samples were rinsed with deionized water ( 5 s ) and exposed to artificial saliva ( ph 6.8 , 30 ml / samples , 25c ) for 2h between the erosive challenges and overnight . the artificial saliva ( v=500 ml ) consisted of 0.001 g ascorbic acid , 0.015 g glucose , 0.290 g nacl , 0.085 g cacl2 , 0.080 g nh4cl , 0.635 g kcl , 0.080 g nascn , 0.165 g kh2po4 , 0.100 g carbamide and 0.170 g na2po4 , and it was daily renewed \n . dentin erosive loss ( m ) was quantitatively determined by a contact profilometer ( mahr perthometer , gttingen , lower saxony , germany ) before ( baseline ) and after 7 days of experiment . for the profilometric measurement , the nail varnish was carefully removed using a scalpel and acetone solution ( 1:1 water ) . five profile measurements were performed at exactly the same sites as the baseline measurement , at intervals of 0.5 mm . to achieve this outcome , the dentin samples presented the identification marks ( small drillings made with drill 1/4 ) and were inserted into a metal device , allowing the stylus to be accurately repositioned at each measurement . baseline and final profiles were done and compared using the software mahrsurf cxr20 ( mahr , gttingen , lower saxony , germany ) . the scans were superposed and the average depth of the under curve area was calculated ( m ) \n . for a better understanding of the treatments effect , the prevention fraction ( % ) of each treatment the software graphpad instat version 2.0 for windows ( graphpad software , la jolla , ca , usa ) was used for the statistical analysis . the assumptions of equality of variances and normal distribution of data were checked using the bartlett and kolmogorov - smirnov tests , respectively . once the homogeneity was not achieved , the data from dentin loss ( m ) were analyzed using kruskal - wallis followed by dunn s test .", "ninety dentin samples , which were stored in 0.1% thymol/0.9 % nacl solution during the preparation phase , were cut from bovine dental roots . the root was separated from the crown using a water - cooled diamond saw and a cutting machine ( isomet low speed saw , buehler , lake bluff , il , usa ) , and embedded in pre-30 self - polymerized acrylic resin in cylindrical shape to facilitate the handling . thereafter , they were serially flattened with water - cooled abrasive discs ( 320 , 600 , and 1200 grades of al2o3 papers ; buehler , lake bluff , il , usa ) , and finally polished with felt paper wetted with a diamond solution ( 1 m thickness of particles ; buehler , lake bluff , il , usa ) on a rotating polishing machine ( arotec sa ind . after polishing , the samples were cleaned in an ultrasonic device with deionized water for 2 min . the reference areas on the polished dentin surface were marked with two parallel lines made with a scalpel blade , 1.0 mm apart . small drilling was also done on the outer area of the dentin surface to allow the correct position of the sample in the profilometric system . prior to the experiment , the baseline profile was measured and two layers of nail varnish ( colorama , com . , so paulo , sp , brazil ) were applied on 2/3 of the control surface ( sound surfaces ) , leaving only 1/3 central of the exposed dentin ( 1.0 mm x 5 mm ) .", "dentin samples were randomly allocated to each of the six treatment groups ( n=15 ) : 1 ) commercial sncl2/naf / amf solution ( 800 ppm sn , 500 ppm f , ph 4.5 , erosion protection , gaba int . ag , basel , switzerland , positive control ) ; 2 ) experimental 0.0815% tif4 solution ( 315 ppm ti , 500 ppm f , ph 2.5 ) ; 3 ) experimental 0.105% naf solution ( 500 ppm f , ph 4.5 adjusted with phosphoric acid ) ; 4 ) experimental 0.042% naf+0.049% tif4 solution ( naf- 190 ppm f , tif4 190 ppm ti and 300 ppm f , ph 4.4 ) ; 5 ) experimental 0.063% naf+0.036% tif4 solution ( naf 285 ppm f , tif4 140 ppm ti and 220 ppm f ; ph 4.5 ) ; 6 ) no treatment ( untreated , negative control ) . all solutions had approximately 500 ppm f based on the calculation obtained from the salts concentrations diluted in deionised water , and their ph was measured using a ph electrode . the experimental fluoride solutions were prepared using the analytical grade reagents from sigma - aldrich ( st . the fluoride treatments were performed twice a day ( immediately after the first and the last erosive challenges of the day ; v=0.5 ml / sample ) for 1 min , during 7 days of erosive challenges .", "erosive challenges took place by immersion in a freshly opened bottle of soft drink ( sprite zero , coca - cola company spal , porto real , rj , brazil , ph 2.6 , 30 ml / sample ) four times a day for 90 s each , at 25c . then , the samples were rinsed with deionized water ( 5 s ) and exposed to artificial saliva ( ph 6.8 , 30 ml / samples , 25c ) for 2h between the erosive challenges and overnight . the artificial saliva ( v=500 ml ) consisted of 0.001 g ascorbic acid , 0.015 g glucose , 0.290 g nacl , 0.085 g cacl2 , 0.080 g nh4cl , 0.635 g kcl , 0.080 g nascn , 0.165 g kh2po4 , 0.100 g carbamide and 0.170 g na2po4 , and it was daily renewed \n .", "dentin erosive loss ( m ) was quantitatively determined by a contact profilometer ( mahr perthometer , gttingen , lower saxony , germany ) before ( baseline ) and after 7 days of experiment . for the profilometric measurement , the nail varnish was carefully removed using a scalpel and acetone solution ( 1:1 water ) . five profile measurements were performed at exactly the same sites as the baseline measurement , at intervals of 0.5 mm . to achieve this outcome , the dentin samples presented the identification marks ( small drillings made with drill 1/4 ) and were inserted into a metal device , allowing the stylus to be accurately repositioned at each measurement . baseline and final profiles were done and compared using the software mahrsurf cxr20 ( mahr , gttingen , lower saxony , germany ) . the scans were superposed and the average depth of the under curve area was calculated ( m ) \n . for a better understanding of the treatments effect , the prevention fraction ( % ) of each treatment", "the software graphpad instat version 2.0 for windows ( graphpad software , la jolla , ca , usa ) was used for the statistical analysis . the assumptions of equality of variances and normal distribution of data were checked using the bartlett and kolmogorov - smirnov tests , respectively . once the homogeneity was not achieved , the data from dentin loss ( m ) were analyzed using kruskal - wallis followed by dunn s test .", "all experimental mouthrinses promoted significantly lower dentin erosive loss when compared to the negative control ( p<0.0001 ) , except naf solution ( prevention fraction of 13.3% ; p>0.05 ) . the best anti - erosive effect was found for experimental solutions containing 0.0815% tif4 ( prevention fraction of 100% ) and 0.042% naf+0.049% tif4 ( 58.3% ) . sncl2/naf / amf ( erosion protection , 52% ) and 0.063% naf+0.036% tif4 ( 40% ) did not significantly differ from 0.042% naf+0.049% tif4 and naf alone , but both were less effective than tif4 alone . the median values ( minimum - maximum ) of dentin erosive loss for each group table 1median ( minimum - maximum ) of the dentin erosive loss for different groupssolutionsmedian ( min ; max)erosion protection(positive control)0.86 ( 0.67 ; 1.85 ) \n tif4 ( 0.0815%)-0.19 ( -0.45 ; -0.05 ) \n naf ( 0.105%)1.56 ( 1.01 ; 2.38 ) \n naf+tif4 ( 0.042%+0.049%)0.75 ( 0.21 ; 1.59 ) \n naf+tif4 ( 0.063%+0.036%)1.08 ( 0.59 ; 1.66 ) \n negative control1.80 ( 1.23 ; 4.94 ) \n * negative value means increase of the surface ( deposition)different letters show significant differences among the groups ; min = minimum ; max = maximum ( p<0.0001 ) \n * negative value means increase of the surface ( deposition ) different letters show significant differences among the groups ; min = minimum ; max = maximum ( p<0.0001 )", "considering the increase of dental erosion s prevalence \n\n\n\n\n\n\n\n\n , the attention has been focused on the development of preventive approaches to reduce the progression of this dental condition . the present study investigated the protective effect of the daily application of solution containing tif4/naf . the null hypothesis tested in this study was rejected because the tested fluoride mouthrinses had a significantly different effect among them against dentin erosive loss . the solution containing pure tif4 showed the best protective effect , differing from all other groups except from a specific combination of tif4 and naf . this new approach would benefit patients with high risk of erosion presenting gingival recession due to periodontal disease , brushing habits ( abrasion ) or / and occlusal disorders ( abfraction ) . the dentin , in these cases , may be likely exposed to extrinsic acid sources from the diet , and therefore , susceptible to the development of erosion . the present study aimed to simulate the home - care application of low - concentrated fluoride ( 500 ppm f ) solution , after two meals ( morning and evening ) , in periods in which the patient could perform a rinse after the daily hygiene habit . the idea behind the combination of two fluorides , tif4 and naf , into an experimental mouthrinse is based on the fact that pure tif4 has low ph , impairing its clinical use . the addition of naf to tif4 solution was able to increase its ph to a suitable value to be applied in vivo and to be compared with commercial products . in this study , tif4 alone reduced in 100% dentin loss , which might be due to the deposition of acid - resistant surface layer rich in caf2 , titanium dioxide and hydrated titanium phosphate ( unpublished data ) . the protocol of tif4 application tested in this study has not been applied in previous studies , since most of them tested high concentrated tif4 solution applied at once \n\n\n\n\n\n\n\n\n\n\n . the addition of naf into tif4 solution decreased the protective effect , considering the percentage of prevention fraction , due to a likely lower precipitation of ti and f salts . however , one of the combinations ( 0.042% naf+0.049% tif4 ) was still statistically similar to pure tif4 solution . the present results in respect to the daily application of fluoride mouthrinses are more promising than those found for a unique application of a product with high concentration of fluoride , as varnish , against dentin erosion and erosion - abrasion \n\n\n . the findings suggest the importance of a frequent low concentrated fluoride exposure rather than a unique application of a high concentrated fluoride product . a recent study was conducted in enamel showing similar results \n however , only one of the combinations ( 0.042% naf+0.049% tif4 ) was effective in reducing enamel erosive loss ( 41% preventive fraction ) , while the other one did not differ from the negative control . generally , the tested fluoride mouthrinses had better impact on dentin compared to enamel , which might be explained by the differences in the composition between the dental tissues . in case of dentin , the effect of the combinations of tif4 and naf was similar to those provided by a commercial fluoride solution ( positive control ) , which has been widely used in europe for prevention of tooth erosion . the preventive fraction found by the application of erosion protection in the present study was similar to a previous in situ study performed by other research group \n . based on this finding , we can speculate that the acid - resistance of ti and f precipitates found for our experimental solutions are similar to tin and fluoride precipitates produced by the application of erosion protection on dentin . on the other hand , naf solution presented the worst performance , not differing from the negative control . it is widely known that naf is ineffective to protect against tooth erosion \n\n\n\n\n\n\n\n\n especially in case of dentin , in which its effect depends on the presence of the dom \n\n\n . in this study , the dom was not removed , but it would be interesting to test the effect of the experimental fluoride solutions on dentin without dom . further studies should also test the effect of the experimental fluoride solutions on both dentin erosion and brushing abrasion to check the stability of the protective effect faced by two different challenges ( chemical and mechanical ) . another point to consider is that erosion in dentin is very complex due to the role of dom in the progression of erosive loss \n . therefore , erosive loss is difficult to be quantified , since the quality of the remaining organic layer may interfere with the profilometric measurement . therefore , to generate reliable data , the profiles must be measured with the samples immersed 100% in water or without dom . we have decided to perform the analysis with dom under 100% humidity , since in previous study we have not found differences in the comparison between tif4 and naf varnishes in the profile analysis of dentin with or without dom \n . future studies , including in situ and in vivo models , must be performed to confirm the findings , since saliva can be able to buffer the ph of the fluoride solutions , which might lead to different results .", "under the conditions of the present study , we can conclude that the daily application of an experimental mouthrinse containing a specific combination of tif4 and naf has the ability to reduce dentin erosion in vitro , and may be a good alternative for high - risk populations ." ]

[ "allergic diseases are among the most common chronic diseases throughout the world and the prevalence of atopic diseases in childhood has significantly increased during the past several decades [ 2 , 3 ] . although there is a general consensus on the importance of a genetic predisposition for atopic diseases , only changes in environmental factors can explain this increase [ 46 ] . there is a strong association between sensitisation and symptoms of allergic diseases although this association is not absolute . the allergy march refers to the natural history of sensitisation to allergens and symptoms of eczema , asthma , and rhinitis , which is characterized by a typical sequence of sensitisation and manifestations of symptoms that appear during a certain age period [ 7 , 8 ] . food allergy and atopic eczema during the first years of life have been considered risk factors for subsequent asthma and rhinitis caused by indoor and outdoor inhalant allergens [ 5 , 9 , 10 ] . however , allergy - like symptoms in childhood like wheezing and eczema need not have an atopic background [ 11 , 12 ] . wheezing episodes in young children are often transient and associated with viral respiratory infections [ 13 , 14 ] . thus , better predictors of disease development and diagnostic markers for allergic disease are needed to give proper treatment and valuable advice , especially concerning environmental control to parents of young children . the present study was carried out in order to evaluate the diagnostic performance of phadiatop infant , an in vitro test designed to detect allergen - specific ige antibodies known to be relevant in the development of ige - sensitisation in early childhood .", "the study was conducted retrospectively in consecutively included children , below the age of five years and admitted to bkl voksentoppen , rikshospitalet , oslo , during a period of twelve months . the children were referred from paediatricians and other paediatric departments at hospitals in norway and thus selected for more severe allergic symptoms . frozen - serum samples from 122 children were analysed and clinical data documented in the patients ' records were compiled for the study . the study conformed to the principles of helsinki 's declaration and was approved by the local ethics committee . skin prick test ( spt ) was performed according to standard procedure at the hospital . glycerinated allergen extract ( soluprick alk - abello , denmark and a standard lancet with 1 mm tip and a shoulder ( alk - abello , denmark ) was used . histamine chloride 10 mg / ml was used as positive - control and as negative - control glycerol . the reaction was recorded as 3 + when the reaction was equal to the histamine control , 2 + when half the histamine control , and 4 + when double the histamine control . the panel included egg white , cow 's milk , cod fish , peanut , hazel nut , wheat , house dust mite , cat dander , birch , timothy , cladosporium , and latex . total and allergen - specific ige antibodies were determined in immunocap 100 ( phadia ab , sweden ) at the hospital laboratory when appropriate according to clinical findings . serum samples were sent to phadia ab , uppsala , sweden , for determination of specific ige antibodies using immunocap phadiatop , fx5 ( a food mixture of milk , egg white , fish , peanut , wheat , and soy bean ) , and immunocap phadiatop infant using immunocap100 ( phadia ab , uppsala , sweden ) . phadiatop infant is designed to detect allergen - specific ige antibodies to food and inhalant allergens , relevant in the development of ige - mediated disease in young children . the following allergens are included in the test : hen 's egg , cow 's milk , peanut , shrimp , cat epithelium and dander , dog dander , house dust mite , common silver birch , timothy , ragweed , and wall pellitory . the laboratory analyses were performed in a blinded manner and the results of phadiatop and fx5 were sent back to the investigating physician . atopy was defined as a constitutional disposition to produce ige antibodies to common allergens whether the patients had clinical symptoms or not , as judged by the investigator . the study was designed to make the diagnosis with best possible available tools ( case history , spt , and allergen - specific ige results ) to evaluate the clinical performance of phadiatop infant . a preliminary diagnosis whether a child was atopic or not was assessed by the investigating physician in retrospect , taking into account clinical history and diagnostic procedures , which includes available spt and allergen - specific ige results , noted in the patient records . in the final diagnosis of the atopic state , the laboratory results from phadiatop and fx5 were also taken into consideration in order to get comparable data of allergen - specific ige sensitisation on all children . this final diagnosis was used as the reference for calculation of the diagnostic performance of phadiatop infant . quantitative variables are described in appropriate measures of localisation and dispersion , quantitatively variables presented by counts and percentages . the diagnostic performance of phadiatop infant was evaluated by calculating sensitivity , specificity , negative and positive predictive values ( npv , ppv ) , respectively , with 95% confidence intervals . the subgroups divided by age , < 2 years and 2 years were compared with regard to the diagnostic performance of phadiatop infant using descriptive statistics .", "the demographic characteristics of the children classified according to the final diagnosis of atopy / nonatopy or inconclusive diagnosis are shown in table 1 . thirty - eight ( 31% ) subjects in the study population were girls and 84 ( 69% ) were boys with a median age of 2.7 years . of the 122 children , 86 ( 70% ) were atopic , 26 girls and 60 boys , which is a commonly found gender distribution among atopic children at that age . only 18% of the children presented with wheezing as a single symptom and the majority of these children were nonatopic , 55% below 2 years and 40% above this age , respectively . eczema as a single symptom was the most prevalent symptom among the children below two years of age ( 49% ) and 63% were classified as atopic . in the older age group of children , eczema and/or wheezing in combination with other allergic symptoms dominated ( 41% ) and other allergy - like symptoms such as rhinitis , rhinoconjunctivitis , anaphylaxis , and gastrointestinal symptoms were registered in 31 ( 26% ) children , out of whom 22 ( 71% ) were older than 2 years ( data not shown ) . eighty - three of the children ( 68% ) reported at least one first degree relative , with about the same proportion for the atopic as for the nonatopic children , 71% and 61% , respectively ( data not shown ) . the diagnostic performance characteristics of phadiatop infant in this study population with a prevalence of 70% are presented in table 2 . the sensitivity calculated for the whole group of children was 98% ( 95% ci : 92100% ) and the specificity 89% ( 95% ci : 7497% ) . the ppv and npv values were 95% ( 95% ci : 8999% ) and 94% ( 95% ci : 8099% ) , respectively . the diagnostic performance of the test was found to be similar when the children were separated in the two age groups , below or above two years , but due to small numbers of children in the separated age groups , the calculated values are not presented .", "symptoms of allergic disease in young children are generally unspecific and the diagnosis without objective tests could be an arbitrary process . the paediatric section of the european academy of allergy and clinical immunology has recently published a position paper with recommendations on allergy testing in children to improve the identification of allergy and quality of care . an earlier published study has shown that 76 out of 147 children could not be classified as having an ige - mediated disease or not , based on case history and physical examination alone . similar results were found in a recently published study , where measurements of ige - antibodies , added to case history and physical examinations , highly improved the discrimination between ige- and non - ige - mediated diseases in young children . the results from our study confirm these findings and suggest that phadiatop infant could be a useful tool for discrimination between atopy / non - atopy . a positive phadiatop infant test should however be followed by allergen - specific antibody testing to a selected panel to identify the offending allergen(s ) [ 19 , 20 ] . the test seems to be at least as useful among the youngest children , below two years , as among children at 24 years of age . the youngest child in the study was 6 months , which confirms findings from other publications that allergen - specific ige - antibodies can be detected early in life [ 17 , 18 , 21 ] . these findings support the value of testing children with allergy - like symptoms at an early age . family history has been considered an important risk factor for atopy and has been widely used for prediction of allergy and allergic diseases . the results from our study are in good agreement with the notion that allergy / atopy is extremely commonly found . on the other hand , the fact that 30% of the atopic children did not have a family history of allergy agrees with investigators claiming that a great portion of newly diagnosed allergics / atopics do not have a family history of allergy / atopy . thus it could be stated that family history is no longer practical in predicting allergic disease . this study population represents a selected cohort as voksentoppen is a hospital having referred patients with allergy - like symptoms and allergic diseases from general paediatricians in the whole country , often of a more severe character . however , other studies have shown that phadiatop infant could be applied in populations with a lower prevalence of atopy , still demonstrating good performance characteristics [ 17 , 18 , 21 ] . the clinical appearance of allergy in our study is in agreement with the concept of the allergy march and supports what has been reported earlier from other studies [ 7 , 8 ] . thus , eczema was not common in the nonatopic group of children and only one of the 31 children with eczema was classified as nonatopic . the progression from eczema to other allergic problems eighty - six percent of the children with eczema and wheezing in combination with other symptoms were found in the older age group and as many as 82% were classified as atopic . the majority of children , all ages , presenting with wheezing were nonatopic ( 73% ) . many infants and children who wheeze have transient conditions associated with diminished airway function and do not have an increased risk of asthma later in life . however , children with persistent wheezing , starting during the first years of life , and with an atopic heredity , should be considered being at risk for asthma later during childhood [ 11 , 22 , 23 ] . therefore , an early diagnosis of ige sensitisation may be important for the choice of treatment to wheezing toddlers . children with allergic symptoms usually present at a general paediatrician who needs to discriminate which patients have to be sent to an allergist for further evaluation . rule - out tests with a high discriminating potential are suggested to have a gateway function to fulfil this differentiation and an important role to prevent the march of allergic children from the first to secondary level of care . the present study shows that phadiatop infant has a diagnostic performance with a high sensitivity and specificity . thus , the test could be recommended as a complement to the clinical information in the differential diagnosis on ige - mediated disease in young children with allergy - like symptoms . furthermore , the test could be useful in assisting primary care physicians in selecting atopic children at an early stage for further intervention or referral to an allergist . an early correct diagnosis will thus allow for better management and a possibility to delay or even prevent the onset of asthma in children with eczema and the avoidance of further deterioration of lung function in children with asthma [ 16 , 25 ] ." ]

[ "mainly for safety reasons , many patients and their families are looking for a seizure detection system that is efficient , comfortable , and easy to use . this implies that such a system should have a high detection sensitivity ( detect as many seizures as possible ) and low false alarm rate ; it should be unobtrusive , wireless , and in case of daytime use practically unnoticeable ; and it should allow long - term use in a home situation without the presence of professionals . alarming for safety reasons or reassurance is already used in fall detectors for the elderly , babyphones ( reacting to sound or movement ) , and glucose monitors for persons with diabetes , . in addition to being used for alarming , a detection system could allow offline storage or online streaming of selected data , allowing follow - up on treatment efficacy or summoning emergency support , respectively . our team is interested in the long - term observation of patients with epilepsy and detection of their seizures , . the focus lies on those convulsive seizures that can be dangerous because of their intensity ( possible injuries ) , duration , or serious consequences such as brain damage , autonomic dysregulation , or suffocation . clonic and clonic seizures with patients remaining in one place , their bed , mainly because of the need for supervision at night and because seizures often occur during sleep . as sensors need to be as unobtrusive as possible but still effective , small wireless accelerometers ( measuring the acceleration of movement ) are used and attached to the wrists and ankles of the patient . the goal of this study was to test the efficacy of the varia ( video , accelerometry , and radar - induced activity recording ) system and algorithms for tonic clonic and clonic seizures compared with that of semicontinuous monitoring by professional caregivers ( keeping an eye on multiple patients ) , as well as the independence , robustness , comfort , and user - friendliness of the system . we therefore measure long term in a home environment without uncomfortable and stigmatizing electroencephalography ( eeg ) electrodes rather than in a video / eeg monitoring unit , and the system therefore needs to be able to store the data and to allow visual verification of detected events .", "two patients were measured for one month in their rooms in an epilepsy center in flanders , belgium . as they returned home for the weekends and as the caregivers needed to get acquainted with the recording system , they were measured for a mean of 12 nights per patient . patient 1 is an 8-year - old girl with epilepsy e.c.i . and different types of seizures that typically last no more than 3 min : tonic clonic seizures with or without faltering respiration , tonic seizures , and clonic seizures . she also exhibits myoclonic jerks manifesting as ( head ) nods or facial contractions with eye deviation . seizures are noticed based on semicontinuous video monitoring and when a scream or breathing problem is heard . patient 2 is a 9-year - old boy with lesional epilepsy due to herpes encephalitis , who is kept in bed with a restraining belt around the waist . clonic seizures of various duration , tonic , clonic , and myoclonic seizures and ( series of ) spasms . the caregivers use a babyphone and semicontinuous video monitoring to keep an eye on him . approval by the medical ethical commission of the antwerp university hospital , belgium and signed informed consent forms from all parents were obtained prior to inclusion in the study , which was performed in accordance with the 1964 declaration of helsinki . the system uses video , accelerometry ( acm ) , and radar - induced activity recording and is therefore named varia . it consists of an axis m1011 camera ( axis communications ab , sweden ) and a hygrosens rad - mod motion sensor based on the radar principle ( b + b thermo - technik gmbh , germany ) . the camera and radar are attached to a tripod that is placed close to the patient 's bed . the radar is added for detection of movements in the direction of the sensor and for measurement through sheets . radar technology is also used for detection of falling , wandering , sitting , or getting up , so we expect it to detect large and slow epileptic and nonepileptic movements , also those caused by other persons in the room . four shimmer sensors with integrated three - axis acm ( shimmer , ireland ) , streaming wireless ( bluetooth ) communication standards , are adjusted to allow recording of more than 10 h before batteries need recharging and are put in elastic bracelets worn around wrists and ankles . a laptop with a software application developed in labview ( national instruments corporation , us ) stores all movement data recorded by either camera , radar , or acm ( fig . the technical aspects of the recording system will be published in more detail by bonroy et al . and are briefly described in the supplementary material . clonic and clonic seizures based on a large database of video / electroencephalography ( eeg ) data were used . results of a patient - specific ( algorithm trained only on data of the patient itself ) , a nonpatient - specific ( algorithm trained on data not including those of the patient itself ) , and a semipatient - specific ( algorithm trained on data also including those of the patient itself ) approach were compared with the notes of professional caregivers . for a full description on how to implement these methodologies in practice professional caregivers were asked to write down all seizures the patients had , with time and description in a form of a clinical report . they recognize epileptic seizures ( one month training and yearly tuition ) , are awake during the whole night , know the patients , and are semicontinuously watching on average four patients with active epilepsy in front of a video screen , only leaving if one of them or one of the other ( maximum ) twelve patients need care . the events detected with the algorithms were visually inspected by a pediatric video / eeg specialist and a pediatric neurologist using the screening tool which is a graphical user interface developed in matlab ( mathworks inc . , us ) ( fig . 2 ) . the screening tool displays information on the number of movement events and on their duration . the acm signals , a distribution graph , and the video images are depicted for each event . also , radar and video signals are shown , as well as the fraction ( percentage ) of movement within the event . the graph at the lower left corner sets out amplitude of all events based on acm signals and length of all events based on the three detection modalities . in other words , it shows the intensity and duration of the movement . after the application of each of the three developed seizure detection algorithms and during postprocessing , the following logical reasoning was used : rule 1 : a margin of error of 5 min has been taken into account for the seizure reporting . as the caregiver might write down the seizure after having attended to the patient , we assume the seizure may have been noticed 5 min before or after the actual time in the notes.rule 2 : only seizures longer than 10 s are considered as possibly dangerous and therefore candidates for the alarm system , hence shorter seizures are not counted when calculating detection performance.rule 3 : an alarm is set after 7 s of continuous positive detection . clonic seizures is not typically detected by acm ; the tonic phase involves muscle contraction rather than limb movement.rule 4 : an alarm within 1 min after a previous one is ignored . a future real - time alarm system should allow the system to be turned off by the caregiver when checking on an alarm , and 1 min is considered too short for the caregiver to have checked on and left the patient after the first alarm.rule 5 : alarms caused by the caregiver waking or handling the patient ( medication administration ) and installing ( evening ) or removing ( morning ) the system and acm are ignored . again , at these times , the future real - time alarm system should be turned off by the caregiver . rule 1 : a margin of error of 5 min has been taken into account for the seizure reporting . as the caregiver might write down the seizure after having attended to the patient , we assume the seizure may have been noticed 5 min before or after the actual time in the notes . rule 2 : only seizures longer than 10 s are considered as possibly dangerous and therefore candidates for the alarm system , hence shorter seizures are not counted when calculating detection performance . rule 3 : an alarm is set after 7 s of continuous positive detection . clonic seizures is not typically detected by acm ; the tonic phase involves muscle contraction rather than limb movement . rule 4 : an alarm within 1 min after a previous one is ignored . a future real - time alarm system should allow the system to be turned off by the caregiver when checking on an alarm , and 1 min is considered too short for the caregiver to have checked on and left the patient after the first alarm . rule 5 : alarms caused by the caregiver waking or handling the patient ( medication administration ) and installing ( evening ) or removing ( morning ) the system and acm are ignored . again , at these times , the future real - time alarm system should be turned off by the caregiver . true positives ( tp ) are detected seizures with the extra seizures detected by the algorithm but not the caregiver mentioned in between brackets . false negatives ( fn ) are seizures reported by the caregiver but not detected by the algorithm . to calculate sensitivity , the formula tp / ( tp + fn ) was used . false positives ( fp ) are detections that were not seizures , which in some occasions were multiple alarms in one movement event . false detection rate ( fdr ) is calculated as the number of fp per night .", "two patients were measured for one month in their rooms in an epilepsy center in flanders , belgium . as they returned home for the weekends and as the caregivers needed to get acquainted with the recording system , they were measured for a mean of 12 nights per patient . patient 1 is an 8-year - old girl with epilepsy e.c.i . and different types of seizures that typically last no more than 3 min : tonic clonic seizures with or without faltering respiration , tonic seizures , and clonic seizures . she also exhibits myoclonic jerks manifesting as ( head ) nods or facial contractions with eye deviation . seizures are noticed based on semicontinuous video monitoring and when a scream or breathing problem is heard . patient 2 is a 9-year - old boy with lesional epilepsy due to herpes encephalitis , who is kept in bed with a restraining belt around the waist . clonic seizures of various duration , tonic , clonic , and myoclonic seizures and ( series of ) spasms . the caregivers use a babyphone and semicontinuous video monitoring to keep an eye on him . approval by the medical ethical commission of the antwerp university hospital , belgium and signed informed consent forms from all parents were obtained prior to inclusion in the study , which was performed in accordance with the 1964 declaration of helsinki .", "the system uses video , accelerometry ( acm ) , and radar - induced activity recording and is therefore named varia . it consists of an axis m1011 camera ( axis communications ab , sweden ) and a hygrosens rad - mod motion sensor based on the radar principle ( b + b thermo - technik gmbh , germany ) . the camera and radar are attached to a tripod that is placed close to the patient 's bed . the radar is added for detection of movements in the direction of the sensor and for measurement through sheets . radar technology is also used for detection of falling , wandering , sitting , or getting up , so we expect it to detect large and slow epileptic and nonepileptic movements , also those caused by other persons in the room . four shimmer sensors with integrated three - axis acm ( shimmer , ireland ) , streaming wireless ( bluetooth ) communication standards , are adjusted to allow recording of more than 10 h before batteries need recharging and are put in elastic bracelets worn around wrists and ankles . a laptop with a software application developed in labview ( national instruments corporation , us ) stores all movement data recorded by either camera , radar , or acm ( fig . the technical aspects of the recording system will be published in more detail by bonroy et al . and are briefly described in the supplementary material .", "the algorithms developed by milosevic et al . for tonic clonic and clonic seizures based on a large database of video / electroencephalography ( eeg ) data were used . results of a patient - specific ( algorithm trained only on data of the patient itself ) , a nonpatient - specific ( algorithm trained on data not including those of the patient itself ) , and a semipatient - specific ( algorithm trained on data also including those of the patient itself ) approach were compared with the notes of professional caregivers . for a full description on how to implement these methodologies in practice professional caregivers were asked to write down all seizures the patients had , with time and description in a form of a clinical report . they recognize epileptic seizures ( one month training and yearly tuition ) , are awake during the whole night , know the patients , and are semicontinuously watching on average four patients with active epilepsy in front of a video screen , only leaving if one of them or one of the other ( maximum ) twelve patients need care . the events detected with the algorithms were visually inspected by a pediatric video / eeg specialist and a pediatric neurologist using the screening tool which is a graphical user interface developed in matlab ( mathworks inc . , us ) ( fig . 2 ) . the screening tool displays information on the number of movement events and on their duration . the acm signals , a distribution graph , and the video images are depicted for each event . also , radar and video signals are shown , as well as the fraction ( percentage ) of movement within the event . the graph at the lower left corner sets out amplitude of all events based on acm signals and length of all events based on the three detection modalities . in other words , it shows the intensity and duration of the movement . after the application of each of the three developed seizure detection algorithms and during postprocessing , the following logical reasoning was used : rule 1 : a margin of error of 5 min has been taken into account for the seizure reporting . as the caregiver might write down the seizure after having attended to the patient , we assume the seizure may have been noticed 5 min before or after the actual time in the notes.rule 2 : only seizures longer than 10 s are considered as possibly dangerous and therefore candidates for the alarm system , hence shorter seizures are not counted when calculating detection performance.rule 3 : an alarm is set after 7 s of continuous positive detection . clonic seizures is not typically detected by acm ; the tonic phase involves muscle contraction rather than limb movement.rule 4 : an alarm within 1 min after a previous one is ignored . a future real - time alarm system should allow the system to be turned off by the caregiver when checking on an alarm , and 1 min is considered too short for the caregiver to have checked on and left the patient after the first alarm.rule 5 : alarms caused by the caregiver waking or handling the patient ( medication administration ) and installing ( evening ) or removing ( morning ) the system and acm are ignored . again , at these times , the future real - time alarm system should be turned off by the caregiver . rule 1 : a margin of error of 5 min has been taken into account for the seizure reporting . as the caregiver might write down the seizure after having attended to the patient , we assume the seizure may have been noticed 5 min before or after the actual time in the notes . rule 2 : only seizures longer than 10 s are considered as possibly dangerous and therefore candidates for the alarm system , hence shorter seizures are not counted when calculating detection performance . rule 3 : an alarm is set after 7 s of continuous positive detection . clonic seizures is not typically detected by acm ; the tonic phase involves muscle contraction rather than limb movement . rule 4 : an alarm within 1 min after a previous one is ignored . a future real - time alarm system should allow the system to be turned off by the caregiver when checking on an alarm , and 1 min is considered too short for the caregiver to have checked on and left the patient after the first alarm . rule 5 : alarms caused by the caregiver waking or handling the patient ( medication administration ) and installing ( evening ) or removing ( morning ) the system and acm are ignored . again , at these times , the future real - time alarm system should be turned off by the caregiver . true positives ( tp ) are detected seizures with the extra seizures detected by the algorithm but not the caregiver mentioned in between brackets . false negatives ( fn ) are seizures reported by the caregiver but not detected by the algorithm . to calculate sensitivity , the formula tp / ( tp + fn ) was used . false positives ( fp ) are detections that were not seizures , which in some occasions were multiple alarms in one movement event . false detection rate ( fdr ) is calculated as the number of fp per night .", "monitoring for 15 nights for patient 1 and nine nights for patient 2 resulted in 9586 movement events . in this first validation , 322 events ( 3.4% or 15 min ) were discarded before algorithm application because the data of one or more accelerometers lasted less than 1 s or was completely missing . the results of the nonpatient - specific and semipatient - specific approaches can be found in table 1 . the nonpatient - specific approach resulted in a sensitivity of 90% and fdr of one per night for patient 1 and a sensitivity of 33% and fdr of almost two per night for patient 2 . the semipatient - specific approach gave somewhat better results with a sensitivity of 93% and fdr of a little over one per night for patient 1 and a sensitivity of 40% and fdr of one per night for patient 2 . results of the patient - specific approach are not depicted as it was immediately clear that many seizures were missed , many false alarms occurred , and the approach was not stable in between trials ( the results depended on which data were used for algorithm training ) .", "in this work , we validated algorithms for the detection of tonic clonic and clonic epileptic seizures with a new ( wireless ) system using video , wireless accelerometry ( acm ) , and radar - induced activity recording , which is placed in a home environment for a prolonged period of time . three methodologies were tested : patient - specific , nonpatient - specific , and semipatient - specific algorithms . it seems that combining a large amount of data of many ( other ) patients as in the last two methodologies , instead of using a limited amount of data of one specific patient as in the first approach , yields better classification results . the semipatient - specific algorithm gave the best results , including 13 extra seizures detected ( 31% ) and eight seizures missed ( 19% ) compared with professional caregivers ' observations . of these eight , four were not even recorded in any of the movement data . possible explanations include a temporary defect in the system , mistakes in reporting by the caregiver ( one seizure was reported at 5:20 a.m. but found at 6:20 a.m. ) , or short seizures involving only the head ( not attached to an acm ) . the limitations of our setup are discomfort ( four accelerometers ) , noncontinuously recorded data ( only movement events ) , and lack of gold standard ( no electroencephalography or eeg ) . they are not able to detect the tonic phase of tonic clonic seizures ( which involves muscle contraction rather than limb movement ) , so if the clonic phase is too short , the seizure will be missed : the alarm is set after 7 s of positive detection , so if the clonic phase lasts 6 s and this whole part is detected , the alarm will not be set off . finally , asymmetric tonic clonic or clonic seizures during which the movements of the limbs are not synchronized and seizures with a low frequency of clonic jerks are often missed , since the spatial and frequency content of these seizures differ from the majority of seizures in the training set ( a large database of wired acm data synchronized with video / eeg ) . fig . we compared the results of the semipatient - specific algorithm with those of the screening tool of bonroy et al . ( submitted ) where the most intense and longest movement events were visually inspected for seizures using the same datasets and the graphical user interface of fig . 2 . the screening tool can be used before a diagnosis is made to quickly and retrospectively look at a night and report abnormal nocturnal behavior , including seizures . once the patient is diagnosed ( with epilepsy ) this implies that we have to reduce the false detection rate ( fdr ) and increase the sensitivity . the comparison results , presented in table 2 , show an increase of sensitivity from 58% to 66% ( five seizures were missed , but 14 more were detected ) and a decrease of fdr per night from 15 to 0.7 . because the method of bonroy et al . selected a percentage of most abnormal events irrespective of the number of movements or seizures that night , this automatically resulted in more false positives , so comparison of fdr is not relevant . moreover , 11 of the 16 false positives in our approach were due to a system failure ( broken channel or high - frequency noise ) , hence clustered alarms can be used to indicate this kind of events and reduce the number of false alarms . other publications reported on body - attached accelerometry for tonic clonic and clonic seizure detection . lockman et al . reached a sensitivity of 87% testing 6 patients with ( only ) 8 seizures ; however , patterson et al . only obtained a sensitivity of 31% it is difficult to compare with this study and obtained results , however , mainly because the gold standard video / eeg was not used to annotate the data . furthermore , we did not review all video data ( only where the algorithm or caregiver indicated a seizure ) , and some of the seizures reported by the caregivers were not even found in the ( movement ) data . although setup without eeg is less optimal for seizure detection performance , it is optimal for testing the independence and robustness of the system and the patient - friendliness of the system in a long - term home environment . also , the second part of the gold standard , namely video , is present in our system . furthermore , a major advantage of our system is that it allows video storage for retrospective analysis . of the commercially available seizure detection systems reported by van de vel et al . , some keep a log of the detected seizures : epiwatcher stores the time and duration of up to 20 detections , smartwatch , , keeps the time , duration , and movement patterns , epicare , saves the time and duration of an unspecified number of detections , and the mobile phone application epdetect logs the raw accelerometer data . some studies report on video - based seizure detection ( so without acm ) , but a disadvantage is the difficulty to measure through bed linen , , . in order to improve the accuracy of the device , we are convinced that a multimodal approach is needed , and literature research as well as user questioning has persuaded us that the most important signals to be monitored are movement ( often an early manifestation of seizures ) and heart rate changes ( indicating clinically relevant seizures and part of the pathophysiological mechanism leading to sudden unexpected death in epilepsy or sudep ) . it is clear that the number of sensors should be reduced to one or two at the most . attachment of a seizure detection device to the upper arm is less comfortable than to the lower arm and can easily move when for example changing clothes or not tightly attached ; so for the moment , we will continue our research with wrist - attached devices . detection of respiration changes is certainly useful , but these changes occur probably almost simultaneously with heart rhythm changes , respiration is a very slow signal , and heart rhythm changes are very easy to detect , which is why more studies focus on cardiac- than respiration - based detection , . oxygen saturation measurement and electrodermal activity ( eda ) seem promising , but changes are detected more slowly than heart rhythm changes , , and eda is measured using electrodes ( as are ecg and emg ) , which cause potential skin irritation , and there is a risk of losing the signal due to electrodes falling off or a bad contact with the skin , . furthermore , emg and respiration can not be measured at the wrist , and oxygen saturation can not be measured yet without adding a finger cuff , even though reflectance oximetry might be an option in the future . all of these arguments lead us to focus our future research on movement detection by acm in combination with heart rate detection by ppg ( photoplethysmography ) . the algorithm should be robust and independent of the number and functionality of used sensors , so that there is no rejection of the data , and to be able to use our future device patient - independently , we will be concentrating on adaptive ( learning ) algorithms . not only efficacy of the device will be important but also comfort ( including the reduction of sensors ) , user - friendliness ( less setup steps ) , and therapeutic ( e.g. , medication changes ) and social ( e.g. , quality of life including the impact of false alarms ) impact . therapeutic impact can be examined by using the logging function of a seizure detection device , but in order to look into social impact , the device obviously needs to allow online use ( with real - time alarming ) . the latter brings along additional challenges such as the need for fast computation time , low energy consumption , large storage capacity , and miniaturization of the device , which we need to address . finally , it would be interesting to compare the performance with that of commercially available seizure detection bracelets using accelerometry , such as smartwatch or epicare free , also tested in a home environment .", "this study demonstrates the first clinical results of an algorithm for the detection of tonic clonic and clonic seizures tested on two patients with epilepsy monitored in a long - term home environment with the varia system ( video , accelerometry , and radar - induced activity recording ) developed by our team . compared with the professional caregivers ' observations , a mean sensitivity of 61.97% and false detection rate of 1.44 per night were obtained with the nonpatient - specific approach and a mean sensitivity of 66.87% and false detection rate of 1.16 per night with the semipatient - specific approach . we believe that , while privacy protection needs to be taken into account , the addition of video to accelerometry allows a seizure detection system not only to alarm the family or ( informal ) caregiver but also allows retrospective ( offline ) or emergency ( online ) verification of detected events . much work remains to develop a multimodal , learning , comfortable , and user - friendly device .", "", "" ]

[ "angiomyolipoma ( aml ) is a benign mesenchymal tumour consisting of varying amounts of mature adipose tissue , smooth muscle , and thick walled blood vessels . it is relatively rare benign tumour appearing in about 0.3% of general population and accounts for 3% of solid renal masses . extra renal amls ( eramls ) are rare tumours that present as incidentalomas upon imaging for other conditions . case reports of extra renal aml are rare with < 60 reported cases since they were first described by friis and hjortrup in 1982 . our case described one of the largest ever reported myolipomas , which despite its size , can be rather asymptomatic .", "magnetic resonance imaging ( mri ) revealed 9.5 cm 8 cm 2 cm right adrenal mass [ figure 1 ] . the tumour was predominantly hyperintense with signal intensity similar to fat on t1/t2-weighted images and lost signal on the fat - suppressed sequences . a well - encapsulated , firm globular mass separate from the right kidney and no definable adrenal was found [ figures 2 and 3 ] . gross post - operative evaluation of the adrenal mass showed approximately 10 cm 8 cm 2 cm greyish white solid , smooth , and firm mass [ figure 4 ] . histological examination revealed benign adrenal cortical elements , with a predominance of mature benign adipose tissue interspersed with pockets of haemopoietic ( erythro - myeloid ) intermediates , and megakaryocytes which was confirmatory for the diagnosis of adrenal aml .", "angiomyolipoma is a rare clinical entity mostly involving kidney and is part of the group of tumour known as tumours of perivascular epithelioid cell origin . the most widely accepted theory of origin is adrenocortical cell metaplasia in response to stimuli , such as necrosis , inflammation , infection or stress ( meyer et al . ) . the presence of perivascular epithelioid cells is characteristic of aml since these cells show immunoreactivity for muscle markers ( epithelial membrane antigen , keratin , vimentin , desmin , and actin ) and hmb-45 . positive immunoreactivity for hmb-45 , a monoclonal antibody , is characteristic of amls and can be used to differentiate amls from other similar appearing lesions . one is isolated aml , and the other is that is associated with tuberous sclerosis . most patients of isolated cases are in the age group of 27 - 72 years , mean age being 43 years . although the majority of eramls are benign , two cases of metastatic and recurrent eramls have been reported . the demonstration of fat density ( hypodense ) within an adrenal mass by computed tomography is virtually diagnostic of aml . mri is sometimes required to demonstrate origin of the tumour , to define the tissue planes when the tumour is large and heterogeneous , and to distinguish benign from malignant lesions by comparing signal intensity ratios of adrenal to liver . a small , < 5 cm , asymptomatic myelolipoma could be followed - up over 1 - 2 year period with imaging controls . on the contrary , asymptomatic lesion or a large > 5 cm myelolipoma should be surgically excised , since there are reports of spontaneous rupture and haemorrhage of the mass presented with life - threatening cardiovascular shock . unstable patients may benefit from emergent tumour embolisation and a subsequently staged surgical resection . since it is a benign disease , its prognosis is good . nevertheless , follow - up is recommended because of atypical morphology . currently , there is no agreed protocol on follow - up but an ultrasound three to 6 months following the surgery with annual clinical examination for large tumours is recommended .", "the adrenal myolipoma is a rare urological entity , which seems to increase its frequency , probably due to causes affecting primarily the function and physiology of the adrenals . ever since its introduction by gagner in 1992 , laparoscopic adrenalectomy has become the standard of care for the treatment of functioning and non - functioning adrenal tumours . many authors have found a decrease in perioperative morbidity and convalescence after this procedure when compared with open surgery ." ]

[ "a 67-year - old male presented to the emergency eye centre ( eec ) complaining of a painful right eye of 5-day duration . clinical examination revealed a visual acuity ( va ) of 6/9 with minimal conjunctival injection , anterior chamber ( ac ) cells 1 + and posterior synechiae ( ps ) . a diagnosis of anterior uveitis was made and the patient was commenced on topical prednisolone 1% and topical cyclopentolate 1% . the response to this treatment was good and the steroids were slowly tapered over 1 month ; however , before cessation of treatment , the anterior segment inflammation worsened . the patient represented with va 6/36 and ac cells 3 + , extensive ps and a posterior vitritis . 2 , the topical treatment was increased and an urgent referral was made to the uveitis service . at review , 4 weeks after presentation , the anterior and posterior segment inflammation remained and a white mass was noted in the peripheral nasal retina [ fig . 1 upper plate ] , almost at the ora serrata . a diagnosis of presumed toxoplasma chorioretinitis was made and treatment with pyrimethamine and sulfadiazine followed by oral clindamycin was initiated . on further questioning , it was discovered that there was the possibility of a previous pulmonary tuberculosis ( tb ) infection . he had had no previous treatment for active tuberculosis . in view of concern over possible reactivation of tb with an increase in oral steroids , quantiferon and induced sputum sampling were also performed ( all negative ) and the dose of prednisolone was increased to 60 mg daily . blood cultures were also negative and there was no serological evidence of toxoplasma infection ( toxoplasma latex < 16 ) . ( upper plate ) 10 mhz b - scan ultrasonography of subretinal mass ( nasal peripheral retina - white arrow ) ( middle plate ) hematoxylin and eosin stained section of the retinal biopsy showing brown fungal hyphae ( black arrows ) coursing through the abscess.(lower plate ) masson fontana stain showing a positive melanin brown reaction . thin arrows showing fungal septae and thick arrows indicate dichotomous branching of hyphae the patient responded to oral steroids and clindamycin , with a reduction in intraocular inflammation and improved va of 6/18 after 2 weeks treatment . however , when the oral prednisolone was gradually reduced and the clindamycin stopped ( after 5 weeks treatment ) , there was an increase in intraocular inflammation and va reduced to 3/60 . a diagnostic pars plana vitrectomy was therefore performed with vitreous sampling , which revealed a chronic vitritis without infectious agent or neoplasia . no herpes family viruses or toxoplasma organisms were identified on polymerase chain reaction testing . in order to clinch the diagnosis , combined cataract surgery , retinal biopsy , and intraocular oil tamponade was performed . the nasal sub - retinal mass was biopsied using a 23-gauge ( 23 g ) vitrector hand piece and samples sent to histopathology and microbiology . close inspection showed brown pigmented septate branching hyphae that stained strongly with masson fontana melanin stain and with a periodic acid schiff ( pas ) and silver stain [ fig . the presence of a melanin containing , septate , branching , and mycelial fungus on histopathology was diagnostic of phaeohyphomycosis infection , on morphology alone . prolonged fungal culture of the biopsy was negative and 18s ribosomal subunit polymerase chain reaction ( pcr ) was also negative ( most likely due to the presence of pcr inhibitors in the sample ) . the absence of a culture and pcr result did not permit precise speciation of the phaeohyphomycosis fungus . the patient remained under joint care and was treated with antifungal therapy for 6 months ; however , no primary source of fungal infection was identified . following retinal biopsy the patient developed a retinal fold secondary to proliferative vitreoretinopathy ( pvr ) , which extended from the biopsy site to the optic disc . vitrectomy , removal of silicone oil , epiretinal membrane peel , subretinal pvr removal and retinectomy were performed with laser retinopexy and intraocular gas tamponade . unfortunately , the patient required two further operations for rhegmatogenous retinal detachment . currently , the retina is flat with heavy silicone oil tamponade and the va is 2/60 . further retinal biopsy taken during vitrectomy for retinal detachment revealed no fungal elements on microscopy and intravitreal amphotericin b was also injected perioperatively .", "phaeohyphomycosis is a collective term that describes infection caused by darkly pigmented mycelial fungi , a feature secondary to the presence of melanin within their cell walls . the most common phaeohyphomycosis genera pathogenic to humans include exophilia , phialophora , wangiella , bipolaris , exserohilum , cladophialophora . morphology by histopathology is sufficient to make a diagnosis of phaehyphomycosis , characterized by branching , septate hyphae with confirmation of melanin by tinctorial staining ( masson fontana or an equivalent ) . whilst histopathology permits a clear diagnosis of phaeohyphomycosis , the precise species does require pcr and cultures . infection is presumed to be as a result of implantation following superficial trauma and exposure to contaminated soils or organic matter . systemic infections result either from direct invasion from a more superficial site , such as the paranasal sinuses or by means of haematogenous dissemination . the central nervous system is most frequently affected but other sites including lung , bone , and joint or peritoneum may also be involved . , primary cerebral phaeohyphomycosis seems to ignore this rationale with more than half of cases being fully immunocompetent . melanin within the cell walls of dematiaceous fungi may provide the reasons for this disparity ; it has been extensively investigated as a virulence factor . however , this is the first time a subretinal abscess caused by phaeohyphomycosis has been documented in the medical literature . the most plausible theory involves a haematogenous route ( metastatic infection ) transmission from a peripheral nidus to the subretinal space , which in turn initiated a posterior and anterior segment uveitis . patients with underlying lung disease appear to be at a increased risk of pulmonary phaeohyphomycosis . it is possible that , in this patient , the lung parenchyma may have been a source of infection , in the setting of chronic , low level immune suppression / modulation by the methotrexate therapy with reactivation of a previous self - limiting respiratory phaeomycotic infection , with subsequent dissemination . posterior segment pathology is usually diagnosed by characteristic clinical signs , extensive systemic investigations and non - invasive ocular investigations such as fluorescein angiography . however , it is not uncommon for vitreoretinal surgeons to aid in the diagnosis of a posterior uveitis of unknown aetiology by sampling vitreous , retina or choroidal tissue , leading to increased diagnostic accuracy and prompt treatment . reported 13 cases of retinochoroidal biopsy in unclear uveitis seven of the cases tissue biopsy helped direct specific treatment . intraocular lymphoma , recurrence of lymphoblastic leukaemia , chronic scleritis , toxoplasmosis , and metastasis were diagnoses confirmed as a result of the tissue biopsies performed . malignancy was also excluded in several cases , which allowed for a trial of medications such as oral steroids and anticytomegalovirus agents . in this case , it is difficult to postulate whether the final va and outcome have been improved by surgical intervention . it is clear that the patients intraocular inflammation was increasing rapidly and only high dose steroids subdued the response . without sub - retinal biopsy , the specific treatment of this patient 's phaeohyphomycosis with antifungal medication would not have been possible and years of treatment for idiopathic uveitis may have ensued ." ]

[ "in 1978 , primary health care was seen as the solution to the inadequate illness management systems that had developed throughout the world . it was hoped that phc would address some of the major inequalities in health that were observed by a balanced system of treatment and disease prevention . the world health organization ( who ) envisaged that phc would take place as close as possible to where people live and work and be the first element of a continuing health care process . additionally , health service collaboration and multi - professional partnerships were expected to replace professional boundaries and competition . to sum up , phc used family physician as the most important ways to increase equitable access and utilization of public health services . in any case , family physician , with the key elements of first contact , comprehensiveness , continuity , and coordination of patient care , is central to the health of any health care system . recent government initiatives are supporting general practice to deliver health care through a variety of means and personnel . these initiatives have included expanding the roles of nurses in general practice and enabling better access to allied health services through general practitioners ( gps ) . evidence clearly indicates the effectiveness of teams in improving the outcomes , especially in chronic disease . now , people in most of the countries use professional and educated nurses [ called nurse practitioner ( np ) ] besides family physician or are under their supervision for diagnosis , treatment , and specifically health education of the family . in accordance with the international council of nurses definition , a nurse practitioner is a registered nurse who has acquired the expert knowledge base , complex decision - making skills , and clinical competencies for expanded practice , the characteristics of which are shaped by the context and/or country in which s / he is credentialed to practice . the royal college of nursing ( rcn ) defines an np as a registered nurse who has undertaken a specific course of study of at least first - degree ( honors ) level and who : \n makes professionally autonomous decision , for which he or she is accountable;works collaboratively with other health care professionals;provides counseling and health education;screens patient for disease risk factors and early signs of illness ; andhas the authority to admit or discharge patients from their caseload , and refers patients to other health care providers as appropriate . \n makes professionally autonomous decision , for which he or she is accountable ; works collaboratively with other health care professionals ; provides counseling and health education ; screens patient for disease risk factors and early signs of illness ; and has the authority to admit or discharge patients from their caseload , and refers patients to other health care providers as appropriate . in new reform toward family physician in iran , there is not enough attention toward nurses , their services , and specifically their role in education and counseling . according to the health - for - all goals , the central concern of nurses in primary care should be the prevention of the disease by educating individuals and families on healthy lifestyles , and teaching community health workers and traditional birth practitioners to carry out many of the functions that nurses themselves have normally performed . whereas a big part of the family physician program has not been realized in iran yet ( especially in big cities with a population of over 20,000 ) , most graduate nurses are now working in the school of nursing and midwifery , hospitals , and ambulatory clinics with limited responsibilities . in addition , most graduate nurses in our community can play an important role in preventing medicine and family physician team . consequently , in spite of their ability and capacity , they have a brief role in our family physician team & their job description .", "the main goal of this study was to review the role and situation of nps in the new reform for better use of their capabilities in health care services . this is a qualitative , comparative ( role of nurses in family physicians team ) , and cross - sectional study that was carried out with triangulation method in three stages in 2011 . in the first stage , we conducted a literature review to design a conceptual framework . the second stage was a comparative study on four countries that had great experiences in these two fields ( family physician reform and nps ) and included usa , uk , austria , and canada , based on purposive sampling . in the third stage , all experts were completely familiar with the health system and had academic and research experiences in nursing education system in iran .", "the survey on health systems in different countries indicates that many of the health sectors have begun their reforms with two main goals , including quality improvement and cost limiting . family physician and referral system are among the few options that can maintain and even upgrade the quality of services , reducing the costs simultaneously . as each health system in each country has its specific referral system , iran is now on the verge of implementing a best fit referral system reform . so , it is crucial to well define the roles of each component , such as nurses , in this system . in the united states , nps are licensed by the state in which they practice , and have a national board certification ( usually through the american nurses credentialing center or american academy of nurse practitioner ) . most nps specialize in a particular field of medical care , and there are as many types of nps as there are medical specialties . nps provide high - quality , cost - effective individualized care that is comparable to the health care provided by the physicians , and np services are often covered by insurance providers . role of nurses in some organizations in canada , the nurses involved in clinics should participate in specific training course of diagnosis and management of health care after registration . then , they are allowed to prescribe drugs , and lab and other diagnostic tests . having access to patient medical record , nps can reduce unnecessary visits . according to the standards of practice for nps , the college of nurses of ontario states that they offer the full scope of primary health care practice , including consultation with physicians or other health care professionals when the client requires care beyond the nps scope of practice . further , they are accountable for establishing a consultative relationship with a physician and consultation occurs with a family physician ; however , nps may consult with a specialist physician , if appropriate to the situation and practice setting . no legislative or regulatory deterrent related to the scope of practice exists for the nps to refer to specialist physicians . in austria , nurses in nursing home and maternity do some of the medical procedures under the supervision of physicians . these nurses are educated , and can treat , inject drugs , and request for some diagnostic tests for their patients . in the united kingdom , the gps monopoly on primary care has been broken by nurse - led services , including nhs direct , which provides 24-h health advice by telephone , and nhs walk - in centers , which treat minor illness and injury . practice nurses and nps increasingly substitute for gps in the care of minor illness and routine management of chronic diseases such as asthma , diabetes , and coronary heart disease . in england and wales , the role of the nps had evolved from that of undertaking traditional , medically prescribed nursing tasks in a treatment room to undertaking screening activities and health assessments of new patients , with over 50% of the nps managing chronic disease clinics . six experts in two panels were asked to confirm the role of nurses in family physician reform . they suggested that special courses are needed to empower our graduated nurses for their new rules . meanwhile , using nps as substitution of gps does not seem to be logically correct due to the gps workload and the social and cultural background in iran .", "the survey on health systems in different countries indicates that many of the health sectors have begun their reforms with two main goals , including quality improvement and cost limiting . family physician and referral system are among the few options that can maintain and even upgrade the quality of services , reducing the costs simultaneously . as each health system in each country has its specific referral system , iran is now on the verge of implementing a best fit referral system reform . so , it is crucial to well define the roles of each component , such as nurses , in this system .", "in the united states , nps are licensed by the state in which they practice , and have a national board certification ( usually through the american nurses credentialing center or american academy of nurse practitioner ) . most nps specialize in a particular field of medical care , and there are as many types of nps as there are medical specialties . nps provide high - quality , cost - effective individualized care that is comparable to the health care provided by the physicians , and np services are often covered by insurance providers . role of nurses in some organizations in canada , the nurses involved in clinics should participate in specific training course of diagnosis and management of health care after registration . then , they are allowed to prescribe drugs , and lab and other diagnostic tests . having access to patient medical record , nps can reduce unnecessary visits . according to the standards of practice for nps , the college of nurses of ontario states that they offer the full scope of primary health care practice , including consultation with physicians or other health care professionals when the client requires care beyond the nps scope of practice . further , they are accountable for establishing a consultative relationship with a physician and consultation occurs with a family physician ; however , nps may consult with a specialist physician , if appropriate to the situation and practice setting . no legislative or regulatory deterrent related to the scope of practice exists for the nps to refer to specialist physicians . in austria , nurses in nursing home and maternity do some of the medical procedures under the supervision of physicians . these nurses are educated , and can treat , inject drugs , and request for some diagnostic tests for their patients . in the united kingdom , the gps monopoly on primary care has been broken by nurse - led services , including nhs direct , which provides 24-h health advice by telephone , and nhs walk - in centers , which treat minor illness and injury . practice nurses and nps increasingly substitute for gps in the care of minor illness and routine management of chronic diseases such as asthma , diabetes , and coronary heart disease . in england and wales , the role of the nps had evolved from that of undertaking traditional , medically prescribed nursing tasks in a treatment room to undertaking screening activities and health assessments of new patients , with over 50% of the nps managing chronic disease clinics .", "six experts in two panels were asked to confirm the role of nurses in family physician reform . they suggested that special courses are needed to empower our graduated nurses for their new rules . meanwhile , using nps as substitution of gps does not seem to be logically correct due to the gps workload and the social and cultural background in iran .", "according to the who , in most countries , nurses are the most important group of health workers in terms of numbers , closeness to people and their health problems , and understanding of community needs . there is still debate in nursing and medical circles about what the focus of their role should be . for example , lauder , sharkey , and reel suggest that nps and gps in rural and remote areas should be interchangeable and that the focus should be on the competency of the person delivering care rather than the right of one discipline ( medicine ) to perform a particular role . in contrast , campbell believes that public acceptance of nurses as gp substitutes would be poor , and therefore suggests that a better role for nurses in primary care would be health education and illness prevention . on the other hand , in our country ( iran ) until now , nurses have not got a competent role in health sector reform . given that consumers have limited understanding of phc , it is not surprising they do not articulate confidence in nps acting autonomously but rather as complementary to gps , perhaps undertaking initial assessment for triage purposes and providing ongoing management , education , and support under the gps delegation . they would also like them to be family oriented and holistic in their practice , supporting their emotional and social needs in the context of their family lives . it means that any effort to change nurses roles in health care services should accompany with some social and cultural changes toward their competencies . in iran , whereas a noticeable reform toward family physician is going on , redefining nurses role is essential . they can perform more active roles in associating with gps in the clinics of family physicians , both in urban and rural areas , even with higher degrees of autonomy . their competencies for case management , education , treatment , and follow - up may repair many of the pitfalls we are confronting in health care services . of course , if it has to be done , special courses are needed to empower graduated nurses for their new rules . meanwhile , substitution of gps with nps does not seem to be a good suggestion due to gp workload and social and cultural background in iran . thus , it can be concluded that in order to achieve the goals of family physicians reform and also utilize the maximum capacity of trained nurses , a fixed and definite place must be considered for them in the gp team to provide their services under the supervision of family physicians . their active role not only enriches the family physician team , but also might be crucial in patients training , which is currently one of our weaknesses ." ]

[ "despite advancements in renal replacement therapy , acute kidney injury ( aki ) is a frequent complication with severe implications for the critically ill patient . published mortality rates for intensive care unit patients with aki range between 30 and 70% , and aki alone remains an independent risk factor for mortality even after adjustment for demographics and severity of illness [ 1 , 2 ] . kidney ischemia - reperfusion injury ( iri ) occurs in various clinical settings including shock , sepsis , organ transplantation , and vascular surgery . it has become apparent that clinically much of the high patient mortality can be attributed to the onset of systemic inflammatory response syndrome ( sirs ) and progression to multiple organ failure ( mof ) . since the 1950s pulmonary dysfunction was thought to result from increased permeability of congested pulmonary capillaries , and this was dubbed the uremic lung . even in the acute setting , however , kidney dysfunction directly contributes to the onset of remote organ injury . for example , increased kidney ischemia time during complex aortic surgery is associated not only with acute and chronic renal failure , but also with an increased incidence of remote organ injury and death [ 46 ] . clinical and translational laboratory studies have demonstrated the relevance of interactions between the injured kidney and distant organs , and complex mechanisms of crosstalk between injured kidneys and remote organs such as the lungs , liver , heart , gut , brain , and hematologic system have been identified . recent data highlights the importance of both the innate and adaptive immune response , activation of proinflammatory cascades , and an alteration of transcriptional events in remote organs during ischemic aki . the purpose of this paper is to review emerging concepts of organ crosstalk and recent experimental data regarding the activation and systemic expression of proinflammatory pathways during ischemic aki . for a complete list of abbreviations used in this paper , please see table 1", "kidney iri remains a major cause of aki in both native and transplanted organs and lacks a specific treatment aside from renal replacement therapy . the local effects of kidney iri begin in the most vulnerable regions of the organ , after which a cascade of microvascular inflammation propagates . although 25% of cardiac output contributes to renal blood flow , only a fraction ultimately reaches the vasa recta of the renal medulla , with the majority reaching the renal cortex . therefore , even slight alterations in total renal blood flow may lead to anoxic injury in the medulla , resulting in tubular dysfunction , salt wasting , and glomerular vasoconstriction through tubuloglomerular feedback [ 8 , 9 ] . kidney iri activates an inflammatory response which results in endothelial cell activation , leukocyte adhesion and entrapment , and compromised microvascular blood flow . inflammation in the postischemic kidney triggers the upregulation of leukocyte adhesion molecules , toll - like receptors , and downstream transcription factors , which all contribute to disruption of the integrity of the renal vascular endothelium . adhesion molecules such as integrins and selectins along with proinflammatory cytokines propagate cellular injury not only locally in the renal tubular epithelial cells but also travel to remote organs where genomic markers of injury are upregulated and phenotypic injury occurs . unfortunately , selective inhibition of cytokines and adhesion molecules such as tumor necrosis factor- ( tnf- ) and intercellular adhesion molecule ( icam-1 ) have failed to demonstrate global attenuation of both local and remote organ injury during experimental models of ischemic aki [ 1316 ] . however , -melanocyte - stimulating hormone ( -msh ) , a cytokine with broad antiinflammatory , anticytotoxic , and antiapoptotic properties , has demonstrated success in treating the inflammatory phenotype in rodents . in this model , treatment with -msh has attenuated both renal and pulmonary injury during ischemic aki [ 13 , 17 ] . the largely unsuccessful effort to ameliorate mof with specific anti - inflammatory therapeutics highlights the complexity of the systemic response to kidney iri . from these early experimental studies , it is possible that the multiple inflammatory pathways activated in each organ system represent a unique response to ischemic aki . despite a paucity of data , several different pathophysiologic responses to ischemic aki in remote organs have been identified ( figure 1 ) . in the heart , increased expression of tnf and interleukin-1 ( il-1 ) are associated with myocyte apoptosis . in the brain , increased expression of chemokines including keratinocyte chemoattractant ( kc , a brain il-8 homologue ) and granulocyte colony - stimulating factor ( g - csf ) are seen with increased vascular permeability . additional responses in the lungs , gut , and liver have been discovered , and these individual organ responses will be detailed later in this paper . we will now focus on cellular mediators , specifically those involved in the innate and adaptive immune system , which may connect local ischemic aki with distant organ injury . the innate immune system plays an important role in mediating the inflammatory response during ischemic aki . traditionally , innate immunity elicits an immediate , preprogrammed response to tissue injury that lacks immunologic memory . it is composed of plasma proteins ( complement ) , cells ( neutrophils , macrophages , and natural killer cells ) , and physical barriers . proposed initiators of the innate immune response during iri include the activation of toll - like receptors ( tlrs ) and the release of reactive oxygen species ( nitric oxide and superoxide anion ) and mitochondrial products . the complement system , particularly the alternative pathway , is activated , stimulating release of cytokines and subsequent activation of neutrophils , endothelium , and macrophages . tlrs are a family of transmembrane proteins which serve as major pattern recognition receptors , binding to a wide range of microbial products and endogenous ligands released as a consequence of injury . tlr - dependent signaling serves as a rapid response mechanism to local tissue damage and has been implicated in early activation of the innate immune response during kidney iri [ 11 , 20 ] . renal tubular epithelial cells constitutively express tlr2 and tlr4 , and iri results in selective upregulation of these tlrs . experimental studies of kidney iri have demonstrated attenuation of renal structural and functional injury in both tlr2/ and tlr4/mice , implicating tlr2 and tlr4 signaling in renal damage [ 21 , 22 ] . tlr2 may also play a role in transplantation tolerance by decreasing the infiltration of t cells , dendritic cells , and macrophages . t cells may act during early iri despite lacking alloantigenic stimulation , which challenges the traditional function of t cells as exclusive mediators of the adaptive immune response . significant evidence exists to support the role of t cells in gut , heart , and lung ischemia - reperfusion injury [ 2428 ] . likewise , experimental data also points toward antigen - independent t - cell activation in ischemic aki through cytokines secreted by macrophages and dendritic cells , chemokines , oxygen free radicals and the complement system [ 7 , 19 , 29 ] . for example , mice deficient in cd4 + and cd8 + cells and athymic mice demonstrate protection from experimental ischemic aki ; however , only adoptive transfer of t cells of the cd4 + type restores this injury [ 30 , 31 ] . not all t cells , however , perpetuate inflammatory damage during ischemic aki ; some populations of t cells confer renal protection after iri , particularly the th2 phenotype of cd4 + t cells and t regulatory cells . additional recent experimental data has characterized specific populations of t lymphocytes trafficking to remote organs that may facilitate organ crosstalk during ischemic aki . in a rodent model of kidney iri , a distinct influx of cd3 + ( t ) cells with a predominant cd8 + t cell subpopulation was identified 24 hours after experimental kidney iri . these pulmonary t cells acquired increased expression of activation markers suggesting that ischemic aki induced trafficking of activated t cells which contributed to pulmonary injury , specifically apoptosis . the specific role of subpopulations of t cells in the pathogenesis of ischemic aki remains a stimulating topic of current and future investigation , both in the innate and adaptive immune response to kidney iri . the adaptive immune system relies on the specificity of antigen receptors on both b and t cells that respond to millions of various antigenic molecular structures . once stimulated by an antigen , b cells ( humoral immunity ) produce specific antibodies , perform opsonization to facilitate phagocytosis , and activate the complement system . the t - cell receptor ( tcr ) responds to presented antigen peptides by activating macrophages to kill phagocytosed microbes , directly destroying infected cells and by releasing cytokines to promote further response ( cell - mediated immunity ) . antigen - dependent t - cell activation has been demonstrated in experimental models of renal iri [ 34 , 35 ] . for example , mice with a restricted tcr cell repertoire suffer less injury and promote a far diminished inflammatory response during renal iri . additionally , athymic mice that subsequently underwent adoptive transfer with these tcr - restricted t cells failed to restore injury as severely as seen with transfer of wild - type t - cells . t cells also play a role in long term renal modification , as an increased number of both activated and effector - memory t cells have been observed in postischemic kidneys as long as 6 weeks after iri . these t cells may in fact recognize antigens released during kidney iri and subsequently target the kidney in an autoimmune response , leading to long - term progression of renal dysfunction . this hypothesis was demonstrated in a murine adoptive transfer model in which nave mice received t cells from mice who were 6 weeks after kidney iri and subsequently developed albuminuria . little is known about the role of b cells in renal iri ; however , b - cell - deficient mice demonstrated renal protection in the early phase of experimental iri . in summary , both the innate and adaptive immune responses play critical roles in the pathophysiology of ischemic aki . either following antigen stimulation or in the presence of proinflammatory chemokines and oxygen free radicals , t cells undergo early activation and serve as a bridge between adaptive and innate immunity . this specific host immune response to kidney iri facilitates distant organ crosstalk along with soluble proinflammatory mediators and will be further discussed in the following paragraphs .", "the combination of aki with acute lung injury ( ali ) remains a formidable challenge to clinicians caring for critically ill patients . in the setting of mof , aki and ali occur more frequently together than any other combination of organ systems , and predicted mortality approaches 80% [ 40 , 41 ] . this exceedingly high mortality can not be attributed solely to volume overload ; leukocyte trafficking , uremic toxins , and oxidative stress mechanisms all likely contribute to this devastating clinical syndrome . for the purposes of this paper , ali represents a pao2/fio2 ratio < 300 combined with chest radiograph findings of acute bilateral infiltrates in the absence of elevated cardiac filling pressures , as defined by the america - european consensus conference on acute respiratory distress syndrome ( ards ) . while the mechanisms for ischemic aki - induced ali remain incompletely understood , several studies point toward a self - propagating cycle with activation of proinflammatory and proapoptotic pathways ( figure 2 ) . aki leads to lung injury and inflammation , and in turn , ali and its attendant hypoxemia and hypercapnia worsened by mechanical ventilation with high positive end - expiratory pressure leads to diminishing renal hemodynamics and function . lung injury during ischemic aki features marked pulmonary vascular permeability , erythrocyte sludging in lung capillaries , interstitial edema , focal alveolar hemorrhage , and inflammatory cell infiltration [ 12 , 43 , 44 ] . mechanisms for decreased alveolar fluid clearance include downregulation of pulmonary epithelial salt and water transporters including enac , na , k - atpase , and aquaporins during ischemic aki [ 4345 ] . this specific response likely contributes to the increased microvascular permeability and clinical pulmonary edema frequently encountered in the setting of ischemic aki and mof . experimental studies have identified a distinct pulmonary functional response and genomic signature induced during ischemic aki which differs from that induced by uremia alone . a comprehensive genomic map and ontology analysis revealed many of these top differentially expressed genes participating in proinflammatory and proapoptotic pathways . genes with early and sustained activation at 6 and 36 hours after ischemic aki included neutrophilic granule protein ( ngp ) , serum amyloid a3 ( saa3 ) , and interleukin 1-receptor type ii ( il-1r2 ) . further investigation by deng et al . has also identified an early pulmonary inflammatory response with rapid activation of transcription factors nf-b and ap-1 during ischemic aki . by 4 hours , leukocytes play a fundamental role in the development of ali , and several studies have documented lung leukocyte activation and trafficking during experimental aki with early and sustained neutrophil sequestration [ 46 , 47 ] . additional experiments by klein et al . have demonstrated early expression of the neutrophil chemokine keratinocyte - derived chemokine ( kc / cxcl1 ) and macrophage inflammatory protein ( mip-2/cxcl-2 ) along with increased pulmonary myeloperoxidase activity and pulmonary microvascular permeability during ischemic aki . the authors also examined interleukin-6 , a neutrophil - recruiting chemokine previously identified as a candidate gene by preferential expression in whole lung tissue during ischemic aki , and determined it was critical for influencing lymphocyte trafficking and pulmonary permeability . while neutrophils are key mediators in several extrapulmonary models of ali such as sepsis and mesenteric iri , their role in ischemic aki - induced ali remains to be elucidated . uremic neutrophils have even demonstrated a protective effect in the setting of ali . clearly , leukocyte trafficking and the innate immune response play a complex and important role in mediating the pulmonary inflammatory response and dysfunction during renal iri . though not traditionally associated with a proinflammatory response , pulmonary apoptosis plays a critical role in the genomic and phenotypic response to ischemic aki . apoptosis of pulmonary epithelial and endothelial cells along with delayed leukocyte apoptosis occurs during ali [ 5052 ] . pulmonary apoptosis disrupts tethering forces involved in cell - to - cell and cell - to - extracellular matrix interactions , leading to a loss of endothelial barrier function and increased vascular permeability . in a rodent model , our laboratory has characterized caspase - dependent pulmonary apoptosis which is abrogated by the administration of a broad - spectrum caspase inhibitor . not only did caspase inhibition attenuate the pulmonary functional injury , but the proapoptotic response to ischemic aki appears to be mediated via a tnf receptor-1 ( tnf - r-1 ) dependent pathway . our research has also demonstrated t - cell - dependent pulmonary apoptosis during ischemic aki . along with identification of activated t cells trafficking to the lungs during ischemic aki , we have found that pulmonary apoptosis was subsequently attenuated in t - cell - deficient animals . further pursuit of the specific pathway for t cell and tnfr1-dependent pulmonary apoptosis remains an active focus of future investigation in our research laboratory . cardiovascular collapse is one of the most common causes of death in the setting of aki , yet the mechanisms involved are not entirely understood . kelly has demonstrated left ventricular dilation , increased left ventricular end diastolic and end systolic diameter , increased relaxation time , and decreased fractional shortening in an experimental model of ischemic aki . mechanisms of cardiac injury during ischemic aki include cardiac myocyte apoptosis and neutrophil infiltration , which have been attributed to increased cardiac and systemic tnf , il-1 , and icam-1 expression [ 56 , 57 ] . when kidney ischemic time is decreased , cardiac il-1 and icam expression , along with myocyte necrosis , decreased correspondingly . effects of ischemic aki on the central nervous system ( cns ) are evident clinically when mental status changes develop . of note , renal replacement therapy fails to fully correct this cns manifestation of renal failure . uremic toxins certainly contribute to many symptoms of encephalopathy ; however , cellular and soluble inflammatory mediators have also been implicated . preclinical data identified an increase of kc , g - csf , and glial fibrillary acidic protein ( gfap ) in the cerebral cortex and hippocampus of the brain , which may serve to recruit neutrophils to sites of neuronal damage . this may result from either increased local neuronal production or an alteration of the blood - brain barrier ; further research is required to delineate the source . a cell - mediated proinflammatory response has also been identified with activation of microglial cells ( brain macrophages ) during ischemic aki . ischemic aki is also implicated in oxidative stress , inflammation , apoptosis , and tissue damage in hepatocytes . hepatic stellate cells ( hscs ) regulate leukocyte trafficking and the secretion of chemokines such as il-8 , and crosstalk between hscs likely occurs via a c - jun n - terminal kinase pathway . oxidative stress during ischemic aki causes hepatic malondialdehyde , an index of lipid peroxidation , to increase while total glutathione , an antioxidant , decreases . proinflammatory cytokine tnf expression and hepatic cellular apoptosis is also evident during ischemic aki . previous investigators and clinicians have labeled the gut as the motor of mof because of its ability to amplify the systemic sirs response in the setting of shock and gut hypoperfusion [ 6264 ] . these mechanisms include increased intestinal permeability , interactions between host and bacterial pathogens , and propagation of toxins to distant organs via the lymphatic system [ 63 , 65 ] and could potentially play a role during ischemic aki . clinical studies have long demonstrated the increased secretion of potassium by the colon and rectum in response to aki , and recent literature linked channel - inducing factor , a potassium channel regulator found in both the kidney and colon , to ischemic aki [ 67 , 68 ] . the role of the gut in response to organ crosstalk during ischemic aki remains a fascinating topic of future investigation .", "aki is a frequent complication amongst hospitalized patients , with grave implications in the setting of mof . ischemic aki initiates a cascade of proinflammatory pathways , and through the release of soluble mediators and activation of the host innate and adaptive immune systems , it facilitates organ crosstalk and remote organ injury . as our understanding of the postischemic kidney 's role in mediating organ crosstalk continues to evolve , further laboratory investigation into the remote organ response to this devastating injury" ]