article_sections
sequencelengths 1
17
| abstract
stringlengths 18
2.93k
|
---|---|
[
"of the 130 million babies born worldwide every year , approximately 4 million are stillborn , more than 98% of these occur in developing countries . stillbirth accounts for more than half of perinatal mortality in developing countries . in sub - saharan africa , while countries in south - east asia report the highest overall numbers of stillbirth , countries in africa report the highest incidence rates per 1000 live births . the average stillbirth rate in developing countries has been reported to be 26 per 1000 live births , about five times higher than in developed countries ( 5 per 1000 ) . one fourth to one third of all stillbirths is estimated to take place during delivery [ 5 , 6 ] . stillbirths occurring in the intrapartum period generally have a normal appearance and are often called fresh the skin not being intact implies death more than 24 hours before delivery ( antepartum ) , often called macerated stillbirths . stillbirths have not been widely studied , have been under - reported , and rarely have been considered in attempts to improve birth outcomes in developing countries [ 5 , 6 ] . there are many factors associated with stillbirth including inadequate access to obstetric care , inadequate care , malaria , hypertensive disease , poor nutritional status , history of stillbirth , congenital anomalies , sickle cell disease , and high burden of infectious comorbidities [ 5 , 810 ] . first , maternal infection may cause severe illness , leading to fetal death [ 12 , 13 ] . also , an infection in the uterus or anywhere else in the mother 's body may precipitate preterm labor . last , the placenta may be directly infected , leading to reduced blood flow to the fetus , a likely cause of stillbirth associated with malaria infection . when malaria parasites infect the placenta , placental insufficiency results because of lymphocyte and macrophage accumulation , and increased expression of pro - inflammatory cytokines ; these impede maternal blood flow through the placenta [ 16 , 17 ] . intestinal helminths , including hookworms and trichuris trichura , have been associated with anemia [ 18 , 19 ] . it has been suggested that low hemoglobin concentrations can cause a state of chronic hypoxia , which is presumably exacerbated in pregnancy when oxygen demands are particularly high because of the metabolism of the mother and the fetus , and that oxygen transfer to the fetus is probably reduced in anemic women . a strong association has been observed between maternal plasma , cord plasma , and placental folate concentrations , suggesting that transplacental folate delivery depends on maternal plasma folate concentrations . according to the world health organization 's opportunities for africa 's newborns 2006 report , the stillbirth rate for ghana is 24 per 1000 deliveries . even though stillbirths represent a large proportion of perinatal deaths , causes of stillbirths are poorly understood in ghana . to our knowledge , the association between malaria and intestinal helminth coinfection in pregnancy and stillbirth has not been studied . few studies have studied the association between malaria and helminths in pregnancy , with conflicting results . given that 98% of stillbirths occur in developing countries , especially sub - saharan africa , which also has a high burden of malaria and intestinal helminth infections , it is important to investigate the role of these infections in contributing to stillbirth .",
"the study was conducted in kumasi , the capital of the ashanti region of ghana . the climate in kumasi is humid and tropical , with two rainy seasons , april to june and september to october . helminth infection is endemic in the ashanti region , which also has an intense perennial malaria transmission , the predominant parasite being plasmodium falciparum . the institutional review board of the university of alabama at birmingham and the committee on human research , publications and ethics , school of medical sciences , kwame nkrumah university of science and technology , kumasi reviewed and approved the study protocol before its implementation . a cross - sectional study of women presenting for delivery at two hospitals in kumasi , the komfo anokye teaching hospital ( kath ) , and the manhyia polyclinic was conducted in november and december 2006 after informed consent was obtained , a questionnaire was administered to collect sociodemographic information , and medical and obstetric histories . body weight and mid upper arm circumference ( muac ) were measured for each woman . obstetric information was also obtained from the mothers ' antenatal care ( anc ) charts . anc charts provided information on number of antenatal care visits , gestational age as assessed by palpation at first anc visit or ultrasound at first anc , tetanus shots , malaria prophylaxis , antihelminth medications , hemoglobin level , and illnesses and treatments during pregnancy . blood was drawn by venipuncutre for determination of hemoglobin levels , serum folate level , and malaria antigen tests . state of the newborn ( alive or stillbirth ) , sex , weight , and length were obtained as recorded by the midwives . determination of malaria antigen in plasma was done using the malaria antigen celisa ( cellabs , brookvale , australia ) . the malaria antigen celisa kit is a monoclonal antibody - based assay specific for p. falciparum malaria . the assay detects a merozoite antigen that circulates in the blood for up to 14 days postinfection . determination of hookworms , ascaris lumbricoides , and trichuris trichura was done using the kato - katz thick smear technique ( who , 1991 ) . stool samples were processed within 12 hours of collection and examined microscopically within one hour of preparation to avoid missing hookworm ova . for strongyloides stercoralis , samples were processed using the baermann method . hemoglobin level was measured in an automatic cell counter ( sysmex m-2000 ; digitana ag , hamburg , germany ) about 30 minutes after blood sampling . uncomplicated pregnancy : absence of hypertension , pre - eclampsia , history of a previous caesarean section and hemorrhage , and a normal presentation of the fetus . malaria infection : presence of malaria antigen in the mother 's peripheral blood at the time of delivery . intestinal helminth infection : presence of helminth eggs or larvae in stool collected at the time of delivery . anemia : hemoglobin levels < 11 g / dl of blood , and severe anemia : hemoglobin level < 8 g / dl . stillbirth : an intrauterine death of a fetus weighing at least 500 grams after 20 completed weeks of gestation occurring before the complete expulsion or extraction from its mother . an intrauterine death of a fetus during labor or delivery was considered a fresh stillbirth , and an intrauterine death of a fetus sometime before the onset of labor , where the fetus showed degenerative changes was considered a macerated stillbirth . induced abortion : the purposeful interruption of an intrauterine pregnancy with the intention other than to produce a live - born infant , and which does not result in a live birth . sample size was calculated using unpublished reports on stillbirth from the two study hospitals , which estimated that at least 1%1.5% of 1000 births would be stillbirths . we made the assumption that if we obtained 10 stillbirths , and that 1025% of women with normal births had both malaria and intestinal helminth infections , at a 5% significance level , we would have 80% power to detect an odds ratio of 7.59.0 ; assuming 15 stillbirths , we would be able to detect an odds ratio of 6.07.5 .",
"data analysis was performed using sas software version 9.1 ( sas institute , cary , nc ) . differences in socio - demographic and obstetric characteristics by stillbirth were assessed by chi - square or t - test . correlation analyses were performed to identify potential multicollinearity between independent variables . to determine factors associated with stillbirth , we used multiple logistic regression . variables that were significant ( p < .05 ) on bivariate analysis and those that are known to be associated with stillbirth based on previous studies were entered into a regression model . through this procedure , we calculated odds ratios ( or ) and 95% confidence intervals ( ci ) .",
"seven hundred and eighty five ( 785 ) women were recruited into the study before delivery in the two hospitals in kumasi . we obtained both malaria and intestinal helminth results from 746 women , and data analysis was limited to these women . overall , the mean age of the women was 26.8 years ( range : 15 to 48 years ) ; 21.1% were single , 30.2% were primigravidae , 30.6% were anemic , 29.5% had a prior induced abortion , and 5.2% had a history of stillbirth ( table 1 ) . . a higher proportion of women who were single did not receive sp during pregnancy , had fewer than 5 anc visits , had low folate levels , were anemic , had had a prior induced abortion or a prior stillbirth and delivered a stillborn infant compared to their counterparts ( table 1 ) . of the 746 women , 407 ( 54.6% ) had neither infection , 147 ( 19.7% ) were infected with p. falciparum only , 68 ( 9.1% ) were infected with helminths only , while 124 ( 16.6% ) were coinfected . a higher proportion of women with either organism presented with stillbirth than women with neither infection . women who were coinfected had a modestly higher rate of stillbirth than women with a single infection ( table 2 ) . low serum folate , severe anemia , prior induced abortion and prior stillbirth were each strongly , independently associated with stillbirth , with increased odds ranging from over 3-fold to a 6-fold increase ( table 3 ) . women with malaria irrespective of whether or not they had intestinal helminths had a 90% increased odds of stillbirth . although intestinal helminth infection had a stronger association , it was not statistically significant ( table 3 ) .",
"this study demonstrated that the study population had a relatively high rate of stillbirth ( 5% of all deliveries ) . factors associated with stillbirth were malaria , severe anemia , low serum folate concentration , past induced abortion , and history of stillbirth . many stillbirths were fresh ( 75.7% ) , an indication that a proportion of these cases could likely have been prevented . it has been suggested that stillbirths occurring in the peripartum period could be prevented through appropriate cesarean section , improved obstetric care , and improved emergency response to obstetric complications . in this study , women who had fewer antenatal care visits had an increased risk of stillbirth , suggesting that stillbirths are closely linked to use and quality of maternal services . malaria is endemic in many african countries , and is thought to play a role in contributing to stillbirth . intestinal helminths , especially hookworms and trichuris can cause anemia [ 18 , 19 ] , which in turn leads to adverse birth outcomes including stillbirth . we did not observe an association between intestinal helminths and stillbirth , a finding that has been previously reported . however , our observation could be the result of small numbers , that is , malaria was more common than intestinal helminthes . coinfection with malaria and intestinal helminths did not increase the risk for stillbirth but as in the case of intestinal helminths , this could be a matter of numbers . malaria contributes to anemia by hemolysis or destruction of parasitized cells and causes shortened red cell survival [ 36 , 37 ] , while hookworms and trichuris cause anemia through direct blood loss [ 19 , 38 ] . since the mechanisms by which malaria and intestinal helminth infections cause anemia differ , it is possible that their impact on anemia are additive and could exacerbate adverse birth outcomes . a strong association has been observed between maternal plasma , cord plasma , and placental folate concentrations , suggesting that transplacental folate delivery depends on maternal plasma folate concentrations . some studies [ 40 , 41 ] have reported higher rates of stillbirth in women with megaloblastic anemia than those without . abortion is legal in ghana only for medical reasons , and is not available upon request ( ministry of health , ghana ) . most women seeking abortion therefore sometimes attempt illegal abortions , and then go to the hospital for treatment of complications . removal of retained products of conception in the hospital setting is usually performed by cervical dilation and curettage . there has been concern that this may result in cervical insufficiency , hence future adverse birth outcomes . the tendency to repeat pregnancy outcomes in successive births is well known and includes risk of stillbirth . previous studies have demonstrated that women with a history of stillbirth may have a 6 to 10-fold increased risk of stillbirth [ 46 , 47 ] . the causal mechanism may involve impaired placental development and function due to compromised vascular support system . a methodological weakness of our study lies in limited power due to the number of stillbirths , therefore our findings should be interpreted with caution . the fact that it was a cross - sectional study also limits our ability to draw causal or temporal associations . the study however has several strengths including new findings , high participation and consistency with other studies in some risk factors of stillbirth , which strengthens confidence in the new findings . another strength of the study lies in the fact that the hospitals in which the study was conducted are secondary and tertiary hospitals which cater to large numbers of women of all socioeconomic status from kumasi and surrounding areas . the 2008 demographic health survey for ghana ( dhs , 2008 ) reported that 82.4% of women in urban areas in ghana deliver in a health facility . the fact that most of the stillbirths were fresh suggests that higher quality intrapartum care could reduce stillbirth rates . more studies need to be conducted to further assess the association between stillbirth and malaria and intestinal helminth coinfection . it is important to conduct further studies to investigate risk factors of stillbirth to determine which stillbirths are preventable so that targeted interventions can be developed and tailored for resource - poor settings ."
] |
objective . the objective of the study was to assess plasmodium / intestinal helminth infection in pregnancy and other risk factors for stillbirth in ghana . methods . a cross - sectional study of women presenting for delivery in two hospitals was conducted during november - december 2006 . data collected included sociodemographic information , medical and obstetric histories , and anthropometric measures . laboratory investigations for the presence of plasmodium falciparum and intestinal helminths , and tests for hemoglobin levels were also performed . results . the stillbirth rate was relatively high in this population ( 5% ) . most of the stillbirths were fresh and 24% were macerated . when compared to women with no malaria , women with malaria had increased risk of stillbirth ( or = 1.9 , 95% ci = 1.29.3 ) . other factors associated with stillbirth were severe anemia , low serum folate concentration , past induced abortion , and history of stillbirth . conclusion . the fact that most of the stillbirths were fresh suggests that higher quality intrapartum care could reduce stillbirth rates . |
[
"type 1 diabetes is characterized by insulin deficiency resulting from destruction of pancreatic cells and subclassified into type 1a ( autoimmune ) and type 1b ( idiopathic ) diabetes . we previously reported a novel subtype of type 1b diabetes that we referred to fulminant type 1 diabetes . in fulminant type 1 diabetes , remarkably acute and almost complete cell destruction occurs and nearly no insulin secretion remains , even just after the disease onset . measurement of serum cpeptide level is effective for assessing the ability of endogenous insulin secretions . in particular , it is valuable to presume residual cell capability for type 1 diabetic patients . with a conventional method , enzyme immunoassays ( eia ) , low levels ( usually < 0.07 nmol / l [ 0.2 ng / ml ] ) of serum cpeptide are difficult to detect . however , we can now detect up to 0.003 nmol / l ( 0.01 ng / ml ) serum cpeptide levels using a high sensitivity method , chemiluminescent enzyme immunoassay ( cleia ) . it enables us to know more precise levels of serum cpeptide in patients who have almost no insulin secretion , such as patients with fulminant type 1 diabetes . in the present study , we evaluated serum cpeptide levels measured by cleia and clarified the clinical features of fulminant type 1 diabetic patients based on residual endogenous insulin secretions .",
"we studied 12 patients with fulminant type 1 diabetes ( 5 males and 7 females ) . these patients were diagnosed as having fulminant type 1 diabetes between 19882006 , and had been followed in our hospital for more than 0.5 years since the disease onset . the diagnosis of fulminant type 1 diabetes was established according to the inclusion criteria proposed by the committee of the japan diabetes society . namely : ( i ) the presence of ketosis or ketoacidosis within a week after the onset of hyperglycemic symptoms ; ( ii ) urinary cpeptide excretion < 10 g / day or fasting serum cpeptide level < 0.10 nmol / l ( 0.3 ng / ml ) and peak serum cpeptide level < 0.17 nmol / l ( 0.5 ng / ml ) after glucagon ( 1 mg ) or a meal load soon after disease onset ; and ( iii ) plasma glucose level 16.0 mmol / l ( 288 mg / dl ) and hba1c level < 8.5% at first visit . patients characteristics were as follows : they were aged 2278 years ( 44.2 18.4 ) , duration of the disease was 0.819 years ( 4.8 5.2 ) , body mass index ( bmi ) was 18.524.8 ( 20.8 1.9 ) , hba1c was 5.710.4% ( 7.2 1.5 ) , and glycoalbumin was 19.032.5% ( 25.1 4.1 ) . eight of the 12 patients were receiving multiple daily injections and three patients were receiving continuous subcutaneous insulin infusion . every patient was usually followed every month in our outpatient clinic and insulin doses were adjusted for targeting nearly normal glucose levels ( hba1c < 6.5% , fasting glucose level < 5.6 mmol / l [ 100 mg / dl ] , 120min postprandial glucose level < 7.8 mmol / l [ 140 mg / dl ] ) . the data of hba1c , glycoalbumin , bodyweight and daily dosages of insulin were measured every 9 months ( from january to september in 2006 ) and expressed as mean of 9 months measurements . sevenpoint ( fasting and 120 min postprandial for each meal and bedtime ) capillary blood glucose concentrations were measured in seven of the 12 patients for at least two days , and mean mvalue was calculated in each patient . mvalue is a logarithmic transformation of the deviation of blood glucose from a selected standard . we used 5.6 mmol / l ( 100 mg / dl ) as the selected standard . the deviation index ( ) of each individual glucose value ( ) is first calculated as = ( 10 log[/5.0 ] ) . serum cpeptide levels were measured by cleia ( lumipulse f , lumipulse cpeptide ; fujirevio , tokyo , japan ) and two different eia , aia21 ( e test cpeptide ; tosoh , tokyo , japan ) and eclusys 2010 ( eclusis cpeptide ; roche diagnostics , basel , switzerland ) simultaneously by using the same serum samples . serum cpeptide level was also followed for 9 months by cleia , and the maximal value was determined in each patient . the present study was carried out with patients approvals and informed consent was obtained from every patient . the significance of differences between the two groups was evaluated by pearson s correlation coefficient and mvalue was evaluated by mann ",
"we studied 12 patients with fulminant type 1 diabetes ( 5 males and 7 females ) . these patients were diagnosed as having fulminant type 1 diabetes between 19882006 , and had been followed in our hospital for more than 0.5 years since the disease onset . the diagnosis of fulminant type 1 diabetes was established according to the inclusion criteria proposed by the committee of the japan diabetes society . namely : ( i ) the presence of ketosis or ketoacidosis within a week after the onset of hyperglycemic symptoms ; ( ii ) urinary cpeptide excretion < 10 g / day or fasting serum cpeptide level < 0.10 nmol / l ( 0.3 ng / ml ) and peak serum cpeptide level < 0.17 nmol / l ( 0.5 ng / ml ) after glucagon ( 1 mg ) or a meal load soon after disease onset ; and ( iii ) plasma glucose level 16.0 mmol / l ( 288 mg / dl ) and hba1c level < 8.5% at first visit . patients characteristics were as follows : they were aged 2278 years ( 44.2 18.4 ) , duration of the disease was 0.819 years ( 4.8 5.2 ) , body mass index ( bmi ) was 18.524.8 ( 20.8 1.9 ) , hba1c was 5.710.4% ( 7.2 1.5 ) , and glycoalbumin was 19.032.5% ( 25.1 4.1 ) . eight of the 12 patients were receiving multiple daily injections and three patients were receiving continuous subcutaneous insulin infusion . every patient was usually followed every month in our outpatient clinic and insulin doses were adjusted for targeting nearly normal glucose levels ( hba1c < 6.5% , fasting glucose level < 5.6 mmol / l [ 100 mg / dl ] , 120min postprandial glucose level < 7.8 mmol / l [ 140 mg / dl ] ) . the data of hba1c , glycoalbumin , bodyweight and daily dosages of insulin were measured every 9 months ( from january to september in 2006 ) and expressed as mean of 9 months measurements . sevenpoint ( fasting and 120 min postprandial for each meal and bedtime ) capillary blood glucose concentrations were measured in seven of the 12 patients for at least two days , and mean mvalue was calculated in each patient . mvalue is a logarithmic transformation of the deviation of blood glucose from a selected standard . we used 5.6 mmol / l ( 100 mg / dl ) as the selected standard . the deviation index ( ) of each individual glucose value ( ) is first calculated as = ( 10 log[/5.0 ] ) . serum cpeptide levels were measured by cleia ( lumipulse f , lumipulse cpeptide ; fujirevio , tokyo , japan ) and two different eia , aia21 ( e test cpeptide ; tosoh , tokyo , japan ) and eclusys 2010 ( eclusis cpeptide ; roche diagnostics , basel , switzerland ) simultaneously by using the same serum samples . serum cpeptide level was also followed for 9 months by cleia , and the maximal value was determined in each patient . the present study was carried out with patients approvals and informed consent was obtained from every patient .",
"the significance of differences between the two groups was evaluated by pearson s correlation coefficient and mvalue was evaluated by mann ",
"maximal concentrations of serum cpeptide evaluated by cleia were 0.020.10 nmol / l ( 0.060.29 ng / ml ) in four patients and < 0.003 nmol / l ( 0.01 ng / ml ) in eight patients . serum cpeptide concentrations of the former four patients ranged from 0.007 to 0.10 nmol / l ( 0.020.29 ng / ml ) and those of the latter eight patients were always less than 0.003 in contrast , serum cpeptide was detectable in just two patients ( 0.090.10 nmol / l , respectively ) by conventional eia . detectable serum cpeptide levels in 4 patients ( , , , ) ranged from 0.007 to 0.10 nmol / l , however serum cpeptide levels in eight patients were always < 0.003 nmol / l . patients who kept more serum cpeptide levels needed significantly fewer daily dosages of insulin ( p < 0.01 ; figure 2 ) . the patients with detectable serum cpeptide levels showed a significantly lower mvalue ( median 2.94 , range 0.966.15 , n = 4 ) than those without detectable serum cpeptide levels ( median 16.62 , range 5.3627.10 , n = 3 ; p = 0.01 ) . relationship between maximal serum cpeptide level(nmol / l ) and daily dosages of insulin ( unit / kg ) . residual insulin secreting capacity shown as serum cpeptide level and daily dosages of insulin indicated a significant negative correlation ( * p < 0.01 ) . there were no significant correlations between hba1c , glycoalbumin , bmi , duration of disease and serum cpeptide levels .",
"in the present study , we clarified a significant negative correlation between serum cpeptide levels and daily dosages of insulin . the patients who had more residual endogenous insulin secreting capacity needed fewer daily dosages of insulin injection . in addition , the patients whose serum cpeptide levels were < 0.003 nmol / l had a significantly higher mvalue than the patients whose serum cpeptide levels were 0.0070.10 nmol / l . these results suggest that even very low endogenous insulin secreting capacity would improve the doses of required insulin and stability of blood glucose controls in patients with fulminant type 1 diabetes . fukuda et al . have reported a negative correlation between endogenous insulin secreting capacity and degree of blood glucose instability in 20 patients with type 1 diabetes whose fasting serum cpeptide levels were 0.010.13 nmol / l . in the present study , compared with the report from fukuda et al . , not fasting but maximal postprandial cpeptide levels were 0.020.10 nmol / l or less , showing that a negative correlation was observed even in the patients with lower levels of serum cpeptide . second , serum cpeptides were detectable and ranged from 0.007 to 0.10 nmol / l in four patients with fulminant type 1 diabetes throughout the followup period of 9 months . pathophysiology of fulminant type 1 diabetes is known as almost complete cell destruction around the disease onset , resulting in nearly no cpeptide secretion . however , our results also suggest that endogenous insulin secreting capacity would be preserved by intensive insulin therapy , as shown in data from the diabetes control and complications trial , even in patients with fulminant type 1 diabetes . it is important because preserving cell function , even at a low level , could help to stabilize blood glucose levels in patients with fulminant type 1 diabetes . in conclusion , our present results suggest that even very low levels of serum cpeptide could reduce daily dosages of insulin and stabilize blood glucose controls in fulminant type 1 diabetes ."
] | abstractfulminant type 1 diabetes is characterized by almost complete cell destruction , resulting in scarce insulin secretion . in the present study , we aimed to clarify clinical features related to serum cpeptide levels measured by a high sensitivity method , chemiluminescent enzyme immunoassay , in 12 patients with fulminant type 1 diabetes . serum cpeptide was detected ( 0.0070.10 nmol / l ) in four patients and was not detected in eight patients . a negative correlation was observed between serum cpeptide levels and daily dosages of insulin ( p < 0.01 ) . the patients with detectable cpeptide showed a significantly lower mvalue than those without ( p = 0.01 ) . in conclusion , our present results suggest that even very low levels of endogenous insulin secreting capacity can improve daily dosages of insulin and stabilize blood glucose levels . ( j diabetes invest , doi : 10.1111/j.20401124.2010.0059.x , 2010 ) |
[
"two types of cnt were investigated , nc7000 from nanocyl and mwnt sa from sigma aldrich ( catalog reference 659258 ) , both produced by chemical vapor deposition ( cvd ) . nc7000 has a diameter of 710 nm , and mwnt sa has a diameter of 110170 nm . the cnt were functionalized by a 1,3-dipolar cycloaddition reaction of azomethine ylides using a one - pot functionalization procedure described elsewhere13 leading to the formation of pyrrolidine - type groups bonded to the cnt surface . the functionalization was carried out at 250 c over 5 h. the unzipping of the cnt was performed using an ultrasonic processor up100h from hielscher , equipped with a sonotrode ms2 . cnt suspensions were prepared by mixing functionalized cnt ( 5 mg ) in ethanol ( 8 ml ) . a control experiment was conducted using pristine cnt ( 5 mg ) in ethanol ( 8 ml ) . the suspensions were centrifuged ( 8000 rpm , 1 h ) to separate the unzipped cnt , and the gnr supernatant solutions were collected . these solutions were analyzed by uv - visible spectroscopy on a shimadzu uv-240 1 pc , using 10 mm light path quartz cells . the micro - raman analysis was conducted in the backscattering configuration on a jobin yvon hr800 instrument ( horiba , japan ) , using a 1800 l mm grating and the 532 nm laser line from a nd : yag dpss laser ( ventus , laser quantum , uk ) . a 50x objective ( spot size : 3 m , na=0.75 , olympus , japan ) was used to focus the laser light onto the sample ( < 0.15 mw m ) and to collect the backscattered raman radiation to be detected by a peltier cooled ( 223 k ) ccd sensor . the spectrometer was operated in the confocal mode , setting the iris to 300 m , while the acquisition time was set to 30 s with 2 accumulations . transmission electron microscopy ( tem ) of the gnr mwnt sa was performed on an energy filtered 200 kv transmission electron microscope hr-(ef)tem tem analysis of the gnr nc7000 was carried out on a titan chemistem 80200 kv probe cs corrected microscope . low - magnification tem and high - resolution tem ( hrtem ) images were acquired with a gatan ultrascan 1000 p camera controlled with digital micrograph software integrated in the microscopes user interface . the samples were prepared by adding a drop of the gnr solution onto a lacey carbon cu grid ( 300 mesh , ted pella ) and allowing it to dry under vacuum . x - rays diffraction experiments were performed on a panalytical xpert pro xrd system using the cu k1 wavelength of 0.15406 nm from a copper x - ray tube operated at 45 kv and 40 ma . a pixcel-3d detector was used , and the scan range was from 4 to 40 in 2. the gnr samples were deposited on glass lamellae by solvent evaporation . the unzipping process produces functionalized gnrs with widths equal or larger than 35 nm for gnr nc7000 and 350 nm for gnr mwnt sa . for this reason , a model of functionalized graphene ( see figure 6 ) , as opposite to finite gnr , was chosen . graphene layers and their intermolecular interactions were modelled with the mm3 force field that has been found to give accurate intermolecular structures.17 all the calculations were performed with the tinker molecular mechanics suite18 using three - dimensional periodic boundary conditions.19 the shape and dimensions of unit cells containing five functionalized graphene layers with different concentrations of functional groups were systematically obtained by energy minimization . additional data for the characterization for the gnr : thermogravimetric analysis ( tga ) and fourier - transform infrared spectroscopy ( ftir ) , is provided as supporting information .",
"as a service to our authors and readers , this journal provides supporting information supplied by the authors . such materials are peer reviewed and may be re - organized for online delivery , but are not copy - edited or typeset . technical support issues arising from supporting information ( other than missing files ) should be addressed to the authors ."
] | graphene nanoribbons ( gnr ) were generated in ethanol solution by unzipping pyrrolidine - functionalized carbon nanotubes under mild conditions . evaporation of the solvent resulted in regular few - layer stacks of graphene nanoribbons observed by transmission electron microscopy ( tem ) and x - ray diffraction . the experimental interlayer distance ( 0.490.56 nm ) was confirmed by computer modelling ( 0.51 nm ) . computer modelling showed that the large interlayer spacing ( compared with graphite ) is due to the presence of the functional groups and depends on their concentration . stacked nanoribbons were observed to redissolve upon solvent addition . this preparation method could allow the fine - tuning of the interlayer distances by controlling the number and/or the nature of the chemical groups in between the graphene layers . |
[
"periodontal diseases are polymicrobial immune - inflammatory infectious diseases that can lead to the destruction of periodontal ligaments and adjacent supportive alveolar bone . the subgingival plaque contains more than 700 bacterial species , and some of these microorganisms have been shown to be responsible for initiation / progression of periodontal diseases [ 1 , 2 ] . the red complex , which includes porphyromonas gingivalis , treponema denticola , and tannerella forsythia ( formerly bacteroides forsythus ) , encompasses the most important pathogens in adult periodontal disease . additionally , fusobacterium nucleatum , prevotella species , eikenella corrodens , peptostreptococcus micros , and campylobacter rectus are increased in deep periodontal pockets and are implicated as possible periodontopathogens [ 14 ] . these bacteria are not usually found alone , but in combination in the periodontal pockets , suggesting that some bacteria may cause destruction of the periodontal tissue in a cooperative manner . studies using animal models have reported the synergistic pathogenicity of mixed infections with p. gingivalis - t . furthermore , coaggregation , nutrient effects , and modulation of virulence factors by periodontopathogens or by interspecies interactions between periodontopathogenic and nonpathogenic organisms have been reported to contribute to oral microbial pathogenesis . this paper focuses on interspecies pathogenic interactions within the red complex , in particular the combinations of p. gingivalis - t . potential therapies using normal inhabitants of the oral microbiota that have an antagonistic relationship with the red complex are discussed .",
"\n p. gingivalis possesses many virulence factors , such as fimbriae , lipopolysaccharides , and proteases [ 1315 ] . the arg - gingipain ( rgp ) and lys - gingipain ( kgp ) cysteine proteinases are important for the virulence of p. gingivalis as they elicit dysfunction of inflammatory and immune responses and can degrade various connective tissue proteins [ 16 , 17 ] . rgp is encoded by two separate genes ( rgpa and rgpb ) , whereas kgp is encoded by a single gene ( kgp ) . in a murine abscess model , rgpa and rgpb double and kgp single - mutants induced smaller abscesses than did the wild type , and the rgpa - rgpb - kgp triple ( gingipain - null ) mutant showed negligible lesion formation . these findings indicate that gingipains play an important role in abscess formation in mice . compared to the abscess formation induced by monoinfection with each bacterium in the abovedescribed murine model , mixed infection with wild - type p. gingivalis atcc 33277 and t. forsythia atcc 43037 showed a synergistic effect on abscess formation . on the other hand , mixed infection with p. gingivalis mutants devoid of gingipain ( rgpa rgpb , kgp , and rgpa rgpb kgp ) with t. forsythia showed only just an additive effect on abscess formation . these findings suggest that the gingipains of p. gingivalis play an important role in the pathological synergism between p. gingivalis and t. forsythia . a combination of t. forsythia strains isolated from periodontitis patients and p. gingivalis also showed synergistic pathogenesis in a rabbit abscess model . the researchers found 100% abscess formation in rabbits with mixed infection using p. gingivalis and t. forsythia but 0% in rabbits with monoinfection with each bacterium . recently , verma et al . injected p. gingivalis fdc 381 and t. forsythia atcc 43037 into the oral cavity of rats and evaluated the synergistic effect of mixed infection on periodontal disease . mixed colonization by p. gingivalis and t. forsythia in the rat oral cavity was confirmed by polymerase chain reaction ( pcr ) . the induction of moderate periodontal inflammation and pronounced apical migration of junctional epithelium , generation of a specific immunoglobulin g ( igg ) antibody response , and stimulation of both th1- and th2-like immune responses as reflected by the serum igg subclass profiles were evident . mixed infection with p. gingivalis and t. forsythia resulted in a significant increase in interproximal alveolar bone resorption compared to that in rats infected with a single bacterial strain and controls , but there was no synergy between the bacteria . the researchers indicated that the virulence of p. gingivalis and t. forsythia mixed infection resulted from the immune - inflammatory responses and the lack of humoral immune protection during periodontitis in rats . mice that were first infected with a wild - type strain and subsequently reinfected with the same wild - type strain showed significantly smaller lesions than control mice that were mock - infected with medium only and then re - infected with the wild - type strain . assessed the serum igg antibody response in a murine abscess model after mixed infection with various levels of p. gingivalis atcc 33277 or t. forsythia atcc 43037 whole bacteria cell antigens . after mixed infection , igg antibody responses to p. gingivalis increased in proportion to the level of t. forsythia injected . in contrast , igg antibody responses to t. forsythia did not correlate with the level of p. gingivalis injected . reasons for this difference may be that p. gingivalis and t. forsythia induced different antibody responses after mixed infection in mice ; alternatively , these bacteria may exhibit different interactions in terms of growth at the injected sites . \n t. forsythia , which is a fastidious anaerobic gram - negative rod , is frequently isolated together with p. gingivalis , especially from the active state of periodontitis [ 2427 ] . it is well known that the growth of t. forsythia is accelerated on blood agar when cocultivated with p. gingivalis or f. nucleatum , suggesting that a form of symbiosis occurs with respect to nutrition . sonicated cell extracts of t. forsythia atcc 43037 stimulate growth of p. gingivalis atcc 33277 in nutrition - decreased medium in a dose - dependent manner , whereas the cell extract of t. forsythia had no stimulatory effect on the growth of the rgpa rgpb kgp triple ( gingipain - null ) mutant of p. gingivalis . these results suggest that gingipains of p. gingivalis play an important role in the digestion or uptake of the growth - promoting factor derived from t. forsythia . the growth - promoting interaction between p. gingivalis and t. forsythia may be partly related to synergistic virulence in a murine abscess model . \n t. forsythia is a member of the polymicrobial flora that invades buccal epithelial cells taken directly from the mouth . epithelial cell invasion by periodontopathogens is considered to be an important virulence mechanism for evasion of the host defense responses and for forming reservoirs important in recurrent infections . t. forsythia possesses some putative virulence factors , such as a trypsin - like protease , a sialidase , hemagglutinin , components of the bacterial s - layer , and a cell surface - associated and secreted protein ( bspa ) . bspa has been recognized as a virulence factor important for alveolar bone loss in mice . inagaki et al . investigated the epithelial cell adherence and invasion abilities of t. forsythia and reported that these are dependent on bspa . additionally , they found that p. gingivalis fdc 381 or its outer membrane vesicles enhance the attachment and invasion of t. forsythia atcc 43037 to epithelial cells .",
"\n t. denticola , a small oral spirochete , is frequently found with p. gingivalis in progressing periodontitis lesions [ 1 , 3335 ] . t. denticola is located within the surface layers of the subgingival plaque , whereas p. gingivalis is observed predominantly beneath the spirochete layer ; a symbiotic nutrient utilization relationship between these two periodontopathogens has been shown in vitro . the growth - stimulating factors produced by p. gingivalis atcc 33277 and t. denticola atcc 35405 have been identified as isobutyric acid and succinic acid , respectively . coculture of p. gingivalis fdc 381 and t. denticola atcc 35405 induced synergistic biofilm formation and coaggregation . confocal microscopy demonstrated that p. gingivalis attaches to the substratum first as the primary colonizer followed by coaggregation with t. denticola to form a mixed biofilm . the t. denticola flagellar mutant and cytoplasmic filament mutant exhibit significantly reduced biofilm formation with p. gingivalis . similarly , the p. gingivalis gingipain mutant and major fimbriae mutant exhibited significantly reduced biofilm formation with t. denticola . using two - dimensional electrophoresis followed by a ligand overlay assay with p. gingivalis fimbriae , hashimoto et al . determined that dentilisin , a chymotrypsin - like proteinase of t. denticola , was the p. gingivalis fimbriae - binding protein . these results support the hypothesis that these two organisms assist each other 's survival in subgingival sulcus and explain why they are frequently isolated together from subgingival plaque . synergistic virulence of mixed p. gingivalis and t. denticola infection has been assessed in several animal lesion models . using a murine abscess model , one group reported that high doses of p. gingivalis w50 ( 1 - 2 10 cells per dose ) together with t. denticola atcc 35404 ( 1 10 or 1 10 cells per dose ) had no effect on the formation and size of the spreading lesion caused by p. gingivalis . however , at low p. gingivalis doses ( 1 - 2 10 cells ) , addition of t. denticola ( 1 10 cells ) significantly enhanced the virulence of p. gingivalis compared with monoinfection . investigation of the synergistic virulence of p. gingivalis and t. denticola using a murine experimental model of periodontitis found that a 1 : 1 ratio of p. gingivalis w50 and t. denticola atcc 35405 coinoculum at 5 10 or 1 10 total bacterial cells induced the same level of bone loss as four doses of 1 10 p. gingivalis . coinoculation induced strong p. gingivalis - specific t cell proliferative and interferon- ( ifn- ) cytokine responses and induced a strong t. denticola - specific ifn- cytokine response . another study using a rat model of periodontal disease reported that a mixed p. gingivalis fdc 381 ( 5 10 cells ) and t. denticola atcc 35404 ( 5 10 cells ) infection produced significantly more interproximal and horizontal alveolar bone loss compared to monoinfections ( 1 10 cells ) ; however , there was no synergy between p. gingivalis and t. denticola . furthermore , colonization of these bacteria was observed in the rat oral cavity during 7 weeks of periodontal disease , resulting in the generation of a specific serum igg antibody response that reflected oral infection and the induction of an inflammatory response consistent with the established characteristics of periodontitis . these results suggest that p. gingivalis and t. denticola act synergistically ( with no synergy between the bacteria ) to stimulate the host immune response and to induce alveolar bone loss in a rat model of periodontitis .",
"epithelial cells and macrophages play a major role in the host response to periodontopathogens , and secretion of inflammatory mediators and matrix metalloproteinases ( mmps ) by these host cells contribute to periodontal tissue destruction . investigated the inflammatory response of an in vitro macrophage / epithelial cell coculture model following mono- or mixed infections with whole bacterial cells of the red - complex and their lipopolysaccharide ( lps ) . mono- or mixed infections of the coculture model induced the secretion of interleukin-1 beta ( il-1 ) , il-6 , il-8 , prostaglandin e2 ( pge2 ) , and mmp-9 . all lps mono- or mixed infections induced an increase in chemokine , mmp-9 , and pge2 production . compared to mono - infections with individual bacterial species , no synergistic effects on cytokine , pge2 , or mmp-9 production by the bacterial mixtures tested were observed . p. gingivalis and t. forsythia induced the secretion of rantes ( regulated and normal t cell expressed and secreted ) , whereas t. denticola alone or in combination with p. gingivalis resulted in a significant decrease in rantes levels . rantes degradation by mono- or mixed infections with red - complex bacteria resulted in massive proteolytic degradation of rantes by t. denticola . the ability of periodontopathogens to degrade cytokines and chemokines in vivo may play an important role in their pathogenicity by disrupting the host inflammatory response . recently , polymicrobial infection with p. gingivalis , t. denticola , and t. forsythia in a rat model of periodontal disease was investigated . a 1 10 cell mixture ( 1 ml ) containing an equal number of cells of each bacterium was injected into the rat oral cavity . pcr of the bacterial dna in the oral sample revealed that polymicrobial infection enhanced colonization by p. gingivalis , t. denticola , and t. forsythia compared to their levels in monomicrobial infections . oral infection of rats with a polymicrobial consortium comprising p. gingivalis , t. denticola , and t. forsythia induced significant increases in maxillary and mandibular alveolar bone resorption compared to those resulting from any of the monomicrobial infections ( p < 0.001 ) . the levels of serum igg against all of the bacteria in the polymicrobial infection were lower than the respective levels induced by monomicrobial infections . this suggested that the host response to the polymicrobial infection was altered , resulting in enhanced evasion of protective immune responses by the bacterial consortium .",
"most therapeutic modalities for treatment of periodontitis aim to remove pathogens and kill all bacteria in the periodontal pocket . understanding the effect of interbacterial interactions on the pathogenesis of periodontitis may facilitate development of novel treatment modalities , such as the inhibition of adherence using antagonists , passive immunization , replacement therapy , regulation of levels of nonpathogenic bacteria to modulate virulence , probiotics , and interference with signaling mechanisms . the disruption of the harmonic relationship between the host and commensal microorganisms is considered to be an important factor for the development of oral pathologies . , we discuss the significance of interbacterial antagonism for maintenance and recovery of a healthy oral microbiota . moreover , antagonistic bacteria have the potential for probiotic action , which may protect against periodontitis . staphylococcus aureus and streptococcus mutans isolates inhibited the growth of t. denticola and p. gingivalis . s. aureus strains produced a bacteriocin - like inhibitory substance , whereas the inhibitory effect of s. mutans was related to the production of lactic acid . s. sanguinis , s. cristatus , s. salivarius , s. mitis , actinomyces naeslundii , and haemophilus parainfluenzae inhibited the adhesion of standard p. gingivalis strains in vitro . s. cristatus arginine deiminase repressed fima , a major subunit protein of the long fimbriae , and inhibited biofilm formation by p. gingivalis . an analysis of the ability of clinical isolates from healthy and periodontitis patients to inhibit the growth of periodontopathogens showed that the number of isolates from healthy volunteers that inhibited either p. gingivalis or p. intermedia was significantly higher than that from diseased patients . these isolated growth - inhibiting strains included some viridans group streptococcus , actinomyces , and bifidobacterium strains . compared to these isolates , commercial dietary probiotics showed stronger inhibition of the periodontopathogens . in a study that compared oral lactobacilli from patients with chronic periodontitis and periodontally healthy subjects , the most prevalent species in healthy subjects were lactobacillus gasseri and l. fermentum , whereas the most prevalent species in subjects with periodontitis was l. plantarum . furthermore , the greatest antimicrobial activities were associated with l. paracasei , l. plantarum , l. rhamnosus , and l. salivarius . the international guidelines for the evaluation of probiotics confirm that these four organisms exhibit both high antimicrobial activity and high tolerance to environmental stress . some oral bacteria possess the potential for antagonism towards periodontopathogens , which highlights the therapeutic potential of stimulation of oral health using beneficial effector strains . most evidence indicates that probiotics in the gut do not populate the gastrointestinal microbiota permanently , and they disappear from feces soon after cessation of probiotic ingestion . probiotic bacteria used in the human oral cavity include bifidobacterium and lactobacillus species , and most of them were not derived from the oral cavity . l. reuteri and l. salivarius colonized the oral cavity of patients ; however , the study was of only 2 weeks duration [ 5759 ] . another study reported that oral administration of l. salivarius decreased the proportion of l. salivarius in saliva during the 4- and 8-week intervention periods , although the sampling and analysis methods differed . organisms antagonistic to periodontopathogens that are derived from typical representatives of the oral microbiota and have probiotic potential may overcome the weaknesses associated with exogenous probiotic bacteria ."
] | the red complex , which includes porphyromonas gingivalis , treponema denticola , and tannerella forsythia ( formerly bacteroides forsythus ) , are recognized as the most important pathogens in adult periodontal disease . these bacteria are usually found together in periodontal pockets , suggesting that they may cause destruction of the periodontal tissue in a cooperative manner . this article discusses the interspecies pathogenic interactions within the red complex . |
[
"glaucoma is a leading cause of blindness worldwide.1 despite the growing understanding of its pathophysiology and advances in its treatment , challenges remain regarding how to predict and stop its progression . the treatment plan for glaucoma depends on its progression rate . in practice , most ophthalmologists determine the glaucoma progression rate based on the results of examinations of the patient s visual field ( vf ) . it is difficult to predict the rate of glaucoma progression.2 many studies on the progression of glaucoma have been reported . candidate factors associated with glaucoma progression include increased baseline intraocular pressure ( iop ) , increased mean iop , increased peak iop , and greater iop fluctuation.38 de moraes et al reported that the peak iop is a better predictor of vf deterioration compared to the mean iop.9 the study is supported by an investigation of an animal model of glaucoma which demonstrated a more predictive role of the maximum iop in structural change , compared to the mean iop.10 it is difficult to identify the peak iop because it might occur while the patient is asleep . if the peak iop is to be determined using goldmann applanation tonometry ( gat ) , the iop must be measured many times . the iop is known to fluctuate , and iop fluctuation might be a better predictor of the progression of glaucoma than the mean iop.6,8,11 the existing studies on iop fluctuation can be divided into short - term ( throughout the day ) and long - term ( several years ) studies . the relationship between short - term and long - term iop fluctuations has not been clear . since an assessment of short - term iop fluctuation requires that the iop be measured at night , it burdens both the patient and his or her examiner(s ) . short - term ( 24-hour ) iop fluctuation can be measured using a contact lens sensor ( cls ) . the cls was developed to continuously monitor habitual iop fluctuations over a 24-hour period by measuring changes in the eye s circumference in the area of the corneoscleral junction.12,13 once a cls is placed on an eye , the iop fluctuation can be measured automatically without interference with the subject s sleep . the measurement obtained with a cls has been shown to be accurate and reproducible.14 in the present study , we investigated the relationship between short - term and long - term iop fluctuations .",
"this was a retrospective study . fifty adult glaucoma patients ( 25 men , 25 women ) all 50 patients underwent a comprehensive ophthalmic examination , including test of refraction and visual acuity , goldmann gonioscopy , gat , a fundus examination , and automated perimetry ( humphrey field analyzer ; carl zeiss meditec ag , jena , germany ) . the study and the research protocol were approved by the institutional review board of the university of toyama ( approval no 23 - 100 ) , and the procedures used conformed to the tenets of the declaration of helsinki . after the nature and possible consequences of the study were explained to the subjects , written informed consent was obtained from each subject . the diagnosis of glaucoma was made if both of the following criteria were satisfied : 1 ) the presence of glaucomatous optic disk neuropathy ( a cup / disk ratio of 0.7 or the presence of notching ) accompanied by corresponding vf defects , and 2 ) a threshold sita 30 - 2 examination showing a glaucoma hemifield test result outside normal limits , and a cluster of three contiguous points on the pattern deviation plot depressed at the p<0.05 level ( occurring in age - matched normal subjects ) not crossing the horizontal meridian which are compatible with glaucoma . the inclusion criteria for the subjects were as follows : 1 ) the subject had best - corrected visual acuity 0.2 . 2 ) the subject had spherical equivalent < + 6 or > 6 d. in this study , we included patients who had undergone a previous cataract surgery at least 2 years prior to the enrollment in the study . eyes with myopia over 6 d or hyperopia over + 6 d before cataract surgery were excluded . we defined the start of the follow - up period when the patients were diagnosed with glaucoma . for the patients who had underwent a cataract surgery during the follow - up period , we excluded the iop data obtained before cataract surgery , and used the iop data obtained after the cataract surgery . we included patients who met the requirement of > 2-year follow - up period after the cataract surgery . for the patients who had underwent selective laser trabeculoplasty , we used the iop data in the same way . we also included the cases in whom the glaucoma medications were changed or added during the follow - up period . the exclusion criteria were 1 ) history of glaucoma operation , 2 ) history of ocular trauma , 3 ) retinal diseases , and 4 ) ocular inflammatory diseases . physicians who had been trained in cls measurement conducted the placement and removal of cls in each subject in a hospital setting . one eye of each subject was monitored . if both eyes had glaucoma , we measured the eye with the worse vf which also met the inclusion criteria . the 24-hour iop was monitored with a triggerfish cls ( sensimed , lausanne , switzerland ) . the cls consists of a highly oxygen - permeable soft contact lens , the key elements of which are two sensing - resistive strain gauges that are capable of recording circumferential changes in the area of the corneoscleral junction . this device is based on a novel approach to iop monitoring in which changes in corneal curvature and circumference are assumed to correspond to changes in the iop . the unit of measurement used for the monitoring of iop fluctuation with the cls is not mmhg but mveq , which is unique to the cls . the median iop values were obtained every 5 minutes , providing 288 points over the 24-hour period . the range of iop fluctuations , which was defined as the difference between the maximum value ( mveq ) and the minimum value measured during the 24-hour course , was calculated from the iop fluctuation data . patients who were taking glaucoma medication continued to take the medication during the measurement period . we defined the number of glaucoma drops as the number of drops prescribed when the subject s iop was measured by cls . the long - term iop fluctuation was defined by four parameters : 1 ) the mean of the eligible iop ( mmhg ) determined during the follow - up ; 2 ) the iop difference ( mmhg ) , which we defined as the difference between the maximum iop and the minimum iop ; 3 ) the standard deviation of iop ( sd - iop , mmhg ) which was calculated from all eligible iop values ; and 4 ) the peak iop ( mmhg ) , which was defined as the maximum iop . all statistical analyses were performed using the jmp 10 software program ( sas institute inc . , we used the spearman rank correlation coefficient for determining the correlation of the long - term iop fluctuation index and short - term iop fluctuation .",
"this was a retrospective study . fifty adult glaucoma patients ( 25 men , 25 women ) all 50 patients underwent a comprehensive ophthalmic examination , including test of refraction and visual acuity , goldmann gonioscopy , gat , a fundus examination , and automated perimetry ( humphrey field analyzer ; carl zeiss meditec ag , jena , germany ) . the study and the research protocol were approved by the institutional review board of the university of toyama ( approval no 23 - 100 ) , and the procedures used conformed to the tenets of the declaration of helsinki . after the nature and possible consequences of the study were explained to the subjects , written informed consent was obtained from each subject .",
"the diagnosis of glaucoma was made if both of the following criteria were satisfied : 1 ) the presence of glaucomatous optic disk neuropathy ( a cup / disk ratio of 0.7 or the presence of notching ) accompanied by corresponding vf defects , and 2 ) a threshold sita 30 - 2 examination showing a glaucoma hemifield test result outside normal limits , and a cluster of three contiguous points on the pattern deviation plot depressed at the p<0.05 level ( occurring in age - matched normal subjects ) not crossing the horizontal meridian which are compatible with glaucoma . the inclusion criteria for the subjects were as follows : 1 ) the subject had best - corrected visual acuity 0.2 . 2 ) the subject had spherical equivalent < + 6 or > 6 d. in this study , we included patients who had undergone a previous cataract surgery at least 2 years prior to the enrollment in the study . eyes with myopia over 6 d or hyperopia over + 6 d before cataract surgery were excluded . we defined the start of the follow - up period when the patients were diagnosed with glaucoma . for the patients who had underwent a cataract surgery during the follow - up period , we excluded the iop data obtained before cataract surgery , and used the iop data obtained after the cataract surgery . we included patients who met the requirement of > 2-year follow - up period after the cataract surgery . for the patients who had underwent selective laser trabeculoplasty , we used the iop data in the same way . we also included the cases in whom the glaucoma medications were changed or added during the follow - up period . the exclusion criteria were 1 ) history of glaucoma operation , 2 ) history of ocular trauma , 3 ) retinal diseases , and 4 ) ocular inflammatory diseases .",
"physicians who had been trained in cls measurement conducted the placement and removal of cls in each subject in a hospital setting . one eye of each subject was monitored . if both eyes had glaucoma , we measured the eye with the worse vf which also met the inclusion criteria . the 24-hour iop was monitored with a triggerfish cls ( sensimed , lausanne , switzerland ) . the cls consists of a highly oxygen - permeable soft contact lens , the key elements of which are two sensing - resistive strain gauges that are capable of recording circumferential changes in the area of the corneoscleral junction . this device is based on a novel approach to iop monitoring in which changes in corneal curvature and circumference are assumed to correspond to changes in the iop . the unit of measurement used for the monitoring of iop fluctuation with the cls is not mmhg but mveq , which is unique to the cls . the median iop values were obtained every 5 minutes , providing 288 points over the 24-hour period . the range of iop fluctuations , which was defined as the difference between the maximum value ( mveq ) and the minimum value measured during the 24-hour course , was calculated from the iop fluctuation data . patients who were taking glaucoma medication continued to take the medication during the measurement period . we defined the number of glaucoma drops as the number of drops prescribed when the subject s iop was measured by cls .",
"the long - term iop fluctuation was defined by four parameters : 1 ) the mean of the eligible iop ( mmhg ) determined during the follow - up ; 2 ) the iop difference ( mmhg ) , which we defined as the difference between the maximum iop and the minimum iop ; 3 ) the standard deviation of iop ( sd - iop , mmhg ) which was calculated from all eligible iop values ; and 4 ) the peak iop ( mmhg ) , which was defined as the maximum iop .",
"all statistical analyses were performed using the jmp 10 software program ( sas institute inc . , cary , nc , usa ) . we used the spearman rank correlation coefficient for determining the correlation of the long - term iop fluctuation index and short - term iop fluctuation .",
"we classified the subtypes of glaucoma as primary open - angle glaucoma ( 30 eyes including 15 normal - tension glaucoma eyes ) , primary angle - closure glaucoma ( one eye ) , and pseudo - exfoliation glaucoma ( 19 eyes ) . we defined normal - tension glaucoma as untreated iop that had never been > 21 mmhg among the primary open - angle glaucoma eyes . we were able to successfully measure the 24-hour iop with the cls in all of the subjects . some subjects had minor complications : conjunctivitis , slight hyperemia , or peripheral corneal edema . these healed within a few days without any additional eye drops . as shown in figure 1 and table 2 , the short - term iop fluctuation was significantly correlated with the mean iop ( p=0.001 ) , the iop difference ( p=0.0207 ) , the sd - iop ( p=0.0061 ) , and the peak iop ( p=0.0017 ) . the short - term and the long - term iop fluctuations were moderately but significantly correlated .",
"we classified the subtypes of glaucoma as primary open - angle glaucoma ( 30 eyes including 15 normal - tension glaucoma eyes ) , primary angle - closure glaucoma ( one eye ) , and pseudo - exfoliation glaucoma ( 19 eyes ) . we defined normal - tension glaucoma as untreated iop that had never been > 21 mmhg among the primary open - angle glaucoma eyes .",
"we were able to successfully measure the 24-hour iop with the cls in all of the subjects . some subjects had minor complications : conjunctivitis , slight hyperemia , or peripheral corneal edema .",
"as shown in figure 1 and table 2 , the short - term iop fluctuation was significantly correlated with the mean iop ( p=0.001 ) , the iop difference ( p=0.0207 ) , the sd - iop ( p=0.0061 ) , and the peak iop ( p=0.0017 ) . the short - term and the long - term iop fluctuations were moderately but significantly correlated .",
"the prior studies on iop fluctuation were a mix of short - term and long - term studies . it has been difficult to determine the significance of these studies due to lack of standardization regarding the time between assessments , the methods of measurement , and the definition of iop fluctuation itself . to the best of our knowledge , this study is the first to analyze the relationship between long - term and short - term iop fluctuations with a cls . the mean iop as well as peak iop , the iop difference , and sd - iop of long - term iop fluctuation was correlated with the short - term iop fluctuation measured with a cls . thus , the short - term and the long - term iop fluctuations were significantly correlated . the long - term iop fluctuation was shown as a significant risk factor by multiple logistic regression analysis.8,15 another study showed that peak iop was a better predictor of progression than mean iop or iop fluctuation.9 some studies reported that the short - term and the long - term iop fluctuations were correlated in stable glaucoma patients.1519 these results are in agreement with our present findings . tan et al reported that short - term iop fluctuation correlated with thickness of retinal nerve fiber layer.17 agnifili et al compared iop fluctuations between healthy subjects and glaucoma patients . they reported that glaucoma patients showed larger iop fluctuation than normal subjects.18 the larger iop fluctuation in both long and short term could predict the rate of deterioration of vf . the only available treatment for glaucoma at present is lowering the iop , but it does not adequately suppress the progression of glaucoma.8,9 since a new treatment modality to reduce the iop fluctuation is required , it may be necessary to use a cls to measure iop fluctuations . measuring the iop fluctuation with a cls could thus become a standard method of measuring short - term iop fluctuation . this method has several merits : iop fluctuation can be measured every 5 minutes rather than every few hours . no restriction is imposed on the subject s posture during the measurement . even though the obtained values are objective ( mveq ) , short - term iop fluctuations measured with a cls might help to predict long - term iop fluctuations .",
"it was reported that glaucoma medication could make the circadian iop fluctuation smaller.20 holl et al reported that a cls could not measure the effect of topical medication or body position.21 adherence of a cls to the cornea might alter the effects of topical medications . second , short - term iop fluctuation was assessed with a cls on different days , although some studies reported a good reproducibility of the results of short - term iop fluctuation with a cls.2225 third , the value in mveq measured with a cls can not be converted to mmhg . mottet et al reported that the iop measurement using a cls is an accurate and reproducible method to characterize the iop rhythm but does not allow estimating the iop value in mmhg corresponding to the relative variation of the electrical signal measured.14 to address these problems , further studies are necessary .",
"in conclusion , long - term and short - term iop fluctuations were significantly correlated . measuring iop fluctuation with a cls could be useful to predict long - term iop fluctuation ."
] | purposewe investigated correlations between short - term and long - term intraocular pressure ( iop ) fluctuations.methodswe examined 50 eyes of glaucoma patients who were followed for > 2 years . we measured short - term iop fluctuation using a triggerfish contact lens sensor ( cls ) . the short - term iop fluctuation ( mveq ) was defined as the difference between the maximum value and the minimum value measured during the 24-hour course with cls . the long - term iop fluctuation was defined by four parameters : 1 ) the mean iop ( mmhg ) determined during follow - up ; 2 ) the iop difference , which was defined as the difference between the maximum iop and the minimum iop ; 3 ) the standard deviation of iop ; and 4 ) the peak iop , which was defined as the maximum iop . correlations between these parameters and the short - term iop fluctuation were examined.resultsthe mean follow - up period was 5.4 years . the average iop was 15.04.0 mmhg . the range of short - term iop fluctuation identified with cls was significantly correlated with all the four long - term iop fluctuation parameters.conclusionshort-term iop fluctuations were found to be associated with long - term iop fluctuations . examination of 24-hour iop fluctuations with the cls might be useful for predicting the long - term iop fluctuation . |
[
"to reproduce highly esthetic tooth - colored fixed dental prostheses , computer aided design / computer aided manufacturing ( cad / cam ) techniques are becoming frequently used . since the commercial introduction of polymeric blanks into the dental market , cad / paul , mn , usa ) are innovative new cad / cam materials that make it possible to achieve superior esthetic results in easy steps . the milled rnc restorations can be individualized intra- or extra - orally , either before or after insertion . in recent years , researchers have tried to achieve a more effective and longer - lasting adhesion between restorative materials and the dental substrate . the adhesive techniques are based on research on the hybrid layer and on chemical and mechanical adhesion . some researchers have attempted to shorten the application time and reduce the number of steps , creating new generations of materials and improving their quality . increasing demand for esthetic restorations has led to greater use of all ceramic materials because of their improved biocompatibility and optical properties , compared with metal - ceramic restorations . advances in cad and cam systems are providing new options for dentistry , creating an alternative to the conventional impression and casting technique for producing dental restorations . a requirement for the successful function of a cad / cam restoration is adequate adhesion between ceramic and tooth substance ; however , the literature is unclear on which cement , ceramic , conditioning treatment , and dentine bonding agent produce the highest bond strength . resin composite cements are used to lute conventional metal crowns , fixed partial dentures , ceramic crowns , and veneers and to repair fractured metal ceramic restorations . resin cements have been selected for their advantageous mechanical and adhesive properties compared with conventional luting agents . the use of resin luting agents also appears to be essential in determining an effective stress distribution , which will prevent crack initiation . bond strength to ceramic material is influenced by the composition of the ceramic substrate as well as by mechanical and chemical interaction between substrate and bonding agent . the aim of this study was to evaluate the influence of three different luting protocols ( total - etch , self - etch , and self - adhesive ) on shear bond strength of cad / cam rnc material , based on cad / cam technology , to dentin .",
"in the present in vitro study , 30 disks ( 5 mm in diameter , 3 mm thick ) were designed with cerec software 4.2 platform ( sirona dental gmbh , salzburg , austria ) and obtained by milling from rnc blocks for cad / cam ( lava ultimate restorative , 3 m espe , st . paul , mn , usa ) with cerec mc xl ( sirona dental gmbh , salzburg , austria ) [ figure 1 ] . the disks were obtained by milling from resin nano ceramic blocks for computer aided design / computer aided manufacturing with cerec mc xl . characteristics of materials tested the disks were subsequently cemented to the exposed dentin of 30 bovine permanent mandibular incisors freshly extracted and stored in a 0.1% ( wt / vol ) thymol solution , which were used as a substitute for human teeth . the criteria for tooth selection included intact buccal enamel with no cracks caused by extraction , the absence of caries , and adequate dimension of the crown . the teeth were cleansed of soft tissue remnants and debris with periodontal curettes , stored in the thymol solution for 1 week , and later in saline solution at room temperature until testing . then the roots of the teeth were embedded in self - curing , fast - setting acrylic resin ( rapid repair , degu dent gmbh , hanau , germany ) . specially fabricated cylindrical teflon mold with an internal diameter of 14 mm were filled with the acrylic resin and allowed to cure , thus encasing each specimen while allowing the buccal surface of dentin to be exposed . each tooth was oriented so that its labial surface was parallel to the shearing force . the buccal enamel was removed using a high - speed carbide rotary instrument ( no . h21 l.314.014 ; komet , lemgo , germany ) under copious water irrigation , to expose midcoronal dentin . the exposed dentin surfaces were finished off with an automated polishing machine ( apl-4 ; arotec s.a . ind com , cotia , sp , brazil ) with a 600-grit silicon carbide abrasive paper disks for 5 s , to obtain a flat and uniform dentin surface and reduce any micromechanical interlocking that could affect the real bonding influence of the tested adhesive cements . before cementation , to remove the smear layer and to treat the dental surface with cleaning solution , the dentin surface was rinsed for 1 min with a cotton pellet impregnated with tubulicid blue ( dental therapeutics ab , saltsj - boo , sweden ) without fluorine . the surface was then rinsed and dried before cementation ; the labial surface of each incisor was cleaned for 10 s with a mixture of water and fluoride - free pumice and rubber polishing cup in a low - speed handpiece . the dentinal surface was rinsed with water to remove pumice or debris and then dried with an oil - free air stream . the bonding surface of each disk was cleaned with alcohol and rinsed with water to remove oil debris contained in the milling liquid . the specimens were randomly assigned to 3 groups of 10 teeth each [ figure 1 ] according to different luting procedures ( total - etch , self - etch , and self - adhesive ) . group 1 : ult - te : disks were cemented on the dentin surface , which had been acid - etched with scotchbond universal etchant phosphoric acid ( 3 m espe , st . paul , mn , usa ) for 15 s , the etched substrates were rinsed with water for 15 s , and gently air dried for 15 s to remove excess water and treated with scotchbond universal adhesive ( 3 m espe , st . paul , mn , usa ) with adhesive resin cement ( relyx ultimate/3 m espe , st . paul , mn , usa)group 2 : ult - se : disks were cemented on the dentin surface , which had been treated with scotchbond universal adhesive , with the adhesive resin cement ( relyx ultimate)group 3 : u2-sa : disks were cemented on the dentin surface with the dual polymerization resin luting agent relyx unicem 2 automix . \n group 1 : ult - te : disks were cemented on the dentin surface , which had been acid - etched with scotchbond universal etchant phosphoric acid ( 3 m espe , st . paul , mn , usa ) for 15 s , the etched substrates were rinsed with water for 15 s , and gently air dried for 15 s to remove excess water and treated with scotchbond universal adhesive ( 3 m espe , st . paul , mn , usa ) with adhesive resin cement ( relyx ultimate/3 m espe , st . paul , mn , usa ) group 2 : ult - se : disks were cemented on the dentin surface , which had been treated with scotchbond universal adhesive , with the adhesive resin cement ( relyx ultimate ) group 3 : u2-sa : disks were cemented on the dentin surface with the dual polymerization resin luting agent relyx unicem 2 automix . a vinyl ring with an internal diameter of 4.5 mm was applied under the dentin surface to standardize the adhesion area . for all groups , no further procedures were applied in order to avoid bias and confounding factors . during cementation , a thin layer of cement was applied and distributed to the bonding surface of the cylinders by means of a heidemann spatula . on each specimen , five surfaces were identified : mesial , lingual , distal , buccal , and occlusal . as suggested by the manufacturer , every surface was light - polymerized for 20 s at a light intensity of 1000 mw / cm using a light - emitting diode ( led ) curing light in soft start - polymerization mode ( celalux 2 high - power led curing light , voco gmbh , cuxhaven , germany ) . the power output ( light intensity ) of the led was measured with a cure rite radiometer ( caulk - dentsply mod . all samples were stored in distilled water at room temperature for 24 h. after storing , the specimens were all submitted to a shear bond strength test to check the strength of adhesion between the two substrates , dentin , and rnc . this test is defined as a test in which two materials are connected by an adhesive agent and loaded in shear until separation occurs . specimens were placed in a universal testing machine ( model 3343 , instron corporation , norwood , ma , usa ) . teeth were secured in the lower jaw of the machine so that the bonded cylinder base was parallel to the shear force direction . specimens were stressed in an occlusogingival direction at a crosshead speed of 1 mm / min [ figure 2 ] . the maximum load necessary to debond was recorded in newton ( n ) and calculated in mpa as a ratio of newton to the surface area of the cylinder ( the calculated shear bond strength was determined by dividing the strength at which bond failure occurred by the bonding area ) . specimens were placed in a universal testing machine , secured in the lower jaw of the machine so that the bonded cylinder base was parallel to the shear force direction . after the testing procedure , the fractured surfaces were examined with an optical microscope ( stereomicroscope sr , zeiss , oberkochen , germany ) . statistical analysis was performed with stata 12.0 software ( stata , college station , texas , usa ) . descriptive statistics , including the mean , standard deviation , median , and minimum and maximum values were calculated for all groups . analysis of variance ( anova ) was applied to determine whether significant differences in debond strength values existed among the groups .",
"in the present in vitro study , 30 disks ( 5 mm in diameter , 3 mm thick ) were designed with cerec software 4.2 platform ( sirona dental gmbh , salzburg , austria ) and obtained by milling from rnc blocks for cad / cam ( lava ultimate restorative , 3 m espe , st . paul , mn , usa ) with cerec mc xl ( sirona dental gmbh , salzburg , austria ) [ figure 1 ] . the disks were obtained by milling from resin nano ceramic blocks for computer aided design / computer aided manufacturing with cerec mc xl . characteristics of materials tested the disks were subsequently cemented to the exposed dentin of 30 bovine permanent mandibular incisors freshly extracted and stored in a 0.1% ( wt / vol ) thymol solution , which were used as a substitute for human teeth . the criteria for tooth selection included intact buccal enamel with no cracks caused by extraction , the absence of caries , and adequate dimension of the crown . the teeth were cleansed of soft tissue remnants and debris with periodontal curettes , stored in the thymol solution for 1 week , and later in saline solution at room temperature until testing . then the roots of the teeth were embedded in self - curing , fast - setting acrylic resin ( rapid repair , degu dent gmbh , hanau , germany ) . specially fabricated cylindrical teflon mold with an internal diameter of 14 mm were filled with the acrylic resin and allowed to cure , thus encasing each specimen while allowing the buccal surface of dentin to be exposed . each tooth was oriented so that its labial surface was parallel to the shearing force . the buccal enamel was removed using a high - speed carbide rotary instrument ( no . h21 l.314.014 ; komet , lemgo , germany ) under copious water irrigation , to expose midcoronal dentin . the exposed dentin surfaces were finished off with an automated polishing machine ( apl-4 ; arotec s.a . ind com , cotia , sp , brazil ) with a 600-grit silicon carbide abrasive paper disks for 5 s , to obtain a flat and uniform dentin surface and reduce any micromechanical interlocking that could affect the real bonding influence of the tested adhesive cements . before cementation , to remove the smear layer and to treat the dental surface with cleaning solution , the dentin surface was rinsed for 1 min with a cotton pellet impregnated with tubulicid blue ( dental therapeutics ab , saltsj - boo , sweden ) without fluorine . the surface was then rinsed and dried before cementation ; the labial surface of each incisor was cleaned for 10 s with a mixture of water and fluoride - free pumice and rubber polishing cup in a low - speed handpiece . the dentinal surface was rinsed with water to remove pumice or debris and then dried with an oil - free air stream . the bonding surface of each disk was cleaned with alcohol and rinsed with water to remove oil debris contained in the milling liquid .",
"the specimens were randomly assigned to 3 groups of 10 teeth each [ figure 1 ] according to different luting procedures ( total - etch , self - etch , and self - adhesive ) . group 1 : ult - te : disks were cemented on the dentin surface , which had been acid - etched with scotchbond universal etchant phosphoric acid ( 3 m espe , st . paul , mn , usa ) for 15 s , the etched substrates were rinsed with water for 15 s , and gently air dried for 15 s to remove excess water and treated with scotchbond universal adhesive ( 3 m espe , st . paul , mn , usa ) with adhesive resin cement ( relyx ultimate/3 m espe , st . paul , mn , usa)group 2 : ult - se : disks were cemented on the dentin surface , which had been treated with scotchbond universal adhesive , with the adhesive resin cement ( relyx ultimate)group 3 : u2-sa : disks were cemented on the dentin surface with the dual polymerization resin luting agent relyx unicem 2 automix . \n group 1 : ult - te : disks were cemented on the dentin surface , which had been acid - etched with scotchbond universal etchant phosphoric acid ( 3 m espe , st . paul , mn , usa ) for 15 s , the etched substrates were rinsed with water for 15 s , and gently air dried for 15 s to remove excess water and treated with scotchbond universal adhesive ( 3 m espe , st . paul , mn , usa ) with adhesive resin cement ( relyx ultimate/3 m espe , st . paul , mn , usa ) group 2 : ult - se : disks were cemented on the dentin surface , which had been treated with scotchbond universal adhesive , with the adhesive resin cement ( relyx ultimate ) group 3 : u2-sa : disks were cemented on the dentin surface with the dual polymerization resin luting agent relyx unicem 2 automix . a vinyl ring with an internal diameter of 4.5 mm was applied under the dentin surface to standardize the adhesion area . for all groups , no further procedures were applied in order to avoid bias and confounding factors . during cementation , a thin layer of cement was applied and distributed to the bonding surface of the cylinders by means of a heidemann spatula . on each specimen , five surfaces were identified : mesial , lingual , distal , buccal , and occlusal . as suggested by the manufacturer , every surface was light - polymerized for 20 s at a light intensity of 1000 mw / cm using a light - emitting diode ( led ) curing light in soft start - polymerization mode ( celalux 2 high - power led curing light , voco gmbh , cuxhaven , germany ) . the power output ( light intensity ) of the led was measured with a cure rite radiometer ( caulk - dentsply mod .",
"after storing , the specimens were all submitted to a shear bond strength test to check the strength of adhesion between the two substrates , dentin , and rnc . this test is defined as a test in which two materials are connected by an adhesive agent and loaded in shear until separation occurs . specimens were placed in a universal testing machine ( model 3343 , instron corporation , norwood , ma , usa ) . teeth were secured in the lower jaw of the machine so that the bonded cylinder base was parallel to the shear force direction . specimens were stressed in an occlusogingival direction at a crosshead speed of 1 mm / min [ figure 2 ] . the maximum load necessary to debond was recorded in newton ( n ) and calculated in mpa as a ratio of newton to the surface area of the cylinder ( the calculated shear bond strength was determined by dividing the strength at which bond failure occurred by the bonding area ) . specimens were placed in a universal testing machine , secured in the lower jaw of the machine so that the bonded cylinder base was parallel to the shear force direction . after the testing procedure , the fractured surfaces were examined with an optical microscope ( stereomicroscope sr , zeiss , oberkochen , germany ) .",
"statistical analysis was performed with stata 12.0 software ( stata , college station , texas , usa ) . descriptive statistics , including the mean , standard deviation , median , and minimum and maximum values were calculated for all groups . analysis of variance ( anova ) was applied to determine whether significant differences in debond strength values existed among the groups .",
"anova showed the presence of significant differences among the various groups ( p < 0.0001 ) . as showed in figure 3 , post - hoc tukey testing showed that the highest shear strength values ( p < 0.001 ) were reported in group 2 ( ult - se ) . the lowest data ( p < 0.001 ) were recorded in group 3 ( u2-sa ) . descriptive statistics ( mpa ) of the different groups shear bond strength values ( mpa ) obtained in the three groups .",
"patients needs and desires and developments in adhesive dentistry have made the use of all - ceramic restorations increasingly frequent , particularly silica - based ones such as crowns , inlay - onlays , and laminate veneers . in order to improve the impression and casting procedure steps and to produce indirect restorations faster and easier , without the need for provisional restorations and dental laboratories , cad / paul , mn , usa ) is a new composite / nanoceramic material for cad / cam manufacturing . this material allows the possibility to use composite materials to characterize and adjust the restoration after milling . unlike conventional ceramic restorations , customization and glaze firing industrially , prefabricated cad / cam restorations are polymerized by standardized methods and improving material properties , in particular , predictability and consistency . comparing these machinable prostheses to laboratory - handmade restorations , it has been advocated that , due to a highly homogeneous quality crystalline content , the bond strength to hard tooth tissues and the clinical longevity of these cad / cam restorations have been increased . in contrast , conventional manual polymerization and processing is greatly influenced by the operator and can cause a high level of variations . however , to achieve a long duration of restoration and , therefore , its long - term success , durable bond strength between the tooth and the restorative material is fundamental . to date , no study has evaluated the shear bond strength between the new nanoceramic lava ultimate material and tooth structures . the aim of this study was to investigate the influence of different luting protocols ( total - etch , self - etch , and self - adhesive ) on the shear bond strength values between dentin and this innovative rnc material , based on cad / cam technology . although it is preferable to use extracted human teeth for bonding research , it has become increasingly difficult to obtain such samples for laboratory studies in italy . to compare data from the current study with that reported in previous bovine enamel bond strength tests , bovine teeth have some advantages , as they are easy to obtain in large quantities , are in good condition and have less composition variables than human enamel . bovine teeth also have large , flat surfaces and are unlikely to have undergone prior caries challenges that could affect the test result . the mineral distribution within the carious lesions in bovine teeth is reportedly similar to that found in human teeth , and the structural changes that occur in human and bovine teeth are also similar . for the cementation procedure , three different luting protocols have been evaluated in this study : total etch / etch and rinse protocol ( group 1 - ult - te : sco35% phosphoric acid + scotchbond universal adhesive + relyx ultimate conventional resin cement ) ; self - etch protocol ( group 2 - ult - se : scotchbond universal adhesive + relyx ultimate conventional resin cement ) , and self - adhesive protocol ( group 3 - u2-sa : relyx unicem 2 automix self - adhesive resin cement ) . these three different cementation techniques have been selected according to contemporary adhesive systems classification into etch - and - rinse and self - etch adhesives . while the etch - and - rinse approach requires a separate acid - etch step to promote dentin and enamel demineralization before monomer infiltration , demineralization and infiltration occur simultaneously in the self - etch approach , although with no perfect synchronism . in addition , the separate etch - and - rinse step completely removes the smear layer , while the combined etch and bonding step in self - etch adhesive systems only partially dissolve the smear layer . complete removal of the smear layer may allow for more intimate contact of the hydrophilic primer and hydrophobic bonding agent to the tooth . many articles related to adhesive procedures used for the cementation of ceramic to tooth structure have shown that the presence of a hybrid layer between adhesive resin and dentin seems to adequately seal the dentinal tubules and allows a cellular reorganization of the pulpal tissues . in the present study , all the tested cements are based on adhesive procedures , which determine the formation of the hybrid layer and lead to the creation of a stronger link between dental structure and composite cement . in general two different types of resin composite cements exist : the conventional and the self - adhesive resin composite cements . to bond cad / cam restoration to dentin , relyx ultimate conventional resin cement was used together with a etch and rinse adhesive or with a self - etch adhesive ; while relyx unicem 2 automix self - adhesive resin cement was used alone . a pretreatment of tooth abutment is necessary in case of use of conventional resin composite cements . for this reason , since they do not necessitate any pretreatment of tooth substrate , self - adhesive resin composite cements have been developed . self - adhesive resin composite cements contain acid monomers , resulting in an initial lower ph value for the infiltration into the demineralized collagen network , in our study significant differences were found between conventional and self - adhesive resin cements . the lowest shear bond strength values were recorded in group 3 ; i.e. , lava ultimate rnc disks bonded to dentin with self - adhesive cements . this is in accordance with a study by stawarczyk et al . , which reported lower tensile bond strength with self - adhesive resin composite cements to polymeric crowns , compared to the bonding with conventional resin cements . while some products have equal bond strength of self - adhesive resin cement to dentin , other products show an inferior bond to enamel . the success of the restoration depends not only on the bond between tooth and resin cement but also on the bond between restoration and resin composite cement . according to some authors to achieve a resistant bond , further conditioning of the restoration material is needed . when comparing the shear bond strength values of conventional resin cements used together with an etch and rinse adhesive or with a self - etch adhesive , significantly higher bond strength values were recorded in group 2 ( self - etch protocol ) . accurate and meticulous procedures during the cementation phase may play an essential clinical role in achieving a valuable connection between the dentin and the ceramic restoration . retention form of the preparation , marginal integrity , and clinical micro - leakage are the key parameters used to judge the effectiveness of a resin composite cement system . further studies should be conducted to test the correlation of bond strength for both tested materials to 48 h , 1 week , 1 month , and 1 year to evaluate the time factor related to the effective quality of bonding between ceramic material and dentin . additional research should also be conducted to test the correlation between porosity , poor wetting , high viscosity , and failures .",
"within the limitations of this in vitro study , conventional resin cements ( coupled with etch and rinse or self - etch adhesives ) showed better shear strength values compared to self - adhesive resin cements . then , for the tested polymeric cad / cam materials , the use of additional adhesives for conditioning is necessary . furthermore , conventional resin cements used together with a self - etch adhesive reported the highest values of adhesion . however , future researches are needed to evaluate the bond strength to new ceramic / polymer prosthetic materials . the authors of this manuscript declare that they have no conflicts of interest , real or perceived , financial or non - financial in this article",
"",
"the authors of this manuscript declare that they have no conflicts of interest , real or perceived , financial or non - financial in this article"
] | background : the purpose of this study was to evaluate the influence of three different luting protocols on shear bond strength of computer aided design / computer aided manufacturing ( cad / cam ) resin nanoceramic ( rnc ) material to dentin.materials and methods : in this in vitro study , 30 disks were milled from rnc blocks ( lava ultimate/3 m espe ) with cad / cam technology . the disks were subsequently cemented to the exposed dentin of 30 recently extracted bovine permanent mandibular incisors . the specimens were randomly assigned into 3 groups of 10 teeth each . in group 1 , disks were cemented using a total - etch protocol ( scotchbond universal etchant phosphoric acid + scotchbond universal adhesive + relyx ultimate conventional resin cement ) ; in group 2 , disks were cemented using a self - etch protocol ( scotchbond universal adhesive + relyx ultimate conventional resin cement ) ; in group 3 , disks were cemented using a self - adhesive protocol ( relyx unicem 2 automix self - adhesive resin cement ) . all cemented specimens were placed in a universal testing machine ( instron universal testing machine 3343 ) and submitted to a shear bond strength test to check the strength of adhesion between the two substrates , dentin , and rnc disks . specimens were stressed at a crosshead speed of 1 mm / min . data were analyzed with analysis of variance and post - hoc tukey 's test at a level of significance of 0.05.results:post-hoc tukey testing showed that the highest shear strength values ( p < 0.001 ) were reported in group 2 . the lowest data ( p < 0.001 ) were recorded in group 3.conclusion:within the limitations of this in vitro study , conventional resin cements ( coupled with etch and rinse or self - etch adhesives ) showed better shear strength values compared to self - adhesive resin cements . furthermore , conventional resin cements used together with a self - etch adhesive reported the highest values of adhesion . |
[
"uterine cancer is the most common diagnosed gynecologic cancer among women in the united states , with 43,470 estimated new cases and approximately 7,950 estimated deaths in 2010 . although uterine cancer is found mainly in the older patient population , up to 14% of uterine cancers are found in women younger than 45 years of age . most studies have demonstrated that younger women have a lower risk of death from uterine cancer than older women independent of stage at diagnosis [ 4 , 5 ] . surgical management of uterine cancer entails a staging procedure which includes a total hysterectomy , salpingooophorectomy , and possible lymph node dissection depending on the spread of the disease and histological type . a high index of suspicion must be maintained if the diagnosis of uterine cancer is to be made in the young patient . young women with or without risk factors may present with abnormalities in their menstrual periods , which can be initially treated with hormonal therapy , thereby delaying the diagnosis of cancer . some risk factors for uterine malignancy include prolonged exposure to unopposed estrogen either endogenous , ( e.g. , early menarche , late menopause , nulliparity , polycystic ovarian syndrome , obesity ) , or exogenous ( e.g. , estrogen therapy or hormone replacement without progesterone ) . uterine cancer in young women is often associated with early - stage disease , well - differentiated tumors , and a good prognosis [ 68 ] . the actual care delivered to women diagnosed with uterine cancer appears to depend upon a number of variables including surgeon training , hospital volume , extent of disease , patient characteristics , and physician access . these women are mostly managed by gynecologic oncologists as well as by nongynecologic oncologists ( general gynecologists and general surgeons ) . gynecologic oncologists are specifically trained to perform the required staging and cytoreductive surgical procedures for uterine cancer . however , patterns of care studies have shown that gynecologic oncologists provided care in 48.8% of the patients and gynecologists in 50.2% of the cases . roland et al . have shown that the gynecologic oncologist completed the surgical staging two times more frequently than the general gynecologist ( 94.0% versus 45.2% , p they concluded that women with uterine cancer managed by gynecologic oncologists are more likely to receive comprehensive surgical staging resulting in an efficient use of health care resources and minimizing the potential morbidity associated with adjuvant radiation therapy . numerous studies have evaluated the association of surgeon case volume with clinical outcomes for various procedures and have shown that higher surgeon volume is associated with improved outcomes [ 1013 ] . while specialty training is critically important to quality cancer care , recent attention has also focused on the positive relationship between surgeon and hospital case volume and clinical outcomes for malignancies treated with technically complex surgical procedures . recently , there has been an interest in elucidating patterns of care for patients treated with uterine cancer . most studies evaluating age - based outcomes for uterine cancer have been single institution analysis containing only a small portion of patients . more specifically , prior studies have not evaluated whether care provided by high - volume surgeons at high - volume centers leads to differences in resource allocation and short - term survival among younger patients . therefore , the goals of this study were to evaluate volume - based care for women with uterine cancer aged 50 years and younger using a statewide population database .",
"approval to conduct this study was obtained from the johns hopkins medical institutions clinical research committee and joint committee on clinical investigation , and the requirements for informed patient consent were waived . the study design was a cross - sectional analysis of hospital discharge data from the nonfederal acute care hospitals in maryland collected by the maryland health services cost review committee ( hscrc ) . the hscrc database provides information regarding the index hospital admissions and is limited to 30 days of followup . the main study objective was to characterize volume - based care among women 50 years when compared to women > 50 years . a subgroup analysis among women 50 years with regards to surgeon and hospital uterine cancer volume was performed to evaluate the risk of in - hospital related death and associations with the length of hospital stay , hospital - related costs , and icu length of stay . all adult female patients , 18 years of age and older , who underwent a surgical procedure including a hysterectomy for a malignant uterine neoplasm in maryland between january 1 , 1994 until december 31 , 2005 were included in the study . the international classification of disease , 9th revision ( icd-9 ) code 182.0 ( malignant uterine neoplasm ) was used for sorting . the surgical procedures included in the analysis were limited to those incorporating hysterectomy as this was felt to be the most likely to capture those patients undergoing initial surgery for uterine cancer . patient age was modeled as a categorical variable ( patients 50 years of age and younger compared to patients over 50 years of age ) . this age cutoff was designated based on the average age of menopause as 51.4 years [ 15 , 16 ] . frequency distribution for variables like ethnicity , insurance payer status , hospital volume , surgeon volume , hospital type , inpatient death , and concordance between attending and operating physician was tabulated among the two groups . information regarding international federation of gynecology and obstetrics ( figo ) or american joint committee on cancer ( ajcc ) stage of disease , tumor grade , histological subtype , extent of disease , or residual disease was not available from the hscrc database . in addition , the hscrc database only provides clinical information for the index hospital admission , so that data on clinical outcomes beyond this time period could not be assessed . based on previous research in volume - based care in uterine cancer , surgeons performing 100 cases of uterine cancer per study period were categorized as high volume , and those performing < 100 cases of uterine cancer per study period as low volume . surgeons were included in the analysis if they performed at least one uterine cancer surgery during the entire study period . based on previous research in volume - based care in uterine cancer , hospitals with 200 cases of uterine cancer per study period were categorized as high volume , while those with < 200 cases of uterine cancer per study period were categorized as low volume . similarly , hospitals were included in the analysis if at least one uterine cancer surgery was performed during the entire study period . a community teaching hospital was defined as a nonuniversity hospital with a residency program in obstetrics and gynecology . hospital - related charges for each index admission were converted to the organizational cost of providing care using cost to charge ratios for individual hospitals . cost to charge ratios were calculated from data from the health services cost review commission by dividing the average inpatient expense by the average inpatient revenue of each hospital during each year of the study interval . this ratio was then multiplied by each patients ' charge to obtain the cost per admission . t - test for simple linear regression was employed to evaluate adjusted cost of hospital - related care , intensive care unit length of stay , and admission length of stay among the two age groups . t - test for simple linear regression was done for the subset group of women aged 50 years and younger to evaluate the variables of adjusted cost of hospital - related care , admission length of stay , and intensive care unit length of stay among hospital 's and surgeon 's volume . all statistical computations were performed using the sas system , and all reported p values are two sided .",
"a total of 6,181 women who met the criteria for a primary surgical procedure for a malignant uterine neoplasm were identified in the state of maryland during the period of 19942005 . women aged 50 years and younger comprised 13.6% ( n = 844 ) of the cases . most of the women aged 50 years and younger were white ( 78.0% ) , had insurance coverage through an hmo ( 40.3% ) , and were treated in a community - based hospital ( 67.4% ) ( table 1 ) . young women were more likely than older women to have concordance between the operating physician and the attending physician ( p = 0.03 ) ( table 1 ) . in other words , young women were more likely to have an operating surgeon that was the same clinician of record . younger women were more likely to have shorter length of hospitalization stay ( p < 0.0001 ) and lower adjusted cost of hospital - related care ( p = 0.0002 ) . there were no significant differences between the lengths of intensive care stay between groups ( table 2 ) . four of the reported deaths occur among the group of women 50 years of age and younger . in total , 894 different surgeons provided primary uterine cancer surgical care , although not all surgeons provided continuous care for the entire duration of the study period . only 9 ( 1.0% ) of the surgeons were categorized as high - volume surgeons . women aged 50 years and younger were less likely to be managed by high - volume surgeons when compared to women older than 50 years ( 31.6% versus 35.1% , resp . , p = 0.02 ) . in the subgroup of women aged 50 years and younger , those that were managed by high - volume surgeons were more likely to have longer hospitalization stays ( p = 0.003 ) and higher adjusted cost of hospital - related care ( p < 0.0001 ) ( table 3 ) . no difference was observed in terms of icu length of stay between high- and low - volume surgeons . no deaths were reported among high - volume surgeons during the immediate 30-day period . due to the lack of events on one of the groups , a statistical comparison of death rates between high- and low - volume surgeons could not be performed . a total of 49 hospitals provided care for uterine cancer patients during the study period . only 8 ( 16.3% ) hospitals meet the criteria of high - volume hospitals . no difference was observed among groups in terms of access to high - volume centers ( 52.0% versus 54.0% , p = 0.22 ) . in the subgroup of women 50 years of age and younger , those admitted to a high - volume hospital were more likely to have higher adjusted cost of hospital - related care ( p = 0.01 ) ( table 4 ) . no deaths were reported among high - volume hospitals during the immediate 30-day period . due to the lack of events on one of the groups , a statistical comparison of death rates between high- and low - volume surgeons could not be performed .",
"several studies have demonstrated that age is an independent predictor of overall survival [ 4 , 5 ] . our analysis of the hscrc database from 19942005 confirms that younger women have lower short - term mortality than older women diagnosed with uterine cancer . the fact that younger women have better outcomes can be explained by a number of hypotheses . it may be that younger individuals have a better health profile , with less morbidity and concurrent medical problems . younger body / tissues may respond to a surgical insult with less postoperative complications and accelerated healing . also , uterine cancer in young women is often associated with early - stage disease , well - differentiated tumors , and a good prognosis [ 68 ] . even though the lack of events did not allow performing a statistical analysis , no in - hospital related deaths were reported among the young group of women treated by high - volume surgeons or at high - volume centers . in addition to reduced mortality , lengths of hospital stay and hospital costs for younger women with uterine cancer were lower . the reduced rate of medical comorbidities at baseline in younger women likely contributed to this difference as preoperative comorbidities are an independent predictor of length of postoperative hospitalization and therefore cost . younger women were more likely to be managed at university - based hospitals and more likely to have an operating surgeon that was the same attending physician of record decreasing the opportunity for miscommunication and repetition of testing that could occur when multiple providers are involved in patient care . rogers and curtis had shown that continuity of care leads to decreased hospital admissions , decreased length of stay , reduced duplication of diagnostic testing , increased patient satisfaction , and improved compliance . the high level of concordance in the younger women may account for the improved outcomes such as the decreased cost and shorter length of stay . the analysis suggests that younger women were less likely to be managed by high - volume surgeons . for women a perceived lower risk of cancer risk or mortality , limited financial resources , unwillingness to travel long distances for care , and the absence of medical comorbidities may lead fewer younger women to seek out the expertise of a high - volume specialist on their own . several studies have shown the benefit of women that have been cared for by a gynecologic oncologist [ 9 , 24 , 25 ] . although the overall peri - operative outcomes were similar , the subspecialists were more likely to perform comprehensive surgical staging , if necessary , and the patient was less likely to receive adjuvant radiotherapy . the overall survival favored those patients managed by the general gynecologist , with no difference in disease - free interval . this may reflect the patient population that is usually managed by the general gynecologist , as compared to the gynecologic oncologist . similar to the differences in costs of care between younger and older women , younger women treated at low - volume settings had lower costs of care and shorter hospital stays . the reduced rate of medical comorbidities of women treated at these settings is likely to contribute to these cost differences for the same reasons as mentioned previously . the hscrc database can not be queried to clarify whether high - volume surgeons are located exclusively at high - volume hospitals ; therefore it is unclear whether higher costs are impacted by more frequent care by gynecologic oncologists . low - volume hospital costs may also be reduced due to the different resources of these facilities . surgeons may be less inclined to perform aggressive procedures if these low - volume facilities do not have adequate support ( i.e. , access to consultants or high - acuity icu care ) and thus refer complex patients to high - volume centers . improved efficiency at low - volume hospitals can not be excluded as an alternative cause for lower costs . the strength of this study lays in the relatively large number of patients included form institutions across the state of maryland . unfortunately , the maryland hscrc database is limited in ways typical of large population - based studies as it does not provide followup beyond 30 days from the index admission and contains no information on either ajcc or figo stage of disease , tumor grade , or histological subtype . given these restrictions , a meaningful analysis of long - term surgical outcome was not practical from the available data . also , the hscrc does not provide information in terms of performance status , asa scores , and comorbidities . these factors may have had an impact on the overall morbidity and mortality between the two populations studied . furthermore , additional information regarding the baseline medical condition of the populations was not examined , and this could be a confounding factor on the results . a second limitation is that there is a possibility that the grouping by case volume could be too selective and there could be subgroups in the lower - volume level that still are able to achieve excellent outcomes . due to the lack of previous reports of case volume among uterine cancer , a third limitation of the current study is that our selected volume criteria have not been widely validated as outcomes measures . despite these limitations , the current study provides the most extensive evaluation on volume - based care among young women that underwent surgery for uterine cancer . the information obtained in this study increases our current knowledge of volume - based care of young women diagnosed with uterine cancer and may be useful in developing strategic planning in order to improve the care offered to this population ."
] |
purpose . to characterize volume - based care of uterine cancer among women aged 50 years . methods . the maryland health service cost review commission database was accessed for uterine cancer surgical cases from 1994 to 2005 . cross - tabulations and logistic regression models were used to evaluate for significant associations among volume - based care and other variables comparing women 50 years with those aged > 50 years . results . women 50 years comprised 13.6% of the cases . women 50 years were less likely to be managed by high - volume surgeons ( 31.6% versus 35.1% , p = 0.02 ) . for women 50 years , there was a trend toward management at low - volume hospitals ( 52.0% versus 54.0% , p = 0.22 ) . no deaths were reported among the group of women 50 years treated by high - volume providers or at high - volume centers . women 50 years managed by high - volume surgeons had longer length of stay ( p < 0.001 ) and higher adjusted cost of hospital - related care ( p < 0.00 ) . women 50 years managed at high - volume centers had higher adjusted cost of hospital - related care ( p = 0.01 ) . conclusion . primary surgical care of young women with uterine cancer is often performed by low - volume providers . |
[
"in iden 2012 , many diverse experiences associated with basic procedures to advanced techniques of endoscopic retrograde cholangiopancreatography ( ercp ) were highlighted in great enthusiastic lectures by world renowned experts . interesting cases entitled \" interesting cases in pancreatobiliary endoscopy \" were introduced in video forum . in this highlight summary of interesting presentations , i will present a summarized review about basic procedures of ercp like balloon dilation for common bile duct ( cbd ) stones , advanced techniques like endoscopic necrosectomy for necrotizing pancreatitis , recently proposed management for the prevention of post - ercp pancreatitis , and spyglass direct visualization system through which we can directly observe the cbd and pancreatic duct .",
"eplbd is easy to use and effective for the removal of common bile duct ( cbd ) stones , but still debates exist on safety issue . since eplbd requires only a small endoscopic sphincterotomy ( est ) or none at other occasions , eplbd is generally believed to avoid the complications of a full est . lee and han1 conducted a large retrospective multicenter study , in which a total of 946 consecutive patients with large cbd stones were enrolled in this study . serious adverse events occurred in 95 patients ( 10% ) , after which the following guidelines of eplbd in order to pursuit zero mortality were suggested ; 1 ) eplbd should be avoided in patients with distal cbd strictures ; 2 ) full est should be avoided immediately before eplbd ; 3 ) the balloon should be inflated gradually ; 4 ) inflation should be discontinued in cases of persistent balloon waist ( 75% rule ) ; 5 ) not to be inflated beyond the maximum diameter of the dilated cbd ; and 6 ) convert to an alternative stone removal or drainage method any time there is difficulty in removing the stone . because it was multicenter study analyzing the safety of eplbd based on large numbers of cases , experienced experts will agree with the above referred recommendations , though it was studied retrospectively .",
"kahaleh and freeman2 recently made recommendations to minimize risks of ercp in international digestive endoscopy network ( iden ) 2012 as follows ; adequate selection of patients undergoing ercp , skilled operators using novel techniques for prompt identification , which is key to successful prevention and management . pancreatitis is the most common complication associated with ercp procedure with average rate of about 5% . risk factors for the occurrence of post - ercp pancreatitis include younger age , indication of suspected sphincter of oddi dysfunction , history of previous post - ercp pancreatitis , absence of elevated serum bilirubin levels , and female sex are usually at increased risk . techniquerelated issues have long been recognized to be important in causing post - ercp pancreatitis . he also mentioned about specific techniques to reduce risk of post - ercp pancreatitis , such as pancreatic stents , more promising pharmacological agents including non - steroidal anti - inflammatory drug , and enema for prevention of post - ercp pancreatitis .",
"new possibility that eus - guided endoscopic pancreaticobiliary drainage can replace the percutaneous techniques and obviate surgery was shown in iden 2012 . kahaleh3 referred that endoscopic debridement and stent insertion can reduce high morbidity and mortality of surgery in severe necrotizing pancreatitis . endoscopic necrosectomy using repeats session of debridement and plastic stents insertion has been more frequently used within the last decade and half . fully covered self - expandable metal stents might provide a safer and more efficient drainage through a larger diameter stent . additionally he described techniques of transmural drainage and endoscopic debridement , how to make the transenteric access into the pancreatic necrosis , how to make active endoscopic irrigation with a gastroscope and debridement of cystic contents using biopsy forceps , and roth nets and polypectomy snares in detail . this technique is evolving continuously as we attempt to optimize the post - procedural outcomes .",
"there were attractive video lectures during iden 2012 dealing with advanced techniques for pancreaticobiliary visualization including direct peroral cholangioscopy , spyglass direct visualization system , forward - viewing echoendoscopy , and contrast - enhanced eus and elastography accompanied with actual interesting cases for each . kahaleh4 mentioned that the single operator cholangioscopy ( soc ) system ( spyglass ; direct visualization system , natick , ma , usa ) may offer an interesting compromise in terms of size ( 10 fr diameter ) and complexity of use . soc is challenged by the size of the biopsy obtained and the stiffness of the forceps ( spybite ; boston scientific , natick , ma , usa ) fitting within the working channel of the system . sensitivity of forceps biopsy through the cholangioscope was far higher for intrinsic ( 66% ) than extrinsic ( 8% ) malignant lesions . conclusively , spyglass ( direct visualization system ) has not only been used as a platform for advanced intraductal imaging with probe based endomicroscopy and spyglass - guided stone fragmentation ; but also for photodynamic therapy to treat bile duct cancer . soc can be a great step to realize intraductal visualization as well as therapy , but the best is yet to come .",
"pancreatobiliary endoscopy is continuously evolving area with new techniques and we attempt to optimize the postprocedural outcomes ."
] | the pancreatobiliary organ is composed of one of the most complicated structures and complex physiological functions among other digestive organs in our body . this is why endoscopic procedure in pancreaticobiliary system requires rather complicated techniques . in international digestive endoscopy network ( iden ) 2012 , many interesting pancreatobiliay endoscopy related topics were presented . basic procedures like endoscopic papillary balloon dilation ( epbd ) , advanced techniques like endoscopic necrosectomy , prevention and management of post - ercp pancreatitis , and spyglass system are reviewed in this highlight summary . |
[
"parvovirus b19 is a small , uncoated dna virus belonging to the family parvoviridae ( 1 ) . parvovirus b19 associates with a wide range of clinical symptoms and their pattern is under effect of age and immune status of the host ( 4 ) . most of b19 infections are asymptomatic or only associate with mild non - specific illness . this virus can also be transmitted through blood transfusion and blood products ( 5 ) . b19 infects humans widely and is almost endemic in all parts of the world ( 2 ) . parvovirus b19 can also be transmitted through vertical transformation ( from mother to fetus ) ( 6 ) . its prevalence in pregnancy is about 15% , but in epidemic situation it receives to 10% ( 78 ) . its incidence in pregnancy is about 15% and it can cause complications in 3% of infected pregnant women ( 9 , 10 ) . the virus is transmitted through vertical transmission to the fetus and creates some complications to fetus including anemia , spontaneous abortion , hydrops fetalis , intrauterine fetal death and congenital anomalies ( 11 ) . parvovirus infection of mothers is diagnosed using serologic or an immune assay enzyme b19 igm and b19 igg ( 12 ) . b19 igg positive serologic evidence of previous infection with the virus that leads to lifelong immunity . in this study , we tried to determine prevalence of serum parvovirus infection in pregnant women and its association with some of the parameters such as number of lived children , number of family members , number of commensalts and amount of hemoglobin . the risk of adverse fetal outcome increases if maternal infection occurs during the first two trimesters of pregnancy but may also happen during the third trimester . it is significant cause of fetal loss throughout pregnancy , but has a higher impact in the second half of pregnancy when spontaneous fetal loss from other causes is relatively rare ( 13 ) . for example , the risk of infection in pregnant women with one child are 3 times more than nulliparous women , but this risk for women with three or more children are 7.5 times more . the other risk factors are working in the school , care centers and other full stress jobs ( 1416 ) . igg antibody levels elevated with the increase of age ( 17 , 18 ) at the age of 15 , about 50% of persons have detectable igg levels and its amount in older people , has increased to more than 90% ( 2 ) . the importance of b19 investigation in pregnant women is due to vertical transmission of this virus . the complications related to this virus are anemia , hydrops fetalis , fetal death , and unintended abortion ( 11 ) . intrauterine growth retardation , myocarditis , pleural effusion , pericardial effusion and brain involvement of the fetus may occur following infection with the virus . although , parvovirus b19 is not related to congenital malformations ( 19 , 20 ) , in case of pregnant women infection , the prevalence of transmision to the fetus is 30% ( 21 ) . acute parvovirus b19 ( b19v ) infection is a proven risk for pregnant women and their fetus ( 22 ) . regarding to complications related to b19 virus infection during pregnancy and lack of study about its infection prevalence in ardabil county , this study was conducted with the aim of determination of the prevalence of parvovirus and igg in pregnant women in ardabil .",
"the numbers of samples were calculated 350 , based on statistical formula for sample size . these numbers were divided into 39 prenatal care centers , according to population covered by each center . 5 ml of blood was taken from participant in care centers and was referred to the reference laboratory , immediately . the serum of blood samples were isolated and were stored at 20 c , until analysis . the questionnaire consisted of two parts : part i including mother s age , location , number of family members ( father , mother , sister , brother ) , number of children , number of commensalts , and in part ii information about blood test of pregnant women , were recorded . for measurement of igg antibodies in serum samples against b19 virus , the elisa kit euroimmune , ( germany ) was used as follows : 100 l of serum 1/201 diluted patients and 100 l of each of the standards were added to micro plate wells in which the viral antigen was coated . the samples were incubated for 1 h at room temperature , then the wells were washed and 100 l goat , anti - human , anti - igg antibody binded to the peroxide was added to each sample and they kept at room temperature for one more hour . then , after washing the wells , 100 l of substrate ( 3 , 3 , 5 , 5 tetra - methyl benzidine ) was added to each well and allowed to create color within 30 minutes at room temperature . subsequently , 100 l of fixing solution ( sulfuric acid ) was added to each well and a maximum light absorption of the double wavelengths of 450/630 nm were read using a plate reader . the chi - square and t - test and descriptive methods were used for data analysis . the significant levels of 0.05 were used for all statistical analysis . in order to consider the principles of medical ethics ,",
"in this study , of 350 pregnant women , 64.6% ( 226/350 ) were ardabil citizen and the rest were from rural area ( 124/350 ) . the youngest participant was 15 years old and the oldest was 34 years ( average of 23 3.92 years ) . overall , 242 ( 69.1% ) had positive serology b19 igg and 124 ( 30.9% ) were seronegative . distributions of seroprevalence of parovirus b19 among pregnant women in residence location are shown in table 1 . of 108 people that living in rural areas , 85 ( 68.5% ) were seropositive and 39 ( 31.5% ) were negative . there was no significant relationship between residence location and prevalence of serum parvovirus b19 ( p=0.475 ) . distribution of serology parvovirus b19 prevalence among pregnant women based on residence location the average age of participants with positive serology was 24.774.26 years , and the mean age of those with negative serology was 22.983.58 years . result showed there was a significant correlation between age and the prevalence of parvovirus ( r=0.268 ) and the immunity against the virus was higher in older pregnant women ( table 2 ) . distribution of serology parvovirus b19 prevalence among pregnant women according to age group the average number commensalts seropositive pregnant women was 3 1.74 and those with negative serology 2.83 1.16 that showed no significant relationship between the number of commensalts and prevalence of parvovirus ( p=0.377 ) . the average family members of participants with positive serology was 6.86 2.4 and those with negative serology was 6.61 2.23 , which showed no significant relation between family size and prevalence of parvovirus ( p=0.369 ) ( table 3 ) . relationship between the number of people breaking bread together , family size and the number of children living with an outbreak of parvovirus b19 the average number of lived children in participants those with positive serology was 0.57 0.655 and average number of lived children in those with negative serology was 0.51 0.634 which presented the relationship between family size and sero prevalence of parvovirus was insignificant ( p= 0.417 ) . the average amount of hemoglobin in participants with positive serology was 12.51.12 ( p=0.177 ) and the average amount of hemoglobin in those with negative serology was 12.261.06 ( p=0.169 ) which showed no significant relationship between hemoglobin and serum parvovirus .",
"results of this study showed that the prevalence of b19 in pregnant women in ardabil was 69.1% . ( 2005 ) in shiraz showed that parvovirus infection providence was 69.01% ( 17 ) . in a cross - sectional study , sohrabi et al . ( 2007 ) reported that 55.7% of pregnant women referred to ahvaz imam khomeini hospital were b19 positive ( had specific igg of b19 ) . according to their findings , more than 40% of pregnant women had not igg b19 and were at the risk of the virus infection and its fetus complications ( 23 ) . in a study conducted in nigeria by emiasegen et al . ( 2011 ) parvovirus infection prevalence among pregnant women attending to prenatal care clinics and its relation to occupation , number of children and transfusion history were studied . they reported that 273 pregnant women were studied and 27.5% of them had igg antibody for b19 and the relationship between the numbers of living children , occupation and achieved transfusion history were significant ( 24 ) . in another study , elnifro ( 2009 ) found that its prevalence in libya was 69% ( 25 ) . the other hand , khameneh ( 2014 ) reported that in orumiyeh prevalence of parvovirus was 75.6% ( 26 ) , that was further from the results of our study . for example , sohrabi in a study in ahvaz showed that its incidence was 55.7% ( 19 ) ; abiodun ( 2013 ) reported 20% in nigeria ( 27 ) , and cohen ( 1995 ) declared 53% of pregnant women are immune to the virus ( 28 ) . the difference between rural and urban areas in the prevalence of b19 virus was not significant . of 226 people lived in urban area , 157 patients ( 69.5% ) were positive while 68.5% of people ( 85 of 108 ) lived in rural areas were positive in serology . the significance of difference among mean age between positive serology and negative serology indicates that relationship between age and the prevalence of parvovirus . therefore , its incidence was higher in older women . in the ziyaeyan ( 2005 ) and sohrabi ( 2007 ) studies , there was no significant correlation between age and the prevalence of parvovirus , that is contrast to our results ( 17,23 ) . in this study , the relations between seropositive incidences with number of children , number of family members , number of commensalts , and hemoglobin content were not significant . ( 2001 ) ( 29 ) . in a study from nigeria , emiasegen et al . ( 2011 ) showed that the number of children was related to the outbreak of parvovirus ( 24 ) that is not consistent with the results of our study . comparison between the average number of sero - positive children and seronegatives revealed that the number of children did nt related to the prevalence of parvovirus that is in accordance with the shahraki et al . the relation between the number of children and outbreak of parvovirus was significant ( 24 ) that is not consistent with our results .",
"the results of this study showed a high susceptibility of pregnant women to parvovirus b19 in ardabil region and immunity to the virus increases with age . in our study , a significant correlation was not found between the prevalence of parvovirus and the number of living children , number of family member , number of commensalts and hemoglobin content . considering that a high percentage of infected pregnant women with parvovirus b19 in the ardebil region , health education and screening for the virus , especially in pregnant women with anemia is recommended to prevent fetal complications ."
] | background and objectives : trans - placental transmission of parvovirus b19 during pregnancy can causes adverse outcomes . regarding its importance in prenatal care , we decided to study prevalence of parvovirus b19 infection among pregnant woman in ardabil , iran.materials and methods : in a community based study with a cluster sampling , 350 pregnant women that attended in health care centers in ardabil were selected . serum samples were collected and anti - b19 specific igg was detected using commercial enzyme - linked immunosorbent assays ( euroimmune elisa kit , germany ) . furthermore , a questionnaire filled for all participants during samples collection.results:64.6% ( 226/350 ) of participants were ardabil citizen and the rest were from rural area ( 124/350 ) . anti - b19-specific igg antibody was detected in 69.1% of pregnant women ( 242/350 ) . participants ages ranged from 15 to 34 years with average of 23 years . according to our study , seroprevalence of igg antibodies had positive significant correlation with the participants age ( r=0.268 ) but there were no significant relations between b19 seropositivity and living area , family member , number of commensals , number of living children , and the amount of hemoglobin ( p>0.05).conclusion : approximately , one - third of the participants were at risk of primary b19 infection . therefore , health education of pregnant women and screening of infected pregnant women is recommended to prevent fetal complications . |
[
"there is both growing recognition and scientific evidence that interventions of physical activity and exercise programs ( paeps ) have a favorable impact on patients with psychiatric disorders.17 these findings have been reported among groups of patients with major depressive disorders ( mdds),6,8,9 schizophrenia,10,11 post - traumatic stress disorder ( ptsd),12,13 alcohol abuse,14,15 sleep disorders,16 or autism spectrum disorders.17 the neurophysiological mechanisms underlying the beneficial effects of pa on psychological functioning and wellbeing are complex , although there is increasing evidence that regular , acute , and chronic pa does have an impact at the molecular level18,19 and on brain plasticity.1,20,21 in parallel , psychological mechanisms are involved ; specifically , regular pa has a favorable influence of self - esteem among patients with psychiatric disorders,22 on body image and physical self - concept,23 and , most importantly , on dimensions of anxiety and depression.6,9,24 however , it is widely reported that patients with psychiatric disorders are less physically active and do exercise less than healthy peers,2527 potentially increasing and maintaining the risk for further physical and mental health problems . among those seeking treatment , psychiatric hospitals provide an excellent environment to initiate physical activity , as they offer supervised free training during a phase in which patients are under few time constraints . in view of the potential of paeps as adjunct treatment reported in the literature to date , our aim in this study was to explore the extent to which these programs are implemented in the inpatient treatment of psychiatric disorders in the german - speaking part of switzerland . an understanding of the implementation of paeps in practice , and the experiences of program staff , is an important factor for the future translation of research findings to clinical practice .",
"during spring 2012 , all psychiatric hospitals of the german - speaking part of switzerland ( n=55 ) were identified via publicly accessible lists on the internet . to be enrolled in the study , the minimum requirement was that psychiatric hospitals treated not only outpatients but also inpatients and that the official language was german ; that is to say , staff and inpatients communicate in german or swiss german . next , nb contacted all identified hospitals by phone calls and asked for a brief talk with the staff member responsible for the paeps . the aim of the phone call and the study were explained , and , if agreed , the url of an online survey was transmitted via email . all participants were informed that participation was voluntary and that all data would be gathered anonymously ; written informed consent was obtained on the first page of the questionnaire . furthermore , they were informed that they could withdraw from the study at any time . to improve participation , participants could take part in a prize draw ( ten vouchers of chf 30.00 [ approximately usd 30.00 ] from a known national supermarket ) , although to do so they needed to provide an email address . ethical approval was not required by the institutional review board of the university of basel because the survey was not addressed to patients or underage people . data collection was done online , as this was judged to be both time saving for participants and a reliable method to gather data.28 we used commercially available software ( unipark ; http://www.unipark.de ) , as this is an easily applied tool for the creation of internet - based studies . furthermore , the software provider guarantees that all data are stored on a server that is not accessible to any third party . importantly , the user of the software receives the raw data of the answers but not participants ip address , ensuring both data security and participants anonymity . moreover , the online survey was designed to avoid repeated participation ( ip addresses already used are automatically blocked ) . participants needed ~1520 minutes to complete the survey . a questionnaire with multiple choice response options was developed expressly for this study , in order to address the specific areas of inquiry . the findings are based on descriptive statistics such as mean , standard deviation , median , or percentage . furthermore , chi - square tests were performed to calculate associations between dimensions as specified in more detail in the text . all statistical analyses were performed with spss 22.0 ( ibm corporation , armonk , ny , usa ) for apple mac .",
"during spring 2012 , all psychiatric hospitals of the german - speaking part of switzerland ( n=55 ) were identified via publicly accessible lists on the internet . to be enrolled in the study , the minimum requirement was that psychiatric hospitals treated not only outpatients but also inpatients and that the official language was german ; that is to say , staff and inpatients communicate in german or swiss german . next , nb contacted all identified hospitals by phone calls and asked for a brief talk with the staff member responsible for the paeps . the aim of the phone call and the study were explained , and , if agreed , the url of an online survey was transmitted via email . all participants were informed that participation was voluntary and that all data would be gathered anonymously ; written informed consent was obtained on the first page of the questionnaire . furthermore , they were informed that they could withdraw from the study at any time . to improve participation , participants could take part in a prize draw ( ten vouchers of chf 30.00 [ approximately usd 30.00 ] from a known national supermarket ) , although to do so they needed to provide an email address . ethical approval was not required by the institutional review board of the university of basel because the survey was not addressed to patients or underage people .",
"data collection was done online , as this was judged to be both time saving for participants and a reliable method to gather data.28 we used commercially available software ( unipark ; http://www.unipark.de ) , as this is an easily applied tool for the creation of internet - based studies . furthermore , the software provider guarantees that all data are stored on a server that is not accessible to any third party . importantly , the user of the software receives the raw data of the answers but not participants ip address , ensuring both data security and participants anonymity . moreover , the online survey was designed to avoid repeated participation ( ip addresses already used are automatically blocked ) .",
"a questionnaire with multiple choice response options was developed expressly for this study , in order to address the specific areas of inquiry .",
"the findings are based on descriptive statistics such as mean , standard deviation , median , or percentage . furthermore , chi - square tests were performed to calculate associations between dimensions as specified in more detail in the text . all statistical analyses were performed with spss 22.0 ( ibm corporation , armonk , ny , usa ) for apple mac .",
"of the 55 psychiatric hospitals in german - speaking switzerland approached , staff members of 48 ( 87.3% ) took part in the survey . in all , 42 respondents ( 87.5% ) were physiotherapists , three ( 6.25% ) had a master s degree in sports science , and three ( 6.25% ) did not answer to this item . of the 48 respondents , 32 ( 66% ) were working in a general psychiatric hospital , eight ( 17% ) were working in a university psychiatric hospital , and eight ( 17% ) were working in psychiatric wards of a somatic hospital . twenty ( 43% ) hospitals had > 200 beds for inpatients , nine ( 19% ) hospitals had 99200 beds , 15 ( 32% ) had between 50 and 99 beds , and three hospitals reported < 50 beds for psychiatric inpatients . seventeen ( 35.5% ) psychiatric hospitals were located in the canton berne , eight ( 17% ) were located in the canton zrich , five ( 10% ) in the canton thurgau , four ( 8% ) each in the cantons st gallen and aargau , three ( 6% ) each in basel city and in aarau ( city and close surroundings ) , two ( 4% ) each in the cantons basel country and grisons , and one ( 2% ) each in the cantons of appenzell - ausserrhoden and zug . regarding the disorders most frequently treated at the hospital , 80% of respondents reported personality disorders and mood disorders , ~78% reported anxiety , stress - related , and somatoform disorders , ~65% reported substance use disorders , 55% reported schizophrenia and nonmood psychotic disorders , 50% reported mental disorders due to existing physiological conditions , and 5%15% reported intellectual disabilities , pervasive and specific developmental disorders , behavioral and emotional disorders , and unspecific mental disorders . a chi - square test revealed that there was no association between most frequently treated disorders and the number of beds of the hospital ( (n=48 , df=27)=0.45 ; p=0.67 ) . as depicted in figure 1 , all psychiatric hospitals ( 100% ) offered relaxation techniques , and 47 ( 97% ) offered sports therapy ( fitness , swimming , ball sports , and endurance training ) , 46 ( 96% ) offered general physical activity , 40 ( 85% ) offered physiotherapy / remedial gymnastics , 28 ( 59% ) offered so called body therapies such as feldenkrais or bioenergetics , 27 ( 57% ) offered far - east techniques ( tai chi and qigong ) , and ten ( 22% ) offered hippotherapy . therefore , the majority of hospitals offered more than one type of paep content . as regards the frequency with which paeps took place , responses ranged from once per week to five times per week . factors that were reported as limiting the frequency of sessions were staff availability , sports hall and/or equipment availability , and the size of the hospital : hospitals with a lower number of beds offered fewer and less frequent paeps ( ( n=48 , df=18 ) = 16.45 ; p<0.05 ) . as regards the group size of participants , a range of one to seven participants was the most frequently reported group size . one - to - one sessions were chiefly offered as personal training or for therapeutic interventions such as physiotherapy or other body therapies . of the 48 participants , 40 ( 83.3% ) answered that < 25% of all inpatients participated in the paeps , and eight ( 16.7% ) estimated that between 25% and 50% of all inpatients participated in the paeps ( figure 2 ) . all paeps were attended on a voluntary basis ( 100% ) , although 40 ( 83.3% ) respondents emphasized that patients were made aware of the programs and encouraged to attend the paeps . furthermore , participants reported that patients seemed generally moderately to rather highly motivated to participate in the paeps . thirty - six ( 75% ) participants reported that the availability and equipment of the current paep infrastructure were sufficient , five ( 10.4% ) reported that the infrastructure was well to very well equipped , whereas seven ( 14% ) reported that the availability and equipment of the infrastructure were not or not at all sufficient . all participants responded that in their view , paeps improved patients physical and psychological status . regarding the hypothesized importance of the programs , answers ranged from a little importance ( n=8 ; 16.6% ) , to moderate importance ( n=38 ; 79% ) ; two ( 4.16% ) answered that the importance of paeps was large ( figure 3 ) . all participants reported that after discharge , their patients no longer had access to the paeps offered as part of inpatient treatment . thirty - five ( 72.9% ) answered that the main goal of a paep was to improve patients psychological state , 45 ( 93.75% ) answered that a further main goal was to improve patients social skills , and 17 ( 35.42% ) answered that a further main goal was to improve patients physical status . none of the participants answered that a paep was aimed at improving patients coping strategies ( note that multiple answers were possible ; figure 4 ) . no associations between the main goals of paeps and the most frequently treated disorders were observed ( ( n=48 ; df=27 ) = 0.45 ; p=0.78 ) . all participants answered that they rely on their own experience and vocational training to plan and organize the paep sessions . furthermore , the majority ( n=40 , 83.3% ) also reported benefiting from the experiences and advice of their peers . no respondent stated that they sought or obtained information from specific internet sites or scientific publications . all participants answered that paeps were an integrated treatment modality of the hospital . in all , 38 ( 79.16% ) reported that they were particularly motivated to lead paeps and 30 ( 62.5% ) reported that the hospital s medical staff recognized the beneficial effects of paeps . nobody answered that paeps were offered because supplementary vocational training was available , because the hospital had the existing infrastructure , or because of scientific evidence supporting the benefits of such programs . all participants reported that the main treatment regimen of the hospital comprised medication ( 100% ) , psychotherapy ( 100% ) , and occupational therapy ( 100% ) . thirty ( 62.5% ) answered that within the main treatment regimen , the potential benefits of paeps was fairly well accepted ; ten ( 20.83% ) answered that it was well accepted , four ( 8.3% ) answered that it was not well accepted , and four ( 8.3% ) did not know . all participants reported that in order to improve the paeps offered by the hospital , staff would require advanced vocational training in sport and exercise sciences and advanced vocational training in adapted physical activity for psychiatric patients .",
"of the 55 psychiatric hospitals in german - speaking switzerland approached , staff members of 48 ( 87.3% ) took part in the survey . in all , 42 respondents ( 87.5% ) were physiotherapists , three ( 6.25% ) had a master s degree in sports science , and three ( 6.25% ) did not answer to this item . of the 48 respondents , 32 ( 66% ) were working in a general psychiatric hospital , eight ( 17% ) were working in a university psychiatric hospital , and eight ( 17% ) were working in psychiatric wards of a somatic hospital . twenty ( 43% ) hospitals had > 200 beds for inpatients , nine ( 19% ) hospitals had 99200 beds , 15 ( 32% ) had between 50 and 99 beds , and three hospitals reported < 50 beds for psychiatric inpatients . seventeen ( 35.5% ) psychiatric hospitals were located in the canton berne , eight ( 17% ) were located in the canton zrich , five ( 10% ) in the canton thurgau , four ( 8% ) each in the cantons st gallen and aargau , three ( 6% ) each in basel city and in aarau ( city and close surroundings ) , two ( 4% ) each in the cantons basel country and grisons , and one ( 2% ) each in the cantons of appenzell - ausserrhoden and zug . regarding the disorders most frequently treated at the hospital , 80% of respondents reported personality disorders and mood disorders , ~78% reported anxiety , stress - related , and somatoform disorders , ~65% reported substance use disorders , 55% reported schizophrenia and nonmood psychotic disorders , 50% reported mental disorders due to existing physiological conditions , and 5%15% reported intellectual disabilities , pervasive and specific developmental disorders , behavioral and emotional disorders , and unspecific mental disorders . a chi - square test revealed that there was no association between most frequently treated disorders and the number of beds of the hospital ( (n=48 , df=27)=0.45 ; p=0.67 ) .",
"as depicted in figure 1 , all psychiatric hospitals ( 100% ) offered relaxation techniques , and 47 ( 97% ) offered sports therapy ( fitness , swimming , ball sports , and endurance training ) , 46 ( 96% ) offered general physical activity , 40 ( 85% ) offered physiotherapy / remedial gymnastics , 28 ( 59% ) offered so called body therapies such as feldenkrais or bioenergetics , 27 ( 57% ) offered far - east techniques ( tai chi and qigong ) , and ten ( 22% ) offered hippotherapy . therefore , the majority of hospitals offered more than one type of paep content . as regards the frequency with which paeps took place , responses ranged from once per week to five times per week . factors that were reported as limiting the frequency of sessions were staff availability , sports hall and/or equipment availability , and the size of the hospital : hospitals with a lower number of beds offered fewer and less frequent paeps ( ( n=48 , df=18 ) = 16.45 ; p<0.05 ) . as regards the group size of participants , a range of one to seven participants was the most frequently reported group size . one - to - one sessions were chiefly offered as personal training or for therapeutic interventions such as physiotherapy or other body therapies . of the 48 participants , 40 ( 83.3% ) answered that < 25% of all inpatients participated in the paeps , and eight ( 16.7% ) estimated that between 25% and 50% of all inpatients participated in the paeps ( figure 2 ) . all paeps were attended on a voluntary basis ( 100% ) , although 40 ( 83.3% ) respondents emphasized that patients were made aware of the programs and encouraged to attend the paeps . furthermore , participants reported that patients seemed generally moderately to rather highly motivated to participate in the paeps . thirty - six ( 75% ) participants reported that the availability and equipment of the current paep infrastructure were sufficient , five ( 10.4% ) reported that the infrastructure was well to very well equipped , whereas seven ( 14% ) reported that the availability and equipment of the infrastructure were not or not at all sufficient .",
"all participants responded that in their view , paeps improved patients physical and psychological status . regarding the hypothesized importance of the programs , answers ranged from a little importance ( n=8 ; 16.6% ) , to moderate importance ( n=38 ; 79% ) ; two ( 4.16% ) answered that the importance of paeps was large ( figure 3 ) . all participants reported that after discharge , their patients no longer had access to the paeps offered as part of inpatient treatment . thirty - five ( 72.9% ) answered that the main goal of a paep was to improve patients psychological state , 45 ( 93.75% ) answered that a further main goal was to improve patients social skills , and 17 ( 35.42% ) answered that a further main goal was to improve patients physical status . none of the participants answered that a paep was aimed at improving patients coping strategies ( note that multiple answers were possible ; figure 4 ) . no associations between the main goals of paeps and the most frequently treated disorders were observed ( ( n=48 ; df=27 ) = 0.45 ; p=0.78 ) .",
"all participants answered that they rely on their own experience and vocational training to plan and organize the paep sessions . furthermore , the majority ( n=40 , 83.3% ) also reported benefiting from the experiences and advice of their peers . no respondent stated that they sought or obtained information from specific internet sites or scientific publications .",
"all participants answered that paeps were an integrated treatment modality of the hospital . in all , 38 ( 79.16% ) reported that they were particularly motivated to lead paeps and 30 ( 62.5% ) reported that the hospital s medical staff recognized the beneficial effects of paeps . nobody answered that paeps were offered because supplementary vocational training was available , because the hospital had the existing infrastructure , or because of scientific evidence supporting the benefits of such programs .",
"all participants reported that the main treatment regimen of the hospital comprised medication ( 100% ) , psychotherapy ( 100% ) , and occupational therapy ( 100% ) . thirty ( 62.5% ) answered that within the main treatment regimen , the potential benefits of paeps was fairly well accepted ; ten ( 20.83% ) answered that it was well accepted , four ( 8.3% ) answered that it was not well accepted , and four ( 8.3% ) did not know .",
"all participants reported that in order to improve the paeps offered by the hospital , staff would require advanced vocational training in sport and exercise sciences and advanced vocational training in adapted physical activity for psychiatric patients .",
"the key findings of the present survey are that all psychiatric hospitals of the german - speaking part of switzerland whose staff participated in this survey offer a broad variety of paeps . furthermore , ~25% of all patients staff involved in these programs also felt that specific extended vocational training would allow them to improve their skills and optimize the existing programs . the present survey is the first to give an overview of the existence and role of paeps in psychiatric hospitals of the german - speaking part of switzerland . specifically , the pattern of results shows that paeps are well established and integrated in the treatment regimen . all respondents reported that they felt that participation in peaps impacted favorably on patients psychological status . while anecdotal , this observation is in line with the increasing wealth of studies showing a favorable influence of paeps on a broad variety of psychiatric disorders,17 such as mdds,6,8,9 schizophrenia,10,11 ptsd,12,13 alcohol abuse,14,15 sleep disorders,16 or autism spectrum disorders.17 next , in our opinion , a major issue is patients participation rate : 83% reported that only up to 25% of patients participated in the offered peaps , and further 16.7% reported that 25%50% of patients did so . or simply put : we estimate that 50%75% of inpatients do not attend the peaps , and we claim that this rate of participation is low . the quality of the data does not allow a deeper understanding of patients underlying decisions , although if we combine the result that participating patients seemed moderately to rather highly motivated to participate in the peaps , the key factor of patients ( non- ) participation may be their motivation . nevertheless , the low participation rates were not surprising . for instance , studies consistently show that people with psychiatric disorders have lower physical activity29,30 and cardiorespiratory fitness levels.31,32 this is critical , because low physical activity and cardiorespiratory fitness are considered important factors which may link psychiatric and comorbid somatic disorders.33 a recent meta - analysis showed that exercise interventions have the capacity to improve cardiorespiratory fitness in people with mdd in clinically meaningful ways.34 taken together , the use of paep in the treatment of psychiatric disorders is supported by strong empirical evidence.3537 for instance , studies show that among patients with clinical depression , exercise seems to have similar effects to antidepressants and psychotherapy.38 thus , integrating exercise as an add - on to standard care during inpatient treatment , as well as efforts to promote lifestyle physical activity to prevent relapses after the end of hospitalization , seem promising . a major challenge , however , is that it is particularly difficult to initiate and maintain regular exercise among patients with psychiatric disorders , because their psychiatric symptoms interfere with their motivation and capacity to self - regulate health - related behaviors.33,39 given this background , we claim that intervention programs specifically tailored to motivate psychiatric patients to achieve a more physically active lifestyle should be key among psychiatric hospitals . in this regard , from intervention studies on motivational processes among patients with somatic complaints , we learned that specific psychoeducational inputs were able to increase patients motivation to exercise also after discharge.40 similarly , future studies might focus on applying such motivational programs in patients with psychiatric disorders . in this vein , all participants reported that after patients discharge , no further options of aftercare were available . in light of the fact that all respondents felt that paeps were beneficial for patients and comprise activities , which can be protective against psychological complaints , the potential to extend paep offers for patients after the inpatient phase could represent a long - term element of health promotion for this population . since many psychological disorders are relapsing conditions , long - term interventions must be explored as potentially protective against recurrence . the knowledge that peaps can be extended following the inpatient phase may also be an important motivator for patients to begin with such programs , as they will not have to face a loss of facilities as soon as their treatment ends . furthermore , several participants reported that an aim of the peaps was to bolster patients social skills . this observation is interesting , as , to the best of our knowledge , research on this particular aspect of functioning is sparse . data from a finnish study suggest that individuals who reported frequent exercise also felt more socially integrated than their less active peers , while participation in exercise has been reported to both foster social integration and be a means of maintaining existing social contacts . specific research into the possible mechanisms for this effect , and with clinical populations , is currently lacking . this issue is of particular importance , as compared to adults without psychiatric disorders , patients with psychiatric disorders have a fourfold risk of suffering from social anxiety and adverse social interactions.4145 future research should focus therefore on the extent to which paeps in psychiatric hospitals might favorably impact on patients social skills . finally , a further result demands particular attention : participants reported wanting and needing extended vocational training , specifically as regards the state - of - the - art of peaps for patients with psychiatric disorders . accordingly , one might claim that institutions such as departments of sports science , in collaboration with psychiatric institutions , might organize specific extended vocational trainings . the strengths of the present results should be balanced against the limitations of the study . first , the present data do not reflect the current application of paeps in psychiatric hospitals in non - german - speaking swiss areas , as we sought to avoid the risk of methodological issues related to the translation of the items into french , italian , and rhaeto - romanic . second , only hospitals and participants willing and able to complete the questionnaire took part on the study , and accordingly , results might also be biased . third , the quality of the data did not allow a deeper understanding of which patients with which psychiatric disorder did participate and not participate in the paeps . such a distinction would have allowed more insight into the possible relations between patients psychiatric characteristics ( their disorders ) , motivation and ( non-)participation in specific peaps . specifically , one might assume , that for instance , the framework of paeps of patients with addiction disorders is different from that of paeps of patients with anxiety and affective disorders . fourth , the online survey did not assess patients perception of how useful or detrimental peaps were . finally , it is questionable to what extent domains such as relaxation techniques , physiotherapy , or far - east ( meditation ) techniques should be considered as peaps , or if they should be considered and discussed apart .",
"the pattern of results of the present online survey suggests that psychiatric hospitals of the german - speaking part of switzerland offer a broad variety of physical activity and exercising programs to their inpatients , although only 25%50% of inpatients take part in programs . staff are unanimous in the view that these programs are physically and psychologically beneficial . after discharge staff responsible for paeps state that specific extended vocational training is required to offer activities suited to patients with psychiatric disorders . finally , given that many psychiatric patients may have motivational and volitional deficits , more systematic efforts seem warranted to increase exercise motivation and promote behavioral skills to maintain a more physically active lifestyle among inpatients in psychiatric care settings ."
] | backgroundphysical activity and exercise programs ( paeps ) are an important factor in increasing and maintaining physical and mental health . this holds particularly true for patients with psychiatric disorders undergoing treatment in a psychiatric hospital . to understand whether the benefits reported in the literature are mirrored in current treatment modalities , the aim of the present study was to assess the current state of paeps in psychiatric hospitals in the german - speaking part of switzerland.methodsall psychiatric hospitals ( n=55 ) in the german - speaking part of switzerland were contacted in spring 2014 . staff responsible for paeps were asked to complete an online questionnaire covering questions related to paeps such as type , frequency , staff training , treatment rationale , importance of paeps within the treatment strategy , and possible avenues to increase paeps.resultsstaff members of 48 different psychiatric hospitals completed the survey . hospitals provided the following therapeutic treatments : relaxation techniques ( 100% ) , sports therapy ( 97% ) , activity - related psychotherapeutic interventions ( 95% ) , physiotherapy ( 85% ) , body therapies ( 59% ) , far - east techniques ( 57% ) , and hippotherapy ( 22% ) . frequencies ranged from once / week to five times / week . approximately 25% of patients participated in the paeps . interventions were offered irrespective of psychiatric disorders . paep providers wanted and needed more vocational training.conclusionall participating psychiatric hospitals offer a broad variety of paeps in their treatment curricula . however , the majority of inpatients do not participate in paeps . furthermore , those who do participate can not continue to do so following discharge . paep providers need specific extended vocational trainings and believe that the potential of pa should be improved . |
[
"as the silver tsunami continues through the us and globally , the number of drivers over the age of 75 will increase significantly . as of 2012 , there were 36 million older americans licensed to drive , which was a 34% increase from 1999 . accidents or unintentional injuries are the 7th leading cause of death in persons 65 and older and are often the result of impairment . in the 64 to 75 age group , injuries from motor vehicle accidents ( mvas ) are the leading cause of injury related death and the second leading cause in the 75 to 84 age group . drivers who are 80 years old and older have 9 times greater fatality rate than drivers aged 25 to 69 . assessment of driving capability in the older adult is becoming an essential aspect of the comprehensive geriatric exam , even though many primary care providers ( pcps ) do not view themselves as experts in this area and may defer driving assessment and capability to the local department of motor vehicles ( dmv ) office . however , a survey conducted by the american association of retired persons ( aarp ) showed that 40% of people surveyed aged 50 and older believed that their pcp could best determine their ability to drive safely [ 5 , p. 92 ] . earlier assessment and intervention lead to prolonged health maintenance and independence , which is an essential aspect that the pcp must consider for the older adult driver . according to the american association of nurse practitioners ( aanp ) ( 2012 ) , 80% of nurse practitioners ( nps ) practice in a primary care setting . currently , there are three np graduates to every one primary care physician graduate in the united states ( us ) , and nps are improving access to care , especially in rural areas where alternative transportation methods may not be available . driver safety is considered a public and personal safety issue and the np has a duty to routinely assess and intervene when appropriate . variations across state laws and regulations regarding drivers make it challenging to have a nationally accepted clinical guideline or standard of care specific to assessment of safe driving . driving regulations , laws , and reporting policies vary according to state and many providers are not fully aware of these laws and policies within the state where they practice . in one state , a healthcare provider can be sued for alerting the dmv of a person 's medical diagnosis , whereas , in another state , the healthcare provider is negligible if they do not report it . these extremes in variability make it confusing and difficult for nps to know what to do and what to follow . report a lack of specific guidelines for primary care providers to use when caring for an older adult driver in the office setting . nps caring for older adults do not have an efficient evidenced - based screening instrument for use during a routine 15-minute office visit . the current guidelines published by the american medical association in collaboration with the national highway traffic safety administration ( nhtsa ) are considered opinion - based according to one author ( [ 5 , 9 ] ) . another source describes the guidelines as comprehensive but lengthy and cumbersome to use during a routine office visit and they are not supported by evidenced - based research . the purpose of this critical incident study was to identify strategies utilized by nps in the assessment and intervention of older adult drivers in southeastern north carolina . the aims of this study were to ( 1 ) determine current practice of np 's assessment of and intervention strategies with older adult drivers in southeastern north carolina ; ( 2 ) assess the nps knowledge deficits in assessing safe driving capability of the older adults ; and ( 3 ) assess nps current knowledge of resources available for older adult drivers and their families . assessment and intervention of safe driving in the older adult healthcare providers have standards of care or published guidelines to assess , treat , and evaluate chronic diseases such as the jnc guidelines for hypertension . a similar guideline for assessment , intervention , and evaluation of driving safety in the older adult would prove beneficial .",
"the aging baby boomer generation started turning 65 in 2011 and , by 2030 , 1 in every 5 persons will be 65 years old or older in the united states . persons 85 years old and older are growing at four times the rate of the us population . american 's average life expectancy has increased at the same time death rates for the 65 to 84 age group have decreased . as our population ages , there is an increased need for specialized geriatric care that includes a comprehensive , holistic approach . personal safety behaviors , including safe driving habits , are part of the shuler nurse practitioner model . this theoretical framework guides the np to focus on prevention of disease and disability through maintenance of maximal function , improvement in healthcare status , rapidly responding to declines , and periodic routine assessments . the schuler model assesses the physiological and the psychological needs and status of the older adult . through this holistic approach , the np assesses various areas of functional capability that affect the older adult 's ability to drive safely . a literature review was performed using these databases : ebsco host , pubmed , nursing @ ovid , proaquest nursing and allied health , science direct , and web of science . keywords used were as follows : older adult , elderly , geriatric , driving , safety , assessment , and nurse practitioner . johnson interviewed 25 nps on their perceptions of their role in assessing driving ability in the older adult driver who lives in an urban region . johnson found nps to be comfortable performing the physical assessment as it relates to driving ability such as vision , hearing , and cognitive status , but they reported being uncomfortable approaching or discussing the topic of driving safety and/or driving termination . johnson also concluded that early assessment , discussions , and intervention of safe driving were preferred by the older adult , rather than a discussion of driving termination . even though this study focused on nps , many other healthcare disciplines such as physicians , social workers , and occupational therapists have a vested interest in driving safety of the older adult .",
"a qualitative research method developed by flanagan , the critical incident technique , was selected as the design for this study . the critical incident technique is a tool used to create a functional description of behavioral activity . according to flanagan , obtaining a description of the activity can be achieved by asking the persons who actually perform the work a series of brief , precise questions aimed at identifying behaviors . flanagan stressed that , in a critical incident study , the sample size is not determined by the number of participants but rather by the number of critical incidents observed or reported and whether the incidents represent adequate coverage of the activity being studied . the primary objective of the critical incident technique is the development of a behavioral classification system or taxonomy to find solutions to practical problems or to determine the prevalence and distribution of critical behaviors . critical incident studies have been widely used by health service researchers to identify and categorize behavioral responses of healthcare providers in significant and decisive situations [ 17 , 18 ] . critical incident interviews aimed at identifying specific behaviors and strategies used by nps when assessing and intervening with older drivers were conducted with a sample of 21 nps recruited through the north carolina nurses association ( ncna ) council of nurse practitioners - coastal region . the open - ended self - administered critical incident survey consisted of the following questions : ( 1 ) think of the last time you cared for an older adult driver in your practice . what assessment strategies or parameters did you use to determine if the driver was safe or not ? ( 2 ) what strategies did you use to approach that driver about the issue of driving safety ? ( 3 ) how did you make the determination to intervene if you felt that the older adult was not safe to drive ? permission was obtained through the institutional review board ( irb ) at an appropriate institution prior to initiating the study . data analysis was performed using statistical package for the social sciences ( spss , version 20.0 ) to assess the demographic characteristics of respondents . the narrative data obtained through the critical incident surveys was analyzed through an inductive classification process developed by flanagan . the critical incidents were initially reviewed by an advanced practice nurse with a specialty in gerontology and an expert in using critical incident methodology to determine which incidents should be included in the analysis . incidents that were judged to be nearly identical or very similar were grouped together to form subcategories of behaviors . the incidents were resorted and discussed by the research team to refine and determine the final set of categories . percentages of agreement between the researchers were calculated for each critical incident analysis . as an estimate of the importance of each category , the number of incidents sorted by the researchers was counted and placed into a hierarchical structure or taxonomy that identified categories and their related frequencies .",
"a total of 21 nurse practitioners in the southeast region of the united states ( us ) participated in this study . the predominantly female sample ( n = 20 , 95% ) had a mean age of 48.3 years ( sd 11.3 years ; range 2968 years ) . the average length of employment as a nurse practitioner was 9.1 years ( sd 8.4 years ) . the majority of the participants earned master 's degree ( n = 18 , 85.7% ) . one held bachelor 's degree with a family nurse practitioner certificate , one had a doctorate of nursing practice ( dnp ) , and one received ph.d . approximately one - half of the participants ( 47.6% ) achieved specialty certifications reflecting widely varied areas of advanced nursing practice including : adult , geriatrics , psychiatric mental health , diabetes , oncology , hospice , and wound , ostomy , and continence nursing . none of the study participants had reported attendance at a continuing education program on dealing with older drivers . ninety - five percent ( n = 20 ) reported that they see older adults ( > 65 years ) who are still driving at least once a week or more often in clinical practice settings . when asked what age they usually start screening for driving ability , 76% ( n = 16 ) indicated that there was no specific age level . two participants ( 10% ) reported initiating driver 's safety screening between the ages of 50 and 65 years , while three ( n = 14% ) began screening at the age of 66 years and above . ninety percent ( n = 19 ) involved family members in discussions about driving safety . six categories of driver behavior prompted nps to consider performing an evaluation for driving safety . examples of the circumstances that trigger an assessment of driving capabilities are presented in table 1 . the participants ' self - rating of competence in assessing older driver 's safety reflected a moderate level of success at 6.6 ( sd 1.3 , 110 scale with 1 very poor and 10 excellent ) . self - ratings of comfort in approaching older adults about their driving safety were higher at 8.0 ( sd 2.3 , 110 scale ) .",
"a total of 89 incidents described strategies that nurse practitioners used in assessing an older driver 's safety . when the incidents were analyzed , 11 major categories emerged with an interrater agreement of 95% . a listing of assessment categories and circumstances that trigger an assessment of driving capabilities is presented in table 1 . the largest category , assessing diminished short - term memory , forgetfulness , or dementia , accounted for 30 incidents ( 34% ) . the use of the mental status exam or the montreal cognitive assessment ( moca ) was mentioned most frequently . nurse practitioners shared the following:i ask them about how many times they are getting lost [ while driving ] . i also ask them how many times do you beep ' your horn at other people , and how many times do other people beep their horns at you ? that 's a big red flag to me . if they ca n't tell me how they drove here from their house , that 's another red flag.i had one patient whose daughter mentioned a concern about driving . i asked her [ the patient ] to draw a clock [ i used the clock drawing test to assess cognition ] and this was really abnormal even though the geriatrician had just done a mental status exam 8 months prior . there was a significant change.i [ conducted a ] mental status exam . the trigger for me was having to repeat the same conversation over and over again to a patient who was asking the same questions over and over again , day to day , and week to week . i ask them about how many times they are getting lost [ while driving ] . i also ask them how many times do you beep ' your horn at other people , and how many times do other people beep their horns at you ? that 's a big red flag to me . if they ca n't tell me how they drove here from their house , that 's another red flag . i asked her [ the patient ] to draw a clock [ i used the clock drawing test to assess cognition ] and this was really abnormal even though the geriatrician had just done a mental status exam 8 months prior . there was a significant change . the trigger for me was having to repeat the same conversation over and over again to a patient who was asking the same questions over and over again , day to day , and week to week . the second largest category , identifying physical frailty , included 21 or 55% of the incidents ( n = 21 ) . specific elements included conducting a fall assessment , assessing [ the patient 's ] ability to turn from side to side , including limited range of motion in the neck , how well they can feel their feet , and assessing whether or not the patient is able to use the dominate foot to control the pedals of the car . participants added the following.i assess their physical ability on walking by watching them walk in ' [ to the office ] and also look at their ability to get up on the exam table and also their balance.i [ look for ] patients who describe a poor balance and i assess vertigo or syncope . i also look for people who are losing visual field related to macular degeneration or other visual changes . most people with this are already limiting their own driving.i observe my patients getting out of and then back into their car . i assess their physical ability on walking by watching them walk in ' [ to the office ] and also look at their ability to get up on the exam table and also their balance . i [ look for ] patients who describe a poor balance and i assess vertigo or syncope . i also look for people who are losing visual field related to macular degeneration or other visual changes . i observe their gait , walking , balance , flexibility , and overall mobility . behavioral incidents in the third largest category , assessing changes in sensory impairment , i ask every patient when they had a last eye exam and will [ evaluate their vision ] with the snellen chart . if a person can not seem to hear me in a normal conversation , i 'll check their ears for impaction and the whisper test . a fourth category , obtaining collateral information from family members , accounted for 11% ( n = 10 ) of the total number of incidents . as one participant stated that a trigger is when an adult child makes a comment such as i wo n't ride with him ' or that they will not allow their grandchildren to ride with the patient . a fifth category , assessing for impulsivity / lack of judgment , accounted for 6% ( n = 5 ) of the total number of incidents , while a sixth category contained incidents that described evaluating medications for drowsiness side - effects ( n = 3 , 3% ) . to a far lesser extent , nurse practitioners described retrieving a self - report of impaired driving or motor vehicle accident ( n = 2 , 2% ) , evaluating symptoms of new onset neurologic disease ( n = 2 , 2% ) , assessing changes in functional status ( n = 2 , 2% ) , assessing history of drugs and/or alcohol abuse ( n = 1 , 1% ) , and evaluating postmyocardial infarction status ( n = 1 , 1% ) . the two most common strategies were using therapeutic communication to initiate a nonthreatening conversation about driving safety and expressing concern for the older adult 's driving safely . a total of 66 critical incidents were reported which described strategies that nurse practitioners use in practice to increase safety in older adults . when the incidents were analyzed , nine categories of behaviors were determined with an interrater agreement of 100% . categories included the following : involving family members , using therapeutic communication , referring patient to occupational / physical therapy , conducting a vision examination , using a step approach to driving termination , using objective data , referring patient to the department of motor vehicles , referring patient to a medical specialist , and limiting medications on the beers list . one study has shown that clinicians and older adult drivers are open to the idea of using a tiered approach to driving assessment in the older adult . the largest category , involving family members , accounted for 24% ( n = 16 ) of the incidents . as one nurse practitioner stated the following.bring the family into it . ultimately , they are the ones to take the keys if the patient is resistant.others added the following . sometimes i will voice safety concerns that have been brought up by the family . if the family is present , i try to talk to them and coach them to do the right thing like take the keys or put the care in another place.i tell families to stop being the caregiver and go back to being a family member and make me the bad guy ' . i do n't want to ride with you ' and that is a pretty strong message.it's important to work with families and ask them , why are you letting the most unable person in the room drive down the street ? ' it usually has to do with the way this family has made decisions in the past as well as cultural issues , and family dynamics . when i brought up the situation to the family , they agreed and the patient stopped driving until his medical situation improved . he 's doing a lot better now.the second largest category involved the use of therapeutic communication strategies ( n = 14 , 21% ) . one participant stated ask the older adult about how they feel about their ability to drive . i show empathy toward him and his loss of independence and having to rely on family for transportation , and i try to be honest about safety concerns.i used therapeutic communication . i told him the concerns such as him not being able to recall the names of the roads that he just drove on to get here.i talked to her conversationally about how she 's been doing and how her family has been doing . i started asking about driving when i asked her about her vision and eye glasses . this made her feel comfortable first so then i asked about this [ the driving ] . bring the family into it . ultimately , they are the ones to take the keys if the patient is resistant . sometimes i will voice safety concerns that have been brought up by the family . if the family is present , i try to talk to them and coach them to do the right thing like take the keys or put the care in another place . i tell families to stop being the caregiver and go back to being a family member and make me the bad guy ' . i do n't want to ride with you ' and that is a pretty strong message . it 's important to work with families and ask them , why are you letting the most unable person in the room drive down the street ? ' it usually has to do with the way this family has made decisions in the past as well as cultural issues , and family dynamics . when i brought up the situation to the family , they agreed and the patient stopped driving until his medical situation improved . i show empathy toward him and his loss of independence and having to rely on family for transportation , and i try to be honest about safety concerns . i told him the concerns such as him not being able to recall the names of the roads that he just drove on to get here . i talked to her conversationally about how she 's been doing and how her family has been doing . i started asking about driving when i asked her about her vision and eye glasses . this made her feel comfortable first so then i asked about this [ the driving ] . a third largest category contained incidents that described incidents where the nurse practitioner referred the patient to occupational or physical therapy ( n = 10 , 15% ) , while 12% ( n = 8) involved conducting a vision screening examination . eleven percent of the incidents ( n = 7 ) described using a step approach to driving termination . first thing is to eliminate driving at night and then i try to find out what 's the most important thing they want to drive to . i have one patient who only wants to drive 2 miles from his home to the gas station where he goes into buy his coffee and newspaper and then he drives home . for the longest time this is the only driving he would do and then came the day when i did n't feel he was safe to do that anymore and we had him stop driving i do n't think you can just take it all away from them unless it 's really imminent that they are going to hurt themselves.work with patient to drive only at certain times of the day and to certain areas that are familiar . i had one patient who had very slow response times so we placed a restriction that he could only drive on certain roads and stay off main roads . first thing is to eliminate driving at night and then i try to find out what 's the most important thing they want to drive to . i have one patient who only wants to drive 2 miles from his home to the gas station where he goes into buy his coffee and newspaper and then he drives home . for the longest time this is the only driving he would do and then came the day when i did n't feel he was safe to do that anymore and we had him stop driving i do n't think you can just take it all away from them unless it 's really imminent that they are going to hurt themselves . work with patient to drive only at certain times of the day and to certain areas that are familiar . i had one patient who had very slow response times so we placed a restriction that he could only drive on certain roads and stay off main roads . additional categories reflected the importance of using objective data when discussing driving safety with older adults ( n = 5 , 7% ) and referring the patient to the department of motor vehicles ( n = 3 , 5% ) . two incidents ( 3% ) described referring the patient to a medical specialist , while one incident ( 2% ) described the importance of avoiding the use of inappropriate , high - risk medications with older adult drivers . when participants ( nurse practitioners ) were asked to list perceived barriers for driving cessation , the most frequently mentioned barriers included resistance from the patient with denial , lack of alternative transportation , spousal denial , and increased isolation . a listing of the most frequent barriers that nurse practitioners face in working with older adult drivers is presented in table 4 .",
"the participants in this study closely represent the national np demographics . compared to the 2012 national aanp sample survey , the demographics of nps nationally were a mean age of 51 years , white ( 85.4% ) , black / african american ( 3% ) , female ( 9.4% ) , having a graduate level degree ( 97.2% ) , and having practiced as a np for 11 years . this study identified strategies used by nps in the assessment and intervention of older adults in one geographical region . obvious limitations of this study are the limitation to one geographical area . to the author 's knowledge , this is one of the first studies to examine self - report behaviors and strategies of nps on this topic . clinical practice for assessing and intervening with older adult drivers varies significantly from provider to provider . nps are educated to practice holistically and place great importance on building rapport and trust with their patients and their families . this trusting relationship will prove beneficial when a difficult conversation such as driving cessation is needed . impaired cognition was the most common reason a np determined a need to intervene . assessing cognitive status , physical frailty , and sensory impairments were the most common physical exam strategies used . obtaining collateral information from family members ranked just below obtaining physical exam or objective data . using therapeutic communication techniques and a concern of safety for the older adult were the most common strategies used in approaching the older adult about driving . nps ranked the most helpful intervention was to involve family members and the least helpful intervention was the lack of family guidance from the provider . dealing with patient concerns about lack of transportation , especially in rural areas , and resistance to driving termination were the two most common perceived barriers . the wide variation in ways which nps make the determination to address driving in older adults and the lack of consistent guidelines for dealing with this issue should be noted .",
"as the supply of primary care physicians is expected to decrease , the number of nurse practitioners ( nps ) is expected to increase 94% between 2008 and 2025 . nps are trained to provide a holistic approach to patient care and approximately half of all nps practice in the primary care setting . standardized curriculum for nurse practitioner students does not require faculty to address concerns of older adult drivers ; therefore , few nps graduate with this training . this could be due to lack of clinical guidelines , and faculty are unclear as to what should be taught . as this is a public safety concern having difficult conversations with older adults such as driving cessation is time consuming and possibly threatens the patient - provider relationship . there is a need for the development of clinical guidelines that nps can use efficiently during a routine office visit . nps feel comfortable using evidenced - based clinical guidelines to guide their clinical practice with common chronic disease management . development of an evidenced - based clinical guideline for assessment and intervention with older adult drivers would be used similarly . our social work and occupational therapist colleagues have been working on this issue for quite some time . occupational therapists have developed guidelines for them to use in assessment of older adult drivers . nps and np students should also be aware of community resources available in their areas of clinical practice . simply making themselves aware of resources available to them and the older adult , such as the online aarp driver safety program that can be found at http://www.aarp.org/home-garden/transportation/driver_safety/ would prove beneficial .",
"this study shows the varied and inconsistent clinical practice of nps assessing and intervening with older adults drivers . who is to say that one strategy is better than the other ? it is clear that nps value the relationship they have with their patients and they value the need to intervene when public safety is at risk . development of evidenced - based clinical guidelines would prove beneficial for nps to use in clinical practice , as long as the guidelines were able to be used quickly and efficiently ."
] | as the silver tsunami continues , assessing and intervening with older adult drivers are becoming an essential aspect of the comprehensive geriatric exam . the current lack of time efficient clinical guidelines is a concern and barrier for nps . the purpose of this study was to identify strategies currently used by nps . the critical incident technique was used to obtain data from a convenience sample of nps . a total of 89 incidents were collected . the perspective of the np can provide important information for developing clinical guidelines to promote individual and community safety . |
[
"left ventricular noncompaction cardiomyopathy ( lvnc ) is a very rare cardiomyopathy characterized by an increase in the noncompacted , trabeculated myocardium adjacent to compacted myocardium in the left ventricular ( lv ) . though current research suggests a developmental arrest in embryogenesis as the underlying pathology , the etiology of lvnc are not fully understood . the patients will often present with a spectrum of disease severity ranging from no symptoms to cardiac arrhythmias , cardiac failure , thromboembolism or even sudden cardiac death . historically , lvnc has been diagnosed by echocardiography when the ratio of noncompacted to compacted myocardium is > 2 . echocardiography may not visualize the apical region optimally , leading to underestimation of the degree of lv noncompaction . however , cardiac magnetic resonance imaging ( cmri ) provides a comprehensive depiction of cardiac morphology in any imaging plane . recent cmri reports suggest a ratio of the noncompacted myocardium to compacted myocardium of > 2.3 yield the highest sensitivity ( 86% ) and specificity ( 99% ) in diagnosis . we present a case of lvnc in an adult patient with its clinical and imaging findings .",
"a 24-year - old female patient was initially referred to our vascular department for investigation of bilateral lymphedema . her echocardiogram showed mildly impaired lv with evidence of segmental wall motion abnormality and hypertrabeculation in the apex suggestive of noncompaction . the history of the patient started at birth when she had difficulty swallowing and several delayed milestones such as walking and talking at the age of 5 . due to socioeconomic issues as the patient matured , there was an additional history of palpitations , which were occasionally associated with syncopal attacks . lower limbs bilateral nonpitting edema up to the knees , proximal bilateral upper and lower limbs weakness with intact sensation , waddling gait , and easy fatigability with few steps were noted . computed tomography coronary angiogram was performed to exclude coronary artery disease . results showed segmental wall motion abnormality and revealed normal coronaries , lv dilatation , and lateral wall and apical noncompaction with the noncompacted myocardium to compacted myocardium ratio in the range of 2.53.5 [ figure 1 ] . her cmri showed mildly dilated lv with mild global hypokinesis and a marked decrease in longitudinal shortening . end - diastolic volume was 120 ml , end - systolic volume was 61 ml and the ejection fraction was 50% . in addition , multiple areas of noncompacted myocardium , particularly in the apex and most of the lateral wall extending from apical lateral wall to the mid - to - basal segment were seen . the ratio of maximum thickness of the noncompacted myocardium to compacted myocardium was more than 2.5 in multiple areas [ figure 2 ] . gated cardiac computed tomography scan was performed to evaluate the coronary arteries and showed patent coronary arteries of normal anatomy ( not shown ) . axial image shows left ventricle lateral wall noncompaction with prominent trabeculation ( arrows ) noncompaction cardiomyopathy in a 24-year - old female . a four chambers view dark blood using horizontal long axis t1 fast spin echo - magnetic resonance imaging . ( a ) apparent thickening of the left ventricle lateral wall ( arrows ) . a static image of four chamber view from cardiac magnetic resonance imaging cine , using the balanced steady state free precession technique . ( b ) shows mild dilatation of the left ventricle , prominent left ventricle wall trabecular network ( arrowheads ) and only a thin compacta ( arrows ) further investigation showed elevated creatine kinase and electromyography findings consistent with myopathy . thus , the clinical impression was proximal myopathy mostly mitochondrial or congenital , congenital lymphedema , lv noncompaction with lv ejection fraction of 40% , and normal rv function . as her lv impairment is mild , the decision was made to keep her on beta - blockers and on angiotensin - converting enzyme inhibitor in the form of metoprolol and lisinopril , respectively . on subsequent follow - up visits , she reported a history of interval improvement apart of occasional palpitations with no history of shortness of breath , syncope or dizziness . she has been advised to do regular physiotherapy and to wear compressive stockings for her lymphedema .",
"bellet and gouley described the first case of noncompaction in an autopsy of a newborn infant with aortic atresia and coronary ventricular fistula . lvnc without other cardiac abnormalities ( isolated noncompaction cardiomyopathy ) was first described by an echocardiogram performed by engberding and bender . historically , the prevalence of lvnc has been underestimated due to the lack of knowledge about this rare condition and its similarity to other diseases of the myocardium and endocardium . a study of pediatric patients with primary cardiomyopathy showed that 9% of the patients had lvnc . the median age at diagnosis of isolated noncompaction cardiomyopathy in the initial case series of isolated noncompaction was 7 years ranging from 11 months to 22 years . the prevalence of lvnc in the adult population ranges between 0.01% and 0.3% of all adult patients referred for echocardiography studies . these numbers are mostly extracted from the referred patient for abnormal echocardiographic findings or congestive heart failure ( hf ) . therefore , because of this potential selection bias , the true prevalence is not clear . male patients are predominately affected accounting for 63% , 70% , and 74% of cases in three different reported series . in 2001 , jenni et al . evaluated seven patients with lv noncompaction with pathologic correlation ( four postmortem patients and three cardiac transplant patients ) . histologic analysis demonstrated ischemic lesions in the thickened endocardium and thickened trabeculae with accompanying fibrosis . clinical manifestations are highly variable , ranging from no symptoms to disabling congestive hf , arrhythmias , and systemic thromboemboli . according to a french registry , the diagnosis of lvnc diagnosis was confirmed in 105 cases through the use of echocardiogram performed in a laboratory between 2004 and 2006 . in that study , lvnc was first detected in 12 patients with rhythm disorders , 45 patients with hf symptoms , and eight patients through familial screening . during the follow - up study , patients suffered several complications including hf occurring in 33 of the patients , ventricular arrhythmia in seven , embolic events in nine , and nine of the patients received heart transplantation while death occurred in 12 of the patients . a swiss registry recorded a total of 34 cases over 15 years among a patient population who underwent echocardiogram . in this study , major complications included hf ( 53% ) , ventricular tachycardia ( 41% ) , thromboembolic events ( 24% ) , and death ( 35% ) . six of the reported 12 deaths were sudden and four due to end - stage hf in four and the other two cases were due to unrelated causes . the presented case had a family history of sudden death in two brothers , with one of them presumed to have an unknown type cardiomyopathy . sporadic and familial forms of noncompaction have been described . in the original report of isolated noncompaction ventricular cardiomyopathy that predominantly affected children , half of the patients had a familial recurrence . however , a larger reported adult population with isolated noncompaction ventricular cardiomyopathy showed only 18% familial recurrence . lower percentage compared with the earlier report might be attributed to incomplete screening of siblings in oechslin et al . this patient has a progressive myopathy , which raised the question of other association with her left ventricular noncompaction cardiomyopathy . about 82% of lv noncompaction cases were found to be associated with neuromuscular disorder including becker muscular dystrophy , metabolic myopathy , myotonic dystrophy , barth syndrome , and other rare genetic disorders . the ratio of noncompacted myocardium to compacted myocardium at the end of systole is > 2:1 is the most often used echocardiographic criteria that were proposed by jenni et al . the criteria also include presence of segmental thickening of the myocardial wall of the lv with two layers : prominent trabeculations and deep recesses with a thin epicardial layer and a thick endocardial layer . the absence of coexisting cardiac abnormalities is required to fulfill the criteria . lv diastolic dysfunction , reduced global lv systolic function , abnormal structure of papillary muscles , and lv thrombi are nonspecific findings that can be seen on echocardiography . cardiac magnetic resonance ( cmr ) can be used in correlation with an echocardiogram to localize and quantify the extent of noncompaction . cmr offers a detailed view of the cardiac morphology of the noncompacted myocardial layer in the lv in any image plane including the apical and lateral segments - segments , which are not well visualized by echocardiogram . recent reports suggest that echocardiography diagnostic criteria are strict and mri enhances the detection of more subtle forms of noncompaction . further , cmr identifies a higher rate of two - layered structures in segments such as the anterior , inferior , anterolateral , and inferolateral segments compared with echocardiogram . however , contraindication after implanted devices , cost and availability of cmr are considered barriers on the way of implementing cmr . according to the american heart association , 1.5 tesla is the minimum acceptable magnet strength to perform cardiac imaging in order to be able to visualize both short and long axis views in approximately 17 segments . acquiring three diastolic long axis views best identifies the nc / c ratio of the most prominent myocardial trabeculations segment . the nc / c ratio in cmr is measured at the end of diastole and should be more than 2.3 , more than echocardiography , which is 2.1 . stagnant blood flow , within the myocardial trabeculae may be detracted as a high signal in cmr black blood imaging , supporting the diagnosis lvnc . the efficacy of cmr was evaluated in a report of seven patients with lvnc in whom other features supported the diagnosis ; the results were compared with 170 healthy volunteers , athletes , or patients with dilated cardiomyopathy or hypertrophic cardiomyopathy , aortic stenosis , and hypertensive heart disease . the most distinguishing feature was a ratio of noncompacted to compacted myocardium during diastole ( sensitivity 86% and specificity 99% ) . direct imaging of myocardial fibrosis is possible with the use of an inversion recovery prepared t1-weighted gradient - echo sequence and the extracellular fluid tracer gadopentetate dimeglumine . this technique has been termed delayed hyperenhancement and shows nonviable tissue as hyperenhanced or bright . nevertheless , the early and precise diagnosis is mandatory to rule out other underlying diagnoses and to allow a timely start of standard hf and anticoagulation therapy , thus preventing further complications .",
"some trabeculae show delayed hyperenhancement despite having a normal compacted to noncompacted myocardial ratio , suggesting that lv noncompaction may be a more diffuse disease process than previously suspected . the use of delayed hyperenhancement sequences improves the correlation between cmri and the parameters of the clinical stage of the disease . cmri follow - up examinations would be helpful to assess a potential change of noncompacted or compacted mass in a chronological sequence . in conclusion , cmr can distinguish lvnc from other cardiomyopathies and normal hearts with high sensitivity and specificity ."
] | left ventricular noncompaction cardiomyopathy is a very rare condition , yet believed to be often overlooked . it is thought to be caused by the developmental arrest in embryogenesis and characterized by an increase in the noncompacted , trabeculated myocardium adjacent to compacted myocardium in the left ventricular . the clinical presentations of this type of cardiomyopathy are of variable severity . echocardiography used to be the diagnostic modality , but recent reports suggest that cardiac magnetic resonance imaging has higher sensitivity and specificity by showing a ratio of the noncompacted myocardium to compacted myocardium of > 2.3 . |
[
"lung cancer is the most common cause of cancer mortality in the western world , accounting for approximately 5% of all deaths in many countries . five - year survival for those with pathological stage ia non - small cell lung cancer ( nsclc ) is 73% whereas metastatic disease has a dismal prognosis ( 13% 5-year survival ) . results from several studies suggest that frequent chest radiographic screening does not result in reduced lung cancer mortality , a conclusion reinforced by the prostate , lung , colorectal , and ovarian ( plco ) cancer screening trial [ 3 , 4 ] . in fact , some studies suggest that frequent chest radiographic screening is associated with an 11% relative increase in lung cancer mortality compared with less frequent screening . randomized trials of screening low - dose computed tomography ( ldct ) scans demonstrate that computed tomography ( ct ) is far more sensitive than chest radiography . the national lung screening trial ( nlst ) showed that , in heavy ( 30 pack - years or more ) current or former ( within 15 years ) smokers between the ages of 55 and 75 , three annual ldct screens reduced lung cancer - specific mortality from 309 to 247 deaths per 100,000 person - years . there are still many unanswered questions about the benefits and harms of those programs that could determine the ultimate success of the mass screening implementation . additionally , despite expert guidelines for screening high - risk populations , most national health service providers have not implemented ( and probably will not implement in the near future ) mass lung cancer screening programs . one of the main concerns is that the extrapolation of findings from tightly controlled trials to real - life mass screening programs requires uniform standards and high quality controls not easily achievable in most institutions . consequently , the current practice is that the patients themselves or their physicians may choose early lung cancer detection on an individual basis . there is little information , however , on the clinical characteristics and outcomes of patients with incidentally detected early stage lung cancer from strictly controlled randomized trials . the objective of this study was to analyze the clinical records of lung cancer patients who underwent surgical resection to evaluate the clinical characteristics and outcomes of patients with incidentally detected lung cancer and patients with symptomatic lung cancer .",
"all patients undergoing pulmonary resection with a curative intention for non - small cell lung cancer ( nsclc ) in the british hospital in buenos aires between january 1986 and july 2009 were eligible for inclusion in this retrospective study . our thoracic oncology centre keeps a database of all patients evaluated , with data entered prospectively at the time of their initial evaluation . patients were excluded if they had exhibited small cell lung cancer or a rare histological result . preoperative data included methods of diagnosis and a symptoms questionnaire , tobacco exposure history , and medical history . preoperative staging was performed according to the 7th tnm classification system of the international association for the study of lung cancer using chest computed tomography ( ct ) and abdominal ct or ultrasonography in all patients . brain computed tomography or magnetic resonance imaging was done only in case of clinical suspicion of brain metastases . in cases of uncertain clinical or radiologic findings , pet was included only during the last 3 years and not on a routine basis . mediastinoscopy has not been performed routinely in this series unless the ct scan demonstrated mediastinal lymph node enlargement , pet suggested a malignant involvement of hilar or mediastinal nodes , or high- risk criteria of n2 were present . patients were classified into two groups : group 1 ( asymptomatic ) : patients who had no symptoms attributable to lung cancer at the time of imaging ( patients whose cancer was detected by a medical checkup or under evaluation for other diseases ) , and group b ( symptomatic ) : patients with lung cancer - related symptoms . the charts of patients classified as having asymptomatic incidentally detected lung cancers were reviewed to check if the indications for imaging really were not based on any potentially cancer - related symptom . postoperative follow - up included office visits , quarterly chest x - rays , and yearly chest - ct . operative or in - hospital mortality was defined as death occurring within 30 days after the operation or during hospitalization , respectively . the analysis of differences in categorical outcomes was determined using the chi - squared test or fisher 's exact test . probabilities of survival rates were estimated using the kaplan - meier method and asx and sx patients were compared by using the log - rank test .",
"of 593 patients included in this study ( 68.3% male , median age 60.9 , and range 2386 years ) 320 patients were asymptomatic ( asx ) ( 53.9% ) . two hundred and thirty ( 71.8% of the asx patients ) were diagnosed incidentally on chest x - ray and the remaining on ct scan . amongst the patients with symptoms , the leading complaints that resulted in the indication for imaging were the appearance of new cough or the increase of a previously manifested clinical picture suggestive of pneumonia and haemoptysis ( table 1 ) . amongst the 320 asx patients , once the initial chest - x ray ( 71.8% ) or ct scan ( 28.2% ) showed an abnormal image , the usual workup for pulmonary nodules was started . patients in the asx group were older than patients in sx group ( median age 61.9 9.9 versus 59.51 years / old 10.2 , p = 0.007 ) , without differences in sex ( men 66 versus 73.5% , p = 0.084 ) . they had a higher prevalence of previous malignancy ( 13.2 versus 4.8% , p = 0.002 ) . the frequency of presentation as spn ( 49.5 versus 19.4% , p < 0.001 ) or peripheral location ( 80.3 versus 63.7% , p < 0.001 ) was higher in this group , without differences in clinical suspicion of n2 ( 8.8 versus 12.9% , p = 0.146 ) . patients with incidentally detected lung cancer were more likely to have earlier - stage disease , smaller cancers ( 3.00 2.2 versus 4.3 2.9 cm , p = 0.0001 ) . clinical characteristics of both groups are shown in table 3 . when the last ten years were analyzed , a higher prevalence of incidental detection compared to previous years was observed ( 51.7 versus 39.8% , p = 0.008 ) . the overall 5-year survival rates were higher for asx patients : 66.2% and 46.0% for asx and symptomatic patients , respectively ( p = 0.001 ) ( figure 1 ) . amongst the stage i patients , the 5-year survival rates were 81.2% in asx patients and 58.6% in sx patients ( p = 0.014 ) ( figure 2 ) . when only stage ia was considered , 5-year survival rates were not different ( 71.2 versus 84.1% , p = 0.191 ) ( figure 3 ) . when analysis was restricted to t1a tumors there were no differences either in 5-year survival ( 94.7 versus 93.2 , p = 0.489 ) . median survival times in pathological stages iiib ( 41.6 m in asx versus 22.0 m in sx patients , p = 0.065 ) and iv ( 13.7 versus 12.7 m , p = 0.964 ) were not significantly different .",
"our study shows that the incidental finding of non - small cell lung cancer occurred more frequently in smokers and in patients with a history of previous malignancy . the mortality of patients with nsclc as an incidental diagnosis was lower , and this difference persisted into stage i. more than a half of patients who underwent surgical resection of lung cancer at our institution had incidentally detected cancers and the most common indication for the initial imaging was a routine checkup . that proportion of asx patients is higher than that reported by raz et al . in san francisco but far lower than that published by hanagiri et al . in japan . in the absence of a uniform policy appertaining to the role for screening in clinical practice , the indication of imaging asymptomatic patients relies on the preferences and beliefs of both patients and physicians . different levels of awareness and access to healthcare may justify differences amongst different studied populations . also , our asx patients were slightly older ( contrary to the study by raz et al . ) and more frequently smokers which may mean a higher degree of awareness of their risk for lung cancer as the higher prevalence of previous malignancy may have been one of the reasons for routine radiological surveillance . however , it is noticeable that more than 70% of patients in our group ( as in other series ) were studied by chest - x - ray , a method that has proved to be ineffective and that is not recommended as a screening tool by any major medical organizations . the proportion of early stages of lung cancer was higher amongst our patients with incidental findings . that stage i cases accounted for 65.3% and stage iii cases for 22% in their mass screened group , while , in the symptom group , there was only half that percentage of stage i cases ( 32.2% ) . similarly , in the two more recently published series [ 7 , 8 ] and in the korean lung cancer registry study asymptomatic patients had higher proportions of stages i - ii . however , there were still 20% of our patients that did not have any symptom and had a stage iii or iv lung cancer . interestingly , in a retrospective review of coronial autopsies even when the median tumor size of previously undetected cancers was 3 cm , the range was 110 cm and there were several tumours over 5 cm and even some large endobronchial and hilar tumours undetected before death . we found that survival time in symptomatic cases was worse than in incidentally detected lung cancer patients . the 5-year overall survival was lower for the whole group and for pathological stage i. that better outcome has been consistently demonstrated in all the previous reports ; however , the causes for those differences are still unclear . the korean registry has shown that absence of symptoms at diagnosis significantly reduced the risk of death from nsclc , regardless of age , gender , stage , smoking history , or whether treatment was performed . similarly , hanagiri and colleagues showed that their patients with incidentally diagnosed nsclc had significantly better prognoses than the symptomatic group even in stage ii even when they had a larger proportion of stage iv amongst asymptomatic patients than our series ( 6.7 versus 3.4% ) they were still a small number of patients ( n = 18 ) and exact figures of survival rates for those advanced patients were not provided . in our series , whilst pathological stage i patients had a better survival in asx patients , median survival times in stages iiib and iv were similar . it resembles the results of raz et al . who found that their patients with completely resected incidental lung cancer had similar long - term survival rates as patients with symptomatic lung cancer , after adjusting for stage . in the present study , stage ia disease was diagnosed less frequently in the symptomatic group , similar to what has been reported in other studies [ 7 , 8 , 10 ] . a study by kashiwabara et al . ( published in 2002 , before the publication of the 7th tnm edition ) compared the outcomes in patients with one - year delayed detection of lung cancer on mass screening with chest - x - ray and in patients with no delay ( patients with tumours which could versus could not be detected on past chest roentgenograms ) . they found that one - year delayed detection of lung cancer on mass screening did not affect outcome , but that , according to the maximum dimension of the tumours on the overlooked chest roentgenogram , the 5-year survival rates in patients with missed tumours were different and that survival in early stages ( i - ii ) for missed tumours > 20 mm was worse than that in patients with missed tumours < 10 mm . we had previously shown that tumors over 15 mm are associated with shorter 5-year survival in all tnm stages and several studies have reported tumor size may have an independent predictive value on survival in stage i patients [ 14 , 15 ] . the impact of the tumor size was finally made evident by the analyses of the database of the iaslc and generated the reclassification of t1 in t1a and t1b and t2 in t2a and t2b . when we analyzed separately the pathological stage ia cases , differences in survival in stage i between the two groups disappeared , suggesting that the size was the most important factor in determining survival . our study shows that patients with incidentally detected lung cancer had a better survival because they had smaller cancers and earlier - stage disease . the conclusions of clinical studies like this or any of the previously published studies should not be extrapolated to the potential value of mass screening . this sort of study design does not allow demonstrating if there is a survival benefit of treatments in asymptomatic patients or how large the proportion of invasive procedures for benign lesions is performed . one of the main concerns about any screening program is that a proportion of screen - detected cases will be overdiagnosed simply because of competing mortality , a hypothesis that can not be excluded by a population study like this one . on the other hand , many of the patients in this and the other clinical series were not represented in the clinical trials about mass screening programs : 15% of our asymptomatic patients were never smokers and many of them were under 55 years old and would have not filled criteria for being included in a screening program . this study shows the importance of identifying risk at an individual level as many subjects different from the nlst participants may have a risk similar to or greater than the level of risk observed in nlst . several studies have previously recognized that there is wide variation in lung cancer risk even amongst those who are smokers [ 18 , 19 ] and we do not know yet how to identify other risk factors for lung cancer that could potentially justify extending screening to those individuals . future research to develop clinically useful risk model might include molecular or genetic indicators of risk in order to answer these questions . the national lung screening trial ( nlst ) showed that , in heavy ( 30 pack - years or more ) current or former ( within 15 years ) smokers between the ages of 55 and 75 , three annual low - dose computed tomographic ( ldct ) screens reduced lung cancer - specific mortality from 309 to 247 deaths per 100,000 person - years ( relative risk of 0.8 ) . but at the moment to make individual decisions ( such as screening of certain nonsmokers ) it is necessary to take into account the potential effectiveness of such measures . whilst the number needed to screen ( nns ) to prevent one death for the entire nlst population was calculated as 320 , according to bach and gould for very low risk individuals ( defined by the authors as a 40-year - old former smoker ) the nns was over 35,000 to prevent one lung cancer death . in order to minimise the potential for harm when screening large populations for a condition that is very rare ( derived not only from the costs associated with screening but also from the impact on quality of life of the potential for invasive procedures for incidental findings ) but at the same time not to miss other high - risk subjects out of the nslt criteria , better risk models must be developed to have the greatest predictive accuracy for lung cancer risk . firstly , the classification of a cancer as incidentally detected is a potential bias , once the spontaneous patient consultation may not exclude the presence of some nonspecific symptom that prompted the patient to seek medical consultation . it is remarkable that , in the study by kashiwabara et al . about patients that did not consult a physician after the discovery of a shadow in a radiological screening ( almost 25% of the asymptomatic screened patients in their series ) , when asked about the reason why patients did not consult a doctor , two - thirds answered that it was because they did not have any respiratory symptoms . it shows that a screening program must assure that the health care system can provide all the necessary resources to treat the incidental findings and also the education to guarantee the availability of well - qualified primary care providers trained to encourage patients to follow diagnosis and treatment recommendations once a suspicion of lung cancer is raised from the imaging studies .",
"in summary , our study shows that lung cancer as an incidental finding is not uncommon even amongst nonsmokers and that the better survival of patients with asymptomatic nsclc is related to the greater number of patients with earlier - stage disease . future research is needed to prospectively identify those patients not represented in the nslt who might benefit from ldct screening ."
] |
objective . to evaluate clinical characteristics and outcomes in incidentally detected lung cancer and in symptomatic lung cancer . material and methods . we designed a retrospective study including all patients undergoing pulmonary resection with a curative intention for nsclc . they were classified into two groups according to the presence or absence of cancer - related symptoms at diagnosis in asymptomatic ( asx)incidental diagnosis or symptomatic . results . of the 593 patients , 320 ( 53.9% ) were asx . in 71.8% of these , diagnosis was made by chest x - ray . patients in the asx group were older ( p = 0.007 ) , had a higher prevalence of previous malignancy ( p = 0.002 ) , presented as a solitary nodule more frequently ( p < 0.001 ) , and were more likely to have earlier - stage disease and smaller cancers ( p = 0.0001 ) . a higher prevalence of incidental detection was observed in the last ten years ( p = 0.008 ) . overall 5-year survival was higher for asx ( p = 0.001 ) . median survival times in pathological stages iiib - iv were not significantly different . conclusion . incidental finding of nsclc is not uncommon even among nonsmokers . it occurred frequently in smokers and in those with history of previous malignancy . mortality of incidental diagnosis group was lower , but the better survival was related to the greater number of patients with earlier - stage disease . |
[
"hip arthrodesis as a solution for hip - related problems is mainly superseded by total hip arthroplasty ( tha ) and , in the current treatment of hip disorders , there is hardly room left for arthrodesis of the hip . however , we must realise that in certain scenarios in young adults joint preserving therapy is not an option and total hip arthroplasty is a difficult procedure with an increased risk of failure [ 13 ] . in these selected young patients with severe hip pathology due to trauma or infectious causes an arthrodesis may be a suitable solution with an acceptable outcome [ 14 ] . there has been considerable literature in the past about the technique and outcome of a hip fusion . several studies report of pain in adjacent joints in the long term ; the most frequent being lower back pain based on degenerative changes reported between 15% and 100% of cases [ 59 ] . following in percentage are complaints of the ipsilateral knee and less frequent complaints of the contralateral hip and knee [ 911 ] . the frequency of these complaints seems to be predicted by the alignment of the fusion which should be optimal [ 3 , 6 , 12 ] . in our clinic , we perform hip fusions with our standard technique using a cobra plate ; however , in those complex cases where optimal alignment and optimal fixation can not be achieved by this method we use the technique with a subtrochanteric pendulum osteotomy to achieve the correct alignment . even in the most difficult cases this method enables the optimal combination between a stable connection of the remaining femoral head neck and pelvis and an optimal alignment of the leg . although a hip fusion is not the most ideal solution it remains an important option for selected scenarios . apart from the short - term results , attention should be paid to the long - term results in adolescents and young adults . when performing an arthrodesis the main objective of our study was to show the long - term effects of fusion on the adjacent joints using our technique .",
"in the period between 1974 and 1994 , 47 hip arthrodesis were performed by the senior author ( rkm ) . the average age at the time of the arthrodesis was 29 years ( range 1255 ) . the hip disorder which led to arthrodesis was septic arthritis in ten patients ( including tuberculosis ) , aseptic necrosis in one , post - traumatic in 21 , congenital luxation in three patients , four patients were secondary to childhood hip disorders and there were other indications in eight . we prefer to perform a cobra plate technique , which was initially developed by schneider and later modified by several others , eliminating the need for the pelvic osteotomy [ 13 , 14 ] . the technique we use is similar to this reported technique ; however , we pay extra attention to the abductor muscle since it is mandatory to preserve it if a later total hip arthroplasty is a possibility . the abductors are spared by performing a trochanteric osteotomy which is fixed on / over the cobra plate after the arthrodesis is performed . for complex cases in which the optimal combination of fixation of the arthrodesis and perfect limb alignment is not possible , for instance in septic arthritis with severe destruction of the joint or severe osteonecrosis , we performed an arthrodesis with a subtrochanteric pendulum - osteotomy . the arthrodesis is performed in such a position that optimal contact between femoral head and acetabulum is present , regardless of the position of the leg . the arthrodesis is then relieved by a subtrochanteric osteotomy which also allows optimal positioning of the extremity . after - treatment consisted of traction immobilisation for two weeks followed by six weeks of plaster immobilisation . in this study 33 hips were fused with the cobra plate technique and 14 with the arthrodesis with subtrochanteric pendulum - osteotomy technique . the clinical follow - up consisted of a thorough clinical investigation and the short musculoskeletal function assessment ( smfa ) questionnaire . the smfa is a well - validated , universal , self - reported health status questionnaire . the smfa questionnaire is developed for clinical assessments of the impact of treatment in groups of patients who have musculoskeletal disease or injury . the smfa questionnaire consists of the dysfunction index , which has 34 items for the assessment of patient function , and a bother index , which has twelve items for the assessment of how much patients are bothered by functional problems . since a hip arthrodesis can have a negative influence on the contralateral hip joint , the back and knees , we included these adjacent joints in this analysis . the clinical investigation consisted of : range of motion of hips and knees , mobility of the back , laxity of the knee joint , leg length discrepancies and quadriceps strength . the mobility of the back was measured using a standardised mildenberg finger - floor method and the schber test . the schber test was conducted with the patient standing upright ; a mark was made at the height of l5 . a second mark was made 10 cm above and a third mark 5 cm below the first mark . the patient was asked to bend forward with the knees straight , reaching as far as possible towards his / her toes . the increase between the upper and lower mark was taken as a measurement of lumbar flexion . the finger - floor measurements were taken upon the first attempt of the patient to bend forward with extended knees . quadriceps strength was graded from 0 to 5 according to the british medical research council scale . subjective outcome measurement visual analogue scores ( vas ) were obtained for pain in hips , knees and back . vas scores were also obtained for satisfaction with the results of the arthrodesis and for the eagerness to have the arthrodesis converted to tha . additional questions concerning work , walking distance , problems with sitting and problems with socks and shoes were posed . for both knee joints , the international knee documentation committee ( ikdc ) knee examination form was used to evaluate secondary knee problems . this form results in four groups : group a is normal knees , group b nearly normal knees , group c abnormal knees , and group d severely abnormal knees . for the radiological analysis , weight bearing x - rays of pelvis , both knees and lumbar spine were used . the contralateral hip and both knees were scrutinised for signs of osteoarthritic changes which were scored according to kellgren and lawrence for the medial compartment , the lateral compartment and the patello - femoral compartment . for the knees , the ahlback score was also used for the medial and lateral compartment separately . on the lumbar spine x - rays the presence of osteophytes as an indicator for osteoarthritic changes were scored ; the percentage of joint - space narrowing between the vertebrae and the presence of olisthesis and scoliosis were documented .",
"after an average follow up of 18.9 years ( range 5.631.4 ) , six patients had died . seven hips were eventually converted to tha of which one was performed to facilitate a total knee arthroplasty on the same side . the remaining 30 patients were invited for follow - up and intensively screened . in this group of difficult hip disorders one patient suffered from a deep venous thrombosis which was treated with anticoagulants . in two patients a deep infection occurred , of which both received the arthrodesis for a destructive septic arthritis . in one of them a revision operation was performed with debridement of the infection and surgical drainage ; the infection resolved but resulted in a nonunion . the second infection was treated conservatively , and after 24 years of follow - up a fistula and deep infection were still present . besides the nonunion after infection , in five other patients a nonunion was diagnosed , and in three patients one re - arthrodesis was sufficient to achieve union , while in one patient two re - arthrodesis were performed to achieve union . one patient was left untreated because of co - morbidity for which this arthrodesis was performed for severe post - traumatic destruction ; however , the same trauma led to a post - traumatic ankylosis of the ipsilateral knee , a paresis of the contralateral arm and permanent brain damage ( mainly cognitive ) . clinical and radiological follow - up was obtained for 30 patients after an average of 18.2 years ( range 6.230.5 ) ( fig . 1 ) . clinically , the smfa showed a mean total score of 31.2 ( range 9.070.0 ) , the subscore dysfunction an average of 29.1 ( range 8.070.5 ) and the subscore limitations an average of 37.3 ( range 9.084.0 ) . the clinical and radiological results for the arthrodesis and adjacent joint will be discussed separately . \n h x - rays of pelvis , knees and lumbar spine 28 years postoperatively . the arthrodesis was converted to a total hip replacement ( thr ) 20 years postoperatively ( on the contralateral hip a shortening at intertrochanteric level was performed 1 year after the fusion ) a a 17-year - old boy with a central hip luxation . h x - rays of pelvis , knees and lumbar spine 28 years postoperatively . the arthrodesis was converted to a total hip replacement ( thr ) 20 years postoperatively ( on the contralateral hip a shortening at intertrochanteric level was performed 1 year after the fusion ) the clinical and radiological investigation of the fused hip joint showed an average vas for pain of 1.9 ( range 0.08.0 ) . the average alignment of the arthrodesis was 19 flexion ( 5 ; 30 ) , 1 of abduction ( 10 ; 10 ) and 2 external rotation ( 10 ; 15 ) . an average leg length discrepancy of 3.3 cm ( range 11.5 to 2 ) was present . walking distance averaged 115 minutes ( range 10unlimited ) for which one patient needed two crutches and two patients needed one crutch for support . twenty - three patients experienced difficulties in putting on their shoes , in 17 of them this was caused by the inability to tie their shoelaces . of these , three had no complaints of the fused hip ( vas pain 0,0,3 ) , and one patient with a nonunion after infection had a vas of 6 . the two remaining patients reported vas of 6 and 7 for pain ; however , they performed full time heavy labour ( north sea fisherman and factory worker ) . the vas for eagerness to have their fusion converted to a tha was 5.4 average ( range 010 ) . the contralateral hip joint on clinical examination showed an average vas for pain of 2.0 ( range 08 ) . one contralateral hip underwent an intertrochanteric shortening osteotomy and one was converted to a tha . the average range of motion was : for flexion 104 ( range 30140 ) , extension 0.2 ( 0 5 ) , abduction 25 ( 1040 ) , adduction 17 ( 030 ) , external rotation 27 ( 560 ) and internal rotation 16 ( 0 30 ) . on clinical examination the ipsilateral knee joint showed an average vas for pain of 2.0 ( range 08 ) . average range of motion for flexion was 125 ( 20160 ) and for extension 2 ( 010 ) . on radiological examination three knees showed severe osteoarthritic changes with a grade 4 k - l and iv ahlback in both compartments , and in one knee only in the lateral compartment . a grade 3 or 4 k - l oa in the patello - femoral compartment was present in four knees . the ikdc knee examination form showed a grade a in nine knees , grade b in 14 knees , grade c in four knees and grade d in eight knees . on clinical examination the contralateral knee joint showed an average vas for pain of 1.8 ( range 08 ) . quadriceps strength was optimal ( grade 5 ) in all . average range of motion for flexion was 140 ( 100160 ) and for extension 1 ( 10 to 20 ) . on radiological examination one knee showed severe osteoarthritic changes with a grade 4 k - l and a grade iv ahlback in both compartments , and in one knee only in the lateral compartment . a grade 3 or 4 k - l oa in the patello - femoral compartment was present in three knees . the ikdc knee examination form showed a grade a in 23 knees , grade b in five knees , grade c in five knees and grade d in three knees . there was a significant differences in the outcome of the ikdc examination form ( laxity ) for the ipsilateral and contralateral knees ( chi - square p < 0.001 ) . clinical investigation of the lower back showed an average vas for pain of 3.6 ( 08 ) ( table 1 ) . the average schber test was 6.1 ( 310.5 ) , and the standardised mildenberg finger - floor method averaged 32.5 cm ( 1551 ) . radiological examination of the sacro - iliacal joint showed three joints with severe arthrosis ( one grade 3 and two grade 4 k - l ) on the ipsilateral side , and two ( both grade 3 k - l ) on the contralateral side . the lumbar spine showed signs of oa in the form of osteophytes in 12 backs . in two spines an olisthesis was present , one grade 1 and one grade 2 . ten ap lumbar spine showed a scoliosis , of which eight had the convexity on the opposite side of the arthrodesis . results per operation technique sfma short musculoskeletal function assessment , avg average , vas visual analogue score",
"although arthrodesis has been forced into the background by the successful tha , it still remains a valid option for specific difficult problems . this descriptive study of our fusion techniques shows a good outcome measured by the smfa and a good vas for pain for all related joints after an average of 19 years of follow - up . especially lower back pain seems to occur frequently after a hip fusion in the long term , since 42% of our patients had a vas for pain of 3 and higher for lower back pain . the cobra head plate technique is our first choice since it provides a high fusion rate and allows early mobilisation . for some indications , including severe unilateral destruction of the femoral head in young patients with severe loss of bone stock , which can occur in chronic septic arthritis or osteonecrosis , a cobra head plate arthrodesis does not provide the necessary stability . this method enables the optimal combination between a stable connection of the remaining femoral head - neck and pelvis and an optimal alignment of the leg even in the most difficult cases . the fact that an arthrodesis is only indicated in difficult cases is probably the best explanation for the relatively high complication rate in this group of patients . a second important complication is the occurrence of nonunions in our patient group . at follow - up , six hips showed signs of a nonunion , although in three of them a real nonunion was unlikely due to the absence of symptoms . two other patients with signs of a nonunion indicated pain in the fused hip ( vas 6 & 7 ) , but were able to perform full time heavy labour . using these two techniques for these selected patients our nonunion rate of 6% it is known that an arthrodesis of any joint has influence on the adjacent joints . these effects can be minimized by performing an optimal alignment of the affected extremity . in an ideal arthrodesis this alignment is adjusted to the patient 's preferences . in patients with a mainly sitting occupation more flexion both knee joints did not suffer from the arthrodesis in a way that they caused pain or discomfort . however , we noticed that significantly more knees on the ipsilateral side showed an increased laxity ( ikdc knee examination form ) . no differences were found in the vas scores for the contralateral and ipsilateral knees . in 2000 , karol et al . showed in a detailed gait analysis that excessive motion of the lumbar spine and the ipsilateral knee were present in patients with a fused hip . these excessive movements caused complaints in the ipsilateral knee and lower back in their group of seven patients . our data supports the fact that a fusion causes more lower back complaints in the long term ( 42% with a vas higher than 3 ) ; however , we could not confirm the occurrence of more complaints in the ipsilateral knee . in our study seven arthrodeses ( 15% ) were eventually converted to a tha ( fig . 1 ) , all with a good result . in the literature several studies can be found regarding conversion of an arthrodesis to a tha , showing identical results to primary tha in patients older than 50 [ 1 , 19 , 20 ] . although primarily tha may not be a solution for these patients , an arthrodesis can bridge the gap to a future tha , while generating a good quality of life in the meantime . we asked our patients how eager they were to convert their arthrodesis to a tha and 13 ( 43% ) saw no reasons for conversion at long - term follow - up , indicating that these patients were content with their current quality of life . we found that the mobility and quality of life were good for patients with an arthrodesis . the average walking time was almost two hours ( 115 minutes ) , while ten patients were able to walk for at least three hours , and one patient even participated in marathon running . although hip arthrodesis has lost it popularity it still is an option for young patient with severe hip disorders , while leaving the possibility to perform a tha at a later stage . if the arthrodesis is performed with an optimal alignment of the leg , complaints from the adjacent joints are minimal , even in the long term , and an acceptable quality of life can be obtained ."
] | even in current orthopaedic practice , some cases are still not suitable candidates for hip replacement and hip fusion remains the only option in these highly selected patients . in this retrospective study we describe the long - term clinical outcome , quality of life and radiological evaluation of all adjacent joints in a cohort of 47 hip fusions . the main objective of our study was to show the long - term effects of a fusion . thirty patients were analysed after an average of 18.2 years ( range 6.230.5 years ) with a mean smfa of 31.2 ( range 970 ) . the vas for pain for the fused hip was an average 1.9 ( range 08 ) , for the contralateral hip 2.0 ( 08 ) , for the ipsilateral knee 2.0 ( 08 ) , for the contralateral knee 1.8 ( 08 ) and for the lower back 3.6 ( 08 ) . average walking distance was 115 minutes ( range 10unlimited ) . although the hip arthrodesis has lost popularity , it still is an option for the young patient with severe hip disorders , while leaving the possibility to perform a tha at a later stage . if the arthrodesis is performed with an optimal alignment of the leg , complaints from the adjacent joints are minimal , even in the long - term , and an acceptable quality of life can be obtained . we believe that in highly selected cases a hip fusion , even in current practice , is still a valid option . |
[
"leukotrienes ( lts ) , first described by samuelsson 's group [ 1 , 2 ] , are a class of lipid mediators involved in several diseases but classically known for their effects on asthma and allergy . the generation of leukotrienes ( lts ) is dependent upon the action of 5-lipoxygenase ( 5-lo ) in association with membrane - bound 5-lipoxygenase - activating protein ( flap ) on arachidonic acid ( aa ) . aa is derived through the action of cytosolic phospholipase a2 ( cpla2 ) and/or secreted phospholipase a2 ( spla2 ) on membrane phospholipids . lta4 , an unstable precursor of all leukotrienes , is quickly metabolized to one of the two different classes of lts , ltb4 ( by lta4 hydrolase ) or ltc4 ( by ltc4 synthase ) and its metabolites ( ltd4 and lte4 ) . collectively , ltc4 , ltd4 , and lte4 were previously known as the slow - reacting substance of anaphylaxis ( sr - a ) and are currently termed the cysteinyl lts ( cyslts ) [ 3 , 4 ] . the receptors for ltb4 ( btl1 and btl2 ) and cysteinyl lts ( cyslt1 and cyslt2 ) are cell surface g protein - coupled receptors . additionally , some studies support the existence of other cyslt receptors [ 5 , 6 ] . some cells express both btls and cyslts ; however , the expression of these receptors differs in different cells types . in addition , these receptors are also expressed on peripheral blood leukocytes [ 7 , 8 ] . lt receptors and 5-lo are expressed mainly in immune cells , and lts play important roles in innate and adaptive immune responses and are involved in several inflammatory and infectious diseases [ 4 , 9 ] . for example , cyslts increase vascular permeability and edema , and ltb4 is involved in leukocyte chemotaxis , lysosomal enzyme secretion , neutrophil degranulation , adhesion molecule expression , defensins and nitric oxide ( no ) production , phagocytosis , and other functions . lts are produced during the interaction of phagocytes and microorganisms in vitro and experimental infections in vivo . pharmacologic or genetic approaches to reduce or block the lt biosynthesis pathways decrease the phagocytic and antimicrobial activities against bacteria , fungi , and parasites [ 12 , 13 ] . in addition , immunodeficient individuals , such as hiv patients , are characterized by low lt production , which has been associated with impaired immune responses and infection control . lts play important roles in both th1 and th2 immune responses , which are involved in the defense against protozoan and helminth infections , respectively . in light of the current research on the role of lts in infectious diseases , we have divided the current review into two sections focusing on ( 1 ) protozoan infection and ( 2 ) helminth infection .",
"each year , protozoan parasites infect many people worldwide , mainly in developing countries , causing serious health , political , social , and economic problems . the major protozoan parasites with clinical importance for human diseases are plasmodium ssp , leishmania ssp , trypanosoma cruzi , toxoplasma gondii , trichomonas vaginalis , and entamoeba histolytica [ 1517 ] . the first three of these organisms are obligate intracellular protozoan parasites that are transmitted to vertebrate hosts by insect vectors . t. gondii is also an obligate intracellular protozoan parasite ; however , its transmission to human hosts occurs by ingestion of raw or undercooked meat containing tissue cysts or food or water contaminated with oocysts . t. vaginalis is transmitted sexually ( trophozoites ) and e. histolytica is transmitted through food and water contaminated with cysts [ 1517 ] . protective immunity against protozoans is mediated mainly by t helper 1 ( th1 ) responses which are characterized by the production of inflammatory cytokines , such as il-12 , which is required for the development of the th1 immune response , and interferon gamma ( ifn- ) and tumor necrosis factor alpha ( tnf- ) , which activate macrophages to produce no , which is involved in the control of parasite replication [ 16 , 1820 ] . reiner and malemud [ 21 , 22 ] conducted the first studies to demonstrate the role of leukotrienes in protozoan infection ( leishmania spp ) . the main effects of lts , in both innate and adaptative immune responses , during the protozoan infections are illustrated in figure 1 . mouse strains resistant ( c57bl/6 ) to leishmania infection mount th1 immune responses against leishmania . in contrast , infection of susceptible mouse strain ( balb / c ) is associated with the development of a th2 immune response . in vitro studies have demonstrated increased ltc4 production in splenocytes and macrophages from l. donovani - infected or uninfected balb / c mice upon stimulation with nonspecific ( phytohemagglutinin ) or specific ( l. donovani amastigotes ) stimuli [ 21 , 22 ] . in another study , splenocytes from balb / c mice stimulated with antigens from l. major promastigotes displayed increased ltb4 and il-4 production with concomitant decreases in ifn- and tnf- production . . demonstrated an increase in the parasite burden of balb / c macrophages infected with l. amazonensis when compared to macrophages from the resistant mouse strain c3h / hepas . this effect was associated with lower levels of ltb4 in macrophages from balb / c mice . in agreement with this finding , macrophages from either susceptible or resistant mice treated with mk0591 ( flap inhibitor ) and u75302 ( blt1 antagonist ) , but with not mk571 ( cyslt1 antagonist ) , as well as macrophages derived from 5-lo - deficient mice , exhibited decreased leishmanicidal activity . interestingly , treatment with exogenous ltb4 or ltd4 favored parasite killing by macrophages from balb / c mice . supporting these in vitro results , susceptible and resistant mice treated with zileuton ( inhibitor of 5-lo ) or 5-lo - deficient mice infected with l. amazonensis displayed larger footpad lesions than nontreated or wild type animals . the success of lutzomyia longipalpis , an insect vector of the leishmania ssp , at blood feeding on mammals depends on the inhibition of the immediate inflammatory response ( e.g. , increased vascular permeability , swelling , pain , and itching ) . it is well known that active substances in the saliva of hematophagous arthropods facilitate the uptake of blood by counteracting host hemostatic , inflammatory and immunological defenses [ 2528 ] . mixed lysates from the salivary glands of l. longipalpis significantly increased the cutaneous lesions and/or parasite loads in the footpads of mice infected with l. major or l. braziliensis when compared to infected animals not exposed to the saliva lysates [ 29 , 30 ] . in addition , the modulation of infection by saliva was il-4-dependent . in agreement with these results , the salivary gland extract of l. longipalpis exhibited anti - inflammatory activities by decreasing tnf- and ltb4 production , neutrophil numbers , and ltb4-induced chemotactic activity in a murine ovalbumin - induced peritonitis model . , these findings suggest that lts , and particularly ltb4 , play a role in immune response to leishmania infection by promoting leishmanicidal activity and consequently , control of infection . therefore , the modulation of ltb4 during infection in association with the modulation of the immune system during leishmania transmission ( by saliva from the insect vector ) in synergism with genetic factors ( susceptibility ; th2 ) could markedly affect leishmania infection in humans . the components derived from the saliva of the arthropod vector of malaria ( e.g. , anopheles stephensi ) have also pharmacologic effects , such as inhibition of inflammation and coagulation , similar to those observed in the saliva of insect vectors of leishmania . in addition , these proteins also have the ability to neutralize inflammatory small molecules by rapid binding . the anst - d7l1 protein produced by a. stephensi binds cyslts ( ltc4 , ltd4 , and lte4 ) but does not chemically modify them . anst - d7l1 effectively inhibited ltc4-induced ileal contraction by binding ltc4 , thereby preventing interactions between this molecule and its appropriate cellular receptor . the effects of ltc4 inhibition on the course of malaria infection as well as the influence in the malaria pathogenesis are not known . in the experimental cerebral malaria model , mice infected with plasmodium berghei showed increased ltb4 production in the serum . interestingly , treatment with aspirin , which may direct arachidonic acid metabolism away from the cyclooxygenase ( cox ) pathway and toward the lo pathway , induced increased parasitemia and death of infected mice . this effect was associated with the overproduction of ltb4 in the serum . in agreement with these results , children with cerebral malaria treated with salicylate demonstrated complications of severe malaria ( metabolic acidosis , hypoglycemia , and death ) . although ifn- plays a protective role in malaria infection , it has also been associated with the immunopathology of cerebral malaria [ 36 , 37 ] . besides playing a role in initiating the th1 immune response mediated by dendritic cells , therefore , the overproduction of ltb4 after aspirin treatment in experimental and human cerebral malaria could be associated with the overproduction of ifn-. further studies are needed to evaluate this hypothesis . eryptosis , or suicidal death of erythrocytes , which occurs in a wide variety of diseases including malaria , is characterized by cell shrinkage , membrane blebbing , and exposure of phosphatidylserine ( ps ) at the cell surface . like apoptotic cells , ps - exposing erythrocytes are identified by macrophages and are engulfed , degraded , and removed from the circulation . demonstrated increased phagocytosis of mutant red blood cells infected with trophozoites of p. falciparum , which may represent a protective mechanism against infection . remarkably , an in vitro assay demonstrated that erythrocytes were able to produce cyslts upon energy depletion . these effects were inhibited by cyslt1 receptor antagonists and by the 5-lo inhibitor ( bw b70c ) . these results suggest that ltc4 might confer protection during the course of malaria by accelerating the clearance of infected erythrocytes . on the other hand , excessive eryptosis might favor the development of anemia ; thus , ltc4 might have a dual effect in malaria pathogenesis . during t. gondii infection , an efficient immune response is important to contain dissemination of the parasite and to prevent mortality of the host . ltc4 , ltd4 , and free aa were detected when murine macrophages from swiss mice were cultured with viable t. gondii . in contrast , when macrophages from resistant mice ( balb / c ; major histocompatibility complex haplotypes h2 ) or human macrophages were cultured with viable t. gondii , no 5-lo products were observed . accordingly , prior incubation of human macrophages with viable t. gondii decreased the ltb4 release induced by the calcium ionophore a23187 , suggesting that t. gondii inhibits ltb4 production . treatment with zileuton ( an inhibitor of 5-lo ) decreased the toxoplasmacidal activity of ifn- in human macrophages , whereas exogenous ltb4 promoted intracellular killing of ingested t. gondii in human monocytes . this effect might be associated with the effect of ltb4 on the induction of cytotoxicity ( surface membrane vesiculation , extravasation of cytoplasmic contents into a space between the intermembrane spaces and cytoplasmic vacuolization ) in t. gondii tachyzoites [ 47 , 48 ] . in agreement with these results , 5-lo - deficient mice infected with t. gondii displayed decreased survival as a consequence of an excessive inflammatory response characterized by elevated il-12 and ifn- concentrations in the serum and cd4 and cd8 t - cell infiltration in the brain tissue and not of increased parasitic burden . the increased inflammation in the absent of lts might indicate a compensatory mechanism to control the parasite infection . taken together , these findings suggest that the downregulation of lts production , and particularly of ltb4 , by t. gondii might be considered an evasion mechanism , as this lipid mediator can promote cytotoxicity and toxoplasmacidal activity studies by our group and others have demonstrated reduced lt synthesis ( e.g. , ltb4 ) in hiv - infected subjects [ 14 , 50 ] . although the clinical manifestation of t. gondii infection is usually asymptomatic in immunocompetent individuals , immunocompromised individuals , such as hiv - seropositive patients , exhibit reactivation of latent tissue cysts ( bradyzoites become tachyzoites ) and consequent toxoplasmic encephalitis or retinochoroiditis [ 51 , 52 ] . interestingly , in agreement with these results , the ltb4 and ltc4 concentrations in the cerebrospinal fluid of hiv-1-seropositive patients with toxoplasmic encephalitis but not those of hiv-1-seropositive patients without inflammatory disease or encephalitis were below the detection limit . these results support those described above and suggest that the reduced basal production of lts in hiv-1-seropositive patients synergizes with the suppression of lts by t. gondii . moreover , this synergistic decrease in lt production might contribute to the pathogenesis of cerebral toxoplasmosis through the increased reactivation of bradyzoites from tissue cysts and the reduced control of the parasitic infection . protective immunity against toxoplasmosis and chagas disease is mediated by th1 cells , cd8 t cells , and ifn- . chagas ' heart disease is a severe clinical manifestation of trypanosoma cruzi infection . in chronic chagas disease , cardiomyopathy is observed as an inflammatory process characterized by the infiltration of t cells and macrophages , resulting in myocarditis , fibrosis , and heart fiber damage . treatment with lt inhibitors has demonstrated beneficial effects in cardiovascular pathologies [ 55 , 56 ] . t lymphocytes from patients with chronic chagas ' heart disease or from chagasic mice show increased contractile activity ( positive inotropic and chronotropic effects ) of heart ( atrial ) in an in vitro assay . interestingly , pretreatment with lipoxygenase inhibitors ( ndga ) or a cyslt receptor antagonist ( fpl 55712 ) decreased this effect . in a separate study , ltc4 production was observed in the supernatants of murine atria cocultured with t lymphocytes from chagasic mice . in accordance with these results , ltb4 induces chemotaxis of lymphocytes ( cd4/cd8 t cells ) [ 8 , 59 ] . therefore , lts might modulate the cardiac pathology of chagas disease by modulating the immune response profile during this infection . ltb4 and ltc4 also increased the phagocytic and trypanocidal activity of murine macrophages incubated with t. cruzi trypomastigotes in vitro . in addition , ltb4 restored no and tnf- levels , which were decreased by an ltb4 receptor antagonist ( cp-105,696 ) . cp-105,696 treatment also decreased the trypanocidal activity of ifn- in murine macrophages . with the use of pharmacologic ( ltb4 receptor antagonist and lo inhibitors ) and genetic approaches ( 5-lo - deficient mice ) , in addition , the following anti - inflammatory profiles were observed in t. cruzi infection : ( 1 ) decreased leukocyte infiltration in the heart ; ( 2 ) reduced numbers of cd4 , cd8 , and ifn--producing cells in the heart ; ( 3 ) decreased fibrosis in cardiac tissues ; ( 4 ) decreased inos expression and no production in the heart ; ( 5 ) decreased tnf- and ifn- in the heart ; ( 6 ) increased il-10 in the heart ; and ( 7 ) decreased oxidative stress in erythrocytes [ 6365 ] . the survival of 5-lo - deficient mice was greatest when the animals were infected with low number of parasites when compared to animals infected with higher number of parasites . taken together , these findings suggest that lts , and specifically ltb4 , play important roles in the control of chagas disease . the supernatant of viable t. vaginalis induced increased ltb4 production in neutrophils in an igg- and complement-(c5- ) dependent manner . this effect was decreased by sc-41930 ( ltb4 antagonist ) treatment . in the vaginal discharges from patients with vaginal trichomoniasis , shaio and lin demonstrated a positive correlation between neutrophils and ltb4 production in symptomatic patients when compared to asymptomatic patients . peritoneal and splenic macrophages from nave mice incubated directly with e. histolytica trophozoites or with their excretory / secretory products show increased ltc4 production . on the other hand , peritoneal and splenic macrophages from e. histolytica - infected mice produced low levels of ltc4 . the downregulation of ltc4 by e. histolytica in inflammatory but not nave macrophages might be associated with the pathogen 's evasion mechanisms .",
"over one - third of the human population is infected with one or more species of helminths [ 69 , 70 ] . although host immune responses attempt to control or expel the parasites , these organisms can develop evasion strategies to modulate the innate and adaptive immune responses , allowing them to survive . the most prevalent human helminthiases are caused by nematodes ( e.g. , ascaris lumbricoides , strongyloides spp . , enterobius vermicularis , and trichuris trichiura ) , including filarial worms ( e.g. , brugia malayi and wuchereria bancrofti ) , hookworms ( e.g. , ancylostoma duodenale and necator americanus ) , and trematodes ( schistosoma spp ) . asthma and helminthiasis present similar features and are both controlled by a cd4 t - cell immune response . initial exposure of the immune system to allergic or parasitic antigens leads to the activation of a subset of t cells known as th2 cells , which orchestrate the immune response to these exogenous antigens by secreting cytokines , including il-4 , il-5 , and il-13 [ 7174 ] . in addition , the accumulation of eosinophils in the blood ( eosinophilia ) , as well as in different organs and tissues , is a hallmark of both diseases . eosinophils are multifunctional cells that are involved in tissue damage as a consequence of the release of cationic proteins [ 7679 ] . in addition , eosinophils are important sources of various inflammatory and regulatory cytokines , chemokines , and lipid mediators , such as lts [ 78 , 80 , 81 ] . during a helminth infection such as a nematode infection , most of the ige produced binds to mast cells and basophils through their high - affinity ige fc receptor ( fcri ) [ 82 , 83 ] . subsequent exposure of immune cells to parasitic antigen induces the degranulation of ige - sensitized mast cells and the release of both preformed and newly generated mediators . these mediators , such as lts , function alone or in conjunction with th2 cytokines to increase the contractility of smooth muscle cells , the permeability of epithelial cells and the production of mucus , thereby contributing to worm expulsion . the experimental gastrointestinal infection of rats with the nematode trichinella spiralis demonstrated that preimmune rats ( previously infected with t. spiralis ) expelled the nematode t. spiralis more rapidly than nonimmune rats . this effect was associated with the increased production of ltb4 and ltc4 in the gut homogenate as well as the release of rat mast cell protease ii ( rmcpii ) in the serum [ 85 , 86 ] . ltc4 causes smooth muscle contraction , increases vascular permeability , and stimulates mucus hypersecretion , and ltb4 recruits and activates inflammatory cells such as eosinophils to favor the expulsion of helminths . therefore , leukotrienes released from mast cells may effectively participate in protective immune responses resulting in the rapid expulsion of t. spiralis and possibly other helminths . the main effects of lts , in both innate and adaptative immune responses , during the helminth infections are illustrated in figure 3 . parasitic worm survival in the host for longer periods depends on the ability of the parasite to evade the host immune system . the aba-1 protein from ascaris lumbricoides ( human parasite ) and ascaris suum ( pig parasite ) the interaction between aba-1 and leukotrienes might be associated with an evasion mechanism ; however , further studies are needed to evaluate the ability of this interaction to inhibit the biologic effects of lts in vitro or in vivo . \n brugia malayi is a nematode ( roundworm ) that can cause lymphatic filariasis in humans . the infective larvae ( l3 ) of brugia malayi are transmitted to a vertebrate host by an insect vector and undergo two molts to develop into adult worms and complete the life cycle . interestingly , treatment with inhibitors of lipoxygenases ( aa861 ) or cyslt biosynthesis ( ethacrynic acid or acivicin ) or with a cyslt1 antagonist ( zafirlukast ) inhibited the brugia malayi l3 larvae from molting to the l4 stage without altering their survival or motility . in contrast , u-75302 , an antagonist of the ltb4 receptor btl1 , failed to inhibit molting . the -glutamyl transpeptidase , the enzyme that converts ltc4 to ltd4 , has been cloned from brugia malayi ( adult worms ) . in another filaria that causes human infection , dirofilaria immitis , the glutathione s - transferase , which can function as an ltc4 synthase , these results demonstrated that a lipoxygenase pathway involved in the generation of cyslts could be required for molting of the infectious larvae and may possibly have some role in the adult worm . in vivo models of infection with b. malayi could be used to better understand the role of cyslts in the pathogenesis of filariasis . it is widely known that some types of infections in immunocompromised individuals are critical in determining the severity of the disease . the immunosuppression observed in hiv - seropositive subjects has been associated with strongyloides spp infections of abnormally high intensity . interestingly , reduced lt production was observed in hiv - seropositive patients . in an experimental model that mimics human strongyloidiasis ( mice infected with strongyloides venezuelensis ) , an increase in the concentration of ltb4 but not of ltc4 was observed in the lung and small intestines . in addition , increased larvae recovery in the lung and/or increased worm burdens in the intestines were observed in animals treated with mk886 ( a selective inhibitor of 5-lipoxygenase - activating protein ( flap ) ) and in 5-lo - deficient mice than in control animals . moreover , treatment of animals with mk886 resulted in decreases of igg1 and ige levels in serum , eosinophil numbers in the blood , peritoneal cavity and bronchoalveolar fluid volumes and il-5 concentrations in the lung homogenate as well as increased levels of il-12 , which is involved in the th1 response . il-5 is the major cytokine involved in the accumulation of eosinophils in the blood during allergic inflammation and parasitic infections . this cytokine is essential for eosinophil migration from the bone marrow to the blood [ 72 , 95 ] and specifically supports the terminal differentiation and proliferation of eosinophil precursors as well as the activation of mature eosinophils [ 9699 ] . ltb4 regulates il-5 production by human t lymphocytes and consequently contributes to parasite elimination . these findings suggest that lts , and specifically ltb4 , might be necessary to control s. stercoralis infection . thus , the reduced levels of ltb4 observed in hiv - seropositive subjects might favor opportunistic hyperinfection with s. stercoralis ; however , further human studies are needed to evaluate this association . \n toxocara canis is an intestinal parasite of dogs and is the etiologic agent of toxocariasis , also known as visceral larva migrans syndrome ( vlms ) . infection of both humans and animals with t. canis is characterized by eosinophilia in the blood and tissues , increased total serum ige , and inflammation of the upper respiratory system [ 72 , 95 , 101104 ] . during the inflammatory response , leukocyte recruitment is directly related to the expression of adhesion molecules , which allows the transmigration of these blood cells to the tissues . it has been proposed that the 2 integrin mac-1 ( cd11b / cd18 ) and the 1 integrin vla-4 ( cd49d / cd29 ) adhesion molecules are the major molecules involved in cytokine- and chemokine - induced adhesion and migration of eosinophils in vitro [ 106 , 107 ] . t. canis infection causes early upregulation of mac-1 with late changes in vla-4 profiles on both peritoneal cavity fluid and bronchoalveolar lavage fluids , whereas mk886 treatment promoted the opposite effect . in addition , lt inhibition had a clear impact on eosinophil recruitment to tissues and on blood eosinophilia throughout the course of infection . in another study , in addition to increased eosinophil numbers , the researchers showed increased numbers of mast cells in the peritoneum , lungs , and small intestines of t. canis - infected rats . interestingly , these animals increased the concentration of ltb4 in the serum and this was correlated with mast cell and eosinophil accumulation and/or recruitment . thus , lts might play an important role in eosinophilic inflammation during toxocariasis by inducing leukocytes recruitment and modulating the expression of adhesion molecules . in schistosomiasis , lts can control parasite infection by modulating immune responses and through direct cytotoxic effects on the parasite . ltb4 , but not cyslts ( ltc4 and ltd4 ) , enhanced the ability of neutrophils and eosinophils to kill the schistosomula of s. mansoni in a complement - dependent manner . the cytotoxicity of eosinophils against helminths has been associated with the expression of cellular receptors ( high affinity ige receptor , fcri ) and adhesion molecules and with degranulation and the release of cationic proteins . in an in vitro assay , ige - coated schistosomula induced eosinophil adherence , resulting in the death of the parasites . in addition , the release of ltc4 was observed during this interaction . in agreement with this finding , schistosomula can produce ltb4 and ltc4 . the function of lts in schistosomula is not known ; however , their production might accelerate parasite elimination and/or modulate the pathogenesis of schistosomiasis . in addition to the proteolytic enzymes produced by cercariae , host - derived skin essential fatty acids and lts including ltb4 also play important roles in the penetration of the skin by the parasite . in an in vitro assay , increased penetration rates were correlated with increased lts levels . in addition , penetration was reduced upon treatment with a 5-lo inhibitor [ 116 , 117 ] . hepatic stellate cells ( hscs ) are involved in liver remodeling due to collagen production and deposition of extracellular matrix as a consequence of proliferative and fibrogenic phenotypes induced by several mediators ( cytokines , lipid peroxide , and others ) . mrna for 5-lo , flap and ltc4-synthase and 5-lo expression was observed in hscs from schistosomal granulomas of s. mansoni - infected mice . consequently , these cells produced cyslts , but not ltb4 , and the production of cyslts was increased upon treatment with transforming growth factor beta ( tgf- , a fibrogenic cytokine ) . the proliferation induced by tgf- in hscs from schistosomal granulomas of s. mansoni - infected 5-lo - deficient mice or wild type mice treated with zileuton ( 5-lo inhibitor ) was reduced . in addition , ltc4 induced tgf- production , suggesting a synergic effect in schistosomal granulomas . in another study , dipeptidases were isolated from extracts of hepatic granulomas of mice infected with s. mansoni ; these enzymes increased the hydrolysis of ltd4 to lte4 , potentially accelerating the metabolism of lts and decreasing their effects on liver remodeling . moreover , ltb4 and ltc4 are produced by schistosomula and adult females , while males produced only ltb4 . together , these results suggest that cyslt inhibition might influence liver remodeling in s. mansoni infection . in this way , cyslt1 antagonists ( such as montelukast , zafirlukast , and pranlukast ) [ 4 , 122 , 123 ] , which are currently used in asthma treatment , could be evaluated for their effects on schistosomal granuloma remodeling in experimental or human schistosomiasis . similar to schistosomiasis , fasciolosis causes liver alterations , which can range from fibrosis to cirrhosis . fasciolosis is considered both a human health concern and a veterinary problem ( zoonoses ) . during the course of f. hepatica infection in sheep , a reduction in serum ltb4 was observed when compared to control animals . interestingly , ltb4 was produced in both the culture supernatant and the homogenate of f. hepatica adult parasites recovered from the bile duct 20 weeks after infection . moreover , recruitment of leukocytes consisting mainly of eosinophils , macrophages , and lymphocytes was observed in the livers of goats infected with f. hepatica . in this way , ltb4 produced by host inflammation in synergy with that produced by the parasite could contribute to liver alterations and consequent pathology .",
"lts are associated with the control of helminth and protozoan infections through their ability to modulate inflammatory processes and/or to promote direct cytotoxicity of protozoans . in addition , lts may also be associated with exacerbated pathogenesis in protozoan diseases , such as cerebral malaria , and helminthic diseases , such as schistosomal granulomas . interestingly , some helminths ( b. malayi ) might use the lts to complete their development to adult worms . in addition , other parasites produce lts ( s. mansoni and f. hepatica ) or produce enzymes involved in lt biosynthesis ( dirofilaria immitis ) . taken together ,"
] | leukotrienes ( lts ) , formed by the 5-lipoxygenase-(5-lo- ) catalyzed oxidation of arachidonic acid , are lipid mediators that have potent proinflammatory activities . pharmacologic or genetic inhibition of 5-lo biosynthesis in animals is associated with increased mortality and impaired clearance of bacteria , fungi , and parasites . lts play a role in the control of helminth and protozoan infections by modulating the immune system and/or through direct cytotoxicity to parasites ; however , lts may also be associated with pathogenesis , such as in cerebral malaria and schistosomal granuloma . interestingly , some proteins from the saliva of insect vectors that transmit protozoans and secreted protein from helminth could bind lts and may consequently modulate the course of infection or pathogenesis . in addition , the decreased production of lts in immunocompromised individuals might modulate the pathophysiology of helminth and protozoan infections . herein , in this paper , we showed the immunomodulatory and pathogenic roles of lts during the helminth and protozoan infections . |
[
"the term replication stress describes the slowing or stalling of replication forks by endogenously or exogenously derived impediments to dna polymerization ( zeman and cimprich , 2014 ) . replication stressors can be local factors , such as dna damage or secondary structures that affect forks randomly as they are encountered , or global ones , such as nucleotide pool depletion or imbalance that simultaneously slows all forks ( poli et al . , 2012 , it is now recognized that replication stress induced by nucleotide pool imbalance is an important consequence of the activation of some oncogenes , which drive cells into s phase without upregulation of nucleotide supply ( bester et al . , 2011 ) . the resulting loss of polymerase processivity is thought to lead to localized uncoupling of the replicative helicase and polymerase and formation of tracts of single - stranded dna ( byun et al . , 2005 , pacek and walter , 2004 ) . while this normally induces checkpoint activation and senescence ( bartkova et al . , 2006 , , in cells that can bypass the checkpoint , such replication stress provides a fertile source of genetic instability , particularly in the vicinity of fragile sites and sites capable of forming secondary structures ( de and michor , 2011 , tsantoulis et al . , 2008 ) . in addition to the extensive genetic changes that have been well documented in many types of cancer , there are also extensive local and global alterations in histone and dna modifications . the consequent changes in chromatin structure are accompanied by significant dysregulation of gene expression ( timp and feinberg , 2013 , berdasco and esteller , 2010 ) , which , since it is not accompanied by changes in the dna sequence , may be considered epigenetic ( berger et al . , 2009 ) . these epigenetic changes could act alongside genetic instability to produce clonal variation within a tumor , upon which selective pressure can act , and so may contribute to tumor evolution . mutations in histone and dna - modifying enzymes , and even histone proteins themselves , have been found in several cancers and are likely to explain at least some of the observed epigenetic instability ( timp and feinberg , 2013 ) . however , it is not clear that mutations in histone - modifying enzymes account for all the alterations observed in different cancer types . we recently provided evidence that deficiencies in enzymes responsible for replicating g quadruplex ( g4 ) structures , such as the specialized dna polymerase rev1 and helicases fancj , wrn , and blm , can lead to localized changes in histone modifications and gene expression ( sarkies et al . , 2010 , sarkies et al . , 2012 , schiavone et al . , 2014 ) . g4s can form within motifs comprising four short runs of dg bases , separated by linker sequences . the dg bases in the motif form planar hoogsteen - bonded quartet structures that can stack on top of each other , resulting in an often highly thermodynamically stable secondary structure , the g4 ( reviewed in maizels and gray , 2013 ) . we proposed that persistent replication fork stalling at g4s in mutants such as rev1 or fancj leads to pathologically long daughter strand gap formation , resulting in local uncoupling of dna synthesis from parental histone recycling . this , in turn , leads to loss of the histone modifications present on the parental chromatin , which , if in the vicinity of a gene promoter , results in changes in transcription ( sarkies et al . , 2010 , sarkies et al . , 2012 , schiavone et al . , a prediction of this model is that global replication stressors that lead to loss of processive dna polymerization with uncoupling of the replicative helicase and polymerase also should promote epigenetic instability by dissociating dna synthesis from histone recycling . here we test this hypothesis by examining the effect of hydroxyurea ( hu)-induced nucleotide pool depletion on the epigenetic stability of a sensitive reporter locus , bu-1 , in chicken dt40 cells ( sarkies et al . we show that chronic treatment with low - dose hu induces stochastic instability of bu-1 expression , characterized by loss of the chromatin marks h3k4me3 and h3k9/14ac seen in the normally active locus . this instability depends significantly on the presence of a g4 motif 3 of the promoter , oriented to stall the leading strand of a fork heading toward the transcription start site ( tss ) . the presence of this g4 motif not only increases the rate at which bu-1 expression is lost , but is additionally associated with phosphorylation of h2ax and appearance of the heterochromatic mark h3k9me3 . this is consistent with the g4 acting to focus dna damage induced by the global replication stress imposed by hu , with the damage leading to repression of the locus . further , we show that , across the genome , chronic exposure to hu results in an altered pattern of gene expression similar to that seen in cells lacking the g4-unwinding helicases fancj , wrn , and blm , and that affected genes are enriched in g4 motifs . together , these observations indicate that nucleotide depletion can combine with naturally occurring dna secondary structures to promote epigenetic instability .",
"we first sought conditions in which we could culture dt40 cells in low - dose hu such that replication is slowed but completed ( alvino et al . , 2007 ) . we therefore exposed wild - type dt40 cells to a range of hu concentrations and monitored their doubling time . the cells were able to proliferate for over a week in up to 150 m hu ( figure 1a ) . at this dose , their doubling time increased from 12.3 to 32.7 hr , recovering when the hu was washed out ( figure 1a ) . to determine the effect of low - dose hu on replication dynamics , we performed dna molecular combing after pulse labeling the cells with halogenated nucleotides ( figure s1a ) 3 days after initiating culture in hu . average fork velocity decreased from 1.26 to 0.71 kb / min ( figure 1b ) , with a compensatory decrease in average interorigin distance from 72 to 40 kb ( figure 1b ) . consistent with these perturbed replication dynamics , cell - cycle profiles revealed a significant accumulation of cells in s phase while in hu ( figure s1b ) . we have reported previously that replication - dependent transcriptional instability associated with g4 motifs can be monitored by following expression of a surface marker , bu-1a , in dt40 cells ( sarkies et al . , 2012 , schiavone et al . , 2014 ) . the bu-1 locus contains prominent g4 motifs 3.5 kb downstream of the tss and 3 kb upstream . both are orientated to be g - rich on the feature strand with respect to the bu-1 transcript ( figure 1c ) . epigenetic instability of bu-1 in rev1 cells is entirely dependent on the + 3.5 g4 motif , and it requires the motif to be orientated such that its g - rich strand forms on the leading strand of a replication fork entering the locus from the 3 end ( figure 1c ; schiavone et al . , 2014 ) . we have reported previously that the bu-1 locus is bidirectionally replicated , meaning that during any given s phase there is a 50% probability of the + 3.5 g4 being replicated on the leading strand template ( schiavone et al . , 2014 ) . growth of wild - type dt40 cells in 150 m hu resulted in the appearance of a bu-1a population as cells divided over the course of 7 days ( figure 1d ) . surface expression of bu-1a correlates closely with transcript abundance ( sarkies et al . , 2012 ) , and this held true for bu-1a clones recovered after hu treatment ( figure s1c ) . to estimate the rate at which bu-1a variants are formed in hu , we performed a fluctuation analysis by expanding multiple parallel populations of 10 bu-1a cells in hu for 7 days , after which we monitored the appearance of bu-1a variants . this revealed a striking degree of expression instability despite the small number of cell cycles through which the cells had passed ( figure 1e ) . using our previously described monte carlo simulation of bu-1a loss as a replication - dependent phenomenon ( schiavone et al . , 2014 ) , we estimated a per - division probability of generating of a bu-1a state during culture in hu of c. 0.15 . to obtain additional evidence that this induced transcriptional instability of bu-1 reflected decreased dna polymerase processivity , we asked whether bu-1 variants could be induced by aphidicolin . aphidicolin slows replication by directly inhibiting dna polymerases , particularly pol ( oguro et al . , 1979 ) , and a low dose induces replication stress ( pacek et al . , 2006 ) . dt40 cells were able to proliferate in up to 150 m aphidicolin for 10 days and , as with low - dose hu , this resulted in substantial instability of bu-1a expression ( figure 1f ) . we have shown previously that removal of the + 3.5 g4 motif from both alleles of bu-1 in rev1-deficient cells results in complete stabilization of expression of the locus ( schiavone et al . , 2014 ) . we therefore examined the extent to which this motif also accounted for the observed hu - induced instability of bu-1a expression in wild - type dt40 . we grew wild - type cells lacking the + 3.5 g4 on both alleles , bu-1 ( schiavone et al . , 2014 ) , in hu and assessed the frequency of bu-1a variants after 7 days by fluctuation analysis ( see figure e3 in schiavone et al this revealed that removal of the + 3.5 g4 motif resulted in a significant reduction in the rate at which bu-1a variants were generated . however , it did not result in complete stabilization of the locus ( figures 2a and 2b , i and ii ) . we considered the possibility that the residual instability could be due to the 3.0 g4 upstream of the tss . however , deleting this motif ( figure s2 ) had no impact on hu - induced instability ( figure 2b , iii ) . to confirm the contribution of the + 3.5 g4 motif , this resulted in the return of the high - level hu - induced instability of bu-1 expression observed in wild - type cells ( figure 2c , i ) . however , this was not seen if the motif was mutated to render it incapable of forming an intramolecular g4 ( figure 2c , ii ) or when it was inverted so that the g4 structure would form on the lagging strand template ( figure 2c , iii ) . thus , hu treatment alone can induce instability of bu-1a expression , but its effect is significantly potentiated by the presence of a g4-forming sequence orientated to stall the leading strand replication of a fork heading toward the tss . we next investigated the basis for the hu - induced generation of bu-1a variants . to test whether the bu-1 state is permanent , we isolated five bu-1 clones at the end of 1-week growth in hu and cultured them for a further 3 weeks in hu - free medium . the clones remained stably bu-1 with no evidence of reversion to bu-1 , suggesting that this was a permanent change . we considered the possibility that bu-1 cells resulted from genetic changes in the locus , although the observed rate of mutation would be extraordinarily high for this to be the case . we therefore sequenced the region around the + 3.5g4 to look for mutation of the motif and used pcr with restriction digestion to detect larger deletions ( figure s3 ) . neither assay revealed any evidence of genetic instability consistent with the formation of bu-1 variants being an epigenetic event . we therefore examined the pattern of histone modification at the bu-1 promoter by chromatin immunoprecipitation ( chip ) from bulk populations of cells exposed to hu . bu-1 is a transcriptionally active locus characterized by high levels of h3k4me3 around its tss . after 48-hr treatment with hu , we observed a small but not significant loss of h3k4me3 at the bu-1 promoter ( figure 3a ) , consistent with the size of the population of bu-1a cells generated by this time point ( figure 1d ) . however , after 7-day treatment , we observed a more significant loss of h3k4me3 correlating with the much larger population of bu-1a cells at this time point ( figures 1d and 2a ) . the loss of h3k4me3 was accompanied by a reduction in h3k9/14 acetylation ( figure s4 ) . seven days of hu treatment also induced a marked increase in h3k9me3 at the bu-1 promoter ( figure 3a ) . it has been proposed previously that hu - induced displacement of parental h3/4 and its buffering by the histone chaperone asf1 may lead to unscheduled heterochromatinization by ectopic deposition of pre - marked histones upon their release from asf1 ( jasencakova et al . , 2010 , schwab et al . , 2013 ) . alternatively , the appearance of h3k9me3 may result from dna damage - induced heterochromatinization , which has been observed following double - strand breaks ( ayrapetov et al . breaks can arise from fork collapse in hu ( petermann et al . , 2010 ) , and thus , if unscheduled incorporation of h3 with k9 methylation was responsible , then an increase in h3k9me3 would be observed irrespective of whether the + 3.5 g4 motif was present . however , if localized g4-induced dna damage was responsible , then the appearance of h3k9me3 would be dependent on the + 3.5 g4 motif . we therefore examined h3k4me3 and h3k9me3 at the promoter of bu-1 in cells lacking the + 3.5 g4 motif . after 7 days in hu , h3k4me3 was reduced ( figure 3b ) , but to a lesser extent than in wild - type cells ( figure 3a ) , consistent with the reduced rate at which bu-1a variants are generated in cells lacking the + 3.5 g4 motif ( figure 2b ) . however , we observed no associated increase in h3k9me3 ( figure 3b ) . to monitor the extent to which hu induced dna damage in the two situations , we performed chip for phosphorylated h2ax ( h2ax ) ( rogakou et al . , 1998 ) at the bu-1 promoter . h2ax was enriched 2.5-fold at the bu-1 promoter in wild - type cells after 7 days in hu , but not enriched in cells lacking the + 3.5 g4 motif grown under the same conditions ( figure 3c ) . this favors a model in which heterochromatinization of bu-1 in hu is promoted by dna damage , likely from fork collapse associated with the + 3.5 g4 motif . we next examined the extent to which hu - induced changes in histone modifications were permanent by performing chip at the bu-1 promoter in the five stable bu-1a clones discussed above . this revealed that promoter h3k4me3 remained low , showing that loss of this mark was permanent ( figure 3d ) . thus , while h3k9me3 is induced by hu in cells containing the + 3.5 g4 motif , this mark is not essential to maintain the bu-1a state . this may be because it is installed only transiently during repair of hu - induced dna damage in the locus , or because cells in which h3k9me3 persists are growth disadvantaged and are lost from the population . the data thus far were consistent with a working hypothesis that reduced polymerase processivity increases the probability of g4 formation at the + 3.5 g4 motif through exposure of more single - stranded dna within the replisome , which , in turn , focuses replication stalling at this site . implicit in this model is the idea that the + 3.5 g4 can form during replication but that it is usually rapidly resolved to maintain fork progression . we therefore reasoned that trapping the g4 structure using a g4-binding ligand also might induce instability of bu-1a expression in otherwise wild - type cells further , we predicted that g4 ligands and hu would act synergistically to destabilize expression of the locus . to test these ideas , we treated cells with the g4 ligand n - methyl mesoporphyrin ix ( nmm ) ( nicoludis et al . , 2012 ) . we first identified the maximum dose at which the cells retained normal viability and global replication dynamics . at 2 m nmm , the fork rate , as assessed by molecular combing , was 1.13 kb / min compared with 1.26 kb / min in wild - type cells , with no significant change in the inter - origin distance ( figure s5 ) . nonetheless , fluctuation analysis for bu-1a loss in wild - type and bu-1 cells cultured for 7 days in 2 m nmm revealed instability in bu-1a expression in wild - type cells , but not cells lacking the + 3.5 g4 motif ( figure 4a ) . since 2 m nmm does not in itself significantly reduce global fork rates and the agent will only interact with the formed g4 structure , not with just the linear dna sequence ( ren and chaires , 1999 ) , this observation is consistent with transient formation of g4s during normal replication . we next asked whether combining nmm - induced g4 stabilization with hu - induced reduction in polymerase processivity led to a further destabilization of bu-1 expression . interestingly , use of both drugs together resulted in significant toxicity , meaning that we had to reduce the dose of each drug by 50% in order to carry out the fluctuation analysis . as expected , growth of cells in hu at 75 m or nmm at 1 m individually had little effect on stability of bu-1a expression ( figure 4b ) . however , the combination of nmm and hu at these doses resulted in a significant increase in bu-1a instability , revealing a marked synergy between hu - induced replication stress and g4 stabilization . we replaced the natural + 3.5 g4 motif with a series of four g4 motifs of varying in vitro thermal stabilities ( schiavone et al . , 2014 ) . all four motifs ( g4 14 ) potentiated the formation of bu-1a variants upon treatment with hu ( figure 5a ) . interestingly , we observed no correlation between the degree of potentiation by the motifs and the in vitro melting temperature of the equivalent oligonucleotides ( figure 5b ) . however , there was a significant trend toward greater potentiation of bu-1a loss being associated with longer non - g loops in the range of 1 to 9 bp ( figure 5c , solid line ) . to explore this further , we also tested a single repeat of the g4 motif containing human ceb1 mini - satellite ( piazza et al . , 2012 ) , which has 18 bp between its first three and last run of dgs . this g4 motif , but not a mutated form that is incapable of forming a g4 structure in vitro ( piazza et al . , 2012 ) , also potentiated bu-1a instability after treatment with hu . however , this was not to a greater extent than the natural + 3.5 g4 dna with its central 9-bp loop , suggesting that there may be a limit after which lengthening the loop has no further effect . finally , we asked whether we could detect genome - wide evidence of an interaction between hu and g4s . we therefore performed affymetrix expression microarray analysis on cells before and after culture in 150 m hu . three parallel cultures of dt40 were treated with 150 m hu for 7 days , or mock treated , and then recovered into normal medium for 7 days , after which rna was prepared for array hybridization . despite this relatively short treatment , a total of 2,937 of 12,920 unique genes exhibited a change in expression of > 0.25 log2 units with p < 0.05 , with an approximately equal number of genes being upregulated and downregulated ( figure 6a ) . we previously have observed a similarly large number of dysregulated genes in cells deficient in the 5-3 g4-unwinding helicase fancj and in double mutants for the 3-5 helicases wrn and blm ( sarkies et al . , further , we found a highly significant overlap in the identity of dysregulated genes in the two sets , the direction in which their expression changed , and the association of the dysregulated genes with g4 motifs ( sarkies et al . we anticipated that if transcriptional dysregulation by hu was linked with g4s that there might be a significant similarity in the gene set altered by hu and the sets altered by loss of fancj and wrn / blm . indeed , the overlap in the identities of the genes dysregulated in all three conditions was highly significant ( figure 6b ) , as were the pairwise correlations in the direction of the change in expression ( figure 6c ) . nearly 68% of the 6,061 genes within the venn diagram in figure 6b have a g4 motif within 1 kb upstream of the tss and the end of the body of the gene in comparison with 59% of the 6,859 genes in the remainder of the array ( p < 1 10 ) ( table s1 ) . to ascertain whether the overlaps in the identity of dysregulated genes reflected the perturbation of common pathways in the three datasets , we analyzed the functional annotation terms associated with the genes in each set and in the overlap sets using david ( https://david.ncifcrf.gov ; huang et al . while treatment with hu resulted in dysregulation of genes with gene ontology ( go ) terms associated with cellular stress and nucleotide metabolism , a large number of miscellaneous go terms also were enriched to a similar degree ( table s2 ) . significantly , despite the large number of genes overlapping in the three datasets , there was no evidence of their being members of common pathways ( figure s6 ) . this is consistent with much of the dysregulation of expression resulting from processes that are not related to a coordinated physiological response either to treatment with hu or ablation of fancj or wrn and blm helicases . nonetheless , the degree of overlap in the dysregulated transcriptomes in these three conditions suggest that cells treated with hu and cells lacking fancj and wrn / blm face similar challenges . however , the enrichment of g4s in affected genes , while statistically significant , is still relatively modest , suggesting that other factors , such as secondary effects or other dna secondary structures , may be contributing as well .",
"numerous lines of evidence have linked replication stress with genetic instability ( halazonetis et al . , 2008 , zeman and cimprich , 2014 ) . imbalanced or depleted nucleotide pools during replication are an important cause of such stress and can arise from the expression of oncogenes uncoupling entry into s phase from upregulation of nucleotide supply ( bester et al . , 2011 ) . importantly , the dna damage resulting from replication stressors like hu or aphidicolin that act directly on the replicative dna polymerases is not randomly distributed across the genome , but is instead focused on sites that often have features that make them potentially problematic to replicate even under ideal conditions ( tsantoulis et al . , 2008 ) . many of these hotspots also correspond to classical fragile sites , in which chromosome breaks are observed after replication stress . such sites have been linked to regions depleted in replication origins , meaning that single forks have to traverse long distances ( letessier et al . , 2011 ) . thus , a combination of regions of low fork density and problematic structures may focus sites of fork collapse under conditions of global replication stress ( wickramasinghe et al . , 2015 ) . the mechanisms by which replication stress leads to epigenetic changes are less well explored . alterations in chromatin composition and structure are common features of cancer cells ( berdasco and esteller , 2010 , hansen et al . , 2011 , timp and feinberg , 2013 ) and are particularly associated with g4-dense breakpoint hotspots ( de and michor , 2011 ) . although the cell line we used in this study , dt40 , is itself transformed , we found no evidence of significant stress to the dna replication program under normal growth conditions . however , growth of the cells in low - dose hu recapitulated the key features of the acutely stressed replication observed in oncogene - expressing primary cells ( bester et al . we have been able to explore directly the interaction between global replication stress induced by nucleotide depletion and a dna secondary structure to demonstrate how they conspire to exacerbate replication - dependent epigenetic instability . we have provided evidence that two parallel epigenetic perturbations contribute to permanent and transient epigenetic changes following an episode of replication stress . the first mechanism relates to the uncoupling of the activity of replicative helicase and polymerase ( byun et al . , 2005 , pacek and walter , 2004 ) during hu treatment . this has been shown to lead to interruption of the normal flow of histones from the parental to the nascent daughter strands , with the histone chaperone asf1 buffering the displaced h3/h4 ( jasencakova et al . , 2010 ) . groth and colleagues suggested that their release from asf1 might lead to local alterations in epigenetic state of chromatin due to unscheduled incorporation of inappropriately marked histones ( jasencakova and groth , 2010 , jasencakova et al . , 2010 ) . ( 2013 ) invoked this model to explain an increase in heterochromatin formation in cells deficient in fancj , suggesting that failure to unwind lagging - strand template g4 structures in fancj - deficient cells led to unscheduled deposition of histones bearing marks that would lead to h3k9me3 and heterochromatin formation . however , this model does not adequately explain the bidirectional changes in gene expression changes seen either in fancj cells or in wild - type cells treated with hu ( sarkies et al . in contrast , the model we have developed previously , in which loss of processive replication at g4s leads to localized loss of parental histone mark recycling , could explain both derepression of loci , such as -globin ( sarkies et al . , 2010 ) , and loss of activation , as can be observed in the bu-1 locus ( sarkies et al . however , since the mechanism by which h3k4me3 is maintained during replication is poorly understood , the precise mechanisms by which replication impediments disturb the maintenance of this mark remain to be fully elucidated this mark is induced alongside the loss of h3k4me3 when the + 3.5 g4 motif is present and cells are exposed to hu . importantly , the appearance of this mark of heterochromatin is accompanied by h2ax phosphorylation , a marker of dna damage ( rogakou et al . , 1998 ) . g4 motifs have been linked to hotspots of genetic instability and translocation ( de and michor , 2011 ) . further , the g4 ligand pyridostatin , which acts similarly to nmm , leads to localized h2ax accumulation at g4 motifs across the genome , suggesting the formation of dna breaks ( rodriguez et al . , dna breaks have been shown to induce transcriptional repression ( shanbhag et al . , 2010 ) and to induce h3k9me3 even in a normally euchromatic locus ( ayrapetov et al . , 2014 ) . thus , the appearance of h2ax and h3k9me3 in the bu-1 locus only in hu - treated cells containing the + 3.5 g4 is consistent with collapse or incision of replication forks , already stressed by nucleotide depletion , that have stalled at the g4 . we therefore propose that nucleotide depletion can give rise to loss of parental h3k4me3 and the appearance of h3k9me3 by distinct mechanisms . h3k4me3 is lost stochastically as a result of interruption of parental histone recycling , a mechanism that is locally exacerbated by the presence of a g4 motif . in contrast , we propose that h3k9me3 may reflect protective transient heterochromatinization of the locus during repair of breaks resulting from hu - induced fork collapse at g4 structures ( figure 7 ) . in the case of loci like bu-1 , in which hu - induced epigenetic instability is linked to g4 formation , an interesting question is whether hu results in a greater opportunity for g4 formation during replication or diminished g4 resolution . it is not currently possible to formally distinguish these possibilities and indeed it is likely that elements of both are true . notably , the observation that the g4-binding ligand nmm can induce bu-1a expression instability at a dose that does not significantly impact on global replication dynamics provides strong evidence that g4 structures form readily during normal replication and that they are usually promptly resolved . the synergy between replication stress caused by nucleotide depletion and structured dna is of considerable potential importance to understanding the development of cancer . epigenetic changes are prevalent in many cancer types , although their origin is unclear , and likely complex ( berdasco and esteller , 2010 , timp and feinberg , 2013 ) . recently , several instances of epigenetic instability in cancer have been linked to mutations in histone or dna - modifying enzymes . however , the widespread and often apparently random nature of epigenetic changes in tumors suggests that other processes also may be at work . we have suggested previously that delayed replication of g quadruplex structures could contribute to the epigenetic diversity of cancer ( sarkies and sale , 2012 ) . however , mutations in enzymes that may cause this form of epigenetic instability , for example rev1 , fancj , wrn , and blm ( sarkies et al . , 2010 , sarkies et al . , 2012 ) , are rarely observed in sporadic cancers . replication stress , on the other hand , is emerging as an important feature of cancer cells , particularly in the early stages of their evolution ( bester et al . , 2011 , di micco et al . , 2006 , thus , we suggest that some of the epigenetic changes seen in tumors may be explained by problems managing replication blocks . consistent with this idea , both copy number variations and changes in dna methylation patterns in cancer have been linked to g4 motifs ( de and michor , 2011 ) . finally , it is worth noting that hu is used extensively in treatment of hemoglobinopathies , such as sickle cell disease and thalassaemia , as it can re - induce expression of the fetal -globin gene , ameliorating the effects of the defective adult globins found in these disorders ( platt et al . , 1984 ) . importantly , the effect of hu on -globin expression is unlikely to be specific , since chronic exposure to the drug leads to quite widespread changes in erythroid gene expression ( flanagan et al . , 2012 ) . although the -globin locus in humans has no g4 motifs in the immediate vicinity of its promoter , its key transcriptional regulator , bcl11a ( bauer et al . , 2013 ) , has a high density of g4 motifs on both sides of its tss . it will , therefore , be interesting to explore whether the mechanisms we propose here could help explain the action of hu on fetal globin expression .",
"dt40 cells culture and the strategy for removing and replacing the + 3.5 g4 motif in the bu-1 locus have been described previously ( schiavone et al . , 2014 ) . genetic manipulation of the + 3.5 g4 motif was performed in the bu-1a allele of cells in which the motif had been removed from the bu-1b allele to avoid the transvection - like effect between the alleles ( schiavone et al . , 2014 ) . oligonucleotides are listed in table s3 . for fluctuation analysis , 150 m hu ( sigma - aldrich , h8627 ) after 7 days , cells at a concentration between 0.2 and 1 10 were stained for 20 min at 37c with anti - bu-1a - phycoerythrin ( 1:100 , santa cruz biotechnology clone 5k98 , 70447 ) . bu-1a expression was assessed by flow cytometry using an lsrii cytometer ( becton dickinson ) . experiments with aphidicolin ( sigma - aldrich , a0781 ) and nmm ( frontier scientific , nmm580 ) were conducted in 96-well plates starting with ten cells expanded for 10 days . bu-1a cells were isolated after hu treatment using a moflo sorting cytometer ( dako - cytomation ) . chip was performed as described previously ( nelson et al . , 2006 ) with modifications . following a 10-min incubation at room temperature with 1% ( v / v ) formaldehyde , glycine was added to 0.2 m for 5 min . the extracted nuclei were sonicated at 4c using a bioruptor water bath sonicator ( diagenode ) with 30 cycles of 30 s separated by 30-s intervals . sheared chromatin samples were resuspended in dilution buffer ( 1.1% triton x-100 , 1.2 mm edta , 16.7 mm tris [ ph 8.0 ] , 167 mm nacl supplemented with pmsf , and a protease inhibitor cocktail ) . for immunoprecipitation , lysates were incubated overnight with the following antibodies at 4c : histone h3 ( 1:100 , cell signaling technology , 2650 ) , h3k4me3 ( 1:100 , cell signaling technology , 9727 ) , h3k9/14ac ( 1:200 , millipore , 17 - 615 ) , h3k9me3 ( 1:200 , abcam , ab8898 ) , h2ax ( 1:50 , abcam , ab2893 ) , and the negative control normal rabbit igg ( millipore ) . following overnight incubation at 4c with tumbling and four washing steps , the qpcr was performed with power sybr green master mix ( applied biosystems , 4367659 ) on an abi prism real - time cycler with the following cycle times : 50c for 2 min , 90c for 10 min , 45 cycles of 90c for 15 s plus 60c for 1 min . the cdna was made from 5 mg mrna with super rt ( ht biotechnology ) and oligodt primer in a final volume of 40 l . dna molecular combing was conducted 3 days into culture with 150 m hu . it was performed and analyzed as previously described ( guilbaud et al . , 2011 ) . rna was extracted from three independent wild - type cell populations treated for 7 days with hu and allowed to recover for another 7 days , as well as from three untreated parallel controls . microarray analysis was performed using r ( http://www.r-project.org/ ) and its bioconductor packages ( gentleman et al . , 2004 ) . raw cel files were processed using the robust multichip average ( rma ) algorithm available in the affy package ( gautier et al . , 2004 ) . genes that showed a change of > 0.25 log2 units relative to the mean wild - type intensity , with a p value of < 0.05 ( t test ) , were identified as exhibiting statistically significant transcriptional dysregulation . custom written r scripts were used to identify and plot genes co - dysregulated between different mutants . venn diagrams were generated with the limma package ( smyth , 2004 ) , and significance for the overlaps was calculated using fisher s hypergeometric distribution ."
] | summarynucleotide pool imbalance has been proposed to drive genetic instability in cancer . here , we show that slowing replication forks by depleting nucleotide pools with hydroxyurea ( hu ) can also give rise to both transient and permanent epigenetic instability of a reporter locus , bu-1 , in dt40 cells . hu induces stochastic formation of bu-1low variants in dividing cells , which have lost the h3k4me3 present in untreated cells . this instability is potentiated by an intragenic g quadruplex , which also promotes local h2ax phosphorylation and transient heterochromatinization . genome - wide , gene expression changes induced by hu significantly overlap with those resulting from loss of the g4-helicases fancj , wrn , and blm . thus , the effects of global replication stress induced by nucleotide pool depletion can be focused by local replication impediments caused by g quadruplex formation to induce epigenetic instability and changes in gene expression , a mechanism that may contribute to selectable transcriptional changes in cancer . |
[
"it has been proposed that solar devices based on thin film technologies and third - generation materials can greatly benefit from plasmonic and photonic structures that can assist with light trapping and absorption . one promising strategy is to replace the traditional transparent conducting oxide layer with a semitransparent metallic contact that exhibits a surface plasmon at visible wavelengths . structured appropriately , for example , by perforating with an array of sub - wavelength holes , the metal film can provide the high transparency and conductivity needed in a transparent electrical contact while also actively assisting with photon management . a recent study demonstrated a high - performing organic photovoltaic cell with a metal contact patterned with an array of sub - wavelength holes , providing the contact with broad featureless transmission throughout the visible spectrum and robust coupling to the semiconductor as a function of incident light angle . despite this progress , a key challenge is to probe and understand the details of the light - matter interactions between the incident photon , the surface plasmon modes of the structured contact , and the absorption properties of the active area . we have developed a set of small area , high - brightness spectroscopies that are appropriate for characterizing prototypes of light - harvesting devices utilizing plasmonic contact materials , for understanding the details of light - matter interactions in these systems . our primary interest in developing a set of rapid , high - sensitivity characterization tools capable of probing the influence of the perforated metal nanostructure , including pore size and pitch , as well as film thickness on the optical transmission modes , and ultimately the effect on solar cell performance . the aim is both to enable rapid screening of test device structures and to design structures capable of providing specific physical insight into coupling between the device active area and the modes of the patterned metal film . our strategy utilizes fourier transform ( ft)-based measurements in the solar portion of the optical spectrum , for optimally combining spatial resolution , spectral resolution , speed , and dynamic range . ft - based measurements are highly advantageous for characterizing nanoscale photovoltaic materials in the visible and near infrared ( nir ) portions of the electromagnetic spectrum , although they are more typically applied in the infrared . as compared to scanned techniques , ft photocurrent measurements benefit from the multiplex ( fellgett ) advantage because the detectors are not shot - noise - limited , unlike in optical measurements employing low - noise photodetectors ( e.g. raman scattering with a high sensitivity ccd or pmt ) . this is particularly important since , unlike dispersive optical measurements ( e.g. transmission , pl , and raman ) , photocurrent multi - channel detection with scanned sources is not typically possible . for measurements of photovoltaic phenomena , the throughput advantage ( jacquinot ) is much less relevant due to the lower required resolution , when compared to vibrational or high - resolution absorption measurements . this is particularly true when using a high - brightness light source and a small sample size such that the throughput becomes comparable to a scanned source . however , ft - based measurements still typically have more bandwidth capabilities , as there is no need to switch gratings between the visible and the nir .",
"the key to the experiment is achieving solar ( or higher ) spectral irradiance levels in a spot size of < 100 m in order to achieve high signal / noise external quantum efficiency ( eqe ) measurements on prototype devices . we have recently demonstrated the power of these types of measurements on individual single - walled carbon nanotube field effect transistors , but the benefit is equally applicable to other structures with active areas of the order of ( 100 m ) , such as photonic structures that are difficult and/or time - consuming to fabricate over large areas . achieving a high irradiance in a small area requires the use of high radiance sources . the alternative increasing the power without increasing the size of the source or solid angle of radiation becomes impractical at these size scales , because most of the photon flux would be wasted . in the mid- to far - ir , similar advantages are gained using synchrotron - based sources for microspectroscopy . here , we achieve these advantages in the solar spectral region with an inexpensive benchtop source a true - cw high - brightness laser - driven light source ( energetiq eq-99 ) . this differs significantly from a laser , in that the output radiates incoherently into 4 rather than being highly directional and coherent . we have also examined laser supercontiuum sources for the same purpose ( e.g. fianium sc-450 ) , which are able to achieve even higher brightness levels due to the highly collimated output . however , for photocurrent and photovoltaic applications , we have found the laser - driven light source to be a much better choice for several reasons . primarily , the pulsed nature of the laser supercontinuum was found to generate small but detectable electrical transients that added significant noise to low - eqe regions of the spectrum . since a 200 m core multi - mode fiber is utilized to simplify alignment to the translating microscope optics , this negates the advantage a smaller emitter has in focusing capabilities . additionally , we have found it difficult to stay in a low - fluence ( solar - like ) regime with the pulsed laser ; focusing ps pulses with the full bandwidth of the laser has resulted in either saturation ( resulting in signal non - linearity ) or damage to samples and optical detectors , even with significant attenuation of the beam . we did not encounter the same issue for similar power levels in a true cw source . lastly , the laser - driven light source unit is significantly cheaper than the laser supercontinuum ( ~5 difference ) . similarly , other groups have found that despite the higher spectral power density of a supercontinuum source , the sensitivity of absorption - based measurements are higher with the ldls due to superior long - term stability . the laser - driven light source output is collimated by an off - axis parabolic mirror ( 1.5 diameter , 2 efl , na = 0.375 ) and coupled into a commercial ft spectrometer ( bruker v80 ) using the backward input . the light is modulated using a broadband caf2 uv vis - nir beam splitter and the slowest rapid - scan setting available on our instrument ( 2.5 khz referenced to the hene line ) . the modulated light is sent to an output port of the spectrometer , where the remaining uv portion of the beam ( < 420 nm ) is filtered out . the broadband light is focused into a 200 m core multimode fiber used to couple the light into an upright optical microscope ( nikon fn-1 ) using a reflective collimating optic and a set of steering mirrors attached to an epi - illuminator . this microscope is designed for a stationary stage , such that electrical probes can be contacted with a sample via micromanipulators . as such , the microscope itself sits on a translating stage for sample visualization and beam alignment . the use of an optical fiber for coupling ensures that the beam stays aligned to the microscope even during translation . a 5050 beam splitter is used to simultaneously image and excite the device under test . for photoconductivity measurements , the photocurrent interferogram is sent through a trans - impedance amplifier ( dl instruments , 1210 ) and an electronic band - pass filter ( stanford research , sr650 ) before being digitized by the spectrometer bench electronics . to correct for the lamp spectrum and the transmission function of the bench and microscope optics , a set of photodiodes with known responsivity curves the resulting single - beam spectra from test devices are corrected by these reference spectra , which are collected at the same time as the unknown devices . the spot sizes at the output of the microscope are measured using a calibrated beam profiler ( ophir - spiricon ) . for transmission spectra , the sample compartment of the spectrometer is used , resulting in a spot size of 0.75 mm at the focus . samples are aligned to the beam using a xyz translating mount and the transmitted light is detected with a pyrolelectric detector ( la - dtgs ) . we define arrays of sub - wavelength holes across areas of ( 300 m ) by focused ion beam ( fib ) milling completely through 50 nm thick ag films sputter deposited on glass . holes with average diameter of 200 nm are milled using a beam of ga ions ( 0.26 na ) , with dwell times ranging from 2 to 8 ms for hole separations ( pitch ) ranging from 240 to 560 nm , respectively . after defining the perforated ag electrode , the subsequent organic photovolatic device fabrication steps include : thermal evaporation of 9 nm thick of moo3 electron - blocking layer ; spin coating ( 700 rpm for 60 s ) the 170 nm thick semiconductor active layer , a 1:1 wt . blend of poly(3-hexlythiophene ) : phenyl - c61-butyric acid methyl ester ( p3ht : pcbm ) ( 3 wt . % in chlorobenzene ) ; and thermal evaporation of a 200 nm al film , which serves as an electron - collecting ( and hole - blocking ) electrode .",
"we match the source , coupling , and focusing optics in order to optimize the throughput and achieve a high - brightness white - light spot . the critical quantity is the optical extent or tendue ( g ) of the system that will maximize the light throughput to the sample . it is this quantity that needs to be appropriately matched throughout the system to maximize the spectral irradiance , rather than the numerical aperture of the individual optical components . because g is proportional to both the area of the source and the solid angle into which it propagates , we aim to match the collimating and focusing optics without introducing a bottleneck ( e.g. the multimode optical fiber ) . the combination of the laser - driven light source and a parabolic mirror results in g ~ 3 10 mm sr , a value well matched to a 0.22 numerical aperture fiber with a 0.2 mm core size ( ~4.5 10 mm sr maximum g ) . the effective tendue of the sample is determined by the spot size of the light and the microscope objective used to image and focus the light . the numerical aperture of the objective determines the solid angle , but the spot size is not determined by the nominal magnification , which is referenced to a 200 mm tube lens . we assume that the reference specifying the magnification value is a 200 mm tube lens . here , the value of the objective magnification is now defined by the numerical aperture of the fiber itself and the collimating optic . as a result , the magnification of the objective is considerably smaller than the 10/50 values specified . for the 10 objective , we obtain nearly 1:1 imaging , with the core diameter of the multimode fiber limiting the ultimate spot size . for example , focusing the broadband ft - modulated light source with a 10 ( 0.3 numerical aperture ) long - working distance objective yields a measured spot size of ~215 m ( beam profile shown in figure 1(a ) ) . we can achieve a smaller spot size using the 50 objective , for two reasons . first , the higher numerical aperture results in additional magnification , and second , the smaller entrance aperture of the higher na objective slightly reduces the collimated beam size ( thereby reducing the effective source size and the tendue out of the fiber ) . the net result is a reduction in spot size to ~40 m using the nominal 50 ( 0.45 numerical aperture ) objective . as we discuss below , this small reduction in throughput still results in an overall higher spectral irradiance . these larger - than - diffraction - limit spots are due to the necessity of using of a multimode optical fiber to accommodate a large spectral bandwidth . using a single - mode fiber and a monochromatic solid - state laser , we can achieve near diffraction - limited spots using these same optics . from the measured spot sizes and the focal length of the objectives , we can determine the ntendu of the sample in order to find the overall limiting factor in the optical system . in all cases , the ntendue of the 10 objective is higher than that of the source and fiber , meaning that the limiting factor is not the small area of the detector ( i.e. sample ) . ( a ) beam profile of the image formed using the eq-99 laser - driven light source and a low magnification 10 objective . the spot size is approximately 215 m with the 10 and 40 m with the 50 . ( b ) spectral irradiance in the visible and near infrared with the 10 and 50 objectives compared to the solar air mass 1.5 standard ( astm g-173 ) . ( the colour version of this figure is included in the online version of the journal . ) with the combination of a high - radiance light source and microscope focusing optics , we can achieve high - spectral irradiances for highly sensitive quantum efficiency measurements on small area devices . the spectral irradiance is shown in figure 1(b ) for the output of the ldls microscopy system with the 10 and 50 objectives , along with the solar air mass 1.5 ( astm g173 - 03 ) spectrum for comparison . the key metric is that the solar spectral irradiance can be matched or exceeded across the visible and nir , particularly in the visible region of the spectrum , where we achieve in excess of 10 times higher irradiances . these numbers can be further improved since a 50:50 beam splitter ( optimized for the visible ) is used to direct light into the microscope objective . replacing the dielectric optic with a metallic one would double the output in the visible , but result in even more significant gains in the nir . however , for the purposes of this study , the irradiances achieved are more than sufficient for our measurements . the overall photon flux achieved is also quite high due to strong focusing of the light beam , exceeding 4.5 10 ms with high spatial resolution .",
"we match the source , coupling , and focusing optics in order to optimize the throughput and achieve a high - brightness white - light spot . the critical quantity is the optical extent or tendue ( g ) of the system that will maximize the light throughput to the sample . it is this quantity that needs to be appropriately matched throughout the system to maximize the spectral irradiance , rather than the numerical aperture of the individual optical components . because g is proportional to both the area of the source and the solid angle into which it propagates , we aim to match the collimating and focusing optics without introducing a bottleneck ( e.g. the multimode optical fiber ) . the combination of the laser - driven light source and a parabolic mirror results in g ~ 3 10 mm sr , a value well matched to a 0.22 numerical aperture fiber with a 0.2 mm core size ( ~4.5 10 mm sr maximum g ) . the effective tendue of the sample is determined by the spot size of the light and the microscope objective used to image and focus the light . the numerical aperture of the objective determines the solid angle , but the spot size is not determined by the nominal magnification , which is referenced to a 200 mm tube lens . we assume that the reference specifying the magnification value is a 200 mm tube lens . here , the value of the objective magnification is now defined by the numerical aperture of the fiber itself and the collimating optic . as a result , the magnification of the objective is considerably smaller than the 10/50 values specified . for the 10 objective , we obtain nearly 1:1 imaging , with the core diameter of the multimode fiber limiting the ultimate spot size . for example , focusing the broadband ft - modulated light source with a 10 ( 0.3 numerical aperture ) long - working distance objective yields a measured spot size of ~215 m ( beam profile shown in figure 1(a ) ) . we can achieve a smaller spot size using the 50 objective , for two reasons . first , the higher numerical aperture results in additional magnification , and second , the smaller entrance aperture of the higher na objective slightly reduces the collimated beam size ( thereby reducing the effective source size and the tendue out of the fiber ) . the net result is a reduction in spot size to ~40 m using the nominal 50 ( 0.45 numerical aperture ) objective . as we discuss below , this small reduction in throughput still results in an overall higher spectral irradiance . these larger - than - diffraction - limit spots are due to the necessity of using of a multimode optical fiber to accommodate a large spectral bandwidth . using a single - mode fiber and a monochromatic solid - state laser , we can achieve near diffraction - limited spots using these same optics . from the measured spot sizes and the focal length of the objectives , we can determine the ntendu of the sample in order to find the overall limiting factor in the optical system . in all cases , the ntendue of the 10 objective is higher than that of the source and fiber , meaning that the limiting factor is not the small area of the detector ( i.e. sample ) . ( a ) beam profile of the image formed using the eq-99 laser - driven light source and a low magnification 10 objective . the spot size is approximately 215 m with the 10 and 40 m with the 50 . ( b ) spectral irradiance in the visible and near infrared with the 10 and 50 objectives compared to the solar air mass 1.5 standard ( astm g-173 ) . ( the colour version of this figure is included in the online version of the journal . )",
"with the combination of a high - radiance light source and microscope focusing optics , we can achieve high - spectral irradiances for highly sensitive quantum efficiency measurements on small area devices . the spectral irradiance is shown in figure 1(b ) for the output of the ldls microscopy system with the 10 and 50 objectives , along with the solar air mass 1.5 ( astm g173 - 03 ) spectrum for comparison . the key metric is that the solar spectral irradiance can be matched or exceeded across the visible and nir , particularly in the visible region of the spectrum , where we achieve in excess of 10 times higher irradiances . these numbers can be further improved since a 50:50 beam splitter ( optimized for the visible ) is used to direct light into the microscope objective . replacing the dielectric optic with a metallic one would double the output in the visible , but result in even more significant gains in the nir . however , for the purposes of this study , the irradiances achieved are more than sufficient for our measurements . the overall photon flux achieved is also quite high due to strong focusing of the light beam , exceeding 4.5 10 ms with high spatial resolution .",
"in order to demonstrate the utility of a technique having simultaneously high spatial resolution , spectral resolution , and high sensitivity , we examined a set of prototype organic photovoltaic devices that employed a nanostructured plasmonic ag thin film as a transparent electrical contact . first , we discuss the photophysical properties of the perforated metal films with sub - wavelength apertures , in order to best match the contact s optical properties to the light absorption bands in the organic active area . we fabricated the nanostructured electrical contacts by depositing a thin ag film on glass and using a fib tool ( fei helios dualbeam ) to mill square arrays of uniformly sized holes across typical areas of ( 0.3 mm ) ( scanning electron micrograph , figure 2(a ) ) . we can fully characterize even these small - area samples because of the high - brightness light source , therefore minimizing the associated fabrication time . the advantage of using the fib for fabrication is that the design can be varied ( e.g. adjusting hole size and/or diameter ) without the need for any process re - optimization . the variation in an average hole size introduced by our fabrication approach does not significantly affect the optical properties of the array . the absolute optical transmission spectra of ag films fully perforated with hole arrays having pitches ranging from 240 to 560 nm on glass show a series of peaks and troughs resulting from the plasmon and diffraction modes in the array ( figure 2(b ) . spectra are offset for clarity ) . as predicted from momentum conservation arguments , these mode positions are nearly constant on a wavelength - to - pitch ratio scale . ( a ) scanning electron micrograph of a silver thin film perforated with a hole array having a pitch of 400 nm . ( b ) absolute optical transmission spectra of 100 nm thick ag films with a total area of ( 300 m ) on glass vs. the wavelength / pitch ratio , for different pitch values . ( the colour version of this figure is included in the online version of the journal . ) the optical transmission properties of these perforated metal films are sensitive to the dielectric interfaces on either side , such that the modes of the film when assembled into solar cell will shift compared to those of the same metal film on glass . in order to understand the metal film transmission properties of our target device structure , we coat the perforated ag film ( 100 nm thick , 200 nm average hole diameter , and 400 nm average pitch ) with a 220 nm thick polymer layer ( microposit s1811 ) that mimics the dielectric constant of the organic semiconductor in the non - resonant regime of the spectrum , but does not exhibit significant absorption at visible wavelengths . to best imitate the device structure , we insert a 17 nm thick tio2 layer between the ag and polymer films , because such selective electronic transport layers are essential for organic device operation . we use finite difference time domain ( fdtd ) calculations ( lumerical solutions , inc . ) to understand the origin of the primary transmission resonances and their effect on the target photovoltaic device . we find reasonably good agreement between the measured ( figure 3(a ) , black ) and calculated ( figure 3(a ) , red ) transmission curves , with a primary maximum in the transmission spectrum at ~1020 nm and a minimum near ~930 nm . we believe the peak broadening in the nir results from hole size inhomogeneities . however , the hole pitch uniformity generates a resonance peak that is well matched to the calculation . ( a ) experimental ( black line ) and fdtd transmission spectrum ( red ) of a glass / perforated ag electrode ( height = 100 nm , diameter = 200 nm , pitch = 400 nm)/tio2 ( h = 17 nm)/polymer ( 220 nm)/air dielectric stack . normalized field intensity distributions , |e|/|e \n 0| for light with ( b ) = 927 nm and ( c ) = 1020 nm . in ( b ) and ( c ) , the glass spans from z = 0.2 m to z = 0 m , the ag mha spans from z = 0 m to z = 0.1 m ( and the hole in the ag layer spans from x = 0.1 m to x = 0.1 m ) , the tio2 layer spans from z = 0.1 m to z = 0.117 m , and the polymer layer spans from z = 0.117 m to z = 0.337 m . ( the colour version of this figure is included in the online version of the journal . ) our calculations allow us to examine the light intensities of corresponding spatial modes in order to identify the mechanism for light dissipation or transport . in figure 3(b ) and ( c ) , we plot the normalized field intensity |e|/|e \n 0| in the xz plane ( where incident light propagates in the + z direction , downwards in the figure ) . this calculation shows that at 927 nm ( figure 3(b ) ) , near the transmission minimum , the field intensity is delocalized throughout the polymer active area , with a minimum under the hole open area . this calculated spatial distribution is consistent with that of a wood s anomaly ( evanescent mode ) , which redirects the light propagation due to diffraction . in contrast , the normalized field intensity profile |e|/|e \n 0| for a wavelength near the transmission maximum ( 1020 nm ) shows feature characteristics of the near - field enhancement due to surface plasmon modes in the perforated metal film , resulting in hot spots of electric field intensity near the edges of the contacts along the metal - polymer layer . though one benefit of these plasmon modes is enhanced light transmission through sub - wavelength apertures , there is also an opportunity for modification of the absorption and radiative properties of the active layer via the purcell effect . though this subject is beyond the scope of the current manuscript , it does imply that the benefits of perforated metal films as electrical contacts potentially extend beyond their role as passive , light - transmitting elements . because the primary features in the transmission spectrum of the perforated metal film result from light - matter interactions at the metal / polymer interface , we can leverage this structure for design of a solar cell transparent electrical contact . in this demonstration , we employ a 35 nm thick ag film ( perforated with a square array of 200 nm diameter holes on a 410 nm pitch ) to couple light into a 160 nm thick active layer of blended organic p3ht : pcbm . the device also includes both hole transporting ( 10 nm thick moo3 ) and electron transporting ( 220 nm thick al ) on either side of the organic active layer ( schematic in figure 4(a ) and cross - sectional sem image in figure 4(b ) . ( a ) device schematic and ( b ) sem cross - section of an organic photovoltaic device with a perforated ag film as transparent contact . the high extinction due to absorption by the active layer occurs around 500 nm and is indicated by the arrow . ( d ) dark ( dot - dash ) and illuminated ( lines ) j v curves for fully fabricated devices using the ag / polymer materials shown in ( c ) . device hole array pitches are : 320 nm ( green ) , 400 nm ( red ) , and 480 nm ( blue ) . also shown is the performance of a similar device having an unpatterned 50 nm thick ag electrical contact ( dark : dashed , illuminated : black ) . ( the colour version of this figure is included in the online version of the journal . ) the optical transmission spectra of organic devices having metal contacts with a hole array of pitches 320 , 400 , and 480 nm ( figure 4(c ) , measured prior to forming the al electrical contact ) contain features in the nir region that are similar to that of the non - resonant model system ( figure 3(a ) ) , but show dramatic differences in the spectral regions where the p3ht : pcbm blend absorbs . the primary polymer absorption manifests as dramatic dip around 500 nm ( indicated with an arrow in figure 4(c ) ) . the magnitude of the transmission ( < 10% ) is similar to that of the electrode evanescent mode near 900 nm , and is consistent with an active area thickness of ~170 nm . although the primary propagating mode of the perforated ag film ( > 700 nm ) is far from the organic material absorption peak ( at 500 nm ) , higher order surface plasmon modes ( visible at shorter wavelengths in figure 3(a ) ) can nevertheless couple light efficiently into the device structure in order to generate photocurrent . for example , the current - voltage ( j v ) characteristics of fully assembled devices under illumination by 1 sun simulated am 1.5 g radiation display average photocurrent ( j \n sc ) in the range of j \n sc ~ 4 ma / cm ( nearly independent of hole array pitch ) , open circuit voltage , v \n oc \n = 0.58 v , and power conversion efficiencies around ~1% ( figure 4(d ) ) . although conventional transparent contact materials ( e.g. indium tin oxide ) have achieved power conversion efficiencies around ~4% in p3ht : pcbm devices , there are opportunities for considerable improvement by better matching the electrode s propagating mode to the absorption resonance in the organic layer . potential approaches to achieving performance improvements include scaling the hole arrays to smaller pitches , or leveraging recent breakthroughs in utilizing nir absorbing polymers which are better matched to the size of the perforated metal contacts described in this work . the high - brightness photocurrent measurement is ideal for acquiring high - sensitivity eqe spectra of these small - area devices ( 300 m ) ( figure 5 ) . although in these measurements we are not required to match the lamp spectrum to the solar spectrum , we nevertheless target an overall spectral irradiance comparable to that of solar illumination in order to avoid high - fluence recombination processes . the achievable spot size under low magnification is 215 m , well matched to our device area of ( 300 m ) and to the solar irradiance in the active region of the device . these measured eqe spectra result from averaging for approximately one minute in total , because the entire spectrum ( from 420 to 2500 nm ) is collected in a single shot . ft photocurrent spectra of ( 300 m ) area devices on a ( a ) linear and ( b ) log scale for organic photovoltaic devices with perforated metal film transparent contacts ( hole array pitches of 320 nm ( green ) , 400 nm ( red ) , and 480 nm ( blue ) , along with a reference device ( black ) utilizing an ito transparent contact . on a log scale , weak absorption by ct states can be visualized with over six orders of magnitude dynamic range . ( the colour version of this figure is included in the online version of the journal . ) the integrated eqe of the organic devices using perforated metal films as transparent electrical contact ( figure 5(a ) , green , red , and blue colors ) is approximately five times lower than a similar organic device having a traditional ito transparent contact ( figure 5(a ) , black ) , due primarily to low - light transmission through the contact in the wavelength range where the organic material absorbs strongly . unlike the j v measurement ( figure 4(d ) ) , the eqe spectrum more clearly demonstrates the effect of changing hole array pitch on the device performance . the primary absorption changes shape as a function of pitch and relative to the ito contact ( figure 5(a ) ) , with the most apparent difference being a flattening of the absorption spectra moving towards the uv region , compared to the conventional ito device . the high sensitivity of our high - brightness ftpc measurement facilitates detailed investigations of the nir spectral regions , where although the polymer shows weak absorption , the effect of coupling to surface plasmon modes is expected to be the strongest . previous high - sensitivity measurements on organic photovoltaic devices have shown that weak absorption characteristics of charge transfer ( ct ) states contribute to the overall photocurrent signal . the response of these ct states are readily seen on a log scale of the eqe spectra ( figure 5(b ) ) in both the ito and hole array contact devices . although the primary absorption features of the polymer are considerably weaker than the control devices , the ct absorption is not . in fact , structure in the ct absorption can be seen , leading to fluctuations ( particularly in the 480 nm pitch device ) that exceed those of the control . work is still on - going to separate the relative contributions of the propagating ( plasmonic ) and evanescent ( wave - guiding ) modes to the change in the overall eqe spectrum , and this will be the subject of future work . here , we stress that these types of studies are enabled by our ability to look at photocurrent spectra with more than six orders of magnitude of sensitivity with high spatial resolution . this allows us to quickly prototype and characterize photovoltaic devices employing plasmonic and photonic structures .",
"we demonstrate that high - sensitivity photocurrent spectroscopy can be achieved on small - area organic photovoltaic devices with greater than six orders of magnitude dynamic range in the eqe spectra . these methods can be used to understand the interactions between the plasmonic modes of sub - wavelength metal hole arrays and an organic absorber . there are several factors that must be considered when evaluating performance of these devices , including scattering of light perpendicular to the direction of incidence , enhancement of absorption and radiative rates in near fields via the purcell effect , and photonic confinement of the propagating modes in the fully assembled device stack ."
] | we present a methodology for probing light - matter interactions in prototype photovoltaic devices consisting of an organic semiconductor active layer with a semitransparent metal electrical contact exhibiting surface plasmon - based enhanced optical transmission . we achieve high - spectral irradiance in a spot size of less than 100 m using a high - brightness laser - driven light source and appropriate coupling optics . spatially resolved fourier transform photocurrent spectroscopy in the visible and near - infrared spectral regions allows us to measure external quantum efficiency with high sensitivity in small - area devices ( < 1 mm2 ) . this allows for rapid fabrication of variable - pitch sub - wavelength hole arrays in metal films for use as transparent electrical contacts , and evaluation of the evanescent and propagating mode coupling to resonances in the active layer . |
[
"heat shock proteins ( hsps ) are a group of proteins that repress the denaturation of molecules by various stressful circumstances such as exercise , gravity , heat , oxygen , ca etc . hsp family has a structurally common chaperone subset controlling the form of proteins folding ( misfolding , facilitating , or reconstructuring ) , which maintains homeostasis of proteins to stressful circumstances ( dimauro et al . , 2016 ) . heat - induced heat shock factor 1 controls transcriptional upregulation of hsps ( brinkmeier and ohlendieck , 2014 ) . small hsp ( shsp ) , hsp70 , and hsp90 exist in the cytoplasm and glucose regulated proteins ( grp ) 78 ( a homologue of hsp70 ) , bip , hsp47 are located in mitochondria to transmit each of specific functional proteins to mitochondria . tcp1 ( cytoskeleton forming chaperones ) is associated with neogenesis of actin and tubulin and shsp are involved in intracellular dynamics ( polymerization and depolymerization ) . a transcript ( unfolded protein response element , ure ; ccaaan9 ccacg ) binds to the sequence of the chaperone gene . hsp families are made up by range from 10 to more than 100 kda in molecular size , and are located in various cellular compartments . the expressional locations of homologue or cognate members of hsps ( such as hsc70 vs hsp70 or hsp90 vs hsp90 ) are arbitrary according to the accumulated evidences indicating cell or tissue restricted expressions in vivo systems . accumulated studies show that hsp families are located in various sites within cell ; hsp10 , hsp60 , and hsp75 are located in mitochondria , however , others are present in the cytoplasm , cytosol , endoplasmic reticulum and nucleus in physiological conditions ( xu , 2002 ) . the following general description involving molecular chaperones shows the outline regarding the maintenance of physiological homeostasis of living body . based on comprehensive studies of hsps , this review offers important information regarding the mechanism related with the characteristic procedure of signal pathway according to the specifically cared substrate of each hsp , structural characteristics , specifically expressed location and those roles .",
"molecular weight of shsp varied from 15 to 43 kda are also called heat shock protein ( hspbs ) and have a chaperoning function in the process of embryonic development . hspbs are also interacting with cytoskeleton proteins to maintain the homeostasis of cytoskeleton proteins by preventing those from damages , which results in conservation of the cell function . hspb1 , hspb6 , hspb7 , and hspb12 are involved in the development of respiratory morphology such as cardiac muscles and the lethal myopathy in diaphragm and cardiomyopathy is caused with the lack of those hspbs ( juo et al . , 2016 ; ke et al . , 2011 ; rosenfeld et al . , hsp10 ( chaperonin ) is considered as a suppressor of maternal immune response via releasing from fetal placental unit ( noonan et al . , 1979 ) . this includes 101 amino acids and is used as a plausible biomarker in endometrial cancer ( dub et al . , 2007 ) . hsp 10 in mitochondria plays a role in protein folding supplied by adenosine triphosphate ( atp ) ( table 1 ) ( meyer et al . , 2003 ) . it has been reported that hsp10 is a by - product during the process of neoplastic cell proliferation and is considered as a growth factor in the cell ( quinn and morton , 1992 ) . hsp10 is also known as an obligatory autocrine growth factor in tumor cells ( quinn et al . , 1990 ) . molecular size 1530 kda hsps are related with shsp and it has been know that there are 9 shsp in mammals ( mounier and arrigo , 2002 ) : hsp27 ( denoted hsp25 in mice ) , a- and b - crystallins , hsp20 , hspb2 , hspb3 , cvhsp or hspb7 , hsp22 or hspb8 , and hspb9 . human shsp has 105205 amino acids and -crystallin domain as a homologous 80 sequenced residues ( ingolia and craig , 1982 ) . this domain shows highly conserved structure and 38%60% of amino acid identity ( mounier and arrigo , 2002 ) . alpha - crystallin structure is influenced by factors such as ph , temperature , calcium ions , and ionic strength ( mounier and arrigo , 2002 ) . each of the shsp is phosphorylated via specific kinase to involve teleological signal pathway ( fig . hsp16.5 has been structurally studied that it has dimeric -crystallin domain as a basic structural domain unit and this common domain is possibly related with the basic function as a molecular chaperone ( bertz et al . , 2010 ) . ( 2006 ) reported a function of shsp on myosin enzymatic activity that b - crystallin cares atpase activity of myosin and the comparing rate shows 58% in relation to control ( 8% , without b - crystallin ) under 43c for 30 min . alpha b - crystallin maintaining atpase activity of myosin prevent aggregation of the protein and this is probably related with myofibrilogenesis without myosin unfolding that induces muscular performance under stress condition or vigorous exercise ( melkani et al . , 2006 ) .",
"forty - three kda sized hsps has various amino acidic sequences that results in different n - terminal length . those hsps also comprise conserved -crystallin core domains and c - terminal extension domain including highly conserved i - x - i / v motif ( ghosh et al . , 2005 ) . hsp47 acting as a chaperone for procollagen has been also found to be involved in atherosclerosis . heat shock and oxidized low density lipoprotein stimulate the expression of hsp47 mrna in smooth muscle cells . these findings identify hsp47 as a novel constituent of human coronary atheroma , and selective upregulation by stress raises the possibility that hsp47 may be a determinant of plaque stability . collagen , an extracellular matrix substrate , requires hsp47 to be transported within the cell and folded from three helices . hsp47 located in endoplasmic reticulum and functions to support collagen folding and its release to extracellular environments . hsp60 forms a large ( 970 kda ) hetero - oligomeric protein complex called the tcp1 ring complex ( containing tcp1 and several other proteins ) , which is essential for protein assembly . the hsp60 family has been shown to be involved in the development of many diseases , such as adjuvant arthritis in rats , rheumatoid arthritis in humans , insulin - dependent diabetes mellitus in mice , and systemic sclerosis in humans .",
"hsp70 is in the cytosol and has family of grp78 which plays role in helping protein folding assembly and refolding , transporting and blocking protein degradation in endoplasmic reticulum . hsp70 and hsp90 expression levels are variant according to different individual athletic abilities and seem to be upregulated in response to heat acclimation ( banfi et al . , 2004 ; mcclung et al . , 2008 ; shastry et al . , 2002 ) . as a chaperone , hsp70 plays a role in the assembly and transport of newly synthesized proteins within cells , as well as in the removal of denatured proteins . downhill ( eccentric contraction exercise induced muscle damage by increased delayed onset muscle soreness ) in hot conditions elevates the largest expression of hsp72 and hsp90 mrna level ( tuttle et al . , in related with myocyte formation , hsp90 plays a key role in myosin folding and sarcomere formation ( du et al . , 2008 ; etard et al . , 2007 ; hawkins et al . , 2008 ; srikakulam et al hsp90 consists of n - terminal atp binding domain , substrate interacting middle domain , and c - terminal dimerization domain ( jackson , 2013 ) . by atp binding to the n - terminal atp - binding domain , hsp90 regulates myosin thick filament formation and muscle myofibrilogenesis ( hawkins et al . , 2008 ) . hsp90 binds steroid receptors , protein kinases , intermediate filaments , microtubules , and actin microfilaments in a specific manner . hsp90 is an essential component of the glucocorticoid receptor , assembled in a complex of several proteins . hsp90 is divided into hsp90 and hsp90 . hsp40 and hsp70 are cochaperones with the hsp90s . hsp90s are located in cytoplasm and endoplasmic reticulum to play roles in folding newly made proteins .",
"hsp100 is located in the cytoplasm and cochaperones with hsp40 , hsp70 , and hsp90 . hsp110 is in the cytosol and nucleus ( dimauro et al . , 2016 ) . hsp110 and hsp70 super family commonly have the presence of a loop structure and hsp110 helps immune response ( zuo et al . , 2016 ) . hsp110 is also in working with hsp70 or grp78 to fold proteins and counter stress for cell survival ( gething and sambrook , 1992 ; hartl , 1996 ) . ( 2016 ) vaccinated with purified hsp110 results in reduced cancer metastasis thus large hsps amplify inflammatory signals in the cellular environment , suggesting potential endogenous immuno - stimulation during injury such as infection ( zuo et al . , 2016 ) . there are comparatively very rare studies regarding large hsps especially in the effect of exercise on the expression of large hsp and its function .",
"over several decades , hsps have been known as a potent factor playing a role in maintaining the homeostasis of living body . versatile functions of hsps according to those wide ranges of molecular weight that care those each substrate have been increasingly attentive with other research subjects such as exercise , carcinogenesis , muscles , etc . the broad ranges of hsps are organelle - specifically expressed within the body to play physiological roles via interacting with various signal pathways . provoking these pathways in a positive way ( e.g. , physical exercise ) enhance hsps signal pathway and maintain / improve vital function of hsps in the living body ."
] | molecular chaperones are ubiquitous and abundant within cellular environments , functioning as a defense mechanism against outer environment . the range of molecular chaperones varies from 10 to over 100 kda . depending on the size , the specific locations and physiological roles of molecular chaperones vary within the cell . multifunctionality of heat shock proteins ( hsps ) expressed via various cyto - stress including heat shock have been spotlighted as a reliable prognostic target biomarker for therapeutic purpose in neuromuscular disease or cancer related studies . hsp also plays a critical role in the maintenance of proteins and cellular homeostasis in exercise - induced adaptation . such various functions of hsps give scientists insights into intracellular protective mechanisms in the living body thus hsps can be target molecules to know the defense mechanism in cellular environment . based on experimental results regarding small to large scaled hsps , this review aims to provide updated important information regarding the modality of responses of intracellular hsps towards extracellular stimulations . further , the expressive mechanisms of hsps data from tremendous in vivo and in vitro studies underlying the enhancement of the functionality of living body will be discussed . |
[
"adenoid cystic carcinoma was first described by billroth in 1859 and called \" cylindroma \" due to its characteristic histologic appearance1 . in 1953 , adenoid cystic carcinoma is a malignant salivary gland tumour characterized by a deceptive histologic pattern , indolent , locally invasive growth with high propensity for perineural invasion , local recurrence and distant metastasis . these uncommon neoplasms account for fewer than 1% of all head and neck malignancies and fewer than 10% of all salivary neoplasms . they make up 15%-30% of submandibular gland tumours , 30% of minor salivary gland tumours , and 2%-15% of parotid gland tumors1 . it is defined by the world health organization as \" a basaloid tumour consisting of epithelial and myoepithelial cells in various morphological configurations , including tubular , cribriform and solid patterns . the present case report is unique as it shows presentation of adenoid cystic carcinoma as a solitary ulcer on the floor of the mouth rather than the classical nodular swelling .",
"a 56-year - old male patient presented with a chief complaint of an ulcer in the left floor of the mouth for one week . he gave a history of pain of respect on the left side of the jaw which was continuous , dull , throbbing , and radiating to the ear of the same side . the patient had under gone extraction for tooth # 18 but the pain still persisted . thereafter , he noticed an ulcer on the left floor of the mouth which was initially small and increased to the present size . there was no history of bleeding or discharge , but he did have difficulty eating and speaking . intraoral examination of the soft tissues , the buccal mucosa , labial mucosa , tongue , and palate showed no abnormalities , but there was a solitary ulcer on the left floor of the mouth . examination of gingival status revealed his oral hygiene status to be poor , with severe stains and calculus deposits . on hard tissue examination , healing socket was present in respect to tooth # 19 . on local examination of the lesion , inspectory findings revealed a solitary ulcer presenting as a mucosal tear involving the mucosa and connective tissue extending mesially from left side of the lingual frenum and distally to an area corresponding to the extracted tooth # 19 region . it was oval in shape , 32 cm at its widest point , and 3 cm deep . the margins were everted , the edges of the ulcer were sloping , and the floor was not evident . the colour was the same as that of the adjacent mucosa , but erythematous at the periphery of the ulcer . 1 ) on palpation of the site , the size and the extent of the ulcer were confirmed . the margins and the base of the ulcer were mildly indurated in a posterior aspect . based on the history given by the patient and the clinical features , a provisional diagnosis of carcinoma of the floor of the mouth t4an0m0 , chronic generalized periodontitis , partially edentulous in respect to tooth # 7 , # 5 , # 3 , # 13 , # 14 , # 15 , # 24 , # 19 , # 25 , and # 31 was made . lesions presenting as solitary ulcers on the floor of the mouth were considered in the differential diagnosis . traumatic ulcers are most common on the tongue , lips , mucobuccal fold , gingiva and palate . they present as solitary ulcers with raised reddish borders and white necrotic floors with associated history of trauma . on the floor of the mouth , they are usually due to calculus or sharp denture margins . major recurrent apthous ulcers are mostly solitary , deep , and painful , with smooth margins and a reddish halo and may persist for months with history of reoccurrences . habit associated lesions seen in quid chewers may also form ulcerations at the region of quid placement . odontogenic infections may be associated with an ulcer that may serve as a cloacal opening of a sinus draining a chronic alveolar abscess . other conditions such as acute necrotic ulcerative gingivostomatitis or gangrenous stomatitis usually present as necrotic sloughing ulcerative lesions diffusely involving the gingiva . solitary ulcers are also seen in nonodontogenic systemic diseases such as uncontrolled diabetes mellitus , blood dyscrasias ( leukemia , sickle cell anemia ) , gastrointestinal and immunocompromised individuals and autoimmune conditions ( pemphigus , pemphigoid , erythema multiforme , epidermolysis bullosa ) . the ulcers in such conditions are well demarcated , painful , and shallow with an erythematous halo and a grey necrotic floor , usually in the marginal and interdental gingiva . salivary gland disorders such as adenoid cystic carcinoma , mucoepidermoid carcinoma , mucous adenocarcinoma , warthin tumor and necrotising sialometaplasia are seen as solitary palatal ulcers . an orthopantomogram and a mandibular crossectional occlusal radiograph were taken and showed no abnormality in the region of interest.(fig . 2 ) a magnetic resonance image was taken , and the axial sections showed a t1-weighted image of a mass of medium intensity extending from the midline of the mandible to the premolar region on the left side.(fig . 3 ) an incisional biopsy was performed and the histopathologic report showed the presence of uniform basaloid cells arranged in the form of solid islands , along with a cribriform pattern at some places . based on the clinical features and the histopathologic report , a final diagnosis of adenoid cystic carcinoma t4an0m0 was made.(fig .",
"adenoid cystic carcinoma is a malignant tumour with a deceptively benign histological appearance , characterized by indolent locally invasive growth with a high propensity for local recurrence and distant metastasis . according to the literature gender predilection is an inconsistent feature in the literature ; however , it is slightly more common in women than in men4,5 . although the palate is the most commonly involved intraoral site , other commonly involved areas are the major and minor salivary gland regions , the floor of the mouth , the tongue and the gingiva ( in decreasing order ) . adenoid cystic carcinoma usually presents as a slowly growing , firm , unilobular mass in the glands . however , in our case it presented as a solitary ulcer on the floor of the mouth . the clinical course is characterized by an initial period of slow and indolent growth that is usually asymptomatic , although bone invasion or perineural spread can cause pain or hypoesthesia5 . adenoid cystic carcinoma of the salivary glands is a malignant epithelial tumour with bidirectional differentiation towards luminal ( ductal ) and abluminal ( myoepithelial and basal ) cells . the tumour is composed of basaloid cells with small , angulated , and hyper chromatic nuclei and scant cytoplasm arranged into three prognostically significant patterns : cribriform , tubular , and solid . the combination of surgery and postoperative radiation therapy has improved locoregional control of the disease . despite this achievement , late local recurrence and distant metastasis rates remain high and may occur decades after initial diagnosis5 . in its most frequently seen histological pattern , the majority of the cells are small and darkly stained with scant cytoplasm . the cells are arranged in nests or sheets that are fenestrated by round or oval spaces , creating the characteristic \" cribriform \" design . occasionally , the tumours have a predominantly solid cellular growth with a basaloid or anaplastic appearance that has few , if any , fenestrations . tubular structures with minimal stratification of the lining epithelium are often mixed with the classic cribriform and solid areas6 . several authors have suggested that a solid histological pattern indicates a more serious prognosis than a cystic pattern . stewart7 first noted the increased aggression suggested by the solid variant , although he credits the initial observation to patey and thakray8 . little information exists on cytogenetic abnormalities in salivary gland neoplasms , but in adenoid cystic carcinoma , anomalies in the terminal part of the 6q and 9p chromosomes have been reported . recent studies have demonstrated a high incidence of loss of heterozygosity at chromosome 6q23 - 359 . the differential diagnosis of adenoid cystic carcinoma in cludes tumours that also exhibit tubular and cribriform structures , such as polymorphous low - grade adenocarcinoma , tumours with basaloid cellular morphology , such as basal cell adenoma , and basal cell adenocarcinoma and tumours with a dual population of ductal and myoepithelial cells , such as pleo morphic adenoma8 . possible treatments of adenoid cystic carcinoma include four different modalities : surgical therapy , radiotherapy , chemotherapy and combined therapy . avery et al.11 recommend postoperative radiation since radiation often produces tumour regression and relieves symptoms . postoperative radiotherapy is also indicated when the tumour location is close to the base of the cranium with the presence of neck lymph node metastasis and perineural invasion , with a solid histological subtype , and for recurrent tumours11 . adenoid cystic carcinoma shows a limited response to chemotherapy , and it is believed that this lack of a response is due to its slow growth rate . however , a study by alcedo et al.12 opened up a new possibility in the pharmacological treatment of this tumour by demonstrating its response to imatinib mesylate , a potent inhibitor of kit gene tyrosine kinase , which is an enzyme involved in the pathogenesis of the tumour . however , more studies are needed to confirm its effectiveness . distant metastasis can occur even decades after the primary tumour has been treated and after having achieved adequate locoregional control . furthermore in the setting of inoperable , incompletely resected or recurrent tumours , outcomes after conventional therapy are dismal and remain a therapeutic challenge . some authors have applied other forms of radiotherapy , particularly neutron irradiation , aiming to improve treatment results13 . however , adenoid cystic carcinoma remains incurable because further improvements in local - regional control are not likely to impact survival due to the high number of distant failures . the present case differs from usual cases of adenoid cystic carcnioma with respect to site and presentation , making it a rare entity . thus , the aim of this article is to emphasise that though the literature states that adenoid cystic carcinoma ulcerates the superficial lesional mucosa , it can also present as an ulcerative lesion ."
] | adenoid cystic carcinoma is a rare epithelial tumour , and comprises about 1% of all malignant tumours of the oral and maxillofacial region . it is a malignant tumour which may develop in the trachea , bronchus , lungs or mammary glands , in addition to the head and neck region . occurrences in the head and neck are mostly detected in the major salivary gland , oral cavity , pharynx and paranasal sinus where it presents as a slow growing firm nodular swelling . the aim of the article is to highlight the unique presentation of adenoid cystic carcinoma as a solitary ulcer on the floor of the mouth . |
[
"india leads the world with the largest number of patients with diabetes earning the dubious distinction of being termed the diabetes capital of the world . according to the diabetes atlas 2015 published by the international diabetes federation , the number of people with diabetes in india is currently around 69.2 million and is expected to rise to 123.5 million by 2040 . although there are large regional variations in the prevalence of diabetes , it has more than quadrupled in the past 20 years from < 1%3% to 10%15% in urban and 3%5% in rural areas . diabetes registries can be used as an important epidemiological tool : to monitor the prevalence and incidence of diabetes , provide a sampling frame for epidemiologic and clinical studies , provide information to health service providers and planners on risk factors and complications , and assist in the overall monitoring of diabetes control program . diabetes registries are used in many countries for population management of diabetes , outcomes management , and development of clinician decision support system , for example , national diabetes register ( ndr ) in sweden , new york glycated hemoglobin ( hba1c ) registry , and singapore diabetes registry . hospital - based diabetes registries have been established in developing countries such as thailand and malaysia . in india , the first diabetes registry was set up in goa as a public private partnership , with the aim of population - based disease management . it is essential for similar registry in all states to implement and monitor activities under the national program for prevention and control of cancer , diabetes , cardiovascular diseases , and stroke . to make the registry sustainable and replicable , it is necessary to implement it within the existing system of primary health care . a community - based cohort study showed the incidence of diabetes in rural puducherry to be 21.5 for 1000 person - year follow - up . in this context , a pilot project was set up to establish a diabetes registry in the primary health care setting of puducherry . here , we share the design and implementation of the registry and propose a management information system for diabetes registry in puducherry district .",
"union territory of puducherry has one of the best health care delivery services in the country . primary health care is delivered through a network of 27 primary health centers ( 12 urban and 15 rural ) and 52 subcenters , besides 8 hospitals . patients with diabetes registered in the chronic disease clinics run at phcs receive free insulin injections and oral hypoglycemic drugs along with regular blood sugar monitoring . this was a facility - based prospective registry study done at six randomly selected phcs in urban puducherry district . patients with a diagnosis of diabetes mellitus ( dm ) , enrolled in chronic disease clinics at the selected phcs were the participants . all known patients with diabetes , both type i and ii , receiving treatment from primary health - care facilities were included in the registry . the project was approved by the institute scientific advisory committee and ethics committee and registered with the clinical trials registry of india ( ref/2012/04/003467 ) . research assistant was recruited to assist in data collection , data management , and final compilation of the registry . manuals for training of medical officers and health - care workers on data collection and details on diabetes , risk factors , complications , and lifestyle modifications were prepared and issued to all the phcs . the study was planned in two phases : development of diabetes registry and development of management information system for diabetes [ figure 1 ] . case report forms ( crfs ) were developed for collecting information required for the diabetes registry in terms of demographic characteristics , risk factors , complications , coexisting chronic conditions , lifestyle and medical management , and clinical outcomes phase i. the data elements captured in crfs for the registry are shown in figure 2 . the follow - up card for obtaining data for registry maintenance design of the diabetes registry project data elements captured for the diabetes registry and source of data the research assistant underwent intensive training on all aspects of the study interview techniques , data recording , anthropometry , data entry , communication skills , organization of health systems , functioning of phc , etc . training of medical officers and health workers from the selected phcs was done through a sensitization workshop , in coordination with the state government health services . logistics were planned out , and roles and responsibilities were identified during the workshop . a pilot study was carried out in urban health center of a tertiary care institute . the crfs were modified , and data entry format in epi info [ centers for disease control and prevention ( cdc ) in atlanta , georgia ( usa ) ] was finalized .",
"union territory of puducherry has one of the best health care delivery services in the country . primary health care is delivered through a network of 27 primary health centers ( 12 urban and 15 rural ) and 52 subcenters , besides 8 hospitals . patients with diabetes registered in the chronic disease clinics run at phcs receive free insulin injections and oral hypoglycemic drugs along with regular blood sugar monitoring . this was a facility - based prospective registry study done at six randomly selected phcs in urban puducherry district . patients with a diagnosis of diabetes mellitus ( dm ) , enrolled in chronic disease clinics at the selected phcs were the participants . all known patients with diabetes , both type i and ii , receiving treatment from primary health - care facilities were included in the registry . the project was approved by the institute scientific advisory committee and ethics committee and registered with the clinical trials registry of india ( ref/2012/04/003467 ) . research assistant was recruited to assist in data collection , data management , and final compilation of the registry . manuals for training of medical officers and health - care workers on data collection and details on diabetes , risk factors , complications , and lifestyle modifications were prepared and issued to all the phcs . the study was planned in two phases : development of diabetes registry and development of management information system for diabetes [ figure 1 ] . case report forms ( crfs ) were developed for collecting information required for the diabetes registry in terms of demographic characteristics , risk factors , complications , coexisting chronic conditions , lifestyle and medical management , and clinical outcomes phase i. the data elements captured in crfs for the registry are shown in figure 2 . the follow - up card for obtaining data for registry maintenance design of the diabetes registry project data elements captured for the diabetes registry and source of data the research assistant underwent intensive training on all aspects of the study interview techniques , data recording , anthropometry , data entry , communication skills , organization of health systems , functioning of phc , etc . training of medical officers and health workers from the selected phcs was done through a sensitization workshop , in coordination with the state government health services . logistics were planned out , and roles and responsibilities were identified during the workshop . a pilot study was carried out in urban health center of a tertiary care institute . the crfs were modified , and data entry format in epi info [ centers for disease control and prevention ( cdc ) in atlanta , georgia ( usa ) ] was finalized .",
"banners intimating the process , timings , and requirements were put up , and notices were issued to patients with diabetes indicating the same . registration was scheduled for 5 days a week on fixed timing , for a period of 12 months . health workers facilitated the distribution of registration cards and created awareness and sufficient publicity for registration among the patients . during the chronic diseases clinics , patients with a diagnosis of dm , enrolled in chronic disease clinics at these phcs , were enlisted in the registry . consent from the participants for use of clinical data was sought after they are explained about the registry and its purpose . a unique i d number was created for each patient based on phc code ( 3 digits ) , presence of comorbidity ( dm or diabetic and hypertensive [ dh ] ) , and patient identification ( 3 digits ) . details on their demographic characteristics , information on diabetes and coexisting chronic conditions , and clinical outcomes were recorded . the medical officer in charge also assisted in quality control by verifying a proportion of randomly chosen participants . discussions were held with a few health workers and medical officers before finalizing the register . this was done to maintain brevity without compromising on data quality and utility of register at the clinics . data in the compiled registry can be categorized as ( 1 ) demographics , ( 2 ) risk factors , ( 3 ) disease and treatment details , ( 4 ) glycemic control , and ( 5 ) microvascular end - organ disease data . around 2177 patients with diabetes six patients had type 1 dm ; 332 patients received insulin from the phcs . on an average , the research assistant spent nearly 1015 min per patient to review all the details in the patient notebook , conduct interview regarding risk factors and treatment - seeking behavior , and perform anthropometry . time taken to complete the registration process at each phc was variable and depended mainly on the number of clinic days and efficiency of the existing system ( ranging from 6 to 12 weeks at each center ) ; completion of registry took around 14 months . second phase involves setting up a management information system based on monthly reporting of a number of patients with diabetes , glycemic control , referrals , and compliance to treatment from all these centers . this requires the use of register by the staff - in - charge of the clinics on a regular basis for monitoring patient care and follow - up . the proposed flow of information from the phcs to the nodal office ( in the directorate of public health ) would constitute the management information system for diabetes . based on the registry compiled , patient level indicators in terms of a number of patients who achieved glycemic control , compliance to treatment , existing level of complications , proportion of patients screened for complications in the past year , etc . based on monthly reporting of activities , process and outcome measures can be designed to monitor the services provided . the target for a process indicator for each patient would be availability of investigation reports during the stipulated interval ( 1 year ) . process targets such as proportion of patients with hba1c , low - density lipoprotein ( ldl ) , microalbuminuria , or foot examination done in the past 1 year would be designed . outcome targets could be set based on desired clinical outcomes , for example , proportion of patients with glycemic control , ldl < 130 mg / dl , and blood pressure < 130/80 mm hg .",
"banners intimating the process , timings , and requirements were put up , and notices were issued to patients with diabetes indicating the same . registration was scheduled for 5 days a week on fixed timing , for a period of 12 months . health workers facilitated the distribution of registration cards and created awareness and sufficient publicity for registration among the patients . during the chronic diseases clinics , patients with a diagnosis of dm , enrolled in chronic disease clinics at these phcs , were enlisted in the registry . consent from the participants for use of clinical data was sought after they are explained about the registry and its purpose . a unique i d number was created for each patient based on phc code ( 3 digits ) , presence of comorbidity ( dm or diabetic and hypertensive [ dh ] ) , and patient identification ( 3 digits ) . details on their demographic characteristics , information on diabetes and coexisting chronic conditions , and clinical outcomes were recorded . the medical officer in charge also assisted in quality control by verifying a proportion of randomly chosen participants .",
"banners intimating the process , timings , and requirements were put up , and notices were issued to patients with diabetes indicating the same . registration was scheduled for 5 days a week on fixed timing , for a period of 12 months . health workers facilitated the distribution of registration cards and created awareness and sufficient publicity for registration among the patients .",
"during the chronic diseases clinics , all patients with diabetes were approached and explained the purpose of this registry . patients with a diagnosis of dm , enrolled in chronic disease clinics at these phcs , were enlisted in the registry . consent from the participants for use of clinical data was sought after they are explained about the registry and its purpose . a unique i d number was created for each patient based on phc code ( 3 digits ) , presence of comorbidity ( dm or diabetic and hypertensive [ dh ] ) , and patient identification ( 3 digits ) . details on their demographic characteristics , information on diabetes and coexisting chronic conditions , and clinical outcomes were recorded .",
"the medical officer in charge also assisted in quality control by verifying a proportion of randomly chosen participants .",
"discussions were held with a few health workers and medical officers before finalizing the register . this was done to maintain brevity without compromising on data quality and utility of register at the clinics . data in the compiled registry can be categorized as ( 1 ) demographics , ( 2 ) risk factors , ( 3 ) disease and treatment details , ( 4 ) glycemic control , and ( 5 ) microvascular end - organ disease data . around 2177 patients with diabetes six patients had type 1 dm ; 332 patients received insulin from the phcs . on an average , the research assistant spent nearly 1015 min per patient to review all the details in the patient notebook , conduct interview regarding risk factors and treatment - seeking behavior , and perform anthropometry . time taken to complete the registration process at each phc was variable and depended mainly on the number of clinic days and efficiency of the existing system ( ranging from 6 to 12 weeks at each center ) ; completion of registry took around 14 months .",
"second phase involves setting up a management information system based on monthly reporting of a number of patients with diabetes , glycemic control , referrals , and compliance to treatment from all these centers . this requires the use of register by the staff - in - charge of the clinics on a regular basis for monitoring patient care and follow - up . the proposed flow of information from the phcs to the nodal office ( in the directorate of public health ) would constitute the management information system for diabetes . based on the registry compiled , patient level indicators in terms of a number of patients who achieved glycemic control , compliance to treatment , existing level of complications , proportion of patients screened for complications in the past year , etc . based on monthly reporting of activities , process and outcome measures can be designed to monitor the services provided . the target for a process indicator for each patient would be availability of investigation reports during the stipulated interval ( 1 year ) . process targets such as proportion of patients with hba1c , low - density lipoprotein ( ldl ) , microalbuminuria , or foot examination done in the past 1 year would be designed . outcome targets could be set based on desired clinical outcomes , for example , proportion of patients with glycemic control , ldl < 130 mg / dl , and blood pressure < 130/80 mm hg .",
"any delivery system seeking to manage their patients with diabetes using a disease management program that is internally integrated within their primary care delivery system must develop a registry for diabetes as an essential element of the program . while setting up a population - based register , we need to notify the public health authorities , publicize the registry , establish arrangements for access to data , data security , and accountability ( in terms of reporting and feedback ) . efforts to achieve improved outcomes for diabetes require an organized population - based approach to diabetes management using all of the components of the chronic illness care model that identifies the six essential elements of a health - care system the community , the health system , self - management support , delivery system design , decision support , and clinical information systems . the uk , australia , new zealand , and canada have taken the lead in adopting models of chronic care . health information technologies such as electronic health records and registers can be considered as an input or building block of health systems . there is a great potential of these interventions in facilitating decision - making both at the individual and community level . the swedish ndr was initiated in 1996 with 41,000 patients as a tool for local quality control and benchmarking against the national treatment aims . one aim of the ndr was that all patients with diabetes in sweden should ideally be reported yearly , based on registered annual data from actual patient visits in primary health care . another aim was to provide local centers with data regarding the quality indicators of diabetes care , also making a comparison possible with the national or regional ndr data . ndr is probably among the largest ndrs in the world , with repeated annual surveys . nearly 40% of all patients with diabetes in sweden in 2005 were registered in the ndr . a web - based interactive gis system , saudi national diabetes registry , was designed to serve as an electronic medical file for patients with diabetes retrieving data from medical files by trained registrars . a total of 84,942 patients were registered from 2000 to 2012 , growing by 10% annually . the singapore diabetes registry was built to enhance the continuity of care for patients with diabetes and facilitate greater efficiency in outcome measurement . the chronic disease management system provides reports of clinical outcomes in a systematic and efficient manner for quality improvement and evidenced - based population management . these include process indicators consisting of the rates of hba1c , ldl - cholesterol ( ldl - c ) , and nephropathy tests , and intermediate outcome indicators of the proportion of patients with poor hba1c ( > 9% ) and optimal ldl - c ( < 2.6 the malaysian diabetes registry was set up in 2008 with the objective of creating an accessible diabetes information system , open for health clinics and hospitals , and to provide data for public health action . , the first diabetes registry was set up in goa as a public private partnership , with the aim of population - based disease management . a state - wide campaign over 4 years has screened and revealed about 44,000 patients with diabetes in the state . this registry would help the state health services in regular monitoring , identify people at risk of diabetic complications , and aid in reducing the gap between evidence - based recommendations and clinical outcomes . similar innovative initiatives under the changing diabetes barometer of novo nordisk education foundation have targeted states such as bihar and gujarat . a total of 12,140 subjects were screened at five primary health centers in gujarat found 13.1% diabetic and 11.3% prediabetes population . diabetes registry involves collecting and sharing of quality data , analyzing for variations , identifying current practices , comparing with existing guidelines for care , giving feedback , and providing learning opportunities for the health systems . at the patient level , this registry can facilitate needs assessment for specialist services , recall facility for complications screening , and aid in reducing the gap between evidence - based recommendations for care and clinical outcomes . at the health systems level , this can facilitate integration with other services ( such as ophthalmology and podiatry ) . the registry can be used as a tool for the assessment of quality of care through system inputs ( number of clinic visits and investigations ) , process measures ( eye screening and foot status ) , and clinical outcomes ( glycemic control , micro and macrovascular complications ) . this can also provide useful information to health service providers and planners on risk factors and complications , and hence the data can be utilized for the planning of preventive services and better resource management [ figure 3 ] . this could help change behaviors , enhance the quality of care , increase the value of the resources spent , and thus contributing toward a virtuous improvement cycle . potential applications of diabetes registry in this project in puducherry , this pilot project was started with the aim of creating a population - based diabetes registry . in the first phase , known patients with diabetes availing services at the selected phcs were enrolled . this can be expanded to the entire population for registering all known patients with diabetes through house - to - house enumeration . the proposed design and methodology of implementation can be useful to plan such registries for chronic diseases under the national health program .",
"this study has documented the methodological details , and the learning experiences gained while developing a diabetes registry at the primary health care level and the scope for upscaling to a management information system for diabetes and a state - wide registry . john 's medical college and research institute , bengaluru , with training supported by nhlbi - uh , global health initiative for chronic diseases .",
"john 's medical college and research institute , bengaluru , with training supported by nhlbi - uh , global health initiative for chronic diseases .",
""
] | background : diabetes registries monitor the population prevalence and incidence of diabetes , monitor diabetes control program , provide information of quality of care to health service providers , and provide a sampling frame for interventional studies . this study documents the process of establishing a prospective diabetes registry in a primary health - care setting in puducherry.methods:this is a facility - based prospective registry conducted in six randomly selected urban health centers in puducherry , with enrollment of all known patients with diabetes attending chronic disease clinics . administrative approvals were obtained from government health services . manuals for training of medical officers , health - care workers , and case report forms were developed . diabetes registry was prepared using epi info software.results:in the first phase , demographic characteristics , risk factors , complications , coexisting chronic conditions , lifestyle and medical management , and clinical outcomes were recorded . around 2177 patients with diabetes have been registered in six primary health centres out of a total of 2948 participants seeking care from chronic disease clinic . registration coverage ranges from 61% to 105% in these centers.conclusion:this study has documented methodological details , and learning experiences gained while developing a diabetes registry at the primary health care level and the scope for upscaling to a management information system for diabetes and a state - wide registry . improvement in patient care through needs assessment and quality assurance in service delivery is an important theme envisioned by this registry . |
[
"subclinical hypothyroidism ( sh ) , described as a condition characterized by elevated serum level of thyroid stimulating hormone ( tsh ) with normal levels of free thyroxine ( ft4 ) and free triiodothyronine ( ft3 ) , is a common disorder having a prevalence of about 7.58.5% in females and 2.84.4% in males , worldwide . several studies have established overt hypothyroidism to be associated with abnormalities of lipid metabolism such as elevated levels of total cholesterol ( tc ) , low - density lipoprotein - cholesterol ( ldl - c ) , and triglycerides ( tg ) , thereby predisposing to cardiovascular diseases . however , the association of sh with abnormalities in lipid parameters have been studied with conflicting results . some studies have also established a link between sh and metabolic syndrome while others have failed to do so . it has also been indicated that small changes in thyroid hormone levels within the reference range may influence the severity of atherosclerosis . currently , serum lipid ratios such as tc / high - density lipoprotein - cholesterol ( tc / hdl - c ) , tg / hdl - c , and ldl - c / hdl - c have been shown to be better predictors of cardiovascular risk compared to conventional lipid profile . small dense ldl ( sdldl ) , a subtype of ldl has been described as the main determinant of the atherogenicity of ldl - c . atherogenic index of plasma ( aip ) has been defined as the logarithmically transformed ratio of tg to hdl - c . aip , which is a good surrogate marker of sdldl , has been indicated as a superior predictor of cardiovascular risk than the previously used lipid parameters . however , research on the complex interrelationship between sh and lipid ratios and aip has been extremely rare . thus , though the effect of overt hypothyroidism on abnormalities in lipid parameters has already been established , the relationship between sh and lipid metabolism needs further study . furthermore , there is insufficient information regarding the effect of sh on lipid ratios and aip . this is particularly true in the indian scenario where conflicting results have been obtained , especially in the female population where sh is more prevalent . therefore , this study was conducted to understand the association of sh with abnormalities in the serum lipid profile and aip in apparently healthy adult females . the study also aims to find out whether any correlation exists between aip and serum tsh levels among sh cases .",
"the study was a retrospective , time - bound , hospital - based , case control study carried out by detailed analysis of patient records in the department of biochemistry at a medical college in southern india . the study was approved by the institutional research committee and ethics committee , which follow the guidelines set by the helsinki declaration ( reference number - rc/14/123 ) . data collection was done for 2 months from may 1 , 2015 , to june 30 , 2015 . study subjects were taken from the records of apparently healthy adult females coming for a master health check to our hospital from june 1 , 2014 , to may 30 , 2015 . adult females with high tsh ( > 4.2 iu / ml ) but normal ft3 ( 2.04.4 pg / ml ) and ft4 ( 0.931.7 ng / dl ) levels were included in the sh group . adult females having normal tsh ( 0.274.2 iu / ml ) , ft3 ( 2.04.4 pg / ml ) , and ft4 ( 0.93 - 1.7 ng / dl ) levels were included in the euthyroid ( eu ) group . individuals with a history of overt hypothyroidism or levothyroxine replacement therapy , history of radioiodine treatment or thyroid surgery , history of alcohol abuse and smoking , history of drugs such as estrogens , diabetic individuals , subjects with renal , hepatic or other systemic diseases , and known history of dyslipidemia , were excluded from the study . totally , 504 female subjects came for master health check during the period that had been selected . of these , 300 patient records could be studied during the 2 months when the study was carried out . based on the ft3 , ft4 , and tsh values , the subjects were classified into sh and eu groups according to the inclusion criteria . based on age - matching between the sh and eu groups , seventy consecutive patients in each group , according to their date of presentation were taken for statistical analysis . detailed epidemiological information along with a detailed history was taken from the hospital records of the patients who came for a master health check to our hospital . specific emphasis was given to age , history of smoking and alcohol intake , history of overt hypothyroidism or levothyroxine replacement therapy , history of thyroid surgery , history of hypertension , diabetes or dyslipidemia , history of liver , hepatic or any other systemic disease and history of medications such as oral contraceptive pills . next , the reports of the subjects were collected with special emphasis on serum fasting glucose , liver function tests , renal function tests , complete blood count with peripheral smear , and routine examination of urine . for the study , the following results were noted : serum tsh , ft3 , ft4 , tc , tg , hdl - c , and ldl - c . for each subject included in sh group and eu group , the lipid ratios were calculated as tc / hdl - c , tg / hdl - c , and ldl - c / hdl - c . the routine serum parameters in all the study subjects had been measured using automated routine chemistry analyzer ( roche cobas integra 400 plus , roche diagnostics limited , switzerland ) with commercial kits ( roche cobas c packs , roche diagnostics limited , switzerland ) according to manufacturer 's protocol . thyroid profile of all the study subjects had been measured using automated electrochemiluminescence immunoassay analyzer ( roche cobas e411 , roche diagnostics limited , switzerland ) with commercial kits ( cobas cassettes containing working solutions ) according to manufacturer 's protocol . the data were analyzed using spss statistical software ( v 16 ; ibm corporation , armonk , ny , usa ) . to describe continuous variables , mean and standard deviation was used . since the data were not normally distributed , the difference in lipid parameters , lipid ratios , and aip between sh group and eu group , were compared using mann whitney u - test and a p < 0.05 was considered statistically significant . in the sh group , aip and tsh logistic regression was performed to ascertain the effects of age , tc , tg , hdl , ldl , tg / hdl , tc / hdl , ldl / hdl , and aip on sh . variables which are significant at < 0.1 in simple regression were considered for multiple regression analysis and because of multicollinearity , only one of the following variables were included in the model at a time : tg , tg / hdl , and aip .",
"the data were analyzed using spss statistical software ( v 16 ; ibm corporation , armonk , ny , usa ) . to describe continuous variables , mean and standard deviation was used . since the data were not normally distributed , the difference in lipid parameters , lipid ratios , and aip between sh group and eu group , were compared using mann whitney u - test and a p < 0.05 was considered statistically significant . in the sh group , aip and tsh were correlated using spearman 's correlation . logistic regression was performed to ascertain the effects of age , tc , tg , hdl , ldl , tg / hdl , tc / hdl , ldl / hdl , and aip on sh . variables which are significant at < 0.1 in simple regression were considered for multiple regression analysis and because of multicollinearity , only one of the following variables were included in the model at a time : tg , tg / hdl , and aip .",
"there was no statistically significant difference ( p > 0.05 ) among the mean ages of sh and eu groups . however , there was a statistically significant ( p < 0.05 ) difference between the means of ft3 , ft4 , and tsh of the sh and eu groups . comparison of baseline characteristics of the study subjects the data in table 2 represent a comparison of lipid profile parameters of eu group and sh group . it includes mean and standard deviations of tc , tg , hdl - c , and ldl - c of eu and sh groups . the differences between the means of tc , tg , and ldl - c were found to be statistically significant while that for hdl - c was found to be insignificant ( p = 0.712 ) . the data presented in table 3 shows the comparison of lipid ratios such as tc / hdl - c , tg / hdl - c , and ldl - c / hdl - c between sh and eu groups . the difference in the mean tg / hdl - c between the two groups was found to be significant ( p < 0.005 ) . comparison of lipid profile parameters between the study groups comparison of lipid ratios between the study groups figure 1 represents the comparison between the mean aip of sh group and eu group . the mean aip of eu group was 0.078 , and that of sh group was 0.211 . when the means were compared using mann whitney u - test , the difference was found to be statistically significant ( p = 0.002 ) . the spearman 's correlation coefficient r is 0.174 ( p = 0.149 ) indicating that there is no significant correlation between aip and tsh in the sh group . eu : euthyroid group , sh : subclinical hypothyroidism group , aip : atherogenic index of plasma . * difference of the means of aip between eu and sh groups is statistically significant ( p = 0.002 , < 0.05 ) correlation between atherogenic index of plasma and thyroid stimulating hormone in subclinical hypothyroidism group . no significant correlation , spearman 's correlation coefficient r is 0.174 ( p = 0.149 ) table 4 represents the results of logistic regression analysis . aip has a significantly higher risk ( or = 22.38 ) than tg ( or = 1.01 ) or tg / hdl ( or = 1.42 ) .",
"the link between dyslipidemia and sh has been explored in a large number of studies of varying methodologies in different parts of the world . however , studies on the abnormalities in lipid ratios and aip which are better markers of cardiovascular risk than conventional lipid profile are rare . with this background control study , where we retrospectively studied patient records to investigate the abnormalities in conventional lipid profile , lipid ratios , and aip in sh . the study also aimed to find out if there was any correlation between tsh and aip levels in sh . in our study the mean age of sh patients in our study was 42.5 similar to other studies done in tamil nadu ( india ) , greece , and turkey but higher than studies done in kashmir ( india ) , italy , and turkey . the differences can be explained by the different study populations used in the different studies which differed on ethnicity , gender preponderance , race , etc . , however , tsh levels were significantly higher in sh as compared to eu similar to other studies . in our study , we also reported that the mean ft3 and ft4 was significantly lower in sh as compared to eu though in both groups the values were within normal reference ranges . this is in contrast to the other study done in tamil nadu where no significant difference was noted . the difference could be explained by our larger sample size whereby the study in tamil nadu had a sample size of 30 whereas our study had a sample size of 70 . regarding lipid profile parameters , our study showed a significantly lower tc and ldl - c level and a significantly higher tg level in sh as compared to eu . several other studies conducted in india and abroad have also reported similarly higher tg levels , but tc and ldl - c were also reported to be higher in sh as opposed to our study . since our study was based on retrospective analysis of patient records , it can be suggested that a prospective study could lead to a better agreement . on the other hand , a contrasting result was obtained in national health and nutrition examination survey iii , a large study of 215 subjects with sh and 8013 euthyroid individuals , where no significant difference in lipid parameters between sh and euthyroid individuals was reported , when adjusted for age , race , sex , and the use of lipid - lowering agents . in overt hypothyroidism , the molecular basis of this dyslipidemic pattern has been elucidated . in overt hypothyroidism , due to the reduced activity of ldl - c receptors , the catabolism of ldl - c , and intermediate density lipoprotein - cholesterol are affected , consequently increasing serum tc and ldl - c . moreover , in overt hypothyroidism , the activity of the enzyme lipoprotein lipase is lowered , thereby inhibiting the removal of tg - rich lipoproteins leading to a high serum tg level . in our study , the mean hdl - c was lower in sh than in eu , but the difference was not statistically significant . this result is in contrast to the study done in tamil nadu where the hdl - c was significantly lower in sh compared to eu . in our study , the lower than desirable hdl - c levels in both sh and eu can be explained by the lack of exercise and sedentary lifestyle among the study participants . in the indian context , this poses a serious health risk and needs to be investigated further by large population - based studies as well as experimental studies to elucidate the molecular etiopathogenetic links . several studies have also shown that levothyroxine therapy has led to significant improvement in dyslipidemia in sh patients , but we have not studied this aspect . in contrast , in overt hypothyroidism , elevation of serum hdl - c levels may be seen due to increased concentration of hdl2 particles . considering our results about the lipid ratios , our study showed a significantly higher tg / hdl - c in sh as compared to eu , but no significant difference was seen in tc / hdl - c and ldl - c / hdl - c levels . in a study , it was proved that 6-month treatment with levothyroxine led to normalization of tsh , and this improved the adverse lipid profile of elderly women with sh . this effect was reflected in the lipid ratios and thereby concentrations of tc / hdl - c , tc / ldl - c , lp(a ) and apob were significantly reduced but apoai and hdl - c were also reduced but not significantly . however , the difference in the means of lipid ratios between sh and eu have not been studied . thus , though controversies exist regarding the association of sh with cardiovascular risk , to the best of our knowledge , no other study has investigated the status of lipid ratios in sh . thus , to fill this knowledge lacuna , we decided to include lipid ratios in our study . in our study , aip was significantly higher among sh subjects than eu subjects . the mean value of aip in sh subjects was found to be 0.211 which falls in the at risk category ( aip > 0.11 ) for cardiovascular diseases . aip has already been established as strongly correlating with serum sdldl level , which is the main atherogenic fraction of ldl . on the other hand , sh has been shown to be associated with highly atherogenic pattern b of ldl - c subfractions . it has been reported that as a marker of lipoprotein particle size , aip adds predictive value beyond that of the individual lipids , and/or tc / hdl - c ratio . this is corroborated in our multiple regression analysis , where aip emerged as the single most significant factor associated with sh among the study parameters . this could also indicate that sh is associated with high aip and thereby a highly atherogenic lipid profile . nevertheless , despite extensive literature search in other metabolic disease states such as metabolic syndrome , hyperuricemia , and diabetes mellitus , aip was found to be a good predictor of cardiovascular risk . in overt hypothyroidism also aip levels have not been studied , but conflicting results were seen in studies investigating the impact of overt hypothyroidism on ldl - c subfractions , particularly sdldl . though a recent study conducted on newly diagnosed hypothyroid patients showed an association between hypothyroidism and elevated sdldl , other studies could not conclusively prove such an association . all these results reiterate the need for studies on the association of aip and abnormal lipid ratios with sh . in our study , we have attempted to bridge this gap and from our results , it could be speculated that though serum ldl - c was lower in sh subjects , their pattern is significantly atherogenic with a high level of sdldl . we failed to find any correlation between aip and tsh levels in sh subjects thereby indicating that though sh patients were at a greater risk of cardiovascular diseases , the risk did not proportionately increase with an increase in tsh levels . several studies have reported that dyslipidemic changes were not apparent when serum tsh levels were below 10 miu / l but above this level , dyslipidemia was more overt . an indian study reported that there was no association between lipid abnormalities and sh when the value of serum tsh was < 10 miu / l . on the other hand , patients with tsh concentrations mu / l had significantly greater levels of tc and ldl - c as well as lower hdl - c compared with controls . based on these findings , it would not be wrong to speculate that since a majority of our patients had a tsh level < 10 miu / l , aip could not be correlated with tsh levels in sh patients . ours is a retrospective , hospital - based , time - bound study where hospital records of study subjects were analyzed . large , well - planned , community - based , prospective studies need to be conducted to gain a better understanding of dyslipidemia in sh , particularly the study of aip . thus , the positive association of dyslipidemia and sh indicates a need for regular screening of sh patients for dyslipidemia to enable early diagnosis and treatment of the condition . even in patients who have a normal conventional lipid profile , lipid ratios , and aip the high prevalence of low hdl levels reiterates the need for counseling of patients regarding healthy dietary habits and regular exercise . high aip among the sh population too underlines the need for large - scale , community - based programs for health awareness and lifestyle modification . however , this is a cross - sectional study and so , whether sh leads to high aip could not be determined . moreover , the molecular basis for this association can only be elucidated by experimental studies with animal models .",
"this study helped to bridge the knowledge gap as well as paucity of indian data available regarding the complex interplay between thyroid hormones and atherogenic lipid parameters , particularly in sh . the study also emphasizes the importance of aip in the detection of atherogenic risk in sh patients , even in the presence of minor dyslipidemia . abnormalities found in conventional lipid profile as well as in lipid ratios and aip imply sh to be a risk factor for dyslipidemia and atherosclerosis . an atherogenic lipid profile is a prequel to cardiovascular and cerebrovascular diseases , and hence , its association with sh in general and calculation of aip , in particular , could provide avenues for early diagnosis and rigorous management of dyslipidemia in hypothyroidism .",
"",
""
] | background : a controversy exists regarding the association between subclinical hypothyroidism ( sh ) and dyslipidemia . moreover , studies on lipid ratios and atherogenic index of plasma ( aip ) in sh are rare , particularly in the indian scenario.aim:this study aimed to investigate abnormalities in conventional lipid profile , lipid ratios , and aip in sh and attempted to correlate thyroid stimulating hormone ( tsh ) and aip in sh.materials and methods : in this retrospective analysis of patient records of sh subjects and euthyroid subjects , age , free triiodothyronine , free thyroxine , tsh , total cholesterol , triglycerides , high - density lipoprotein - cholesterol ( hdl - c ) , low - density lipoprotein - cholesterol , lipid ratios , and aip were compared between the two groups . the correlation of tsh and aip in sh was studied . spearman 's correlation , mann whitney u - test and logistic regression analysis were performed.results:triglyceride , triglyceride / hdl - c , and aip were significantly higher in sh as compared to euthyroid group , but there was no correlation between tsh and aip in sh . aip emerged as the significant single factor associated with sh in multiple logistic regressions.conclusion:the positive association of dyslipidemia and sh indicates a need for regular screening of these patients to enable early diagnosis and treatment of dyslipidemia . even in patients who have a normal conventional lipid profile , lipid ratios , and aip have to be calculated for better assessment of atherogenic risk . |
[
"the ability of mammals to respond to an inadequate o2 supply , commonly termed hypoxia , is crucial for their survival . although a proper response to changed o2 tensions triggers adaptation , a number of pathological conditions or failures in the o2 response are associated with various diseases such as anemia , myocardial infarction , thrombosis , atherosclerosis , or cancer . when exposed to hypoxia or even anoxic conditions , mammalian organisms initiate a variety of responses in different organs , aiming to increase the delivery of oxygen to the tissues . in addition to the switch from an aerobic to an anaerobic metabolism and the suppression of energy - using reactions , the carotid body chemoreceptor cells stimulate the brain stem center controlling the respiratory and cardiovascular systems to enhance ventilation , heart rate , and blood pressure ( reviewed by prabhakar1 ) . in addition , neuroepithelial cells in the lung contribute to adjusting pulmonary perfusion and gas exchange . moreover , organs and cells switch their gene expression profile : the kidneys produce erythropoietin , which increases red blood cell production in the bone marrow , and vascular cells produce vascular endothelial growth factor to promote angiogenesis and flow of enhanced blood volume ( reviewed by semenza2 ) . in addition to the expression of erythropoietin and vascular endothelial growth factor , the expression of more than 500 genes , products of which are involved in glycolysis , angiogenesis , erythropoiesis , cell death , and differentiation , is also changed on exposure to hypoxia ( reviewed by wenger and stiehl3 and semenza4 ) . in mammals , the hypoxia - dependent changes on the level of gene expression are mainly mediated by the -subunits of hypoxia - inducible transcription factors ( hifs ) . hif -subunits are tightly regulated , and post - translational hydroxylations in response to hypoxia appear to be of major importance . in addition to hypoxia , hif -subunits were also found to respond to various growth and coagulation factors , hormones , cytokines , or stress factors already under normoxia . indeed , different kinases , among them glycogen synthase kinase 3 ( gsk-3 ) , have been identified to directly phosphorylate hif- proteins . this review discusses the regulation of hif- by gsk-3 and compares it with hydroxylase - dependent hif- protein regulation .",
"in their active form , hifs are heterodimeric transcription factors consisting of an - and -subunit . the hif -subunit represents the stable nuclear subunit primarily represented by the ubiquitously found arnt ( arylhydrocarbon receptor - nuclear translocator ) protein ; however , arnt2 or artn3 , although to a lesser extent , also appear to be able to take part in the formation of hif dimers ( reviewed by semenza5 ) . so far , three -subunit proteins , hif-1 , hif-2 ( also known as epas,6 hlf,7 hrf,8 or mop29 ) , and hif-3 have been identified . together , the different hif - and -subunits may give rise to the formation of several combinations of hif dimers.5,10 hif-1 and hif-2 are the best - studied hif- isoforms . although they share structural and functional similarities , it appears that differences in the cell - type expression pattern , the target genes , the embryonic deletion phenotypes , and the effects on tumorigenesis exist between hif-1 and hif-2.1114 the function of hif-3 , from which several splice variants exist in humans,15,16 is largely unknown , although some human hif-3 variants and a mouse splice variant termed inhibitory pas protein ( ipas ) appear to act as negative regulators of the hypoxic response.1619 similar to the arnt proteins , the hif -proteins belong to the basic helix - loop - helix pas ( per - arnt - sim ) protein family . in particular , hif-1 and hif-2 show the highest degree of sequence identity in the basic helix- loop - helix ( 85% ) , pas - a ( 68% ) , and pas - b ( 73% ) domains . both also contain two nuclear localization sequences responsible for translocation to the nucleus under hypoxia ; they are localized in the n terminus ( amino acids 1733 in hif-1 and amino acids 150 in hif-2 ) and in the c terminus ( amino acids 718721 in hif-1 and amino acids 689870 in hif-2).20,21 with the exception of hif-3 , which does not contain a c - terminal transactivation domain ( c - tad),22,23 hif -subunits also contain n- and c - terminal transcriptional activation domains ( n - tad and c - tad ) . a unique oxygen - dependent degradation domain ( oddd , amino acids 401603 in hif-1 and amino acids 517682 in hif-2 ) overlaps n - tad . the residues between n - tad and c - tad represent an inhibitory domain ( amino acids 604785 in hif-1 and amino acids",
"hif -subunit activation under hypoxia is mainly the result of an increased protein stability and coactivator recruitment , although transcriptional and translational mechanisms also were shown to be involved in hif -subunit activation.22,2630 as a result , hif- proteins accumulate , translocate to the nucleus , and dimerize with hif- to form a functional transcription factor.31 thus , in the presence of oxygen ( ie , normoxia ) , hif- proteins become degraded . this is primarily achieved by oxygen - dependent hydroxylations at the oddd.32 under normoxia , prolyl hydroxylase domain proteins ( phds),33,34 in particular phd2 , hydroxylate two crucial residues in the oddd of hif -subunits ( p402 and p564 in hif-1 and p405 and p531 in hif-2).25,32,35 prolyl hydroxylation is required for binding the von hippel - lindau protein ( vhl),36,37 which represents the substrate recognition subunit of an e3 ubiquitin protein ligase consisting of elongin c , elongin b , ring box 1 , cullin 2 , and an e2 ubiquitin - conjugating enzyme ( figure 1 ) . the prolyl hydroxylation and ubiquitination can be further promoted by the binding of phd2 to os938 and that of hif-1 , vhl , and elongin c to ssat2 , respectively.39,40 in addition to prolyl hydroxylation , a conserved asparagine residue ( n803 in hif-1 and n852 in hif-2 ) in the c - tad is hydroxylated by the factor - inhibiting hif in an oxygen - dependent manner . this hydroxylation prevents interaction with the coactivator proteins cbp / p300.4144 thus , the major posttranslational modification appears to be the oxygen - dependent hydroxylation.36,37",
"in addition to hydroxylation , hif- transcriptional activity and protein stability appear also to be dynamically regulated by other posttranslational modifications such as acetylation , s - nitrosylation , sumoylation , and phosphorylation ( for review , see dimova and kietzmann45 ) . phosphorylation appears to be of special importance under normoxic conditions , mediating the response of hif- to various growth and coagulation factors , hormones , cytokines , or stress factors ( reviewed by dimova et al46 ) under normoxia . indeed , a panel of protein kinases is reported to be involved in hif-1 phosphorylation , either directly ( table 1 ) or indirectly.4752 although the individual action of certain kinases on hif-1 regulation was mainly studied in vitro ( table 1 ) , the in vivo mechanisms are likely much more complex . at least the extent to which the kinases can be involved in hif- phosphorylation may vary according to the signal , cell type , or tissue . given the different developmental and/or differentiation status of a cell or tissue , the expression of various growth factors , their receptors , and respective signaling components and thus , it seems not to be surprising that phosphorylation of hif- by different kinases or after modulation of signaling pathways may be a highly cell type - specific event . although direct proof is currently lacking , it is plausible that the phosphorylation pattern of hif- in a certain cell may be explained by different layers of regulations that affect kinases depending on the cellular context . in addition to being activated by a variety of extracellular signals , the pi3k / akt cascade appeared also to be regulated by hypoxia , thus integrating hypoxia signaling with extracellular signals affecting multiple cellular processes such as apoptosis , metabolism , cell proliferation , and cell growth ( for review , see braccini et al53 ) . the pi3k / akt pathway is considered to control hif-1 within the cell via regulation of hif-1 protein synthesis and stability . however , it appeared that hif- proteins are not directly phosphorylated by pkb / akt but , rather , by a pkb / akt target . the pkb / akt targets hdm2,54,55 mammalian target of rapamycin ( mtor),56 and gsk-357 were shown to contribute to changes in hif- protein levels ; however , only gsk-3 was shown to do this directly , ie , by phosphorylating hif- proteins .",
"gsk-3 is a serine / threonine kinase that was first identified as a negative regulator of glycogen synthesis ; inhibition is achieved through phosphorylation of glycogen synthase.58,59 since its initial discovery , gsk-3 has been found to be involved in numerous signaling pathways initiated by diverse stimuli and to contribute to the regulation of cell proliferation , stem cell renewal , apoptosis , and development , which are processes often associated with hypoxia . because of these multiple involvements , dysregulation of gsk-3 has been implicated in the pathogenesis of human diseases , including type 2 diabetes , bipolar disorders , inflammation , alzheimer s disease , and cancer ( reviewed by frame and cohen,60 grimes and jope,61 and woodgett62 ) . two isoforms , gsk-3 ( 51 kda ) and gsk-3 ( 47 kda ) , have been identified in mammals . despite their homology in the catalytic domain ( 98% ) , they significantly differ in their n- and c - terminal parts63,64 and do not have entirely overlapping roles in metabolism ( reviewed in force and woodgett65 ) . moreover , gsk-3 ( gsk-3 ) homozygous knockout mice showed an embryonic lethal phenotype around day 16 because of hepatic apoptosis or a cardiac pattern defect,66,67 whereas homozygous gsk-3 ( gsk-3 ) knockout mice are viable and fertile.68,69 gsk-3 is a target of pkb / akt , which can phosphorylate both gsk-3 isoforms ( serine 21 of gsk-3 and serine 9 of gsk-3 ) , leading to an inhibition of gsk-3 activity.70 interestingly , these serine residues can also be phosphorylated by other kinases such as erk1/2,71 p70 ribosomal s6 kinase 1,72 camp ( cyclic adenosine monophosphate)-dependent protein kinase a ( pka),73 and protein kinase c ( pkc).74 in contrast , an autophosphorylation event leading to phosphorylation of tyrosine 279 in gsk-3 and of tyrosine 216 in gsk-3 increases gsk-3 activity.75,76 neurons seem to possess a spliced gsk-3 variant called gsk-32 that contains a 13 amino acid residue insert within the kinase domain , leading to reduced kinase activity.77,78 although gsk-3 is mostly known in the insulin field as a regulator of glycogen synthesis , it has been shown that early hypoxia enhanced pi3k / akt activity and increased hif-1 protein levels.57 similarly , hypoxia was capable of inhibiting gsk-3 by phosphorylation in different cell types , such as pc-12 ( rat pheochromocytoma cell line ) cells,79 ht1080 ( human fibrosarcoma cell line ) cells,80 and hepg2 ( human liver hepatocellular cell line ) cells,57 as well as in vivo.81 although this effect was not observed in other cell types , including some breast cancer cell lines,82 pc-3 prostate cancer cells,83 and 3t3 cells,84 it was considered to have a cell type - specific component . however , the findings that gsk-3 inhibition57 and small interfering rna - mediated depletion induced hif-1 , whereas gsk-3 overexpression reduced hif-1 protein levels,85 suggested that hif-1 is a direct target of gsk-3. indeed , the oddd86 and three sites , s-551 , t-555 , and s-589 , located within the oddd overlapping the n - tad of hif-1 were found to be directly phosphorylated by gsk-3.85 another study reported five sites , t-498 , s-502 , s-505 , t-506 , and s-510 , within the n - tad of hif-1 as gsk-3 phosphorylation sites.87 the disparity of the different phosphorylation sites is difficult to explain , but the different oxygen concentrations ( 8% o2 compared with 2% o2 ) used in these studies may contribute to the differences . it is possible that different oxygen levels may induce variable signaling pathways that have unequal effects on hif-1 and its ability to act as a substrate for gsk-3. another possibility could be the different cell types ( hepg2 compared with sk - ov-3 [ human ovarian cancer cells ] ) that were used in the studies . despite the differences in the phosphorylation sites , both studies demonstrated that the regulation of hif-1 by gsk-3 is independent of o2 , hydroxylation , and recruitment of the vhl - containing e3 ubiquitin ligase . experiments with vhl - deficient cells showed that gsk-3-dependent hif-1 degradation occurred independent of vhl , indicating that the phosphorylation of hif-1 by gsk-3 target hif-1 for proteasomal degradation in an oxygen - independent manner.85 this suggested involvement and recruitment of another so - far - unknown e3 ubiquitin ligase to gsk-3-phosphorylated hif-1. indeed , two groups demonstrated that the f - box and wd protein fbw7 ( also known as hcdc4 in yeast , hsel10 in caenorhabditis elegans , or ago in drosophila ) acted as the substrate - recognition component of a multisubunit e3 ubiquitin ligase , which was crucial for the proteasomal degradation of gsk-3 phosphorylated hif-1.85,87 in this e3 ligase , fbw7 interacts with skp1 ( s - phase kinase - associated protein 1 ) , cul1 ( cullin 1 ) , and rbx1 , forming the so - called scf complex . similar to vhl , fbw7 is considered to serve as a tumor suppressor , and three fbw7 isoforms ( fbw7 , fbw7 , and fbw7 ) are known to be produced by alternative splicing . they are found in the nucleoplasm , cytoplasm , and nucleolus , respectively.88 in addition to hif-1 , fbw7 was shown to be involved in the degradation of various oncogenic proteins , including cyclin e,89 c - myc,90,91 c - jun,92,93 and notch.94 several studies have shown that loss of the fbw7 gene is associated with malignant transformation , especially in ovarian cells and t cells,95 in breast cancer cells,96 and later also in human colorectal cancers,97 which leads then to chromosomal instability and some types of malignancy . furthermore , investigation of more than 1,500 human tumors revealed that approximately 6% of those tumors showed mutations in the fbw7 coding region . specifically , cholangiocarcinomas ( 35% ) , t - cell acute lymphocytic leukemia ( 31% ) , and endometrial ( 9% ) , colon ( 9% ) , and stomach ( 6% ) cancer98 had the highest mutation rates . strikingly , nearly half ( 43% ) of these were missense mutations that resulted in amino acid substitutions within the wd40 domain ( arg465 and arg479 ) , which are shared by all three fbw7 isoforms , suggesting that all fbw isoforms might collectively contribute to the tumor - suppressor function.98 with respect to hif-1 , all three fbw7 isoforms were able to induce hif-1 degradation , and the loss of the fbw7 wd domain abolishes gsk-3-initiated degradation , leading to higher hif-1 levels , which has been found to be associated with several tumors.99101 the finding that hif subunits can be targeted for degradation by two different e3 substrate recognition proteins indicates that the system is highly dynamic . the human genome encodes nearly 100 deubiquitylating enzymes that are predicted to be active and that oppose the function of around 600 e3 ligases.102,103 similar to e3s , deubiquitylating enzymes have a central role in cell cycle regulation and dna damage response and , depending on the context , can act either as a tumor promoter or suppressor ( see references in love et al104 ) . with respect to vhl , two different deubiqiutinating enzymes , vdu1 ( usp33 ) and vdu2 ( usp20 ) , were suggested to oppose the vhl - e3 ubiquitin ligase.105,106 later , it was shown that vdu2 but not vdu1 can interact with hif-1.107 experiments with cycloheximide and hypoxia showed that the half - life of hif-1 was significantly increased upon overexpression of vdu2 , whereas a catalytic inactive vdu2 c154a mutant had no effect . in addition , it was shown that only vdu2 , not vdu1 , deubiquitinated hif-1 , resulting in the stabilization of hif-1 protein107 ( figure 1 ) . experiments with gsk-3- and fbw7-deficient cells revealed that gsk-3- and fbw7-dependent hif-1 degradation can be antagonized by ubiquitin - specific protease 28 ( figure 1).99 these findings suggest that the gsk-3-dependent degradation of hif-1 is not limited by the presence of oxygen and is therefore independent of vhl . together , these results demonstrate that hif-1 protein stability is regulated in a dynamic manner involving different ubiquitin ligases and deubiquitinases . as such , the hydroxylation- and vhl - dependent ubiquitination and degradation of hif-1 under normoxia is opposed by the deubiquitinase vdu2 . in contrast , the oxygen - independent but phosphorylation - dependent ubiquitination of hif-1 is counteracted by ubiquitin - specific protease 28-mediated deubiquitination . the latter process allows the integration of the hif system into the cellular response to various physiologic and pathophysiologic signals independent of the oxygen tension .",
"the finding that gsk-3 is involved in the degradation of hif-1 indicated similarities with the destruction of -catenin in the canonical wnt signaling pathway . in this pathway , gsk-3 and -catenin are part of a destructive complex in which binding of gsk-3 and -catenin promotes phosphorylation of -catenin by gsk-3 , which requires priming phosphorylation by casein kinase 1 , -isoform . the phosphorylated -catenin is recognized by the f - box / wd protein -trcp and subsequently ubiquitylated and targeted for proteasomal degradation ( for review , see cohen and frame108 and metcalfe and bienz109 ) . when this phosphorylation event is blocked , -catenin accumulates and binds to the t - cell - specific transcription factor / lymphoid enhancer - binding factor 1 family of transcriptional activators to activate numerous target genes ( reviewed by reya and clevers110 ) contributing to embryonic development and adult tissue homeostasis ( reviewed by clevers111 ) . similarly , gsk-3-mediated phosphorylation of hif-1 recruits fbw7 , and thus targets hif-1 for ubiquitylation and proteasomal degradation.99 those very similar scenarios imply interference or interconnection of both the wnt/-catenin and hypoxia / hif-1 signaling on the level of gsk-3 . actually , crosstalk between the hypoxia and/or hif-1 and wnt/-catenin pathway was reported and appears to be quite complex because of controversial and likely cell / tissue / differentiation - stage specific data.112117 indeed , it was reported that hypoxia and/or hif-1 can inhibit wnt/-catenin signaling . several mechanisms , such as binding of hif-1 to hard1 ( human arrest - defective-1 protein ) with subsequent interference with acetylation of -catenin,112 blocking processing and secretion of wnt proteins,113 down - regulating -catenin via p53-dependent activation of siah-1 ( seven in absentia homolog 1),118 or direct interaction between hif-1 and -catenin119,120 were proposed to contribute to these effects . in contrast , hypoxia was also shown to activate wnt/-catenin signaling in undifferentiated cells and in vivo.115,117 in hypoxic embryonic stem cells , this occurred via hif-1-mediated expression of lymphoid enhancer - binding factor 1 and t - cell - specific transcription factor , followed subsequently by increased interaction of -catenin with lymphoid enhancer - binding factor 1/t - cell - specific transcription factor , and thus activating wnt/-catenin targets.115 in addition , hypoxia was able to activate -catenin via gsk-3 inactivation116,121 in different human cell lines such as ht-29 ( human colorectal adenocarcinoma cell line ) and hepg2 ; this activation contributed to an endothelial mesenchymal transition program , leading to significantly increased invasiveness,121 and in renal tubular cells , this process impaired wound healing.116 together , the reported findings indicate that complex interconnections between hypoxia and/or the hif-1 and wnt/-catenin pathway exist and that cell- , tissue- , and differentiation - specific aspects contribute to their functional consequences .",
"hypoxia and hifs play important roles in many critical aspects of physiological and pathological processes . most solid cancers contain hypoxic areas , and clinical data demonstrate that overexpression of hif-1 is associated with an increased risk for patient mortality . in line , downregulation of hifs interferes with tumor growth , vascularization , invasion , and metastasis , as well as radiation and chemotherapy . activation of multiple oncogenic pathways including growth factor signaling coupled with enhanced kinase signaling is a common event in tumors , thus making it likely that kinases are involved in the modulation of hif- function . because regulation of hif- protein stability is critical for its activation , identification of kinases contributing to hif- stability may provide a link explaining normoxic hif- stabilization by extracellular stimuli . in light of this , dysregulation of gsk-3 is thought to underlie the pathogenesis of various diseases that are also associated with hypoxia and changed hif- levels , such as type 2 diabetes mellitus , alzheimer s disease , mood disorders , cardiovascular diseases , and cancer.122 thus , given that gsk-3 upstream regulation leads to inhibition of gsk-3 and hif-1 accumulation , this raises the question whether it is an option to target gsk-3 in those diseases and disregard the adverse effects . although research from the last decade has demonstrated that a number of kinase pathways contribute to hif-1 regulation , data for hif-2 or hif-3 are limited . taking into consideration the overlapping , but different , roles of the hif- proteins , more knowledge about the phosphorylation - dependent regulation of hif-2 and hif-3 is necessary to better understand both already - observed general and different effects ."
] | hypoxia - inducible factors ( hifs ) , consisting of - and -subunits , are critical regulators of the transcriptional response to hypoxia under both physiological and pathological conditions . to a large extent , the protein stability and the recruitment of coactivators to the c - terminal transactivation domain of the hif -subunits determine overall hif activity . the regulation of hif -subunit protein stability and coactivator recruitment is mainly achieved by oxygen - dependent posttranslational hydroxylation of conserved proline and asparagine residues , respectively . under hypoxia , the hydroxylation events are inhibited and hif -subunits stabilize , translocate to the nucleus , dimerize with the -subunits , and trigger a transcriptional response . however , under normal oxygen conditions , hif -subunits can be activated by various growth and coagulation factors , hormones , cytokines , or stress factors implicating the involvement of different kinase pathways in their regulation , thereby making hif--regulating kinases attractive therapeutic targets . from the kinases known to regulate hif -subunits , only a few phosphorylate hif- directly . here , we review the direct phosphorylation of hif- with an emphasis on the role of glycogen synthase kinase-3 and the consequences for hif-1 function . |
[
"the pars distalis of the pituitary is composed of both granular and agranular cell types , the former largely hormone - producing cells , the latter forming a reticular and canalicular network in and around the granulated cells . among the nongranulated cells are folliculo - stellate ( fs ) cells , which have numerous long cytoplasmic processes that insinuate among the endocrine cells . neighboring fs cells are joined by well - developed junctional complexes forming an interconnected network of channels extending throughout the anterior pituitary , but particularly , the pars distalis [ 2 , 3 ] . fs cells resemble polarized epithelial cells , with their apical surfaces containing microvilli and lining the lumen of the follicular cavities [ 2 , 3 ] . of relevance to the current study , there is evidence that fs cells play a role in the absorption of ions and water from the luminal spaces [ 46 ] , which could involve the activity of an apical na / h exchanger . many aspects of metabolism , growth , stress , immunity , and reproduction are under the direct influence of granular cell secretions of the pars distalis ; however , the contribution of fs cells to intrapituitary communication and the mode(s ) by which this occurs are less well understood . fs cells play a regulatory role both by secretion of paracrine factors , including activin , follistatin , and vascular endothelial growth factor [ 7 , 8 ] , and by intercellular communication via ca signals transmitted through gap junctions , which has been suggested to contribute to synchronization of hormone secretion by endocrine cells [ 9 , 10 ] . a potential additional means of intrapituitary communication that could play a role in coordination of both fs cell and endocrine cell activities is the network of channels formed by the fs cells . previous studies showed that genetic ablation of the na / h exchanger isoform 2 ( nhe2 , gene symbol , slc9a2 ) , which is expressed at high levels in stomach , causes loss of gastric acid secretion , decreased viability of parietal cells , and severe metaplasia and hyperplasia of the gastric mucosa [ 12 , 13 ] . histological abnormalities were not observed in the kidney or intestinal tract of nhe2-null ( nhe2 ) mice ; however , they exhibited defects in the absorption of na and hco3 in both the renal nephron and colonic crypts [ 14 , 15 ] , where nhe2 is also expressed , indicating that nhe2 can function as an absorptive na / h exchanger . in the current study , it was shown that pituitaries from mice lacking nhe2 exhibited significant histopathological changes , particularly in the pars distalis and pars intermedia , both of which are derivatives of the primitive gut ectoderm . there was a greater accumulation of cytoplasmic lipid in fs cells and parenchymal cells , an undulating and reduplicated basement membrane , and decreased thickness of the pars intermedia , with a reduction of projections into the pars nervosa . however , the most striking change was a dilated fs cell canalicular system with large cyst - like spaces throughout the pars distalis , which is consistent with the loss of an absorptive ion transport mechanism in the luminal membrane of fs cells . interestingly , the cystic fibrosis transmembrane conductance regulator ( cftr ) , a cl channel that is defective in cystic fibrosis , is expressed in the pituitary gland and likely mediates the camp - stimulated anion currents detected in cultured fs cells [ 4 , 5 ] . a recent study showed that treatment with forskolin , which stimulates cftr - mediated cl secretion , affects secretion of growth hormone from pituitary slices in culture and suggested that loss of cftr activity in the pituitary might be responsible , in part , for the reduced growth rates in both humans and pigs with cystic fibrosis . the current results support the view that fs cells play a major role in regulating the ionic composition and volume of the interstitial and follicular fluid and suggest that nhe2 serves as an absorptive na / h exchanger on the luminal surface of fs cells that counters fluid accumulation resulting from cftr - mediated secretion of anions .",
"\n nhe2 and age- and gender - matched wild - type ( wt ) mice of the original 129/svj and black swiss background were used for these studies . all mice were housed in humidity and temperature controlled rooms , on a 12-hour light / dark cycle , with access to standard mouse chow and water ad libitum . mice varied in age from 17 days to over 1 year old at euthanasia , with approximately equal numbers of males and females . animals were separated into two age groups , age 1 : 17 days to 2.5 months , age 2 : 4 months1 yr , and 37 mice were used . the number ( n ) of mice in any given analysis or bar graph is given in the legend . animal protocols were approved by the university of cincinnati institutional animal care and use committee , and animal handlers were trained in an american association of assessment and accreditation of laboratory animal care facility . genotypes were determined by pcr analysis of dna isolated from tail biopsies using a set of 3 primers that simultaneously amplified wild - type and nhe2-null alleles . forward ( 5-catctctatcacaagttgcccacaatcgtg-3 ) and reverse ( 5-gtgactgcatcgttgagcagagactcg-3 ) primers from the 5 and 3 ends of exon 2 amplified a 450-base pair product from the wild - type allele . a reverse primer ( 5-gacaatagcaggcatgctgg-3 ) complementary to sequences within the neomycin resistance gene cassette , which was inserted into exon 2 , and the forward primer described above amplified a 221-base pair product from the targeted allele . using total rna from colon and pooled pituitaries of 3 - 4 month - old mice and a 3.1 kb rat nhe2 cdna probe spanning nucleotides 4493561 ( accession number l11236 ) . in situ hybridization using s - labeled antisense ( as ) and sense ( s ) probes corresponding to codons 684813 and detected using autoradiographic emulsion . pituitaries were removed immediately after euthanasia and immersed in 2% paraformaldehyde/2.5% glutaraldehyde or 4% paraformaldehyde in phosphate - buffered saline ( pbs ) for at least 24 hrs . tissues were postfixed in 1% osmium tetroxide in either millonig 's buffer or pbs for 2 hrs , dehydrated stepwise in increasing concentrations of ethanol , with two changes of propylene oxide and one change each of 1 : 1 and 1 : 3 propylene oxide : spurr ( electron microscopy sciences , hatfield , pa ) . tissues were left overnight in fresh 100% resin and flat - embedded in cut - off beem capsules ( electron microscopy sciences , hatfield , pa ) the following day in fresh resin . sections , 1.5 m thick , were stained with toluidine blue for light microscopy . pituitaries were also preserved in 4% paraformaldehyde , dehydrated in ethanol and xylene , blocked in paraffin , and serially sectioned at 5 m . some of these slides were stained with hematoxylin and eosin ( h&e ) and others were prepared for in situ hybridization . pituitaries fixed for fine structural detail and opportunely oriented were thin - sectioned and stained with uranyl acetate and lead citrate for transmission electron microscopy . light microscopic morphology and morphometry were conducted on h&e stained sections as well as on plastic sections stained with toluidine blue . the vd ( percentage ) of cytoplasmic elements was calculated from the number of intersections of a 320 point grid lying over any element/(320 minus the points over nontissue elements ) 100 . the 320-point grid was printed directly onto digital light micrographs acquired from toluidine blue stained sections at a magnification of 100x . intersections of that grid lying over the following cytoplasmic and nuclear features were counted for pars distalis : ( 1 ) fs cell canalicular space , ( 2 ) obvious fs cell cytoplasm and nuclei ( mainly where the cells were adjacent to canalicular lumens ) , ( 3 ) nuclei and cytoplasm of somatotrophs and mammotrophs ( as a single group of cells containing large granules ) and other endocrine cells ( those with smaller granules ) , ( 4 ) lipid droplet inclusions , ( 5 ) blood vessels and vascular luminal contents ( endothelium , red cells , and vascular space ) , and ( 6 ) negative areas ( those which were not tissue content , such as grid bars , edges , folds , and tears ) . the number of cells per light micrograph was approximately 200 ; metaphase cells were counted and the percentage of cells in mitosis calculated . although it was not possible to absolutely identify the cell types in 1.5 m thick sections at the light microscopic level , morphological consistencies among cell types allowed for a reasonable separation of the large granule cells , granule cells with smaller granules , fs cells , and capillaries . fs cells are somewhat under - represented in light micrographs because the thinness is just at the limits of the light microscope . basement membrane redundancy was quantified by drawing a line perpendicular to the endothelial cell basal lamina up through the basement membranes to the closest fs cell basal lamina . measurements of the thickness of the pars intermedia were obtained similarly , using both paraffin and plastic sections at 10x magnification , drawing a line perpendicularly to the interface with pars nervosa up to the pars distalis , sometimes ending at the remnants of rathke 's pouch . data were analyzed using sas 9.1 ( sas institute , cary , nc ) and sigmaplot 2000 . means and standard errors of the means were determined by genotype , gender , and age using the general linear model for vd parameters . mean thickness of the pars intermedia , standard errors , and unpaired t - tests were obtained using sigmaplot . for data shown in bar graphs or tables , n is the number of animals . data points from wt mice were pooled since no significant differences were found in morphometry within age comparisons . images were obtained using a spot i camera and nikon inverted microscope or scanned from electron microscopy prints . images were contrast enhanced , and , when needed , the grey tones were evened , and the bandaid , dust , and scratches filters were conservatively applied with photoshop 7 ( adobe.com ) , without altering the integrity of the histological data .",
"previous studies of nhe2 mice revealed functional defects directly related to loss of ion transport activity in stomach , kidney , and colon [ 12 , 15 , 16 ] . although some disturbances in fertility of nhe2 mice were suggested , gross appearance , growth curves , and overall health of nhe2 mice were seemingly normal . however , in a routine histological survey of h&e - stained tissues , we observed cyst - like structures in the pars distalis of nhe2 pituitary glands ( figure 1 ) . these first became noticeable by 5 weeks of age and by 10 weeks were well developed . such cystic changes could be due to increased secretion of ions and fluid into canalicular spaces or to reduced absorption . to determine whether the cysts were a direct effect of the loss of nhe2 , an absorptive na / h exchanger [ 15 , 16 ] , in pituitary rather than an indirect effect of pathology in other organs , the expression of nhe2 in the pituitary gland was analyzed by blot hybridization and in situ hybridization . northern blot analysis of pituitary and colon rna ( figure 2 ) showed that nhe2 mrna is expressed in the pituitary , but at much lower levels than in colon , the tissue in which the highest levels of nhe2 are expressed . the relative levels of expression suggest that expression of nhe2 mrna might be restricted to a limited area of the pituitary or to a small subset of pituitary cells . in situ hybridization ( figure 3 ) showed three distinct areas in coronal and transverse sections from both wt and nhe2 mice , comprising the more or less concentrically arranged view of these anatomical divisions , with pars distalis forming the outer layer and pars intermedia in a semicircular array around the centrally located pars nervosa ( figure 3 ) . \n in situ hybridization using the antisense probe demonstrated similar grain distribution patterns for both wt and nhe2 pituitaries , though the latter signal was greatly reduced in intensity . the antisense probe was complementary to the part of the mrna that encoded amino acids 684813 of the protein . this region is present in the mutant mrna , which contains a frame - shift mutation just beyond codon 172 ; it is expressed at low levels in some tissues , likely accounting for the reduced signals detected . hybridization with a control sense probe labeled the entire pituitary uniformly , and at very low levels , with no specific signal in any region ( data not shown ) . with the antisense probe , grain deposition was the highest in the pars distalis , with lower levels in the pars intermedia . in pars distalis , the pattern of distribution of the grains was not clearly specific to either fs cells or to granule cells ; however , this may be due to the interdigitation of fs cell cytoplasmic projections around the granule cells . cystic changes were not observed in pars intermedia or pars nervosa of nhe2 or wt mice . the pars intermedia of nhe2 mice showed significant thinning ( figure 3 , cf . 3(i ) and 3(j ) ) compared to that of wt mice ( nhe2 : 96 8 m , n = 6 ; wt : 146 8.4 m , n = 5 ; p = .003 ) . finger - like projections of the pars intermedia into the pars nervosa ( black arrows in figures 3(e ) and 3(g ) ) appeared to be reduced in nhe2 mice as well . these data show that pars intermedia is also affected , although the loss of nhe2 did not cause cystic changes as in pars distalis , at least in the time frame studied . fs cells and their junctional complexes formed the canaliculi . on tissue sections they occupied a very small percent of the pars distalis in wt mice , a volume density ( vd ) of less than 2% . canalicular lumens were generally collapsed in wt mouse pituitary but on occasion canaliculi contained small amounts of membrane - like debris . in contrast , in nhe2 mice there was a considerable increase in the combined vd of fs cells and canalicular space ( figure 4 ) to a vd of more than 10% ( nhe2 null : 12.05% 2.9 ; wt : 1.45% 0.35 ) . the integrity of the canalicular lumens seemed not to be compromised , but it became apparent that with increasing age the combined vd of fs cells and follicular space ( figure 4 ) increased in the pars distalis . analysis of pituitary sections from a single 56-day old achlorhydric mouse that lacked the gastric h , k - atpase subunit revealed no histopathology . the vd of large granule pituitary cells ( somatotrophs + mammotrophs ) was greater in nhe2 pituitaries ( figure 4 ) compared to wt . however , no differences were detected in the actual morphology of the large granule cells . both vd of fs cells ( figure 5 ) and dilation of canaliculi gradually increased in nhe2 mice compared to wt ( figure 5 ) . and while the vd of fs cell cytoplasm and nucleus increased to about 4% in the aged nhe2 mice ( p = .04 ) it still represented only a small portion of the pars distalis as a whole . the increase in the vd of fs cells appeared to be fs cell hypertrophy rather than hyperplasia ; this backed up the fact that there was no statistically significant increase in the number of mitotic cells in the nhe2 mice ( nhe2 : 0.022 0.17 ; wt : 0.003 0.02 , p = .48 ) . while the vd of folliculo - stellate cells increased in nhe2 mice , in several other respects , fs cell morphology and ultrastructure were similar to those of wt fs cells ( figure 5 ) . connections among fs cells surrounding the dilatations were seemingly occlusive , and there was no evidence for expansion or edema in the lateral ( intercellular ) spaces . junctional complexes were prominent and extensive and , like desmosomes , were most common just beneath the canalicular lumens . canalicular cystic dilatations were quite variable in size and were clearly demarcated by contiguous fs cells . nhe2 mice had fs cell canaliculi lined with unremarkable microvilli and an occasional primary cilium and sometimes contained membrane - like fragments and other cellular debris , and recognizable apoptotic bodies . there were occasional phagolysosmal structures within fs cells , particularly in the nhe2 mice . ultrastructure of the fs cell cytoplasm and nucleoplasm was not obviously changed in organization ( figure 5 ) , and intercellular interdigitations among fs cells , appearance of the rough endoplasmic reticulum , polyribosomes , mitochondria , golgi bodies , nuclei , and other organelles appeared to be unchanged from wt as well . an increase in small lipid droplets ( figure 6 ) was found predominantly in fs cell cytoplasm , and also in other cell types , including granulated cells . the vd of lipid was about 3-fold greater in the aging nhe2 mice than in wt mice , but in both groups the vd of lipid increased as age increased . values for vd of lipid for each group were compared with the genotype - matched younger age group ( resp . ) , but statistical significance was reached in the nhe2 animals only . lipid droplets were typically less than a few m in diameter and were found either as part of or adjacent to inclusions ( phagolysosomes or autophagosomes ) ( figure 6(a ) ) . microvilli on the apical membranes of fs cells of nhe2 mice ( projecting into the canalicular space ) were not noticeably different from wt ( figure 7 ) . they appeared similar to the flexible microvilli that were found in numerous other tissues , such as bile canaliculi in the liver and canalicular microvilli of parietal cells in the stomach ( about 1 m in length ) . the actin filaments seen on cross - section were more or less evenly distributed within the microvillus , if not peripherally , and were definitely not bundled centrally as one typically sees in intestinal and renal brush border . the microvilli were not very densely packed along the fs cell apical membrane in either wt or nhe2 fs cells ( figure 7 ) though , on occasion , areas of densely packed microvilli were found in the nhe2 fs cells displaying a phenotype not unlike that of parietal cell canaliculi . similar to the membrane - like debris occasionally found in canalicular lumens , membrane - like debris was sometimes found within the apical cytoplasm of fs cells of nhe2 mice ( figure 7 ) . basal membranes of fs cells adjacent to capillary endothelium abutted two basement membranes : one an fs cell product and the other produced by the capillary endothelium . in wt mice reduplicated and redundant basement membranes were common in the nhe2 mice , older animals showing greater changes . redundancies were sometimes focal , and on occasion as many as 8 redundancies were counted , with a mean number of basement membranes in the nhe2 samples significantly greater than in wt ( wt : n = 3 , 1.7 0.19 ; nhe2 : n = 4 , 2.2 0.14 , p = .036 ) . subjectively , areas of redundant and duplicated membrane appeared more likely to be attributable to the fs cells than to the capillary endothelium . an increase in other extracellular matrix proteins may have occurred as well , and occasionally collagen was seen . the vd of blood vessels in the pars distalis was not significantly different among the groups of old , young , null , or wt mice . there were many desmosomal - mitochondrial connections , which spanned adjacent fs cell membranes at the site of desmosomes ( figure 9 ) . these comprise mitochondria with a portion of outer lamella abutting the keratin filaments which radiate from the desmosome into the cytoplasm . such desmosomal - mitochondrial juxtapositions often were present on both sides of the desmosome ( i.e. , adjacent to desmosomes in adjacent cells ) , other times adjacent to the desmosome on one side only . since so many of these juxtapositions occurred , they are likely more paired than not , at least in wt mice , and section orientation has left one mitochondrion unseen ( table 1 ) . the order and incidence of junctional complexes , desmosomes , and desmosomal - mitochondrial associations in a tally made from electron micrographs revealed a significant reduction from wt in the number of desmosomes which were associated with 2 mitochondria ( table 1 ) . junctional complexes , intercellular spaces , membrane interdigitations , microvilli , and pinocytotic vesicles / caveolae are not different in nhe2 than in wt samples , as counted in this study . a count of caveolae per membrane profile per cell showed no significant difference between wt and nhe2 ( wt : 0.69 0.16 ; nhe2 : 0.23 0.10 ; p = .2 ) .",
"the most prominent histological finding consequent to gene - targeted ablation of the nhe2 na / h exchanger was the dilation of the canaliculi formed by fs cells in the pars distalis of the anterior pituitary . the cyst - like structures were lined by fs cells , with their luminal surfaces containing microvilli , and a morphology clearly indicating that they were derived from the network of interconnected follicular cavities . the cysts became apparent at about 5 weeks of age and were very prominent by 8 and 10 weeks . the absence of cysts in pituitary sections from an achlorhydric mouse lacking the gastric h , k - atpase subunit indicated that the cysts in the nhe2 pituitaries were a direct response to the loss of nhe2 in the pituitary rather than an indirect response to achlorhydria . given the known absorptive functions of nhe2 [ 14 , 15 ] , the expression of nhe2 mrna in pars distalis and at lesser levels in pars intermedia , both of which are reported to contain fs cells , and the previously demonstrated transcellular fluxes of ions and water across fs cells [ 4 , 5 ] , the data suggest that nhe2 serves as an important absorptive na / h exchanger on the luminal surface of fs cells of the anterior pituitary . nhe2 mrna expression , as indicated by northern blot analysis , was very low in the pituitary gland when compared with its expression in colon , the tissue with the highest expression in rats and mice [ 11 , 12 ] . the apparent low level of expression may be due in part to the relatively low abundance of fs cells compared to endocrine cells , as indicated by measurements of fs cell vd ; however , other factors might also be involved . under normal conditions , the luminal membrane of the follicles , where nhe2 is presumably expressed , is a small percentage of the total plasma membrane of fs cells . in addition , the gradual appearance and expansion of the canaliculi in nhe2-null pituitary glands suggest that the absorptive process is far less robust than in colonic crypts and kidney , where large quantities of ions and water are absorbed on a continuous basis . rather , the pituitary phenotype developing with the loss of nhe2 suggests that absorption mediated by low levels of nhe2 may counter relatively low levels of fluid accumulation in the follicular cavities . attempts to identify the membrane location of nhe2 protein in the pituitary gland using antibodies that have been used for immunolocalization in apical membranes of salivary acinar and duct cells were unsuccessful . thus , at the present time the membrane location of nhe2 can only be inferred from the histological phenotype and from its expression on apical membranes in epithelial tissues where it is expressed at much higher levels . earlier studies showed that fs cells in culture can function like typical epithelial cells involved in transepithelial ion and fluid transport . when grown as primary cultures , fs cells derived from the pars distalis and pars tuberalis and from the pars intermedia formed domes , indicating that they absorbed ions and water from the culture fluid . studies using cultured cells mounted in ussing chambers showed that application of -adrenergic agonists to the serosal surface led to currents consistent with cftr - mediated anion secretion , whereas application of amiloride to the mucosal surface , at concentrations known to inhibit the epithelial na channel , led to a reduction in transepithelial currents , with a further reduction in response following inhibition of the na , k - atpase with ouabain . these data indicated that fs cells contained an apical anion channel and apical transporters that were able to absorb na , with accompanying anions , from the luminal spaces . aquaporin 4 has also been shown to be expressed in fs cells , suggesting that it contributes to water transport associated with ion movements . the identities of specific ion transporters involved in transcellular ion fluxes in fs cells have not been determined ; however , a recent study showed that cftr is expressed in the pituitary and the current data indicate that nhe2 plays a critical role in this process . nhe2 is one of two absorptive na / h exchangers in apical membranes of renal and intestinal epithelial cells [ 14 , 15 ] . nhe3 mediates high levels of nacl absorption via coupling with either cl / formate exchange or cl / hco3 exchange [ 21 , 22 ] . however , when operating alone , na / h exchange mediates na and hco3 absorption . nhe2 has an unusual ph sensitivity that would appear to make it suitable for a role in nahco3 absorption . its activity is very low at normal extracellular ph , but it exhibits 50% activity at ph 8.0 , and its activity increases further as the extracellular ph increases . in the kidney , nhe2 plays a role in na and hco3 absorption and is particularly important under conditions of increased delivery of hco3 to the distal nephron . in colon , nhe2 is expressed primarily in the crypts , where the luminal ph is relatively alkaline in the presence of physiological concentrations of short - chain fatty acids , again consistent with a function in nahco3 absorption . as far as we are aware , the ph and hco3 content of follicular fluid is not known , but it is possible that the sensitivity of nhe2 to extracellular ph makes it more suitable for its role in the pituitary . cystic dilatations were not observed in the pars intermedia of nhe2 mice despite the presence of fs cells and nhe2 expression in this segment of wt pituitary glands . it is possible that secretory processes that expand the canaliculi , which may involve cftr - mediated anion secretion , are less active in this segment than in the pars distalis or that a compensatory absorptive mechanism prevents their expansion . for example , an ion transport mechanism that can compensate for the loss of nhe2 has been shown to be activated in colonic crypts of nhe2 mice . for example , de bold et al . reported the presence of two types of interconnected channels in the pars intermedia , which they noted was highly avascular and presumed that fluid and solutes in the channel systems can reach the general circulation . if this were the case , it could provide drainage , thus preventing cyst formation . it is difficult to draw clear parallels between the pituitary and stomach phenotypes of nhe2-null mice . nhe2 was originally proposed to function on the basolateral membrane of the parietal cell , operating in concert with the ae2 cl / hco3 exchanger to mediate na and cl uptake that is required for stimulated acid secretion . however , it is clear that the few mature nhe2 parietal cells were able to secrete high levels of acid and there is evidence that nhe4 is the basolateral na / h exchanger required for acid secretion . an alternative possibility is that nhe2 is expressed in canalicular membranes , where it could operate in concert with the slc26a6 cl / hco3 exchanger and other transporters to dehydrate secretory membranes during transitions to the resting state . such a function would be similar to the absorptive function proposed in fs cells and consistent with its apical expression in other epithelial tissues [ 14 , 15 , 19 , 28 ] . the cystic dilations in the fs cell canaliculi in nhe2 mice did not readily conform to those of known human or animal pituitary disease , where most reported cystic changes were within pituitary neoplasms or were cysts containing mucins or colloid - type inclusions [ 29 , 30 ] . metaplastic transformation of fs cells , described in human pituitary , was not found in the nhe2 mice . while neither colloid contents nor mucins were found with any regularity within the dilated canaliculi of nhe2 ( or wt ) pituitaries , membrane and nuclear debris were seen on occasion . they were greater in quantity in nhe2 pituitaries than in wt , and likely the residue from an occasional expulsion of previously phagocytosed apoptotic debris into the canalicular lumen . the amount of cellular debris , apoptotic bodies , or phagolysosomal vacuoles did not suggest excessive fs cell death in the nhe2 mice . this is in contrast to conspicuous parietal cell death which occurred in the stomach of nhe2 mice . fs cell microvilli most closely resembled the morphology of bile canaliculi in the liver , but nhe2 fs cells occasionally formed apical invaginations containing clusters of densely packed microvilli ( figure 7(b ) ) resembling those of parietal cell canaliculi . it is unclear whether these rare instances of densely packed microvilli correspond to an absorptive state or to a secretory state , as is the case for parietal cells , but given the invagination of the canaliculus into the cell a secretory state seems more likely . ultrastructure was also affected on the basal side of fs cells and comprised duplicated and/or redundant basement membranes . fs cells produce their own basement membranes , of the continuous type , distinct from , and parallel to , basement membranes of the capillary bed . the ability of these cells to produce matrix proteins and basement membrane structures has been described using a transgenic mouse model . redundancies in basement membranes occurred primarily beneath fs cells and were short and fragmented . duplicated basement membranes have been described in bile duct and other tissues [ 3436 ] but were not reported in stomach or other affected tissues of the nhe2 mouse [ 12 , 13 ] . it is possible that physical strain related to canalicular dilation could induce an increase in matrix proteins or that perturbations of cellular homeostasis related to the ion transport defect are involved . fs cells displayed numerous instances of close physical associations between mitochondria and the intracellular filaments of desmosomes . in wt mice , over half of the desmosomes exhibited associations with two mitochondria , one from each cell contributing to the desmosomal junction . nhe2 fs cells exhibited a significant decrease in the percentage of desmosomes associated with 2 mitochondria , from 52% in wt to 7% in mutant mice . desmosomes undergo frequent remodeling , so if mitochondria are involved in this process , it would suggest less remodeling in nhe2 fs cells . the frequent associations between mitochondria and desmosomes have led to speculations of their providing for energy requirements and calcium delivery , but the function is not known . these desmosome - mitochondria associations [ 3841 ] lend further credence to the dynamic nature of the apical membrane of fs cells . lipid droplet accumulation in the cytoplasm of cells is a well - recognized indicator of cell stress and pathology [ 4245 ] . therefore the significant increase in cytoplasmic lipid in fs and granule cells of the pars distalis of nhe2 mice may be an indication of cell stress resulting from the loss of nhe2 . this observation and the increased vd of large granule cells indicate that these endocrine cells are negatively affected by the fs cell defect . the function of the canalicular network is unclear ; however , there is compelling evidence that fs cells themselves form an extensive cell network in addition to the canalicular network and that intrapituitary communication occurs via ca signaling through gap junctions [ 9 , 10 , 4648 ] . this mechanism , which allows propagation of ca signals over long distances within the anterior pituitary , has been suggested to provide a means by which fs cells synchronize secretory activity of endocrine cells [ 9 , 10 ] . it is clearly important , and perhaps predominant ; however , it has also been noted that the anastomosing channels formed by fs cells might provide a means of synchronizing hormone secretion . one can speculate that the two networks operate separately , with fs cell ca signaling through gap junctions providing rapid coordination of endocrine activity and fs cell control of the canalicular fluid composition via ion secretion and absorption providing longer - term regulation . alternatively , anion secretion and ca signaling might act in concert if they were stimulated together or if one activity triggered the other . additional studies will be needed to identify all of the transporters involved in ion secretion and absorption by fs cells and to determine their relevance to human diseases involving transepithelial ion transport defects . in this regard , it has long been reported that pituitary function is impaired in cystic fibrosis , the most common genetic disease in humans , and recent work showed that cftr is expressed in pituitary and that the absence of its activity impairs hormone secretion ( , and references therein ) . in conclusion , the loss of nhe2 produced anterior pituitary pathology , including a gross dilation of fs cell canaliculi , increase in the vd of fs cells , a significant accumulation of small lipid droplets in fs cell and granule cell cytoplasm , a reduction in desmosomal - mitochondrial complexes , reduplication of the fs cell basement membranes , an increase in the vd of somatotrophs and mammotrophs , and a thinning of the pars intermedia . the absence of apparent effects on growth and development suggests that dilation of the canaliculi resulting from the loss of nhe2 is a relatively benign defect . nevertheless , a fertility defect remains unexplained , and the increase in both vd and lipid droplets in large granule cells showed that endocrine cells are affected . the dilation of the canaliculi suggests that nhe2 is the major absorptive mechanism that counters the accumulation of canalicular fluid resulting from ion secretion by fs cells . thus , if ion secretion serves an important function in the pituitary , as suggested by studies on the pig cystic fibrosis model and human infants with cystic fibrosis , then one might expect that disease conditions or drugs that impair ion secretion or homeostatic regulation of the volume and ionic composition of the canalicular fluid would affect pituitary function and human health ."
] | genetic ablation of the nhe2 na+/h+ exchanger causes gastric achlorhydria , absorptive defects in kidney and colon , and low fertility . here we show that nhe2 is expressed in the pituitary , with the highest mrna expression in pars distalis and lower expression in pars intermedia . in pars distalis of nhe2-null mice , prominent cyst - like dilatations of folliculo - stellate ( fs ) cell canaliculi developed with age , and there were increased fs cell area , accumulation of lipid in fs cell cytoplasm , redundancies in fs cell basement membrane , and other changes . the expansion of the canaliculi indicates that nhe2 is a major absorptive na+/h+ exchanger in the luminal membranes lining the extensive network of channels formed by fs cells , which may provide a means of intrapituitary communication . the results suggest that nhe2 contributes to homeostatic regulation of the volume and composition of the canalicular fluid and may counter the secretory activity of the cftr cl channel , which is known to be expressed in pituitary . |
[
"autonomic neuropathy ( an ) has long been recognized as a significant health risk and leads to reduced quality of life ( qol ) , increased mortality and morbidity and increased health care costs ( 1 - 2 - 3 ) . cardiovascular autonomic neuropathy ( can ) is an end - stage condition and is characterized by structural deficits due to loss of parasympathetic or sympathetic neurons that innervate the heart and blood vessels , resulting in abnormalities in heart rate ( hr ) control and vascular dynamics ( 3 ) . can is associated with multiple cardiovascular disease states , including low ejection fraction ( 4 , 5 ) , atrial fibrillation ( 6 ) , ventricular arrhythmias ( 7 ) , cardiomyopathies ( 8 , 9 ) , symptomatic systolic heart failure ( 10 ) and myocardial ischemia ( 11 ) , as well as many of the traditional and nontraditional risk factors for heart disease ( 12 ) . in patients diagnosed with diabetes and coronary artery disease serial an testing of a large population ( 774 ) of patients with diabetes demonstrated that 26% progressively worsened over time , despite clinical surveillance , while only 3% improved ( 13 ) . a meta - analysis of 15 studies of patients diagnosed with diabetes and can demonstrated a relative mortality risk of 3.65 over those without can ( 3 ) . the disease process of an is poorly understood by many clinicians and the early stages of disease are often overlooked . the two branches of the autonomic nervous system ( ans ) , parasympathetic and sympathetic ( p&s ) , act together to maintain sympathovagal balance ( sb ) ( 14 ) . establishing and maintaining appropriate sb slows the progression of an , reducing morbidity and mortality and improving outcomes ( 3 , 15 , 16 ) . eta1-adrenergic agonists ( beta - blockers ) are known to reduce sympathetic activity ( 17 ) and thereby alter sb . is known to be cardioprotective and is associated with greater longevity in geriatric and heart disease patients ( 16 , 18 ) . propranolol and metoprolol have been studied previously for their effect on diabetic autonomic nerve dysfunction , and these drugs affect only sympathetic inhibition ( 19 , 20 ) . the third - generation adrenergic blocker , carvedilol , has both beta - blocker and alpha - blocker effects . the alpha - blocker acts as a vasodilator ( 21 ) , and an antioxidant and endothelin biosynthesis suppressor ( 22 ) . thus , carvedilol has a broader affect on the ans , which may explain why it further reduces mortality ( 23 ) . our hypotheses are that the beta - blocker , metoprolol , would inhibit sympathetic tone less than the combination alpha- and beta - blocker , carvedilol . second , we hypothesize that carvedilol will also result in an increase in parasympathetic activity .",
"patients who had undergone serial autonomic p&s testing ( anx-3.0 ; ansar medical technologies , inc . , the registry consists of 147 arrhythmia - free patients diagnosed with noninsulin - dependent ( type 2 ) diabetes mellitus from eight ambulatory clinics located in new york , pennsylvania , new jersey , maryland and virginia . the patient selection method and demographics , and the three noninvasive autonomic measurement methods used for screening , are described in the companion article ( 24 ) . ( + ) beta - blocker , are those patients who were beta - blocker nave at the beginning of the study and were started on beta - blocker during the study . ( )beta - blocker , consists of patients who started the study period on beta - blocker and had beta - blocker discontinued during the study . eg3 , ( o)beta - blocker , the control group , are patients who were on stable doses of beta - blockers that did not change throughout the study . eg3 patients were case - matched to the study population patients with respect to comorbid conditions such as hypertension ( htn ) and cardiovascular disease ( cvd ) , as well as age , gender , height and weight . each experimental patient in the registry performed a baseline p&s study ( test n ) the day of the prescribed change to their beta - blocker . to remain in the registry , there needed to be documentation of the patient s compliance according to grouping , for at least 3 months , after which the patient performed a follow - up p&s study ( test n+1 ) . all graphs consist of two curves : the broken lines represent the responses to carvedilol , and the solid lines represent the responses to metoprolol . in all figures , the responses are normalized to 1.0 in the baseline test to highlight the changes ( ) in response to beta - blocker titration . the figure data present the average change ( ) in a parameter from baseline to follow - up ( test n+1 ) . absolute values for the data in the figures are presented in the tables of the companion article ( 24 ) .",
"the average age , height and weight of the cohort are 61.8 12 yrs , 166.7 27 lb and 64.8 6 in , respectively , and serial tests are separated by 4.1 ( 1.2 ) months ( 24 ) . figure 1 displays the normalized , average hemodynamic responses from the two tests for each of the three subpopulations . similarly , figures 2 through 4 display the results from the three autonomic measurement methods : ( 1 ) p&s method results , ( 2 ) spectral - domain hrv - alone results and ( 3 ) time - domain hrv - alone results , respectively . ( a ) and ( b ) represent the experimental groups ( 1 and 2 , respectively ) and ( c ) represents the control group . ( a ) and ( b ) represent the experimental groups ( 1 and 2 , respectively ) and ( c ) represents the control group . ( please see text for details . ) in response to increasing either agent , the mean hr ( mhr ) and mean systolic bp ( sbp ) decreased . in response to increasing metoprolol , the mhr decreases from 78 to 72 bpm and the average mhr response to increasing carvedilol decreases from 76 to 70 bpm ( both statistically significant , p<0.001 ) . the average changes in sbp were not significant in response to increasing either agent , staying at 125 mmhg for metoprolol and changing from 122 to 121 mmhg for carvedilol . the metoprolol - nave subpopulation demonstrates an average increase in dbp from 73 to 74 mmhg , and the carvedilol - nave subpopulation demonstrates no change . in response to discontinuing either agent , all hemodynamic measures increase there is a statistically significant increase in mhr in response to discontinuing carvedilol ( from 73 to 77 bpm ) as compared with metoprolol ( 68 to 69 bpm ; p<0.001 ) . the average sbp increase to discontinuing either agent ( from 115 to 116 mmhg and 122 to 123 mmhg for metoprolol and carvedilol , respectively ) is also statistically significant ( p<0.001 ) , but not clinically significant . the average dbp increases in response to discontinuing either agent are not significant ( from 67 to 69 mmhg for metoprolol and 69 to 70 mmhg for carvedilol ) . in response to continuing either agent , none of the hemodynamic responses are significant . the normalized data ( to highlight the respective changes in hemodynamic responses ) are displayed in figure 1 . from figure 2 , the results of the p&s method show that when either beta - blocker is introduced ( fig . however , only the ( greater ) decrease for carvedilol is significant ( p<0.001 ) . a significant increase in parasympathetic activity ( fig . 2a , middle ) is measured ( p<0.001 ) in response to either agent , with the average parasympathetic increase in response to carvedilol greater than that for metoprolol . a significant decrease in sb ( fig . 2b , top ) to discontinuing either agent increases significantly ( p<0.001 for carvedilol response and p<0.010 for metoprolol response ) , and the average parasympathetic responses decrease significantly ( p<0.001 ; fig . 2b , middle ) . for both p and s , the change in response to carvedilol is greater than that for metoprolol the average sb response to discontinuing carvedilol increases , whereas the average sb response to discontinuing metoprolol decreases . for those patients continuing beta - blocker therapy without any adjustment ( fig . 2c ) , there is very little change in p&s method results : p = 0.747 for sympathetic activity , p = 0.301 for parasympathetic activity and p = 0.275 for sb , overall . the results of the spectral domain hrv - alone analysis [ low frequency ( lf ) , high frequency [ hf ] and lf / hf ratio ) are presented in figure 3 . the total spectral power ( tsp ) normalized lf ( lfnu ) increases in response to discontinuing carvedilol , and decreases in response to discontinuing metoprolol ( fig . 3b , middle ; p<0.010 ) in response to carvedilol , and increases in response to metoprolol . ratio decreases in response to carvedilol , and increases in response to metoprolol ( fig . tsp decreases in response to discontinuing either agent , with only the metoprolol change being significant ( fig . these data show that average tsp changes to either agent are statistically significant ( see fig . 4 , top row ) . in response to increasing beta - blocker , tsp increases in response to carvedilol ( p<0.001 ) and decreases in response to metoprolol ( p<0.010 ) ( see fig . 4a , top ) . while the absolute value of the change in tsp in response to carvedilol is much greater than that for metoprolol ( 240.9 vs 42.2 ms , respectively ) , the relative changes with respect to baseline ( test n ) are similar . for patients who continued beta - blocker without adjustment ( fig . 3c ) , carvedilol further decreases the lf measure significantly ( lfnu = 0.34 , p<0.010 ) and increases the hf measure significantly ( hfnu = + 0.77 , p<0.010 ) , whereas only metoprolol decreases the hf measure significantly ( hfnu = 0.08 , p<0.010 ) . spectral - domain hrv - alone responses to beta - blocker therapy at baseline and at follow - up . ( a ) and ( b ) represent the experimental groups ( 1 and 2 , respectively ) and ( c ) represents the control group . the time - domain hrv - alone responses to the introduction of a beta - blocker ( fig . 4 ) were mixed and statistically significant in response to either agent ( p<0.001 ) . rangehr ( not shown graphically , see ( 24 , table 4 ) ) and e / i ratio increase in response to carvedilol and decrease in response to metoprolol . 4a , bottom ) . the average response to introducing carvedilol ( p<0.001 ) is greater than that to metoprolol ( p<0.010 ) . rangehr decreases significantly in response to either agent ( data not shown , see ( 24 , table 4 ) ; p<0.001 ) , while the e / i ratio increase is statistically significant for carvedilol ( fig . 4b , bottom ) to discontinuing either agent are statistically significant ( p<0.001 for both ) . total spectral power and time - domain hrv - alone responses to beta - blocker therapy at baseline and at follow - up . ( a ) and ( b ) represent the experimental groups ( 1 and 2 , respectively ) and ( c ) represents the control group .",
"our study concurs with , and expands upon , previously reported effects of beta - blockers in restoration of autonomic balance ( 20 ) . more specifically however , our study shows that carvedilol , which is both an alpha- and beta - adrenergic blocker , demonstrates a greater response than metoprolol , which is a pure beta - blocker , and demonstrates clear differences on the effects on sympathovagal balance ( sb ) . this may be due to the fact that carvedilol contains more adrenergic blockade as compared with metoprolol . whether hrv - alone is in the form of time - domain measures or frequency - domain measures , hrv - alone is shown in this study to not be a reliable or consistent measure to differentiate parasympathetic activity independent from sympathetic activity ( see the discussion in ( 24 ) ) . the subpopulation of patients who continued current beta - blocker therapy without any adjustment can be considered the control group . as shown in figure 2c , no significant changes in average hemodynamic responses are demonstrated ( note the scale of the ordinate ) . similarly , as shown in figure 3c , no significant changes in average parasympathetic or sympathetic responses are demonstrated . the changes in the p&s method are consistent with the hemodynamic changes observed for the same group ( p = 0.055 ) . as seen in figure 4c , the hrv - alone , spectral analysis method showed statistically significant responses to the continuation of beta - blockers . carvedilol further decreased the lf measure ( assumed to represent sympathetic tone ) and increased the hf measure ( assumed to represent parasympathetic tone ) , whereas metoprolol decreased hf and produced no change to the lf measurements . the spectral analysis of hrv - alone changes are not consistent with the hemodynamic changes observed for the same group ( p = 0.880 ) . it is known that the sympathetic nervous system exerts major effects on mhr and the baroreceptor reflex response , which in turn contributes to the regulation of bp . while beta - blockers cause decreases in mhr , sbp and sympathetic activity ( see figs . 2 and 3 ) , the net desired effect is an overall reduction in relative sympathetic activity . the data demonstrate that , on average , metoprolol has less of a sympatholytic effect that carvedilol ( see fig . these results are corroborated by the sb responses ( sb = s / p from the p&s method ) seen in figure 3a , bottom . 3a ) responses to the introduction of metoprolol are greater than that to carvedilol due to overall reduction in relative sympathetic activity , a significantly greater increase in tsp ( fig . 4a , top ) in response to carvedilol with respect to metoprolol is demonstrated . since tsp is based on the arithmetic sum of lf and hf ( 25 ) , and since the lf measure decreases , and the hf measure increases , the change in tsp indicates a relatively greater increase in the hf with carvedilol than with metoprolol . therefore , the change in tsp would indicate a net , relative increase in parasympathetic activity . similarly , increase in e / i ratio , rangehr and hrv , and the greater sdnn increase in response to carvedilol over metoprolol is significant . these results suggest that carvedilol not only reduces overall sympathetic dominance , but concomitantly increases parasympathetic activity , while metoprolol only reduces relative sympathetic dominance . after weaning from beta blockers , an increase in sympathetic activity and decrease in parasympathetic activity increases in mhr , bp and sympathetic activity increase significantly more after weaning from carvedilol than weaning from metoprolol . significant increases in the sb response to withdrawing carvedilol indicate a shift in the autonomic balance toward a more sympathetic dominant state , as our results reflect . the spectral domain hrv - alone ( lf and hf ) responses to discontinuing beta - blockers are mixed . lf increases in response to discontinuing carvedilol , which is consistent with a significant increase in sympathetic activity as compared with the decrease in parasympathetic activity . however , lf decreases in response to discontinuing metoprolol . this dichotomy may also be due to the dual alpha- and beta - adrenergic activity of carvedilol having greater sympathetic affect . given that lf is defined as a measure of sympathetic activity as modulated by parasympathetic activity ( 25 ) , the effect of discontinuing metoprolol on the lf measure may indicate a weaker sympathetic rebound and a relatively stronger decrease in parasympathetic activity . in other words , sb ( the measure of relative sympathetic to parasympathetic activity ) increases when carvedilol is discontinued and decreases when metoprolol is discontinued . this theory is supported by the absolute p&s values of these changes ( see ( 24 ) , table 2 ) .",
"the subpopulation of patients who continued current beta - blocker therapy without any adjustment can be considered the control group . as shown in figure 2c , no significant changes in average hemodynamic responses are demonstrated ( note the scale of the ordinate ) . similarly , as shown in figure 3c , no significant changes in average parasympathetic or sympathetic responses are demonstrated . the changes in the p&s method are consistent with the hemodynamic changes observed for the same group ( p = 0.055 ) . as seen in figure 4c , the hrv - alone , spectral analysis method showed statistically significant responses to the continuation of beta - blockers . carvedilol further decreased the lf measure ( assumed to represent sympathetic tone ) and increased the hf measure ( assumed to represent parasympathetic tone ) , whereas metoprolol decreased hf and produced no change to the lf measurements . the spectral analysis of hrv - alone changes are not consistent with the hemodynamic changes observed for the same group ( p = 0.880 ) .",
"it is known that the sympathetic nervous system exerts major effects on mhr and the baroreceptor reflex response , which in turn contributes to the regulation of bp . while beta - blockers cause decreases in mhr , sbp and sympathetic activity ( see figs . 2 and 3 ) , the net desired effect is an overall reduction in relative sympathetic activity . the data demonstrate that , on average , metoprolol has less of a sympatholytic effect that carvedilol ( see fig . these results are corroborated by the sb responses ( sb = s / p from the p&s method ) seen in figure 3a , bottom . 3a ) responses to the introduction of metoprolol are greater than that to carvedilol due to overall reduction in relative sympathetic activity , a significantly greater increase in tsp ( fig . 4a , top ) in response to carvedilol with respect to metoprolol is demonstrated . since tsp is based on the arithmetic sum of lf and hf ( 25 ) , and since the lf measure decreases , and the hf measure increases , the change in tsp indicates a relatively greater increase in the hf with carvedilol than with metoprolol . therefore , the change in tsp would indicate a net , relative increase in parasympathetic activity . similarly , increase in e / i ratio , rangehr and hrv , and the greater sdnn increase in response to carvedilol over metoprolol is significant . these results suggest that carvedilol not only reduces overall sympathetic dominance , but concomitantly increases parasympathetic activity , while metoprolol only reduces relative sympathetic dominance .",
"after weaning from beta blockers , an increase in sympathetic activity and decrease in parasympathetic activity is expected . increases in mhr , bp and sympathetic activity increase significantly more after weaning from carvedilol than weaning from metoprolol . significant increases in the sb response to withdrawing carvedilol indicate a shift in the autonomic balance toward a more sympathetic dominant state , as our results reflect . the spectral domain hrv - alone ( lf and hf ) responses to discontinuing beta - blockers are mixed . lf increases in response to discontinuing carvedilol , which is consistent with a significant increase in sympathetic activity as compared with the decrease in parasympathetic activity . however , lf decreases in response to discontinuing metoprolol . this dichotomy may also be due to the dual alpha- and beta - adrenergic activity of carvedilol having greater sympathetic affect . given that lf is defined as a measure of sympathetic activity as modulated by parasympathetic activity ( 25 ) , the effect of discontinuing metoprolol on the lf measure may indicate a weaker sympathetic rebound and a relatively stronger decrease in parasympathetic activity . in other words , sb ( the measure of relative sympathetic to parasympathetic activity ) increases when carvedilol is discontinued and decreases when metoprolol is discontinued . this theory is supported by the absolute p&s values of these changes ( see ( 24 ) , table 2 ) .",
"noninvasive measures of hemodynamic and autonomic responses to changes in beta - blocker therapy were collected . overall , the hemodynamic results are consistent with the known effects of changes in specific beta - blocker vs alpha- and beta - blocker therapy ( 21 - 22 - 23 ) . the combination of alpha- and beta - blocker decreases sympathetic tone and increases parasympathetic tone , whereas a pure beta - blocker precipitates a reflex increase in alpha - adrenergic activity , leading to less of an increase in parasympathetic tone . the p&s method results are consistent with the hemodynamic results and with the expected autonomic effects of changes in beta - blocker therapy known to underlie the hemodynamic responses ( 13 ) . as shown , hrv - alone measures are not always consistent with the hemodynamic responses , and are only consistent with expected variations in hr and perhaps total autonomic activity . adrenergic - blockade is shown to reduce sympathetic activity . by providing both alpha- and beta - blockade , carvedilol has a more profound effect in reducing sympathetic activity as compared with the pure beta - blockade of metoprolol . our results also suggest that carvedilol not only reduces overall sympathetic dominance , but concomitantly increases parasympathetic activity . adrenergic antagonists may restore autonomic balance and decrease functional disturbances that can lead to early an ( 26 ) , which leads to increased morbidity and earlier mortality ( 3 , 27 ) . a simple measure of balance ( sb ) done prospectively may add significantly to the ability to identify and predict people at risk , and the adoption of multifactorial preventive measures . both agents block sympathetic input to the heart , reducing cardiac sympathetic tone , thereby lowering hr . carvedilol also blocks sympathetic input to the vasculature , reducing sympathetic tone in the blood vessels , leading to vasodilation . the importance of autonomic assessment is emphasized by the current reports from the diad study ( 28 ) and the accord study ( 29 , 30 ) . diad demonstrates that abnormal hrv is associated with a prediction of greater increased risk of major adverse cardiovascular events ( maces ) . the risk is greater than all traditional risk factors , including perfusion scanning ( 28 ) . the development of ad is a multifactorial process , and maintaining sb may improve longevity and decrease morbidity and mortality . thus , it is likely that combination therapies directed at the various components of the pathogenic pathway will be needed to reduce the development of autonomic nerve fiber dysfunction . with intensification of glycemic control , accord demonstrates a 22% increase in sudden deaths associated with ad . establishing and maintaining normal parasympathetic and sympathetic balance may reduce morbidity risk and minimize mortality risk .",
"the importance of autonomic assessment is emphasized by the current reports from the diad study ( 28 ) and the accord study ( 29 , 30 ) . diad demonstrates that abnormal hrv is associated with a prediction of greater increased risk of major adverse cardiovascular events ( maces ) . the risk is greater than all traditional risk factors , including perfusion scanning ( 28 ) . the development of ad is a multifactorial process , and maintaining sb may improve longevity and decrease morbidity and mortality . thus , it is likely that combination therapies directed at the various components of the pathogenic pathway will be needed to reduce the development of autonomic nerve fiber dysfunction . with intensification of glycemic control , accord demonstrates a 22% increase in sudden deaths associated with ad . establishing and maintaining normal parasympathetic and sympathetic balance may reduce morbidity risk and minimize mortality risk ."
] | backgroundcardiovascular autonomic neuropathy ( can ) is recognized as a significant health risk , correlating with risk of heart disease , silent myocardial ischemia or sudden cardiac death . beta - blockers are often prescribed to minimize risk.objectivesin this second of two articles , the effects on parasympathetic and sympathetic activity of the alpha / beta - adrenergic blocker , carvedilol , are compared with those of the selective beta - adrenergic blocker , metoprolol.methodsretrospective , serial autonomic nervous system test data from 147 type 2 diabetes mellitus patients from eight ambulatory clinics were analyzed . patients were grouped according to whether a beta - blocker was ( 1 ) introduced , ( 2 ) discontinued or ( 3 ) continued without adjustment . group 3 served as the control.resultsintroducing carvedilol or metoprolol decreased heart rate and blood pressure , and discontinuing them had the opposite effect . parasympathetic activity increased with introducing carvedilol . sympathetic activity increased more after discontinuing carvedilol , suggesting better sympathetic suppression . with ongoing treatment , resting parasympathetic activity decreased with metoprolol but increased with carvedilol.conclusioncarvedilol has a more profound effect on sympathovagal balance than metoprolol . while both suppress sympathetic activity , only carvedilol increases parasympathetic activity . increased parasympathetic activity may underlie the lower mortality risk with carvedilol . |
[
"\n location of the study area - \n the administrative district of barcelos is located north of am . to the east , it borders the state of roraima ; to the southeast and south , it borders the district of santa isabel do rio negro and , to the north , it borders venezuela ( latitude 058'1 \" south of the equator and longitude 6256 \" west of greenwich ) . the city of barcelos , where this study was conducted , is located on the right bank of the negro river , 490 km from manaus , the capital of am ( \n fig . 2 \n ) . \n 2location of barcelos , state of amazonas , brazil , 2010 , and number of blood samples collected by teams ( a - f ) and city district for screen tests . \n \n survey and samples - \n the new serological survey was conducted in the main settlement of barcelos and covered the entire resident population that was willing to participate in the survey after providing informed consent . for minors , the main settlement of the municipality was divided into six areas ( a - f ) , which were to be covered by the municipality 's health agents under supervision by two laboratory technicians at the municipal hospital . the teams were trained by the project coordinator ( jr coura , a physician and infectologist ) and were monitored throughout the survey by a postgraduate student ( mhp marquez ) . each team was composed of two health agents ; the two laboratory technicians each supervised three of the teams and all six teams were monitored by the postgraduate student . in total , 4,880 blood samples were collected on filter paper in accordance with the technique of souza and camargo ( \n 1966 \n ) for the screening test : 770 samples were collected by team a ( so sebastio ) , 925 by team b ( so lzaro ) , 1,000 by team c ( so francisco ) , 728 by team d ( nazar ) , 817 by team e ( vila linhares ) and 640 by team f ( aparecida ) . all the blood samples on the filter paper were eluted in 250 l of phosphate - buffered saline ( ph 7.2 ) and were tested using the iif test , as recommended by fife and muschel ( \n 1959 \n ) and souza and camargo ( \n 1966 \n ) , as adapted by ostermayer et al . ( \n 2011 \n ) for the detection of anti- \n t. cruzi \n antibodies . the iif - chagas kit produced by biomanguinhos was used . in this kit , the antigens used are cultured epimastigote forms of \n t. cruzi \n in liver infusion tryptose medium . the tests were performed in the serology sector of the parasitic diseases laboratory of the oswaldo cruz institute , oswaldo cruz foundation , state of rio de janeiro ( rj ) , brazil . the slides were prepared in accordance with the classical techniques for iif and were examined under an immunofluorescence microscope by at least two observers . the slide readings were considered to be negative ( unreactive , absence of fluorescence ) , doubtful ( weakly reactive , low intensity of fluorescence ) or positive ( strongly reactive , high intensity of fluorescence ) . \n confirmatory serological test - \n to perform confirmatory reactions , venous blood ( 5 ml ) was collected by the laboratory technicians from 315 patients ( 60% ) who presented positive ( 137 patients ; 62% ) or doubtful ( 178 patients ; 59% ) iif reactions to \n t. cruzi \n infection based on the serological screening of blood on the filter paper . after separation , the serum was frozen , packed on dry ice and sent from barcelos to our laboratory in rj . these serum samples were subjected to three serological reactions : iif ( chagas kit , biomanguinhos ) with a dilution of 1:40 , with the positive samples tittered as much as 1:1,280 , conventional elisa ( dmed kit ) and recombinant elisa ( wiener lab . samples were considered to be seronegative if two or three of the tests were negative and seropositive if two or three of the tests were positive .",
"\n serological screening test - \n the screening test performed on the blood placed on the filter paper using immunofluorescence , 221 ( 4.5% ) of the 4,880 samples were considered to be positive ( strongly reactive ) and 302 ( 6.2% ) were considered to be doubtful ( weakly positive ) ( \n table ii \n ) . of the 4,880 samples examined , 2,741 ( 56.2% ) were from females and 2,139 ( 43.8% ) were from males . among the 221 samples that were considered to be positive , 104 ( 3.8% ) were from females and 117 ( 5.5% ) were from males . the numbers of blood samples collected on filter paper , along with the percentage of positivity for \n t. cruzi \n infection , varied according to the number of people living in the area and their degree of exposure to infection in rural areas , especially in relation to piassava harvesters and their families . this characteristic has already been presented in previous studies by our group ( \n coura et al . 1995a \n , \n b \n , \n 2002a \n , \n b \n , \n 1999 \n , \n albajar et al . 2010 \n , \n coura & junqueira 2012 \n , \n junqueira et al . 2013 \n ) . \n table ii age groups \n ( years ) tested \n n positives \n n ( % ) doubtful \n n ( % ) < 5 495 9 ( 1.8 ) 17 ( 3.4)5 - 962618 ( 1.9)30 ( 4.8)10 - 1462212 ( 2.9)30 ( 4.8)15 - 1952424 ( 4.6)35 ( 6.7)20 - 2987246 ( 5.3)56 ( 6.4)30 - 3957834 ( 5.9)41 ( 7.1)40 - 4941324 ( 5.8)39 ( 9.4)50 - 5929319 ( 6.5)18 ( 6.1)60 - 6922717 ( 7.5)17 ( 7.5)70 - 791389(6.5)10 ( 7.2 ) > 79554 ( 7.3)2 ( 3.6)unknown \n 37 5 ( 13.5)7 ( 18.9 ) 4,880 221 ( 4.5 ) 302 ( 6.2 ) \n a \n : yanomami indians . \n \n a \n : yanomami indians . the prevalence of serological positivity in samples collected on filter paper gradually increased after the age of 15 years , precisely when adolescents ( especially males ) started to be involved in piassava harvesting and after the age of 20 years among women , when as wives would accompany their husbands to the piassava plantations ( \n fig . the unknown age group ( yanomami indians who do not know their age ) is the most exposed to wild triatomines in the forest ; therefore , they had the highest percentage of iif - positive results ( 13.5% ) , as shown in \n fig . 3percentage of positive immunefluorescence by age group in the screen tests in barcelos , state of amazonas , brazil , 2010 . \n \n confirmatory serological test - \n among the 137 serum samples that were considered to be positive based on immunofluorescence testing , 37 ( 27% ) were considered to be seronegative based on the confirmatory serological test , 67 ( 48.9% ) were considered to be serodivergent , as only one of the three reactions was positive , and only 33 ( 24.1% ) were confirmed as seropositive , with two or three positive reactions ( \n table iii \n ) . of the 178 serum samples for which the immunofluorescence was considered doubtful , 89 ( 50% ) were seronegative in all three confirmatory reactions , 79 ( 44.4% ) were considered to be serodivergent \n , \n with only one positive reaction out of the three reactions , and only 10 ( 5.6% ) were considered to be seropositive , with two or three positive reactions ( \n table iii \n ) . in summary , of the 137 samples that were positive in the screening serological tests , only 33 ( 24.1% ) were positive in the confirmatory tests , while only 10 ( 5.6% ) of the 178 samples that were doubtful in the screening test were positive in the confirmatory test , as shown in \n table iii \n . the numbers of serum samples and the titres of igg confirmed by immunofluorescence as positive are shown in \n fig . 4 \n . these data most likely reflect the low level of parasitaemia and the particular \n t. cruzi \n strain circulating in the area ( tci ) , which likely provide low stimulation for antibody genesis . \n table iiiconfirmatory serological tests of 137 samples positives and 178 doubtful by indirect immunofluorescence ( iif ) in blood from filter paper evaluated by iif and elisa conventional and or recombinantserological evaluation positives iif \n from filter paper \n n ( % ) doubtful iif \n from filter paper \n n ( % ) seronegatives 37 ( 27 ) 89 ( 50)serodivergents 67 ( 48.9)79 ( 44.4)seropositives33 ( 24.1)10 ( 5.6 ) total 137 ( 100 ) 178 ( 100 ) \n \n fig . 4titres of igg of immunofluorescence in serum from confirmatory serological tests in barcelos , state of amazonas , brazil , 2011 .",
"the high prevalence found in the preliminary serological screening surveys that we conducted in 1991 , 1993 and 1997 ( \n coura et al . 1999 \n ) certainly occurred due to cross - reactions with a variety of diseases that are endemic in this area , including malaria , american cutaneous leishmaniasis , tuberculosis , leprosy and \n trypanosoma rangeli \n infection . additionally , the low titres of anti- \n t. cruzi \n antibodies demonstrated in the present study favoured occurrences of cross - reactions with other infections . the prevalence of \n t. cruzi \n infection in barcelos was observed to vary according to the intensity of exposure . in a group of 244 highly exposed individuals , we found that 11% were serologically positive ( iif and tesa - blot ) . however , among the 46 individuals in this group who underwent xenodiagnosis and polymerase chain reaction ( pcr ) analysis , we only isolated \n t. cruzi \n in 19% of the individuals through xenodiagnosis and the pcr was only positive in these cases ( coura et al . ( 1998a , b ) demonstrated only two lineages of \n t. cruzi \n in the area ( tci and z3 ) . although no studies have provided evidence , we can suppose that these lineages of \n t. cruzi \n are poorly immunogenic for antibody generation . finally , we recommend that the serological diagnosis of \n t. cruzi \n infection in the amazon region should be made using at least two different techniques , e.g. , immunofluorescence and elisa and confirmed by western blot analysis when possible .",
""
] | the serology of human
trypanosoma cruzi
infection in the rio negro microregion is very complex because of the large numbers of false - positive cases that result from low antibody titres and cross - reactions with other infections . in the present study , we collected 4,880 blood samples on filter paper ; of these , indirect immunofluorescence ( iif ) was strongly reactive in 221 ( 4.5% ) , which were considered to be positive ( iif strongly reactive ; high intensity of fluorescence ) and weakly reactive in 302 ( 6.2% ) , which were considered to be doubtful ( iif weakly reactive ; low intensity of fluorescence ) . the confirmatory test on the serum using at least two of three techniques ( iif , conventional elisa and recombinant elisa ) on 137 samples that were positive in the screening test only confirmed 33 cases ( 24.1% ) . of the 178 samples that were considered doubtful in the screening test , only 10 ( 5.6% ) were considered to be positive in the confirmatory test . finally , we recommend that the serological diagnosis of
t. cruzi
infection in the amazon region be made using at least two different techniques , for example immunofluorescence and elisa and confirmed by western blot analysis when possible . |
[
"all procedures were performed under the guidelines and with the approval of the ethics committee in animal experimentation at the federal university of minas gerais ( ufmg ) , protocol 174/2011 . one hundred and seventyeight regional lymph nodes ( 162 inguinal , 14 axillary , and 2 location not available ) were assessed from 97 female dogs with malignant mammary tumors . the intact or spayed animals were subjected only to the surgical treatment of their mammary tumors , without adjuvant treatment , at the hospital of the veterinary school of the federal university of minas gerais ( ufmg ) between 2008 and 2013 . before surgery , all animals had complete clinical examinations that included hematology and serum biochemistry . moreover , the dogs underwent thoracic radiography to rule out distant metastasis at the time of diagnosis and abdominal ultrasound examination only when serum biochemical changes or increased abdominal size were observed . the surgical technique ( e.g. , simple tumor removal , simple mastectomy , regional mastectomy , and radical mastectomy ) was chosen according to the number of lesions and sites , considering the lymphatic drainage and established prognostic factors such as lesion size and existence of skin or muscular adherences , as previously described.34 the present study included 3 ( 3.1% ) simple mastectomies , 46 ( 47.4% ) regional mastectomies , and 43 ( 44.4% ) radical mastectomies ; the type of surgery was unknown for 5 dogs . all of the tumors were completely excised , and the muscle fascia was not removed in any cases . the inguinal lymph nodes were resected en bloc , along with the inguinal mammary gland , whenever this gland was removed , or in the same manner as the axillary lymph nodes when they were enlarged , adherent , or firm . the surgical specimens ( mammary tumors and lymph nodes ) were obtained from archives of the pathology department of the veterinary clinic and surgery at the veterinary school of ufmg and of the laboratory of comparative pathology at the institute of biological sciences ( icb / ufmg ) and were analyzed by 3 veterinary pathologists ( mra , ef , and gdc ) . all of the sections were included in different cassettes and were analyzed together , evaluating the long axis of the lymph node . the tumor samples and regional lymph nodes were fixed in 10% buffered formalin and routinely prepared and stained with hematoxylineosin ( h&e ) . three veterinary pathologists ( mra , ef , and gdc ) histologically examined a minimum of 3 sections ( 3 m ) of the mammary tumors . when tumors were > 5 cm , a minimum of 5 sections were examined . all tumors were classified according to the veterinary histological classification.33 , 37 , 38 one section ( 3 m ) of each lymph node was cut and stained with h&e . three veterinary pathologists ( mra , ef and gdc ) reviewed all of the lymph nodes . in addition , the maximum width and length ( the 2 greatest dimensions ) of all metastatic foci in each positive lymph node were measured , and the larger of the 2 measurements was used as the maximum diameter of the metastatic focus . to confirm the absence of metastasis , a consecutive section ( 3 m ) of the same paraffin block obtained for h&e analysis of each lymph node negative for metastasis was cut for ihc analysis . the slides were deparaffinized , rehydrated in graded alcohol , and subjected to heatinduced antigen retrieval with antigen retrieval solution1 ( water bath at 98c ; ph 6.0 ) . the sections were stained with antibodies specific for cytokeratin ( ck ) ae1/ae31 ( 1:100 , clone ae1ae3 ) , vimentin1 ( 1:100 , clone v9 ) , or p632 ( 1:80 , clone 4a4 ) and were incubated for 1 hour at ambient temperature . the cytokeratin stain was performed for all h&e lymph node slides that were scored as negative for metastasis . the vimentin and p63 stains were performed only for h&e lymph nodes slides negative for metastasis and with primary diagnoses of carcinosarcoma and malignant adenomyoepithelioma , respectively . the ihc was used only to confirm the absence of metastasis and cases positive for metastasis by ihc were excluded from pathologic analyses . after incubation , the antigen was immunodetected using the dako advance ( hrp ) visualization method1 with diaminobenzidine ( dab substrate system)1 as the chromogen . sections were counterstained with mayer 's hematoxylin , dehydrated , and mounted in a synthetic medium . neoplastic cells in the lymphoid parenchyma or distributed in the lymphatic sinuses ( i.e. , subcapsular , medullary , or both ) in h&estained sections were considered metastases as previously described.21 when > 1 lymph node in the same patient was affected by several metastatic foci , the largest metastatic focus was measured ( maximum diameter ) for the classification of metastasis as macrometastases , micrometastases , or itc . images of all metastatic foci were obtained on an olympus bx41 microscope using a spot insight color capture system with different objectives depending on the size of the metastatic focus . the animals were organized into 5 groups according to a classification of metastasis adapted from human medicine : a ( animals without metastasis ) ; b ( animals with macrometastases : lymph node metastases > 2 mm ; fig 1a ) ; c ( animals with micrometastases : foci of neoplastic cells with diameters ranging from 0.2 to 2 mm ; fig 1b ) ; d ( animals with itc : foci of neoplastic cells < 0.2 mm ; fig 1c ) ; and e ( animals with nonmeasurable metastasis ) . group e included animals with lymph nodes that had considerable metastatic involvement but in which it was not possible to measure metastasis ( i.e. , lymph nodes partially sectioned or lymph nodes with metastatic burden distributed diffusely without defined limits ) . ( a ) neoplastic proliferations characterized by numerous structures resembling acini contain significant fibrosis replacing part of the lymphoid parenchyma ( macrometastases ) . ( b ) neoplastic proliferation characterized by structures resembling acini localized in the subcapsular sinus ( micrometastases ) . ( c ) multiple deposits of isolated epithelial neoplastic cells ( arrows ) in the subcapsular sinus . the size of the largest metastatic deposit , measuring 0.06 mm , was used to classify lymph node metastasis as isolated tumor cells ( itc ) . in addition , all animals with metastasis were stratified according to the number of lymph nodes involved , the number of metastatic foci , the maximum diameter of metastasis , and the area of metastasis ( maximum width maximum length ) . moreover , when > 1 metastatic focus was identified in 1 lymph nodes in the same patient , individual metastatic areas were summed to calculate the total metastatic area ( tma).8 for all of these analyses , a cutoff ( mean plus 1 standard deviation [ sd ] ) was established for stratification into groups . the number of lymph nodes involved , the maximum diameter of the lymph node metastases and the number of metastatic foci from each animal were used to obtain the averages for each group . all of the metastatic foci were measured to obtain an average metastatic area in animals that had > 1 metastatic focus . the animals with malignant mammary tumors were assessed , and the endpoints were defined according to the type of analyses : histologic tumor types ( 827 days of followup ; 84 animals ) , presence or absence of lymph node metastasis ( 1112 days of followup ; 84 animals ) , number of lymph nodes involved ( 778 days of followup ; 84 animals ) , classification of metastasis ( 778 days of followup ; 84 animals ) , area of metastasis ( 285 days of followup ; 33 animals ) , number of metastatic foci ( 537 days of followup ; 33 animals ) , maximum diameter of metastasis ( 285 days of followup ; 33 animals ) , and tma ( 778 days of followup ; 24 animals ) . survival time was defined as the period ( days ) between surgical tumor removal and date of death from disease . animals that were alive and that died of unknown causes or causes unrelated to the tumor were censored . among the most common causes was visceral ( calazar ) leishmaniasis ( leishmania chagasi ) , which is endemic in the city of belo horizonte , minas gerais , brazil , where the research was conducted . other causes of death were external causes ( road accidents ) , orthopedic surgery , and cardiorespiratory and neurological conditions . meier estimator , and statistical significance was examined using a logrank test , after a normality test , with p < .05 considered significant . survival data were evaluated according to the histologic tumor types , presence or absence of lymph node metastasis , number of lymph nodes involved , classification of lymph node metastasis , area of metastasis , number of metastatic foci , maximum diameter of metastasis , and tma .",
"one hundred and seventyeight regional lymph nodes ( 162 inguinal , 14 axillary , and 2 location not available ) were assessed from 97 female dogs with malignant mammary tumors . the intact or spayed animals were subjected only to the surgical treatment of their mammary tumors , without adjuvant treatment , at the hospital of the veterinary school of the federal university of minas gerais ( ufmg ) between 2008 and 2013 . before surgery , all animals had complete clinical examinations that included hematology and serum biochemistry . feed , but not water , was withheld for 36 hours before surgery . moreover , the dogs underwent thoracic radiography to rule out distant metastasis at the time of diagnosis and abdominal ultrasound examination only when serum biochemical changes or increased abdominal size were observed . the surgical technique ( e.g. , simple tumor removal , simple mastectomy , regional mastectomy , and radical mastectomy ) was chosen according to the number of lesions and sites , considering the lymphatic drainage and established prognostic factors such as lesion size and existence of skin or muscular adherences , as previously described.34 the present study included 3 ( 3.1% ) simple mastectomies , 46 ( 47.4% ) regional mastectomies , and 43 ( 44.4% ) radical mastectomies ; the type of surgery was unknown for 5 dogs . all of the tumors were completely excised , and the muscle fascia was not removed in any cases . the inguinal lymph nodes were resected en bloc , along with the inguinal mammary gland , whenever this gland was removed , or in the same manner as the axillary lymph nodes when they were enlarged , adherent , or firm . the surgical specimens ( mammary tumors and lymph nodes ) were obtained from archives of the pathology department of the veterinary clinic and surgery at the veterinary school of ufmg and of the laboratory of comparative pathology at the institute of biological sciences ( icb / ufmg ) and were analyzed by 3 veterinary pathologists ( mra , ef , and gdc ) .",
"all of the sections were included in different cassettes and were analyzed together , evaluating the long axis of the lymph node . the tumor samples and regional lymph nodes were fixed in 10% buffered formalin and routinely prepared and stained with hematoxylineosin ( h&e ) . three veterinary pathologists ( mra , ef , and gdc ) histologically examined a minimum of 3 sections ( 3 m ) of the mammary tumors . when tumors were > 5 cm , a minimum of 5 sections were examined . all tumors were classified according to the veterinary histological classification.33 , 37 , 38 one section ( 3 m ) of each lymph node was cut and stained with h&e . three veterinary pathologists ( mra , ef and gdc ) reviewed all of the lymph nodes . in addition , the maximum width and length ( the 2 greatest dimensions ) of all metastatic foci in each positive lymph node were measured , and the larger of the 2 measurements was used as the maximum diameter of the metastatic focus . to confirm the absence of metastasis , a consecutive section ( 3 m ) of the same paraffin block obtained for h&e analysis of each lymph node negative for metastasis was cut for ihc analysis . the slides were deparaffinized , rehydrated in graded alcohol , and subjected to heatinduced antigen retrieval with antigen retrieval solution1 ( water bath at 98c ; ph 6.0 ) . the sections were stained with antibodies specific for cytokeratin ( ck ) ae1/ae31 ( 1:100 , clone ae1ae3 ) , vimentin1 ( 1:100 , clone v9 ) , or p632 ( 1:80 , clone 4a4 ) and were incubated for 1 hour at ambient temperature . the cytokeratin stain was performed for all h&e lymph node slides that were scored as negative for metastasis . the vimentin and p63 stains were performed only for h&e lymph nodes slides negative for metastasis and with primary diagnoses of carcinosarcoma and malignant adenomyoepithelioma , respectively . the ihc was used only to confirm the absence of metastasis and cases positive for metastasis by ihc were excluded from pathologic analyses . after incubation , the antigen was immunodetected using the dako advance ( hrp ) visualization method1 with diaminobenzidine ( dab substrate system)1 as the chromogen . sections were counterstained with mayer 's hematoxylin , dehydrated , and mounted in a synthetic medium . neoplastic cells in the lymphoid parenchyma or distributed in the lymphatic sinuses ( i.e. , subcapsular , medullary , or both ) in h&estained sections were considered metastases as previously described.21 when > 1 lymph node in the same patient was affected by several metastatic foci , the largest metastatic focus was measured ( maximum diameter ) for the classification of metastasis as macrometastases , micrometastases , or itc . images of all metastatic foci were obtained on an olympus bx41 microscope using a spot insight color capture system with different objectives depending on the size of the metastatic focus . the animals were organized into 5 groups according to a classification of metastasis adapted from human medicine : a ( animals without metastasis ) ; b ( animals with macrometastases : lymph node metastases > 2 mm ; fig 1a ) ; c ( animals with micrometastases : foci of neoplastic cells with diameters ranging from 0.2 to 2 mm ; fig 1b ) ; d ( animals with itc : foci of neoplastic cells < 0.2 mm ; fig 1c ) ; and e ( animals with nonmeasurable metastasis ) . group e included animals with lymph nodes that had considerable metastatic involvement but in which it was not possible to measure metastasis ( i.e. , lymph nodes partially sectioned or lymph nodes with metastatic burden distributed diffusely without defined limits ) . ( a ) neoplastic proliferations characterized by numerous structures resembling acini contain significant fibrosis replacing part of the lymphoid parenchyma ( macrometastases ) . ( b ) neoplastic proliferation characterized by structures resembling acini localized in the subcapsular sinus ( micrometastases ) . ( c ) multiple deposits of isolated epithelial neoplastic cells ( arrows ) in the subcapsular sinus . the size of the largest metastatic deposit , measuring 0.06 mm , was used to classify lymph node metastasis as isolated tumor cells ( itc ) . in addition , all animals with metastasis were stratified according to the number of lymph nodes involved , the number of metastatic foci , the maximum diameter of metastasis , and the area of metastasis ( maximum width maximum length ) . moreover , when > 1 metastatic focus was identified in 1 lymph nodes in the same patient , individual metastatic areas were summed to calculate the total metastatic area ( tma).8 for all of these analyses , a cutoff ( mean plus 1 standard deviation [ sd ] ) was established for stratification into groups . the number of lymph nodes involved , the maximum diameter of the lymph node metastases and the number of metastatic foci from each animal were used to obtain the averages for each group . all of the metastatic foci were measured to obtain an average metastatic area in animals that had > 1 metastatic focus .",
"the animals with malignant mammary tumors were assessed , and the endpoints were defined according to the type of analyses : histologic tumor types ( 827 days of followup ; 84 animals ) , presence or absence of lymph node metastasis ( 1112 days of followup ; 84 animals ) , number of lymph nodes involved ( 778 days of followup ; 84 animals ) , classification of metastasis ( 778 days of followup ; 84 animals ) , area of metastasis ( 285 days of followup ; 33 animals ) , number of metastatic foci ( 537 days of followup ; 33 animals ) , maximum diameter of metastasis ( 285 days of followup ; 33 animals ) , and tma ( 778 days of followup ; 24 animals ) . survival time was defined as the period ( days ) between surgical tumor removal and date of death from disease . animals that were alive and that died of unknown causes or causes unrelated to the tumor were censored . among the most common causes was visceral ( calazar ) leishmaniasis ( leishmania chagasi ) , which is endemic in the city of belo horizonte , minas gerais , brazil , where the research was conducted . other causes of death were external causes ( road accidents ) , orthopedic surgery , and cardiorespiratory and neurological conditions .",
"survival curves were calculated using the kaplan meier estimator , and statistical significance was examined using a logrank test , after a normality test , with p < .05 considered significant . survival data were evaluated according to the histologic tumor types , presence or absence of lymph node metastasis , number of lymph nodes involved , classification of lymph node metastasis , area of metastasis , number of metastatic foci , maximum diameter of metastasis , and tma .",
"the ages of the 97 animals at the time of surgery ranged from 4 to 16 years ( mean , 10.7 2.7 years ) . the dogs were predominantly purebred ( 68/93 ; 72.34% ) , and poodles ( n = 31 ) were the most common breed . mongrel dogs were observed less frequently ( 25/93 ; 26.60% ) , and the breed was not recorded for 4 dogs . the dogs were intact ( 52/76 ; 68.42% ) and spayed ( 24/76 ; 31.58% ) ; reproductive status was not available for 21 dogs . the inguinal and caudal abdominal glands were the predominant sites of the lesions ( 31/93 ; 33.33% each ) in relation to the multicentric localization ( 15/93 ; 16.13% ) , cranial abdominal glands ( 12/93 ; 12.90% ) , and thoracic glands ( 4/93 ; 4.31% ) . in 4 cases , none of the animals had pulmonary changes on radiographic examination , changes in abdominal ultrasound findings , or both at the time of surgery . initially , 178 lymph nodes ( 162 inguinal , 14 axillary and 2 location not confirmed ) of 97 dogs were accessed . however , after ihc analysis , 161 lymph nodes of 90 dogs were considered for study . among 161 lymph nodes , 49.7% ( 80 ) one axillary lymph node and multiple ipsilateral axillar lymph nodes were removed from 5.7% ( 5/88 ) and 3.4% ( 3/88 ) of dogs , respectively . one ipsilateral inguinal lymph node and multiple ipsilateral inguinal lymph nodes were identified in 39.8% ( 35/88 ) and 47.7% ( 42/88 ) of dogs , respectively . both axillary and inguinal lymph nodes were excised from 3.4% ( 3/88 ) of dogs . in 2 dogs , dogs with lymph node metastasis were predominantly observed ( 57/90 ; 63.3% ) relative to dogs without lymph node metastasis ( 33/90 ; 36.7% , table 1 ) . the mean number of evaluated nodes per animal was 1.78 ( sd , 1.01 ) , with a maximum of 6 and a minimum of 1 lymph node . the mean number of metastatic lymph nodes per animal was 1.4 ( sd , 0.75 ) , with a maximum of 5 and a minimum of 1 metastatic lymph node . the inguinal lymphatic region was the predominant site of metastasis ( 45/55 ; 81.8% ) relative to the axillary lymphatic region ( 8/55 ; 14.5% ) and simultaneous occurrence ( inguinal and axillary ; 2/55 ; 3.6% ) . distribution of histologic tumor types and lymph node features according to the adapted metastasis classification used in humans mtc , carcinoma in mixed tumor ; sc , solid carcinoma ; rtmt * , rare type malignant mammary tumors ( including micropapillary carcinoma , n = 14 ; lipidrich carcinoma , n = 1 ; pleomorphic lobular carcinoma , n = 1 ; malignant adenomyoepithelioma , n = 1 ; and malignant phyllodes tumor , n = 1 ) ; ptc * * , ( including papillary carcinoma , n = 10 ; and tubular carcinoma , n = 3 ) ; css , carcinosarcoma . carcinomas in mixed tumors were the most common cancer , and the rarest tumors were lipidrich carcinoma , malignant adenomyoepithelioma , pleomorphic lobular carcinoma , malignant phyllodes tumor , and invasive micropapillary carcinoma , all of which were included in the group of rare types of malignant mammary tumors ( table 1 ) . the animals with carcinoma in mixed tumors , rare types of malignant tumors , solid carcinoma , papillary and tubular carcinoma and carcinosarcoma had mean respective survival times of 485.5 259.4 days ( not reaching median survival ) , 227.1 235.2 days ( median , 180 days ) , 228.2 253.4 days ( median , 195 days ) , 401.7 196.8 days ( not reaching median survival ) , and 163.3 115.7 days ( median , 185 days ) . animals with solid carcinoma , carcinosarcoma , and rare types of malignant mammary tumors had lower survival rates than animals with carcinoma in mixed tumors and papillary and tubular carcinoma ( p < .0001 ; fig 2a ) . ( a ) kaplan meier survival curve for the animals according to the histologic types : mtc ( carcinoma in mixed tumor ; n = 32 ) ; ptc ( papillary and tubular carcinoma ; n = 11 ) ; sc ( solid carcinoma ; n = 16 ; median , 195 days ) ; rtmt ( rare type malignant mammary tumors ; n = 18 ; median , 180 days ) ; and css ( carcinosarcoma ; n = 7 ; median , 185 days ) . animals with mtc and ptc not did reach median survival ( p < ( b ) kaplan meier survival curve for the animals with metastasis ( n = 53 , median , 275 days ) and without metastasis ( n = 31 , not reaching median survival ) ( p < .0001).(c ) kaplan meier survival curve for the animals according to the number of lymph nodes involved : 0 ( no metastatic lymph nodes ; n = 31 , not reaching median survival ) , 1 ( 1 metastatic lymph node ; n = 37 ; median , 348 days ) , and 2 ( 2 metastatic lymph nodes ; n = 16 ; median , 130 days ) ( p < .0001 ) . ( d ) kaplan meier survival curve for the animals according to the classification of metastasis : a ( absence of metastasis ; n = 31 ) , b ( macrometastases ; n = 11 ; median , 240 days ) , c ( micrometastases ; n = 14 ) , d ( isolated tumor cells ; n = 8 ; median , 262 days ) , and e ( no measurable metastasis ; n = 20 ; median , 180 days ) ( p < .01 ) regarding the presence or absence of lymph node metastasis , the animals with metastasis had lower survival times ( mean , 253.9 244.2 days and median , 275 days ) compared with animals without metastasis ( mean 530.6 286.8 days and not reaching median survival ; p < .0001 ; fig 2b ) . when the number of lymph nodes involved was evaluated , the presence of 2 metastatic ipsilateral lymph nodes ( equal or different lymphatic basins ) was associated with lower survival ( p < .0001 ; fig 2c ) . the mean survival times of animals with lymph nodes without metastasis , with 1 metastatic lymph node , and with 2 metastatic lymph nodes were 497.6 238.4 days ( not reaching median survival ) , 275.3 223.2 days ( median , 348 days ) , and 174.2 192.8 days ( median , 130 days ) , respectively . animals with isolated tumor cells ( group d ; mean , 200.1 108.0 days and not reaching median survival ) , nonmeasurable metastases ( group e ; mean , 191.8 186.9 days and median , 180 days ) , and macrometastases ( group b ; mean , 248.8 277.8 days and median , 240 days ) had lower survival times than those without metastasis ( group a ; mean , 497.6 238.37 days and not reaching median survival ) and those with micrometastases ( group c ; mean , 342.9 238.9 days and not reaching median survival ) . lower survival with statistical significance was observed in animals from groups ba ( p = .002 ) , da ( p = .001 ) and ea ( p < .0001 ) and in animals from group e relative to group c ( p < .001 ; fig 2d ) . stratification of animals with measurable metastasis ( i.e. , macrometastases , micrometastases , and itc ) distributed in groups according to the area of metastasis , number of metastatic foci , maximum diameter , and tma is presented in table 1 . the mean area of metastasis was 2.95 mm ( range , 0.0001169.88 mm ; sd , 17.16 mm ; n = 33 ) . when stratified by area , animals with areas < 20.11 mm ( mean , 207.1 93.4 days and not reaching median survival ) had a greater survival than those with areas > 20.11 mm ( mean , 103.0 107.1 days and median , 86.5 days ; p = .0457 ; fig 3a ) . ( a ) kaplan meier survival curve for the animals according to the area of metastasis : < 20.11 mm ( n = 28 ; not reaching median survival ) and > 20.11 mm ( n = 5 ; median , 86.5 days ) ( p = .0457 ) . ( b ) kaplan meier survival curve for the animals according to the number of metastatic foci : < 28 foci ( n = 30 ; median , 404 days ) and > 28 foci ( n = 3 , not reaching median survival ) ( p = .629 ) . ( c ) kaplan meier survival curve for the animals according to the maximum diameter of metastasis : < 7.32 mm ( n = 27 ; not reaching median survival ) and > 7.32 mm ( n = 6 ; median , 63 days ) ( p = .0068 ) . ( d ) kaplan meier survival curve for the animals according to the total metastatic area ( tma ) : < 88.92 mm ( n = 21 ; not reaching median survival ) and > 88.92 mm ( n = 3 ; median , 110 days ) ( p = .3329 ) . the mean number of metastatic foci was 10 ( range , 197 foci ; sd , 18 foci ; n = 33 ) . there were no statistically significant differences in the survival of animals with < 28 foci ( mean , 237.1 174.5 days and median , 404 days ) and > 28 foci ( mean , 361.3 155.3 days and not reaching median survival ; fig 3b ) . the mean maximum diameter of the metastases was 2.86 mm ( range , 0.0616.92 mm ; sd , 4.46 mm ; n = 33 ) . when stratified by maximum diameter , the survival of animals with diameters > 7.32 mm ( mean , 95.8 97.4 days and not reaching median survival ) was lower than animals with diameters < 7.32 mm ( mean , 212.6 90.6 days and median , 63 days ; p = .0068 ; fig 3c ) . finally , the mean tma obtained for animals with > 1 metastatic focus was 26.04 mm ( range , 0.0196239.41 mm ; sd , 62.88 mm ; n = 24 ) . when stratified by tma , no significant difference was found in survival of the animals with tmas < 88.92 mm ( mean , 303.3 210.1 days and not reaching median survival ) and with tmas > 88.92 mm ( mean , 317.0 399.9 days and median , 110 days ; fig 3d ) .",
"as in women , regional lymph node status has major impact on survival in dogs with mammary tumors.22 , 23 , 24 , 25 , 26 , 27 in the present study , animals with metastasis had lower survival times than did animals without metastasis . these findings are similar to those reported in the literature.22 , 23 , 24 , 25 , 26 \n to our knowledge , this study is the first to describe the prognostic significance of identifying a higher number of lymph nodes positive for metastasis in dogs , as has been reported in humans.1 , 39 another novel aspect is the use of a more accurate technique for measuring metastases , which yields a more detailed representation of the metastatic load of the lymph nodes in these animals . in this study , dogs with lymph node metastases with diameters > 7.32 mm had lower overall survival . another interesting finding was that the presence of itc in the lymph nodes of dogs with malignant mammary tumors was associated with lower overall survival in comparison to dogs with no metastatic malignant mammary tumors . histological type is one of the most important prognostic factors in dogs with mammary tumors and , our results are similar to those described in the literature.23 , 24 we found that solid carcinomas are extremely aggressive histologically and have a worse prognosis compared with histologically welldifferentiated tumors , such as carcinomas in mixed tumors , papillary carcinoma , and tubular carcinoma . these tumors were associated with lower overall survival compared with other tumors , as described in previous studies.40 , 41 , 42 , 43 \n in this study , metastatic involvement of > 1 lymph node showed a direct correlation with worse prognosis . this parameter may become an important prognostic factor in veterinary clinical practice and has not previously been described in dogs . in women , a higher number of affected axillary lymph nodes is associated with shorter survival times , which is a wellrecognized prognostic factor in breast cancer.1 , 39 \n the presence of lymph node macrometastases is also a clinically relevant prognostic factor in dogs with mammary tumors.36 however , a novel finding of similar prognostic relevance was the identification of isolated cells in these animals . in this study , 33.33% of the animals diagnosed with itc had more aggressive tumors , such as carcinosarcoma and solid carcinoma . such behavior may be similar to that observed in women with breast cancer , in whom the clinical relevance of identifying cell clusters < 0.2 mm has shown conflicting results and may be directly related to the histologic type studied.13 , 16 , 18 , 21 \n the differences in animal survival demonstrate that metastatic area measurements can be used to characterize regional lymph node metastases in female dogs with malignant mammary tumors . however , this characterization may not be practical in routine laboratory pathology because it would be necessary to measure all metastatic foci to obtain the mean metastatic area . the maximum diameter of metastases currently is used to classify metastases as macrometastases , micrometastases , or itc in humans.7 in the present study , the classification of metastasis used in humans was made , along with stratification to the maximum diameter ( cutoff : mean plus sd = 7.32 mm ) . lower survival was observed in animals with a maximum diameter of lymph node metastasis > 7.32 mm relative to animals with a maximum diameter of lymph node metastasis < 7.32 mm . thus , the behavior of macrometastases and staging in dogs can vary , and the current classification system based on humans ( macrometastases : metastasis > 2 mm ) may not be the most appropriate . other authors have discussed the use of classification systems other than the classification systems used in humans that have been adapted to veterinary medicine.35 a subclassification system for macrometastases should be considered because the lymph node metastasis can reach considerable size in female dogs , similar to findings in the present study . the tma measurements in slns can predict nonsln metastasis in women with breast cancer.8 the present study found no differences in animal survival between a tma ( cutoff : mean plus sd ) > 88.92 mm and a tma < 88.92 mm . thus , to obtain prognostic information , we consider that the maximum diameter measurement could be one of the most suitable methods when analyzing single sections of lymph nodes in female dogs with malignant mammary tumors . in the clinical studies of humans , substantial advances are described in relation to the standardization of gross sectioning and the number of histologic sections to be analyzed in slns of women with breast cancer.44 in veterinary medicine , evaluating lymph node metastases , determining the prognostic value of metastatic size , and even establishing the number of histologic sections to be analyzed should be investigated in additional studies , especially when using sln mapping in mammary tumors of dogs . the findings in this study may help in future proposals for the standardization of these methods of analysis , showing the real prognostic relevance of the occurrence of lymph node metastasis in malignant mammary tumors of dogs . corroborating previous findings,22 , 23 , 24 , 25 , 26 our study showed that the presence of lymph node metastasis is a negative prognostic factor . however , the analysis of these data with tumor size , histologic type , mitotic index , histologic grading , status of hormonal receptors , and cell proliferation markers may provide more consistent information in a multivariate analysis of the possible independent prognostic factors in dogs with malignant mammary tumors and may provide actual practical applications for the data presented in this study for clinical practice . however , the independent prognostic relevance of lymph node status in dogs with mammary tumors is still poorly established in multivariate analysis.23 , 45 , 46 \n",
"the identification of 1 metastatic lymph nodes is considered a parameter for prognostic assessment in affected animals . moreover , macrometastases and itc in regional lymph nodes are associated with a worse prognosis in dogs with malignant mammary tumors subjected only to surgical treatment . a more detailed classification system and staging that takes into account differences in the sizes of macrometastases identified in female dogs should be considered , and additional studies should be conducted to confirm these findings ."
] | backgroundas in women , regional lymph node status impacts survival in dogs with malignant mammary tumors . however , few studies have evaluated regional lymph node metastases in dogs with malignant mammary gland tumors.objectivesto estimate overall survival based on the assessments of the lymph node status and the morphologic and morphometric features in female dogs with malignant mammary gland tumors.materials and methodsin total , 178 lymph nodes from 97 female dogs were assessed and reviewed , and after confirmation by immunohistochemistry ( ihc ) , 161 lymph nodes were selected for analysis of metastases . animals were considered metastasisfree ( negative lymph nodes ) only after ihc analysis for cytokeratin ae1/ae3 . the number of positive lymph nodes , the number of metastatic foci , the maximum diameter and the area of metastasis were analyzed , and estimates of overall survival were made.resultsdogs with metastasis had lower mean survival than those with metastasisfree regional lymph nodes , showing a direct relationship between the number of affected lymph nodes and shorter survival . however , histologic analysis of the lymph nodes identified lower survival rates in animals with macrometastases and isolated tumor cells , areas of metastasis > 20.11 mm , and metastatic diameters > 7.32 mm.conclusionthe identification of 1 lymph nodes positive for metastasis and morphometric characterization of lymphatic metastases indicate the prognostic relevance of lymph nodes status in dogs with mammary tumors . |
[
"these lesions though may cause life threatening hemorrhage , watchful observation is still considered as a treatment option in these patients .",
"a 71-year - old male presented with pulsatile swelling over the right side of face and over the forehead in october 2009 . patient is a known diabetic and hypertensive for the past 9 years on regular medications . patient was evaluated with computed tomography ( ct ) angiogram , which showed aneurysm of the external carotid artery with thrombus within and multiple aneurysm of the branches of external carotid arteries . treatment option of excising the aneurysm with ligation of external carotid aneurismal branches was discussed with the patient . since the swelling was asymptomatic for the past 34 years , patient was not willing for any procedure . he is assessed with clinical examination on each visit and ultrasound examination performed once in a year to assess the size of the aneurysm . the patient has been on follow up for the past 4 years without any new symptoms or increase in size of the aneurysm .",
"aneurysm of the external carotid artery and its branches have been described in cases due to trauma , iatrogenic injury , dental extraction , and also due to head and neck cancer because of tumor infiltration or due to radiation therapy . geriatric patients with aneurysm are first consulted by a primary care physician and hence primary care physician at the community level has a major role in following these patients and referring these patients to specialized vascular centre . increase in size of the aneurysm or impending rupture necessitates the need for referral to specialized center . the need for surgical intervention or endovascular stenting does not arise in our patient who has this aneurysm for 34 years and was on follow up for the past 4 years without any symptoms [ figure 1 ] . pulsatile swelling over the face , forehead , and scalp in this setting , the role of primary care physician is important to decide upon surgical or conservative management after having discussion with the patient . multiple aneurysm of external carotid artery this case was discussed for the rarity of idiopathic multiple aneurysm [ figure 3 ] of the external carotid artery [ figure 4 ] and the need for individualized treatment protocol to be followed , as in this case , only watchful observation . in this world of evolving surgical techniques and newer treatment modalities , conservative treatment still has a role to play .",
"even in the era of advanced medical technology practices , treatment should be individualized and the choice rests with the patient . primary care physicians have a major role in follow up of these patients and decide upon referring these patients to specialized vascular center thus lessen the burden of vascular centre in following these patients ."
] | aneurysms of external carotid artery are rare . treatments for these are undertaken for the prevention of complications like hemorrhage or rupture , and embolism . we present a 71-year - old male with idiopathic multiple aneurysm for the past 34 years on conservative management and regular follow up for the past 4 years . this case was discussed for the rarity of idiopathic multiple aneurysm of the external carotid artery and the need for individualized treatment protocol to be followed as in this case , only watchful observation considering the age and patient compliance . in this world of evolving surgical techniques and newer treatment modalities , conservative treatment still has a role to play . primary care physicians at the community level have a major role in following these patients and referring them as and when the need arises . |
[
" tis education forms the common mind ; just as the twig is bent , the tree s inclined , wrote alexander pope in 1734 . this is likely one of the earliest poetic descriptions of a current topic of great interest to psychiatrists and research neuroscientists , namely the impact of early psychosocial factors on subsequent neuronal development and ultimate phenotypic presentation . michael meaney and colleagues at mcgill university have demonstrated , in an elegant series of experiments in rats , the effect of early maternal grooming of rat pups on stress resilience via hippocampal glucocorticoid receptor expression and activation of nerve growth factor inducible - a . offspring interactions can dramatically influence the child s behavior as they age.1 the focus of this study is to examine retrospectively the potential relationship between maternal personality characteristics , as measured by the minnesota multiphasic personality inventory ( mmpi ) , and drug dependence in their sons . the hypothesis is that certain personality traits in mothers may help predict an at - risk population of their sons for the development of drug dependence . this preliminary work is intended to explore a potential translational aspect of the work of meaney and others . bucknall and robertson,2 have demonstrated the role of family in the etiology of drug abuse , with an even greater role in the maintenance of an individual s drug dependence . andersson and eisemann,3 confirmed that a parental rearing behavior perceived both as rejecting and overprotective represents a link between dysfunctional parenting and the development of maladaptive psychosocial behaviors , like drug addiction . drug addicts often come from families where there is frequently expressed ill will and hostility in the home . they have weaker family ties than do those who do not take drugs . in families in which there was contact with drugs , authority belonged to the mother to a greater degree than the father.4 handlarz et al5 studied drug addicts and their families and observed general characteristics common to all substance - dependent patients . among these were vulnerability of personality and ego weakness , absent father , narcissistic mother , disaggregation of the family , and pathological communication among family members . graeven and schaef 6 reported the relationship with the opposite sex parent had the strongest impact on both male and female heroin users . kaufamn7 studied the family structure of drug addicts and their families who were in residential treatment at the time of the study . the most common familial pattern seen was that of a mother enmeshed with her addicted son . the father reported feeling excluded by the dyad and reacted with disengagement , brutality , or increased consumption of alcohol . this paper examines the personality of mothers and its relationship to severity of addiction of their sons . it is a follow up to our previous work on childhood parenting styles of the substance - dependent patient.8",
"patients were diagnosed according to diagnostic statistical manual ( dsm iv).9 the control group consisted of 35 mothers of non - drug - dependent subjects . mothers from both groups fulfilled the following inclusion criteria : \n age between 40 and 60.not suffering substance use disorders or any other psychiatric disorders.not suffering significant medical disorder . age between 40 and 60 . not suffering substance use disorders or any other psychiatric disorders . all study subjects were informed they were participating in a volunteer study examining the relationship between a mother s personality and drug dependence in their children . all study participants provided informed consent to a psychiatrist ( sa ) member of the study team . both groups were administered the minnesota multiphasic personality inventory ( mmpi),10 which is a self - reported inventory developed in 1937 by starke hanthaway and charnley mckinley . the items of each scale were selected for their ability to separate medical and psychiatric patients from normal control subjects . we applied the arabic version prepared by melika et al.10 substance - dependent patients were assessed with the addiction severity index ( asi).11 the asi is a semi - structured interview designed to address 7 potential problem areas in substance use disorder patients : medical status , employment and support , drug use , alcohol use , legal status , family / social status , and psychiatric status . in 1 hour , a skilled interviewer can gather information on recent ( past 30 days ) and lifetime problems in all of the problem areas . the asi provided an overview of problems related to substance , rather than focusing on any single area . personality profiles of mothers of both groups were compared , and those of mothers of dependent patients were correlated to the 7 dimensions of the asi .",
"differences between quantitative variables for the addicts group and the control group were assessed using student s t - test . the mmpi scales for mothers were classified into risk grades and differences between the study groups were assessed using pearson s chi - square test . the association between the different study scales for mother and their offspring was assessed using correlation analysis .",
"the mean age of mothers of patients was 50 , while that of the control was 44.8 years . they were age matched ( p = 0.07 ) there were significant differences between both groups on depression , hysteria , and paranoia scales of the mmpi . depression scores were higher than 70 ( pathological ) in 8% of study group compared to only 1% of control group . depression scores were in the normal range ( 45 to 50 ) in 5% of study group compared to 22% of the control group ( p = 0.003 ) . scores on the hysteria scale were higher than 70 in 4% of study group compared to none of the control group . negative scores for hysteria were seen in 15% of the study group , compared to 40% of the control group ( p = 0.02 ) . paranoia scale scores were positive in 4% of the study group , compared to 1% of controls ( p = 0.03 ) . no paranoia was detected in 10% of the study group , compared to 40% of controls . no significant differences were reported on any of the other mmpi scales ( table 1 ) . significant positive correlations were observed among mothers of substance - dependent patients on scores of depression , hypochondrias , and psychopathic deviance ( p = 0.003 , and p = 0.01 respectively ) . a positive correlation was also detected between scores of hysteria , hypochondrias and psychopathic deviance ( p = 0.001 and p = 0.004 , respectively ) , and between paranoia and hypochondrias , depression , and psychopathic deviance ( p = 0.005 , p = 0.01 , and p = 0.01 , respectively ) . pearson s correlation coefficient was calculated to measure the degree of association between mmpi scores and the asi . results showed significant positive correlation between scores of hysteria and psychopathic deviance and asi legal status impairment ( p = 0.023 and p = 0.019 , respectively ) . there was a significant negative correlation between social introversion and asi scores of drug / alcohol use , and family history ( p = 0.007 and p = 0.003 , respectively ) . significant positive correlations were observed between scores of social status impairment and those of psychiatric and legal status impairment ( p= 0.005 and p = 0.04 , respectively ) .",
"the role of parenting in the development of drug abuse is a widely discussed topic . this is best demonstrated by 2,590,000 google hits displayed when the role of parenting on drug abuse is searched . behavioral scientists appreciated the highly complex nature of parental interactions , particularly maternal , and have demonstrated the role of nurturing in early life to the development of pathophysiologic functioning in later years of the offspring . schweitzer and lawton12 and brook et al1 have independently reported mothers assessed as cold , indifferent , controlling , and intrusive were a major risk factor for the development of adolescent drug use . similarly , andersson and eisemann3 reported that parenting perceived as rejecting was linked to maladaptive psychosocial behaviors , including drug abuse . our previous study confirmed these findings8 and demonstrated that substance - abusing patients had lower maternal protection scores than non - drug - abusing controls . this analysis of maternal mmpi scores in addicted offspring demonstrated a statistically significant correlation in the depression , hysteria and paranoia subscales . these results have significant health , mental health , and public health and health policy implications . the cost of drug abuse and addiction to the patient , their family , and society is enormous . any primary interventions which might decrease pathologic drug use would be beneficial . these and other data strongly support the importance of early mother child assessment and intervention when clinically indicated . although the role of family varies somewhat based on cultural norms , the effect of early maternal nurturing on neuronal development and subsequent phenotypic expression is not affected by socio - cultural variations . it is far more effective to work with mothers than to treat drug addiction in their grown children . future research needs to focus on identifying cost - effective and clinically effective early intervention strategies through prospective , longitudinal trials . clinical translational research drawing on results from pre - clinical reports will also be valuable ."
] | drug addicts often come from dysfunctional families . the prevailing view in the literature is that mothers of drug - dependent patients can be characterized by strong emotional bonds and overprotection . studies suggest that maternal rejection could be a major risk factor of developing drug addiction . this work is a continuation of our previous study of childhood parenting experiences of substance - dependent patients . the aims were to compare the personality profile of mothers of substance - dependent patients and that of mothers of matched control subjects ; and to examine the relation between the personality of mothers of addicts , and severity of their offspring s addiction . the study group consisted of 20 mothers of substance - dependent patients and a control group of 35 mothers of non - dependent subjects ; mothers of both groups were age matched . patients were diagnosed according to dsm iv criteria . personalities of mothers of both groups were assessed using the minnesota multiphasic personality inventory ( mmpi ) . substance - dependent patients ( sons ) were administered the addiction severity index ( asi ) . the mean scores of the mmpi scales were higher for mothers of dependent patients compared to mothers of non - dependent subjects . scores on the depression , hysteria and paranoia scales were significantly higher for mothers of patients ( p = 0.03 , 0.02 , and 0.03 , respectively ) . there was a significant positive correlation between scores of hysteria , and psychopathic deviance and the asi ( p = 0.03 and 0.01 , respectively ) . there were significant negative correlations between scores of social introversion and the asi drug / alcohol use status ( p = 0.007 ) , and family history dimensions ( p = 0.003 ) . mothers of substance - dependent patients showed disturbances in aspects of personalities that might be related to initiation of perpetuation of substance dependence . |
[
"cardiovascular disease , the leading cause of death in western countries , is a preeminent health problem worldwide . atherosclerosis , a chronic inflammatory - based disease ( cibd ) , constitutes the single most important contributor for cardiovascular complications . mainly , atherosclerosis results from an immune response to oxidized low - density lipoproteins ( ldls ) . induced by an atherogenic diet , monocytes are promoted to adhesion into the artherial endothelium and intimae ( diapedesis ) . once in the intimae , monocytes differentiate into macrophages and then modified lipoproteins ( such as oxidized ldls ) are accumulated as cytoplasmatic droplets . some of these mediators are involved in proatherogenic processes , such as interleukin- ( il- ) 1 , il-6 , and tumor necrosis factor alpha ( tnf- ) that involve in the upregulation of the molecular adhesion on the endothelial cells . others have demonstrated to have antiatherogenic properties such as il-10 that involve in the attenuation of the monocyte differentiation into macrophages . the use of medicinal plants , or extracts from them , has been traditionally practiced worldwide in the prevention and treatment of several chronic diseases such as cardiovascular diseases , intestinal inflammatory diseases , inflammatory bowel disease , arthritis , diabetes , allergies , multiple sclerosis , parkinson 's and alzheimer 's diseases , and others . extracts from thyme have been used in traditional medicine for the treatment of several respiratory diseases like asthma and bronchitis and for the treatment of other pathologies thanks to several properties such as antiseptic , antispasmodic , antitussive antimicrobial , antifungal , antioxidative , and antiviral [ 7 , 8 ] . thyme oils have also been described as a strong bactericide against gram - positive and gram - negative bacteria and also as a bronchospasmolytic [ 9 , 10 ] . for example , it has been reported that thyme oil reduces no production in j774a.1 murine macrophages . major bioactive compounds of the extracts from thyme are carvacrol and thymol [ 12 , 13 ] . thymol exhibits multiple biological activities including anti - inflammatory , immunomodulating , antioxidant , antibacterial , antifungal , and free radical scavenging properties . carvacrol also possesses antimicrobial , antifungal , and antioxidant activities [ 2022 ] , as well as antimutagenic and anticarcinogenic effects . there have been demonstrated effects on the treatment of colitic mice with essential oils of thyme and oregano containing thymol and carvacrol as their principal bioactive compounds , decreasing levels of the proinflammatory cytokines il-1 , il-6 , and tnf-. however , mechanisms mediating these suppressive effects are unclear . borneol , another compound present in thyme , has been also described as an anti - inflammatory since its dietary supplementation significantly decreases the concentration of the proinflammatory cytokines il-1 and il-6 in mice . nowadays medicinal therapies for cibds involve treatment with nonsteroidal anti - inflammatory drugs , antibiotics , corticosteroids , and immunosuppressant , but the application of these drugs is limited due to their toxicity and side effects . therefore , there is an increasing interest in finding alternative treatments with fewer side effects . supercritical fluid extraction ( sfe ) is considered an attractive extraction method when compared to conventional techniques such as steam distillation or soxhlet extraction because it avoids solute contamination with solvent residues and the degradation of thermolabile compounds . in this sense , sfe with co2 is in increasing demand to produce high - quality essential oils from plant material with medicinal properties . during our on - going screening program , designed to identify natural compounds with anti - inflammatory potential , we have studied thyme oils from three different species ( thymus vulgaris , thymus zygis , and thymus hyemalis ) . to determinate whether thyme oils could have immunomodulation properties and could mediate in inflammatory cytokines regulation , we study the effect of our extracts on ox - ldl - activated thp-1 macrophages , measuring the expression and release of several inflammatory mediators .",
"co2 sfe oil fractions composition from three different species of thyme ( thymus vulgaris , thymus zygis , and thymus hiemalys ) were determined by gc - ms ( see table 1 ) . the cytotoxicity effect on thp-1 macrophages of s1 and s2 co2 supercritical fluid extracts from thyme leaves was evaluated before the bioactivity study . mtt assay was performed for periods of 24 of incubation ( figure 2 ) . after 24 hours of incubation neither extracts reduced significantly cell viability for concentrations from 5 to 25 g / ml . to activate the thp-1 macrophage , cu - oxidized ldls ( ox - ldl ) these ox - ldl - treated cells showed an increase in total protein secreted ( data not shown ) . treatment of activated cells with thyme fractions results in an overall reduction of proinflammatory cytokines release , tnf , il-1 , and il-6 ( figures 3 and 4 ) , in a dose - dependent manner . to test anti - inflammatory effects of oil extracts , one group was treated with a small amount of diclofenac ( 5 g / ml ) . extracts in general show a better anti - inflammatory effect than diclofenac at this small concentration , diminishing more the proinflammatory cytokines ( tnf- and il-1 ) than diclofenac did and inducing anti - inflammatory release of il-10 that was not observed with diclofenac . after 24 hours of incubation , activated cells treated with any of the thyme fractions showed a very significant decrease in tnf- release when compared with nontreated cells . both fractions of thymus zygis and thymus vulgaris had similar effects on tnf- secretion . for fraction concentrations of 15 g / ml and higher , the reduction of tnf- was such that these cytokine levels were much lower than the nonactivated basal levels . for thymus hyemalis , tnf- secretion was lower than the nonactivated controls for fraction concentrations of 25 g / ml . despite the large reduction of tnf- secretion at 24 hours treatments , treatment with fractions of thymus zygis and thymus vulgaris for 48 hours showed a lesser reduction of tnf-. for these fractions , only concentrations of 25 g / ml induced a very significant reduction of tnf- levels , equal to nonactivated basal levels . at 48 hours , thymus hyemalis induced larger tnf- release inhibition , with all fractions concentration showing a decrease under the nonactivated basal levels . regarding il-1 release at 24 hours , treatment of activated cells with any of the thyme fractions induced a decrease of this cytokine secretion in a dose - dependent manner ( figure 3(b ) ) . both fractions of thymus zygis or thymus vulgaris induced similar reduction of il-1. 24-hour treatment with 15 g / ml of these fractions reduced il-1 secretion significantly to the nonactivated cells basal secretion . after 48-hour incubation with these thyme fractions , il-1 concentration in the medium was the same as the basal secretions of nonactivated cells . regarding thymus hyemalis , at 24-hour treatments , both fractions of this species induced similar cell responses . there is a decrease in il-1 secretion with the increase of fraction concentration , although this il-1 decrease is only significant till 25 g / ml incubations . after 48 hours , incubations with these two fractions reduced il-1 secretion to nonactivated basal levels in the same manner as thymus zygis and thymus vulgaris did . il-6 secretion was reduced significantly when activated cells were incubated with any of the fractions of either thymus zygis or thymus vulgaris at a concentration of 15 g / ml or higher . this reduction on il-6 secretion was dose dependent and was verified on both 24 and 48 hours of incubations . incubations with 25 g / ml of these extracts reduced il-6 secretion to nonactivated cells basal levels . 48-hour treatment with thymus hyemalis , induced the same decrease as thymus zygis and thymus vulgaris , whereas at 24 hours , there was no significant reduction of il - secretion at the concentrations used . 24-hour treatment with any of the fractions induced an increase on il-10 secretion in a dose - dependent manner ; higher fraction concentration induced higher il-10 secretion . thymus zygis and thymus vulgaris increased significantly il-10 secretion of activated cells , with both fractions and at any of the concentrations used . as for thymus hyemalis , the increase in il-10 secretion was lower and only significant when the fractions were 15 g / ml or higher concentrations . 48-hour treatments with higher concentrations of the fractions induced an increase on il-10 secretion ; the rest concentrations did not induce significant increases . in all experiments , thymus hyemalis had shown to be less effective than thymus vulgaris and thymus zygis , either in increasing or reducing cytokine release . a dose - dependent effect was observable in treatments with 24 and 48 hours of incubation . changes on production were dose dependentent and according to the thymol content of each species ( table 1 ) . relative quantification ( rq ) determinates the change in expression of a nucleic acid sequence relative to a control . endogenous control represented in this figures was 18s rrna ; similar results were showed using gapdh ( data not shown ) . similar to the observed cytokine release , gene expression of analyzed cytokines , but not il-10 , increased in oxldl - activated cells compared with nonactivated cells in treatments during 24 hours . 48-hour treatments caused an increase only in tnf expression on oxldl - activated cells compared with nonactivated cells . tnf gene expression decreases only in cells treated with thymus zygis s1 at 24 hours of incubation ; other treatments did not change expression of this gene with respect to oxldl - activated cells . similar to 24 hours of incubation , at 48 hours tnf- gene expression did not change with extract treatments ; only thymus hyemalis s2 caused significant reduction of this cytokine gene expression . expression of il-1 decreased in cells treated with all thyme extracts with respect to activated cells at 24 hours of incubation . at 48 hours of incubation , all treatments , except thymus hyemalis s2 , caused reduction in gene expression . for thymus zygis s2 , thymus vulgaris s1 , and s2 and thymus hyemalis s1 , expression of il-1 was lower than the nonactivated controls cells . il-6 gene expression at 24-hour treatment with any of thyme extracts was reduced until level of nonactivated control cells which expression was decreased to half compared to activated cells . in contrast , at 48-hour treatment , expression was reduced using only thymus zygis s1 and s2 and thymus vulgaris s2 extracts with respect to activated cells . il-10 expression gene increased twice with all thyme extracts at 24 hours of treatment compared with oxldl - activated cells . at 48 hours , gene expression in cells treated with thymus zygis s1 and s2 and thymus vulgaris s1 extracts increased significantly , but thymus vulgaris s2 and thymus hyemalis did not change expression of il-10 compared to oxldl - activated cells . cytokines are considered to be key players in the inflammatory response involved in atherosclerosis and other chronic inflammatory - based diseases ( cibds ) . among these , interleukin ( il)-1 , il-6 , il-10 , and tumor necrosis factor- ( tnf- ) are expressed in atherosclerotic lesions by endothelium cells , macrophages , and smooth muscle cells [ 29 , 30 ] . some of them are involved in proatherogenic processes , such as upregulation of adhesion molecules on the endothelial cells , while others were proved to have an antiatherogenic role like attenuating the differentiation of monocytes in macrophages . the imbalanced expression of cytokines has been implicated in the progression of many diseases including cibds . cytokines exhibit both beneficial and pathologic effects on their target cells and are produced by many cell types . several natural compounds are known for their beneficial properties to some diseases or their derived complications and particularly concerning anti - inflammatory effects . in our experiments , were observed significant cellular responses elicited by the treatment of thp-1 cells with thyme fractions . the action of thyme fractions appears to involve the expression of the proinflammatory cytokine : tnf- , il-6 , and il-1 and the anti - inflammatory cytokine il-10 . the most interesting observation made during these studies was that treatment of oxldl - activated thp-1 cells with thyme oils had different effects on proinflammatory and anti - inflammatory expression : tnf- , il-6 , and il-1 expressions were inhibited while il-10 expression was enhanced . proinflammatory cytokines levels decreased in a dose - dependent manner with any thyme fraction from thymus vulgaris , thymus zygis , or thymus hyemalis used ( after 24 or 48 h of incubation ) . these results were in agreement with the ones regarding the expression of cytokines genes at 24 hours of incubation . other authors have previously reported an increment in cytokine secretion in activated macrophages treated with ox - ldl [ 3 , 33 ] . similar results have been described for essential oils extracted from cinnamomum osmophloeum , a herb traditionally used in asia as food and as a medicine , which contains cinnamaldehyde . murine macrophages were treated with essential oils from this plant ; anti - inflammatory effects by decreasing tnf- , il-6 , and il-1 secretions were reported . main compounds present in supercritical thyme extract were thymol , 1,8 cineole , camphor , borneol , and carvacrol . anti - inflammatory effect of thymol has been reported on human neutrophiles incubated with 10 or 20 g / ml of this compound . mice edema has been reported to be reduced with a topical application of 100 g / cm of carvacrol . moreover , antioxidant properties of thymol and carvacrol have been demonstrated in several studies , suggesting their use as nutraceutical ingredients in the development of novel functional foods . derivatives of thymol and carvacrol have been described as antioxidant according to the dpph radical scavenging method [ 3537 ] . essential oils of thyme and their components carvacrol and thymol inhibited 3-nitrotyrosine formation , biomarker of the oxidative stress , supporting the nutraceutical value of thyme and the potential of thymol and carvacrol in preventing the formation of toxic products by the action of reactive nitrogen species . also , thymol and carvacrol prevent autoxidation of lipids . in the same way , the inhibitory activity of 1,8-cineol ( eucalyptol ) on cytokine production in cultured human lymphocytes and monocytes has been described : particularly , in monocytes , inhibition of tnf- , il-1 , il-6 , and il-8 was 99 , 84 , 76 , and 65% , respectively , when monocytes were treated with 0.15 g / ml of 1,8-cineol . borneol , one of the major compounds present in essential oils from sage , has been described as anti - inflammatory since its dietary supplementation significantly decreases the concentration of the proinflammatory cytokines il-1 and il-6 in mice . results observed in this work suggest that supercritical thyme s1 and s2 fraction oils from thymus vulgaris , thymus zygis , and thymus hyemalis may act as effective inhibitors of oxldl - induced proinflammatory cytokines ( tnf- , il-1 , and il-6 ) secretion , and also as enhancers of the anti - inflammatory cytokine il-10 secretion , in macrophage thp-1 cells . in summary , co2 supercritical thyme extracts showed anti - inflammatory properties by ( a ) reducing the release of proinflammatory cytokines , and ( b ) increasing the anti - inflammatory secretion in activated macrophages . these results may suggest that essential oils from thyme extracts could be used as novel options for treatment of chronic diseases based on inflammatory processes . however , numerous and in - depth studies should be carried out for this purpose .",
"dried and cryogenic grinded leaves from three varieties of thymes ( thymus hyemalis , thymus zygis , and thymus vulgaris ) were subjected to supercritical fluid extraction with co2 . the supercritical extractions were carried out in a pilot - plant - scale supercritical fluid extractor ( thar technology , pittsburgh , pa , usa , model sf2000 ) of 2 l capacity using pure supercritical co2 at a pressure of 300 bar and a temperature of 40c . extracts from the three thyme species were fractionated using a two - cascade depressurized system and samples were collected in each of the two ( separators 1 and 2 ) separators . fractionation conditions were as follows : separator 1 was kept at constant pressure and temperature of 15 mpa and 40c , respectively , whereas separator 2 was maintained at a pressure of 2 mpa and a temperature of 40c . composition of the supercritical thyme extracts was carried out by a gc-2010 ( shimadzu , japan ) , equipped with a split / splitless injector , electronic pressure control , aoc-20i autoinjector , gcms - qp2010 plus mass spectrometer detector , and a gcms solution software . the column used was a zb-5 ( zebron ) capillary column , 30 m 0.32 mm i.d , and 0.25 m phase thickness . helium , 99.996% , was used as a carrier gas at a flow of 1 ml / min . oven temperature programming was 60c isothermal for 4 min , increased to 64c at 1c / min , and then increased to 106c at 2.5c / min . oven temperature was then increased from 106c to 130c at 1c / min , then to 200c at 5c / min , and then to a final temperature of 250c / min at 8c / min which was kept constant for 10 min . sample injections ( 1 l ) were performed in split mode ( 1 : 20 ) . injector temperature was of 250c and ms ion source and interface temperatures were 230 and 280c , respectively . the mass spectrometer was used in tic mode , and samples were scanned from 40 to 500 m / z units . compounds thymol , carvacrol , borneol , and linalool were identified by comparison with standard mass spectra obtained in the same conditions and compared with the mass spectra from library wiley 229 . rests of the compounds were identified by comparison with the mass spectra from wiley 229 library and by their linear retention index . the chromatographic method was to be based on the previously described by jordn et al . . human thp-1 monocyte cell lines ( american type culture collection , atcc ) were maintained in suspension in rpmi 1640 culture medium ( atcc ) supplemented with 10% fbs ( gibco ) , 100 u / ml penicillin ( gibco ) , 100 mg / ml streptomycin ( gibco ) , 0.05 mm -mercaptoethanol ( sigma - aldrich ) , and 2 mm l - glutamine ( gibco ) , at a density of 39 10 cells / ml at 37c in 5% air 95% co2 . cells were pelleted via centrifugation and assessed for viability using the trypan - blue exclusion method . viable cells were plated at a density of 5 10 cells / ml in 24 wells plates ( 100 l and 1 ml , resp . ) and incubated with phorbol 12-myristate , 13-acetate ( pma ) 100 ng / ml ( sigma - aldrich ) for 48 h in fbs - free medium . afterwards oil extracts toxicity was assessed using the mitochondrial - respiration - dependent 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium ( mtt ) reduction method . thp-1 cells were plated in 96-well plates , differentiated and incubated with different concentrations of extract for 24 and 48 hours at 37c in 5% co2 . after treatment , the cells were washed with pbs and incubated with mtt 1 mg / ml in pbs for 2 hours at 37c in 5% co2 . afterwards , formazan crystals produced from mtt by the mitochondrial hydrolase of the viable cells were solubilized in lysis buffer ( 10% sds in 50% dimetilformamida ph = 7 ) . the absorbance of each well was then read at 540 nm using a microplate reader ( sunrise remote , tecan ) . the optical density of formazan formed in control cells ( without treatment with extract ) was taken as 100% viability . oil thyme extracts were dissolved in dimethyl sulfoxide ( dmso ; sigma - aldrich ) to stock concentration of 10 mg / ml determined as the maximum doses not cytotoxic by the cell viability assays . after differentiation , the cells were washed with pbs and treated with or without cu oxidized ldls to activated or not activated them . then , cells were incubated with the corresponding thyme extract diluted in fbs - free medium , for 24 or 48 hours at 37c in 5% co2 . afterwards , the supernatant was frozen and rna isolated . supernatants were centrifuged at 12,000 rpm to remove debris and then stored at 80c until cytokine analysis . il-10 , il-1 , il-6 , and tnf- were quantified using elisa kits from bd biosciences , according to the manufacturer 's instructions . 100 l of 1 : 10 diluted medium was added to anticytokine antibody - coated polystyrene wells and incubated for 2 h. after washing , the plates were incubated with biotin - labeled secondary antibody for 1 hour . the plates were washed and incubated for 30 min in the dark with substrate solution . stop solution was added and the absorbance read at 450 nm with correction at 570 nm using a microplate reader ( sunrise remote , tecan austria gmbh , grdig , austria ) . 5 10 cells were homogenized in 200 l of trizol reagent and , if necessary , stored at 80c . following homogenization , samples were left to rest at room temperature for 5 minutes . after 40 l of chloroform was added , the tubes were vigorously shaken for 15 seconds and let rest at room temperature for 5 minutes . tubes were then centrifuged at 12000 g , 4c for 15 minutes . the aqueous ( upper and colorless ) phase was transferred to a new tube . 100 l of isopropyl alcohol was added to the aqueous phase ; the tube was then gently mixed and incubated at room temperature for 10 minutes . after incubation , samples were centrifuged at 12000 g , 4c for 10 minutes . the pellet was washed with 200 ml of 75% ethanol in depc - treated h2o and centrifuged at 7600 , 4c for 5 min . total rna was then dissolved in 15 l of depc h2o , incubated at 55c for 10 minutes , and stored at 80c for future use . total rna isolated from thp-1 cells was quantification of il-1 , il-6 , il-10 , tnf- , 18srna , and gapdh gene expression using real - time pcr . 10 ng/l total rna was used as template for cdna synthesis using the high - capacity archive kit from applied biosystems , according to the manufacturer 's instructions . real - time pcr was performed using taqman probes ( applied biosystems ) following the manufacturer 's recommendations in an ab7900 ht fast real - time pcr system ( applied biosystems ) . the taqman probes used were hs99999029_m1 for il-1 , hs00174131_m1 for il-6 , hs999999035_m1 for il-10 , hs00174128_m1 for tnf- , hs99999901_s1 for 18s rrna , and hs99999905_m1 for gapdh . gene expression quantification was determined using delta - delta ct method with correction for values of amplification efficiency and normalized to 18s rrna expression . for single variable comparisons , student 's t - test was used . for multiple variable comparisons , data were analyzed by one - way analysis of variance ( anova ) followed by dunnett 's multiple comparison test and bonferroni test when necessary using the graphpad prism statistical software ( graphpad software inc ."
] | properties of thyme extracts from three different species ( thymus vulgaris , thymus zygis , and thymus hyemalis ) were examined . two oil fractions from each species were obtained by co2 supercritical fluid extraction . main compounds presented in the supercritical extracts of the three thyme varieties were 1,8 cineole , thymol , camphor , borneol , and carvacrol . as a cellular model of inflammation / atherogenesis , we use human macrophages derived from thp-1 monocytes and activated by oxidized ldls . these cells were incubated with the thyme fraction oils , and the productions and gene expressions of the inflammatory mediators tnf- , il-1b , il-6 , and il-10 were determined . thyme extracts significantly reduced production and gene expression of the proinflammatory mediators tnf- , il-1b , and il-6 and highly increased these parameters on the anti - inflammatory il-10 cytokine . changes on production and gene expressions were dose dependent and according to the thyme content of each species . taken together , these results may suggest that thyme extracts could have anti - inflammatory effects . |
[
"the prevalence of obesity continues to rise worldwide with an alarming priority in developed and developing countries . researchers , practitioners , and policy - makers call for updated valid evidences to monitor , prevent , and control of obesity . this information , mostly , provide through the publication and distribution of research results . most of the times , quality of health services affected by the application of updated results of scientific productions . aim to monitoring and assessment of scientific trends , scientometrics provides reliable , practical methods that measure , evaluate and analyze scientific products of specific fields . in these regards , using qualitative , quantitative and computational approaches , different indicators are increasingly employed to show the pattern of research performed by researchers , universities , institutes , and countries . one of its main indices is the number of published articles or science production in a specific field of sciences . in addition , citations of papers is another index that mostly is used as a proxy of application of papers . the collaboration in research conduct and papers publication and collaborative research centers consider as another citation indexes . considering above , the aim of this paper is scientometrics analysis of obesity / overweight knowledge productions in the middle east region countries . the trends in published papers , citations , and collaborative researches in the fields of obesity / overweight , as the proxy of knowledge production , reviewed , during the past 24-year period . we specifically focused on iran and assessed its contribution in obesity / overweight researches by more details .",
"present study is scientometric analysis of obesity / overweight scientific papers among middle east countries from 1990 to 2013 . reviewing the publication number , publication trends , citations , and collaborative institutions , iran has been compared with other countries of the region and also with global indices . for its most coverage in health and biomedicine discipline , we systematically searched scopus database . as it was the only sources for multidisciplinary citation reports , we select it as the valid source of citation reports of knowledge products . in addition , all of the collaborative papers extracted and analyzed for middle east countries . we also introduce top institutions , journals , and collaborative research centers in the field of obesity / overweight . using methods of reviews and considering emtree , terms of obesity , overweight , and anthropometric indexes , search strategy has designed by researchers committee and validated by external scientific group . the name of middle east countries were identified according to free encyclopedia of wikipedia including ; bahrain , cyprus , egypt , iraq , iran , israel , jordan , kuwait , lebanon , oman , palestine , qatar , saudi arabia , syria , turkey , united arab emirates , and yemen ( in alphabetical order ) . period of study was limited to 19902013 , and there was no limitation for language . 2011 ( stata statistical software : release 12 . college station , tx : stata corp lp .",
"given scopus data , globally , during 19902013 , 415,126 papers have been published in the fields of obesity / overweight . from them , 136,595 were affiliated to usa , 33,927 to uk , and 20,019 to germany . during this period , 14,792 published papers were affiliated to middle east countries . compare with other countries in the regions ; after turkey ( 7092 papers : 47.94% ) and israel ( 5214 paper : 35.25% ) , it has achieved to third position . the time trend of obesity / overweight publication by middle east countries , 19902013 pearson chi - square test confirmed a significant time trends of published papers between region countries ( p = 0.000 ) . table 2 shows the p - trends of total number of papers and the total number of citations , in middle east 's countries , during the 19902013 . p - trends of total number of papers and total number of citations of middle east 's countries obesity / overweight related papers , 1990 - 2013 as it shows in table 2 , based on the pearson chi - square test results , all of region countries have significant time trends in their obesity / overweight publications citations ( p = 0.000 ) . the comparative situations of citations time trends of obesity / overweight publications is presented in figure 2 . the time trend of citations of obesity / overweight publication by middle east countries , 19902013 in overall , in the field of obesity / overweight , iran had the most collaborative papers respectively with usa ( 180 , 4.6% ) , uk ( 140 , 3.6% ) , and canada ( 66 , 1.7% ) . turkey with 15 collaborative papers ( 0.4% ) had the 16 rank of this list . usa also had the most participation in publications of all other 16 middle east countries . the situation of contributions of middle east 's countries in obesity / overweight related papers have been shown in table 3 . the diagonal diameter of table ( green marked number ) shows papers that there was no partnership between the countries in their publication . for example from bahrain publications , 197 cases have been published by contribution of only internal researchers and academic members of bahrain scientific centers . red marked zeros refer to situations in which , there were no any joint contribution for common publications between two countries that have been indicated in the top of leading rows . contributions of middle east 's countries in obesity / overweight related papers , 1990 - 2013 in overall , in global level , most of obesity / overweight papers published in the field of medicine ( 76.7% ) , after that , the highest proportion of publications respectively , belonged to , biochemistry ( 23.3% ) , and agricultural and biological sciences ( 12% ) . in iran , publications approximately follow this distribution . considering the results , 64% of iranian papers were completely related to medicine , 11% were published in the field of biochemistry , genetics and molecular biology , and 6% were aligned to the fields of agricultural and biological sciences . figure 3 compares the distribution of publications subject area of obesity / overweight publications at national , regional and global levels . the distribution of subject area of obesity / overweight publication at national , regional and global levels considering the role of universities or other scientific institutes in publication of obesity / overweight papers ; the first three effective institutes with the most publications are ; va medical center , brigham and womans hospital , and inserm , respectively with 1.25% , 0.81% , and 0.78% of global participation in knowledge production . harvard school of public health with insignificant difference is the fourth producing center of obesity publications ( 3,154 papers , 0.87% ) . in iran , after that , shahid beheshti university of medical sciences counterpart in 15% of knowledge productions . the third rank belonged to isfahan university of medical sciences ( 14% contribution ) [ figure 4 ] . contribution of national universities / scientific institutes in publication of obesity / overweight papers , 19902013 regarding the sources of publications in global level , the three first journals are ; international journal of obesity ( 5396 ; 1.30% ) , plos one ( 4280 ; 1.03% ) , and obesity surgery ( 4033 ; 0.99% ) . in iran , iranian journal of endocrinology and metabolism , journal of research in medical sciences , and archives of iranian medicine , respectively with 3.47% , 2.78% , and 2.19% of national publication contribution , were the top three sources of obesity - related publication . during this period , the most prevalent type of obesity - related publications was original articles that consist 90% of all knowledge products . after these review articles ( 4% ) and letters ( 2% ) set on next levels .",
"given scopus data , globally , during 19902013 , 415,126 papers have been published in the fields of obesity / overweight . from them , 136,595 were affiliated to usa , 33,927 to uk , and 20,019 to germany . during this period , 14,792 published papers were affiliated to middle east countries . compare with other countries in the regions ; after turkey ( 7092 papers : 47.94% ) and israel ( 5214 paper : 35.25% ) , it has achieved to third position . the time trend of obesity / overweight publication by middle east countries , 19902013 pearson chi - square test confirmed a significant time trends of published papers between region countries ( p = 0.000 ) . table 2 shows the p - trends of total number of papers and the total number of citations , in middle east 's countries , during the 19902013 . p - trends of total number of papers and total number of citations of middle east 's countries obesity / overweight related papers , 1990 - 2013",
"as it shows in table 2 , based on the pearson chi - square test results , all of region countries have significant time trends in their obesity / overweight publications citations ( p = 0.000 ) . the comparative situations of citations time trends of obesity / overweight publications is presented in figure 2 . the time trend of citations of obesity / overweight publication by middle east countries , 19902013",
"in overall , in the field of obesity / overweight , iran had the most collaborative papers respectively with usa ( 180 , 4.6% ) , uk ( 140 , 3.6% ) , and canada ( 66 , 1.7% ) . turkey with 15 collaborative papers ( 0.4% ) had the 16 rank of this list . usa also had the most participation in publications of all other 16 middle east countries . the situation of contributions of middle east 's countries in obesity / overweight related papers have been shown in table 3 . the diagonal diameter of table ( green marked number ) shows papers that there was no partnership between the countries in their publication . for example from bahrain publications , 197 cases have been published by contribution of only internal researchers and academic members of bahrain scientific centers . red marked zeros refer to situations in which , there were no any joint contribution for common publications between two countries that have been indicated in the top of leading rows . contributions of middle east 's countries in obesity / overweight related papers , 1990 - 2013",
"in overall , in global level , most of obesity / overweight papers published in the field of medicine ( 76.7% ) , after that , the highest proportion of publications respectively , belonged to , biochemistry ( 23.3% ) , and agricultural and biological sciences ( 12% ) . in iran , publications approximately follow this distribution . considering the results , 64% of iranian papers were completely related to medicine , 11% were published in the field of biochemistry , genetics and molecular biology , and 6% were aligned to the fields of agricultural and biological sciences . figure 3 compares the distribution of publications subject area of obesity / overweight publications at national , regional and global levels . the distribution of subject area of obesity / overweight publication at national , regional and global levels",
"considering the role of universities or other scientific institutes in publication of obesity / overweight papers ; the first three effective institutes with the most publications are ; va medical center , brigham and womans hospital , and inserm , respectively with 1.25% , 0.81% , and 0.78% of global participation in knowledge production . harvard school of public health with insignificant difference is the fourth producing center of obesity publications ( 3,154 papers , 0.87% ) . in iran , after that , shahid beheshti university of medical sciences counterpart in 15% of knowledge productions . the third rank belonged to isfahan university of medical sciences ( 14% contribution ) [ figure 4 ] . contribution of national universities / scientific institutes in publication of obesity / overweight papers , 19902013 regarding the sources of publications in global level , the three first journals are ; international journal of obesity ( 5396 ; 1.30% ) , plos one ( 4280 ; 1.03% ) , and obesity surgery ( 4033 ; 0.99% ) . in iran , iranian journal of endocrinology and metabolism , journal of research in medical sciences , and archives of iranian medicine , respectively with 3.47% , 2.78% , and 2.19% of national publication contribution , were the top three sources of obesity - related publication .",
"during this period , the most prevalent type of obesity - related publications was original articles that consist 90% of all knowledge products . after these review articles ( 4% ) and letters ( 2% ) set on next levels .",
"the results of the present study verify iran 's position in obesity / overweight publications between other middle east countries. scientific evidences have emphasized that overweight and obesity become one of the most important health priority , with increasing trends , which need special attention and quick response . designing and implementation of these preventive or controlling programs require to accurate information and scientific evidences that have provided through scientific papers and reports . , number of citations have become increasingly important as instruments for analyzing scientific activities and their relationship with economic and social development . based on the iran 's 20-year national vision document , iran is pictured as the highest developed country in science / technology by 2025 . considering that , iran follow one of the fastest growth rates in scientific production in the whole world . compare with other countries in the regions , after turkey and israel , respectively with 7,092 and 5,214 papers , iran has achieved to third position with 3,886 papers . citation as one of the representative indexes for paper 's application and quality , in most of region countries , has ascending pattern . in a closer inspection , these recent rapid increasing trends in research outputs can be attributed to the attention to research by country policy - makers up to the highest level of leadership that has caused a national comprehensive commitment on research policy , facilities , and resources . these collaborations , potentially , provide more facilities for increasing the citations and applications of papers . israel between the region countries had the most citation for obesity - related papers that is directly associated with its higher rate of collaborative papers . in this regard , after turkey , iran had the third ranks of high citation order . between out of regions countries , usa had the most participation in the publication of all 17 middle east countries . inside the region , saudi arabia and egypt with 145 collaborative papers had the first collaborative position . in the field of obesity / overweight , iran had the most collaborative papers respectively with usa ( 4.6% ) , uk ( 3.6% ) , and canada ( 1.7% ) . between region countries , the increase in the number of related multidisciplinary faculties as well as research centers and consequently the increase of related specialists , students , research projects , and dissertations are inevitably positive factors which influence the rise in the number and citations of papers in this field . first , we focused on specific obesity / overweight domain to clarify the exact situation of knowledge production . third , we assessed collaboration between middle east countries in related research fields ; and fourth , we explain the situation of iran as one of the most effective knowledge productive country in the region in details .",
"to the best of our knowledge , this is the first scientometrics analyses of obesity / overweight knowledge productions in the middle east region countries that provide practical information for better research planning in related multidisciplinary fields . despite the ascending trends in research outputs , more efforts required for promotion of collaborative partnerships . these results also could be useful for better health policy and more planned studies in this field ."
] | background : researchers , practitioners , and policy - makers call for updated valid evidences to monitor , prevent , and control of alarming trends of obesity . we quantify the trends of obesity / overweight researches outputs of middle east countries.methods:we systematically searched scopus database as the only sources for multidisciplinary citation reports , with the most coverage in health and biomedicine disciplines for all related obesity / overweight publications , from 1990 to 2013 . these scientometrics analysis assessed the trends of scientific products , citations , and collaborative papers in middle east countries . we also provided information on top institutions , journals , and collaborative research centers in the field of obesity / overweight.results : over 24-year period , the number of obesity / overweight publications and related citations in middle east countries had increasing trend . globally , during 19902013 , 415,126 papers have been published , from them , 3.56% were affiliated to middle east countries . iran with 26.27% , compare with other countries in the regions , after turkey ( 47.94% ) and israel ( 35.25% ) , had the third position . israel , turkey , and iran were leading countries in citation analysis . the most collaborative country with middle east countries was usa and within the region , the most collaborative country was saudi arabia.conclusions:despite the ascending trends in research outputs , more efforts required for promotion of collaborative partnerships . results could be useful for better health policy and more planned studies in this field . these findings also could be used for future complementary analysis . |
[
"the sagittal alignment of the spine has important ramifications to the health - related quality of life.1 it varies with age,2 \n 3 gender,4 spinal disease,5 \n 6 and body position.7 \n 8 \n 9 \n 10 many researchers have evaluated the sagittal alignment of the cervical spine . however , they used different neck positions,7 \n 8 as well as different radiographic views . most commonly , these are cervical spine lateral radiographs and whole - spine lateral radiographs.4 \n 11 \n 12 \n 13 \n 14 however , to the best of our knowledge , there is no literature comparing the sagittal cervical parameters between these two views . the purpose of this study is to determine if the radiographic parameters for sagittal cervical alignment are comparable between these two views .",
"this retrospective study included adult patients from a single institution who had the radiographs taken to evaluate the neck pain . the criteria for inclusion were as follows : ( 1 ) age 20 years or older at the time of evaluation ; ( 2 ) no contraindication for radiographic exposure ( e.g. , pregnancy , tumor ) ; ( 3 ) agreement of patients to take both radiographs . lateral radiographs were obtained with a 10 12-inch cassette at a 72-inch ( 182 cm ) distance with the radiographic tube centered at the c4c5 disk space with no magnification ( fig . subjects were instructed to stand in a comfortable position and keep their eyes forward with their arms extended on their chests ( fig . 1 ) . immediately after taking the cervical lateral radiographs , whole - spine lateral radiographs were taken with a 14 17-inch cassette at a 98.4-inch ( 250 cm ) distance with the tube centered at the xiphoid process and with the subjects in a comfortable standing position , keeping their eyes forward and their arms crossed upon their chests without magnification ( figs . 2 , 3 ) . the digital x - ray images were obtained and measured on the pacs system ( view , infinitt , seoul , korea ) . \n cervical spine lateral radiographs were obtained with a 10 12-inch cassette at a 72-inch distance with the radiographic tube centered at the c4c5 disk space with subjects in a comfortable standing position , keeping their eyes forward and their arms extended on their chests without magnification . \n whole - spine lateral radiographs were taken with a 14 17-inch cassette at a 98.4-inch distance with the tube centered at the xiphoid process with subjects in a comfortable standing position , keeping their eyes forward and their arms crossed upon their chests without magnification . \n cervical spinal morphology was measured using the standard techniques to obtain the following parameters for the two different radiographs : occipital c2 angle : cobb angle between the mcgregor line and the inferior end plate of axis ( fig . 4 ) c2c7 angle : cobb angle between the inferior end plate of c2 and the inferior end plate of c7 ( fig . 4 ) c7sternal angle : cobb angle between the inferior end plate of c7 and the anterior border of sternum ( fig . 4 ) sternal slope : cobb angle between the anterior border of sternum and the horizontal line ( fig . 4 ) t1 slope : cobb angle between the superior end plate of t1 body and the horizontal line ( fig . 5 ) c2 central offset distance : the distance between the center of c2 body and the line tangential to the posterior cortex of c7 body ( fig . 6 ) \n angle ( occipital c2 ) is formed by mcgregor line and the inferior end plate of the axis ; angle ( c2c7 ) , by the inferior end plate of c2 and inferior end plate of c7 ; angle ( c7sternal ) , by the inferior end plate of c7 and the anterior border of sternum ; angle ( sternal slope ) , by the anterior border of sternum and the horizontal line . \n c2 central offset distance ( a ) is the distance between the center of c2 body and the line tangential to the posterior cortex of c7 body ; t1 slope ( ) is the angle between the superior end plate of t1 body and the horizontal line . \n the distance between c2 and c7 plumb lines ( b to c ) is the distance between c2 plumb line and c7 plumb line , the difference of b and c ; c4 ap diameter ( d ) is anteroposterior diameter of c4 vertebral body . additionally , we calculated the ratio of c2 central offset distance to c4 ap diameter and the ratio of plumb lines ' distance to c4 ap diameter to reduce the radiographic magnification ( figs . 5 , 6 ) . the statistical analysis was performed using spss version 13.0 ( ibm corporation , armonk , ny , united states ) . the differences in continuous variables between the two groups were examined with a paired t test . the power analysis was performed by g*power version 3.1.5 ( universitt kiel , germany ) . the power was 0.8 for paired t tests with the effect size of 0.5 and error probability of 0.05 . the statistical significance level was set at p < 0.05 . the intraobserver and interobserver reliability were calculated using the reliability statistics by intraclass correlation for the cobb angle and the distance . the intraclass correlation values were graded using previously described semiquantitative criteria : excellent for values in the 0.9 to 1.0 range , good for 0.7 to 0.89 , fair / moderate for 0.50 to 0.69 , low for 0.25 to 0.49 , and poor for 0.0 to 0.24 . finally , we compared the statistical difference of the previously mentioned parameters with the errors of measurement for the two different radiographs .",
"this retrospective study included adult patients from a single institution who had the radiographs taken to evaluate the neck pain . the criteria for inclusion were as follows : ( 1 ) age 20 years or older at the time of evaluation ; ( 2 ) no contraindication for radiographic exposure ( e.g. , pregnancy , tumor ) ; ( 3 ) agreement of patients to take both radiographs .",
"cervical spine lateral radiographs were obtained with a 10 12-inch cassette at a 72-inch ( 182 cm ) distance with the radiographic tube centered at the c4c5 disk space with no magnification ( fig . subjects were instructed to stand in a comfortable position and keep their eyes forward with their arms extended on their chests ( fig . immediately after taking the cervical lateral radiographs , whole - spine lateral radiographs were taken with a 14 17-inch cassette at a 98.4-inch ( 250 cm ) distance with the tube centered at the xiphoid process and with the subjects in a comfortable standing position , keeping their eyes forward and their arms crossed upon their chests without magnification ( figs . 2 , 3 ) . the digital x - ray images were obtained and measured on the pacs system ( view , infinitt , seoul , korea ) . \n cervical spine lateral radiographs were obtained with a 10 12-inch cassette at a 72-inch distance with the radiographic tube centered at the c4c5 disk space with subjects in a comfortable standing position , keeping their eyes forward and their arms extended on their chests without magnification . \n whole - spine lateral radiographs were taken with a 14 17-inch cassette at a 98.4-inch distance with the tube centered at the xiphoid process with subjects in a comfortable standing position , keeping their eyes forward and their arms crossed upon their chests without magnification . \n cervical spinal morphology was measured using the standard techniques to obtain the following parameters for the two different radiographs : occipital c2 angle : cobb angle between the mcgregor line and the inferior end plate of axis ( fig . 4 ) c2c7 angle : cobb angle between the inferior end plate of c2 and the inferior end plate of c7 ( fig . 4 ) c7sternal angle : cobb angle between the inferior end plate of c7 and the anterior border of sternum ( fig . 4 ) sternal slope : cobb angle between the anterior border of sternum and the horizontal line ( fig . 4 ) t1 slope : cobb angle between the superior end plate of t1 body and the horizontal line ( fig . 5 ) c2 central offset distance : the distance between the center of c2 body and the line tangential to the posterior cortex of c7 body ( fig . 6 ) \n angle ( occipital c2 ) is formed by mcgregor line and the inferior end plate of the axis ; angle ( c2c7 ) , by the inferior end plate of c2 and inferior end plate of c7 ; angle ( c7sternal ) , by the inferior end plate of c7 and the anterior border of sternum ; angle ( sternal slope ) , by the anterior border of sternum and the horizontal line . \n c2 central offset distance ( a ) is the distance between the center of c2 body and the line tangential to the posterior cortex of c7 body ; t1 slope ( ) is the angle between the superior end plate of t1 body and the horizontal line . \n the distance between c2 and c7 plumb lines ( b to c ) is the distance between c2 plumb line and c7 plumb line , the difference of b and c ; c4 ap diameter ( d ) is anteroposterior diameter of c4 vertebral body . additionally , we calculated the ratio of c2 central offset distance to c4 ap diameter and the ratio of plumb lines ' distance to c4 ap diameter to reduce the radiographic magnification ( figs . 5 , 6 ) .",
"the statistical analysis was performed using spss version 13.0 ( ibm corporation , armonk , ny , united states ) . the differences in continuous variables between the two groups were examined with a paired t test . the power analysis was performed by g*power version 3.1.5 ( universitt kiel , germany ) . the power was 0.8 for paired t tests with the effect size of 0.5 and error probability of 0.05 . the statistical significance level was set at p < 0.05 . the intraobserver and interobserver reliability were calculated using the reliability statistics by intraclass correlation for the cobb angle and the distance . the intraclass correlation values were graded using previously described semiquantitative criteria : excellent for values in the 0.9 to 1.0 range , good for 0.7 to 0.89 , fair / moderate for 0.50 to 0.69 , low for 0.25 to 0.49 , and poor for 0.0 to 0.24 . finally , we compared the statistical difference of the previously mentioned parameters with the errors of measurement for the two different radiographs .",
"fifty - nine adults made up the study group ( 31 men and 28 women ) . the measurements of the cobb angles in the cervical spine lateral radiographs had 0.979 intraobserver reliability and 0.966 interobserver reliability . the difference of the intraobserver measurements for the cobb angles in the cervical spine lateral radiographs was 0.58 2.74 degrees , and the difference of the interobserver measurements was 0.73 3.43 degrees . the measurements of the c2 offset distance had 0.978 intraobserver reliability and 0.926 for interobserver reliability . the difference of the intraobserver measurements for the cervical spine distance in the lateral radiographs was 0.26 3.05 mm , and the difference of the interobserver measurements was 0.90 5.48 mm . for the whole - spine lateral radiographs , the measurements of the cobb angles had 0.969 intraobserver reliability and 0.803 interobserver reliability . the difference of the intraobserver measurements for the cobb angles in the whole - spine lateral radiographs was 0.36 3.65 degrees , and the difference of the interobserver measurements was 4.08 7.78 degrees . the measurements of the c2 offset distance had 0.982 intraobserver reliability and 0.979 interobserver reliability . the difference of the intraobserver measurements for the distance in the whole - spine lateral radiographs was 4.67 9.00 mm , and the difference of the interobserver measurements was 6.09 9.48 mm . c2 angle , sternal slope , and c4 ap diameter were similar , but the c2c7 angle , c7sternal angle , t1 slope , c2 central offset distance , distance between c2 and c7 plumb lines , ratio of c2 central off distance to c4 ap diameter , and the ratio of plumb lines ' distance to c4 ap diameter were statistically different ( table 1 ) . however , the error of measurement , especially interobserver measurements for the cobb angles in the whole - spine lateral radiographs ( 4.08 7.78 degrees ) and distances ( 6.09 9.48 mm ) , were greater than the angular statistical differences ( 2.51 7.86 degrees of c2c7 angle ) and linear statistical differences ( 4.38 10.04 mm of c2 central off distance ) between the two types of radiographs ( table 1 ) .",
"several methods have been described to evaluate the sagittal alignment of the cervical spine.4 \n 7 \n 8 \n 11 \n 12 \n 13 however , they have used different neck positions and different radiographic techniques,7 \n 8 including cervical spine lateral radiographs and whole - spine lateral radiographs.4 \n 11 \n 12 \n 13 \n 14 however , to the best of our knowledge , there is no literature comparing the sagittal cervical parameters obtained from cervical spine lateral views versus whole - spine lateral views . in the current study , the occipital however , the c2c7 angle , c7sternal angle , t1 slope , c2 central offset distance , distance between c2 and c7 plumb lines , ratio of c2 central off distance to c4 ap diameter , and ratio of plumb lines ' distance to c4 ap diameter were different . however , the angular and linear differences between the two types of radiographs were smaller than the error of measurement for the two types of radiographs . the lordotic curvature of the cervical spine is considered as normal3 ; however , the exact values and the recommended methods of measurement are not clearly described . normal lordotic angles for c2c7 have been reported to range from 20 to 35 degrees,13 but these values are highly related to the method of measurement used and the positioning of the patients while taking a radiograph . moreover , the head posture can influence the sagittal curve of the cervical spine.8 in addition , the arm or shoulder posture can influence sagittal spinal balance.9 \n 10 according to vedantam et al,10 positioning the arms at 90 degrees rather than 30 degrees resulted in a negative shift of the sagittal vertical axis . according to marks et al,9 shoulder flexion of 30 degrees is the best position to use when a lateral radiograph is made to repeatedly measure the sagittal vertical axis . also , cervical lordosis is increased when the thoracic kyphosis of the trunk is increased.4 \n 14 in analyzing spinal sagittal alignment , it is most important to standardize the patients ' posture while taking radiographs . we tried to keep the patients ' standing posture as identical as possible to limit the effect of positioning . spine radiographs can be distorted by parallax.15 to limit the distortion , one can move the x - ray source away from the patient to reduce the divergence of the beam ( conventional teleradiography ) or translate the multiple focuses and coupled receptors simultaneously to scan the entire spine ( digitalized teleradiography).15 the reasons for the differences in measurements for the two views include the differences in the centering target of the radiation beam , the distance from x - ray source to the cassettes , and the posture of arms between the two radiographs . cervical spine lateral radiographs were taken at a 72-inch distance from the radiograph tube and centered at the c4c5 disk space with the subject in a comfortable standing position with eyes forward and arms extended upon their chests . whole - spine lateral radiographs were taken at a 98.4-inch distance from the tube and centered at the xiphoid process of the subject with eyes forward and arms crossed upon their chests . the 95% confidence limits for intra- and interobserver variability of the cobb method in the cervical lateral radiographs were 5 and 9 degrees with the traditional manual method.16 in many cases , a 5-degree variation between the measurements in the whole - spine lateral radiographs by the traditional manual cobb method is acceptable.17 in the current study , the mean difference of the intra- and interobserver measurements for the cobb angles in the cervical spine lateral radiographs with digital methods was 0.58 and 0.73 degrees . the mean difference of the intra- and interobserver measurements for the cobb angles in the whole - spine lateral radiographs was 0.36 and 4.08 degrees . the reproducibility of the cobb angle measurements with digitalized images appears better than those with traditional manual methods.18 the difference in the intraobserver measurements on the digitalized images of the distance in the cervical spine lateral radiographs was 0.26 3.05 mm and the difference in the interobserver measurements was 0.90 5.48 mm in the current study . the reproducibility of the distance measurements with digitalized images may be better than those with traditional manual methods , similar to cobb angle measurements in the current study . however , we did not compare the reproducibility of the distance measurements using digitalized images with those using traditional manual methods . as with any study , the present investigation has limitations . arm posture was one reason for the difference between the cervical and whole - spine lateral radiographs . ideally , we should have taken the two radiographs in the same arm posture to reduce the variables . however , we tried to compare the real - life situation in clinical practice and clinical research . to the best of our knowledge , this study is the first comparing sagittal cervical parameters between the cervical spine lateral view and whole - spine lateral view . in conclusion , most numerical values of parameters for the two radiographic views appear to be different . however , the angular and linear numerical differences between the two radiographic views were smaller than the inter- and intraobserver errors of measurement for the two radiographic views . our results suggest that to determine the alignment of only the cervical spine , there is no advantage to using whole - spine lateral radiographs . however , this finding does not take into account the overall spinal alignment , for which whole - spine lateral radiograph are necessary ."
] |
study design retrospective radiologic study .
objective the sagittal alignment of the cervical spine can be evaluated using either a lateral cervical radiograph or a whole - spine lateral view on which the cervical spine is included . to our knowledge , however , no report has compared the two . the purpose of this work is to identify the difference in radiographic parameters between the cervical spine lateral view and the whole - spine lateral view .
methods we retrospectively analyzed 59 adult patients suffering from neck pain with cervical spine lateral radiographs and whole - spine lateral radiographs from november 2007 to december 2011 . the radiographs were measured using standard techniques to obtain the following parameters from the two different radiographs : occipital c2 angle , c2c7 angle , c7sternal angle , sternal slope , t1 slope , c2 central offset distance , the distance between c2 and c7 plumb lines , c4 anteroposterior ( ap ) diameter , the ratio of c2 central off distance to c4 ap diameter , the ratio of plumb lines ' distance to c4 ap diameter .
results we found that the occipital c2 angle , sternal slope , and c4 ap diameter were similar , but the c2c7 angle , c7sternal angle , t1 slope , c2 central offset distance , distance between c2 and c7 plumb lines , ratio of c2 central off distance to c4 ap diameter , and ratio of plumb lines ' distance to c4 ap diameter were different . however , the error of measurement was greater than the small angular and linear differences between the two views .
conclusions most numerical values of the measured radiographic parameters appear to be different between the two views . however , the two views are comparable because the numerical differences were smaller than the errors of measurement . |
[
"since the beginning of mankind , organisms \n producing natural products \n have provided a reservoir of therapeutic remedies and medicines for \n various diseases . a subset of these drugs \n has been classified as antitumor antibiotics based on their ability \n to block cell growth by interfering with dna , the genetic \n material in cells . key general \n features of an antitumor antibiotic include interference with dna \n synthesis , membrane transport , and production of reactive oxygen species . one of the most notable examples of an antitumor \n antibiotic is mitomycin c , a microbial metabolite that is used currently \n for the treatment of breast and bladder cancer . among other antitumor antibiotics , daunorubicin and its \n semisynthetic derivative doxorubicin represent chemotherapeutic leukemia \n agents in clinical settings . the \n search for new antitumor antibiotics led to the discovery of \n chlorothricin ( 1 ) , a complex polyketide produced by various streptomyces strains . its intriguing \n chemical structure and bioactivity defined a new family of microbial \n metabolites , commonly referred to as spirotetronate polyketides . this \n family is identified by the presence of a cyclohexene ring spiro - linked \n to a tetronic acid moiety ( figure 1 , fragment \n a ) that is embedded in a macrocycle ( figure 1 , fragment b ) . in several cases , the structure also contains a trans - decalin ring ( figure 1 , fragment \n c ) and is decorated by various deoxy oligosaccharides ( figure 1 , fragment d ) . in terms of biological profile , spirotetronate \n polyketides exhibit potent antibacterial and antitumor activities \n and a documented value as tools in the elucidation of new biological \n pathways . as such , they represent highly promising leads in drug discovery . \n to appreciate their untapped potential , in this review we group the \n known spirotetronates based on common structural elements and biosynthetic \n considerations .",
"recently sssmuth and co - workers proposed a classification \n of tetronates based on two main categories : the linear tetronates \n and the spirotetronates . on the basis \n of biosynthetic considerations , the latter subgroup can be divided \n into two classes : class i ( generic structure 4 ) , which \n contains the spirotetronate moiety within a varying size macrocycle , \n and class ii ( generic structure 5 ) , which additionally \n contains a decalin moiety ( figure 2 ) . representative \n members of the class i spirotetronates in order of increasing macrocyclic \n length are abyssomicin c ( 6 ) ( containing a c11 macrocycle ) , okilactomycin d ( 7 ) ( containing a c13 macrocycle ) , and spirohexenolide a / b ( 8/9 ) ( containing a c15 macrocycle ) . \n representative members of the class ii spirotetronates include maklamicin \n ( 11 ) ( containing a c11 macrocycle ) , tetronolide ( 12 ) ( the aglycon of tetrocarcin a containing a c13 macrocycle ) , and chlorothricolide ( 2 ) ( the aglycon of chlorothricin containing a c13 macrolactone ) . in this class is also included versipelostatin aglycone \n ( 13 ) , which contains the largest c17 macrocyclic \n motif isolated to date . quartromicins 10 , unusual spirotetronate polyketides containing four spirotetronate \n subunits , lie outside these two classes due to their peculiar structure and unique biosynthesis . the above classification stems from a common biosynthetic \n pathway that accounts for construction of these compounds .",
"in general , the biosynthesis of spirotetronates occurs through \n condensation of acetic acid units via the type i polyketide synthase \n pathway ( scheme 1 ) . as shown in the biosynthesis of abyssomicin c and okilactomycin , construction \n of the class i spirotetronates proceeds by elongating their carbon \n chain via incorporation of propanoyl and/or acetyl units ( 14/15 ) to the acyl carrier protein ( acp ) . incorporation of \n a glyceryl unit , via coa intermediate 17 , forms tetronate 18 likely via a \n claisen condensation followed by lactonization . the precise mechanism \n for the elimination of the c-5 hydroxy group was recently elucidated \n by the sun and leadlay groups and shown to proceed via acetylation \n and subsequent elimination , thereby forming dienophile 19 . an intramolecular diels the resulting substrates subsequently undergo peripheral oxidations \n to produce the final structures of the natural products . the biosynthetic pathways of the class \n ii polyketide spirotetronates \n have been elucidated for chlorothricin , tetrocarcin a , kijanimicin , and versipelostatin . following chain elongation , the diene and dienophile groups of 20 undergo an imda to construct the characteristic decalin \n moiety of 21 . glyceryl coa ( 17 ) is then inserted to generate tetronate 22 , which following a second imda gives rise to the aglycones \n of the class ii spirotetronates ( figure 2 ) . oxidations and/or glycosylations \n at the periphery of the aglycone \n lead to various natural products of the class ii spirotetronates . \n for instance , chlorothricolide ( 2 ) , the aglycone of chlorothricin , \n contains an acyl - oxy tetronic acid moiety . this functionality ( i.e. , \n oxygenation at the c-2 position ) is proposed to result from a baeyer a similar biosynthetic scenario can be proposed for the construction \n of pa-46101 a and b ( see structures 57/58 ) . another interesting example of post - translational \n modification is found in the structure of tetronolide ( 12 ) , the aglycone of tetrocarcin a ( see structure 47 ) . \n this functionality was proposed to result \n from oxidation at c-32 to the corresponding aldehyde followed by double - bond \n migration to c-22c-23 and further allylic oxidation at c-21 . several class ii spirotetronates are \n subject to glycosylation mostly \n with 2-deoxycarbohydrates such as d - tetronitrose ( 26 , d - kijanose ) , amicetose ( 27 ) , and digitoxose \n ( 28 ) . these carbohydrates are proposed to arise from \n thymidine diphosphate ( tdp)-6-deoxy-4-keto - d - glucose ( 24 ) , which , in turn , is available from d - glucose-1-phosphate \n ( 23 ) ( scheme 2 ) . biosynthesis \n of the uncommon tetronitrose is proposed to occur from 25 via aminotransferase and methylation , while the precise mechanism \n for the carbamate biosynthesis still remains elusive .",
"the majority of spirotetronates have been subjected \n to biological \n assays that aim to define their bioactivity as antibiotic and/or anticancer \n leads as well as compounds that regulate metabolism . with this in \n mind , we have grouped these molecules in three major classes that \n describe the commonality of their bioactivities . isolated \n from a marine verrucosispora , abyssomicin c ( 6 ) and its atropisomer \n ( 29 ) ( figure 3 ) are the first \n known natural products to block para - aminobenzoic \n acid ( paba , 41 ) biosynthesis.paba is a biosynthetic precursor of folic acid \n ( vitamin b9 ) , and as such , it is essential for dna synthesis / repair \n and cell survival ( scheme 3 ) . on the other hand , lack of folic acid importantly , blocking the paba pathway is detrimental to bacteria but inconsequential \n to humans since the latter can not produce folic acid but only absorb \n it through their diet . studies on the \n effect of the abyssomicin motif in paba biosynthesis \n have been performed with atrop - abyssomicin ( 29 ) and are highlighted in scheme 3 . amino-4-deoxychorismate ( adc ) synthase , a heterodimeric protein , \n catalyzes the biosynthesis of amino-4-deoxychorismate ( 40 ) , a synthetic precursor of paba . compound 29 was found to covalently react with the cys-263 of the pabb \n subunit of adc synthase at the c-9 enone center . the transiently formed \n c-8 nucleophile then reacts with the spirotetronate subunit at the \n c-16 center to form compound 39 , thus irreversibly binding \n to adc synthase . several natural products of the abyssomicin family have been \n tested \n for their ability to inhibit paba biosynthesis ( scheme 3 ) . among them , only abyssomicin c ( 6 ) , atrop - abyssomicin c ( 29 ) , and abyssomicin \n j ( 31 ) have shown promising bioactivities . specifically , 6 and 29 potently inhibit proliferation of methicillin - resistant staphylococcus aureus at mic values of 5.2 and 3.5 g / ml , \n respectively . similar cytotoxicities have been \n reported against various tuberculosis - related mycobacteria . on the other hand , abyssomicin d ( 32 ) and related analogues \n lacking the c-7c-9 enone motif are inactive , attesting to \n the biological significance of this functionality . this increased potency has been attributed to \n an increased conjugation between the c-7 carbonyl group and the c-8c-9 \n alkene that renders 29 a stronger michael acceptor than 6 . the bioactivity of abyssomicin \n j ( 31 ) , a thioether dimer of the abyssomicin scaffold , \n can be explained by considering that oxidation of the sulfur accelerates \n a retro - michael addition , producing the c-7c-9 enone functionality \n in situ . in fact , it has been suggested that 31 is a \n prodrug of 6 , and as such , it represents a more attractive \n drug candidate . isolated \n from various micromonospora bacteria , kijanimicin \n ( 43 ) and lobophorin b ( 42 ) are \n structurally defined by a c13 macrocycle ( referred to as \n kijanolide , 44 ) in which the c-9 and c-17 hydroxy groups \n have been glycosylated ( figure 4 ) . most members \n of this group show potent activity against gram - positive bacteria as well as cytotoxicity against various cancer cell lines . in addition , kijanimicin was \n shown to exhibit robust anticancer and \n antimalarial activities in mouse models . \n moreover , fenical et al . reported promising anti - inflammatory activities \n of lobophorins in a mouse ear edema model . interestingly , this is \n the first report on the untapped potential of spirotetronates as small - molecule \n leads against inflammation . a similar \n framework is in the structures of pyrrolosporin a ( 45 , c-9-glycosylation ) and mm46115 ( 46 , c-17 glycosylation ) . the \n glycopyranose motif of pyrrolosporin is also found in the structures \n of decatromicin a / b and nai414-a / b , which also exhibit similar antibiotic activity \n against various strains of gram - positive bacteria . in addition to \n its potent antibiotic activities mm46115 was found to exhibit promising \n antiviral activities . along these lines , \n the structurally unrelated quartromicins 9(14a,14c ) were shown to display potent bioactivity against herpes simplex \n virus ( hsv ) and human immunodeficiency virus ( hiv ) at low m \n concentration . recent studies indicate \n that kijanimicin binds to the tetr family \n of transcriptional regulators that control \n expression of various cytoplasmic proteins in prokaryotes . this binding \n leads to ( a ) c-9-deglycosylation of kijanimicin , which results in \n loss of activity , and ( b ) overexpression of the receptor , thus increasing \n antibiotic resistance . the structurally \n related saccharocarcins are subject to \n a similar mechanism of deactivation and antibiotic resistance . reported \n the isolation of spirohexenolides a ( 8) and b ( 9 ) and their potent cytotoxicities \n against various cancer cell lines ( figure 2 ) . subsequent immunoaffinity - fluorescent \n labeling studies indicated that 8 targets human macrophage \n migration inhibitory factor ( hmif ) . this \n interaction reduces the phosphorylation levels of pi3k / akt , ultimately \n leading to a reduction of tumor cell growth ( figure 6 ) . conjugation of spirohexenolide \n a with fluorescent tags showed localization in the lysosome of hct-116 \n cells , suggesting that spirohexenolides interfere with cellular endocytosis \n of hmif . isolated from \n various micromonospora bacteria , tetrocarcin a ( 47 , also known as antlermicin a and ac6d ) represents the archetype of the tetronolide family of natural \n products that also includes ac6h ( 48 ) and arisostatins a ( 49 ) and b ( 50 ) ( figure 7 ) . the antibiotic potential of these spirotetronates against several \n gram - positive bacteria has been reported . animal studies \n have shown that 47 is about 4 times more potent than \n the commonly used antibiotic diminazene . although 47 has \n a narrow safety margin , it can be used in combination with diminazene , \n providing a beneficial synergistic effect . various reports on the potential anticancer profile \n of tetrocarcin \n a and related family members have been published . initial studies \n showed tumor reduction in a mouse sarcoma model upon administration \n of 10 mg / kg of 47 over a period of 6 days . similar treatment \n in a mouse leukemia p388 model led to an increased life expectancy . comparable studies in b16 mouse melanoma showed that the life expectancy \n more than doubled at a single dose of 27 mg / kg of 47 . moreover , ac6h 48 exhibited cytotoxicity \n against p388 leukemia and b16 melanoma cells at 6.25 and 25 g / ml , \n respectively . ac6h also showed a moderate \n increase in the life expectancy of a p388 leukemia mouse model albeit \n less active than tetrocarcin a. studies \n in u937 cells indicated that arisostatin a ( 49 ) is equipotent \n to tetrocarcin a , while arisostatin b ( 50 ) was 10-fold \n less active . arisostatin a was also found to be active in various \n breast and lung cancer cell lines at low micromolar concentrations . mode - of - action studies in hela cells showed \n that tetrocarcin a \n ( 47 ) potently inhibits bcl-2 , an important antiapoptotic \n protein that is often overexpressed in cancer cells ( figure 6 ) . although there is \n no evidence of direct binding to bcl-2 , the phenotypical response \n induced by 47 is very promising and suggests that this compound represents an important and unexplored \n lead against cancer . studies in \n lymphoma cells showed that 47 induces a \n stress response of the endoplasmic reticulum ( er ) , resulting in upregulation \n of the heat shock protein hsp70 , ultimately triggering cell apoptosis \n ( figure 6 ) . studies \n in breast cancer cells have suggested an alternative mechanism of \n action of 47 that proceeds by inhibiting phosphorylation \n of the pi3k / akt signaling cascade . although \n the main cellular target of tetrocarcin a is still under investigation , \n preclinical studies have demonstrated its potential as a drug against \n chemoresistant cancers . in fact , 47 was reported to be \n more effective than paclitaxel at inducing cell apoptosis in breast \n cancer cells . arisostatin a ( 49 ) was found to induce cell apoptosis \n by generating reactive oxygen species ( ros ) , altering mitochondrial \n transmembrane potential , and releasing cytochrome c ( cyt c ) in amc - hn-4 cells ( figure 6 ) , ultimately \n leading to activation of caspase-3 and induction of apoptosis . however , \n bcl-2 activation was not altered by arisostatin a , indicating a different \n mode of action from that of 47 . screening the potential anticancer and antimicrobial activities \n of naturally occurring tetrocarcins has produced the main structure these studies have led to \n the following observations : ( a ) the number of carbohydrate units ( digitoxose \n and amicetose ) attached at the c-9 center of tetrocarcin a is proportional \n to its antimicrobial activity ; ( b ) c-21 acetylation and c-9 glycosylation of tetrocarcin a did \n not significantly affect bcl-2 activation . the results suggest that the attachments of amicetose ( 27 ) and digitoxose ( 28 ) at the c-9 position of tetrocarcin \n a enhance its antibacterial profile but have no significant effect \n on its anticancer potential . versipelostatin a ( 51 ) was isolated from a strain \n of streptomyces versipellis ( figure 8) . biological \n studies showed that 51 is the first known molecule to \n inhibit gene expression of grp78 . together with its isoform grp94 , \n these heat shock proteins are induced by stress responses in the endoplasmic \n reticulum and are essential for cancer cell survival . in addition to its role in cancer , er stress is considered to play \n a major role in the pathogenesis of various cns diseases , such as \n alzheimer s and parkinson s disease . recent studies have shown that versipelostatin \n a ( 51 ) inhibits heat shock proteins and unfolded protein \n response ( upr ) \n under glucose deprivation conditions . as such , it appears to operate via a different mechanism as compared \n to that of rapamycin , an fda - approved immunosuppressive drug that \n activates grp78 independently of glucose availability . thus , versipelostatin may offer a significant \n advantage due to its selective effect in hypoglycemic cells . although there is no information for direct \n binding of 51 to a protein target , its effect on the \n upr signaling pathway offers a novel tool to understand er - induced \n stress and pharmacologically regulate related illnesses . sar studies on this family have been limited to the bioactivities \n of naturally occurring versipelostatins . the results show that versipelostatins a ( 51 ) , e ( 52 ) , and f ( 53 ) are the only biologically active \n compounds , inhibiting grp78 expression at low micromolar ic50 values . interestingly , 53 was found to be 10 times more potent than 51 in grp78 \n expression with an ic50 of 0.3 m . the data attest to the significance of the glycosylation \n motif to the grp78 expression and bioactivity . in addition to these studies , takahashi et al . demonstrated \n the importance of the l - oleandrose sugar for the bioactivity , \n and changes in the oxidation state of c-7 had no effect on biological \n activity . okilactomycin ( 54 ) was isolated from streptomyces griseoflavus and is noted for its potent antitumor \n activity against ehrlich ascites carcinoma in vivo at 2.5 mg / kg with \n a t / c of 145.7% for mice survival . in \n addition , 54 exhibited in vitro activity against p388 \n and l1210 leukemia cells , with ic50 values of 89 and 216 \n nm , respectively . recently , okilactomycin \n was shown to inhibit rrna protein synthesis at low m concentrations , suggesting potential applications as an antibacterial \n agent . although other natural okilactomycins \n were found to be inactive , the related \n chrolactomycin ( 55 ) was reported to exhibit antibacterial \n and anticancer activity at a low m concentration . it has been reported that 55 inhibits \n telomerase activity , thus blocking the ability of cancer dna to replicate . the most recently isolated 6-hydroxy chrolactomycin \n was less active than 55 against gram - positive bacteria . the potent antibiotic \n properties of pa-46101a ( 57 ) and b ( 58 ) \n have been reported . recent efforts by \n igarashi and co - workers led to the isolation of maklamicin ( 11 ) and nomimicin ( 59 ) , which contain the smallest macrocyclic \n ring of the class ii spirotetronates . both compounds display potent \n activity against many gram - positive bacteria , while 11 also exhibits moderate antitumor activity against hela and mcf7 \n breast cancer cells . chlorothricin ( 1 ) was shown \n to inhibit the activity of pyruvate carboxylase , a key enzyme that converts pyruvate to oxaloacetate , thus \n allowing consumption of glucose through the krebs cycle ( figure 11 ) . inhibition of pyruvate carboxylase leads to \n an increase of pyruvate concentration in liver , which through gluconeogenesis \n accounts for accumulation of glucose , ultimately leading to diabetes . moreover , an inhibitory effect of 1 on malate dehydrogenase , an enzyme that oxidizes malate to oxaloacetate \n in the krebs cycle , has also been reported . it should be noted , however , that the direct cellular target of 1 is under debate and may involve interaction with components \n in the cell membrane that may account for the observed downstream \n effects . although the potential \n anticancer properties of chlorothricin ( 1 ) have not been \n investigated , c-31 hydroxychlorothricin ( figure 1 ) was shown to exhibit antitumor activity at 40 \n mg / kg against implanted ehrlich carcinoma cells in mice with an ld50 of 295 mg / kg . c-28 methyl ester \n of chlorothricolide ( 2 ) , the aglycone of 1 ( figure 1 ) , \n also inhibits pyruvate carboxylase albeit at higher concentrations \n than 1 , suggesting that glycosylation enhances biological \n activity . efforts to discover \n new gastric atp - ase inhibitors led to \n the isolation of a88696f ( 61 ) and its \n dehydroxylated counterpart a88696c ( 60 ) . hydroxylation at c-3 was found to enhance the biological \n activities since 61 was the most active , with an ic50 at 0.5 m , while 60 was considered inactive . isolated from a streptomyces species , tetronothiodin \n ( 62 ) was shown to inhibit brain - type cholecystokinin \n ( cck)-b receptor in rat cerebral cortex with an ic50 value \n of 3.6 nm . it is worth noting that cck \n receptors are structurally similar to gastrin and are used throughout \n the central nervous system ( cns ) and gastric tract . interestingly , 62 has 27 000 times \n higher affinity for cck - b over cck - a in rat models . thus , in addition to its pharmaceutical promise , 62 could be used as a tool to study the cck - b / cck - a signaling \n pathway .",
"chlorothricin ( 1 ) was shown \n to inhibit the activity of pyruvate carboxylase , a key enzyme that converts pyruvate to oxaloacetate , thus \n allowing consumption of glucose through the krebs cycle ( figure 11 ) . inhibition of pyruvate carboxylase leads to \n an increase of pyruvate concentration in liver , which through gluconeogenesis \n accounts for accumulation of glucose , ultimately leading to diabetes . moreover , an inhibitory effect of 1 on malate dehydrogenase , an enzyme that oxidizes malate to oxaloacetate \n in the krebs cycle , has also been reported . it should be noted , however , that the direct cellular target of 1 is under debate and may involve interaction with components \n in the cell membrane that may account for the observed downstream \n effects . although the potential \n anticancer properties of chlorothricin ( 1 ) have not been \n investigated , c-31 hydroxychlorothricin ( figure 1 ) was shown to exhibit antitumor activity at 40 \n mg / kg against implanted ehrlich carcinoma cells in mice with an ld50 of 295 mg / kg . c-28 methyl ester \n of chlorothricolide ( 2 ) , the aglycone of 1 ( figure 1 ) , \n also inhibits pyruvate carboxylase albeit at higher concentrations \n than 1 , suggesting that glycosylation enhances biological \n activity . efforts to discover \n new gastric atp - ase inhibitors led to \n the isolation of a88696f ( 61 ) and its \n dehydroxylated counterpart a88696c ( 60 ) . hydroxylation at c-3 was found to enhance the biological \n activities since 61 was the most active , with an ic50 at 0.5 m , while 60 was considered inactive . isolated from a streptomyces species , tetronothiodin \n ( 62 ) was shown to inhibit brain - type cholecystokinin \n ( cck)-b receptor in rat cerebral cortex with an ic50 value \n of 3.6 nm . it is worth noting that cck \n receptors are structurally similar to gastrin and are used throughout \n the central nervous system ( cns ) and gastric tract . interestingly , 62 has 27 000 times \n higher affinity for cck - b over cck - a in rat models . thus , in addition to its pharmaceutical promise , 62 could be used as a tool to study the cck - b / cck - a signaling \n pathway .",
"in this part of the review , \n we highlight the key steps toward the \n synthesis of selected spirotetronates . when possible , we compare the \n various strategies in terms of overall efficiency . abyssomicin c ( 6 ) and its atropisomer 29 contain a rigid oxabicyclo \n [ 2.2.2 ] octane substructure that encapsulates the spirotetronate moiety . \n to date , three chemical syntheses of 6 and 29 have been reported . sorensen s group used a biomimetic imda \n to construct spirotetronate moiety 65 from diene 63 . c-11c-12 epoxidation of 65 followed \n by c-16 intramolecular enol epoxide opening produced a 1:1 mixture \n of abyssomicin c ( 6 ) and atrop - abyssomicin \n ( 29 ) . the nicolaou \n group s synthesis of abyssomicin c is highlighted by an intermolecular \n diels alder cycloaddition that furnishes cyclohexene 67 with the desired stereochemistry ( scheme 4 ) . a ring - closing metathesis \n ( rcm ) was used to generate the macrocyclic skeleton of 6 from diene 68 . interestingly , the authors showed that \n treatment of 29 with lithium selectride led to formation \n of abyssomicin d ( 32 ) . interestingly , this finding supports \n the notion that abyssomicin c ( 6 ) is a biosynthetic progenitor \n of 32 and further validates the proposed mechanism of \n abyssomicin c deactivation as presented in scheme 3 . more recently , the groups \n of bihelovic and saicic reported a synthesis \n of 29 . interestingly , this strategy produces exclusively atrop - abyssomycin c. it is likely that the \n restricted rotation around the c-2 and c-3 centers , due to the sp hybridization , affects the formation of the two isomers . \n in support of this hypothesis , the nicolaou group has shown that 29 can be converted to 6 by protonating the c-16 \n oxygen under mild acidic conditions . other \n studies toward the abyssomicin scaffold have been reported in addition \n to the mentioned total syntheses . ferrier \n union / rearrangement of 72(97 ) that yielded the 2,6-cis - tetrahydropyranone ring 73 . grubbs \n second - generation catalyst was used to construct the 13-membered macrocycle \n of 54 . key \n to this approach was a prins - type fragment assembly between cyclohexene 75 and -keto - ester 74 that formed the 2,6-cis - tetrahydropyranone \n ring of 76 . similarly to the smith approach , an intramolecular \n ring - closing metathesis using grubbs second - generation catalyst constructed \n the macrocycle . additional synthetic \n studies toward okilactomycin have been reported by the yoshii and paquette groups . key to this strategy was an imda cycloaddition \n that formed spirotetronate 80 from precursor 79 . the overall synthesis proceeds in 13 linear steps ( 17 total steps ) \n and 17% yield . the burkart group reported a strategy toward spirohexenolides \n based on an intermolecular diels alder cycloaddition ( scheme 7 ) . a ring - closing \n julia kocienski coupling was applied for the synthesis of macrocycle 82 . although the projected intramolecular hemiacetalation \n to 84 failed due to an oxidative rearrangement of 82 to 83 , the overall strategy has successfully \n installed the major skeletal features of spirohexenolides . structurally \n tetronothiodin is highlighted by \n an -acyl tetronic acid moiety and tetrahydrothiophene moiety . \n page et al . have reported a synthesis of the spirotetronate subunit \n isomer 87 using a diels alder reaction with propenal \n and the hydroxyl diene 85 to install the desired stereochemistry \n of 86 ( scheme 8) . several strategies \n have been employed for the synthesis of tetronolide ( 12 ) , the aglycone of tetrocarcin a ( 47 ) , kijanolide ( 44 ) , the aglycone of kijanimicin ( 42 ) , and chlorothricolide \n ( 2 ) , the aglycone of chlorothricin ( 1 ) . \n tetronolide has been synthesized by yoshii and boeckman , while an improved formal \n synthesis has also been reported by roush . in general , these strategies rely upon independently constructing \n the spirotetronate and decalin moieties and then connecting them to \n form the c13 macrocycle . a remarkable synthesis of chlorothricolide \n ( 2 ) was reported by the roush group . the yoshii and roush syntheses of the decalin \n moiety 92 , common to both tetronolide and kijanolide , \n are summarized in scheme 9 . in yoshii s \n approach a horner wadsworth emmons \n ( hwe ) olefination between 88 and 89 was \n used to construct polyene 90 , which underwent an imda \n reaction to produce decalin 92 . the roush group implemented a suzuki coupling between 93 and 94 to form polyene 91 , which , following \n further functionalizations , gave rise to decalin 92 via \n an imda cycloaddition . a synthetic approach toward spirotetronate 100 has \n been reported by yoshii and subsequently \n optimized by roush . this approach is based on constructing \n triene 97 via a hwe olefination between 95 and 96 . an intermolecular diels alder of diene 97 and chiral dienophile 98 , followed by oxidative \n functionalization and double - bond migration , yielded enal 99 . coupling of lithiated spirotetronate 100 with aldehyde 92 followed by subsequent functionalizations yielded sulfone 101 , which , under julia coupling conditions , gave rise to \n the 13-membered macrocycle of 12 . boeckman s group synthesis of 12 is highlighted \n by a tandem ketene - trapping [ 4 + 2 ] cycloaddition of diene 103 and alcohol 102 to form spirotetronate subunit 104 . overall , this approach \n significantly reduces the number of steps required for completion \n of the tetronolide synthesis . various synthetic \n studies toward kijanolide ( 44 ) have \n been reported by the groups of marshall , yoshii , and roush . application of a julia coupling to the synthesis \n of 28,29-bisnor-(+)-kijanolide has been reported by the yoshii group . a tandem intra / intermolecular \n diels alder reaction between \n polyene 105 and chiral dienophile 98 was \n implemented for the synthesis of chlorothricolide ( 2 ) \n ( scheme 11 ) . the reaction gave the desired \n cycloadduct in 40% yield together with partially reacted decalin 107 . upon treatment with dienophile 98 , 107 was converted to the desired product 106 in \n 58% yield . construction of the spirotetronate \n unit followed by coupling with the allyl ester completed the synthesis \n of 2 . a late - stage imda reaction \n was used by yoshii s group for \n the synthesis of ( )-24-o - methylchlorothricolide \n ( scheme 12 ) . although the selectivity of the \n imda reaction was moderate , the overall strategy represents a noteworthy \n bioinspired approach toward these compounds . the groups of marshall , ireland , snider , schmidt , and meyers have also reported studies toward the synthesis \n of 2 . numerous synthetic studies have been reported \n toward the total synthesis of versipelostatin a ( 51 ) , \n but to date its total synthesis has not been completed . a synthesis of the versipelostatin ( 51 ) trisaccharide 114 is shown in scheme 13 . the \n resulting disaccharide 112 was deprotected and coupled \n with l - oleandrosyl imidate 113 to produce 114 ( scheme 13 ) . further functionalization \n of glycosyl 114 and schmidt glycosylation with acetyl \n c-7c-9c-37 versipelostatin aglycone 13 ( figure 2 ) yielded a versipelostatin derivative \n used for biological studies . on the basis of nmr and biological consideration , \n the oleandrose sugar was structurally reassigned from d to l. an alternate strategy used was adding each sugar individually \n to the versipelostatin aglycone , thus elongating the glycosyl chain . a stereocontrolled \n diels alder reaction has been implemented by the roush group \n for the synthesis of the quartromicin spirotetronate unit . in addition , this group reported a strategy of connecting subunits 115 and 116 together using lithium halogen exchange \n and cecl3 coupling . group offered an alternative strategy of constructing the spirotetronate \n subunits using rcm , but to date no total syntheses of quartromicins \n have been completed .",
"the discovery of penicillin \n revolutionized pharmaceutical research \n by demonstrating , for the first time , that microorganisms can produce \n secondary metabolites of value to medicine . since then , cultured microorganisms \n have been recognized as prolific producers of secondary metabolites \n that are used either directly as drugs or have inspired the design \n of drugs . on the other hand , the intricate \n structures of these compounds represent exceptional tools to explore \n new biological pathways and unknown mechanisms of action . these qualities , \n although scattered , are observed in the family of spirotetronate polyketides \n and provide evidence for their significant but still untapped pharmacological \n value . more than 40 years after the discovery of chlorothricin , \n the spirotetronate \n family has grown to include over 70 macrocycles of various sizes that , \n in certain cases , are decorated with carbohydrate side chains . in \n addition to their potent antitumor and antibiotic activities , for example , versipelostatin was found to induce \n potent and selective cytotoxicity in glucose - deprived tumor cells . moreover , abyssomicin c was found to be the \n first natural product to block paba biosynthesis , \n a pathway essential to bacteria but insignificant to humans . impressive synthetic and chemical biology efforts \n were combined to decipher the mode - of - action of abyssomicins at the \n molecular level . this underscores the enormous \n significance of the spirotetronate polyketide family to biology in \n addition to their pharmacological potential . several studies \n have documented the significance of the carbohydrate \n chains for the observed antibiotic activity of spirotetronates . however , with the exception of abyssomicins , there is no clear understanding \n of the biological significance of the spirotetronate aglycone core . \n at present , chemical strategies developed toward the synthesis of \n spirotetronates have uncovered the value of certain key reactions , \n such as diels alder cycloaddition , ring -closing metathesis , \n and julia olefination . nonetheless , the vast majority of these strategies \n have not yielded sufficient amounts of compound for a methodical structure activity \n relationship study , thereby hampering rational drug design . it is \n evident that a methodical fragment - based approach to this structure , \n in combination with chemical biology studies , will be highly beneficial , \n as it could reveal the role of the spirotetronate motif , the effect \n of the macrocyclic size , and the role of the decalin system . in turn , \n this effort would allow a detailed evaluation and optimization of \n the spirotetronate pharmacophore . in addition to a dearly needed scalable \n synthesis , advances in microbial biosynthesis should offer a potential solution to large - scale \n production or semisynthesis of a lead candidate . a combination of \n these efforts should unveil the pharmacological value of spirotetronates \n and would have significant impact in current efforts toward personalized \n medicine ."
] | the discovery of chlorothricin ( 1 ) defined a new family
of microbial metabolites with potent antitumor antibiotic properties
collectively referred to as spirotetronate polyketides . these microbial
metabolites are structurally distinguished by the presence of a spirotetronate
motif embedded within a macrocyclic core . glycosylation at the periphery
of this core contributes to the structural complexity and bioactivity
of this motif . the spirotetronate family displays impressive chemical
structures , potent bioactivities , and significant pharmacological
potential . this review groups the family members based on structural
and biosynthetic considerations and summarizes synthetic and biological
studies that aim to elucidate their mode of action and explore their
pharmacological potential . |
[
"the candida genome database ( cgd , http://www.candidagenome.org/ ) is a freely available online resource , based on the saccharomyces genome database ( sgd , www.yeastgenome.org ; ( 1 ) ) , which collects , organizes , and makes available candida gene , protein and sequence information to the fungal research community . cgd also provides web - based tools for the visualization and analysis of biological data . candida albicans is the most thoroughly studied of the human fungal pathogens and also serves as a model organism for the study of other more experimentally challenging fungal pathogens ( 2 ) . the frequency of fungal infections has risen dramatically over the past few decades , with the current annual incidence of invasive candida infections recently estimated to range between 72 and 228 infections per million ( 3,4 ) . these infections have high mortality rates ( > 35% ) and , despite the availability of antifungal drugs , exceed those associated with bacterial infections among intensive care unit patients ( 5 ) . as a result of medical progress , particularly with respect to chemotherapy , organ transplantation , intensive care and neonatal care , the population of immunocompromised patients susceptible to fungal infection , is expanding ( 68 ) , and resistance to antifungal drugs is increasing ( 3,9,10 ) . furthermore , c. albicans is not the only disease - causing species in the genus ; of great concern is an emerging clinical prevalence of non - albicans candida species ( 11,12 ) . among these , c. tropicalis is common , virulent , and increasingly resistant to antifungal therapy ( 13 ) , c. parapsilosis is particularly problematic , causing severe infections in neonates ( 14 ) , and c. glabrata exhibits a special ability to evade the immune system and survive after cellular engulfment , and can resist antifungal treatment ( 1517 ) . in fungal taxonomy , c. albicans is placed in the order endomycetales , to which the family saccharomycetaceae also belongs ( 18,19 ) , though saccharomyces cerevisiae and c. albicans are separated by 140850 million years of evolution ( 20 ) . despite sharing many similarities , including 3453 pairs of orthologous genes , the two fungi inhabit very different environmental niches , with s. cerevisiae existing as a saprophyte , and c. albicans living in close association with its mammalian hosts . transcriptional rewiring has occurred in their regulatory networks , such that evolved divergence in the activity of orthologous transcription factors , or divergence in cis - regulatory elements , has created distinct regulatory programs in each class ( e.g. galactose metabolism ( 21 ) , mating type ( 22,23 ) and ribosomal proteins ( 24 ) ) . unlike s. cerevisiae , c. albicans exists primarily in a diploid state , with no conventional sexual reproduction that leads to meiosis . instead , c. albicans undergoes a parasexual cycle that involves mating between two diploid cells of the opposite mating type and formation of a tetraploid cell that subsequently returns to diploidy by chromosome loss ( 25 ) . alternatively , chromosome loss may occur prior to mating yielding transient haploids that mate and return to a diploid state ( 26 ) . meiosis has not been observed in either case , and the homologous chromosomes remain mostly intact making the haplotypes much more stable than in other organisms . thus , in order to understand and combat candida pathogenesis , it is important to study candida biology directly , and having access to the phased genome assembly opens up multiple new research opportunities . since its inception in 2004 , cgd has been tasked with maintenance of the primary genome sequence and annotation for the c. albicans reference strain sc5314 . cgd was originally based upon assembly 19 , a diploid , contig - level assembly built from the genomic sequence that had just been completed ( 27 ) , and which included gene models , sequence corrections , and functional annotations provided by a group of volunteer researchers known as the annotation working group ( 28 ) . cgd then took over the task of curating all the candida - related information based on published experimental data , comparative genomics predictions and improved sequence information ( 29 ) . in 2006 , assembly 20 was incorporated into cgd ( 30 ) ; assembly 20 was the first chromosome level assembly for c. albicans , though it consisted of what are referred to as reftigs , wherein each of the chromosomes in the assembly consist of a mosaic of the two haplotypes ( 31 ) . assembly 20 was superseded by assembly 21 , because a sequence from a different strain , wo-1 , had been inadvertently incorporated into assembly 20 . a major update to assembly 21 , based on additional sequence data and comparative analyses ( 32 ) was subsequently also incorporated into cgd . the most recent major update to the sequence is assembly 22 ( 33 ) , which was generated using illumina - based sequencing of sc5314 as well as a collection of congenic strains homozygous for specific chromosomes , which allowed the construction of a phased diploid assembly of the genome . incorporation of assembly 22 into cgd entailed careful reconciliation of sequence ambiguities , potential assembly errors and differences from previous assemblies . we have established a pipeline that takes advantage of all available data , including the illumina - based sequences from muzzey et al . ( 33 ) , roche 454 sequences generated at cgd , as well as independently published , gene - specific sequence data derived from our curation of the candida literature . we have used this pipeline to correct the sequences for more than 300 features , eliminating many reading frame errors and resolving multiple sequence ambiguities ( table 1 ) . we have also re - analyzed the haplotype assignments for the entire chromosome 3 , which led to an exchange of 845 kb between chromosome 3a and chromosome 3b . improving the reference sequence is an ongoing project and we are currently focusing our efforts on intergenic regions , repetitive sequences and segmental duplications . since 2010 , cgd has used a versioning system to track genome sequence releases , and their associated annotations . the version designation appears in the name of each of the relevant sequence and feature annotation files that are available at cgd , so the exact source of the sequence data is always clear . version designations appear in the following format : sxx - myy - rzz where xx , yy , and zz are zero - padded integers . xx is incremented when there is any change to the underlying genomic ( i.e. , chromosome ) sequence . yy is incremented when there is any change to the coordinates of any feature annotated in the genome ( e.g. any change in location or boundary , or addition or removal of a feature from the annotation ) . yy is reset to 01 when xx is incremented ( when a sequence change is made ) . zz is incremented in response to curatorial changes that affect information that appears in the gff file , specifically gene names , gene aliases , gene ids , gene descriptions , feature types ( e.g. gene or pseudogene ) , and orf classifications or qualifiers ( e.g. verified , uncharacterized , deleted , merged ) . files are checked on a weekly basis , as well as any time that a gff file is regenerated manually , to determine if changes have occurred that warrant a change in the zz number . zz is reset to 01 when either xx or yy is incremented ( when a sequence change is made , or when the coordinates of any feature are updated ) . all versions are archived on the cgd download site . as a hypothetical example , say that we start with s05-m01-r01 as the current version . when the next weekly file check is performed , and the new file is noted to contain curatorial updates to gene names in the database , but no new changes to the structural annotation or to the sequence itself , the new version designation becomes s05-m01-r02 . subsequently , the chromosomal coordinates of a gene are changed , based on curation of a paper that provides evidence for updating the gene model . later , a change to correct a sequencing error is made , and the new version designation becomes s06-m01-r01 . cgd recommends that authors note in their materials and methods sections of published papers what version of the genome they were working with when they performed an analysis , so that the analysis is reproducible . with assembly 22 , it became possible to implement a new position based systematic nomenclature for chromosomal features . the previous systematic names , dating back to assembly 19 , consisted of the orf19 prefix followed by a unique but somewhat arbitrary number . the new systematic name is based on the known chromosomal location and haplotype , and it consists of the chromosome ( c1-c7 and cr for the eight nuclear chromosomes , cm for the mitochondrial chromosome ) , a unique number indicating the order of features along chromosomes , the strand ( w for watson or c for crick ) and the haplotype ( a or b ) . for example , c4_03570w_a denotes a feature located on chromosome 4 , watson strand and haplotype a. feature numbers start at the left end of the chromosome and increase by 10 to allow for adding new features in the intervening spaces as they are discovered . since systematic identifiers from all the previous assemblies orf19 names , continue to be used by researchers , cgd includes all the previous identifiers as searchable aliases to allow seamless and unambiguous transition between various nomenclature systems . locus summary pages ( lsp ) exist for every chromosomal feature in cgd and provide a primary way to access gene - specific information . in addition to locus - specific data , such as description , functional annotations ( gene ontology terms , mutant phenotypes ) , or orthologous genes in other species , lsps now also provide access to allele - specific data : dna and protein sequences for both alleles , as well as a listing of allelic variations if they exist . lsps also show graphical representations of the chromosomal context for each allele as thumbnails that lead to genome browser windows and allow farther exploration of a chosen haplotype . assembly 22 allows powerful , allele- and haplotype - specific analyses of the overall genome structure , function and evolution . to facilitate genome - wide research , cgd provides access to all the data in downloadable files that can be used by researchers ' own bioinformatics tools . all dna sequences for the entire chromosomes , coding and non - coding regions , as well as translation products , are available for download at http://www.candidagenome.org / download/. an important part of cgd 's mission is to incorporate and annotate large - scale datasets from published experiments on candida species , and to make them easily available for exploration and analysis by our users . for several years we have provided genexplorer ( 34 ) to display and analyze microarray datasets . recently , to provide access to the growing number of datasets from experiments that use high - throughput sequencing technologies , we have deployed the jbrowse genome browser ( 35 ) . jbrowse is a mature and widely used application that is fast , intuitive , and compatible with most web browsers ( 36 ) . jbrowse allows users to quickly view large - scale sequence data in a genomic context , at multiple zoom - levels of resolution , from base pairs in individual sequence reads to read - density summaries across large genomic regions . the display includes parallel tracks of annotated sequence features , allowing seamless navigation between jbrowse and the locus summary pages for each feature ( figure 1 ) . quantitative tracks graphically display comparative information , such as relative expression level or sequence conservation . jbrowse is highly flexible and customizable : users may easily load their own sequence datasets and analysis tracks , for display in the context of genomic features , or for comparison with datasets and tracks provided by cgd . jbrowse display of the region around the c. albicans serum - inducible gene hwp1 , showing aligned rna - seq reads from serum - treated cells ( 37 ) . the red and blue bars in the top track of the main display window show genes annotated at cgd : red for genes encoded on the w strand ( + ) , blue for genes on the c strand ( ) . clicking on a bar brings up an information window for that gene , and includes a link to its cgd locus summary page . the green bar graph below the gene track shows the density of aligned rna - seq reads along to the chromosome , plotted on a log scale . the bottom track shows all the aligned rna - seq reads along the chromosome : each short bar in the bottom track represents a unique read . in this example the sequence reads are strand - specific : pink bars indicate reads transcribed from the w strand , and light - blue bars indicate reads transcribed from the c strand . clicking on a bar brings up information about the read , including the sequence and quality score for each base . menus and controls at the top of the browser provide navigation , zoom and search functionalities , and allow users to load their own data . we provide the high - throughput dna sequence data ( 33 ) that was the basis of assembly 22 , described above . optional tracks highlight the sequence variation between the two assembly 22 haplotypes , as well as the variation between the common strains sc5314 and wo-1 ( 32 ) . we also make available rna - seq datasets from a number of gene expression studies in c. albicans , including comparisons of different stress conditions ( 37 ) , hyphae - inducing conditions ( 37 ) , biofilm vs. planktonic growth ( 38 ) , white - opaque switching ( 39 ) , and allele - specific expression differences ( 40 ) . in addition , we provide chromatin occupancy data ( chip - seq ) for the wor1p transcription factor during white - opaque switching ( 41 ) . we also have rna - seq datasets for two other candida species : gene expression under ph and nitrosative stress in c. glabrata ( 42 ) , and during biofilm vs. planktonic growth in c. parapsilosis ( 43 ) . we will add new datasets to jbrowse as they become available , and in response to user requests . the reference sequence for an organism is not static while sequencing technologies continue to advance ( both in accuracy and read lengths ) , there is always the possibility that updates will improve the reference sequence . for example , either pacbio or oxford nanopore sequencing ( very long reads , though with high error rates ) , coupled with existing illumina data ( short reads , but low error rates ) may better resolve telomeric and other repeat sequences , which are hard to resolve even with the original sanger reads . another question is whether the sequence of a single instance of a strain is a reasonable representation of the reference sequence indeed , given candida albicans propensity to undergo rearrangement and loss of heterozygosity under stress , different lab isolates of ostensibly the same strain might have different sequences . it is likely in the near future that many distinct strains of candida species will be sequenced , and cgd will endeavor to incorporate these into the database as well . they will provide insight into the genomic variation that exists in each of the candida species . additional high throughput sequencing datasets may also allow refinement of the genome annotations , such as novel additional transcripts , or the addition of 5 and 3 utrs to each of the genes . they may also allow the annotation of functional elements within non - transcribed regions , such as transcription factor binding sites from chip - seq studies . cgd will strive to incorporate such refinements as soon as they become available to maintain the reference sequence and annotation current .",
"since its inception in 2004 , cgd has been tasked with maintenance of the primary genome sequence and annotation for the c. albicans reference strain sc5314 . cgd was originally based upon assembly 19 , a diploid , contig - level assembly built from the genomic sequence that had just been completed ( 27 ) , and which included gene models , sequence corrections , and functional annotations provided by a group of volunteer researchers known as the annotation working group ( 28 ) . cgd then took over the task of curating all the candida - related information based on published experimental data , comparative genomics predictions and improved sequence information ( 29 ) . in 2006 , assembly 20 was incorporated into cgd ( 30 ) ; assembly 20 was the first chromosome level assembly for c. albicans , though it consisted of what are referred to as reftigs , wherein each of the chromosomes in the assembly consist of a mosaic of the two haplotypes ( 31 ) . assembly 20 was superseded by assembly 21 , because a sequence from a different strain , wo-1 , had been inadvertently incorporated into assembly 20 . a major update to assembly 21 , based on additional sequence data and comparative analyses ( 32 ) the most recent major update to the sequence is assembly 22 ( 33 ) , which was generated using illumina - based sequencing of sc5314 as well as a collection of congenic strains homozygous for specific chromosomes , which allowed the construction of a phased diploid assembly of the genome . incorporation of assembly 22 into cgd entailed careful reconciliation of sequence ambiguities , potential assembly errors and differences from previous assemblies . we have established a pipeline that takes advantage of all available data , including the illumina - based sequences from muzzey et al . ( 33 ) , roche 454 sequences generated at cgd , as well as independently published , gene - specific sequence data derived from our curation of the candida literature . we have used this pipeline to correct the sequences for more than 300 features , eliminating many reading frame errors and resolving multiple sequence ambiguities ( table 1 ) . we have also re - analyzed the haplotype assignments for the entire chromosome 3 , which led to an exchange of 845 kb between chromosome 3a and chromosome 3b . improving the reference sequence is an ongoing project and we are currently focusing our efforts on intergenic regions , repetitive sequences and segmental duplications .",
"since 2010 , cgd has used a versioning system to track genome sequence releases , and their associated annotations . the version designation appears in the name of each of the relevant sequence and feature annotation files that are available at cgd , so the exact source of the sequence data is always clear . version designations appear in the following format : sxx - myy - rzz where xx , yy , and zz are zero - padded integers . xx is incremented when there is any change to the underlying genomic ( i.e. , chromosome ) sequence . yy is incremented when there is any change to the coordinates of any feature annotated in the genome ( e.g. any change in location or boundary , or addition or removal of a feature from the annotation ) . yy is reset to 01 when xx is incremented ( when a sequence change is made ) . zz is incremented in response to curatorial changes that affect information that appears in the gff file , specifically gene names , gene aliases , gene ids , gene descriptions , feature types ( e.g. gene or pseudogene ) , and orf classifications or qualifiers ( e.g. verified , uncharacterized , deleted , merged ) . files are checked on a weekly basis , as well as any time that a gff file is regenerated manually , to determine if changes have occurred that warrant a change in the zz number . zz is reset to 01 when either xx or yy is incremented ( when a sequence change is made , or when the coordinates of any feature are updated ) . all versions are archived on the cgd download site . as a hypothetical example , say that we start with s05-m01-r01 as the current version . when the next weekly file check is performed , and the new file is noted to contain curatorial updates to gene names in the database , but no new changes to the structural annotation or to the sequence itself , the new version designation becomes s05-m01-r02 . subsequently , the chromosomal coordinates of a gene are changed , based on curation of a paper that provides evidence for updating the gene model . later , a change to correct a sequencing error is made , and the new version designation becomes s06-m01-r01 . cgd recommends that authors note in their materials and methods sections of published papers what version of the genome they were working with when they performed an analysis , so that the analysis is reproducible .",
"with assembly 22 , it became possible to implement a new position based systematic nomenclature for chromosomal features . the previous systematic names , dating back to assembly 19 , consisted of the orf19 prefix followed by a unique but somewhat arbitrary number . the new systematic name is based on the known chromosomal location and haplotype , and it consists of the chromosome ( c1-c7 and cr for the eight nuclear chromosomes , cm for the mitochondrial chromosome ) , a unique number indicating the order of features along chromosomes , the strand ( w for watson or c for crick ) and the haplotype ( a or b ) . for example , c4_03570w_a denotes a feature located on chromosome 4 , watson strand and haplotype a. feature numbers start at the left end of the chromosome and increase by 10 to allow for adding new features in the intervening spaces as they are discovered . since systematic identifiers from all the previous assemblies orf19 names , continue to be used by researchers , cgd includes all the previous identifiers as searchable aliases to allow seamless and unambiguous transition between various nomenclature systems . assembly 19/21 identifiers , locus summary pages ( lsp ) exist for every chromosomal feature in cgd and provide a primary way to access gene - specific information . in addition to locus - specific data , such as description , functional annotations ( gene ontology terms , mutant phenotypes ) , or orthologous genes in other species , lsps now also provide access to allele - specific data : dna and protein sequences for both alleles , as well as a listing of allelic variations if they exist . lsps also show graphical representations of the chromosomal context for each allele as thumbnails that lead to genome browser windows and allow farther exploration of a chosen haplotype . assembly 22 allows powerful , allele- and haplotype - specific analyses of the overall genome structure , function and evolution . to facilitate genome - wide research , cgd provides access to all the data in downloadable files that can be used by researchers ' own bioinformatics tools . all dna sequences for the entire chromosomes , coding and non - coding regions , as well as translation products , are available for download at http://www.candidagenome.org / download/.",
"an important part of cgd 's mission is to incorporate and annotate large - scale datasets from published experiments on candida species , and to make them easily available for exploration and analysis by our users . for several years recently , to provide access to the growing number of datasets from experiments that use high - throughput sequencing technologies , we have deployed the jbrowse genome browser ( 35 ) . jbrowse is a mature and widely used application that is fast , intuitive , and compatible with most web browsers ( 36 ) . jbrowse allows users to quickly view large - scale sequence data in a genomic context , at multiple zoom - levels of resolution , from base pairs in individual sequence reads to read - density summaries across large genomic regions . the display includes parallel tracks of annotated sequence features , allowing seamless navigation between jbrowse and the locus summary pages for each feature ( figure 1 ) . quantitative tracks graphically display comparative information , such as relative expression level or sequence conservation . jbrowse is highly flexible and customizable : users may easily load their own sequence datasets and analysis tracks , for display in the context of genomic features , or for comparison with datasets and tracks provided by cgd . jbrowse display of the region around the c. albicans serum - inducible gene hwp1 , showing aligned rna - seq reads from serum - treated cells ( 37 ) . the red and blue bars in the top track of the main display window show genes annotated at cgd : red for genes encoded on the w strand ( + ) , blue for genes on the clicking on a bar brings up an information window for that gene , and includes a link to its cgd locus summary page . the green bar graph below the gene track shows the density of aligned rna - seq reads along to the chromosome , plotted on a log scale . the bottom track shows all the aligned rna - seq reads along the chromosome : each short bar in the bottom track represents a unique read . in this example the sequence reads are strand - specific : pink bars indicate reads transcribed from the w strand , and light - blue bars indicate reads transcribed from the c strand . clicking on a bar brings up information about the read , including the sequence and quality score for each base . menus and controls at the top of the browser provide navigation , zoom and search functionalities , and allow users to load their own data . we provide the high - throughput dna sequence data ( 33 ) that was the basis of assembly 22 , described above . optional tracks highlight the sequence variation between the two assembly 22 haplotypes , as well as the variation between the common strains sc5314 and wo-1 ( 32 ) . we also make available rna - seq datasets from a number of gene expression studies in c. albicans , including comparisons of different stress conditions ( 37 ) , hyphae - inducing conditions ( 37 ) , biofilm vs. planktonic growth ( 38 ) , white - opaque switching ( 39 ) , and allele - specific expression differences ( 40 ) . in addition , we provide chromatin occupancy data ( chip - seq ) for the wor1p transcription factor during white - opaque switching ( 41 ) . we also have rna - seq datasets for two other candida species : gene expression under ph and nitrosative stress in c. glabrata ( 42 ) , and during biofilm vs. planktonic growth in c. parapsilosis ( 43 ) . we will add new datasets to jbrowse as they become available , and in response to user requests .",
"the reference sequence for an organism is not static while sequencing technologies continue to advance ( both in accuracy and read lengths ) , there is always the possibility that updates will improve the reference sequence . for example , either pacbio or oxford nanopore sequencing ( very long reads , though with high error rates ) , coupled with existing illumina data ( short reads , but low error rates ) may better resolve telomeric and other repeat sequences , which are hard to resolve even with the original sanger reads . another question is whether the sequence of a single instance of a strain is a reasonable representation of the reference sequence indeed , given candida albicans propensity to undergo rearrangement and loss of heterozygosity under stress , different lab isolates of ostensibly the same strain might have different sequences . it is likely in the near future that many distinct strains of candida species will be sequenced , and cgd will endeavor to incorporate these into the database as well . they will provide insight into the genomic variation that exists in each of the candida species . additional high throughput sequencing datasets may also allow refinement of the genome annotations , such as novel additional transcripts , or the addition of 5 and 3 utrs to each of the genes . they may also allow the annotation of functional elements within non - transcribed regions , such as transcription factor binding sites from chip - seq studies . cgd will strive to incorporate such refinements as soon as they become available to maintain the reference sequence and annotation current .",
"national institute of dental and craniofacial research at the us national institutes of health [ r01 de015873 ] . funding for open access charge : nih . conflict of interest statement ."
] | the candida genome database ( cgd , http://www.candidagenome.org/ ) is a freely available online resource that provides gene , protein and sequence information for multiple candida species , along with web - based tools for accessing , analyzing and exploring these data . the mission of cgd is to facilitate and accelerate research into candida pathogenesis and biology , by curating the scientific literature in real time , and connecting literature - derived annotations to the latest version of the genomic sequence and its annotations . here , we report the incorporation into cgd of assembly 22 , the first chromosome - level , phased diploid assembly of the c. albicans genome , coupled with improvements that we have made to the assembly using additional available sequence data . we also report the creation of systematic identifiers for c. albicans genes and sequence features using a system similar to that adopted by the yeast community over two decades ago . finally , we describe the incorporation of jbrowse into cgd , which allows online browsing of mapped high throughput sequencing data , and its implementation for several rna - seq data sets , as well as the whole genome sequencing data that was used in the construction of assembly 22 . |
[
"all study subjects were from the ongoing , prospective , population - based korean genome and epidemiology study ( koges ) cohort . the original study was designed to establish a representative adult cohort in an urban area , the city of ansan , and to identify the epidemiologic characteristics , frequency , and determinants of chronic diseases in koreans . initially , 5,015 participants ( 2,521 men and 2,494 women 4069 years old ) who participated in a comprehensive health examination and onsite interviews at korea university ansan hospital formed a longitudinal cohort from june 2001 to january 2003 . , subjects signed an informed consent form , which was approved by the human subjects review committee at the korea university ansan hospital . the fifth biennial examination was conducted from march 2009 to february 2011 and the sixth examination from march 2011 to february 2013 . polysomnography ( psg ) was included randomly in the study protocol in september 2009 in about one - half of the koges participants . although psg will be administered to the entire study population during the 4-year period , the present study includes only the subset of the sample with psg data acquired between september 2009 and november 2011 . after excluding the subjects who had missing data and extreme outliers of glucose concentrations , 1,344 subjects ( 706 men and 638 women ) further details from the protocol and design of the koges are described elsewhere ( 11 ) . all participants responded to an interviewer - administered questionnaire and underwent a comprehensive physical examination . lifestyle characteristics were smoking status and alcohol consumption categorized as never , former , and current . level of exercise was categorized as never , lightly ( <3 times / week , 30 min / session ) , or regularly ( 3 times / week , 30 min / session ) during the previous month . the presence of chronic illnesses , including diabetes , hypertension , dyslipidemia , and cardiovascular disease ( cvd ) , was noted as were prescribed medications . subjects with documented events or medical records of myocardial infarction , angina , heart failure , stroke , or peripheral artery disease were considered to have cvd . diabetes was defined by american diabetes association criteria , using a 75-g oral glucose tolerance test ( fasting plasma glucose [ fpg ] 7.0 mmol / l ) , and medical history ( 12 ) . for subjects without diabetes , glucose tolerance status was assessed by american diabetes association criteria ( 12 ) as follows : ifg only ( 5.6 fpg mmol / l ) , and ifg + igt ( 5.6 fpg < 7.0 mmol / l and 7.8 2hpg < 11.1 hypertension was defined as systolic blood pressure 140 mmhg , diastolic blood pressure 90 mmhg , or medical history ( 13 ) . height and body weight were measured to the nearest 0.1 cm and 0.1 kg , respectively . wc was measured at the midpoint between the lower rib margin and the iliac crest in the standing position . obesity was defined as bmi 25 kg / m according to the asian - specific bmi cutoffs from the world health organization report ( 14 ) . plasma glucose , serum triglycerides , hdl cholesterol , and ldl cholesterol levels were measured with an autoanalyzer ( advia 1650 ; siemens , tarrytown , ny ) . insulin was measured with an immunoradiometric assay kit ( ins - irma kit ; biosource , nivelles , belgium ) using a packard counter system . insulin resistance was estimated with the homeostasis model of assessment for insulin resistance ( homa - ir ) and calculated as fasting glucose ( mmol / l ) fasting insulin ( u / ml ) / 22.5 . homa -cell function ( homa- ) ( % ) was calculated as 20 fasting insulin ( u / ml ) / fasting glucose ( mmol / l ) 3.5 ( 15 ) . for subjects who participated in the fifth biennial examination ( n = 820 ) , single - slice computed tomography ( ct ) scanning ( brilliance 64 ; philips , cleveland , oh ) the scans were conducted at 120 kv with a slice thickness of 5 mm at the level of the l4l5 vertebral interspace . the total area of intra - abdominal fat was delineated by manual tracing within the muscle wall , and the visceral fat area ( vfa ) was defined as an area with an attenuation range between 190 and 30 hounsfield units . overnight sleep study was performed at home with a portable device ( embletta x100 ; embla systems , san carlos , ca ) . two trained sleep technologists visited each subject s home in the evening , applied sensors , and instructed the subject on how to start and stop the recording . subjects were required to record the lights - off and -on times and to report them the next morning . recording channels were one for electroencephalography ( c4a1 ) , one for electrooculography ( right upper outer canthus to left lower outer canthus ) , one for chin electromyography , one for modified lead ii electrocardiography , one for airflow from nasal airflow pressure transducer , two for respiratory effort from chest and abdominal respiratory inductance plethysmography , one pulse oximeter , and one position sensor . data were scored by two well - trained technicians who had 5 years of experience with psg monitoring and scoring according to standard guidelines ( 16,17 ) . internal consistency for scoring the apnea - hypopnea index ( ahi ) was high ( cronbach = 0.996 and 1.00 for each rater ) , and interrater reliability was strong ( cronbach = 0.998 ) . although we did not perform a validity study to compare psg recordings obtained in the home and laboratory settings , the sleep heart health study clearly demonstrated that the median respiratory disturbance index was similar in the unattended home and attended laboratory settings , with differences of a small magnitude in some sleep parameters ( 18 ) . obstructive apnea was defined when airflow dropped by 90% of the baseline with ongoing chest and abdominal movement , and hypopnea was defined as a reduction in airflow by 30% associated with at least a 4% oxygen desaturation . the duration threshold for the respiratory events was 10 s. ahi was calculated , and osa was defined as an ahi 5 ( 1,16,19 ) . daytime sleepiness was assessed with the epworth sleepiness scale ( ess ) ( 20 ) , a well - validated and frequently used subjective eight - item , self - administered questionnaire . subjects were asked to score the likelihood of falling asleep in eight different situations with different levels of stimulation . the higher the ess score , the greater propensity for sleepiness implied . in the current study , eds was defined as ess scores > 10 ( 20 ) . subject characteristics at baseline were compared among groups stratified by the presence or absence of osa and obesity by student t test for continuous variables and test for categorical variables . nonnormally distributed variables , such as hba1c , homa - ir , homa- , ahi , and triglyceride level , are presented as the median and interquartile range for each group , and the differences were tested after logarithmic transformation . variables associated with glucose metabolism were compared by ancova after adjusting for age , sex , and bmi among the groups stratified by osa and obesity . for ancova , we confirmed the homogeneity of the slope between the covariates and the dependent variables in subjects with or without osa . the interaction term for osa and obesity on homa- was calculated to determine whether the association between osa and homa- was modified by obesity status . to exclude the potential confounding effect of medication for diabetes or dyslipidemia on glucose metabolism , the same analyses were repeated after excluding subjects who were taking these medications . to evaluate the impact of osa on ifg only , igt only , ifg + igt , and diabetes according to the presence or absence of obesity , the following five models were fit for each outcome : model 1 was adjusted for age and sex ; model 2 was adjusted for age , sex , alcohol consumption , smoking status , exercise , presence of hypertension or cvd , and medication for dyslipidemia ; model 3 was the same as model 2 and adjusted for bmi ; model 4 was the same as model 2 and adjusted for wc ; and model 5 was the same as model 2 and adjusted for vfa in subjects who underwent abdominal ct scan . to exclude the potential confounding effect of medication for diabetes or dyslipidemia on glucose metabolism odds ratios ( ors ) for ifg only , igt only , ifg + igt , and diabetes were calculated according to the tertile of ahi to demonstrate the dose - response relationship . in addition , to examine the additive effect of eds and osa on glucose metabolism , ors for ifg only , igt only , ifg + igt , and diabetes were evaluated in subjects with osa according to the presence or absence of eds compared with those without osa . for logistic regression these models showed no evidence of lack of fit according to the hosmer - lemeshow statistic . all statistical analyses were performed with sas version 9.1 for windows software ( sas institute inc . , cary , nc ) .",
"all participants responded to an interviewer - administered questionnaire and underwent a comprehensive physical examination . lifestyle characteristics were smoking status and alcohol consumption categorized as never , former , and current . level of exercise was categorized as never , lightly ( <3 times / week , 30 min / session ) , or regularly ( 3 times / week , 30 min / session ) during the previous month . the presence of chronic illnesses , including diabetes , hypertension , dyslipidemia , and cardiovascular disease ( cvd ) , was noted as were prescribed medications . subjects with documented events or medical records of myocardial infarction , angina , heart failure , stroke , or peripheral artery disease were considered to have cvd . diabetes was defined by american diabetes association criteria , using a 75-g oral glucose tolerance test ( fasting plasma glucose [ fpg ] 7.0 mmol / l or 2-h plasma glucose [ 2hpg ] 11.1 mmol / l ) , and medical history ( 12 ) . for subjects without diabetes , glucose tolerance status was assessed by american diabetes association criteria ( 12 ) as follows : ifg only ( 5.6 fpg mmol / l ) , igt only ( fpg < 5.6 mmol / l and 7.8 2hpg < 11.1 mmol / l ) , and ifg + igt ( 5.6 fpg < 7.0 mmol / l and 7.8 2hpg < 11.1 hypertension was defined as systolic blood pressure 140 mmhg , diastolic blood pressure 90 mmhg , or medical history ( 13 ) . height and body weight were measured to the nearest 0.1 cm and 0.1 kg , respectively . wc was measured at the midpoint between the lower rib margin and the iliac crest in the standing position . obesity was defined as bmi 25 kg / m according to the asian - specific bmi cutoffs from the world health organization report ( 14 ) . plasma glucose , serum triglycerides , hdl cholesterol , and ldl cholesterol levels were measured with an autoanalyzer ( advia 1650 ; siemens , tarrytown , ny ) . insulin was measured with an immunoradiometric assay kit ( ins - irma kit ; biosource , nivelles , belgium ) using a packard counter system . insulin resistance was estimated with the homeostasis model of assessment for insulin resistance ( homa - ir ) and calculated as fasting glucose ( mmol / l ) fasting insulin ( u / ml ) / 22.5 . homa -cell function ( homa- ) ( % ) was calculated as 20 fasting insulin ( u / ml ) / fasting glucose ( mmol / l ) 3.5 ( 15 ) .",
"for subjects who participated in the fifth biennial examination ( n = 820 ) , single - slice computed tomography ( ct ) scanning ( brilliance 64 ; philips , cleveland , oh ) was used to quantify intra - abdominal adipose tissue . the scans were conducted at 120 kv with a slice thickness of 5 mm at the level of the l4l5 vertebral interspace . the total area of intra - abdominal fat was delineated by manual tracing within the muscle wall , and the visceral fat area ( vfa ) was defined as an area with an attenuation range between 190 and 30 hounsfield units .",
"overnight sleep study was performed at home with a portable device ( embletta x100 ; embla systems , san carlos , ca ) . two trained sleep technologists visited each subject s home in the evening , applied sensors , and instructed the subject on how to start and stop the recording . subjects were required to record the lights - off and -on times and to report them the next morning . recording channels were one for electroencephalography ( c4a1 ) , one for electrooculography ( right upper outer canthus to left lower outer canthus ) , one for chin electromyography , one for modified lead ii electrocardiography , one for airflow from nasal airflow pressure transducer , two for respiratory effort from chest and abdominal respiratory inductance plethysmography , one pulse oximeter , and one position sensor . data were scored by two well - trained technicians who had 5 years of experience with psg monitoring and scoring according to standard guidelines ( 16,17 ) . internal consistency for scoring the apnea - hypopnea index ( ahi ) was high ( cronbach = 0.996 and 1.00 for each rater ) , and interrater reliability was strong ( cronbach = 0.998 ) . although we did not perform a validity study to compare psg recordings obtained in the home and laboratory settings , the sleep heart health study clearly demonstrated that the median respiratory disturbance index was similar in the unattended home and attended laboratory settings , with differences of a small magnitude in some sleep parameters ( 18 ) . obstructive apnea was defined when airflow dropped by 90% of the baseline with ongoing chest and abdominal movement , and hypopnea was defined as a reduction in airflow by 30% associated with at least a 4% oxygen desaturation . the duration threshold for the respiratory events was 10 s. ahi was calculated , and osa was defined as an ahi 5 ( 1,16,19 ) .",
"daytime sleepiness was assessed with the epworth sleepiness scale ( ess ) ( 20 ) , a well - validated and frequently used subjective eight - item , self - administered questionnaire . subjects were asked to score the likelihood of falling asleep in eight different situations with different levels of stimulation . the higher the ess score , the greater propensity for sleepiness implied . in the current study",
"subject characteristics at baseline were compared among groups stratified by the presence or absence of osa and obesity by student t test for continuous variables and test for categorical variables . nonnormally distributed variables , such as hba1c , homa - ir , homa- , ahi , and triglyceride level , are presented as the median and interquartile range for each group , and the differences were tested after logarithmic transformation . variables associated with glucose metabolism were compared by ancova after adjusting for age , sex , and bmi among the groups stratified by osa and obesity . for ancova , we confirmed the homogeneity of the slope between the covariates and the dependent variables in subjects with or without osa . the interaction term for osa and obesity on homa- was calculated to determine whether the association between osa and homa- was modified by obesity status . to exclude the potential confounding effect of medication for diabetes or dyslipidemia on glucose metabolism , the same analyses were repeated after excluding subjects who were taking these medications . to evaluate the impact of osa on ifg only , igt only , ifg + igt , and diabetes according to the presence or absence of obesity , multivariate logistic regression analyses were conducted . in the analysis , the following five models were fit for each outcome : model 1 was adjusted for age and sex ; model 2 was adjusted for age , sex , alcohol consumption , smoking status , exercise , presence of hypertension or cvd , and medication for dyslipidemia ; model 3 was the same as model 2 and adjusted for bmi ; model 4 was the same as model 2 and adjusted for wc ; and model 5 was the same as model 2 and adjusted for vfa in subjects who underwent abdominal ct scan . to exclude the potential confounding effect of medication for diabetes or dyslipidemia on glucose metabolism odds ratios ( ors ) for ifg only , igt only , ifg + igt , and diabetes were calculated according to the tertile of ahi to demonstrate the dose - response relationship . in addition , to examine the additive effect of eds and osa on glucose metabolism , ors for ifg only , igt only , ifg + igt , and diabetes were evaluated in subjects with osa according to the presence or absence of eds compared with those without osa . for logistic regression , we calculated adjusted r and hosmer - lemeshow statistics to assess model adequacy . these models showed no evidence of lack of fit according to the hosmer - lemeshow statistic . all statistical analyses were performed with sas version 9.1 for windows software ( sas institute inc . , cary , nc ) .",
"table 1 shows the characteristics of the participants stratified by the presence or absence of osa and obesity . about 36.6% of nonobese and 58.2% of obese subjects had osa . however , the severity of osa was mostly mild and moderate ( 27 , 8.8 , and 0.8% of nonobese and 38.4 , 14.6 , and 5.2% obese subjects had mild , moderate , and severe osa , respectively ) . among 396 subjects with diabetes , 351 had a history of diabetes of whom 142 were treated with oral hypoglycemic agents ( n = 140 ) or insulin ( n = 4 ) . subjects with osa were older and had a higher 2hpg , hba1c , bmi , wc , vfa , and homa - ir than those without osa , regardless of obesity . in the nonobese group , subjects with osa had higher fpg and triglyceride levels and lower homa- and hdl cholesterol levels than those without osa . the proportion of ifg + igt and diabetes was higher according to osa status in nonobese subjects , whereas only the prevalence of diabetes was higher in obese subjects with osa . characteristics of subjects according to the presence or absence of obesity and osa table 2 presents the age- , sex- , and bmi - adjusted values for glucose metabolism according to osa and obesity status . in the nonobese group , fpg , 2hpg , and hba1c levels were significantly higher , and homa - ir was modestly higher in those with osa than in those without osa . however , in the obese group , only insulin and homa - ir levels were associated with osa . although not statistically significant , homa- was lower in nonobese subjects with osa than in those without osa but higher in obese subjects with osa than in those without osa . therefore , a significant interaction between osa and obesity was observed for homa- ( p = 0.025 ) . after excluding subjects who were taking medication for diabetes or dyslipidemia , in the nonobese group , fpg and 2hpg were still higher in those with osa than in those without . on the contrary , in the obese group , although glucose concentrations were not different , insulin , homa - ir , homa- were higher in those with osa than in those without ( supplementary table 1 ) . variables associated with glucose metabolism according to obesity and osa status after adjusting for age , sex , and bmi multivariate logistic regression analyses were conducted to investigate the effects of osa on glucose metabolism according to obesity status ( table 3 ) . in subjects without obesity , the presence of osa showed higher ors for ifg + igt and diabetes , even after adjusting for several confounding variables , including bmi or wc . osa was significantly associated with diabetes even after adjusting for vfa in nonobese subjects . in an analysis to show the dose - response relationship , nonobese subjects with the highest ahi tertile had the highest ors for ifg + igt or diabetes ( supplementary table 2 ) . in contrast , in those with obesity , none of the abnormal glucose categories was associated with osa . these findings were consistent even after excluding subjects who were taking medication for diabetes or dyslipidemia ( supplementary table 3 ) . association between osa and abnormal glucose metabolism according to obesity status supplementary table 4 shows the joint effect of osa and eds on glucose tolerance categories . in the nonobese group , compared with subjects without osa , nonsleepy subjects with osa had higher ors for diabetes , but sleepy subjects with osa had the highest ors for diabetes ( hazard ratio 5.78 [ 95% ci 2.0516.3 ] ) .",
"in this large community - based cohort study , we demonstrated the differential association between osa and impaired glucose metabolism according to the presence of obesity . of note , osa was significantly associated with abnormal glucose metabolism in nonobese subjects , even after adjusting for several confounding variables , including generalized or visceral adiposity . to our knowledge , this study is the first to show that the impact of osa on glucose metabolism is more evident in the nonobese than in the obese population . we also clearly demonstrated that in the nonobese group , fpg , 2hpg , and hba1c were significantly higher and that homa - ir was modestly higher in subjects with osa than in those without . the only previous study to analyze the effect of osa according to obesity status was the sleep heart health study , where the association between osa and abnormal glucose metabolism was not different between the nonoverweight and overweight / obese groups ( 3 ) . we can hypothesize that osa may have a lesser impact on glucose metabolism in obese than in nonobese individuals because of preexisting derangements in those who are obese . in accordance with this theory , the improvement of insulin sensitivity in patients with osa receiving cpap therapy was minimal in those with a bmi of > 30 kg / m , whereas it was more prominent in those with less obesity ( 5 ) . ( 21 ) demonstrated that the acute intermittent hypoxia caused insulin resistance and increased secretion of leptin and tumor necrosis factor- in lean mice . however , obesity was associated with striking increases in leptin and tumor necrosis factor- levels , which overwhelmed the effects of hypoxia . on the contrary , drager et al . ( 22 ) showed that the effect of chronic intermittent hypoxia on glucose intolerance , inflammation , and oxidative stress was prominent in obese mice but not in lean mice . the causes of these contradictory findings are not clear ; however , the metabolic and proinflammatory responses to acute and chronic intermittent hypoxia may be different . an alternative hypothesis may be a presence or absence of eds in subjects with osa . eds is reportedly associated with hyperglycemia and insulin resistance in subjects with osa ( 23,24 ) . intermittent hypoxemia has been shown to result in disturbed sleep architecture or to damage neuronal structures that promote wakefulness in animal models ( 25 ) . indeed , higher degrees of hypoxemia predict both sleepiness and insulin resistance ( 1,26 ) . according to these studies , we can expect that the effect of hypoxemia on glucose metabolism may be more evident in patients with osa and eds . in the current study , we demonstrated that the joint effect of osa and eds on the or for diabetes was highly significant only in nonobese subjects . therefore , the differential impact of eds on glucose metabolism according to obesity status may be responsible for the discrepant effect of osa in subjects with or without obesity in the current study . the association between homa - ir and osa was similar in subjects with and without obesity , as seen in previous research ( 1,3,27 ) . however , few studies have evaluated insulin secretion according to osa status . recently , in healthy young men without diabetes and obesity ( most of them caucasian ) , subjects with osa had increased insulin resistance and compensatory hyperinsulinemia ( 10 ) . in the current study , however , homa- was lower in nonobese subjects with osa than in those without osa but was higher in obese subjects . this finding was more evident in obese subjects after excluding those taking medication for diabetes or dyslipidemia and suggests that inadequate insulin secretion against the increased insulin resistance may be responsible for the abnormal glucose metabolism in nonobese individuals , which is characteristic for diabetes in asians ( 28,29 ) . on the contrary , increased insulin secretion in response to insulin resistance in obese individuals with osa may explain why glucose metabolism is less impaired by osa . however , the hyperinsulinemic - euglycemic clamp technique should be used to further explore the mechanisms of the impairment of glucose metabolism by osa . therefore , the prevalence of metabolically obese normal weight ( monw ) individuals who have not only a normal bmi , but also a cluster of obesity - related risk factors for diabetes and cvd is reportedly higher in asians ( 30,31 ) . higher levels of inflammatory adipokines and atherogenic ldl profiles in monw individuals ( 32,33 ) may mediate the increase in cvd and mortality in this population ( 34 ) . the finding that a worse cardiometabolic profile was more prominent in nonobese subjects with osa in the current study supports the notion that these individuals may have similar characteristics as those with monw . although the relationship between osa and abnormal glucose metabolism has been demonstrated in several previous studies ( 1,2,35 ) , a few have evaluated the association between osa and distinct prediabetic groups ( ifg and/or igt ) , where sleep - disordered breathing was associated with occult diabetes , ifg only , ifg + igt ( 3 ) , or glucose intolerance ( 1,35 ) in population and clinic - based studies . subjects with ifg had a greater impairment of early phase insulin secretion and increased endogenous glucose output , whereas igt was associated with peripheral insulin resistance ( 36 ) . in the current study , however , osa was associated with neither ifg only nor igt only . because more severe metabolic abnormalities are present in individuals with ifg + igt , diabetes develops more rapidly and unfavorable cardiovascular risk factors and mortality are increased compared with individuals with ifg only or igt only ( 3638 ) . from this point of view , the significant association between osa and ifg + igt in the current study suggests that subjects with osa are at a greater risk for developing diabetes and cvd and have a higher risk of mortality . compared with previous studies , which had several methodological limitations in terms of the study population ( 39,40 ) or lacked rigorous control for numerous confounders , especially obesity , the current study used a large community - based sample and differentiated the effect of osa according to the presence of obesity in addition to adjustment for generalized or visceral obesity . another strength of the current study was the evaluation of osa status during sleep at home , which provides a more realistic estimation of osa severity than hospital - based studies because of the maintenance of regular daily habits of sleep , physical activity , and diet in the general population . the major limitation of the current study was its cross - sectional design , which makes it difficult to determine whether there is a causal relationship between osa and impaired glucose metabolism . secondly , because we did not have a sufficient number of subjects with severe osa ( ahi 30 ) , it is unclear whether the present findings would be consistent in those with severe osa . however , the positive association between the ahi tertile and glucose tolerance categories in the nonobese group supports a dose - response relationship . in addition , the small numerical , but significant differences of some metabolic variables between those with and without osa would be more evident if we had more subjects with severe osa . however , the analysis of the association between ahi tertile and glucose tolerance categories showed that subjects with the third ahi tertile had the highest or for ifg + igt and diabetes in the nonobese group , which supports a dose - response relationship ( data not shown ) . finally , because bmi and body fat distribution in this population are different from other ethnicities , the present findings may not be generalizable to non - asian populations . in summary , the current study provides original evidence that the presence of mild to moderate osa in nonobese individuals confers a higher risk for impaired glucose metabolism , even after adjusting for important risk factors . osa can be responsible for the future risk for diabetes and cvd in nonobese individuals , whereas the prognostic implication of osa in obese individuals is unclear . whether this finding is universal across different populations with diverse ethnicity and obesity status should be studied in the future ."
] | objectivethe purpose of this study was to investigate whether the impact of obstructive sleep apnea ( osa ) on glucose metabolism was different according to the presence or absence of obesity.research design and methodsa total of 1,344 subjects > 40 years old from the korean genome and epidemiology study were included . osa was detected by home portable sleep monitoring . plasma glucose , hba1c , and insulin resistance were compared according to osa and obesity status . the associations between osa and impaired fasting glucose ( ifg ) , impaired glucose tolerance ( igt ) , ifg + igt , and diabetes were evaluated in subjects with and without obesity after adjusting for several confounding variables . the effect of visceral obesity on this association was evaluated in 820 subjects who underwent abdominal computed tomography scanning.resultsin subjects without obesity , fasting glucose , 2-h glucose after 75-g glucose loading , and hba1c were higher in those with osa than in those without after controlling for age , sex , and bmi . in addition , the presence of osa in nonobese subjects was associated with a higher prevalence of ifg + igt and diabetes after adjusting for several confounding variables ( odds ratio 3.15 [ 95% ci 1.446.90 ] and 2.24 [ 1.433.50 ] for ifg + igt and diabetes , respectively ) . further adjustment for visceral fat area did not modify this association . in contrast , in those with obesity , none of the abnormal glucose tolerance categories were associated with osa.conclusionsthe presence of osa in nonobese individuals is significantly associated with impaired glucose metabolism , which can be responsible for future risk for diabetes and cardiovascular disease . |
[
"approximately 24% of non - hodgkin 's lymphomas are considered to be of extranodal origin . primary uterine non - hodgkin 's lymphomas are extremely rare accounting for < 1% of all extranodal non - hodgkin 's lymphomas . however , the diagnosis of primary uterine lymphoma is often delayed due to its low incidence and nonspecific clinical presentation . , we present magnetic resonance imaging ( mri ) and fluorine-18-fluorodeoxyglucose ( f - fdg ) positron emission tomography ( pet)/ct findings in a patient with primary uterine peripheral t - cell lymphoma .",
"a 27-year - old female was admitted to our hospital because of intermittent fever with neutropenia for 7 months . laboratory tests showed decreased white blood cell count ( 1.4 10/l ; range 410 10/l ) . serum cancer antigen 125 was elevated ( 193 u / ml ; range < 35 u / ml ) . mri showed an ill - defined mass involved both the uterine corpus and cervix , resulting in diffuse enlargement of the uterus . this mass showed inhomogeneous hypointensity on unenhanced t1-weighted images , hyperintensity on diffusion - weighted imaging , relative hypointensity compared to the surrounding myometrium on t2-weighted images , and lower enhancement than the surrounding myometrium on enhanced t1-weighted images ( figure 1 ) . , f - fdg pet / ct was performed showing intense fdg uptake in the thickened wall of the uterine corpus and cervix with suvmax of 26.9 . there were multiple hypermetabolic lymph nodes in the pelvis and retroperitoneum ( figure 2 ) . transverse unenhanced t1-weighted image ( a ) showed an inhomogeneous hypointense mass ( arrows ) in the uterus . corresponding transverse diffusion - weighted imaging ( b ) showed peripheral hypointensity of the mass . saggital t2-weighted mr image ( c ) showed the mass ( arrows ) involved both the endomerium and myometrium , resulting in diffuse enlargement of the uterus . this mass showed relative hypointensity compared to the surrounding myometrium . on transverse ( d ) , coronal ( e ) , and saggital ( f ) enhanced t1-weighted images , this mass showed lower enhancement ( arrows ) than the surrounding myometrium . maximum intensity projection pet ( a ) showed intense fdg uptake of the enlarged uterus ( arrow ) and multiple hypermetabolic lymph nodes ( arrowheads ) in the pelvis and retroperitoneum . transverse ct ( b , c ) , corresponding pet ( d , e ) , and fused ( f , g ) images showed intense fdg uptake in the thickened wall of the uterine corpus ( arrows ) and cervix ( arrowhead ) with suvmax of 26.9 . ct = computed tomography , fdg = fluorodeoxyglucose , mri = magnetic resonance imaging , pet = positron emission tomography . microphotograph revealed diffuse myometrial infiltration by small round tumor cells with multifocal coagulative necrosis ( figure 3a ) . the tumor cells were positive for cd2 , cd3 ( figure 3b ) , cd43 , and lat , and negative for cd19 and cd20 . the imaging and pathologic findings were consistent with primary peripheral t - cell lymphoma of the uterus ( stage , ii e ) . after 3 circles of chemotherapy , a follow - up mri showed decreased thickness of the uterine wall ( figure 4 ) . histopathology at higher magnification ( a , hematoxylin - eosin , original magnification 400 ) revealed diffuse myometrial infiltration by small round tumor cells . the tumor cells were positive for cd3 staining ( b , original magnification 400 ) . a follow - up enhanced t1-weighted image showed decreased thickness of the uterine wall after 3 circles of chemotherapy .",
"primary uterine non - hodgkin 's lymphomas are extremely rare accounting for < 1% of all extranodal non - hodgkin 's lymphomas . the mean age of patients with primary uterine non - hodgkin 's lymphoma at presentation is 55 years and abnormal uterine bleeding is the most frequent complaint . the combination of chemotherapy and irradiation is the most effective treatment regimen for uterine lymphomas . on mri , diffuse enlargement of the uterus , relatively homogeneous signal intensity , and multinodular growth pattern are helpful for diagnosing uterine lymphoma . in this case , on t2-weighted mr images , the tumor showed relative hypointensity compared to the surrounding myometrium , which may be due to the hypercellularity and less necrosis of the tumor . on diffusion - weighted imaging , the tumor showed remarkable hyperintensity indicating marked restricted diffusion of the water molecules due to the dense microstructure . on enhanced t1-weighted mr images , the tumor showed lower enhancement than the surrounding myometrium , which may be due to the minimal tumor angiogenesis and destroying of the normal uterine vessels . mri may be helpful for the differential diagnosis between uterine lymphoma and uterine leiomyosarcoma or abscess . unlike uterine lymphoma , hemorrhage and necrosis are common in uterine leiomyosarcoma . therefore , uterine leiomyosarcoma commonly manifests as a large infiltrating myometrial mass with heterogeneous hypointensity on t1-weighted mr images , and intermediate - to - high signal intensity with central hyperintensity on t2-weighted mr images . uterine abscesses commonly show high - signal intensity on t2-weighted mr images , which is different from relative hypointensity of uterine lymphoma . fdg pet / ct may be useful for detection , staging , and treatment evaluation of uterine lymphoma . high - grade uterine lymphomas usually show intense fdg uptake , whereas the low - grade ones show lower fdg uptake . therefore , fdg pet / ct may be helpful for assessment of the tumor grade . this case indicates uterine lymphoma should be included in the differential diagnosis of abnormal uterine fdg accumulation along with physiological endometrial uptake , postpartum uterus , adenomyosis , endometrial hyperplasia , leiomyoma , cervical cancer , endometrial cancer , choriocarcinoma , uterine sarcoma , and uterine metastasis . in conclusion , primary uterine non - hodgkin 's lymphoma should be taken into consideration when a uterine tumor shows large size , relative hypointensity on both t2-weighted images and enhanced t1-weighted images compared to the surrounding myometrium , and intense fdg uptake on pet / ct .",
"ethical approval was obtained from the ethics committee of changhai hospital , shanghai , china . written informed consent was obtained from the patient for publication of this case report and any accompanying images ."
] | abstractprimary uterine non - hodgkin 's lymphoma is extremely rare accounting for < 1% of all extranodal non - hodgkin 's lymphomas . imaging findings of primary uterine lymphoma have rarely been reported before . we present magnetic resonance imaging ( mri ) and fluorine-18-fluorodeoxyglucose ( 18f - fdg ) positron emission tomography ( pet)/ct findings in a patient with primary uterine peripheral t - cell lymphoma.a 27-year - old female presented with intermittent fever with neutropenia for 7 months . mri showed an ill - defined mass involved both the uterine corpus and cervix , resulting in diffuse enlargement of the uterus . this mass showed inhomogeneous hypointensity on unenhanced t1-weighted images , hyperintensity on diffusion - weighted imaging , relative hypointensity compared to the surrounding myometrium on t2-weighted images and lower enhancement than the surrounding myometrium on enhanced t1-weighted images . fdg pet / ct showed intense fdg uptake in the thickened wall of the uterine corpus and cervix with suvmax of 26.9 . there were multiple hypermetabolic lymph nodes in the pelvis and retroperitoneum . uterine curettage and ct - guided biopsy of the uterine mass revealed peripheral t - cell lymphoma . bone marrow biopsy revealed no evidence of lymphomatous involvement . the imaging and pathologic findings were consistent with primary uterine lymphoma . after 3 circles of chemotherapy , follow - up enhanced mri showed decreased thickness of the uterine wall.despite its rarity , primary uterine non - hodgkin 's lymphoma should be taken into consideration when a uterine tumor shows large size , relative hypointesity on both t2-weighted images and enhanced t1-weighted images compared to the surrounding myometrium , and intense fdg uptake on pet / ct . mri may be helpful for describing the relationship between the tumor and adjacent structures . fdg pet / ct may be useful for tumor detection and staging . |
[
"an early cross - sectional study of mild hypertension reported that the predominant hemodynamic feature was a high cardiac output and this observation has been confirmed consistently since . although not invariably so , the high cardiac output is accompanied by an increased heart rate and several studies have demonstrated that when oxygen consumption is measured , both cardiac output and this parameter are raised . in the mild early stages of essential hypertension the peripheral resistance is low although the crucial point is that it remains appropriately high for the corresponding cardiac output . a 20-year longitudinal study of the haemodynamics of essential hypertension , confirmed the finding of initially increased cardiac index heart rate oxygen consumption and blood pressure with normal peripheral resistance . however , over this period the high cardiac index and normal total peripheral resistance pattern changes to a low cardiac index high resistance pattern . again , the inappropriately high level of vascular resistance for the increase in cardiac output is a hallmark of early hypertension . such a haemodynamic profile could be ascribed to a high sympathetic nervous tone with the resulting increased drive to the heart , peripheral circulation and metabolic receptors , which would then promote enhanced oxygen consumption . other studies demonstrated that autonomic blockade of the heart in mild hypertensive patients restored cardiac output to normal and there was a combination of increased sympathetic tone and decreased parasympathetic activity in such individuals [ 4 , 5 ] . this combination of increased sympathetic discharge coupled to a reduced parasympathetic activity suggests that the abnormality in essential hypertension is one of integrated function in the medulla oblongata . recent data have proposed that this might be a consequence of neurovascular compression on the left ventrolateral medulla . therefore it should follow that the resulting increased sympathetic activity would be distributed to all innervated organs and vascular beds producing uniform vasoconstriction and the predicted cardiac indices . there is evidence for this in the heart , kidney and skeletal muscle but it has not been confirmed in studies of the hepatomesenteric circulation . in other words , it is difficult to provide evidence for a ubiquitous abnormality of sympathetic function in all vascular beds although the overall integrated haemodynamic profile can be ascribed to increased sympathetic discharge .",
"since the work of bright and johnson it has been recognized that the walls of medium - sized arteries are thickened in hypertension . however , it has to be conceded that their contribution to vascular resistance is small . the histopathological change appears to be hypertrophy , and indeed the heart and medium - sized blood vessels demonstrate this hypertrophic response to blood pressure . in addition , until the heart dilates it is of interest to note that the hypertrophic response takes place at the expense of the ventricular cavity : in other words there is inward encroachment on the chamber space . therefore in any form of sustained hypertension there is an alteration in the architecture of the circulation that inevitably occurs in consequence . at the level of the resistance artery where the internal diameter of the blood vessels is around 250 m or less , there is evidence of a reduced lumen diameter and increased media thickness : lumen diameter ratio . this was originally reported in necropsy specimens and subsequently confirmed in segments of artery mounted as isometric ring preparations on wires and in vessels perfused in vitro . detailed histological analyses more recently carried out have suggested that eutrophic inward remodelling occurs at this point in the circulation ( fig . it is meant that there is a narrowing of the vascular lumen without having to invoke a growth response of the arterial wal1 . a small amount of hypertrophy may be observed in some pathological states where hypertrophy may supervene and is an adverse prognostic sign . a cartoon representation of small arteries in transfer section . the number of smooth muscle cells in both arteries is the same as is their size indicating that there is no hypertrophy but the cells have re - orientated themselves and as a result produced an increased number of smooth cell layers and decreased the external and internal diameters of the vessel . the most compelling issue is whether structural changes in these small blood vessels occur before blood pressure rises or in consequence of the hypertension ? the corollary of what has been described above , namely the existence of excessive sympathetic nervous activity in the early stages of the development of hypertension being the trigger for the majority of this disorder then it is tempting to regard the small artery as changing shape in consequence . in a study of small artery structural characteristics in first degree offspring of hypertensive patients , in whom one would predict an increasing propensity to developing hypertension , there was no evidence of any alteration despite mean blood pressures being higher . also , in another study in young genetically hypertension - prone spontaneously hypertensive rats ( shr ) , where non - constricting ligatures were placed on the iliac artery and the animals allowed to mature until a point when the ligature compressed gradually on the vessel , the pressures in the hind limb were kept low and structural changes were not observed . however , most recently it has been reported that mice mutant for emilin 1 , a cysteine - rich secreted glycoprotein expressed in the vascular tree , display hypertension , increased peripheral vascular resistance and reduced blood vessel size . emilin 1 inhibits tfg- signalling by binding specifically to protgf- precursor and prevents its maturation by furin convertases in the extracellular space . therefore in this model the other important issue to consider at this time is whether structural alterations amplify vasoconstrictor responses ? korner and angus developed a theory with respect to the role of an increased wall : lumen ratio in the resistance vasculature , which maintains the elevated peripheral resistance in hypertension . this is based on calculating resistance from pressure and flow recordings and consequently calculating an arbitrary radius from the fourth route of 1/r ( poiseuille s law ) . the calculations indicate a constant narrowing in vessel radius from maximal dilatation to maximal constriction in hypertension , which acts to amplify changes in resistance . a number of studies has consistently reported structural changes predicted and described above in small arteries with an internal diameter between 200 and 300 m from patients with essential hypertension and in various animal models with the disease . however , direct supporting evidence needs the measurement of the lumen diameter of blood vessels demonstrated to contribute to the control of resistance in a vascular bed but under extremely rigorous conditions . in this context particular emphasis this has been carried out using studies of functional and structural characteristics of small mesenteric arteries cannulated and pressurized in vitro . such arteries have spontaneous myogenic tone at physiological pressures , which is a major determinant of diameter in the resistance vasculature unlike the upstream mesenteric arteries frequently studied in hypertension research . distal mesenteric arteries were pressurized to 63% of the mean aortic pressure of each rat . it is the pressure recorded at this level of the mesenteric / intestinal vasculature in both rat strains indicating a location within the resistance vasculature . in the absence of tone , however , with spontaneous myogenic tone , lumen diameter became identical in the two strains , and importantly remains identical as tone was increased throughout the complete noradrenaline concentration response curve . such data do not support the hypothesis of an increased wall lumen ratio acting as an amplifier in hypertension . studies in isolated segments of small artery or in isolated intact vascular beds can provide clear insights into basic mechanisms , which can only be considered as hypothesis generating regarding the relevance of a particular mechanism . surprisingly few studies have actually been carried out to date in intact conscious animals and overall the results are not consistent with an amplifier hypothesis . in a recent study , blood pressure and total peripheral resistance responses to infusion of the agonist phenylephrine at two rates at the development phase of hypertension in shr aged 826 weeks was compared with aged matched wistar kyoto rats before and after ganglionic blockade . at 16 weeks of age more complete dose total peripheral resistance responses to phenylephrine were significantly less in shr versus wky rats at all ages in the study . the higher infusion rate increased mean arterial pressure by approximately 80 mmhg and nearly doubled the tpr . in contrast , blood pressure and tpr responses to methoxamine were enhanced in shr in low rates of infusion but did not differ at the higher rates . assuming that methoxamine is the most specific agonist , these results are suggestive for functional rather than structural changes being contributory to the hyper - responsiveness to modest receptor stimulation . from a pathophysiological perspective , changes in tpr in response to low / modest stimulation appear to be a relevant parameter of tpr reactivity . more marked stimulation leading to 5- or 6-fold increases in tpr may lead to increased responsiveness but these are unlikely to be relevant for the maintenance or development of most hypertension . in other words , in vivo studies do not actually support the hypothesis that structural changes amplify vasoconstrictor responses throughout the circulation .",
"to understand how hypertension produces non - hypertrophic changes in small arteries , one must look at the physiological role of the resistance vasculature . at normal pressures , these vessels exhibit a level of contraction ( myogenic tone ) , which is independent of neurohormonal influences and in functioning in this way the response enables arteries to constrict or dilate in response to changes in upstream pressure . this process known as the myogenic response is only observed in smaller resistance arteries , which mediate autoregulation of blood flow and stabilize capillary pressure . this ensures that target organs downstream are supplied with oxygenated blood at a constant flow and pressure . hypertrophy is observed in vessels which do not possess myogenic tone whereas in smaller resistance arteries , initial increase in pressure will bring about an increased myogenic constriction . if an individual has untreated hypertension then there will be prolonged myogenic constriction as the resistance vasculature endeavours to protect the target organs downstream from pressure - induced damage brought about by an increase in blood flow . the structural difference between large conduit and medium - sized arteries and downstream resistance vessels is apparent in many models of hypertension : for example , in a hypertensive model brought on by chronic nitric oxide synthase inhibition . in addition , the magnitude and duration of an increase in intraluminal pressure plays a role in determining the remodelling response .",
"eutrophic inward remodelling is a process of structural adaptation observed in most forms of hypertension including the onset of hypertension and milder hypertensive states . however , a few animal models of hypertension , such as a model developing hypertension independent of the renin angiotensin system ( bph-2 mice ) , demonstrate hypertrophy as the predominating structural change . inward eutrophic remodelling is a relatively fast functional adaptation observed after prolonged vasoconstriction and is thought to be an energetically favoured mechanism to preserve a lumen diameter for long periods . the process is also the preferred physiological mechanism by which wall stress can be normalized while maintaining vasomotor tone . studies of the well - characterized tgr ( mren2 ) 27 rat which develops fulminant hypertension from 4 weeks of age have demonstrated that eutrophic inward remodelling occurs from 4 weeks and is dependent on the integrin av3 , a multifunctional extracellular matrix receptor . the extracellular matrix of resistance arteries is subject to tensile force exerted by blood pressure , which is transferred through integrins across the cell membrane and linked by molecular complexes to the cytoskeleton . using peptides and specific antibodies , it has been shown that integrins v3 and 51 indirectly regulate the myogenic response by influencing the control of calcium flow through ion channels ; 51 is responsible for the initial calcium influx required to establish vascular tone and v3 mediates force maintenance by calcium sensitization of contractile components . these integrins can form complexes , which regulate cytoskeletal dynamics and maintain a vascular myogenic force at a given pressure ( fig . cytoskeletal proteins such as heat - shock protein 27 activated by rhoa kinases have been shown to regulate myogenic tone . it is now clear that rhoa signalling plays a central role in both calcium sensitization and regulation of actin dynamics in small artery remodelling . these figures show a percentage control diameter of isolated arterioles exposed to step increments and intraluminal pressure before and after abluminal treatment with a control antibody anti - rat major histocompatibility complex . anti-5-integrin function blocking antibody or an anti-1-integrin function - blocking antibody , or anti-3-integrin function - blocking antibody . in both cases one can see the amelioration of the myogenic response in consequence implicating these two integrins in the control of myogenic tone ( data taken from ) . in contrast to molecular signalling mechanisms behind the vascular myogenic response relatively few data are available on the role of integrins and the underlying biochemical pathways of the next stage of vascular adaptation for hypertension . remodelling involves a migratory process following prolonged vasoconstriction whereby existing vascular smooth cells reposition themselves in the vascular wall and thereby produce a narrow lumen . a characteristic of migrating cells in vitro is the presence of lamealae podial and filopodial protrusions containing focal adhesion kinase which provide a substrate for other cytosolic proteins such as src and interact with actin - associated cytoplasmic components . recently it has been shown that the migration of vascular smooth muscle cells of arteries in vivo is more subtle and limited to elongation of tape in smooth muscle cells and an increase in cellular overlap . it is thought that cytoskeletal re - arrangements in subsequent force generation play a central role in these changes . integrin v3 is necessary for the pressure - induced inward remodelling process but the rest of the biochemical sensing mechanism is still uncertain . if the physiological response to a raised blood pressure in small arteries is eutrophic inward remodelling then the integrity of the circulation appears to be preserved until this breaks down . as indicated above in the tgr ( mren27 ) rat there is evidence of the development of vascular wall hypertrophy in small arteries from week 6 onwards . this rat model of hypertension develops a severe form of the disorder and indeed dams are unable to breed if they do not receive antihypertensive medication . therefore against this background it would appear that the breakdown of autoregulation ( at the myogenic tone ) is associated with the vascular wall developing a growth response ( hypertrophy ) in an attempt to offset the increased wall stress . recent work on the small blood vessels of patients with type 2 ( maturity onset ) diabetes mellitus has demonstrated that there is vascular wall hypertrophy . these patients were selected as already having evidence of downstream target organ damage because they demonstrated microproteinuria and their myogenic tone was disordered . in other words , the onset of hypertrophy is a consequence of disruption of normal myogenic tone and the delivery of blood at a higher perfusion pressure causing cellular damage . in the kidney , this would inevitably lead to a loss of filtration capability and protein leak . in terms of cardiovascular risk , recent data from italy have demonstrated that there is an increased risk of development of cardiovascular events in patients whose small arteries demonstrate hypertrophy rather than eutrophic inward remodelling ( figs 3 and 4 ) . it has been demonstrated that the myogenic response of the middle cerebral artery from pre - stroke spontaneously hypertensive stroke - prone rat ( shrsp ) are impaired compared with the shr . this observation would explain the deranged cerebral autoregulation that has been observed in the shrsp before stroke occurs . also this is associated with a re - distribution of collagen throughout the blood vessel wall . other studies have demonstrated that the myogenic component of renal autoregulation is impaired in the fawn hooded rat ( the tubuloglomerular feedback component of renin autoregulation is unchanged ) compared with controls thereby causing glomerular hypertension and hyperfiltration , which explains why the kidneys are susceptible to the deleterious effects of moderate hypertension . furthermore , the brown norway rat is normotensive but has a greater than normal life expectancy . however , when hypertension is induced , these animals have a high incidence of cerebral haemorrhage and mortality compared with the long evans rat . also the brown norway rat is very sensitive to hypertension - induced renal injury and recently the myogenic component of renal autoregulation has been found to be abnormal in normotensive brown norway rats . therefore it seems reasonable to speculate that the cerebral vessels from the brown norway animals exhibit weaker myogenic responses compared with cerebral vessels from wistar rats , which would explain the susceptibility of the brown norway rat to hypertension - induced cerebral haemorrhage . inhibition of the renin angiotensin system markedly delays the development of cerebral haemorrhage and mortality in salt - loaded shrsp [ 25 , 26 ] . in the fawn hooded rat early angiotensin - converting enzyme ( ace ) inhibition prevents renal damage and this protection is associated with a normalization of glomerular pressure . the protective effect of ace inhibition in the kidney has been presumed to be a consequence of an inhibition of angiotensin ii induced efferent arteriolar myogenic tone . of course it could be argued that the effects of blood pressure lowering would be important on stroke development and , in consequence , ace inhibition is working by its antihypertensive effects . however , dexamethasone or thyroxine increased blood pressure in the shrsp to a greater extent than salt loading but stroke does not occur . also , the anti - stroke effect of captopril on salt - loaded shrsp which occurs without an antihypertensive effect is unchanged when blood pressure is increased with dexamethasone . therefore it seems that the renin angiotensin system inhibition improves myogenic responses and survival in salt - loaded shrsp largely independent of changes in blood pressure although this remains to be confirmed . individuals with a medial lumen ration greater than the medium of 9.8% show a larger number of cardiovascular events compared with those with smaller wall thickening v ( data from ) . a further analysis of the data from reference 17 indicating that those individuals with marked vascular hypertrophy rather than eutrophic inward remodelling have an increased number of cardiovascular events ( data taken from ) .",
"there is little evidence to suggest that hypertension is associated with abnormalities of contractile function . both in vitro and in vivo studies have suggested that contraction is normal although there is controversy about whether the structural alterations in the vascular wall lead to exaggerated constriction and vascular amplification ( see above ) . this has been the subject of intense debate over a number of years although some work in intact animals really seems to suggest that vascular amplification seen in isolated vascular beds is not something which is observed when the whole of the circulation is integrated and examined . the problem with interpreting studies which have been published is that many other risk factors are often abnormal and accompany hypertension . for example , there is often associated dyslipidaemia and there is clear evidence that oxidized low - density lipoprotein ( ldl ) can reduce the bioavailability of nitric oxide and as a result of this there is evidence of abnormal endothelium dependent dilator function which has been reported in patients with high blood pressure and dyslipidaemia , patients with dyslipidaemia and coronary artery disease or the subcutaneous vasculature of patients with hypercholesterolaemia . in addition endothelial function is recognized to decline as individuals age and therefore it is obviously complex to dissect out whether endothelial function is abnormal as a result of hypertension per se or as a result of other demographic abnormalities and the cohorts being examined . the overall impression that one is left with is that it is the level of oxidized ldl that is important in the bloodstream of individuals with hypertension and that blood pressure per se is not responsible for endothelial dysfunction . with regard to improvement in endothelial function the use of statins has been demonstrated to restore endothelial integrity to near normal as soon as the cholesterol levels are improved . there is also evidence that the use of ace inhibitors or angiotensin receptor blockers can also ameliorate abnormal endothelial function . this is because hypercholesterolaemia is associated with an increased expression of a type 1 angiotensin receptor ( atl ) and that the binding of angiotensin ii to the atl receptor is associated with an increase in oxidative stress and a reduced bioavailability of nitric oxide . animal experiments have demonstrated that the use of angiotensin receptor blockers independent of their antihypertensive effect can be associated with an improvement in endothelial function and a reduction in plaque load throughout the vasculature . of course , longitudinal experiments in human beings are awaited but it is clear that endothelial function can be improved with the use of angiotensin receptor antagonists and ace inhibitors and recent studies have demonstrated in human beings that the combination of an angiotensin receptor blocker and a statin is an extremely powerful one for improving endothelial function .",
"the molecular basis of the physiological remodelling response to hypertension is slowly being understood . the replacement of eutrophic inward remodelling by a pathological change such as hypertrophy appears to herald the development of an increased risk of circulatory disease . future research should look at why this occurs and whether effective antihypertensive medication can reverse this and improve outcome for individual patients . the obvious attraction is that the identification of the , at risk patient will mean that scarce healthcare resource can be targeted at such individuals with maximum benefit in terms of circulatory protection . the challenge ahead is to identify those that are going to develop hypertrophic remodelling against a background of sustained high blood pressure and more indirect measurements of structural changes in blood vessels are urgently required .",
"the authors state that there is no conflict of interest with the view state in this paper ."
] | abstractit has been known for some considerable time that sustained hypertension changes the circulatory architecture both in the heart and blood vessels . the histopathological alterations are of considerable interest because once they have developed they appear to carry an adverse prognostic risk . in the heart it is apparent that there is hypertrophy . this extends also to the large- and medium - sized blood vessels but at the level of the smaller arteries that contribute to vascular resistance , this is not the case : it is clear that the physiological response to higher pressures is a change in the positional conformation of the pre - existing tissue constituents and as a result of this the lumen is narrowed . this brief review looks at our knowledge in this area and attempts to clarify our understanding of how hypertension brings these about and what happens when these homeostatic mechanisms break down . from a therapeutic perspective it appears imperative to control blood pressure in an attempt to reverse or prevent such alterations to cardiovascular structure . our knowledge is fast expanding in this field and it is only to be anticipated that as detection methodology improves everyday practice will alter as we profile our patients in terms of structural alterations in the ventricle and blood vessels . |
[
"annexin a2 ( a2 ) belongs to the annexin family of ca - regulated phospholipid binding proteins , which are expressed in plants , animals , and protists throughout the phylogenetic tree . a2 is a 36-kilodalton protein produced by endothelial cells , monocytes , macrophages , trophoblast cells , and some tumor cells and exists both free in the cytoplasm and in association with intracellular and plasma membrane surfaces [ 2 , 3 ] . the human anxa2 gene consists of 13 exons distributed over 40 kb of genomic dna on chromosome 15 ( 15q21 ) . among mammalian species for which a2 has been sequenced , identity is approximately 98% at the amino acid level . when a2 is membrane associated , the tightly packed , alpha - helical 33-kda core domain forms a disk whose convex face is associated with membrane phospholipid and whose concave face is oriented away from the membrane . membrane binding is mediated by at least two potential ca - binding annexin repeats , features common to all annexin family proteins . while the core domains of the annexin proteins are relatively well conserved , the hydrophilic amino - terminal tail or interaction domains are highly variable and essentially unique to each family member . protein s100a10 , also known as p11 , is a well - described binding partner of a2 [ 7 , 8 ] . as a member of the s100 family of proteins , p11 contains ca - binding helix - loop - helix motifs and confers increased phospholipid binding affinity on a2 . typical s100 proteins undergo a conformational change upon ca - binding that places helix iii ( hiii ) in a perpendicular orientation relative to helix iv(hiv ) , thus forming a cleft that can accept associated target proteins . this calcium activation rule , however , does not apply to p11 , which has permanently assumed a calcium - on state , due to replacement of the bidentate e by s , and the monodentate d with c . the published crystal structure of p11 in complex with the n - terminal 13 amino acids of a2 suggests that the basic unit of p11 structure is a noncovalently linked homodimer , each component of which can bind the a2 tail peptide to form a heterotetramer . upon binding , the a2 tail peptide assumes an -helical conformation that presents key hydrophobic residues ( v , i , l , and l ) within a cleft formed by loop l2 and helix hiv of one monomer and helix hi of the other . the c - terminal region of p11 , particularly its hydrophobic residues within the c - terminal extension ( yfvvhm ) , such as y and f , contributes critical contact points for binding to a2 . the primary fibrinolytic protease , plasmin , is formed upon cleavage of plasminogen at a single peptide bond at position r - v by either of two serine proteases , tissue plasminogen activator ( tpa ) , produced by vascular endothelial cells , or urokinase ( upa ) [ 1113 ] . tpa - dependent plasminogen activation is dramatically accelerated in the presence of fibrin , and to a lesser extent by cell surface fibrinolytic receptors . upar is expressed by monocyte / macrophages , tumor cells , and activated endothelial cells [ 14 , 15 ] , while the ( a2p11)2 complex is expressed on both resting and activated endothelial cells [ 16 , 17 ] . in addition , an interesting array of plasminogen - binding receptors , including -enolase , tata - box protein interacting protein ( tip49 ) , histone h2b , m2 integrin , amphoterin , and plg - rkt , have been identified on many cell types . on cell surfaces , the ( a2p11)2 complex serves as an assembly site for plasminogen and tpa [ 16 , 17 , 25 , 26 ] . although it is clear that heterotetramer - mediated colocalization of activator and substrate accelerates plasmin generation , there are , interestingly , two main theories as to the exact site of interaction of plasminogen and tpa with components of the heterotetramer complex . while one group suggests p11 as the key ligand interaction site and annexin a2 as the molecule that anchors it to the plasma membrane , another proposes annexin a2 , in complex with p11 , as the ligand binding site . a third group has suggested that , in the context of the cell surface and its proteolytic milieu , both annexin a2 and p11 may have exposed lysine residues that are accessible to the lysine binding kringle domains of both tpa and plasminogen . translocation of a2 to the outer leaflet of the plasma membrane of the endothelial cell is a key regulatory step governing vascular fibrinolysis [ 16 , 17 ] . although cell surface appearance of a2 has been linked to plasma membrane fusion of multivesicular bodies in nih 3t3 fibroblasts , and as a consequence of membrane disruption upon exocytosis of secretory granules in chromaffin cells , it is not clear whether similar mechanisms apply to the endothelial cell . endothelial cell translocation , which can occur within minutes , is initiated by several factors including heat stress , thrombin stimulation , and hypoxia [ 3032 ] and is known to require the presence of adequate p11 as well as src kinase phosphorylation at y. a2 was originally identified as a src kinase substrate , and translocation is driven by activation of pp60src . translocation of a2 to the cell surface is dependent upon the abundance of p11 . in the endothelial cell , p11 is stabilized by a2 , which , upon binding , masks a critical degron , or polyubiquitination site on p11 . in the absence of sufficient a2 , p11 is polyubiquitinated and targeted to the proteasome for degradation . in anxa2 mice , which demonstrate low to nondetectable p11 expression , treatment with bortezomib , a proteasome inhibitor , restored p11 expression , verifying its regulation via a proteasome - linked pathway in vivo . in nonendothelial cells , p11 may be stabilized by one or more of its other partner proteins , which include a number of transmembrane channels and membrane receptors , such as the tetrodotoxin - resistant sodium channel nav1.8 , the two predomain k channel task-1 , the acid - sensing ion channel asic1a , the transient receptor potential channels trp5 and trp6 , and the 5ht-1b serotonin receptor . protein kinase c-(pkc- ) mediated phosphorylation of s or s residues on a2 appears to represent an additional regulatory pathway . serine phosphorylation within the tail domain of a2 dissociates the heterotetramer complex , preventing further translocation to the cell surface by allowing polyubiquitination of p11 and its degradation in the proteasome [ 40 , 41 ] . this event appears to be initiated by plasmin , which , once generated , signals activation of conventional pkc and thus limits its own generation . this mechanism appears to require cleavage of a2 by plasmin as well as activation of toll - like receptor 4 . in this paper , we summarize evidence from both animal models and human studies on the in vivo functions of the annexin a2/s100a10 system . the concept of the annexinopathy was first proposed in 1999 , and expanded in several subsequent reviews [ 4347 ] . here , we focus exclusively on the growing body of evidence that annexin a2 and its partner protein p11 contribute to human health and disease .",
"the anxa2 mouse has been highly informative in investigating the role of the annexin a2 system in vascular homeostasis in vivo . although a2-deficient mice display normal development , fertility , and lifespan , fibrin accumulation is evident in both intravascular and extravascular locations within the lungs , spleen , small intestine , liver , and kidney ( figure 1 ) . microvascular endothelial cells isolated from anxa2 mice , moreover , lack the ability to support tpa - dependent plasmin generation in vitro , and arterial injury in vivo leads to an increased rate and severity of vascular occlusion in the anxa2 mouse . recently , fibrinolysis was also assessed in p11-null mice , which also displayed increased vascular fibrin , reduced clearance of thrombi , and impaired neovascularization of matrigel thrombi . interestingly , mice with diet - induced hyperhomocysteinemia share this phenotypic feature with the anxa2 mouse ( figure 1 ) . homocysteine ( hc ) is a thiol - containing amino acid that is generated during the conversion of methionine to cysteine . elevated levels of circulating hc have been associated with both thrombotic and atherosclerotic vascular disease , although therapies that lower plasma hc have not been shown to reduce the risk of recurrent cardiovascular disease . pretreatment , but not cotreatment , of endothelial cells with hc blocks their ability to bind tpa and inhibits endothelial cell - related , tpa - dependent plasminogen activation . incubation of purified a2 with hc , moreover , interferes with its ability to bind tpa . when wild type mice were subjected to diet - induced hyperhomocysteinemia , fibrin accumulated in multiple tissues ( figure 1(d ) ) , and extracted a2 failed to support tpa binding or tpa - dependent plasmin generation , revealing that hc - induced blockade of the cell surface a2 pathway can occur in vivo . the potential clinical utility of recombinant annexin a2 protein ( ra2 ) in ischemic stroke has emerged from thrombosis models in rats . animals were treated with low - dose tpa with or without ra2 at 2 or 4 hours following the initiation of focal embolic stroke . those receiving both agents had a significantly lower infarct size and greater cerebral blood flow compared to animals treated with low - dose tpa alone . in similar experiments , in which animals underwent middle cerebral artery embolization with autologous clot , pretreatment with ra2 not only improved blood flow but also reduced infarct size compared to saline - treated controls . these findings are significant in view of reported neurotoxicity and cerebral hemorrhage associated with the use of tpa in the treatment of thrombotic stroke in humans [ 5759 ] . thus , ra2 or related agents may constitute a useful adjunct to tpa alone for the restoration of cerebral blow flow . a2 or its analogs might also prove efficacious in the treatment of peripheral arterial occlusion . when carotid artery thrombosis was induced by adventitial application of fecl3 , administration of recombinant full length , but not truncated , a2 was associated with improved cerebral blood flow and reduced thrombus size in comparison with untreated control animals . this treatment had no effect on bleeding time , prothrombin time , or activated partial thromboplastin time , indicating that global clotting parameters remained intact . thus , a2 or its analogs may constitute a useful adjuvant to conventional thrombolytic treatment by reducing the effective dose of tpa , thereby limiting its potential toxicity . the fibrinolytic system appears to modulate the development of plaque - like vascular lesions in mouse models of atherosclerosis in a complex fashion . mice deficient in both plasminogen and apolipoprotein e ( apoe ) , for example , display an enhanced tendency toward atherosclerosis compared to those lacking apoe alone , suggesting that plasminogen protects against lesion formation . on the other hand , when macrophages overexpressed upa in apoe mice , plaque development was accelerated through a plasminogen - dependent pathway . when apoe deficiency is combined with global deficiency of either upa or tpa , however , the predilection for early fatty streaks and advanced plaque development was similar to that seen in mice with isolated apoe deficiency . these data suggest that the fibrinolytic system acts at multiple levels in the regulation atherogenesis . in order to determine whether blocking plasmin(ogen ) binding to a2 on the surface of macrophages is an effective strategy to reduce the development of atherosclerosis , apoe mice were crossed with anxa2 mice to generate double nulls ( figure 2 ) . following weaning , apoeanxa2 mice were placed on a western chow diet ( 30% fat ) and sacrificed at 12 or 24 wks . aortas were removed and evaluated for lesion development by en face oil red o staining and morphometry of histologic sections taken through the aortic root at the base of the heart . there was no difference in en face lesion area or lesion size in apoeanxa2 mice as compared to apoeanxa2 mice . therefore , we conclude that the redundant nature of plasmin(ogen)-binding sites on macrophages renders targeting a single binding site ineffective in modulating lesion development in this model system . although embryonic vasculogenesis appears to be normal , anxa2 mice display diminished neovascularization in several in vivo assays , including matrigel implant , corneal pocket , and oxygen - induced retinopathy ( oir ) models . mice with diet - induced hyperhomocysteinemia also display impaired corneal neoangiogenesis , which can be corrected upon intravenous injection of recombinant annexin a2 . microvascular endothelial cells from anxa2 mice , as well as hc - treated human endothelial cells , moreover , migrate less efficiently in growth factor - enriched matrigel . together , these data suggest that absence of a2 , or its modification by hc , leads to impairment of angiogenesis - related endothelial cell function . interestingly , annexin a2 is upregulated in oir ( figure 3 ) . in this model , newborn mouse pups are transitioned to room air after 5 days in a 75% oxygen environment , whereupon relative hypoxia initiates a robust vascular proliferative response in the retina . the return to 21% oxygen also triggers a2 synthesis out of proportion to the increase in vascular endothelial cell abundance . a2 expression is also increased in the endothelial cell under true hypoxia through the direct action of hypoxia - inducible factor-1 ( hif-1 ) with the a2 promoter . electrophoretic mobility shift experiments , chromatin immunoprecipitation studies , and luciferase promoter reporter assays all indicate binding of hif-1 and hif-1 to a hypoxia - responsive element within the promoter region of the human a2 gene , leading to its activation . although oir - associated retinal neovascularization is impaired in the anxa2 mouse , it can be reestablished upon treatment of anxa2 mice with a subretinal injection of an a2-encoding adenovirus , which restores a2 expression . in addition , neovascularization of the hyperoxia - treated anxa2 retina can be repaired upon treatment with the defibrinating agent ancrod , which depletes fibrinogen , thereby preventing fibrin formation . together , these findings provide a link between fibrin accumulation and diminished neoangiogenesis and imply that new therapeutic avenues for proliferative retinal vascular disorders , such as retinopathy of prematurity or diabetic retinopathy , could involve blockade of a2 in addition to inhibition of angiogenic growth factors . in the central nervous system , glioblastomas , malignant tumors derived from glial cells , are usually highly aggressive and refractory to treatment due to the early development of widespread infiltrative loci . glioma - generated proteases , such as plasminogen activators and matrix metalloproteinases , contribute substantially to glioma cell invasion [ 67 , 68 ] . high concentrations of annexin a2 , similarly , are associated with the pseudopodia of invasive glioma cells , and knockdown of a2 reduces their migratory capacity in vitro . in both mouse and rat in vivo models , stable knockdown of a2 expression in glioblastoma cells retarded overall tumor progression upon implantation of the cells into rodent brains ; cellular invasion , proliferation , apoptosis , and angiogenesis interestingly , when a2 expression was stably reduced by transfection of rnai directed against a2 in rat gl261 glioma cells , tumor growth and invasiveness were reduced , even though p11 expression persisted ; this result indicated that the contribution of a2 to tumor invasiveness was p11 independent ( figure 4 ) . these data suggest that a2-directed treatment could offer a new therapeutic modality for human glioblastoma . in a xenograft model in which highly invasive and metastatic breast cancer cells were implanted into nude mice , both tumor growth and vascular density the tumor cells employed in this experiment expressed abundant a2 , strongly supported tpa binding and tpa - dependent plasmin generation and exhibited plasmin- and a2-dependent cellular matrix invasion [ 72 , 73 ] . these studies suggest that a2 may contribute to aggressive breast cancer cellular invasion and tumor angiogenesis through production of localized protease activity . in a third in vivo model , growth of lewis lung and t241 sarcoma tumors implanted into p11-deficient mice impaired tumor growth was correlated with diminished macrophage density within the tumors , and clodronate - mediated depletion of macrophages in wild type mice led to a similar reduction in tumor size . this study recapitulates the finding that thioglycollate - induced macrophage invasion into the peritoneum , and macrophage invasion of subcutaneous matrigel plugs , were also impaired in the p11 knockout mouse . a related study reveals that soluble ( a2p11)2 tetramer activates human and murine monocyte - derived macrophages , that this activation requires toll - like receptor 4 ( tlr-4 ) , and that the tetramer modulates cytokine production in the macrophage . thus , tumor infiltration by macrophages may in part be due to ( a2p11)2 tetramer signaling . nevertheless , aseptic osteolysis , due to generation of wear debris particles ( wdp ) , is an emerging problem that leads to failure of 1030% of all joint replacements . alkane polymers , 812 carbon atoms in length and derived from the breakdown of wdp , bind directly to toll - like receptors 1 and 2 and activate the downstream signaling pathway . in addition , endocytosed wdp can induce endosomal membrane damage and disruption in phagocytic cells , and this process is associated with dramatic recruitment of cytoplasmic annexin a2 to the endosomal membrane ( figure 5 ) . in the absence of a2 , endosomal disruption leads to leakage of lysosomal cathepsins and h ions into the cytosol with subsequent activation of the nlrp inflammasome and an accelerated inflammatory response . a large body of work has focused on the role of p11 in neuropsychiatric function . p11 binds to both the serotonin 1b and serotonin 4 receptors , suggesting a role for p11 in regulation of mood . p11-deleted mice show depression - like behavior , characterized by increased immobility in the tail suspension test , increased thigmotaxis , and decreased responsiveness to a sucrose reward . in wild type mice , adenovirus - mediated deletion of p11 specifically within the nucleus accumbens ( na ) resulted in depressive behavior , indistinguishable from that seen in mice with global p11 deficiency ; exogenous administration of p11 within the na of p11-deleted mice restored normal behavior . these data correlate with findings in human depression , in which p11 protein levels were reduced in the na . furthermore , reduced p11 mrna levels in peripheral blood mononuclear cells may serve as a potential biomarker for patients at high risk of suicide . these studies raise the possibility that some forms of human depression may be reversible by augmentation of p11 expression . indeed , commonly used anti - inflammatory drugs that attenuate the antidepressive effects of serotonin reuptake inhibitors may do so by inhibiting the effects of interferon , a known inducer of p11 [ 82 , 83 ] . the tetrodotoxin - resistant sodium channel ( nav1.8/sns ) , whose expression is restricted to sensory neurons , is the major pain perception receptor and is expressed in 85% of neurons emerging from the dorsal route ganglia . p11 binds to the amino terminus of the nav1.8 protein and promotes its translocation to the plasma membrane to produce functional channels . deletion of p11 specifically in primary nociceptor sensory neurons was achieved using nav1.8 promoter - directed cre recombinase and led to a loss of tetrodotoxin - resistant sodium current density , and severe compromise of noxious coding in sensory neurons from the dorsal root horn . thus , directed p11 targeting may prove useful in the treatment of refractory pain disorders .",
"at diagnosis , acute promyelocytic leukemia ( apl ) is commonly associated with life - threatening hemorrhage . in apl , clonal expansion of immature promyelocytes harboring a balanced chromosomal translocation ( t(15 ; 17)(q2224 ; q1221 ) ) gives rise to the transcriptionally active promyelocytic leukemia - retinoic acid receptor ( pml - rar ) fusion protein . apl frequently responds to differentiation therapy with all - trans retinoic acid ( atra ) , which triggers degradation of pml - rar . while disseminated intravascular coagulation promotes coagulopathy in apl , consumption of the plasmin inhibitor alpha2-antiplasmin and development of a hyperfibrinolytic state due to excessive plasmin generation high - level expression of annexin a2 occurs specifically in apl blast cells ( figure 6 ) . a2 was detected in blast cells recovered from 6 of 6 apl patients , all of whom had evidence of hyperfibrinolysis , as evidenced by elevated circulating fibrin degradation products and d - dimer and depletion of plasma fibrinogen . nb4 cells , which carry the t(15 ; 17 ) translocation and express the pml - rar fusion protein , displayed steady state a2 mrna levels that were approximately 10-fold higher than those found on leukemia cells that lacked the fusion protein . treatment of nb4 cells with the retinoic acid receptor ligand , all - trans retinoic acid ( atra ) , attenuated a2 expression in a time frame associated with clinical resolution of bleeding . intracranial bleeding , an unusually frequent problem in apl , may be due to the relatively high level expression of the a2 system on cerebral microvascular endothelial cells compared to those of other vascular beds . elevated expression of p11 in nb4 cells was also recently demonstrated and shown to respond to treatment with atra . in a second clinical study , a cohort of 26 patients were studied prospectively and found to have enhanced fibrinolysis at diagnosis , despite normal tpa levels and increased pai-1 . apl cells harvested from these subjects expressed 3-fold higher levels of a2 , and their rate of tpa - dependent plasmin generation was similarly elevated over that seen in the presence of m1 , m2 , m4 , or acute lymphoblastic leukemia cells . both elevated a2 expression in blast cells and hyperfibrinolytic hemorrhage corrected in 23 patients upon treatment with differentiation therapy , consisting of all - trans retinoic acid ( atra ) or atra plus arsenic trioxide . this study confirms the role of the a2 system in fibrinolytic bleeding in patients with apl . expression levels of annexin a2 have been examined in a variety of human malignancies . in some , such as renal cell [ 9092 ] , gastric , prostate , pancreatic , breast carcinoma , and osteogenic sarcoma , increased expression levels appear to correlate with higher histologic grade and/or development of distant metastases . in human glioblastoma , a2 expression correlates with histologic grade and cns dissemination [ 49 , 9799 ] . in human breast cancer , a2 appears to be associated with the surface of invasive , malignant cells , but not normal ductal or acinar epithelial cells , and expression correlated with neoangiogenic activity . proteomic profiling of colorectal cancer , moreover , revealed differentially increased expression of a2 in tumors that had progressed to lymph node metastases versus localized tumors . primary multiple myeloma cells harvested from a cohort of patients displayed 10-fold higher cell surface a2 expression than that observed on normal plasma cells ; silencing of a2 in related cell lines suppressed expression of proangiogenic genes . a2 and a related a2-binding receptor has been reported to promote myeloma cell adhesion and growth in the bone marrow . on the other hand , a2 expression in oral squamous cell carcinoma or sinonasal adenocarcinoma these studies suggest that expression levels of a2 may have prognostic value in malignancy , but would need to be validated for each specific tumor . high levels of both p11 and a2 were found in 100% of anaplastic thyroid carcinomas , and correlated with their aggressive behavior . in a comprehensive study of s100 gene expression in over 300 primary breast cancers , both p11 ( s100a10 ) and s100a11 were selectively upregulated in basal versus nonbasal breast cancer subtypes , but did not predict overall survival . among 62 cases of human esophageal squamous cell carcinoma , 11 of 12 s100 genes , including p11 , were downregulated , based on reverse transcription - polymerase chain reaction assays . p11 transcripts have also been reported to be increased in both renal cell and gastric carcinomas [ 92 , 108 , 109 ] . further studies may define p11 expression as a viable biomarker or prognostic indicator in selected tumors . it is characterized by thrombosis and recurrent fetal loss in association with circulating antiphospholipid antibodies . the latter are distinct , often coexisting antibodies directed against either 2-glycoprotein i or other intravascular proteins , which may be found in complex with anionic membrane phospholipids . a2 has been identified as a prominent target of autoantibodies arising specifically in patients with aps with severe thrombosis and/or pregnancy morbidity [ 112 , 113 ] . in vitro , patient - derived antiannexin a2 antibodies blocked endothelial surface tpa - dependent plasmin generation , and also activated cultured endothelial cells , inciting them to express elevated levels of the prothrombotic agent , tissue factor . other groups have noted that a2 can serve as a binding site for (2)-glycoprotein i in aps and can initiate a2-dependent endothelial cell activation . together , these data implicate a2 in the pathogenesis of aps - associated thrombosis through several possible mechanisms . cerebral venous thrombosis is a rare disorder of unknown etiology that mainly affects children and young adults . among a cohort of 40 consecutive patients studied 2 to 6 months following the index thrombotic event , 12.5% were found to have high titer anti - a2 antibodies compared to 2.1% in healthy subjects . thus , anti - a2 may define a new subset of individuals with immune - mediated thrombosis , play a role in the pathogenesis of this disorder , and/or offer novel therapeutic targets . both a2 and p11 are expressed on the brush border of the placental syncytiotrophoblast . in 60 patients with preeclampsia , a2 mrna and protein levels in placenta high titer anti - a2 antibodies , moreover , were detected more frequently in sera from subjects in the pre - eclamptic group and associated with increased placental vascular thrombosis . impaired local fibrinolytic function due to blunted a2 expression may contribute to the pathogenesis of pre - eclampsia and maternal and perinatal infant morbidity . sickle hemoglobinopathy arises from a point mutation within the 6th codon of the human -globin chain . polymerization of abnormal hemoglobin under deoxygenating conditions induces erythrocyte shape change and non deformability , which leads to vascular occlusion , impaired vasodilatation , distal ischemia , and endothelial cell activation with adhesion of leukocytes . in children a recent analysis of 108 single nucleotide polymorphisms in 39 candidate genes revealed that variations in the annexin a2 ( anxa2 ) gene , among several others , were associated with increased risk of stroke . a second independent study linked anxa2 polymorphisms to increased risk for stroke in sickle cell disease , while additional anxa2 snps have been associated with avascular necrosis of bone ( osteonecrosis ) in sickle hemoglobinopathy . these data suggest that annexin a2 may represent a significant modifier gene that shapes the clinical expression and natural history of sickle cell disease ."
] | since its discovery as a src kinase substrate more than three decades ago , appreciation for the physiologic functions of annexin a2 and its associated proteins has increased dramatically . with its binding partner s100a10 ( p11 ) , a2 forms a cell surface complex that regulates generation of the primary fibrinolytic protease , plasmin , and is dynamically regulated in settings of hemostasis and thrombosis . in addition , the complex is transcriptionally upregulated in hypoxia and promotes pathologic neoangiogenesis in the tissues such as the retina . dysregulation of both a2 and p11 has been reported in examples of rodent and human cancer . intracellularly , a2 plays a critical role in endosomal repair in postarthroplastic osteolysis , and intracellular p11 regulates serotonin receptor activity in psychiatric mood disorders . in human studies , the a2 system contributes to the coagulopathy of acute promyelocytic leukemia , and is a target of high - titer autoantibodies in patients with antiphospholipid syndrome , cerebral thrombosis , and possibly preeclampsia . polymorphisms in the human anxa2 gene have been associated with stroke and avascular osteonecrosis of bone , two severe complications of sickle cell disease . together , these new findings suggest that manipulation of the annexin a2/s100a10 system may offer promising new avenues for treatment of a spectrum of human disorders . |
[
"",
"pregnancy in patients with end - stage renal disease ( esrd ) is rare , and kidney disease before pregnancy is associated with poor fetal outcome . however , the outcome of pregnancy in dialysis patients has been much improved , and the overall rate of successful fetal outcome is reported to be 76% ( 1 ) . this is mainly due to a multidisciplinary approach that incorporates intensive dialysis and aggressive management of anemia and hypertension . autosomal dominant polycystic kidney disease ( adpkd ) is the most common inherited renal disease , and approximately half of the patients progress to esrd by age of 60 ( 2 ) . with regard to pregnancy , fertility is not affected by adpkd in patients with normal renal function ( 3 , 4 ) . however , as kidney cysts grow , hypertension and deterioration of kidney function develop , which adversely affect pregnancy . in addition , massively enlarged kidneys may occupy the abdominal and pelvic cavities , preventing the normal growth of placenta and fetus . we present a case of successful pregnancy in an adpkd patient on hemodialysis ( hd ) .",
"she started hd 3 times a week after 3 yr of her initial diagnosis . at the time of presentation , she was normotensive and had been prescribed aspirin ( 100 mg daily ) , multivitamins , calcium - based phosphate binders , and erythropoietin ( 1,000 units every hd session ) . her dry weight was 53.3 kg and interdialytic weight gain was 1.5 - 2.5 kg . she was confirmed to be 8 weeks pregnant by pelvic ultrasound and beta - hcg test . the physical examination revealed a blood pressure ( bp ) of 137/85 mm hg and a regular heart rate of 107 beats per minute . laboratory findings at presentation were as follows : hemoglobin ( hb ) of 10.4 g / dl ; hematocrit ( hct ) 31.5% ; blood urea nitrogen ( bun ) 56.9 mg / dl ; serum creatinine ( cr ) 9.0 mg / dl ; total protein 5.9 g / dl ; serum albumin 3.7 g / dl ; serum calcium 9.3 mg / dl ; serum phosphorus 3.3 mg / dl ; potassium 5.5 mm / l ; and normal liver function . the computed tomography scan taken 2 yr ago showed bilaterally enlarged kidneys filled with numerous renal cysts along with only a few liver cysts ( fig . she was managed by a multidisciplinary team approach to optimize the patient and fetal outcomes . firstly , the risk of pregnancy in a dialysis patient and the need for intensive dialysis were discussed with her family . secondly , our team evaluated the risk of stunted intrauterine fetal growth by her massively enlarged kidneys . we considered a unilateral nephrectomy at the second trimester to secure the intraabdominal space , but the risk was determined to outweigh the benefits in this case . finally , genetic counseling about the fetus 's risk of inheriting adpkd and prenatal genetic diagnosis was provided but declined by the patient . at 10 weeks gestation , hd prescription was changed to 4-hr treatments 4 - 5 times a week , and a predialysis bun less than 50 mg / dl was targeted . throughout pregnancy , predialysis bun her bp was well controlled without any antihypertensive medication : systolic bp remained at 110 - 140 mmhg and diastolic was consistently at 60 - 80 mmhg . erythropoietin doses were adjusted to target a maternal hb between 10 - 11 g / dl . the median dose was 18,000 iu / week ( range , 5,000 - 26,000 iu / week ) during gestational weeks 12 - 36 . in addition , 100 mg intravenous iron sucrose was administered every session during gestational weeks 19 - 22 . the follow - up data of dry weight , predialysis bun and hb level are shown in fig . routine fetal karyotyping was performed at 16 gestational weeks , but mutation screening was not performed . at 34.5 weeks of gestation , the membrane ruptured during hd , and vaginal delivery was performed without any complications . she delivered a healthy female weighing 2,100 g. one week after delivery , the patient was hospitalized for 5 days because of postpartum cardiomyopathy .",
"previous studies suggested pregnancy in women with adpkd and normal kidney function can result in a favorable outcome . ( 3 ) studied fertility and pregnancy complications between patients with polycystic kidneys ( n=76 ) and a control group ( no polycystic kidney ) ( n=61 ) of women at risk of adpkd . they found no significant distinction between the 2 groups with regard to fertility , spontaneous abortion , stillbirth , or urinary tract infection ( 3 ) . another study showed that overall fetal complication rates were not significantly different between women with and without adpkd ( 4 ) . on the contrary , affected women with preexisting renal failure and hypertension developed various complications and were associated with poor fetal outcome . other risk factors for fetal complications include maternal age > 30 yr and development of preeclampsia ( 4 ) . landesman and sherr ( 5 ) suggested a classification of pregnant women with adpkd based on severity of renal disease . the patient in this case would be classified into group c , which refers to patients in renal failure secondary to advanced pkd . ( 6 ) first described a successful pregnancy in a patient with group c disease , and other cases have also been reported ( 6 - 9 ) . prophylactic hemodialysis was needed in 1 case ( 8) , and in another case series , we found a pkd patient who underwent nocturnal hd , which is seldom performed in korea ( 10 ) . with this background , we sought to determine the best way to secure fetal survival and a good maternal outcome . first , the management of ckd - related complications and the hd schedule were reviewed . pregnant women with a favorable outcome were found to have lower predialysis bun levels compared to those with adverse fetal outcomes ( 11 ) . it is recommended to increase the hemodialysis frequency ( usually 4 - 6 sessions / week ) to maintain a predialysis bun below 50 mg / dl ( 12 ) . this provides a less uremic environment for the fetus , allows better control of volume status and bp , and permits the mother a more liberal diet . it also reduces the risk of intradialytic hypotension , which may be associated with fetal distress and premature labor ( 12 ) . increasing the dialysis dose prolongs gestation , resulting in higher birth weights and a better chance of fetal survival ( 13 ) . hypertension is the most frequently reported maternal complication in hd patients , occurring in 42%-80% of women ( 14 ) . both the rate of fetal survival and birth weights were lower in hypertensive pregnant patients compared to normotensive patients . maternal dry weight and interdialytic weight gain should be regularly evaluated and adjusted according to changes in fetal growth ( 12 ) . a lower third trimester hematocrit was associated with risk of an adverse fetal outcome and low birth weight ( 11 ) . erythropoietin dose needs to be increased by approximately 50% in order to maintain a target hemoglobin level of 10 - 11 g / dl ( 13 ) . another important area of concern for adpkd patients is the mass effect of huge kidneys and/or a massive polycystic liver . this can cause chronic pain and compression of adjacent organs , resulting in indigestion , gastroesophageal reflux , malnutrition , and ascites ( compression of ivc or portal vein ) . although adpkd does not affect fertility , pregnancy in patients with large kidneys at an advanced stage of renal failure has not been reported . the patient in this case had a measured kidney volume of about 6 l which is 30-fold larger than normal . fortunately , the patient 's liver size was normal with only a few small cysts , and she had no symptoms related to a mass effect . moreover , abdominal muscles during pregnancy can adapt to increased space requirements by increasing the intra - abdominal volume under the influence of various hormones , such as relaxin . this case illustrates that even a very large kidney volume has no significant adverse effect on pregnancy . lastly , the risk of congenital anomalies and inheritance of mutant pkd genes should be evaluated . prenatal genetic diagnosis can be offered by obtaining fetal dna through chorionic villus sampling or amniocentesis . however , demand for prenatal diagnosis for elective abortion seems to be low , as in our case , and only 4% of women with adpkd would terminate a pregnancy if they knew the inheritance status ( 15 ) . although pregnancy remains risky in adpkd patients with esrd undergoing long - term hemodialysis , outcomes can be improved by optimizing management through a multidisciplinary team of nephrologists , obstetricians , and neonatal care specialists . intensified dialysis , proper anemia management , and improved preconception counseling is needed in all women on dialysis because most of the pregnancies reported were unplanned ."
] | recent advances in dialysis and a multidisciplinary approach to pregnant patients with advanced chronic kidney disease provide a better outcome . a 38-yr - old female with autosomal dominant polycystic kidney disease ( adpkd ) became pregnant . she was undergoing hemodialysis ( hd ) and her kidneys were massively enlarged , posing a risk of intrauterine fetal growth restriction . by means of intensive hd and optimal management of anemia , pregnancy was successfully maintained until vaginal delivery at 34.5 weeks of gestation . we discuss the special considerations involved in managing our patient with regard to the underlying adpkd and its influence on pregnancy.graphical abstract |
[
"a 78-year - old woman presented with weakness , fatigue and hemoglobin of 8.3 g / dl , to another clinic in september , 2009 , and she was given erythrocyte suspension replacement . she had regression in her existing complaints with blood replacement therapy , but after one month , same complaints reappeared with a low hemoglobin value and she was referred for further investigation to the outpatient clinic of hematology of our university faculty of medicine . her hematologic parameters ar that time were as follows : white blood cell count of 6390/mm , neutrophils 3785/mm , hemoglobin 8.1 g / dl , mean corpuscular volume ( mcv ) 95 fl , and platelets 211.000/mm . with the provisional diagnosis of myelodysplastic syndrome due to an isolated anemia unrelated to nutritional status , bone marrow aspiration biopsy was performed . her bone marrow aspiration showed normal cellularity ; and biopsy revealed increase in the number of megakaryocytes , signs of dismegakaryopoiesis , minimal dysplasia in erythroid series , and normal morphology in myeloid series . upon conventional cytogenetical studies she had been lost - to - follow up for approximately a year and during that time she had received a total of 4 units of erythrocyte suspension , and erythropoietin treatment was started . however , erythropoietin treatment discontinued because she did not respond to the maximum dose of 10.000 iu three times a week . she did not attend to her follow - up visits regularly and in the mean time she had transfusions monthly at another clinic . since her transfusion dependency increased , she was considered for lenalidomide treatment in april , 2013 . after 10 days of treatment , her liver enzymes increased more than 3 times of normal values and she had thrombocytopenia ( platelet count : 38.000/mm ) then her treatment was postponed for two weeks she restarted lenalidomide treatment at daily doses of 5 mg after liver enzymes and platelet counts returned to normal . during further follow - up , increase in liver enzymes and severe thrombocytopenia were not detected ; her hemoglobin value increased and transfusion dependency was not observed ( figure 1 ) .",
"in myelodysplastic syndrome , interstitial deletion in the long arm of chromosome 5 is a common cytogenetical abnormality seen in 16 - 28% of the patients . it is characterized by hypoproliferative anemia and normal megakaryocytes with hypolobated nuclei or increased dysplastic megakaryocytes in bone marrow [ 7 , 8 ] . most of the patients are transfusion - dependent because endogen erythropoietin production is usually increased . one of the major problems during the progression of the disease in transfusion - dependent mds patients is the iron overload secondary to transfusion and the dependency for chelation therapy to treat iron overload . the immunomodulatory drug lenalidomide that has additional benefits in the regulation of erythropoiesis , inhibition of angiogenesis , and reorganization of erythroid production , targets the mds clone directly [ 9 , 10 ] . this syndrome is rarely seen ; therefore , there is not enough data about isolated 5q - syndrome as well as lenalidomide therapy in our country . isolated 5q - syndrome presents with normal or increased thrombocyte counts in peripheral blood and anemia with frequent transfusion replacement dependency . in clinical studies lenalidomide provided long term blood transfusion independency and erythroid response in patients with low- risk del(5q ) and without del(5q ) . in a phase ii study of low- risk del(5q ) patients ; after 24 weeks , evaluation of erythrocyte response showed that 67% of the patients with 5q deletion who were treated with lenalidomide became transfusion independent . in low- risk 5q deletion mds patients , daily doses of 10 mg for 21 days are used , and repeated with 28 day - intervals that can be modified if needed . in order to evaluate the response , adverse events can be easily overcome with dose modifications . in clinical studies , thrombocytopenia and leukopenia are frequently observed but these adverse reactions usually appear during the first 8 weeks of treatment . therefore , weekly clinical follow - up at the beginning of the therapy is recommended . less often adverse events of fatigue , rash and diarrhea can be noted . in conclusion , in isolated 5q - syndrome which is a mds subgroup and characterized by transfusion dependency ; lenalidomide can decrease transfusion dependency with a tolerable adverse event profile that can be overcome with dose modifications . assessment of all prevalent cases in our country will be helpful to reveal the efficacy and adverse event profile of lenalidomide ."
] | 5q - syndrome is a special subgroup of myelodysplastic syndrome in terms of follow - up and treatment . lenalidomide is an immunomodulatory drug that is frequently used in the treatment of multiple myeloma . some clinical studies have shown that lenalidomide treatment is effective in 5q syndrome and significantly decreases the transfusion dependency in these patients . in this paper , we would like to share a dramatic response of lowered transfusion dependency after treatment with low - dose lenalidomide in a patient who received myelodysplastic syndrome diagnosis and isolated 5q anomaly in our clinic . |
[
"most clinical complications associated with hepatitis b are manifested in conditions , particularly cirrhosis and hepatocellular carcinoma ( hcc ) as consequences of chronic infection . hepatocellular carcinoma ( hcc ) is the sixth most common in the world and the third leading cause of cancer - related death ( 1 ) . an effective vaccine has been available for more than two decades , which has decreased the prevalence of hbv infection worldwide dramatically . the primary goal of hepatitis b prevention is reduction of chronic hbv infection and hbv - related chronic liver disease . a secondary goal is prevention of acute hepatitis b. in 1991 , the world health organization recommended that all countries include hepatitis vaccine in their routine infant immunization program , especially in areas where hepatitis b is endemic ( 2 ) . the global reported decline in hbsag prevalence , especially from hbv endemic area ( such as south east asia , alaska , etc . ) has been come as something of a surprise . naively speaking , one would expect that the ultimate decline is reaching ; however , this is not the case ; universally , about 5 - 20% of vaccine failure among recipients has been reported manifested by different levels of hypo- or nonresponsiveness to hbv vaccination ( 4 , 5 ) . historically , the potency of immune response after immunization against hepatitis b has been assessed by measuring antibody to hbsag . the persistence of anti - hbs above the protection level ( > 10 iu / ml ) in vaccine recipient is the main goal . this persistence declines by age , particularly , during the first years after vaccination ( 6 ) . on the other hand , a growing body of literature has shown that hbv vaccine - induced immunologic memory lasting persists more than 15 years after immunization ( 7 , 8) . in 1989 , iranian ministry of health launched an immunization program in four provinces as a pilot plan . afterwards , many researches conducted on the level of response to hbv vaccine among iranian children and ample data on the coverage rate of vaccine together with evaluation of vaccine responsiveness published in iran so far . in this study , a systematic review and meta - analysis was performed to provide the statistic power on investigations performed nationally and to provide a summary of the results .",
"we performed a comprehensive search on pubmed , isi , scopus , iran medex and scientific information database ( sid ) , on published describing anti - hbs levels in children below 15 years ( after six months to 15 years old ) who received three doses of hbv vaccine following epi . the primary outcome was frequency of persons with protective levels of anti - hbs ( > 10 iu / ml ) following hbv vaccination . the secondary outcome was frequency of nonresponders to hbv vaccine ( < 10 iu / ml ) . the main inclusion criterion was all studies that included subjects under 15 years old who received 3 doses of hbv vaccine ( regardless of type and brand of vaccines ) . we excluded all studies in which individuals received vaccine episodes out of vaccination schedule ( less or more administrations ) and in those with any medical interventions ( such as using adjuvant , booster doses etc . ) . moreover , we did not include surveys that investigated responsiveness to vaccine in those with medical conditions ( children born to hbsag positive mothers , thalassemia , dialysis , received hb vaccine plus immunoglobulin , predisposing factors for immunodeficiency such as hiv , etc . ) . data was extracted from selected studies including the name of author , year of publication , the mean age of participants and the levels of anti - hbs in different case - studied . subjects were divided into two categories : responders who showed anti - hbs levels > 10 iu / ml and nonresponders ( anti - hbs < 10 iu / ml ) . we merged the subjects who harbored levels between two extremes ; 10 and 100 iu / ml , as responders ( because some studies assigned these levels as hypo - responsiveness ) . the medical subject headings ( mesh ) including entry terms of pubmed and emtree of scopus with affiliation to iran for searching in english databases ( hbv vaccine , anti - hbs , expanded program on vaccination , prevalence , responders and nonresponders ) were used for conducting a more efficient search . persian keywords equivalent to their english terms were used for searching in national search engines . the references of selected citations and non - published national surveys were hand - searched . the authors assessed the risk of bias in the included studies using a risk - of - bias tool . studies that had an adequate handling of incomplete outcome data , were free of selective reporting , included an adequate intervention description , had appropriate criteria for participant recruitment and included an adequate outcome explanation were considered low - bias risk trials . the studies with one or more unclear or inadequate quality component were considered high - bias risk trials . the authors were not blinded to the names of studies authors , journals and results . any disagreements were resolved through discussion among the authors until consensus was reached ( kappa coefficient : 78% ) . data are expressed as percentages for categorical variables and means and sds ( standard deviation ) for continuous variables . statistical heterogeneity of reported prevalence was explored by chi - square ( or chi2)-based q - test and was regarded to be statistically significant at the 10% significance level ( p < 0.10 ) . to gain better insight into the prevalence of dyslipidemia and its heterogeneity throughout iran , we analyzed our findings using random - effects model with a 95% confidence interval ( ci ) . the analyses were conducted with stata software , version 11.0 , produced by statacorp , the usa .",
"the primary outcome was frequency of persons with protective levels of anti - hbs ( > 10 iu / ml ) following hbv vaccination . the secondary outcome was frequency of nonresponders to hbv vaccine ( < 10 iu / ml ) .",
"the main inclusion criterion was all studies that included subjects under 15 years old who received 3 doses of hbv vaccine ( regardless of type and brand of vaccines ) . we excluded all studies in which individuals received vaccine episodes out of vaccination schedule ( less or more administrations ) and in those with any medical interventions ( such as using adjuvant , booster doses etc . ) . moreover , we did not include surveys that investigated responsiveness to vaccine in those with medical conditions ( children born to hbsag positive mothers , thalassemia , dialysis , received hb vaccine plus immunoglobulin , predisposing factors for immunodeficiency such as hiv , etc . ) .",
"data was extracted from selected studies including the name of author , year of publication , the mean age of participants and the levels of anti - hbs in different case - studied . subjects were divided into two categories : responders who showed anti - hbs levels > 10 iu / ml and nonresponders ( anti - hbs < 10 iu / ml ) . we merged the subjects who harbored levels between two extremes ; 10 and 100 iu / ml , as responders ( because some studies assigned these levels as hypo - responsiveness ) . the medical subject headings ( mesh ) including entry terms of pubmed and emtree of scopus with affiliation to iran for searching in english databases ( hbv vaccine , anti - hbs , expanded program on vaccination , prevalence , responders and nonresponders ) were used for conducting a more efficient search . persian keywords equivalent to their english terms were used for searching in national search engines . the references of selected citations and non - published national surveys were hand - searched . the authors assessed the risk of bias in the included studies using a risk - of - bias tool . studies that had an adequate handling of incomplete outcome data , were free of selective reporting , included an adequate intervention description , had appropriate criteria for participant recruitment and included an adequate outcome explanation were considered low - bias risk trials . the studies with one or more unclear or inadequate quality component were considered high - bias risk trials .",
"the authors were not blinded to the names of studies authors , journals and results . any disagreements were resolved through discussion among the authors until consensus was reached ( kappa coefficient : 78% ) . data are expressed as percentages for categorical variables and means and sds ( standard deviation ) for continuous variables . statistical heterogeneity of reported prevalence was explored by chi - square ( or chi2)-based q - test and was regarded to be statistically significant at the 10% significance level ( p < 0.10 ) . to gain better insight into the prevalence of dyslipidemia and its heterogeneity throughout iran , we analyzed our findings using random - effects model with a 95% confidence interval ( ci ) . the analyses were conducted with stata software , version 11.0 , produced by statacorp , the usa .",
"twenty - eight eligible articles were found in the literature review , all were potentially related to the iranian epi . table 1 shows summary of iranian studies on immunization program . in total , these investigations were performed on 11639 children who received full three doses of vaccine . the age of subjects was between 6 months and 15 years old with the mean age of 5.21 3.64 years . overall , 9311 ( 80% ) responded to vaccine ( anti - hbs > 10 iu / ml ) . on the other hand , 2328 ( 20% ) were nonresponders ( anti - hbs < 10 iu / ml ) . the mean titers of antibody for responders and non - responders were 287.05 332.80 iu / ml and 4.08 1.70 iu / ml , respectively which was statistically significant ( p = 0.024 ) . among responders , the mean anti - hbs titers showed differences between a cut - off of three years old ; 500.95 484.19 and 164.82 139.44 iu / ml for those who were under 3 years old versus children more than 3 years old . meta - regression analysis showed that with increase in age , the number of responders to vaccine decreased significantly ( p = 0.001 ) ( table 2 ) . put another way , the number of nonresponders to vaccine increased as age of vaccines increased ( p < 0.001 ) . the other finding was that between years 1995 and 2014 , there was no significant difference in the mean anti - hbs titers between studies ( p = 0.428 ) . however , results from 24 publications indicated that of total 10562 children , 5070 ( 56.3% ) of males and 3937 ( 43.7% ) of females had antibody levels of > 10 iu / ml . in contrast , 1346 ( 59.0% ) and 938 ( 41.0% ) of males and females had antibody levels of < 10 iu / ml , respectively . final result for meta - analysis and model performed for total estimated prevalence is shown in table 3 . however , there was no strong difference between responders versus nonresponders to vaccine ( p = 0.119 ) . forest plot of prevalence of hbv vaccine responsiveness in iranian general , male and female population is shown in figures 1 - 3 , respectively . despite some studies did not specify the type of vaccine used , using different vaccines ( heberbiovac , cuba ; engerix - b , gsk ; recombivax , cuba ; euvax b ) with the same protocol for vaccine doses and administrations , did not show any significant differences regarding response rate to vaccine ( p < 0.001 ) . furthermore , prevalence of anti - hbc was between 0 and 7.5% in different reports ( table 1 ) . in those studies which compared the rate of responsiveness to hbv vaccine between urban and rural area , no significant differences were found between responders and nonresponders ( results not shown ) . no significant complications and side effects were reported after vaccine administration ( results not shown ) . response to vaccine according to ethnic groups ( turkish , arab , kurdish , turkmen , etc . ) and geographic area was evaluated ; however , no strong correlations were found ( p 0.826 and 0.896 , respectively ) . data are presented as % for 10 t : total ; m : male ; f : female abbreviations : ni : non identified . ",
"hbv expanded program on immunization was started in iran in 1993 . accordingly , more than 98% of infants there are ample data on the vaccine coverage rate , response to the vaccine , amnestic response to booster doses etc . among iranian healthy children . moreover , most of those articles published in persian language , makes the interpretation of data more incomprehensible . in this review , the impacts of different variables including age , gender , type of vaccine etc . on the rate of responsiveness of 11639 children - studied , 9311 ( 80% ) and 2328 ( 20% ) were responders and nonresponders to vaccine , respectively . there have been numerous published data on the rate of response to hbv vaccine internationally ; the reported rate of hbv vaccine responsiveness ranged between 41.6 and 98.3% ( table 4 ) . the reverse was also realistic for the extreme of no responsiveness to vaccine . in iran , the rate of responders to vaccine was between 47.6 and 98.3% ; however , in most studies ( 24 out of 28 papers , 85.7% ) , responders were above 69% of population in the surveys . regarding the impact of age on the rate of response to vaccine , we did not find a significant difference between subjects , despite finding cut - off levels for anti - hbs between 500.95 and 164.82 iu / ml for those who were under three years old versus children more than three years old , respectively . there are considerable variations between studies for association between the age of participants and response to vaccine . the massive gaps between the extreme of these results substantially correlated to the age of vaccines . for example , table 4 shows that more increase in the age of vaccines , the more decline in the rate of responders . the other important issue is the timing between the last dose of vaccine administration and measurement of anti - hbs . globally , in various reports , the age of children ranged between 5 and 15 years old ; which makes substantial variance between the levels of anti - hbs in different age groups . on the other hand , this review and other studies showed that with increase in age , the number of nonresponders to vaccine increased significantly . versatile ethnic groups , geographic variations , different age groups between subjects and difference in the endemicity of hbv in those areas might be the reasons for such discrepancies . what is the impact of low level of anti - hbs on acquisition of hbv infection ? taken together , with exception of some rare reports on healthcare workers who were nonresponders to vaccine and subsequently infected with hbv ( 47 - 49 ) , there is no data to support that after robust rising in anti - hbs following hbv vaccination , subsequent decrease in anti - hbs levels endanger the subject to hbv infection ( 50 ) . previous results showed that memory t cells maintain the response to the virus after encountering . this issue has been highlighted by the fact that after booster dose(s ) of hbv vaccine in hypo / nonresponders , there has been amnestic response manifested by increase in the levels of anti - hbs ( 45 , 51 ) . interestingly , between years 1995 and 2014 , there was no significant difference in the mean anti - hbs titers between iranian studies ( p = 0.428 ) . this finding together with this issue that the type of vaccine used did not show any significant differences between the rate of response to vaccine ( p > 0.05 ) , indicate the reasonable potency and antigenicity of vaccine used in iranian epi , which were already assessed by our lab in vivo and in vitro studies ( 52 , 53 ) . despite some studies showed some differences in response to hbv vaccine between rural and urban areas ( 54 - 57 ) furthermore , in our own yet unpublished study on 1200 samples from two categories of rural and urban districts , we did not find any considerable changes ( jazayeri s unpublished manuscript ) . overall , iranian surveys did not find any significant correlation between gender of participants and the rate of response to vaccine ( p = 0.119 ) , which was similar to other findings ( table 4 ) . iran is considered as an intermediate area for hbsag prevalence ( 2.54% ) ( 58 ) . on the other hand , the rate of past hbv infection , manifested by anti - hbc , ranged between 0 and 7.7% in this review . both relative high prevalence for hbsag ( 4.6% ) and anti - hbc ( 7.7% ) previous reports showed rates of 6.3% hbsag and 8% anti - hbc in general population in these areas , respectively ( 59 , 60 ) . however , our unpublished data on 821 samples from vaccinated children showed no positive cases for both two markers ( jazayeri and alavian , unpublished ) . altogether , 0 to 1.29% prevalence of hbsag together with 0 to 2.5% anti - hbc from different provinces underscored the usefulness of hbv vaccination for substantial reduction in hbv endemicity in iran . second , the vaccine was effective in stimulating the immune response of vaccines reasonably , despite being different in generation , manufacturers and types . third , there was no substantial difference between iranian and other international investigations in the rate of nonresponsiveness to hbv vaccine ."
] | context : hepatitis b virus expanded program on immunization ( epi ) started on 1993 in iran . most surveys have assessed the level of response to vaccine by measuring the titers of anti - hbs . this meta- analysis aimed to summarize the iranian published data on the rate of vaccine - responders versus non - responders . moreover , the impact of variables such as age , gender , type of vaccine , etc . on the levels of responsiveness was evaluated.evidence acquisition : all published papers on this topic in iranian and international journals with affiliation of iran were reviewed using standard keywords up to 2014 . we included our study to healthy participants with no previous hbv infection and who had already received a complete course of hb vaccine . the estimated prevalence and 95% confidence intervals in 28 eligible articles for hbv vaccine responders ( anti - hbs > 10 iu / ml ) and non - responders ( 10 < ) were analyzed by random effect method due to between - study heterogeneity.results:the age of subjects was between 6 months and 15 years old . overall , 5991 ( 51.5% ) were male and 4571 ( 48.5% ) females . overall , 80% were responders to vaccine versus 20% nonresponders . with increase in age , the number of responders to vaccine decreased significantly ( p = 0.001 ) . there was no strong difference between responders versus nonresponders to vaccine for gender , types of vaccine , ethnicity and living area.conclusions:the results arose from this meta - analysis highlighted the safety of vaccine and its effectiveness in stimulating immune response of vaccines , despite being different in generation , manufacturers and types . moreover , there was no substantial difference between iranian and other international investigations in the rate of nonresponsiveness to hbv vaccine . |
[
"improperly - placed implants are at risk of dislocation , increased component wear and loosening , and the need for revision surgery . avoiding glenoid component malposition in terms of version and inclination is therefore an important technical goal , which may be very demanding due to a variety of issues related to patient anatomy and surgical technique . altered anatomy in revision cases , joint contractures and complex patterns of glenoid bone loss with unreliable landmarks are commonly encountered in this patient population . in such cases , directing the glenoid baseplate along an appropriate axis with sufficient bone stock for fixation may be a challenging intra - operative task . surgical planning for these patients can be improved using three - dimensional ( 3d ) reconstructions of ct scans , but recreating that same plan at surgery can be difficult . computer navigation has been employed for this purpose , with promising results . however , computer - assisted glenoid implantation techniques use an intra - operative setup using a tracking system , with some disadvantages : instrumentation is cumbersome to use in the shoulder ; pins used for array fixation may cause iatrogenic lesions such as fracture or neurovascular injury ; registration of anatomical landmarks may be inaccurate ; and the need for resetting may result in an increase in operative time of more than 20% patient - specific instrumentation has the potential to provide a similar level of accuracy as computer - assisted navigation , but without such problems or additional surgical steps . this type of pre - operative planning has grown in popularity across a wide range of orthopaedic subspecialties including total hip and knee arthroplasty , pelvic and acetabular procedures and spinal deformities , with varying degrees of success . it is the most recent development in this field , and its effectiveness in both the version and inclination planes of glenoid component placement has been demonstrated for both total anatomical and reverse shoulder arthroplasties .",
"patients undergo a pre - operative thin - cut ct scan of the entire scapula and adjacent humerus following a predefined protocol . original two - dimensional ( 2d ) images are uploaded to a 3d image processing software system and reformatted into accurate 3d models of the scapula , in order to avoid errors in measuring actual version or inclination the plane of image acquisition ( gantry angle ) can deviate from a perpendicular angle to the plane of the scapula . this plane of the scapula is defined by three landmark anatomical points : the inferior scapular angle point , the glenoid centre point and the trigonum spinae point ( intersection of scapular spine and medial border ) . a neutral inclination axis , or glenoid centre line , is defined between the last two ( fig . 1 ) . the version is therefore measured with respect to the scapular plane , and inclination with respect to the neutral axis , as the angle between a line perpendicular to it and a line from the superior to inferior rim of the glenoid . three anatomical points ( red dots ) used as landmarks for the definition of the scapular plane and the neutral inclination axis ( red line ) : the inferior scapular angle point , the glenoid centre point and the trigonum spinae point . the pre - operative planning is performed by the surgeon using adequate software , in a process that may vary according to each provider ( fig . virtual surgical planning requires the definition of the axis for the glenoid baseplate component , by creating patient - specific surgical guides . the guide is designed to fit onto the surface and border of the glenoid in each specific case , requiring minimal additional exposure , and is manufactured following a 3d stereolithography model . this guide , constructed from a sterilisable material ( usually polyamide resin ) has one or two drill cylinders positioned to orientate the drilling of the central glenoid guide pin . in addition to this glenoid guide , a patient - specific glenoid vault replica is also created to aid the surgeon in having the best perception of the placement of the guide on the glenoid during surgery ( fig . a ) radiograph and b ) mri of a shoulder with extensive glenoid destruction for a reverse prosthesis ; c ) coronal , and d ) transverse view of the pre - operative planning . a ) sterilised bone model and glenoid guide , with b ) one inferior - tilted pin hole for a reverse procedure and a second superior one for an anatomical procedure . the technique for exposure and the use of instruments for bone preparation over a guidewire is identical whether or not the patient - specific instrumentation is used . the only additional requirements are care not to resect bony prominences such as osteophytes that were contemplated in the development of the guide and are necessary for the proper seating of the guide , and a slightly more extensive exposure of the anterosuperior aspect of the glenoid and base of the coracoid . this fact , however , may make the use of the deltopectoral approach more favourable as it may facilitate glenoid exposure , which is in fact the only restriction the surgeon may find in using a superior transdeltoid approach . the guide is then fitted to a stable position on the native glenoid and the central kirschner wire ( k - wire ) is drilled into the glenoid until the far cortex is perceived ( fig . this k - wire then guides further cannulated glenoid reaming and subsequent steps for both total and reverse shoulder arthroplasties according to standard guidelines of the manufacturers ( fig . a ) glenoid central pin placement for an anatomical prosthesis in a right shoulder ; b ) good exposure of the anterosuperior glenoid rim is required for the proper seating of the guide . a ) reverse prosthesis in a left shoulder and guided central pin drilling ; b ) native glenoid and patient - specific bone models are compared to check accurate placement of the guide on a very deformed scapula ; c ) central screw drilling completed over a guide pin that keeps its stability due to the integrity of the far cortex with no glenoid vault perforation , made possible with an accurate drilling direction . in addition to single - use patient - specific instrumentation ( psi ) , it should be noted that reusable and adjustable psis are also available from some manufacturers . in the longer term , this technology may prove to be of lower cost than single - use psis and should result in a reduction of the time from planning to use of the instrument .",
"in addition to single - use patient - specific instrumentation ( psi ) , it should be noted that reusable and adjustable psis are also available from some manufacturers . in the longer term , this technology may prove to be of lower cost than single - use psis and should result in a reduction of the time from planning to use of the instrument .",
"no long - term clinical studies comparing patient - specific to standard instrumentations have been published to date , and the few reports on this subject that have been published are mostly laboratory studies on cadaver specimens , evaluating the accuracy of the baseplate positioning . the purpose of those studies was to examine the effectiveness of patient - specific planning and a patient - specific drill guide for glenoid component placement in shoulder arthroplasty . the conclusions drawn are similar in all . in 2011 , suero et al evaluated the safety and accuracy of a custom glenoid jig created using pre - operative ct imaging , with 3d modeling for glenoid component implantation . comparison between the pre - operative plan and the result on post - operative ct scans of seven patients showed that a ct - based custom alignment can reliably guide the placement of the glenoid component during conventional and reverse shoulder arthroplasty , without technical difficulties or complications . in their level i randomised prospective clinical trial , hendel et al concluded that there was a significant improvement in the accuracy of glenoid component placement with the use of patient - specific guides in patients with bone deformity and glenoid retroversion in excess of 16 , and no difference in those with glenoid retroversion below 7. levy at al later concluded that the use of patient - specific guides in 14 reverse arthroplasties was highly accurate in reproducing a virtual 3d pre - operative plan , delivering the accuracy observed using computerised navigation without any additional surgical steps or technical difficulties . likewise , walch et al demonstrated in an in vitro study that using 3d planning software and custom guides is a reliable and precise option in total shoulder arthroplasty . the most recent papers from 2015 further support those conclusions . in 36 prostheses , heylen et al found that patient - specific guidance reduced variability in glenoid component inclination , as well as the risk of extreme inclination errors for total and reverse shoulder arthroplasty when compared with standard pre - operative planning and instrumentation . in a multi - surgeon study in 70 arthritic cadaver specimens , throckmorton et al found that these patient - specific targeting guides were significantly more accurate ( p = 0.01 ) for the combined vectors of version and inclination , and also had fewer instances of significant component malposition than traditional instrumentation . 3d surgical planning and patient - specific guidance reduce variability in glenoid component inclination , which should result in fewer malpositioned glenoids in both total and reverse shoulder arthroplasty . in severe glenoid deformations , namely when bone grafting is required , psi will aid in estimating the best alignment , in terms of version and inclination , as well as the best fixation on stable bone stock , avoiding glenoid vault perforation ( figs 6 and 7 ) . good baseplate alignment on the same patient as shown in figs 2 and 5 , with severe glenoid deformation requiring bone grafting . digitised image from pre - operative plan of an anatomical glenoid component , displaying peg penetration from the vault posteriorly . ( from zimmer - biomet software ; with permission ) . however , there are a few important points that need consideration when using this technology . first , manufacturing the psi guide is based on an accurate 3d model of the patient s scapula made from ct - scan cuts , which may be conditioned by cartilage loss , severe bone deformity or calcified labrum . second , seating the guide properly on the native glenoid demands good exposure of the anterosuperior glenoid rim , with removal of any soft tissues that may impair it . third , reaming to the adequate depth and orientation is still dependent on the surgeon s ability , as bending or pushing the guide pin with the reamer can mislead further reaming . likewise , overtightening screws on soft bone or graft may asymmetrically overcompress the glenoid component against bone and change its final position , despite adequate reaming over a well - positioned central pin . hendel reported four in 15 cases with over 10 of deviation in version or inclination from the pre - operative plan , despite the use of psi , all performed by surgeons with little experience with this technology . by way of addressing these limitations , some manufacturers have developed multiple psi guides to help correct off - axis reaming , control the depth of reaming and assist in the orientation of the fixation screws .",
"current evidence suggests that the use of psi can assist in the avoidance of significant glenoid baseplate orientation errors , especially by less experienced surgeons , resulting in fewer malpositioned glenoid components . custom - made guides will play an important role in the placement of the central pin on glenoids with severe deformation , in cases where the best anatomical landmarks may have vanished and the use of bone grafting is anticipated . however , the surgeon s expertise and intuition remains invaluable , both in the pre - operative planning and in the final component implantation , especially concerning the reaming depth . however , psi seems to offer a distinct advantage to lower - volume surgeons , by reducing the risk of guide - pin malposition , a step that is very much dependent on the surgeon s expertise . furthermore , pre - operative planning time is longer and may be dependent on external technical support , limiting its usage to elective surgeries and making it unsuitable for acute cases such as fractures . psi offers a greater chance of accurate alignment of the glenoid component , which seems to be an advantage . however , scapulae are not all the same , so when we try to align all glenoids in the same way , we may actually be changing the native alignment of some shoulders . predicting the physiological glenoid version for a particular pathologic shoulder can be difficult , unless comparison with a normal contralateral shoulder ( if present ) is done . scalise et al concluded that a 3d vault model , as described by codsi et al , could be used as a template to predict normal or baseline glenoid version for a particular patient . youderian and iannotti have concluded from surgical simulation in a 3d virtual environment that additional use of a patient - specific glenoid vault can predict pre - morbid version , inclination and amount of volumetric bone loss , which can help to generate the best possible scenario of bony structural support for the glenoid implant and can minimise the amount of bone loss , by reaming . these findings are invaluable for further development of systems which may help surgeons in estimating the right degree to which pathological version should be corrected . psi will help in the placement of the glenoid component on the best bone stock with the desired alignment . clear advantages in total knee arthroplasty are the fact that it is very intuitive and effective in placing the components in the desired position , it is attractive to patients because they like a personalised patient - care approach and it increases efficiency in the operating room ( or ) due to the reduced number of instruments required , which leads to reductions in or setup time , turnover time and overall surgical time . while the former may also be observed in psi for shoulder prosthesis , the latter will not necessarily be met . the added cost of psi manufacturing will need to be judged against the potential benefit in clinical outcomes . the cost benefit analysis and long - term clinical studies remain lacking ; these are necessary components in the evaluation of the potential benefits of this alternative .",
"ng has received financial support outside of the current work in the form of consultancy and lecture fees from zimmer biomet ."
] | shoulder arthroplasty is a demanding procedure with a known complication rate . most complications are associated with the glenoid component , a fact that has stimulated investigation into that specific component of the implant . avoiding glenoid component malposition is very important and is a key reason for recent developments in pre - operative planning and instrumentation to minimise risk.patient-specific instrumentation ( psi ) was developed as an alternative to navigation systems , originally for total knee arthroplasty , and is a valid option for shoulder replacements today . it offers increased accuracy in the placement of the glenoid component , which improves the likelihood of an optimal outcome.a description of the method of pre - operative planning and surgical technique is presented , based on the author s experience and a review of the current literature.cite this article : gomes n. patient - specific instrumentation for total shoulder arthroplasty . efort open rev 2016;1:177 - 182 . doi : 10.1302/2058 - 5241.1.000033 . |
[
"despite expanded indications for conservative surgery of urothelial tumors ( ut - formerly transitional cell carcinoma ) of the upper urinary tract ( uut ) , radical nephroureterectomy ( nue ) with complete removal of the distal ureter including the bladder cuff is the standard surgical technique used for most patients with ut of the uut . choosing the best procedure for this group of patients in everyday clinical practice is frequently a challenging task . while laparoscopic nephrectomy as a part of nue was first described in 1991 and it is to - date broadly accepted , the approach to the distal ureter and the timing of the ureterectomy are still disputed . several techniques have been developed to remove the distal intramural part of the ureter during laparoscopic nue and it is very difficult to choose the best procedure for a given patient in everyday clinical practice . there is a risk of residual tumor at the stapling site and titan clips may constitute a nidus for the formation of cystolithiasis [ 5 , 6 ] . two groups [ 79 ] have described a technique for the division of the ureterovesical junction with a thermo sealing system ( ligasure atlas ) . we considered this modification of clnue as an excellent method and we have previously performed this on 14 patients . however , we found a significant risk of incomplete resection of the intramural part of the ureter . exclusive laparoscopic sharp excision of the bladder cuff with intracorporeal suturing [ 1115 ] appears too difficult for us . thus , we have decided to start clnue with excision of the ureterovesical junction with collin 's knife followed by clnue . the main problem with this procedure is the risk of occlusion of the ureter to prevent spillage of urine containing tumor cells during laparoscopic pluck nephroureterectomy . several methods have been described to date : ( 1 ) cauterization of the ureteric ostium only , ( 2 ) endoloop [ 16 , 17 ] , ( 3 ) hem - o - lok clip [ 1820 ] , or ( 4 ) fibrin sealant . we chose to close the ureter with a lockable hem - o - lok clip , which was introduced through a 5 mm intravesical port in the suprapubic area rather than endoscopically [ 18 , 19 , 20 ] . we have labeled this technique as clnue - wilc ( with intravesical lockable clip ) . in this study",
"the study is prospective , but due to the absence of a standard technique for nue , the study was not randomized and comparative . from 1/2010 to 1/2012 , 38 patients with suspected ut of uut were indicated for surgical treatment . four underwent conservative surgery ( one ho : yag ablation , one ureteroscopic resection , one nephroscopic resection with resectoscope , and one open resection of the ureter ) and 34 nue . thirteen underwent some type of open surgery ( advanced cases with open nephrectomy or laparoscopic nephrectomy with open ureterectomy for tumor of the distal ureter ) and 21 nue by clnue- ivlc ( main inclusion criteria : not suitable for conservative treatment , no tumor of distal ureter , no advanced tumor by ct , no contraindications to laparoscopy , or no concomitant bladder tumor ) . the ureterovesical junction is excised transurethrally with collin 's knife ( the paravesical adipose tissue must be clearly visible ) . from the suprapubic region , the stump of the ureter is grasped with biopsy forceps and on the end of ureter , a hem - o - lok clip size ml is applied ( the applicator is introducible through the 5 mm port ) . in broader ureters , the patient is rotated to the flank position and a standard laparoscopic nephrectomy via a transperitoneal approach is performed [ 10 , 22 ] . the transperitoneal approach is more familiar to us than the retroperitoneoscopic one . one additional 5 mm port in the suprapubic region is introduced ; the skin incision from the previous endoscopic phase is used . the ureter is dissected along and under the iliac vessels with a harmonic scalpel or ligasure advance or blunt tip 35 mm . this phase is delicate due to the relatively narrow operation space and the close relation of iliac vessels and the bowel . the ureter is completely separated and the hem - o - lok clip must be clearly visible to constitute proof of completion of the ureterectomy .",
"a few points to emphasize include : four complications ( clavien ii 2x , iiib and v ) wound infection at the site of extraction ( staphylococcus aureus ) , urine leakage from the pelvic drain for 6 days ( bladder catheter was removed on the 8 postoperative day following cystoradiography that did not reveal leakage ) , one open prostatectomy on the 2 postoperative day because of an enlarged prostate ( bph with hematuria ) , and one patient died of heart failure on the day of operation . in four cases ( 19.0% ) application of the clip failed and clnue was concluded with a non - occluded ureter and the risk of dissemination of tumor cells in urine paravesically . in the first case the patient had a ureteral stent and the ureter was incrassate , which is why we did not want to apply 10 mm port to facilitate the introduction of the hem - o - lok clip size l. in another case , the stented ureter was also incrassate and we introduced a 10 mm port to the urinary bladder and applied a size l clip without difficulty . there was one incidence with the inability to grasp the ureter by endoscopic forceps . in two cases the laparoscopic nephrectomy was converted to the open surgery ( flank incision and lumbolaparotomy ) in one case this was due to extensive adhesions in the abdominal cavity ( a history of open cholecystectomy with evacuation of subphrenic abscess ) , and in the other two cases it was due to advanced tumor growth with perirenal and periureteral adhesions . in three cases , laparoscopic nephrectomy was followed by open distal ureterectomy with the standard pluck method , because the laparoscopic approach was not feasible due to poor access of the laparoscopic instruments to the small pelvis . four patients with non - ut histology were judged to be ut by preoperative imaging . follow - up ( mean 10 , range : 0 - 22 months ) , including results of the control endoscopy , are known in all patients . one patient with uc of the renal pelvis pt2n0m0g2 had uc in the contralateral distal ureter and died after 11 months due to extensive metastatic disease , mainly to bone . \n abbreviations : ae adrenalectomy for adenoma , bcg history of intravesical instillation of bcg , bt urinary bladder tumor , eskd end - stage kidney disease , l left , m male , mo right , turb transurethral resection of bladder tumor , up - um ureter proximal - middle , uc notes : all cases were n0m0 ; time of whole procedure ( endoscopy , rotation of patient , laparoscopy ) ; non - uc histology : tumors were described by radiologists on ct / mri as a suspicious uc tumor .",
"it should be noted that the aim of this work is not to comprehensively discuss the whole complex problem of nue . our experience prompted us to review this topic in two recent publications [ 10 , 22 ] and now we will focus the discussion on complete laparoscopic nue with emphasis on the method of removing the distal part of the ureter including the bladder cuff . in our view , due to the disadvantages mentioned in the introduction , the method involving a stapler should be abandoned . the other options of distal ureterectomy as a part of clnue are as follows : ( 1 ) a thermosealing technique [ 7 , 8 , 9 ] , ( 2 ) the sharp excision of the bladder cuff with intracorporeal suturing ( a purely laparoscopic technique ) [ 11 , 12 , 15 ] including modification with a bulldog clamp , ( 3 ) robotic , or ( 4 ) purse string technique . the steps of the endoscopic phase in lithotomy position . the ureterovesical junction is excised transurethrally with a collin 's knife to the paravesical adipose tissue . the stump of the ureter is grasped with biopsy forceps and the end of the ureter is clipped with a hem - o - lok clip size ml ( an applicator is introduced through the 5 mm port inserted as an epicystostomy ) . as pointed out previously , the thermosealing system technique has the risk of leaving the intramural part of the ureter intact . the laparoscopic ne with ensuing sharp excision of the ureterovesical junction and closing of the defect with suture is an ideal but challenging method . we consider the technique with any variant intracorporeal suturing technically more challenging and time consuming [ 10 , 22 ] . the variant with the da vinci robotic system [ 24 , 25 ] decreases the technical difficulty of intracorporeal suturing . the disadvantages of the da vinci system include : high cost , lack of tactile sensation , long set - up time , and unavailability of the robotic system in many hospitals . an exotic technique is the pneumovesicum approach in which three 5 mm ports are introduced to the bladder and insufflated with co2 pneumovesicum ( 10 - 12 mm hg ) . the distal ureter , bladder cuff , and intramural ureter are then completely dissected free using electrocautery . as soon as the distal ureter is dissected an endo - loop knot is used to ligate the ureter . we do not have experience with this technique and we feel this technique to be complicated . the ureter is excised through a laparoscopic single port introduced to the urinary bladder and the defect is closed with intravesical suture . six ports , on the left side , but five usually suffice . the same skin incision as for the epicystostomy is used for the suprapubic port . due to the factors mentioned above we prefer a variant of excision of the ureterovesical junction but with another method for sealing of the ureter . we have long - term experience with excision of ureterovesical junctions using collin 's knife . previously we used it as a pluck technique combined with open and thereafter laparoscopic or retroperitoneoscopic nephroureterectomy , and , later on , we also used it as a part of antegrade mini - invasive nue . 's idea [ 18 , 19 ] of endoscopically closing the excised ureter with lockable clip to be excellent , although the introduction of the hem - o - lok clip via endoscope appears to be difficult . pathak et al . performed their technique in 25 cases with a mean total operative time of 164 ( range : 105 - 235 ) minutes . no pelvic complications in were reported and there were no perivesical tumor recurrences with mean follow - up of 26 ( range : 11 - 44 ) months . we have decided to apply the hem - o - lok clip size ml via an intravesical 5 mm port introduced through the suprapubic area . regarding our first nine cases , we had found the exact same method described in the literature . suprapubic transvesical single - port technique for control of lower end of ureter during laparoscopic nephroureterectomy . the dissected nephroureterectomy specimen during the operation . the tumor can be seen in the upper calyx with hem - o - lok size ml at the end of the ureter ( see detail ) . reportedly , occlusion of the ureter may be performed instead of clip with electro - coagulation only ( it is probably less reliable ) or with fibrin sealant injection .",
"clnue- ivlc is a relatively simple , reproducible , and minimally invasive method with minimal risks of tumor spillage and seeding . the main disadvantage seems to be the risk of an unclosed defect of the urinary bladder , but based on our own experience , as reported in this paper and the available literature , we have not found any significant complications emerging from this . another disadvantage is failure in applying the hem - o - lok clip , in which the technique is concluded without closing the ureter , and is generally thought to carry a higher risk of extravesical tumor recurrence , but as described recently , this technique has comparable oncological results to the open distal ureterectomy [ 3 , 6 ] . failures in clip application were experienced only in early cases and , with increasing experience , this problem was avoided . importantly , if needed , the endoscopic phase can be transformed to open nue or it can be combined primarily with open surgery . some may consider conversion to open distal ureterectomy / nephrectomy as a failure of the method . the method whereby closing of the ureter is performed allows the procedure ( nue ) to be completed safely in complicated cases ( obesity , advanced cases , previous intraabdominal surgery etc . ) ."
] | introductionwe present a cohort of patients with low - stage pelviureteric neoplastic disease who underwent complete laparoscopic nephroureterectomy ( clnue ) with intravesical lockable clip ( ivlc ) . due to the absence of a standard technique of nue , the study was not randomized.materialsfrom 1/2010 to 1/2012 , 21 patients were subjected to clnue - ivlc . the first step was transurethral excision of the ureterovesical junction with collin 's knife deep into the paravesical adipose tissue . the ureter was grasped with biopsy forceps and the distal end of the ureter was occluded with lockable clip . the applicator was introduced through a 5 mm port inserted as an epicystostomy . the patients were rotated to flank position and clnue followed . the endoscopically introduced clip on the distal ureter is proof of completion of the total ureterectomy.resultsthe mean operation time was 161 ( 115 - 200 ) min . in four ( 19.0% ) , the application of the clip failed and clnue was completed with non - occluded ureter . in three cases , subsequent laparoscopic nephrectomy was converted to open surgery . in two cases , the distal ureterectomy was completed with pluck technique through a lower abdominal incision that was also used for extraction of the specimen . there were four complications ( clavien ii 2x , iiib , v ) . follow - up was available for all mean 10.6 ( range : 0 - 25 ) months . one died of disease generalization within 11 months.conclusionclnue-ivlc is fast and safe . if needed , the endoscopic phase can be switched to open nue . disadvantages include : the need to change the position of the patient , the risk of inability to apply the clip on the distal ureter , and the risk of an unclosed defect of the urinary bladder . |
[
"segmental copy - number variations ( cnvs ) , involving the gain or loss of several hundreds of bases to several hundred kilobases ( kb ) of the genome , can be an important source of genetic variation among human populations of different ethnic groups as well as among individuals . molecular genetics analyses and cytogenetic analyses have provided significant information about these variations in the human genome , specifically as they relate to disease , such as cancer , and to congenital malformation ( see [ 1 , 2 ] , and review in ) . following the development of methodologies and the introduction of new research platforms [ 49 ] , information regarding the nature and pattern of cnvs from representative populations have accumulated . examinations of a relatively large number of individuals from various specific ethnic groups have recently been conducted using different array platforms , such as bac - arrays [ 1013 ] , oligo - arrays [ 1416 ] , and others . the results are not always consistent and it is likely that different human populations bear different cnvs . the numbers of japanese individuals examined to date are not so large compared to the studies for other ethnicities . polymorphic cnvs have received considerable attention since they might play an important role in the etiology of common diseases . therefore , more data regarding cnvs should be accumulated from japanese populations . in this report , we focus on cnvs which were observed at a high frequency ( 5.0% of the individuals ) in the population residing in hiroshima and nagasaki , japan by acgh with bac - clones as targets .",
"in the study , the population studies were conducted at two stages : stage ( 1 ) : 80 unrelated japanese individuals were examined using bac - acgh with an array having 2,241 bac clones , and stage ( 2 ) : 133 unrelated japanese individuals were examined using bac - acgh that contained 2,622 bac - clones . the majority of the clones used in stage ( 1 ) of this study were selected from the set of cytogenetically mapped p1-artificial chromosome ( pac ) clones and bacterial artificial chromosome ( bac ) clones reported by the bac resource consortium and obtained from either the children 's hospital oakland research institute ( oakland , ca , usa ) or from invitrogen inc . , co. ( carlsbad , ca , usa ) . in stage ( 2 ) , in addition to bac clones used in stage ( 1 ) , an additional 381 bac clones were used , a majority of which were collaboratively obtained from dr . n. matsumoto of yokohama city university . the 2,241 clones of chromosomal fragments from chromosome 1 to chromosome 22 were used in stage ( 1 ) and 2,622 clones were used in stage ( 2 ) , respectively . that is , the additional 381 bac clones were examined for only 133 unrelated individuals in stage ( 2 ) . those clones are distributed every 1.2 mb across all of the human autosomes in stage ( 1 ) , and 1.1 mb in stage ( 2 ) , respectively . in addition to autosomal clones , four kinds of x - chromosomal clones were used as internal references . with respect to examination for stage ( 1 ) , three sets of arrays were constructed and imprinted : slide no.1 , consisted of 698 clones on chromosomes 1 to 4 ; slide no.2 consisted of 718 clones on chromosomes 5 to 10 , plus two bac clones on chromosome 3 , and six clones on chromosome 4 ; and slide no.3 consisted of 817 clones on chromosomes 11 to 22 . for stage ( 2 ) , all of the clones were printed onto one glass slid . the genomic dna samples used in this study were principally the same as those used in a previous study . the dna samples used for reference purposes were extracted from mononuclear cells of two physically and clinically normal volunteers ( a 57-year - old japanese male and a 54-year - old japanese female ) . the dna used for testing and analyses of this population was extracted from lymphoblastoid cell lines obtained from the offspring of atomic - bomb survivors . high molecular weight genomic dna was isolated using conventional methods as described in detail elsewhere . lymphoblastoid cell lines were derived from a cryopreserved archive of approximately 1000 families consisting of father , mother , and offspring from hiroshima and nagasaki for whom permanent cell lines have been established by epstein - barr ( eb ) virus transformation of peripheral b - lymphocytes . the composition of the families has been reported elsewhere . three hundred five offspring were initially screened . since the offspring include some siblings , we selected one representative offspring to construct unrelated individuals to avoid double counting of polymorphic cnvs from families containing two or more siblings . we selected the offspring who first visited our institution for donating blood rather than other siblings . the 213 offspring selected as unrelated individuals included 124 offspring from hiroshima and 89 from nagasaki . cloned dnas for microarray targets were isolated from bacterial cultures using nucleobond bac 100 ( nippon genetics , tokyo ) . with respect to stage ( 1 ) , dna was digested by noti followed by phenol - chloroform - isoamyl alcohol ( 25:24:1 ) extraction and ethanol - precipitation . on the other hand , in stage ( 2 ) , cloned dna was digested with msei followed by phenol - chloroform - isoamyl alcohol ( 25:24:1 ) extraction and ethanol precipitation . the fragmented dnas were amplified by ligation - mediated pcr carried out as described by snijders et al . . the target dnas ( 0.5 g/l ) were dissolved in 50%-dimethylsuloxide and printed in triplicate onto the glass slides ( matsunami glass co. ltd . ) using the affymetrix 417 arrayer ( affymetrix ) . the screenings of both stages were conducted following the procedures described previously . in brief , for labeling dna , test and reference genomic dna ( 1.25 g each ) was cut by bamhi , and labeled by a random priming method with cyanine-5- and cyanine-3-labeled dutp ( cy5- and cy3-dutp ; perkinelmer life sciences , wellesley , ma , usa ) . the labeled probes were mixed and centrifuged with microcon column ( millipore co. , bedford , ma , usa ) to purify the probes . subsequently , human coti dna ( 120 g ; roche diagnostic gmbh , mannheim , germany ) was added to the column , and recentrifuged . after the volume of the mixture became less than 20 l , it was transferred to microtubes with 100 l of hybridization solution ( 50% formamide , 10% dextran sulfate , 1% tween 20 , 2 ssc , 10 mm tris - hcl [ ph 7.4 ] and 800 g of yeast t - rna [ invitrogen , carlsbad , ca , usa ] ) . the hybridization mixture was then denatured at 70c for 10 minutes , and subsequently incubated at 37c for at least five hours to block repetitive sequences of the labeled probes . prehybridization was conducted in order to block repetitive sequence binding of target dna on the arrays , and to prevent nonspecific binding of probe dna to the targets . following the initial incubation ( overnight at 37c ) , the prehybridization solution was removed , and fresh hybridization solution with cy - labeled dna ( prepared as described above ) was added . again , hybridization processes were carried out . all of the procedures were conducted using the genetac hybridization station ( genomic solutions inc . , ann arbor , mi , usa ) . fluorescent images of the hybridized arrays were obtained using a scanarray 5000 confocal laser scanner ( perkinelmer life sciences ) . fairfax , va , usa ) in stage ( 1 ) and gene pix ( axon instruments , sunnyvale , ca ) in stage ( 2 ) , respectively , were used to quantify the fluorescence of each spot on the array images . fluorescent ratios of the total integrated cy3 and cy5 intensities for each target ( triplicate spots for each target ) were calculated , along with the mean ratios of the triplicate spots ( if the raw ratio of one of the triplicate spots differed by more than 10% from the other two , the value was automatically excluded from the mean ratio calculation ) . normalized ratios were computed by dividing each raw ratio by the mean raw ratios of every autosomally mapped target ( therefore , after normalization , the averaged ratio for all targets in one array was 1.0 ) . the spots whose ratios were 2.58 standard deviations ( sd ) below the mean ( 1.0 ) , or 2.58 sd above the mean , were marked cnv . to confirm the quality of each analysis , the ratio of x - linked clones was verified . dna in the plugs was cleaved by restriction enzymes ( paci , or sse8387i ) . the resulting fragments were then separated by pulse field gel electrophoreses ( pfge ) on 1% pulse field certified agarose ( biorad , hercules , ca , usa ) with 0.5 tbe ( tris - borate - ethylenediaminetetraacetic acid ) . using the chef - dr ii system ( biorad ) , electrophoresis was carried out using 6 v / cm at 14c for 22 hrs . the angle of pulse was 120. the switch time was used : ramped from 0.3 seconds to 15 seconds . southern blot analyses were carried out using conventional , well - described procedures . in brief , after completion of pfge , the dna in the gel was cleaved by uv irradiation and blotted onto nitrocellulose filters ( schleiche & schuell , dassel , germany ) . the filters were prehybridized with human coti dna ( 48 g / ml , roche diagnostic gmbh ) and salmon testis dna ( 14 g / ml , sigma - aldrich ) to decrease the background due to repetitive sequences . subsequently , the filters were hybridized with whole bac - dna as a probe . dna probes were labeled with [ -32p ] dctp ( amersham biosciences , piscataway , nj , usa ) and preannealed with human coti dna and salmon testis dna ( 10.5 g / ml ) . prehybridization and hybridization were performed overnight at 37c in a solution containing 50% formamide , 10% dextran sulfate , 1% tween 20 , 2 ssc , and 10 mm tris - hcl ( ph 7.4 ) . after hybridization , the filters were washed at 65c with 1.0 ssc containing 0.1% sds ( sodium dodecyl sulfate ) and 0.5 ssc containing 0.1% sds . banding patterns were obtained by either exposure to x - ray film ( fuji film , tokyo , japan ) or through use of the molecular imager fx ( biorad ) . the qpcr was performed using sybr premix ex taq ( takara - bio ) and the light cycler system ( roche diagnostics ) , according to the manufacturers ' protocols . primers were designed with primer3 software ( http://primer3.sourceforge.net ) , and the size of pcr products was confirmed by the pattern of restriction enzyme digested fragments using the labchip dna 500 kit on the 2100 bioanalyzer ( agilent technologies , waldbronn , germany ) . two , 0.5 , and 0.125 ng of genome dna from an individual with cnv were used and the quantification of each amplicon was carried out at 45 cycles of pcr . the results were analyzed with light cycler data analysis software using a second derivative maximum model .",
"the main purpose of this paper is to report the accumulation of the data about highly polymorphic cnvs found in 5.0% of the individuals . ( the number of cnvs was 11 or more in each bac - spot . ) as shown in table 1 , 680 polymorphic cnvs were observed on 16 bac - regions . as described before , the results of two bac ( rp11 - 259n12 and rp11 - 121a8 ) were obtained from 133 unrelated individuals examined in stage ( 2 ) . southern blot analyses followed by pfge were carried out for the highly polymorphic cnvs . as shown by the typical cases in figures 1 and 2 , the patterns of these two bac clones ( rp11 - 79f15 and rp11 - 88l18 ) are shown in figures 1 ( rp11 - 79f15 ) and 2 ( rp11 - 88l18 ) as the typical examples . since each individual contained a different number of core segmental duplication units , each individual showed bands having different motilities . the results of qpcr conducted for two bac clone regions are described in figure 3 ( rp11 - 89b15 ) and figure 4 ( rp11 - 79o18 ) . for the former case , a part of a gene ( meox2 ) was deleted . on the contrary , for the latter case , the copy number of a part of the gene ( nsf ) increased , but the copy number of the gene ( wnt3 ) did not change . there are many segmental duplications which have already been summarized in a public data base , such as human genome segmental duplication database ( tcag database ; http://projects.tcag.ca/cgi-bin/variation/gbrowse ) , ucsc human genome browser ( ucsc database ; http:/genome.ucsc.edu / index.html ) , and ncbi map viewer ( ncbi database ; http://www.ncbi.nlm.nih.gov/mapview/map_search.cgi ) . the cnv data obtained in our studies are summarized in table 1 in addition to the presence or absence of cnvs already reported in the databases . one bac clone , named rp11 - 115g22 , was mapped on two chromosomes , 6 and 15 in tcag database , so it is likely that this clone is present on two discrete chromosomes . on the contrary , however , we accept the reports from the latter two databases and described that this clone was mapped on only chromosome no.15 . with respect to segmental duplications , 10 out of 16 ( about 63% ) were present in the above databases ( ucsc database , and ncbi database ) . it was noteworthy that the majority of bac clones containing our cnvs were known to overlap to at least one cnv reported in the database . however , that does not mean that our highly polymorphic cnvs are exactly the same as those reported in previous reports , since precise comparisons between our study and the other studies were not carried out . as mentioned before , there was very little information about the cnvs of 45 japanese individuals for which relatively large sizes of population have been systematically screened . we compared our data with the data of japanese including the hapmap project as reported by redon et al . ten out of 16 cnvs identified in our study were reported in the data reported by redon et al . , although we should emphasize again that the cnvs identified in our bac region are not exactly the same as those reported by redon et al . . cnvs identified in our study with lower numbers tend to not be identified in redon 's report . on the other hand , when our data are compared with redon 's oligo - data from affymetrix 500ea array conducted for japanese , only two cnvs were overlapped to our cnvs . as redon et al . mentioned in their report , the reason appears to be that oligo arrays have some limitations for a complicated genome , such as segmental duplication areas . \n\t\t\t\t\t we summarized the genes and disease - related genes in omim which overlap to the bac - clone region with our cnvs ( table 2 ) . in addition to those two categories , mrnas have been also reported in the database , but they are too many to describe here . all bac - clone regions contained at least one mrna , although the functions of a majority of those mrnas are not known yet ( data not shown ) .",
"we examined 213 unrelated japanese using bac - acgh and found a total of 680 cnvs on 16 bac clones . a large fraction of the regions involved in the cnvs observed in our study ( i.e. , 625 out of 680 ( 92% ) , table 1 ) have been reported previously in other studies listed in the database . a majority ( 63% ) of the cnvs had been found on the bac clones that overlapped with segmental duplication , suggesting the notion that segmental duplication might play a significant role in the creation of cnvs ( table 1 ) . in which they reported the sharing of cnvs among several populations , meaning those specific genomic imbalances either predated the dispersal of modern humans out of africa or arose independently in different populations . on the other hand , our cnvs , especially those showing high frequencies , were also identified by redon 's work . on the contrary , our cnvs showing low frequency , such as less than about 10% of individuals , were not observed in their work ( table 1 ) . that result suggests that those cnvs might be identified if the number of individuals examined by redon et al . were increased to the level of our study ( about 200 individuals ) . moreover , as described before , when our data compared with redon 's oligo - data conducted for japanese , only two of their cnvs were overlapped to our cnvs . although the oligo - based method tends to detect smaller cnvs ( about a few kilobases ) , this approach is less effective in tracking cnvs in genomic regions of complex structure , like segmental duplications , that are not sufficiently tagged by oligo targets . on the contrary , the bac platform can only identify larger cnvs ( > 40 kb ) , but this method has some advantage for detecting cnvs present in the regions of segmental duplications . the cnvs in the human genome are often associated with developmental disorders and susceptibility to diseases . large duplications and deletions have been known to be present within the human genome based initially on cytogenetic observations in the course of etiological studies of congenital malformations ( e.g. , [ 1 , 2 ] ) . the frequency of those duplications and deletions was presumed to be low and , for the most part , directly related to specific genetic disorders . a limited number of studies reported the presence of specific large duplications and deletions that were not apparently related to diseases ( e.g. , ) . reported that cgh on a bac - dna - based microarray could reliably detect single - copy gene decreases or increases from normal diploidy . following this , other array platforms , such as cdna , and oligo - nucleotide , have been developed and many data from them have been reported . as we mentioned before , many cnvs were reported to be closely related to disease phenotypes , and recent studies based on advanced molecular technologies , such as genomewide association studies [ 2729 ] and next generation sequencing [ 30 , 31 ] , reported that many genes appear to play important roles in the etiology of common diseases . we report our highly polymorphic cnvs in bac clones , which were reported to contain genes , expected to be related to phenotypic heterogeneity of each individual , based on the tcag database . we focused on genes reported in the above database , although many mrna were listed in the database in addition to genes ( table 2 ) . bac clone ( rp11 - 90a9 ) contains two genes : ankyrin repeat domain 34b ( ankrd34b ) and dihydrofolate reductase ( dhfr ) . a phosphoprotein encoded by ankrd34b is induced during bone marrow commitment to dendritic cells which play an important role in vertebrate immunity . dhfr genes were reported to be related to various malignancies including lymphoproliferative disorders such as systemic non - hodgkin 's lymphoma , primary central nervous system lymphoma ( pcnsl ) , and childhood acute lymphoblastic leukemia . those two genes are fully overlapped to the bac clone ( rp11 - 90a9 ) . it is likely that the cnvs might affect the copy number of those genes . one bac clone ( rp11 - 89b15 ) contains a gene mesenchyme homeobox 2 ( meox2 ) . the analyses by qpcr ( figure 3 ) demonstrated that the copy number of gene ( meox2 ) is deleted in the individual having cnvs detected by this bac clone . meox2 suppressed epithelial cell proliferation in cooperation with tgf - beta1 , and mediated induction of the cell - cycle inhibitor gene p21 . finally , the data from genome wide association study ( gwas ) reported that this is one of the candidate genes that might be associated with ischaemic stroke . another bac clone ( rp11 - 115g22 ) was mapped on the chromosomes 15 . ( chrna7 ) . that gene was used as a candidate target for examining interactions on the severity of adult attention deficit hyperactivity disorder ( adhd ) . moreover , it was reported that the gene is one of the candidates for alzheimer 's disease . the gene chrna7 is overlapped to the segmental duplication region of bac clone ( rp11 - 115g22 ) . many cnvs were listed in the databases mentioned as above , and those are overlapped to the gene . for those reasons , our cnv appears to be overlapped to the genes , and it might affect the copy number of gene chrna7 . a bac clone ( rp11 - 79o18 ) contains two genes which are n - ethylmaleimide - sensitive factor ( nsf ) and wingless - type mmtv integration site family , member 3 ( wnt3 ) . the qpcr results ( figure 4 ) demonstrated that the copy number of a gene ( nsf ) increased but no change was observed in the gene ( wnt3 ) . that result suggested that the cnv might affect the nsf gene , but not the wnt3 gene . however , there may be an opportunity for the cnvs to become a surrogate marker of wnt3 for the future association study between the cnv and some disease phenotype . the nsf gene is one of the essential components of membrane fusion machinery which is an important homeostatic process in eukaryotic cells . a recent study showed that the nsf gene is a good candidate marker for association studies for genetic risk underlying parkinson 's disease . the wnt3 gene 's single nucleotide polymorphisms ( snps ) were used as candidate markers for association studies of hemorrhagic stroke , hypertension , and chronic kidney disease . upregulation of the wnt gene family , including wnt3 , suggested involvement of the wnt 's canonical and/or noncanonical signaling pathway in chronic lymphocytic leukemia . a bac clone ( rp11 - 79f15 ) contains two genes : methyl - cpg binding domain protein 3-like 1 ( mbd3l1 ) and cell surface associated mucin 16 ( muc16 ) . the protein is localized to discrete areas in the nucleus , and expression appears to be restricted to round spermatids , suggesting that the protein plays a role in the postmeiotic stages of male germ cell development . on the other hand , muc16 is a member of the mucin gene family and encodes cancer antigen 125 ( ca125 ) which is a blood biomarker routinely used to monitor the progression of human epithelial ovarian cancer ( eoc ) , although its potential role in eoc is poorly understood . maintenance of an intact mucosal barrier , one of whose components is a gene product of muc16 , is critical to preventing damage and infection of wet - surfaced epithelia . as we demonstrated by southern blot analysis ( figure 1 ) , the polymorphism was caused by segmental duplications in the bac clone . the series of segmental duplications were on the 5-region of two genes ( mbd3l1 and muc16 ) . the cnvs do not affect the expression pattern of the genes , but these cnvs might be useful surrogate markers for future studies . glutamate receptor , ionotropic , ( ampa 2 ) . ampas are ligand - activated cation channels that mediate the fast component of excitatory postsynaptic currents in neurons of the central nervous system . since the size of the gene ( ampa 2 ) is larger than that of the bac clone ( rp11 - 231j7 ) , it is likely that the cnvs affect the copy number of the gene . a bac clone ( ctd-2100f13 ) contains two genes : rio kinase 3 ( yeast ) ( riok3 ) and niemann - pick disease , type c1 ( npc1 ) . npc1 can have a function in the egress of certain membrane - impermeable lysosomal cargo . the membrane - bound npc1 and soluble npc2 play an important role for the release of cholesterol from lysosomes . as a result of that mechanism , the gene is associated with obesity [ 5658 ] . the bac clone ( ctd-2100f13 ) is fully overlapped to both of the two genes ( riok3 and npc1 ) . the size of cnvs summarized in the databases shows that the reported cnvs were overlapped to both genes . we assumed that our cnvs may reflect the change of copy number of the genes themselves . since the genes mentioned are good candidate markers for enabling us to examine the etiology of common diseases and phenotypical heterogeneities among individuals , our highly polymorphic cnvs should be able to become good markers in future studies .",
"we are currently planning to examine the same population using a high - density oligo - array platform to accumulate more cnv data for japanese . the reason , as mentioned before , is that the bac platform and oligo methods complement each other . the oligo platform is known to be more effective in detecting smaller cnvs ( around a few kilobases ) , even though this approach is less effective in tracing cnvs in genomic regions of complex structure that are covered by the bac approach conducted in this study . we expect to construct a more definite japanese cnv database by the combination of bac- and oligo - platform arrays .",
"we conducted population screening for 213 unrelated japanese , and observed 680 highly polymorphic cnvs . the majority of the polymorphic cnvs presented on bac clones that overlapped with regions of segmental duplication , and had been previously reported in other publications . moreover , it is expected that the cnvs might be good surrogate markers for detecting etiological genes , even if cnvs did not directly affect the genes themselves ."
] | segmental copy - number variations ( cnvs ) may contribute to genetic variation in humans . reports
of the existence and characteristics of cnvs in a large japanese cohort are quite limited . we report the data from a large japanese population .
we conducted population screening for 213 unrelated japanese individuals using comparative genomic hybridization based on a bacterial artificial
chromosome microarray ( bac - acgh ) . we summarize the data by focusing on highly polymorphic cnvs in 5.0% of the individual ,
since they may be informative for demonstrating the relationships between genotypes and their phenotypes . we found a total of 680 cnvs at 16
different bac - regions in the genome . the majority of the polymorphic cnvs presented on bac - clones that overlapped with regions of segmental
duplication , and the majority of the polymorphic cnvs observed in this population had been previously reported in other publications .
some of the cnvs contained genes which might be related to phenotypic heterogeneity among individuals . |
[
"pain control is a primary concern across all care settings . though a universal care concern , pain is frequently viewed in the elderly as a normal process of aging.1 it is estimated that 49%83% of the 1.8 million residents in long - term care have acute or chronic pain , yet the recognition and treatment of pain still presents a challenge.26 recognizing a spectrum of pain behaviors beyond the traditional self - reporting methods , and increasing this knowledge among clinicians and support staff , is still a significant challenge in the provision of care to the elderly . predominantly , pain and cognitive decline often coexist in the elderly , with approximately 47% of residents in nursing homes having a diagnosis of dementia.2 pain assessment and treatment is complex , because residents have varying degrees of cognitive function , complicating how their needs are communicated . when these symptoms do coexist , little is known about the interaction of pain and cognitive decline , beyond laboratory imaging of the brain from a pathophysiological perspective.7,8 empirical studies both support and refute poor neurocognitive performance in conjunction with increased pain intensity.913 evaluating longitudinal data to assess if a relationship exists between pain and cognitive decline may assist in addressing these ambiguous findings . the aim of this research was to examine if concomitance exists between cognition and pain in the elderly residing in long - term care .",
"in a sample of nursing home residents , is cognitive decline a predictor of increased pain theoretical modeling using clinical data is a method used to evaluate resident characteristics and symptoms for inter - relationships between variables . modeling whether chronic pain leads to worsening or declining cognition , thereby contributing to worsened pain , would test the theoretical constructs of this relationship . the significance and correlation of these variables creates a foundation for building additional models , with secondary needs and resident outcomes . information of the relationship between pain and cognition adds to an understanding of how resident outcomes occur , and how quality initiatives can be approached .",
"evaluating cognition in conjunction with pain helps clarify if treating either symptom lessens the severity of the other , or if the symptoms are independent . organic brain disorders cause a progressive process of cognitive decline.14 if it is not possible for patients to regain a normal level of cognitive function , then the process is degenerative understanding the relationship between cognition and pain establishes how these two variables could be included in a theoretical framework . this enables resident outcomes to be more accurately measured through symptoms and treatments , determining the most effective and cost - conscious actions . if pain and cognition were parallel to and not antecedent of each other , a symptom model would be inaccurate , making it difficult to determine where and what symptoms could be treated . neglecting to include variables as a predictor of the other yields an incomplete clinical picture and theoretical model , making it difficult to find and measure care solutions because the root causes were not fully described . understanding the clinical pathways and interrelationships of resident symptoms is essential to the strategic planning and prioritizing of resident care needs . resource allocation in a struggling medicare - funded system is a difficult process to navigate . a new national institutes of health ( nih ) nursing home rating system incorporates pain as a quality measure , previously neglected in long - term resident care assessments.15,16 staff assessments , resident nonverbal cues , verbal complaints , facial expressions , and protective body movements were added as additional assessment items to more fully convey pain in this population . the use of federally - mandated resident assessment surveys is a cost - effective , time - efficient tool to gain insight into resident care needs , and an opportunity to increase our understanding of resident symptom pathways and the effectiveness of interventions used . using existing clinical data to test theoretical constructs adds valuable information to the validity of the models posited against real world , resident care data .",
"pain is an intricate sensory experience involving physiological , pathological , social , cognitive , and emotional factors.17,18 sensory process is modulated by cognitive load.1922 cognitive load helps to describe how hard it is for the individual to make sense of a stimulus . cognitive decline is progressive and may manifest as symptoms of aphasia ( language ) , apraxia ( perform directed acts ) , agnosia ( recognize objects ) , and/or disturbances in global functioning ( planning , organizing , sequencing , and abstract thoughts ) . considerable issues exist in the detection of pain in residents with moderate - to - severe cognitive impairment . a lower incidence of pain is reported as cognition declines , largely due to measurement and communication issues.23,24 the detection of pain behavioral cues by both formal and informal caregivers have marked differences depending on the resident s cognitive status , especially with the interpretation of body movements.25 a case report presented by ashpole and katz17 described a patient with a lifelong history of pain ( somatoform pain disorder ) . after the onset of dementia , the patient s self - reports of pain sharply declined . the pain symptoms were posited to be presenting as an altered mood ( eg , depression or irritability ) and cognitive decline . chronic pain is attributed to increased risk of depression in the elderly.2629 depressive symptoms are linked to decreased processing and motor function , but are not directly attributable to memory impairment.30 chronic pain results in changes to the resident s personality , social interactions , lifestyle , and functional status , impacting their quality of life.27 unresolved pain may result in a decline of the resident s quality of life causing delirium , depression , weight loss , social isolation , decreased activities of daily living , impaired gait , increased incidence of falls and comorbidities . quality of life declines with chronic untreated pain , especially as the intensity of pain increases.27 to date , the relationship between cognition and pain has been evaluated in case reports and pathophysiological studies , but not as a large - scale analysis of concomitance .",
"the concept of need - driven behaviors31 and the framework extending this model to include the consequences of need - driven , dementia - compromised behaviors32 serves as the theoretical platform for this research study . the need - driven behavior , ie , pain , is a coexisting symptom to cognitive state , a background factor . proximal issues , eg , a decline in physical state and social and environmental causes , precipitate improvement or exacerbation of the original need : resolving the resident s pain . the long - term consequence of unresolved , need - driven behaviors gives rise to additional behavioral symptoms and secondary unmet needs . future theoretical constructs , including the complete model , would further evaluate the relationship of secondary needs ( ie , depression , weight loss , social isolation , higher risk of falls , decreased activities of daily living , impaired gait ) , and how appropriate interventions mitigate the occurrence of secondary needs . appropriate interventions to primary needs could improve resident quality of life , use healthcare resources more efficaciously , and reduce staff burden . this theoretical framework enables the clinician to translate a complex system encompassing such factors as resident , caregiver , environment , and outcomes , into a measurable tool to improve care .",
"data were collected from 20012003 ( inclusive ) on residents residing in medicare- receiving nursing homes across the united states . minimum data set ( mds ) 2.033 annual assessments were used as the data source , including all residents aged 65 years . comatose residents were excluded from the sample , because key item sections ( sections b f ) could not be scored . noncompletion of the cognitive , communications / hearing , mood and behavior , and psychosocial well - being sections of mds adheres to the instructions given to assessors completing the resident assessment forms . the university of central florida institutional review board ( irb ) assigned an exempt status to the study . data collection was retrospective and no interventions were tested . the mds is a nationally required assessment providing information on the quality of care provided in nursing homes.16 core items from the mds instrument are used for care planning to trigger events or symptoms requiring intervention ( eg , pressure ulcers , delirium , cognitive loss , falls , and mood state ) . pain is not a care - planning trigger from the resident assessment protocol ( rap ) however , it is a quality measure.33 mds items have demonstrated good - to - excellent validity and reliability3436 with interrater and test retest reliability from 0.400.80 , depending on the item section.34 a composite score was used to detect pain from core mds items ( pain items analyzed are detailed in table 1 ) . the significance ( p = 0.01 ) and validity of the measures used in the pain index have been established in a previous pilot study.24 pain scores could range from 034 . the pain index includes fries pain scale37 ( ps ) items ( eg , j2a for pain frequency and item j2b , pain intensity ) . the ps items highly correlated with a pain sites summary score.24 additional dimensions of affective and behavioral items are also included to aid in detecting pain across cognitive states ( figure 2 ) . the cognitive performance scale ( cps ) was used to determine resident cognitive state . the cps instrument uses key mds items from sections b , c , and g of the resident assessment form.38,39 the cps measure correlates highly ( r 0.70 ) with the folstein mini - mental status examination ( mmse).40 the mds - derived cps scores were converted to mmse average totals . the averaged scores could range from 0.04 ( severe impairment ) to 24.9 , an intact cognitive state . a cps score of 6 converts to an average mmse of 0.4 , a 3 to 15.4 , and 0 to an mmse of 24.9.38 in validation testing of the cps scores against the mmse , a sensitivity of 0.94 and specificity of 0.94 were shown,40 indicating that the utility of this instrument is viable in determining resident cognitive status from mds - derived scores . descriptive statistics , correlations and repeated measures analyses of variance ( anovas ) were completed using spss software ( v 14.0 ; spss inc , chicago , il ) . the spss statistical modeling program , amos ( v 6.0 ; spss inc ) , was used to build the covariance model of pain and cognitive state at three different time intervals for 2001 , 2002 , and 2003 . pain and cognition scores were hypothesized to be inversely related . increasing pain score items indicated higher levels of pain . the covariance model was evaluated for integrity - of - fit statistics ; however , the model is simplistic , with only six discrete measures and five residual terms , so fit statistics would indicate a recently identified model . due to the required large sample size to run structural equation modeling , assessment of statistical power is complex.41,42 sample size requirements generally are the number of free parameters ( n = 17 ) times five to ten , to estimate sample size .",
"data were collected from 20012003 ( inclusive ) on residents residing in medicare- receiving nursing homes across the united states . minimum data set ( mds ) 2.033 annual assessments were used as the data source , including all residents aged 65 years . comatose residents were excluded from the sample , because key item sections ( sections b f ) could not be scored . noncompletion of the cognitive , communications / hearing , mood and behavior , and psychosocial well - being sections of mds adheres to the instructions given to assessors completing the resident assessment forms . the university of central florida institutional review board ( irb ) assigned an exempt status to the study .",
"the mds is a nationally required assessment providing information on the quality of care provided in nursing homes.16 core items from the mds instrument are used for care planning to trigger events or symptoms requiring intervention ( eg , pressure ulcers , delirium , cognitive loss , falls , and mood state ) . pain is not a care - planning trigger from the resident assessment protocol ( rap ) however , it is a quality measure.33 mds items have demonstrated good - to - excellent validity and reliability3436 with interrater and test retest reliability from 0.400.80 , depending on the item section.34 a composite score was used to detect pain from core mds items ( pain items analyzed are detailed in table 1 ) . the significance ( p = 0.01 ) and validity of the measures used in the pain index the pain index includes fries pain scale37 ( ps ) items ( eg , j2a for pain frequency and item j2b , pain intensity ) . the ps items highly correlated with a pain sites summary score.24 additional dimensions of affective and behavioral items are also included to aid in detecting pain across cognitive states ( figure 2 ) . . the cps instrument uses key mds items from sections b , c , and g of the resident assessment form.38,39 the cps measure correlates highly ( r 0.70 ) with the folstein mini - mental status examination ( mmse).40 the mds - derived cps scores were converted to mmse average totals . the averaged scores could range from 0.04 ( severe impairment ) to 24.9 , an intact cognitive state . a cps score of 6 converts to an average mmse of 0.4 , a 3 to 15.4 , and 0 to an mmse of 24.9.38 in validation testing of the cps scores against the mmse , a sensitivity of 0.94 and specificity of 0.94 were shown,40 indicating that the utility of this instrument is viable in determining resident cognitive status from mds - derived scores .",
"descriptive statistics , correlations and repeated measures analyses of variance ( anovas ) were completed using spss software ( v 14.0 ; spss inc , chicago , il ) . the spss statistical modeling program , amos ( v 6.0 ; spss inc ) , was used to build the covariance model of pain and cognitive state at three different time intervals for 2001 , 2002 , and 2003 . pain and cognition scores were hypothesized to be inversely related . increasing pain score items indicated higher levels of pain . the covariance model was evaluated for integrity - of - fit statistics ; however , the model is simplistic , with only six discrete measures and five residual terms , so fit statistics would indicate a recently identified model . due to the required large sample size to run structural equation modeling , assessment of statistical power is complex.41,42 sample size requirements generally are the number of free parameters ( n = 17 ) times five to ten , to estimate sample size .",
"select mds items were collected on 56,494 subjects with a mean age of 83 years . in total , the most prevalent diagnosis was arthritis ( 33.7% ) with 14.2% of the sample complaining of joint pain at the first data collection ( table 3 ) . over the 3-year period , the diagnoses of arthritis increased by 8% , and recorded joint pain dropped to 11.3% . cognition declined slightly over the 3-year period , as did pain ( table 4 ) . the majority of the sample , 60%67% , was moderately - to - severely cognitively impaired . a one - way repeated measure anova was calculated for cognition and pain . each variable compared subject scores at three different time intervals : 2001 , 2002 , and 2003 . a significant effect was found for cognition ( f(2,112986 ) = 5949.23 ; p < 0.01 ) and pain ( f(2,112986 ) = 271.82 ; p < 0.01 ) . follow - up protected t - test with repeated measures was used , because of limitations of spss software to run a post - hoc analysis for within - subject factors.43 a protected t - test between each measure inflates the risk of type i errors , so a significance level of 0.017 was used ( 0.05/3 measures ) instead of 0.05 . the follow - up protected t - test revealed that scores decreased significantly ( p < 0.017 ) for cognition1 ( mean [ m ] = 14.5 , standard deviation [ sd ] = 1.80 ) , cognition2 ( m = 13.7 , sd = 8.1 ) , and cognition3 ( m = 12.8 , sd = 8.3 ) , and decreased significantly ( p = 0.017 ) for pain1 ( m = 2.4 , sd = 2.9 ) , pain2 ( m = 2.34 , sd = 2.8 ) , and pain3 ( m = 2.18 , sd = 2.8 ) . a residual term was not attached to cognition1 ( figure 3 ) , because there was no predictor for these variables . the covariance models indicate pain ( 13 ) and cognition ( 13 ) measurements were stable over time with previous measures being a good predictor of subsequent measures . very little association was found between cognition and pain variables , regardless of the time interval . a concomitant relationship was significant ( p < 0.01 ) , but the associations were weak and ranged from absolute values of 0.03 to 0.08 ( table 5 ) . model 1 depicts cognitive decline as a predictor of increased pain , and model 2 represents the inverse model , increasing pain as a predictor of cognitive decline . the root - mean - square residual ( rmr ) is the averaged squared amount by which the sample variances and covariances differ in their estimates.42 a smaller rmr is preferred with a value of 0 indicating a perfect fit ( see table 6 ) . the goodness - of - fit index ( gfi ) , as it approaches 1 indicates a perfect fit . lewis index , and adjusted gfi could be attributed to the simplicity of the model , even though all three were approaching 1.0 .",
"the sample data do not confirm the presence of concomitance between pain and cognition in this long - term care population . these findings support kovach s model of consequences of need - driven , dementia- compromised behaviors ( c - ndb).32 cognition ( background factor ) and pain ( proximal factor ) exist as contributing aspects of how need - driven behaviors are manifested and communicated . kovach s c - ndb model serves as the template for understanding how symptoms and environmental factors interact . failing to identify resident care needs is not in isolation of the resident , but is a complex system involving clinician , support staff , environmental factors , and the resident . mds can be used as a reliable tool to track resident characteristics and outcomes over time . reporting was consistent for cognition and pain over the 3-year period , and considerable fluctuations in recorded values of cognition and pain did not occur . because pain assessments were recorded annually , differences in pain would be anticipated . the findings showed a gradual decline in recorded pain over the 3-year period , as cognition also declined . this raises concern , because these findings may support previous research , indicating pain is underreported and undertreated in residents with cognitive decline.4446 reductions in pain scores at the third interval may also be attributable to residents having less pain , or residents having received appropriate interventions for their pain . differences in pain would be expected with recent events like fracture , surgery , or falls . partitioning this group of residents into a separate cohort could evaluate the consistency of pain reporting , and pain measures specific to these acute events . until clinicians and support staff increase their awareness of affective , cognitive , and behavioral indicators of pain , the reliability of mds for pain measures will continue to be a concern . results suggest the importance of assessing memory function when managing physiologically distressed residents , because this information aids in determining the best methods to assess resident pain.26,47,48 over the 3-year period , declines in cognitive status occurred which were consistent with the progression of organic brain disease . acute declines in cognition may be indicative of a change in mental status not attributable to the progression of a pre - existing disease , but the onset of infection ( ie , urinary tract infection , pneumonia , or sepsis ) , or psychiatric illness . further research could look at specific diagnoses and the consistency of cognitive decline and pain measures over time . additional variables like the use of multiple medications ( eg , polypharmacy ) , or certain classes of medications , ie , antipsychotics or hypnotics , may yield valuable information about the contributing factors to resident decline , and create an index of outcomes for pharmacoeconomic and clinical data supporting resident care guidelines and health policy reform . supplemental theoretical modeling could evaluate latent growth models , with predictors combining pain , cognition , age , sex , and facility characteristics , enabling a greater understanding of pain and cognition in the elderly beyond this concomitance study . additionally , research examining a growth curve model , plotting parallel points in time , would provide valuable information to trends in data distribution and would clarify if the model were polynomial . one limitation of this method that of using scores derived only from annual assessments of cognition and pain is that it measures only a single point in time , and does not fully capture the day - to - day variation in resident scores . additional research could examine the non - linear relationship of these two variables , to determine if a nonlinear relationship exists . additionally , composite pain scores were used to increase the ease of score totaling from individual score items , to improve the use of the pain indicators in the long - term care setting . further research is required to examine the effect of medication use by class , and how other comorbidities influence pain measures the majority of the population assessed was not experiencing pain , and cognitive groups were also unequal . while the population demographics are representative of nursing homes , very distinct population demographics ( ie , sex , race , educational background , socioeconomic factors ) limit generalizability beyond this setting . variations in the interpretation of reliability measures between those rating the mds sections for mood and behavior have been reported.49,50 the research was limited to the available items in mds , and these items might not capture , define or describe all pain symptoms . even with the further criteria added to measure pain across cognitive states , there remain dimensions of pain still to be discovered and defined .",
"this research sought to ascertain whether in fact a relationship exists between pain and cognition , and if so , to gain preliminary insight into the relationship . investigating whether cognition is a predictor of pain in a concomitant relationship helped to define how secondary patient outcomes might be mediated . further research should be used to link cognition , resident ability to communicate , and levels of pain for significance with quality of life measures like depression , disturbances in gait , weight loss , decreased activity , declines in functional status , or social isolation . in the case of most organic brain diseases , instead of returning to a normal level of cognitive functioning , a progressive decline occurs . pain is a cycle that can be intervened upon , and symptoms can be lessened through medicinal and non - medicinal treatments , improving resident comfort . with an understanding of the role of cognition in identifying how pain is communicated , we can improve pain detection and uniformity of measures to ameliorate symptoms . the significance of confirming , theoretical frameworks with advanced multivariate analysis is an opportunity to evaluate interactions of key variables . a global assessment of concomitance between pain and cognition offers a unique insight towards a better understanding of the relationship of pain and cognition in a general nursing home population ."
] | purposeto examine if a concomitant relationship exists between cognition and pain in an elderly population residing in long - term care.background/significanceprior research has found that cognitive load mediates interpretation of a stimulus . in the presence of decreased cognitive capacity as with dementia , the relationship between cognition and increasing pain is unknown in the elderly.patients and methodslongitudinal cohort design . data collected from the minimum data set - resident assessment instrument ( mds - rai ) from the 20012003 annual assessments of nursing home residents . a covariance model was used to evaluate the relationship between cognition and pain at three intervals.resultsthe sample included 56,494 subjects from nursing homes across the united states , with an average age of 83 8.2 years . analysis of variance scores ( anovas ) indicated a significant effect ( p < 0.01 ) for pain and cognition , with protected t test revealing scores decreasing significantly with these two measures . relative stability was found for pain and cognition over time . greater stability was found in the cognitive measure than the pain measure . cross - legged effects observed between cognition and pain measures were inconsistent . a concomitant relationship was not found between cognition and pain . even though the relationship was significant at the 0.01 level , the correlations were low ( r 0.08 ) , indicating a weak association between cognition and pain.conclusionunderstanding the concomitance of pain and cognition aids in defining additional frameworks to extend models to include secondary needs , contextual factors , and resident outcomes . cognitive decline , as with organic brain diseases , is progressive . pain is a symptom that can be treated and reduced to improve resident quality of life . however , cognition can be used to determine the most appropriate method to assess pain in the elderly , thereby improving accuracy of pain detection in this population . |
[
"peritoneal inclusion cyst ( pic ) is defined as an aggregate mass of variable sized , fluid - filled mesothelial - lined cysts of the pelvis , upper abdomen and retroperitoneum 1 . benign ( multi ) cystic peritoneal mesothliomas , inflammatory cysts of the peritoneum , and postoperative peritoneal cysts , 1 . the pathogenesis is not well understood , yet they are thought to arise secondary to intra - abdominal inflammation and subsequent cyst formation with serous fluid derived from the ovarian stroma 3 . the most likely mechanism is that the small amount of follicular fluid extracted in the normal ovary in the ovulatory phase is mostly absorbed 4 , but the injured peritoneum due to pelvic inflammatory disease or postoperative adhesion reduces the absorption capacity and the peritoneal fluid gradually accumulates 5 . it is thought that pic is formed by the accumulation of unabsorbed follicular fluid secreted by the normal ovary in the adhered peritoneum , and the latter is caused by pelvic inflammation and injury 6 . the fact that the main peak incidence of pic is the premenopausal women gives support that active ovarian tissue contributes the formation of pic . the treatment options are observation , hormonal management , imaging - guided aspiration , image - guided sclerotherapy and surgical excision 1 , 7 - 10 . although complete surgical resection is recommended by some authors 11,12 , recurrence after surgical treatment has been reported in about half of the patients 1 . however , most studies have been case reports and small series , and there is a lack of long - term follow - up data the advantages of laparoscopic surgery include decreased postoperative pain , a short recovery period and improved cosmesis . however , the disadvantages include a longer operating time and the technical difficulty of laparoscopic procedures . the objective of this study is to compare the laparoscopy with laparotomy for the treatment of pic with respect to various demographic , perioperative and postoperative parameters .",
"we conducted a retrospective study involving patients who were operated on at the saint vincent hospital , catholic medical college , during the period january 2003 - december 2009 . the preoperative diagnosis was made by transvaginal ultrasonography , computer tomography ( ct ) or magnetic resonance imaging ( mri ) . the size of the cyst was defined as the mean diameter of the longitudinal and transverse dimensions and the height of the cyst . the outcome was assessed according to the operative time , the estimated blood loss , the serum ca-125 level , the number of septations of the cyst , the difference of hemoglobin between pre - operation and the one day post - operation , the length of hospital stay , the perioperative and postoperative complications , and recurrence of pic . the operating time was defined as the time from entry into the operating room to the time of the delivering the patient to the postoperative anesthesia care unit . for each patient , subsequent follow - up evaluations were performed by clinical assessment and an ultrasound examination in the outpatient clinic . the histories of previous abdominal and pelvic surgery were total hysterectomy , abdominal myomectomy , cesarean section , an operation on the ovary and fallopian tube , appendectomy and surgery of the small and large bowel . we categorized the follow - up results of the operation to complete remission , clinically successful and recurrence . if a patient 's symptoms improved and the mean diameter of the longitudinal and transverse dimensions of a cyst decreased by more than 50% , then the operation was considered as clinically successful . however , if the mean diameter of a cyst increased by over 50% the operation was considered as recurrence 13 . all the data was described as means standard deviation ( sd ) or numbers ( percentages ) . recurrence was calculated from the date of diagnosis to the date of recurrence or the last follow - up . differences in recurrence between two groups and other characteristics in terms of univariate analysis were assessed with the log - rank test . after disinfection and sterile coverage , we started with a small horizontal incision for placing the veres needle . after insufflation of co2 to a limited pressure of 12mhg , a 10 mm re - usable trocar was placed and the camera was inserted . however , when peritoneal adhesion was suspected by lifting the abdomen around the umbilicus , we tried the open method for entry of a 10 mm trocar 14 . the whole abdominal cavity , including the peritoneum , liver , gall bladder , stomach , spleen , appendix and bowels , was inspected for pathologies . further two 5 mm trocars were placed laterally right and left . after placing the patient in a head - down position , the bowels were moved out of the pelvic and the inner genital organs were inspected . the peritoneum was incised over the cyst with scissors or monopolar cutting with low voltage . with the use of meticulous dissection close to the abdominal and pelvic structures , the delineated cyst wall was mobilized and resection was done . the cyst was placed into an endobag ( sejong corporation , incheon , korea ) , and the sac and cyst were extracted through the 10-mm port . somerville , nj , usa ) was applied to the site of the former adhesion to prevent further adhesion . after deflating the intra - abdominal carbon dioxide gas , laparotomy was done either through a horizontal incision above the symphysis or by vertical incision depending on the size of the cyst and the previous operative scar . opening and inspection of the abdominal cavity , and pushing the bowels out of the pelvis were done . the peritoneum was incised over the cyst with mayo scissors or metzenbaum . with the use of meticulous dissection close to abdominal structures , the barrier agent interceed ( ethicon inc . , somerville , nj , usa ) was applied to the site of the former adhesion to prevent further adhesion . after bleeding control ,",
"the operation was done under general anesthesia with the patients in the trendelenburg position . after disinfection and sterile coverage , we started with a small horizontal incision for placing the veres needle . after insufflation of co2 to a limited pressure of 12mhg , a 10 mm re - usable trocar was placed and the camera was inserted . however , when peritoneal adhesion was suspected by lifting the abdomen around the umbilicus , we tried the open method for entry of a 10 mm trocar 14 . the whole abdominal cavity , including the peritoneum , liver , gall bladder , stomach , spleen , appendix and bowels , was inspected for pathologies . further two 5 mm trocars were placed laterally right and left . after placing the patient in a head - down position , the bowels were moved out of the pelvic and the inner genital organs were inspected . the peritoneum was incised over the cyst with scissors or monopolar cutting with low voltage . with the use of meticulous dissection close to the abdominal and pelvic structures , the cyst was placed into an endobag ( sejong corporation , incheon , korea ) , and the sac and cyst were extracted through the 10-mm port . somerville , nj , usa ) was applied to the site of the former adhesion to prevent further adhesion . after deflating the intra - abdominal carbon dioxide gas ,",
"laparotomy was done either through a horizontal incision above the symphysis or by vertical incision depending on the size of the cyst and the previous operative scar . opening and inspection of the abdominal cavity , and pushing the bowels out of the pelvis were done . the peritoneum was incised over the cyst with mayo scissors or metzenbaum . with the use of meticulous dissection close to abdominal structures , somerville , nj , usa ) was applied to the site of the former adhesion to prevent further adhesion . after bleeding control ,",
"a laparoscopy was performed in 35 patients and a laparotomy was performed in 48 patients . of the 35 patients , 4 underwent laparoscopic adhesiolysis of the pic and 31 underwent laparoscopic complete resection of the pic . of the 48 patients in the laparotomic group , 11 underwent only adhesiolysis of the pic , and 37 underwent complete resection of the pic . one case in the laparoscopy was converted to laparotomy due to severe pelvic adhesion and excessive bleeding . no significant difference was found in the mean age , parity , the mean number of previous abdominal operations , the type of operation , and the mean cyst diameter , the duration since the last operation and the serum ca 125 level between the two groups . in both group , there were a significantly shorter mean length of hospital stay , less estimated blood loss and a lesser difference between the preoperative and the one day postoperative hemoglobin level in the laparoscopic group compared to that of the laparotomic group ( p=0.037 , p=0.047 and p=0.040 , respectively ) . the mean operative time was lower in the laparoscopic group than that of the laparotomic group , but there was no statistical significance ( p=0.053 ) . the intraoperative , short - term and long - term complications are listed in table 3 . the total complication rate was lower in the laparoscopic group than that in the laparotomic group ( p=0.037 ) . in the laparoscopic group , two patients had postoperative ileus . they received conservative care without further procedures . in the laparotomic group , 4 cases of wound problems including 2 case of wound seroma , 1 case of wound disruption , and 1 case of ventral hernia , 2 cases of postoperative ileus and 2 cases of perioperative transfusion . of the 4 patients with wound problem , 2 underwent wound revision and hernia repair . conservative care and intravenous antibiotics therapy were done for the 2 cases of postoperative ileus . both the intrapoerative bladder injury and small bowel injury were detected intraoperatively and primary repair was then done . five cases recurred in the laparoscopic group and 10 cases recurred in the laparotomic group ( table 4 ) . of the 5 cases in laparoscopic group , 2 cases underwent ultrasonography - guided aspiration and 3 cases underwent repeat laparoscopic cyst resection without further recurrence . of the 10 recurred cases in laparotomic group , 2 cases underwent ultrasonography - guided aspiration and 1 case underwent laparoscopic cyst resection without further recurrence . two cases had underlying pelvic endometriosis ( stage iv ) and 1 case had underlying pelvic inflammatory disease . , we performed a univariate analysis to determine the impact of age , the mean number of previous abdominal operations , the type of operation , the number of septations in the cyst and concurrent disease on recurrence . there was no statistical difference of the recurrence rate between two groups on the cox proportional hazards model ( p=0.209 ; fig.1 ) .",
"pic is a rare tumor of an unknown origin , and it is most frequently encountered in women of reproductive age . some investigators have mentioned that pic may form as a result of a localized peritoneal fluid collection due to the presence of peritoneal adhesions , and these peritoneal adhesions have a relation to previous pelvic surgery , endometriosis or pelvic inflammatory disease . however , others have said that a pic has a neoplastic etiology according to its recurrence , as well as according to the gross tumor - like appearance of these lesions 11 . the current literature is mostly based on case reports and small series and a uniform treatment approach and long - term follow - up data are lack . observation with serial imaging is a feasible management option for asymptomatic patients with an incidentally discovered pic 15 . image - guided aspiration provides fluid for cytologic evaluation and it can lead to resolution of symptoms with minimal intervention and few complications . however , conservative management of a cystic lesion has not been effective and a tissue sample is required for making the histologic diagnosis and a biopsy is recommended if there is any suspicion of malignancy 16 . birch et al . reported that approximately 50% of cysts recur after aspiration , and aspiration may provide temporary relief of symptoms but not a histologic diagnosis 10 . sclerotherapy using of an intracystic catheter to instill either ethalol or povidone - iodine is a less invasive method and it has been used for the treatment of cysts in the abdominal organs and for treating postoperative lymphoceles 9,17 . reported that 30 cases of aspiration and sclerotherapy under ultrasonography and/or fluoroscopy guidance with absolute ethanol or 10% povidone - iodine showed a 90% of success rate and there was complete resolution 18 . however , studies with the long - term data , follow - up and complication rate of sclerotherapy are lack . complications of sclerotherapy may occur such as viscus perforation , infection , bleeding , or the spillage of cystic fluid and/or sclerosant into the peritoneal cavity . long - term data regarding the procedural complications or effects of sclerotherapy are also not available 9,13 . although not a pic , takayasu et al . reported a case of a hepatic benign cyst that developed into adenocarcinoma after sclerotherapy with ethanol 19 . the recommended treatment is complete resection and the importance of surgery for making the diagnosis and treatment is supported by most authors 10,12 . the advantage of surgical management is that a definitive diagnosis is possible by obtaining a histologic specimen . reported that successful laparoscopic removal of a well - differentiated papillary mesothlioma of the peritoneum in a 46-year - old woman 20 . nezhat et al . reported successful treatments of 3 cases of peritoneal mesothlioma associated with pelvic endometriosis 21 . pic is associated with severe adhesion to the adjacent visceral organ and peritoneal wall . for resection of pic , abdominal and pelvic adhesiolysis adhesiolysis by laparoscopy and laparotomy can be very time - consuming and technically difficult and it is best performed by an expert surgeon . however , laparoscopy has some advantages compared to laparotomy in our experience . first , despite lengthy laparoscopy , most patients are discharged earlier than when undergoing a laparotomy , they experience minimal complications and they return to full activity within one and two weeks of surgery 22 . second , in laparoscopy , the port wound and the wound at the target of dissection are far away from each other , so the chances of adhesion to the peritoneum are less because for adhesion , both layers , which tend to adhere to each other , should be in contact 23 . third , in laparoscopy there is less chance of drying of tissue because the inside environment is cut off from the outside . fourth , the excellent visualization and magnification of laparoscopy allowed better access and exposure for further adhesiolysis 22 . our study showed that laparoscopy was superior to laparotomy for the mean estimated blood loss , the mean difference of hemoglobin , the mean length of hospital stay , and the complication rate . however , there is no significant statistical difference for the recurrence rate of pic between two groups . first , the surgical procedure was performed by several gynecologists with different levels of experience , and the participation of multiple operators may have affected the results . we preferred laparoscopy for the direct inspection of pathology and to make the differential diagnosis of malignancy . a comparative study between laparoscopy and sclerotherapy as a minimal invasive technique may be necessary . however , our study is the first study that has compared laparoscopy with laparotomy for the treatment of pic , and we showed that the laparoscopy is superior to the laparotomy . laparoscopy by well - skilled surgeons may decrease the mean operative time , the rate of conversion to laparotomy and the surgical complication . in conclusion , laparoscopic surgery is a safe , effective and reliable method for the treatments of pic . laparoscopic surgery may reduce the perioperative and postoperative complications and hasten the recovery and return to routine activity . however , for the evaluation of recurrence rate , it is necessary to perform a long - term , larger - scale study ."
] | objectives : peritoneal inclusion cyst ( pic ) is defined as a fluid - filled mesothelial - lined cysts of the pelvis and it is most frequently encountered in women of reproductive age . the treatment options are observation , hormonal management , imaging - guided aspiration , image - guided sclerotherapy and surgical excision . the objective of this study is to compare between the laparoscopic and laparotomic surgery for the treatment of pic.methods : thirty - five patients with laparoscopy and forty - eight patients with laparotomy were included in the study . we compared the perioperative and postoperative data , the complications and the recurrence between the two groups.results : there was a significantly reduced mean length of the hospital stay , estimated blood loss and complication rate in the laparoscopic group as compared to that of the laparotomic group ( p=0.037 , p=0.047 and p=0.037 respectively ) . there was also no statistical difference of recurrence rate between thelaparoscopic and laparotomic groups on the cox proportional hazards model ( p=0.209).conclusion : our study showed that laparoscopy was superior to the laparotomy for the mean estimated blood loss , the mean length of the hospital stay and the complication rate except for the recurrence rate . |
[
"obesity is currently considered to be one of the major public health problems worldwide ; consequently , the number of obese women who become pregnant increases each year . this condition is related with several diseases , such as hypertension , type-2 diabetes mellitus , dyslipidemia , metabolic syndrome , cardiovascular disease , and hepatic steatosis [ 35 ] . obesity is also associated with adverse pregnancy outcomes such as pre - eclampsia , gestational diabetes mellitus ( gdm ) , caesarean delivery , macrosomia , neural tube defect , thromboembolism , postpartum hemorrhage , puerperal infection , and increased risk of maternal and perinatal mortality [ 615 ] . according to the national health and nutrition examination survey , in the united states , more than half of pregnant women are overweight or obese . the risks of most of these complications are amplified by excessive weight gain during pregnancy , which proportionally increases the degree of obesity . changes in the metabolism of carbohydrates and lipids occur during normal pregnancy to ensure a continuous supply of nutrients to the fetus despite non - continuous food intake by pregnant women . these changes are progressive and promote the growth of adipose tissue during early pregnancy , which is followed by the induction of insulin resistance ( ir ) and lipolysis during late pregnancy [ 1719 ] . in humans , leptin is the protein product of the ob gene and is primarily synthesized in adipose tissue . it sends an afferent signal to the central nervous system , where it acts to control food intake , insulin secretion , glucose utilization , glycogen synthesis , fatty acid metabolism , and in the regulation of adipose tissue , energy expenditure , body weight , and appetite . during pregnancy , leptin is also synthesized by the placenta and plays an important role in regulating maternal energy metabolism and the induction of physiological insulin resistance . elevated levels of this adipocytokine are also associated with gdm [ 22,2426 ] , pre - eclampsia , and intrauterine growth restriction ( iugr ) . leptin levels increase progressively during pregnancy , and this increase is related to body fat and to the regulation of placental growth , transfer of nutrients , angiogenesis , and trophoblastic invasion . however , these relationships are complex and have yet to be fully clarified . in this study , we evaluated changes in serum leptin levels during pregnancy in overweight / obese and normal - weight pregnant women . in addition , we evaluated the percent and total body weight gain as possible factors influencing the levels of this adipocytokine in obese and non - obese pregnant women .",
"we conducted a prospective , longitudinal study in which included 42 pregnant women in low - risk prenatal care between september 2010 and june 2011 at the teaching hospital and maternity in juiz de fora , minas gerais , brazil . in total , thirty of them were excluded during the study for various reasons , including voluntary withdrawal from prenatal care in the institution ( n=11 ) , withdrawal of consent to participate in the study ( n=3 ) , referral to high - risk prenatal care ( n=8 ) , preterm delivery ( n=4 ) , and spontaneous abortion ( n=4 ) . inclusion criteria were : age greater than or equal to 20 years , gestational age less than 12 weeks at the beginning of prenatal confirmed by ultrasonography , and singleton pregnancy . exclusion criteria were : hypertension , type 1 or 2 diabetes , drug addiction , smoking , and chronic systemic diseases . at the first prenatal visit , all participants read and signed the consent form according to resolution 196/96 of the brazilian national health council and the helsinki declaration of 1975 , revised in 1983 . the study was approved by the ethics committee of the federal university of juiz de fora ufjf , opinion n 0240/2010 . all data collection was conducted exclusively by the physician responsible for the study . apart from routine visits , the pregnant women underwent clinical and laboratory evaluations 3 times during pregnancy ( gestational weeks 912 , 2528 , and 3437 ) . socio - demographic and clinical / obstetric characteristics were obtained by data collection form and included age , race , marital status , level of education , number of pregnancies , number of births , number of abortions , history of pre - eclampsia , gdm , fetal macrosomia , and any stillbirths from previous pregnancies . we also collected patients family histories of hypertension , pre - eclampsia , diabetes , dyslipidemia , and obesity . weight was measured in kilograms ( within 100 grams ) using a filizola calibrated electronic balance ( personal line 200 ; filizola s.a . pre - pregnancy weight was obtained by patient records , and was collected during the first prenatal visit . pre - pregnancy bmi was calculated from the ratio of body mass ( kg ) to squared height ( m ) and classified into 2 groups non - overweight ( bmi < 25 kg / m ) and overweight / obese ( bmi 25kg / m ) based on criteria from the world health organization . gestational ages were verified using the parameters collected from ultrasounds performed between weeks 11 and 13 of pregnancy . if necessary , the results were used to retrospectively correct the calculations made on the first visit , which were based on last menstrual period as determined by the patient . total weight gain was calculated by subtracting the weight measured at the last prenatal visit before birth , performed between weeks 37 and 40 , from the pre - pregnancy weight reported at the first visit . based on the total weight gain and pre - pregnancy weight of the patient , we calculated the percent weight gain . during each study visit for prenatal care , we obtained a maternal serum sample , which was preserved in triplicate in labeled 2-ml cryogenic tubes ( cral , sp , brazil ) and stored in a thermo scientific freezer ( model 902 ; thermo electric scientific , winchester , va , usa ) at 80c for subsequent analysis . serum leptin levels ( ng / ml ) were analyzed with enzyme - linked immune sorbent assays ( elisa ) using a human leptin elisa kit ( kac2281 ; invitrogen corporation , carlsbad , ca , usa ) according to the manufacturer s instructions . the inter - assay coefficient of variation was 3.9% for 150.6 pg / ml and 5.3% for 240.7 the readings were taken using an elisa microplate reader ( expert plus ; asys hitech , eugendorf , austria ) at 450 nm . these measurements were performed by researchers in the clinical immunology and immunopathology laboratory at the center for reproductive biology , federal university of juiz de fora . for the statistical analyses , pregnant women were divided into 2 groups according to their bmis ( < 25 kg / m or 25 kg / m ) . next , linear regression analyses were performed using maternal weight vs. gestational age , and leptin levels vs. gestational age . to compare leptin levels across the 3 time periods defined in this study , a 1-sided anova was performed on the 2 groups , which was followed by a post hoc bonferroni test . subsequently , we used the t test to compare absolute weight gain and percent weight gain between the 2 groups . all of the statistical analyses were performed using graphpad prism 5.0 ( graphpad software , inc . , la jolla , ca , usa ) .",
"the anthropometric characteristics collected for the study group included the patients weights and heights . weight was measured in kilograms ( within 100 grams ) using a filizola calibrated electronic balance ( personal line 200 ; filizola s.a . pre - pregnancy weight was obtained by patient records , and was collected during the first prenatal visit . pre - pregnancy bmi was calculated from the ratio of body mass ( kg ) to squared height ( m ) and classified into 2 groups non - overweight ( bmi < 25 kg / m ) and overweight / obese ( bmi 25kg / m ) based on criteria from the world health organization . gestational ages were verified using the parameters collected from ultrasounds performed between weeks 11 and 13 of pregnancy . if necessary , the results were used to retrospectively correct the calculations made on the first visit , which were based on last menstrual period as determined by the patient . total weight gain was calculated by subtracting the weight measured at the last prenatal visit before birth , performed between weeks 37 and 40 , from the pre - pregnancy weight reported at the first visit . based on the total weight gain and pre - pregnancy weight of the patient , we calculated the percent weight gain .",
"during each study visit for prenatal care , we obtained a maternal serum sample , which was preserved in triplicate in labeled 2-ml cryogenic tubes ( cral , sp , brazil ) and stored in a thermo scientific freezer ( model 902 ; thermo electric scientific , winchester , va , usa ) at 80c for subsequent analysis . serum leptin levels ( ng / ml ) were analyzed with enzyme - linked immune sorbent assays ( elisa ) using a human leptin elisa kit ( kac2281 ; invitrogen corporation , carlsbad , ca , usa ) according to the manufacturer s instructions . the inter - assay coefficient of variation was 3.9% for 150.6 pg / ml and 5.3% for 240.7 the readings were taken using an elisa microplate reader ( expert plus ; asys hitech , eugendorf , austria ) at 450 nm . these measurements were performed by researchers in the clinical immunology and immunopathology laboratory at the center for reproductive biology , federal university of juiz de fora .",
"for the statistical analyses , pregnant women were divided into 2 groups according to their bmis ( < 25 kg / m or 25 kg / m ) . next , linear regression analyses were performed using maternal weight vs. gestational age , and leptin levels vs. gestational age . to compare leptin levels across the 3 time periods defined in this study , a 1-sided anova was performed on the 2 groups , which was followed by a post hoc bonferroni test . subsequently , we used the t test to compare absolute weight gain and percent weight gain between the 2 groups . all of the statistical analyses were performed using graphpad prism 5.0 ( graphpad software , inc . , la jolla , ca , usa ) .",
"the socio - demographic and clinical / obstetric characteristics of the cohort are described in table 1 . we found that 95.2% ( 40/42 ) of the women were between 20 and 30 years of age , 66.7% ( 28/42 ) were nulliparous , 95.2% ( 40/42 ) had no history of pre - eclampsia during previous pregnancies , and 100% had no previous history of gdm , macrosomia , or stillbirths . as for family history ( fh ) , 83.3% ( 35/42 ) did not have a fh of pre - eclampsia , 76.2% ( 32/42 ) did not have a fh of dyslipidemia , and 78.6% ( 33/42 ) did not have a fh of obesity . figure 1 shows that , in the course of gestation , there was a progressive increase in maternal weight gain in both the non - overweight ( bmi < 25 kg / m ) and the overweight / obese ( bmi 25 kg / m ) groups of pregnant women . there was a progressive increase in maternal serum levels of this adipocytokine in both groups . however , this increase was significantly greater in the non - overweight group ( bmi < 25 kg / m ) ( figure 2 ) . additionally , when the mean serum leptin levels were compared during the first ( t1 ) , second ( t2 ) , and third ( t3 ) trimesters of pregnancy , we concluded that there were significant increases ( t1 vs. t2 , p<0.01 and t1 vs. t3 , p<0.001 ) in leptin levels in group 1 ( non - overweight or g1 ) , as seen in figure 3 . however , we did not observe a significant increase in leptin levels ( p>0.05 ) during the 3 trimesters in group 2 ( overweight / obese or g2 ) . when we analyzed the total weight gain during pregnancy in the 2 groups , we found that g1 had a greater total weight gain than g2 , although the difference between the 2 groups was not significant ( p>0.05 ) ( figure 4a ) . however , when we compared the percent weight gain during pregnancy between g1 and g2 , there was a significantly higher percent weight gain in g1 compared to g2 ( p<0.001 ) ( figure 4b ) .",
"this study contributes to the body of knowledge available on the topic of evaluation of obesity in pregnancy and its association with serum leptin levels . recently , obesity and leptin have been the subject of many studies [ 3032 ] , but there is still a significant gap in knowledge about the behavior of this hormone in women who were not overweight and those who were overweight / obese during pregnancy . from a methodological standpoint , this study provides adequate control of many intervening variables , such as the monitoring of all volunteers by a single physician , which minimizes the possible variations in data collection . the changes in serum leptin levels during pregnancy have been well established through many studies for nearly 2 decades [ 3234 ] . however , there are still many gaps in knowledge about the levels of this adipocytokine in pregnant women in relation to bmi and gestational weight gain . we found that serum leptin levels in non - overweight ( bmi < 25 kg / m ) and overweight / obese ( bmi 25 kg / m ) pregnant women increased progressively throughout pregnancy and the mean leptin concentrations were significantly higher in overweight / obese compared to normal - weight pregnant women . similar findings were also reported by some recent studies that directly related leptin levels with groups of obese and non - obese pregnant women [ 25,3538 ] . our results also suggest that the leptin levels in non - overweight women were significantly higher ( p<0.001 ) during pregnancy compared to overweight / obese women ( figures 2 and 3 ) . this seems paradoxical , considering that probably the largest increase in leptin should have been detected in patients with overweight / obesity . similar data were also observed by misra in the analysis of the serum leptin levels in non - overweight and in overweight / obese pregnant women . the authors concluded that the overweight / obese group had significantly higher serum leptin concentrations than the non - overweight group during pregnancy ( p<0.01 ) and , although these concentrations increased significantly across gestation for both groups , the rate of increase was significantly smaller in overweight / obese women ( p<0.05 ) . they also concluded that factors other than fat mass alone can influence leptin concentrations in overweight / obese women compared to non - overweight women during pregnancy . this study suggests a hypothesis to explain this increase in leptin levels in the non - overweight group . analyzing the total weight gain and percent weight gain in both groups of pregnant women in our cohort , the results suggest that g1 had a greater total weight gain than g2 , although the difference between the 2 groups was not significant ( p>0.05 ) ( figure 4a ) . furthermore , when we analyzed both groups for their percent weight gain during pregnancy compared to their pre - pregnancy weight , the non - overweight patients had a significantly greater percent weight gain ( p<0.001 ) compared to the overweight / obese women ( figure 4b ) . our finding suggests that the adipose tissue in women with a bmi < 25 kg / m exhibits a higher percent increase during pregnancy compared to women with a bmi 25 kg / m . this increase in adipose tissue can directly influence the production of adipocytokines and other inflammatory mediators by adipocytes . these findings suggest a hypothesis to explain the increase in leptin levels in non - overweight group a limitation of this study was that the pre - pregnancy bmi was calculated using the pregnant woman s self - reported weight at the first prenatal visit , and this information was subjective and prone to error . another limitation is the small sample size , which may reduce the external validity of the research .",
"in summary , our results indicate that the significantly greater increase in serum leptin levels in non - overweight pregnant women may be explained by the significantly higher percent weight gain in this group compared to overweight / obese women . this study suggests that controlling both weight gain and the percent weight gain during the prenatal period may be an important preventive measure to control leptin levels during pregnancy and its subsequent medical complications ."
] | backgroundour objective was to evaluate changes in serum leptin levels during pregnancy in overweight / obese and non - obese women and to assess total and percent weight gain during pregnancy as possible factors that influence leptin levels.material/methodsin a prospective study of 42 low - risk pregnant women receiving prenatal care , we assessed serum leptin levels at gestational weeks 912 , 2528 , and 3437 . based on their pre - pregnancy body mass indices ( bmis ) , the cohort was divided into : non - overweight ( bmi < 25 kg / m2 ) and overweight / obese ( bmi 25 kg / m2 ) subjects.resultswe found a progressive increase in maternal weight gain during pregnancy in both groups . there was also a progressive increase in leptin levels in the 2 strata ; however , the increase was significantly higher in the non - overweight patient group . we found that non - overweight pregnant women had a noticeably larger total weight gain . when analyzing the percent weight gain during pregnancy compared to the pre - pregnancy weight , the non - overweight group had a significantly greater percent weight gain than the overweight / obese group.conclusionsour results suggest that the greater increase in leptin levels in non - overweight pregnant women can be explained by the higher percent weight gain in this group compared to overweight / obese women . these findings suggest that controlling the percent weight gain may be an important preventive measure when controlling leptin levels during pregnancy and subsequent medical complications . |
[
"extracellular superoxide dismutase ( sod3 ) is an enzyme known to catalyze dismutation of the highly reactive , superoxide anion into longer - lived and more stable hydrogen peroxide . the consequences of sod3 action in the cells reach beyond the antioxidative functions , as it has been shown to downregulate inflammation , stimulate cell proliferation during tissue injury recovery , and to counteract apoptosis [ 4 , 5 ] by affecting cytokine production , cell signal transduction , and expression of survival - related genes . the anti - inflammatory properties of sod3 have been studied in models of pulmonary disease and peritonitis [ 2 , 6 ] . previous work with collagen - induced arthritis ( cia ) suggests that both genetic transfer of the sod3 gene as well as a small molecular sod mimetic have the ability to ameliorate arthritis . the arthritis ameliorating effect of sod3 was later confirmed using sod3 knock - out mice . these results were explained on the basis that sod3 acts as an antioxidant and catalyses dismutation of superoxide into hydrogen peroxide , thus reducing inflammation - induced oxidative stress and restoring the oxidant balance in the arthritic joints [ 10 , 11 ] . this explanation , however , is difficult to reconcile with the finding that animals naturally deficient in the induced oxidative burst in fact develop more severe arthritis [ 12 , 13 ] . the most potent producer of superoxide , the substrate for sod3 , is the well - characterized phagocytic nox2 complex . in inflamed tissues nox2 complex produces massive amounts of superoxide upon activation in a process called phagocyte oxidative burst . in addition to nox2 , superoxide is produced from various other cellular sources , such as from the mitochondria during cellular respiration and by other members of the nox enzyme family . however , it should be noted that during inflammation these superoxide producers are not nearly as efficient superoxide producers as the nox2 complex . in the current work we studied the role of sod3 in collagen - induced arthritis ( cia ) to understand whether the therapeutic effect of sod3 on arthritis operates through attenuating the biological effects of the induced oxidative burst produced by the nox2 complex . to avoid artifacts introduced by chemical inhibitors of nox2 complex [ 1416 ] thus we used wild - type ( ncf1 ) and ncf1 mutated ( ncf1 ) mice on b10.q background . these strains differ at only one snp in the ncf1 gene , which makes the ncf1 strain unable to produce oxidative burst . the mutated mouse is more susceptible to induced arthritis due to hyperactivated t cells , and also increased susceptibility to thioglycollate peritonitis has been reported in the ncf1 knockout mouse . our results confirm the previously documented anti - inflammatory role of sod3 and additionally , for the first time , we show that it can downregulate both cia and peritonitis even in the absence of functional nox2 complex and phagocyte oxidative burst .",
"the previously described ncf1 ( protein also called p47phox ) mouse , which carries a point mutation globally and completely abolishing nox2 complex derived ros production , has been backcrossed onto the b10.q background and shown to contain only the causative mutation using a 10 k snp typing chip . the mice were housed under specific pathogen - free conditions in climate - controlled environment and fed standard rodent chow and water ad libitum at turku university central animal facility . all experimental mice were sex- and age - matched , treatment groups were blinded , and experimental groups were mixed in cages in all experiments . the experiments were performed in accordance with the national and eu guidelines and the study was approved by the oulu section of the national animal experiment board ( elinkoelautakunta , ella ) with ethical approval numbers eslh-2008 - 02873 , eslh-2008 - 07941 , and esavi-0000497/041003/2011 . replication deficient adenoviral e1-partially - e3-deleted adbglii vectors ( developed from serotype ad5 ) expressing rabbit sod3 ( ade - sod3 ) or bacterial -galactosidase lacz ( ade - lacz ) were used in both in vitro and in vivo experiments . collagen - induced arthritis ( cia ) was induced under isoflurane anesthesia by injecting 100 g rat type ii collagen ( purified from chondrosarcoma ) emulsified in complete freund 's adjuvant intradermally at the base of the tail . arthritis was boosted day 19 with 50 g rat type ii collagen emulsified in incomplete freund 's adjuvant intradermally at the base of the tail . disease development was evaluated macroscopically three times a week before the booster immunization and daily after the boost . one point was given for each swollen toe or joint and five points for a swollen ankle , each paw having the maximum of fifteen points . in the arthritis experiments ade - sod3 , ade - lacz ( vector control ) , and pbs ( injection control ) were injected locally in the left front paw in 25 l injection volume containing 2,5 10 pfu virus . injections were performed right after the booster immunization during the same anesthesia at day 19 , before the onset of clinically apparent arthritis . briefly , mice were pretreated i.p . with 0.5 10 pfu ade - sod3 , ade - lacz , or pbs three days before peritonitis induction with 5% proteose peptone ( bd difco , sparks , md , usa ) and 10 ng il-1 ( r&d systems , minneapolis , mn , usa ) in 1 ml pbs . after 18 hours peritoneal infiltrating cells were collected with 10 ml ice - cold rpmi cell culture medium . cells from the peritoneal lavage were counted and cytocentrifuged , slides were stained with reastain diff - quick ( reagena , toivala , finland ) , and differential counting was performed under a standard light microscope . experiments were pooled and the total cell numbers are presented as percentual increase from the pbs injection control . all peritonitis results were normalized to adjust the vector control group ( ade - lacz ) mean to 100 . cos-7 cells stably expressing all the essential components of the nox2 complex , namely , cybb ( gp91phox ) , cyba ( p22phox ) , ncf2 ( p67phox ) , and ncf1 ( p47phox ) were provided by dr . cells were cultured in dulbecco 's complete medium ( gibco ) , 10% fetal calf serum , and penicillin - streptomycin ( invitrogen , paisley uk ) . extracellular superoxide production was quantified two days after transduction ( moi 4 ) with adenoviral constructs ( ade - sod3 and ade - lacz ) or medium control directly on the 96-well cell culture plate using an isoluminol - enhanced chemiluminescence method [ 22 , 23 ] . briefly , the cells were washed with pbs , and 100 l of isoluminol buffer was added in each well . isoluminol buffer contained isoluminol ( 10 g / ml , sigma - aldrich ) and horse radish peroxidase - type ii ( 4 u / ml , sigma - aldrich ) dissolved in pbs with pma ( 200 ng / ml , dissolved in dmso , sigma - aldrich ) and data collection was initiated immediately and followed at 37c as produced luminescence signal ( tecan infinite m200 , tecan , mnnedorf , switzerland ) for 30 minutes . red blood cells were lysed from heparinized whole blood with hypotonic lysis buffer and leukocytes were surface stained with apc conjugated anti - gr-1 ( rb6 - 8c5 ) and efluor 450 conjugated anti - cd11b ( m1/70 ) antibodies ( ebioscience ) . cells were suspended in high - glucose d - mem ( gibco ) with antibiotics without fcs and incubated for 10 min at 37c with 3 m dihydro - rhodamine 123 ( dhr-123 ; molecular probes and invitrogen life technologies ) followed by 20 min activation at 37c with 200 ng / ml pma ( sigma - aldrich ) . the cells were washed into pbs and acquired on lsr ii flow cytometer equipped with facs diva software ( bd biosciences ) . live cells were gated on the cell type , and geometric means of respective populations were analyzed with flowing software ( cell imaging core , university of turku ) . isoflurane anesthetized animals with equal arthritis scores were injected intraperitoneally with 20 mg / kg l-012 probe ( wako chemicals , germany ) dissolved in pbs . the luminescent signal was detected with ivis 50 bioluminescent system ( xenogen , usa ) that consists of an anesthesia unit built in a light tight chamber equipped with a ccd camera . rna was isolated from the treated paws collected d25 according to the manufacturer 's instructions with tri reagent ( sigma - aldrich ) . the isolated rna was dnase treated with deoxyribonuclease i ( fermentas ) in the presence of ribolock rnase inhibitor ( fermentas ) . the rna was used for reverse transcription reaction performed with revert - aid m - mulv ( fermentas ) . the acquired cdna was subjected to q - pcr with ade - sod3 ( fw : gtg tgc tcc tgc ctg ctc , rev : ctg ctc cac cgt gtc tga g ) and -actin specific primers ( fw : cta agg cca acc gtg aaa ag , rev : acc aga ggc ata cag gga ca ) , and the gene expression level was analyzed using sybr green pcr master mix ( applied biosystems ) , icycler iq multicolor real - time pcr detection system ( bio - rad ) , and the icycler ( version 3.1 ) software . ade - sod signal was normalized against -actin expression levels and the results are reported as fold change from the ade - lacz group mean denoted as 1 . statistical significance was analyzed by using two - tailed student 's t - test or if more than two groups were analyzed one - way anova with lsd post hoc analysis was run using ibm spss statistics 19 software ( spss inc . ) , p < 0.05 is considered as statistically significant .",
"adenoviral sod3 gene delivery reduced the superoxide predominant ros signal 37% compared to the ade - lacz control virus when investigated two days after transduction with ade - sod3 and ade - lacz viruses ( figure 1 ) . mice started to develop mild , clinically apparent arthritis at day 20 and made a full response , mean arthritis scores reaching 7 ( out of the maximum of 15 ) in ade - laz treated and 3 points in ade - sod3-treated mice some days later . the mean disease score in the treated paws was lower in the ade - sod3-treated group when compared to the ade - lacz - injected control group , and the difference reached statistical significance at d26 ( figure 2(a ) ) . the treatment effect was only seen in the treated paw , while there were no differences between the treatment groups in sum scores of the three untreated paws ( see supplementary figure 1(a ) in supplementary material available online at doi : 10.1155/2012/730469 ) highlighting the local character of the used gene therapy vector expressing sod3 . both virus vector treated groups showed elevated arthritis scores in the treated paws when compared to the pbs - injected control paws in the injection control group . this difference is illustrated in figure 2(b ) , where ade - lacz - treated paws are shown to have larger increase in arthritis score than the ade - sod3-treated paws . starting from d20 the ncf1 mice started to develop arthritis with significantly higher mean score than the wild - type mice . interestingly , the mutated mice without functional nox2 complex derived superoxide production also responded to ade - sod3 treatment . ade - sod3-treated paws of the ncf1 mice had significantly lower mean disease score than the ade - lacz - treated vector control paws at days 24 and 25 after arthritis induction . similarly to the wild - type mice , the difference in the mean arthritis score in nox2 complex deficient mice was observed when sod3 was highly expressed from the adenoviral vector ( figure 3(a ) ) . no differences were observed between the treatment groups in the sum scores of the untreated paws ( supplementary figure 1(b ) ) again supporting the local character of the immunomodulatory effect of ade - sod3 treatment . similarly to the wild - type mice , ade - sod3 treatment in ncf1 paws induced significantly smaller difference between the virus - treated and pbs - injected paws than ade - lacz virus injection ( significant d24 and d25 after immunization ) , again confirming the arthritis limiting effect of sod3 ( figure 3(b ) ) . the experiment was repeated and as the experiments were well reproduced , data from both experiments was combined for analysis . sod3 expression significantly reduced the number of peritoneal infiltrating cells in proteose peptone and il-1 induced peritonitis in wild type mice ( figure 4(a ) ) . the decrease in infiltrating leukocytes was mainly due to a lowered number of infiltrating macrophages ( figure 4(b ) ) , which well corresponds with the macrophage phase of peritonitis taking place three days after virus injection and 18 hours after peritonitis induction . both virus - treated groups had more infiltrating cells than the pbs - injected control mice . similarly as in the wild - type mice ade - sod3 was shown to reduce the number of infiltrating cells in the peritoneal cavity of ncf1 mice when compared to ade - lacz - treated mice . the difference was due to a significantly lowered number of infiltrating macrophages in the ade - sod3-treated mice ( figures 5(a ) and 5(b ) ) . in the wild - type mouse both severely inflamed paws ( right hind leg and right front paw ) emitted strong ros - induced l-012 luminescence signal , while in spite of the severe inflammation , no luminescent signal was detected from the ncf1 mice ( severe arthritis with arthritis score of 15 in both front paws and milder symptoms in the left hind leg ) ( figure 6(a ) ) . monocytes ( cd11b - pos , gr-1-lo , or gr-1-neg ) and granulocytes ( gr-1-hi , cd11b - pos ) from ncf1 mice were unable to generate efficient ros production upon pma stimulation , while phagocytes from the wild - type animals responded to pma stimulation and induced significant increase in dhr-123 derived fluorescence signal detected by flow cytometry ( figures 6(c ) and 6(d ) ) . quantitative rt - pcr revealed a a 5.5-fold ( fc , fold change ) expression of adenovirally produced sod3 mrna in the ade - sod3-treated joints collected at d25 when compared to the ade - lacz - treated vector control paws ( figure 6(b ) ) .",
"sod3 is an enzyme that has been shown to give rise to therapeutic responses in damaged tissues such as reduced ischemia - reperfusion injury , arthritis , peritonitis , hind limb injury , and lung injury models . these tissue healing promoting and anti - inflammatory effects induced by sod3 are accompanied by reduced macrophage infiltration , inhibition of oxidative fragmentation of the extracellular matrix matrix , decreased apoptosis [ 4 , 5 ] , and enhanced cell proliferation . the beneficial effects of sod3 are mostly explained by its antioxidant properties and reduction of oxidative stress in the injured tissues . however , in this report we show that overexpression of sod3 downregulated inflammation even in the absence of phagocyte oxidative burst , thus highlighting the capacity of sod3 to affect cellular processes independently of nox2 complex ' superoxide production . the adenoviral gene expression system used in this work reaches its maximal expression around three days after the injection , after which the vector is eliminated by the immune system and the expression of the transgene slowly decreases to undetectable levels 14 days after the initial injection . we confirmed the presence of virally delivered sod3 mrna in the paws d25 and thus confirmed that the decrease in arthritis severity coincided with substantial adenovirus driven sod3 expression . similarly , pretreating the mice three days before induction of peritonitis allowed us to analyze the effect of sod3 during substantial sod3 expression in the peritoneal cavity . the percentual treatment effect in both inflammation models was comparable with the effect previously obtained with transgenic sod3 overexpression in pulmonary emphysema . similarly , the degree of sod3-induced macrophage infiltration inhibition in peritonitis was similar as reported previously . even though sod3 is an important local regulator of the acute inflammatory reaction , it is obvious that there are a number of other factors affecting inflammation severity in vivo . when the nox2 complex is not functional , there are still a number of other enzymes and enzyme complexes producing superoxide in the inflamed tissue . nox1 has been reported to worsen hyperoxia - induced acute lung injury in mice , and nox4 has been suggested to stimulate microglial il-6 expression and to hamper neurodegeneration after poststroke ischemia reperfusion injury . however , only nox2 is abundantly expressed on phagocytes and thus recruited to inflammatory foci . other nox family members are expressed on other cell types than phagocytes and their ros production is not upregulated during inflammation . in addition to the nox family enzymes , superoxide is also produced during mitochondrial respiration at levels corresponding to the general metabolic rate in the tissue . mitochondrial superoxide has also been linked to tlr2/4 signaling and is also suggested as a pathologic mechanism in tissue injury . all these superoxide generating processes , however , can not compensate for the massive production of ros by the nox2 complex during inflammation as the arthritic paws of ncf1 mice emitted no detectable luminescence signal when probed with l-012 dye ( figure 6(a ) ) . l-012 reacts with any radical to produce light and can not be used to distinguish between superoxide and hydrogen peroxide in vivo . as a tool to study the nox2 complex dependency of sod3 , we used ncf1 mutated mice , in which a splice site point mutation abolishes the production of ncf1 protein leading to complete loss of nox2 complex derived oxidative burst . in line with previous reports , arthritis severity was significantly higher in ncf1 animals when compared to b10.q wild - type mice . mutated mice also developed arthritis quicker after the booster allowing us to work with a more homogenous and extremely well reproducible disease model . better arthritis synchronization in the mutated mouse model together with larger treatment groups resulted in less variability and increased statistical power in data analysis . in proteose the use of ncf1 mutant mice allowed us to avoid pit falls associated with the use of chemical nox2 complex inhibitors such as dpi and apocynin , which are not specific for the nox2 complex , do not provide full suppression of superoxide production and additionally profoundly affect various other cellular processes [ 1416 ] . in both arthritis and peritonitis , adenoviral gene expression vectors locally enhanced inflammation . the arthritis enhancing effect was restricted to the treated paw , as the virus - injected groups did not differ from the pbs - injected control group when their nontreated paws were analyzed . this is in line with previous reports where intra - articular injections of adenoviral gene expression vectors have been shown to induce increased paw swelling and elevated levels of inflammation mediators [ 33 , 34 ] . intravenous injection route has not given rise to enhanced arthritis [ 3537 ] , but has triggered liver inflammation ; liver being the primary target of systemically administered adenoviral vectors . the immunogenicity of the adenoviral gene expression systems is well documented in the literature [ 3840 ] . sod3 polymorphisms are associated with copd , coronary artery disease , myocardial infarction as well as acute lung injury and related mortality .",
"we report that sod3 limits inflammation in cia and peritonitis both in the presence and in the absence of phagocyte oxidative burst . the anti - inflammatory function of sod3 is not compromised by the lack of functionality of the nox2 complex as both ncf1 and ncf1 mice develop milder inflammation when treated with sod3 . thus , we conclude that the anti - inflammatory effect of sod3 is not dependent on superoxide produced by the nox2 complex derived phagocyte oxidative burst and thus acts via other signaling pathways ."
] | extracellular superoxide dismutase ( sod3 ) , an enzyme mediating dismutation of superoxide into hydrogen peroxide , has been shown to reduce inflammation by inhibiting macrophage migration into injured tissues . in inflamed tissues , superoxide is produced by the phagocytic nox2 complex , which consists of the catalytic subunit nox2 and several regulatory subunits ( e.g. , ncf1 ) . to analyze whether sod3 can regulate inflammation in the absence of functional nox2 complex , we injected an adenoviral vector overexpressing sod3 directly into the arthritic paws of ncf1/ mice with collagen - induced arthritis . sod3 reduced arthritis severity in both oxidative burst - deficient ncf1/ mice and also in wild - type mice . the nox2 complex independent anti - inflammatory effect of sod3 was further characterized in peritonitis , and sod3 was found to reduce macrophage infiltration independently of nox2 complex functionality . we conclude that the sod3-mediated anti - inflammatory effect on arthritis and peritonitis operates independently of nox2 complex derived oxidative burst . |
[
"traumatic arterial occlusion following major or minor blunt trauma , especially in the absence of any other bony injury , is a rare phenomenon . motor - scooter handlebar syndrome is one such type of arterial occlusion affecting vascular structures following direct blow by a handlebar of a motorbike or bicycle to the groin . given their superficial course at this location , femoral vessels are the most common vascular structures affected . in all instances , injury to iliac vessels remains exceedingly rare , given its posterior position within the pelvis , representing only 0.4% of vascular injuries . in this case , we highlight a delayed presentation of external iliac artery occlusion secondary to motor - scooter handlebar syndrome , in a paediatric patient . pathophysiology and management of vascular injuries in the paediatric population vary significantly compared with the adult population . additional factors which need to be considered include : smaller vessel size or vessel spasm , higher risk of infection , tendency for re - stenosis and continuing growth . we review previous paediatric cases of this unusual vascular injury to highlight the pathology and most appropriate management option .",
"a 15-year - old male presented to the emergency department following a direct blow from his bicycle handlebars to his groin . his abdominal examination was unremarkable , except for a small abrasion and visible mass in his right groin . after exclusion of other abdominal or chest injuries , he was discharged on the same day with a diagnosis of right groin haematoma and follow - up in 68 weeks . his symptoms included pain and paraesthesia in his right buttocks on mobilization > 100 m. he was found to have absent peripheral pulses in his right leg , although it appeared well perfused with a normal capillary refill . an arterial doppler ultrasound showed a right external iliac artery thrombus occluding the proximal two - thirds of the vessel . a computed tomography scan of the abdomen and pelvis with intravenous contrast identified complete occlusion of the right external iliac artery 1 cm beyond its origin . however , the common femoral artery and profunda femoris remained patent via collaterals ( fig . 1 ) . \n he underwent a right external iliac thromboendarterectomy with patch repair using a saphenous vein graft . a suprainguinal incision was initially made in attempt to expose the proximal external iliac artery . due to its extent , retrieval of the entire thrombus was incomplete and a second groin incision near the junction of the common femoral with external iliac ( at the inguinal ligament level ) was required . the patient subsequently underwent a proximal and distal thrombectomy , and the arteriotomy was extended between the two incisions identifying an intimal stricture with significant fibrosis ( fig . 2 ) . an intimal flap was identified in the distal region and tacked down with a 7 - 0 prolene suture . the long saphenous vein was harvested and the defect closed with patch repair extending from proximal iliac to proximal femoral vessel . at the initial 2-week follow - up , the vessels remained patent and patient was progressing well . subsequently , regular biannual follow - up was planned to monitor for any longer - term complications . \n figure 2:occlusion of right external iliac artery 1 cm below its origin ( white arrow ) . occlusion of right external iliac artery 1 cm below its origin ( white arrow ) .",
" motor - scooter handlebar syndrome is an uncommon form of arterial blunt injury following a direct blow by the handlebar of motorbikes or bicycles . only a handful of paediatric cases have been reported [ 1 , 2 , 47 ] . the common femoral vessel is the most commonly affected vascular structure . a common site for these injuries is at the inguinal ligament , where the femoral artery is superficial and courses anterior to the superior pubic ramus and femoral head . as such , it is prone to compression between the handlebar and posterior osseous structures . in addition , it is a relatively immobile structure , tethered by arterial branches , periadventitial connective tissue and the femoral sheath . they proposed that a circumferential tear of the intima leads to dissection and prolapse of the inner aortic layers , causing complete luminal occlusion . , patients may remain asymptomatic until a period of growth spurt or they resume more rigorous physical activity . this can lead to delay in the diagnosis , and a high index of suspicion needs to be maintained to avoid ischaemic complications such as limb length discrepancy [ 8 , 9 ] . in such instances , it is important to rule out any secondary occlusion of the femoral artery and vein that may predispose to the development of thrombosis within these vessels . duplex sonography should be carried out to assess flow velocities and waveform characteristics in these patients , and is especially suited to the paediatric population as they have reduced abdominal fat , and there is no radiation . identified ultrasound , in the right hands , to be highly sensitive ( 100% ) and specific ( 97.5% ) for the detection of arterial injuries when compared with surgical findings . open arterial thromboendarterectomy with graft or patch repair is the standard of care for such cases in trauma centres . previously documented cases include patch repair or bypass using saphenous vein , bovine pericardium and synthetic material [ 13 , 5 , 6 ] . one case was successfully treated with iv heparinzation alone . however , in most injuries , the presence of significant groin haematoma may limit anticoagulation , requiring more urgent operative re - vascularization . in our patient , delayed presentation and presence of significant collaterals meant definitive operative management could be planned as a semi - elective procedure . the role of endovascular intervention in this paediatric population has previously been documented mainly as a temporizing measure for revascularization [ 4 , 5 ] . used a nitinol stent in the distal superficial femoral artery of a 13-year - old patient whose arterial and venous calibre at the time of injury were of inappropriate size for reconstruction . the main disadvantage of endovascular interventions in paediatric patients is the constantly enlarging calibre of the vessel with a fixed stent diameter . this can predispose to complications such as restenosis , stent fracture , stent dislocation and acute on chronic ischaemia . as a result , future vascular reconstruction may be compromised and in extreme cases , this may progress to significant ischaemia and even limb loss . we provide an unusual cause of external iliac occlusion secondary to bicycle handlebar injury to the groin . all patients presenting with groin injury from this mechanism should be carefully investigated with duplex sonography and monitored for risk of vascular injury . the presence of collaterals , particularly in the paediatric population , can lead to delay in diagnosis . literature seems to advocate open primary surgery for management of these injuries ; however , endovascular and conservative medical management have also been used successfully . the latter two were contraindicated in our patient and open surgery was the most appropriate option . long - term follow - up , beyond the 12-month period , is needed , particularly in relation to known vascular complications including pseudoaneurysms , arteriovenous fistula formation and restenosis .",
""
] | arterial occlusion following blunt trauma is an uncommon occurrence . we report an unusual case of delayed external iliac artery occlusion in a young male following blunt abdominal injury . he was successfully treated with thromboendarterectomy and saphenous vein patch repair . there have only been a handful of documented cases occurring in the paediatric population . all patients presenting with groin injury from this mechanism should be carefully investigated and monitored for risk of vascular injury . |
[
"the advent of antihypertensive therapy has substantially reduced the occurrence of cardiovascular events . however , antihypertensive therapy failed to achieve blood pressure control in all patients , with hypertension control rates remaining in general disappointingly low . blood pressure goals are not attained in some patients despite the simultaneous use of several antihypertensive medications . several terms have been used to define this condition : refractory hypertension , difficult - to - treat hypertension , difficult - to - control hypertension ; however , the term resistant hypertension seems to prevail . resistant hypertension is currently defined as uncontrolled blood pressure despite the use of optimal doses of three antihypertensive medications , of which one is a diuretic . poor patient adherence , physician inertia , inadequate doses or inappropriate combinations of antihypertensive drugs , excess alcohol intake , and volume overload are some of the most common causes of resistance [ 210 ] . the list of secondary forms of hypertension is long and covers a large variety of conditions ( table 1 ) . the management of patients with resistant hypertension requires a gratifying combination of clinical acumen and common sense . an extensive workup of all patients with uncontrolled hypertension is scientifically unsound , is very costly and requires immense human and technical resources . therefore , practicing physicians need to implement evidence - based medicine . the effective management of patients with resistant hypertension requires an appropriate combination of physiology and pharmacology , taking into account the unique characteristics of each case in order to tailor the therapeutic approach to the individual patient . this paper will address the most common secondary causes of resistant hypertension ( drug - induced , obstructive sleep apnea , primary aldosteronism , and chronic kidney disease ) , which are frequently encountered in hypertensive patients and are , therefore , the most interesting from the clinical point of view . in addition , this paper will attempt to provide a rational for the workup and treatment of patients with resistant hypertension .",
"data from small observational studies show a wide variation ( from 5% to 50% ) according to the studied populations [ 210 ] . data from large clinical trials point towards a relatively high prevalence of resistant hypertension ( 2035% ) . it has to be noted , however , that atypical drug combinations have been used in most of these studies as required by study protocols . therefore , the evaluation of the prevalence of resistant hypertension requires a large , prospective , population - based study , specially designed for this aim . available evidence addressing the prognosis of resistant hypertension is scarce , since virtually no longitudinal study has addressed this topic . data from small clinical studies point towards an increased cardiovascular risk in patients with resistant hypertension . in addition , patients with resistant hypertension frequently have comorbidities that are known to increase cardiovascular morbidity and mortality , such as chronic kidney disease , diabetes , and obesity . moreover , patients with resistant hypertension have higher rates of target organ damage than the general hypertensive population and are thus at increased cardiovascular risk .",
"excessive dietary salt intake is common in patients with resistant hypertension and contributes to treatment resistance by blunting the blood pressure reduction of most antihypertensive drugs , including diuretics and inhibitors of the renin - angiotensin axis [ 210 ] . it has been shown that blood - pressure control is more difficult to be achieved in obese than lean hypertensive patients . several lines of evidence indicate a graded positive correlation between body mass index and blood pressure levels , while weight loss results in blood pressure reduction . insulin resistance , sympathetic nervous system overactivity , sodium retention , and activation of the renin - angiotensin system have been implicated in the pathogenesis of obesity - induced hypertension . alcohol consumption is another important factor [ 210 ] . large alcohol consumption ( > 3 drinks per day ) has been shown to result in blood pressure elevation . in addition , blood pressure control might be achieved more difficult in heavy drinkers due to poor adherence in antihypertensive therapy . the role of physical inactivity in patients with resistant hypertension has not been adequately studied . ",
"a variety of prescription or over the counter medicines as well as other exogenous substances may induce hypertension or contribute to treatment resistance . drug - induced hypertension is among the most common causes of secondary hypertension and is frequently encountered in everyday clinical practice . however , despite the frequent occurrence of drug - induced hypertension , primary care physicians frequently miss the opportunity to detect and appropriately manage this iatrogenic form of secondary hypertension . therefore , a detailed and meticulous medical history is of utmost importance in patients with resistant hypertension , since the identification and subsequent withdrawal of the offending drug may alleviate treatment resistance . however , withdrawal of the responsible agent is not always possible ; in such cases , dose reduction and/or search for alternate treatment may substantially improve or even control blood pressure levels . another very important aspect relates to the great variability of the effects of administered drugs on blood pressure . the administration of offending drugs can result in excessive blood pressure elevation in some individuals , while most individuals will experience little or no increases of blood pressure . therefore , it would be very important to identify predictors of blood pressure elevation , in order to individualize drug treatment . a descriptive list of all exogenous agents capable of inducing or exaggerating hypertension is presented in table 2 . however , this paper will focus on the drugs that are widely used , represent the most common causes of drug - induced hypertension , and are thus of major clinical importance : nonsteroidal anti - inflammatory drugs ( nsaids ) and oral contraceptives . in addition , a brief comment regarding specific antineoplastic agents ( anti - vegf ) that have emerged as inducers of hypertension is presented at the end of this chapter , since many clinicians are not aware of this condition . by far , the most common cause of drug - induced hypertension is the use of nsaids . in 265 patients with resistant hypertension identified during a one - year period , treatment resistance was drug - related in 36% of the cases , with nsaids being responsible in 88% ( personal unpublished data ) . osteoarthritis is highly prevalent in the general population , and its prevalence would be even greater due to population aging and the obesity epidemic [ 11 , 12 ] . although lifestyle modification , exercise , and weight loss are considered as first - line therapeutic measures for patients with osteoarthritis , the vast majority of such patients require the systematic or intermittent use of either acetaminophen or nsaids for pain relief . two large prospective cohort studies in normotensive women reported higher risks of subsequent hypertension among nsaids users than in women without regular nsaids administration [ 14 , 15 ] . in the first study , the risk of developing hypertension was increased about two times in women using acetaminophen or nsaids . acetaminophen consumption for 14 days per month and nsaids consumption for 514 days per month was necessary for the risk to be apparent . in the second study , women with frequent use of nonnarcotic analgesics ( > 22 days / month ) had statistically significant higher risk for developing hypertension ; in particular , the hazard ratios were 1.20 for acetaminophen , 1.21 for aspirin , and 1.35 for nsaids . it has to be noted that although acetaminophen is considered to have a better safety profile than nsaids [ 16 , 17 ] , its use was associated with a moderate increase in the risk for incident hypertension in both males and females [ 18 , 19 ] . another large , case - control study revealed a 66% increased risk for initiating antihypertensive drugs in nsaids users compared to nonusers . these detrimental effects of nsaids on blood pressure have been also observed in two older meta - analyses of randomized trials with nsaids [ 21 , 22 ] . in the first meta - analysis , mean arterial pressure was increased by 3.3 mmhg in hypertensive patients whereas the increase in normotensive subjects was negligible ( 1.1 mmhg ) . in the second meta - analysis , nsaids resulted in a significant mean arterial pressure elevation of 5.0 mmhg ; blood pressure elevation was apparent in hypertensive patients with controlled blood pressure , whereas normotensive individuals did not experience such an effect . on the contrary , data reporting no or little effect of nsaids on blood pressure exist in the literature as well . in two cross - sectional studies , no association between use of nsaids and hypertension was found [ 23 , 24 ] . similar findings were observed in two small randomized studies regarding the effects of acetaminophen on blood pressure [ 25 , 26 ] , as well as in studies evaluating the effects of aspirin on blood pressure in hypertensive patients [ 27 , 28 ] . in addition , in a large prospective cohort of 8,229 male normotensive physicians , analgesic use was not associated with increased risk of developing hypertension ( hazard ratio : 1.12 ; 95% ci : 0.971.31 ) . the corresponding hazard ratios were 1.08 ( 95% ci : 0.871.34 ) for acetaminophen , 1.16 ( 95% ci : 0.921.48 ) for aspirin , and 1.05 ( 95% ci : 0.891.24 ) for nsaids . this apparent heterogeneity of available data on the effects of traditional nsaids on blood pressure becomes even more complicated when recent data with selective cox-2 inhibitors are taken in account . in a meta - analysis of randomized trials , use of cox-2 inhibitors was associated with a significant increase in blood pressure compared to placebo ( 3.85/1.06 mmhg ) and nonselective nsaids ( 2.83/1.34 mmhg ) . however , it was shown that a great part of blood pressure elevation could be attributed to rofecoxib . indeed , rofecoxib use is associated with greater blood pressure elevations than celecoxib in both hypertensive and normotensive individuals . the above - mentioned study highlights another important aspect : the potential differences on blood pressure effects between the various nsaids . in a meta - analysis of randomized trials , conducted mainly in hypertensive patients , naproxen and indomethacin were associated with the largest blood pressure elevations , while piroxicam , sulindac , ibuprofen , and aspirin exhibited little if any effect on blood pressure . on the contrary , a randomized study in patients with controlled hypertension showed that the blood pressure was significantly higher with ibuprofen than with lumiracoxib . moreover , in 34,701 participants at the medal ( multinational etoricoxib and diclofenac arthritis long term ) program , patients assigned to etoricoxib discontinued the study due to hypertension more frequently than patients randomized to diclofenac . finally , the potential differences of the effects of nsaids on blood pressure according to the various antihypertensive agents coadministered are of great clinical importance . in a study of elderly hypertensives with osteoarthritis , indomethacin had no effect on blood pressure in patients taking calcium antagonists whereas significant blood pressure elevations were detected in patients taking ace - inhibitors . on the contrary , celecoxib exerted similar to placebo effects in patients taking ace - inhibitors . another study among hypertensive patients with osteoarthritis , comparing the effects of rofecoxib and celecoxib , revealed no differences on blood pressure between the two drugs in patients taking diuretics or calcium antagonists , whereas larger blood pressure elevations were observed with rofecoxib than with celecoxib in patients taking ace - inhibitors or beta blockers . the above presented information clearly indicates that available data on the effects of nsaids on blood pressure are sometimes contradictory and in total far from conclusive . convincing data coming from carefully designed randomized studies are necessary to : ( a ) detect potential differences between the various nsaids on blood pressure , ( b ) clarify the effects of coadministering each nsaid with each one of the various antihypertensive drug categories , and ( c ) identify predictors of blood pressure response to nsaids use . withdrawal of nsaids is indicated in patients with resistant hypertension , exacerbation of prior hypertension , or incident hypertension . substituting nsaids with acetaminophen pain relief is more likely in patients with osteoarthritis and pain of muscular skeletal origin . however , this is not always possible in everyday clinical practice , since patients with chronic inflammatory arthritic diseases ( rheumatoid arthritis ) respond better to anti - inflammatory agents . in such cases , hydrocodone , tramadol , or nerve blocking might be of help , constituting effective alternatives to nsaids . in cases , however , where nsaids are still necessary , the lower effective dose should be administered , since existing data point towards dose - related effects of nsaids on blood pressure . nsaids affect blood pressure levels via different mechanisms : activation of the renin - angiotensin - aldosterone system , sodium and water retention , induction of vasoconstriction through endothelin-1 and arachidonic acid metabolites , and mainly inhibition of renal vasodilatory prostaglandins ( e2 and i2 ) [ 3743 ] . these detrimental effects of nsaids may lead to deterioration of renal function and acute kidney injury , especially in patients of older age , preexisting hypertension , chronic kidney disease , or diabetes . in such patients , calcium antagonists seem to be more suitable than drugs inhibiting the renin - angiotensin system , since the concomitant administration of nsaids and calcium antagonists is not accompanied by blood pressure elevation [ 36 , 39 ] . the development of nsaids that apart from cyclo - oxygenase inhibition possess nitric oxide promoting properties might significantly ameliorate current situation and alleviate the effects of nsaids on blood pressure . cinods ( cyclo - oxygenase inhibiting nitric oxide donating drugs ) represent a new class of nsaids ; cinod molecules consist of a traditional nsaid and a nitric oxide - donating chemical group connected by a linker . naproxcinod is the first cinod in clinical trials with very promising preliminary results [ 4447 ] . oral contraceptives represent another class of drugs that are widely used and are capable of inducing hypertension [ 48 , 49 ] . the larger study evaluating the effects of oral contraceptives on blood pressure was the nurses ' health study , in which more than 60,000 normotensive women were prospectively followed for 4 years . women using oral contraceptives had an 80% higher risk of developing hypertension compared to women that were not using such drugs . however , withdrawal of oral contraceptives abolished this increased risk , underlining the need for close monitoring in women taking oral contraceptives . a study in hypertensive women revealed that those taking oral contraceptives had more severe hypertension and lower blood - pressure control rates than women using other contraceptive methods . combined oral contraceptives ( progestin and estradiol ) , which were widely used in the past , were associated with blood pressure elevations more frequently than progestin - only oral contraceptives . on the contrary , therefore , current guidelines recommend the use of progestin - only oral contraceptives in women with established cardiovascular disease , or major cardiovascular risk factors ( such as hypertension ) [ 53 , 54 ] . it can , therefore , be summarized that oral contraceptives may contribute to resistance in hypertensive women , but the type of oral contraceptive is important . close monitoring of women and withdrawal of oral contraceptives may alleviate the effects on blood pressure . another class of agents that emerged as inducers of hypertension are the antineoplastic drugs that target the vegf pathway . a monoclonal antibody ( bevacizumab ) binding to the vegf - a isoform , as well as small molecules inhibiting the intracellular tyrosine kinase domains of all three vegf receptors , is used or is under clinical testing for the treatment of various malignancies [ 5557 ] . hypertension was encountered very frequently in patients receiving treatment with vegf - inhibitors . in particular , 2030% of patients treated with bevacizumab , and 1560% of patients treated with vegf kinase inhibitors developed hypertension . three meta - analyses with drugs inhibiting the vegf pathway uncovered a high relative risk for incident hypertension with these agents : 7.5 ( 95% ci : 4.213.4 ) with bevacizumab , 6.11 ( 95% ci : 2.4415.32 ) with sorafenib , and 21.6 ( 95% ci : 18.724.8 ) with sunitinib [ 6062 ] . interestingly enough , the development of hypertension has been correlated with the efficacy of these drugs [ 6365 ] , suggesting that hypertension could be used as a surrogate marker of anti - vegf efficacy . a phase iii trial evaluates this concept in patients with pancreatic cancer receiving anti - vegf agents . clearly , more data are needed to clarify the blood pressure effects of the various drugs acting on the vegf pathway . experimental studies have shown that vegf upregulates endothelial nitric oxide synthase [ 66 , 67 ] , enhances nitric oxide production , and induces nitric oxide - dependent vasorelaxation . moreover , vegf was shown to result in enhanced prostacyclin production and release [ 70 , 71 ] . it can be therefore anticipated that vegf inhibition may lead to reduction of nitric oxide and prostacyclin bioavailability , a subsequent increase of systemic vascular resistance , and finally blood pressure elevation . in addition , arteriolar rarefaction has been observed in animals treated with vegf kinase inhibitors , proposing another pathogenetic mechanism of hypertension with these drugs [ 7274 ] ; preliminary studies in humans reported similar findings [ 75 , 76 ] . finally , enhanced arterial stiffness has been suggested as another contributing factor in the development of hypertension . the recognition of the pathogenetic mechanisms that contribute to blood pressure elevation with vegf - inhibitors might be helpful in identifying the most appropriate drugs for the management of these patients . reliable data evaluating the efficacy of the various antihypertensive drug categories in anti - vegf - induced hypertension are missing . preliminary reports point towards restricted efficacy of diuretics and beneficial effects of calcium antagonists ; however , appropriate prospective studies are needed in this topic . ",
"a vast amount of evidence demonstrates an association between obstructive sleep apnea ( osa ) and hypertension . such an association has been shown in epidemiological , longitudinal , and cross - sectional studies , as well as in studies from specialized clinics [ 8083 ] . in addition , it has been shown that osa in normotensive subjects predicts future development of hypertension . sympathetic nervous system activation plays a crucial role in the pathogenesis of hypertension in patients with osa . enhanced upper airway resistance and intermittent hypoxia are considered to stimulate the sympathetic system , while the subsequent sympathetic overactivity may result in blood pressure elevation via vasoconstriction and increased systemic vascular resistance , increased cardiac output , and enhanced fluid retention . the exact nature of the association between osa and aldosterone excess remains to be elucidated . whether osa results in aldosterone excess or aldosterone excess contributes to osa , or another underlying factor ( like obesity ) promoting both aldosterone excess and osa has not been clarified . several studies have reported an extremely high prevalence of osa in patients with resistant hypertension . two decades ago , a swedish study of 16 patients with resistant hypertension reported a 56% prevalence of osa in these patients compared to 19% in patients with controlled hypertension . in a study of 41 consecutive resistant hypertensives , an 83% prevalence of unsuspected osa was found ; osa was defined as an apnea / hypopnea index ( ahi ) of more than 10 events per hour . another study of 71 patients with resistant hypertension revealed an 85% prevalence of osa ( ahi 5 events / h ) . a study from spain in 62 resistant hypertensives reported a 90% prevalence of osa ( ahi 5 events / h ) . however , when the diagnosis of osa was based on 30 or more episodes of apnea / hypopnea per hour , the prevalence was reduced to 70% , underlining the importance of accurate and homogeneous definition of osa . moreover , all the above - mentioned recent studies did not have a control group in order to exclude the potential effects of confounding factors . a recent study from brazil evaluated 63 patients with resistant hypertension and an equal number of patients with controlled hypertension , matched for baseline parameters apart from blood pressure . a strong and independent association between osa and resistant hypertension has been described ( odds ratio : 4.8 ; 95% ci : 2.011.7 ) ; osa ( ahi 10 events / h ) in 71% of resistant hypertensives and in 38% of responders . continuous positive airway pressure ( cpap ) represents the treatment of choice for patients with osa . it has been shown that cpap decreases the incidence of cardiovascular events in patients with osa [ 89 , 90].the acute application of cpap attenuates blood pressure elevations during sleep . however , the long - term effects of cpap on blood pressure are controversial , from studies reporting a significant decrease in blood pressure to studies reporting small or no effects [ 92106 ] . three meta - analyses have tried to overcome these discrepancies and revealed that the beneficial effect is modest , with reductions in systolic blood pressure ranging from 1.38 mmhg to 2.46 mmhg [ 107109 ] . it is , therefore , not surprising that in a recent randomized study , valsartan was more effective than cpap in hypertensive patients with osa . it has to be noted , however , that most of the above - mentioned studies have not been performed exclusively in hypertensive patients , usually evaluating both normotensive and hypertensive subjects . in addition , larger blood pressure reductions were observed in osa patients with higher baseline blood pressure levels [ 107 , 111 ] , as expected with any antihypertensive approach ; the motto the higher the blood pressure , the larger the reduction has been verified over the years . indeed , two small studies in osa patients with resistant hypertension revealed significant blood pressure reductions ( over 10 mmhg ) [ 112 , 113 ] . on the contrary , a study in 42 patients with resistant hypertension showed a smaller mean arterial pressure reduction ( 5.6 mmhg ; 95% ci : 2.08.7 mmhg ; p < .03 ) . interestingly enough , the benefits of cpap were evident only at 1-year after cpap application , suggesting that longer followup periods might be necessary for the benefits of cpap treatment to become apparent in osa patients with resistant hypertension . another important factor is that cpap treatment allowed de - escalation of antihypertensive treatment in the majority of participating patients ( 71% ) . a recent study in 96 patients with osa and resistant hypertension showed a slight decrease in systolic blood pressure ( 1.3 mmhg ) . however , the reduction was significantly larger in patients with abpm - confirmed resistant hypertension ( 7.6 mmhg ) . in addition , the reduction was even larger in cpap users for more than 5.8 hours per day . the above - mentioned data delineate the complexity in identifying patients with resistant hypertension and osa that will have the greater benefits with cpap treatment . an important issue challenging the efficacy of cpap relates to patient adherence . among patients prescribed cpap therapy up to 50% failed to initiate it or did not use it at 3 years [ 116 , 117 ] . another important aspect of treatment is the choice of antihypertensive drugs in patients with osa . the crucial role of sns activation and the increased levels of aldosterone in patients with osa , point towards potential advantages of drugs inhibiting these pathways on reducing blood pressure . indeed , beta blockers were found to be more effective than other antihypertensive drugs in osa patients ; however , relevant data is still far from conclusive . even more interestingly , however , spironolactone was shown not only to significantly lower blood pressure in 12 patients with osa and resistant hypertension , but to reduce the severity of osa as well . further , larger studies are needed , however , to confirm these beneficial effects of spironolactone in patients with osa .",
"pa is characterized by autonomous production of aldosterone by adrenal glands and the subsequent decrease in renin levels though negative feedback . aldosterone excess leads to hypertension , metabolic alkalosis , hypernatremia , and potassium loss resulting in hypokalemia ; the latter is currently considered a late manifestation of pa . pa can result from an aldosterone producing adenoma , bilateral adrenal hyperplasia , glucocorticoid - remediable aldosteronism , or rare familial syndromes . although the diagnosis of adrenal adenomas prevailed during the older times , recent reports reveal that hyperplasia is more frequent than adrenal adenomas . the prevalence of pa in the general hypertensive population remains an unresolved issue [ 122 , 123 ] . historically , pa has been considered a rare disease , affecting about 1% of hypertensive patients [ 124127 ] . however , several studies performed in the last decade report a much higher prevalence of pa ( > 10% ) , suggesting an epidemic of this condition [ 128133 ] . these studies , however , were carried out in specialized referral centers , raising concerns of selection bias . indeed , a study of more than 600 unselected patients with hypertension conducted in chile , revealed a 6.1% prevalence of pa , suggesting that the true prevalence is somewhere in the middle . however , irrespective of its exact prevalence , pa has become fashionable again , with leading specialized centers appearing all over the world , from alabama ( d. calhoun ) to italy ( g. rossi ) and from australia ( m. stowasser ) to united kingdom ( m. brown ) . the prevalence of hypertension relates to the severity of hypertension . in the study from chile , pa was found in 1.99% of patients with stage i hypertension and in 13.2% of patients with stage iii hypertension . in another study of more than 400 czech patients with moderate - to - severe hypertension , data from clinical practice indicates that resistant hypertension represents the condition with the highest probability of detecting pa [ 136 , 137 ] . indeed , the prevalence of pa ranged from 1423% in 5 studies conducted in resistant hypertensives [ 138142 ] . a study of 88 patients with resistant hypertension in alabama showed that 18 patients ( 20% ) suffered from pa ; pa prevalence was race independent . the prevalence of pa was quite similar in two other studies , one from seattle ( 17% ) and one from norway ( 23% ) [ 139 , 140 ] . a study from spain reported a 14% prevalence of primary hyperaldosteronism in patients with refractory hypertension ; however , patients with hypokalemia were excluded from the study suggesting that the true prevalence of primary aldosteronism could be up to two times higher than the one reported . finally , a similar prevalence of 14% has been reported in diabetic subjects with resistant hypertension . the above - mentioned studies have reported a pa prevalence of 1423% in patients with resistant hypertension , suggesting that the true prevalence would be around 20% . however , it has to be recognized that all these studies included a small number of patients . in total , only 418 patients participated in these studies , underlining the need for larger studies . a recent study from greece evaluated 2,032 patients with resistant hypertension , with 1,616 of them having true resistant hypertension . it was found that about 21% of studied patients had a high aldosterone to renin ratio combined with high aldosterone levels , which were suggestive of primary aldosteronism . however , only half of them ( 11.3% ) were suffering for primary aldosteronism , confirmed by salt suppression tests and response to spironolactone . another very interesting finding is the coexistence of pa and osa in patients with resistant hypertension . in one study of 109 patients with resistant hypertension , osa however , in another study , pa was found in only 34% of patients with osa . . the other forms of endocrine hypertension , presented in table 3 , are less frequently encountered in hypertensive patients and , therefore , represent rare causes of resistant hypertension . in addition , the clinical presentation of these endocrine forms of secondary hypertension is usually so characteristic that is really hard to be missed . since this paper addresses the most common secondary causes of resistant hypertension , readers interested in endocrine hypertension may refer to other recently published reviews [ 146 , 147 ] .",
"hypertension is commonly found in patients with chronic kidney disease ( ckd ) , with 75% of ckd patients taking antihypertensive drugs . on the other hand , it seems that the relationship between hypertension and ckd is bidirectional ; the kidney is both the victim and the culprit in this relationship . all recent guidelines recommend lower blood pressure goals in patients with ckd , especially when frank albuminuria is present [ 149151 ] . it has been shown , however , that the vast majority ( > 85% ) of patients with ckd fail to achieve these goals ; blood pressure control rates in ckd patients are lower than in other hypertensive patients despite the use of 3 antihypertensive drugs in average [ 152 , 153 ] . it is , therefore , not surprising that the prevalence of resistant hypertension in patients with ckd is over 50% . however , ckd is usually underappreciated as a cause of resistant hypertension , mainly because these patients are being followed at specialized nephrology clinics . sodium and fluid retention plays a cardinal role , while the increased activity of both the sympathetic and the renin - angiotensin - aldosterone systems greatly contribute to treatment resistance . moreover , vascular alterations both at a structural and functional ( increased endothelin-1 , decreased nitric oxide bioavailability ) level , combined with the consequences of renal ischemia play an additional role . another significant contributor to treatment resistance in patients with ckd it has been observed that restrictions in diuretic use were the primary cause of resistant hypertension in patients with ckd . restricted diuretic use includes either lower doses or inappropriate drug selection ; thiazides are usually not effective when gfr is lower than 40 and should , therefore , be replaced by loop diuretics in such patients . in the case that furosemide is chosen , it has to be given at least twice daily due to its limited half - life . finally , dietary salt reduction may effectively attenuate volume expansion and offer significant benefits in these patients . another important key aspect in patients with ckd is the assessment of urinary albumin excretion . drugs inhibiting the rennin - angiotensin axis ( ace - inhibitors , angiotensin receptor blockers , and direct rennin inhibitors ) should be included in the therapeutic regime , since their use is associated with reduction of albuminuria and end - stage renal disease . the combination of ace - inhibitors with angiotensin receptor blockers has not proven any benefits in high - risk patients at the ontarget study and was even associated with more adverse effects [ 158 , 159 ] . however , this combination might still be beneficial in patients with ckd and overt albuminuria . renovascular hypertension is of atherosclerotic origin in the vast majority of cases , thus being more frequent in older individuals , diabetics , smokers , and in patients with atherosclerotic lesions at other vascular beds [ 161 , 162 ] . indeed , about 25% of patients undergoing cardiac catheterization are found to have renal artery stenosis ( ras ) higher than 70% , which could be of clinical significance [ 163 , 164 ] . on the other hand , fibromuscular dysplasia is a much less frequent cause of ras ( approximately 10% ) than atherosclerosis , and is more frequently encountered in younger females . older studies suggested that 1 out of 3 patients with secondary hypertension has renovascular hypertension [ 165 , 166 ] . unfortunately , recent studies in patients with resistant hypertension usually focus on osa and pa and do not even mention ras . it seems that ras came out of fashion , mainly because its diagnosis with noninvasive methods remains tricky . although several methods are used for the detection of ras ( duplex ultrasound , renal scintigraphy , ands ct and mr angiography ) with rather good sensitivity and specificity , the diagnosis of renovascular hypertension represents an unfulfilled challenge for primary care physicians and remains mainly restrained in specialized centers . three choices are available nowadays : surgical treatment , balloon angioplasty ( with or without stenting ) , and conservative drug treatment . the surgical approach has subsided during the last decades and is now reserved for specific indications . balloon angioplasty was not found superior to optimal drug treatment in the recently published astral study ; several drawbacks , however , limit the interpretation of study findings . another ongoing trial , the coral study , will provide hard - endpoint data with the two different approaches .",
"although it seems rational for patients with resistant hypertension to be referred to specialized hypertension clinics , the initial evaluation can be performed by primary care physicians . we will , therefore , attempt to provide a step - by - step approach for the evaluation and treatment of patients with resistant hypertension . the first steps may take place at the primary care level , in the attempt to substantially reduce the number of referred patients and prevent unnecessary costs and patient discomfort . in summary , ( i ) verification of true resistant hypertensionpatients with pseudoresistance should be identified and excluded from further evaluation . three main problems require special attention at this step : patient - related problems , physician - related problems , and blood - pressure technique - related problems . patient - related problems . adherence to antihypertensive treatment is of utmost importance for the effective management of arterial hypertension . both epidemiological and clinical data strongly indicate that patient adherence to antihypertensive therapy is poor [ 170175 ] . almost half of treated hypertensive patients discontinue drug administration during the first year of treatment whereas long - term adherence rates are even lower . in addition , small studies in patients with resistant hypertension suggest that poor patient adherence represents one of the most common causes of treatment resistance [ 176 , 177 ] . detailed medical history , information by relatives , and use of specific questionnaires might help in identifying patients with poor adherence ; these methods can be easily applied by primary care physicians with obvious benefits . modern technology is used with good results ( electronic pill boxes , internet monitoring ) but is not widely applied yet . special programmes using close contact of health care professionals ( doctors , nurses , and pharmacists ) with patients seem also effective but lack wide application as well . finally , simplification of dosing schedule and use of drugs with superior safety profile may be of benefit . it has been shown that doctors are frequently reluctant to maximize drug therapy , either by adding antihypertensive drugs or by switching drug category , in order to achieve blood pressure goals [ 178181 ] . indeed , a gap between guideline recommendations and their implementation in everyday clinical practice has been recognized and represents a significant obstacle in achieving satisfying blood pressure control rates [ 149 , 150 ] . another contributor to treatment resistance is the use of inappropriate drug combinations or suboptimal doses of antihypertensive drugs . indeed , a study of patients with resistant hypertension revealed that simple measures , such as increasing diuretic dosing or switching to appropriate diuretics , can result in significant blood pressure reductions . in our opinion , however , the most important line of evidence suggesting physician inertia on treatment resistance , comes from recent studies reporting significantly higher control rates of hypertension [ 182185 ] . in these studies , various measures have been used to motivate physicians in achieving blood pressure goals , resulting in improved control rates . therefore , physicians need to be the focus of future efforts for the effective management of resistant hypertension . blood pressure technique - related problems . the requirements for proper blood pressure measurement have been standardized and incorporated in the guidelines for the management of arterial hypertension [ 149 , 150 ] . however , the measurement of office blood pressure in clinical practice frequently deviates from the recommendations . therefore , falsely elevated blood pressure levels may be recorded due to several reasons : inappropriate cuff size , failure to comply with the recommendations regarding sufficient time before blood - pressure measurement , arm support at the heart level , assessment in a quiet room , triplicate recordings , and coffee intake or smoking before blood pressure measurement [ 187189 ] . the above mentioned factors may contribute to overestimation of blood pressure and pseudoresistance . similarly , false elevations may be encountered in older patients , in whom adequate artery compression may not be achieved due to marked arterial calcification . therefore , it is essential to assure proper techniques of blood pressure measurement in order to limit the rates of pseudoresistance . another important aspect of resistance is recognition of white coat hypertension . it has been noted that in 2030% of patients with resistant hypertension , treatment resistance may be attributed to the white coat effect [ 143 , 190192 ] . target organ damage therefore , either ambulatory or home blood - pressure monitoring should be performed in every patient with resistant hypertension , in order to exclude the three main problems require special attention at this step : patient - related problems , physician - related problems , and blood - pressure technique - related problems . patient - related problems . adherence to antihypertensive treatment is of utmost importance for the effective management of arterial hypertension . both epidemiological and clinical data strongly indicate that patient adherence to antihypertensive therapy is poor [ 170175 ] . almost half of treated hypertensive patients discontinue drug administration during the first year of treatment whereas long - term adherence rates are even lower . in addition , small studies in patients with resistant hypertension suggest that poor patient adherence represents one of the most common causes of treatment resistance [ 176 , 177 ] . detailed medical history , information by relatives , and use of specific questionnaires might help in identifying patients with poor adherence ; these methods can be easily applied by primary care physicians with obvious benefits . modern technology is used with good results ( electronic pill boxes , internet monitoring ) but is not widely applied yet . special programmes using close contact of health care professionals ( doctors , nurses , and pharmacists ) with patients seem also effective but lack wide application as well . finally , simplification of dosing schedule and use of drugs with superior safety profile may be of benefit . it has been shown that doctors are frequently reluctant to maximize drug therapy , either by adding antihypertensive drugs or by switching drug category , in order to achieve blood pressure goals [ 178181 ] . indeed , a gap between guideline recommendations and their implementation in everyday clinical practice has been recognized and represents a significant obstacle in achieving satisfying blood pressure control rates [ 149 , 150 ] . another contributor to treatment resistance is the use of inappropriate drug combinations or suboptimal doses of antihypertensive drugs . indeed , a study of patients with resistant hypertension revealed that simple measures , such as increasing diuretic dosing or switching to appropriate diuretics , can result in significant blood pressure reductions . in our opinion , however , the most important line of evidence suggesting physician inertia on treatment resistance , comes from recent studies reporting significantly higher control rates of hypertension [ 182185 ] . in these studies , various measures have been used to motivate physicians in achieving blood pressure goals , resulting in improved control rates . therefore , physicians need to be the focus of future efforts for the effective management of resistant hypertension . blood pressure technique - related problems . the requirements for proper blood pressure measurement have been standardized and incorporated in the guidelines for the management of arterial hypertension [ 149 , 150 ] . however , the measurement of office blood pressure in clinical practice frequently deviates from the recommendations . therefore , falsely elevated blood pressure levels may be recorded due to several reasons : inappropriate cuff size , failure to comply with the recommendations regarding sufficient time before blood - pressure measurement , arm support at the heart level , assessment in a quiet room , triplicate recordings , and coffee intake or smoking before blood pressure measurement [ 187189 ] . the above mentioned factors may contribute to overestimation of blood pressure and pseudoresistance . similarly , false elevations may be encountered in older patients , in whom adequate artery compression may not be achieved due to marked arterial calcification . therefore , it is essential to assure proper techniques of blood pressure measurement in order to limit the rates of pseudoresistance . another important aspect of resistance is recognition of white coat hypertension . it has been noted that in 2030% of patients with resistant hypertension , treatment resistance may be attributed to the white coat effect [ 143 , 190192 ] . target organ damage therefore , either ambulatory or home blood - pressure monitoring should be performed in every patient with resistant hypertension , in order to exclude the patient - related problems . adherence to antihypertensive treatment is of utmost importance for the effective management of arterial hypertension . both epidemiological and clinical data strongly indicate that patient adherence to antihypertensive therapy is poor [ 170175 ] . almost half of treated hypertensive patients discontinue drug administration during the first year of treatment whereas long - term adherence rates are even lower . in addition , small studies in patients with resistant hypertension suggest that poor patient adherence represents one of the most common causes of treatment resistance [ 176 , 177 ] . detailed medical history , information by relatives , and use of specific questionnaires might help in identifying patients with poor adherence ; these methods can be easily applied by primary care physicians with obvious benefits . modern technology is used with good results ( electronic pill boxes , internet monitoring ) but is not widely applied yet . special programmes using close contact of health care professionals ( doctors , nurses , and pharmacists ) with patients seem also effective but lack wide application as well . finally , simplification of dosing schedule and use of drugs with superior safety profile may be of benefit . it has been shown that doctors are frequently reluctant to maximize drug therapy , either by adding antihypertensive drugs or by switching drug category , in order to achieve blood pressure goals [ 178181 ] . indeed , a gap between guideline recommendations and their implementation in everyday clinical practice has been recognized and represents a significant obstacle in achieving satisfying blood pressure control rates [ 149 , 150 ] . another contributor to treatment resistance is the use of inappropriate drug combinations or suboptimal doses of antihypertensive drugs . indeed , a study of patients with resistant hypertension revealed that simple measures , such as increasing diuretic dosing or switching to appropriate diuretics , can result in significant blood pressure reductions . in our opinion , however , the most important line of evidence suggesting physician inertia on treatment resistance , comes from recent studies reporting significantly higher control rates of hypertension [ 182185 ] . in these studies , various measures have been used to motivate physicians in achieving blood pressure goals , resulting in improved control rates . therefore , physicians need to be the focus of future efforts for the effective management of resistant hypertension . blood pressure technique - related problems . the requirements for proper blood pressure measurement have been standardized and incorporated in the guidelines for the management of arterial hypertension [ 149 , 150 ] . however , the measurement of office blood pressure in clinical practice frequently deviates from the recommendations . therefore , falsely elevated blood pressure levels may be recorded due to several reasons : inappropriate cuff size , failure to comply with the recommendations regarding sufficient time before blood - pressure measurement , arm support at the heart level , assessment in a quiet room , triplicate recordings , and coffee intake or smoking before blood pressure measurement [ 187189 ] . the above mentioned factors may contribute to overestimation of blood pressure and pseudoresistance . similarly , false elevations may be encountered in older patients , in whom adequate artery compression may not be achieved due to marked arterial calcification . therefore , it is essential to assure proper techniques of blood pressure measurement in order to limit the rates of pseudoresistance . another important aspect of resistance is recognition of white coat hypertension . it has been noted that in 2030% of patients with resistant hypertension , treatment resistance may be attributed to the white coat effect [ 143 , 190192 ] . target organ damage therefore , either ambulatory or home blood - pressure monitoring should be performed in every patient with resistant hypertension , in order to exclude the ( ii ) exclusion of drug - induced hypertensionas discussed in the first section of this paper , several drugs may induce blood pressure elevations , with nsaids and oral contraceptives being the most common . therefore , practicing physicians need to be very meticulous during medical history taking , in order to uncover the use of drugs inducing hypertension . the withdrawal of offended drugs usually results to the return of blood pressure at previous levels . in the case , however , that the drug is considered essential for the treatment of comorbidities , the substitution to another drug with a more friendly profile or the reduction of dose might be beneficial . \n as discussed in the first section of this paper , several drugs may induce blood pressure elevations , with nsaids and oral contraceptives being the most common . therefore , practicing physicians need to be very meticulous during medical history taking , in order to uncover the use of drugs inducing hypertension . the withdrawal of offended drugs usually results to the return of blood pressure at previous levels . in the case , however , that the drug is considered essential for the treatment of comorbidities , the substitution to another drug with a more friendly profile or the reduction of dose might be beneficial . \n ( iii ) reduction of dietary sodium intakesodium intake is excessive in the western world , mainly due to the hidden salt in processed foods . the average sodium intake is far higher than the recommended 2.4 grams per day , reaching even 10 g / day in patients with resistant hypertension . the important role of sodium restriction in patients with resistant hypertension is highlighted by the findings of a recent study . it was found that reductions in sodium intake are accompanied by significant reductions in blood pressure levels in resistant hypertensives . \n sodium intake is excessive in the western world , mainly due to the hidden salt in processed foods . the average sodium intake is far higher than the recommended 2.4 grams per day , reaching even 10 g / day in patients with resistant hypertension . the important role of sodium restriction in patients with resistant hypertension is highlighted by the findings of a recent study . it was found that reductions in sodium intake are accompanied by significant reductions in blood pressure levels in resistant hypertensives . \n ( iv ) evaluation for secondary causes of hypertensionas previously discussed , obstructive sleep apnea , primary aldosteronism , and chronic kidney disease represent the most common secondary causes of resistant hypertension whereas several other conditions may be responsible for treatment resistance as well . the diagnostic workup for secondary hypertension is demanding , requires special knowledge and technology , and should be performed in specialized referral centers , which are familiar with secondary hypertension . although a detailed description of the diagnostic workup is beyond the scope of this paper , some signs and/or findings raising the suspicion of secondary hypertension need to be mentioned . in particular : obesity , snoring , daytime sleepiness , and increased neck diameter raise the suspicion of obstructive sleep apnea ; hypokalemia ( either spontaneous or diuretic induced ) is present in about half of cases with primary aldosteronism ; active urine sediment , small kidneys , and impaired renal function point towards chronic kidney disease ; abdominal bruit , difference in renal size raise the suspicion of renal artery stenosis .. \n as previously discussed , obstructive sleep apnea , primary aldosteronism , and chronic kidney disease represent the most common secondary causes of resistant hypertension whereas several other conditions may be responsible for treatment resistance as well . the diagnostic workup for secondary hypertension is demanding , requires special knowledge and technology , and should be performed in specialized referral centers , which are familiar with secondary hypertension . although a detailed description of the diagnostic workup is beyond the scope of this paper , some signs and/or findings raising the suspicion of secondary hypertension need to be mentioned . in particular : obesity , snoring , daytime sleepiness , and increased neck diameter raise the suspicion of obstructive sleep apnea ; hypokalemia ( either spontaneous or diuretic induced ) is present in about half of cases with primary aldosteronism ; active urine sediment , small kidneys , and impaired renal function point towards chronic kidney disease ; abdominal bruit , difference in renal size raise the suspicion of renal artery stenosis .. \n ( v ) pharmacologic management of resistant hypertensionthe pathophysiology of resistant hypertension provides the rational for the effective management of this clinical entity . the combination of increased systemic vascular resistance with marked volume expansion in many cases , renders the triple combination of a drug inhibiting the renin - angiotensin axis ( ace - inhibitors or angiotensin receptor blockers ) with a calcium antagonist and a diuretic a very attractive combination for the majority of patients ( unless these drugs are contraindicated or not tolerated , or other drugs are indicated due to comorbidities ) . however , reliable data verifying the superiority of this combination over other combinations is not available . special attention has to be drawn in maximizing the dose of diuretics or switching to loop diuretics in patients with low gfr . the overactivation of the sympathetic nervous system renders beta blockers , alpha blockers , and centrally acting antihypertensive drugs ( clonidine , alpha methyldopa ) of potential benefit in many patients when added in previous therapy . direct vasodilators , such as hydralazine and minoxidil , can be very effective for blood pressure management , especially in african americans and patients with chronic kidney disease . a vast amount of evidence indicates that spironolactone is a drug of choice in the treatment of resistant hypertension . several studies revealed impressive blood pressure reductions in patients with resistant hypertension when spironolactone was added in the therapeutic regime [ 195205 ] . administration of one antihypertensive drug at bedtime has been shown to improve blood pressure control in patients with resistant hypertension [ 206208 ] . \n the pathophysiology of resistant hypertension provides the rational for the effective management of this clinical entity . the combination of increased systemic vascular resistance with marked volume expansion in many cases , renders the triple combination of a drug inhibiting the renin - angiotensin axis ( ace - inhibitors or angiotensin receptor blockers ) with a calcium antagonist and a diuretic a very attractive combination for the majority of patients ( unless these drugs are contraindicated or not tolerated , or other drugs are indicated due to comorbidities ) . however , reliable data verifying the superiority of this combination over other combinations is not available . special attention has to be drawn in maximizing the dose of diuretics or switching to loop diuretics in patients with low gfr . the overactivation of the sympathetic nervous system renders beta blockers , alpha blockers , and centrally acting antihypertensive drugs ( clonidine , alpha methyldopa ) of potential benefit in many patients when added in previous therapy . direct vasodilators , such as hydralazine and minoxidil , can be very effective for blood pressure management , especially in african americans and patients with chronic kidney disease . a vast amount of evidence indicates that spironolactone is a drug of choice in the treatment of resistant hypertension . several studies revealed impressive blood pressure reductions in patients with resistant hypertension when spironolactone was added in the therapeutic regime [ 195205 ] . administration of one antihypertensive drug at bedtime has been shown to improve blood pressure control in patients with resistant hypertension [ 206208 ] . \n ( vi ) newer drugs for the management of resistant hypertension endothelin antagonists exhibited promising results in preliminary studies . the future of darusentan remains unclear , however , since in another study in patients with resistant hypertension , darusentan failed to be more effective than placebo regarding office blood pressure reductions . it has to be mentioned , however , that in the latter study , significant differences were detected in ambulatory blood pressure between darusentan and placebo , indicating that further studies are needed with this drug category . another interesting approach for the management of resistant hypertension is the administration of nitric oxide donors . in a recent small clinical study of six patients with resistant hypertension , however , this finding has to be interpreted with caution , since the concomitant use of these medications is contraindicated due to the possibility of severe hypotension . \n the future of darusentan remains unclear , however , since in another study in patients with resistant hypertension , darusentan failed to be more effective than placebo regarding office blood pressure reductions . it has to be mentioned , however , that in the latter study , significant differences were detected in ambulatory blood pressure between darusentan and placebo , indicating that further studies are needed with this drug category . another interesting approach for the management of resistant hypertension is the administration of nitric oxide donors . in a recent small clinical study of six patients with resistant hypertension , however , this finding has to be interpreted with caution , since the concomitant use of these medications is contraindicated due to the possibility of severe hypotension . \n ( vii ) interventional management of resistant hypertensiondespite the wide application of antihypertensive therapy , a substantial portion of the hypertensive population remains uncontrolled although taking more than three drugs . this situation calls for testing alternative approaches in patients with resistant hypertension . carotid baroreceptors and renal sympathetic overdrive play a significant role in blood pressure regulation [ 212 , 213 ] . during the last decade , two new approaches have revived the use of interventional techniques for the management of resistant hypertension . carotid baroreceptor stimulation and renal sympathetic denervation have shown promising preliminary results in patients with resistant hypertension [ 214 , 215 ] . however , further studies are needed to establish their role in the management of resistant hypertension . \n despite the wide application of antihypertensive therapy , a substantial portion of the hypertensive population remains uncontrolled although taking more than three drugs . this situation calls for testing alternative approaches in patients with resistant hypertension . carotid baroreceptors and renal sympathetic overdrive play a significant role in blood pressure regulation [ 212 , 213 ] . during the last decade , two new approaches have revived the use of interventional techniques for the management of resistant hypertension . carotid baroreceptor stimulation and renal sympathetic denervation have shown promising preliminary results in patients with resistant hypertension [ 214 , 215 ] . however , further studies are needed to establish their role in the management of resistant hypertension ."
] | resistant hypertension is defined as uncontrolled blood pressure despite the use of three antihypertensive drugs , including a diuretic , in optimal doses . treatment resistance can be attributed to poor adherence to antihypertensive drugs , excessive salt intake , physician inertia , inappropriate or inadequate medication , and secondary hypertension . drug - induced hypertension , obstructive sleep apnoea , primary aldosteronism , and chronic kidney disease represent the most common secondary causes of resistant hypertension . several drugs can induce or exacerbate pre - existing hypertension , with non - steroidal anti - inflammatory drugs being the most common due to their wide use . obstructive sleep apnoea and primary aldosteronism are frequently encountered in patients with resistant hypertension and require expert management . hypertension is commonly found in patients with chronic kidney disease and is frequently resistant to treatment , while the management of renovascular hypertension remains controversial . a step - by - step approach of patients with resistant hypertension is proposed at the end of this review paper . |
[
"the use of transradial coronary angiography and intervention ( tri ) is increasing because of its low rates of major vascular access - related complications and the potential for early mobilization.1)2 ) a large - bore guiding catheter ( gc ) with a large - bore introducer sheath is needed in patients with complex lesions , but they can not be used in patients with a small radial artery ( ra ) because they can cause forearm discomfort and ra spasm and occlusion,3 ) which are significant limitations to the transradial approach . to conquer this limitation , gc that does not require the sheathless gc system ( sheathless eaucath , asahi intecc , japan ) consists of a hydrophilic gc and a central dilator . this system can be used to insert the gc into the ra without the use of an introducer sheath . the outer diameter of the 6.5 french ( fr . ) sheathless gc ( 2.16 mm ) is smaller than a 5 fr . sheathless gc ( 2.49 mm ) is also less than that of a 6 fr . 1 ) . with this feature , the sheathless gc system enables performance of tri even in patients with small ras . furthermore , the hydrophilic coating that is present along the entire length of the gc may be helpful in reducing radial pain and ra spasm . here , we evaluated the feasibility of coronary intervention using the sheathless gc in patients with small ras .",
"all patients underwent diagnostic coronary angiography using a 5 fr . conventional catheter through a 5 fr . patients who required primary percutaneous coronary intervention ( pci ) were excluded because preparation of a sheathless gc that is composed of two pieces ( a catheter and a central dilator ) requires more time than a conventional one - piece gc . all procedures were performed in the left ra unless the patient had a history of previous angiography through the right ra . a loading dose of 600 mg clopidogrel and 300 mg aspirin was given to all patients at least three hours before the procedure . we administered 5,000 units of heparin through the ra after insertion of the 5 fr . introducer sheath . an additional dose of 5,000 units heparin was given through the same route before pci the ra was punctured using a 20-g venous needle at a point 5 - 10 mm proximal to the styloid process after subcutaneous infiltration with 0.6 ml of 2% lidocaine . a 5 fr . normal saline ( 10 ml ) with 200 g of nitroglycerine was injected into the ra through the introducer sheath to prevent ra spasm . angiography of the ra was performed after injection of normal saline ( 10 ml ) with 200 g of nitroglycerine . a 30- to 40-mm long segment of ra from the tip of the introducer sheath was selected for the determination of the mean diameter . the mean of the maximal and minimal diameter of the selected segment of ra was used to determine the size of the ra using a computer - assisted quantification method ( ge , us ) . because the outer diameter of the 5 fr . introducer sheath was approximately 2.3 mm in diameter , a small ra was defined as a diameter 2.3 mm . after the diagnostic angiography , the sheath was exchanged for the sheathless catheter over a standard 150 cm j - tipped 0.035-inch ( terumo , japan ) wire . the shape and size of the sheathless gc the sheathless gc was composed of two parts : a hydrophilic catheter and a central dilator . the sheathless gc with the central dilator was advanced along the 0.035-inch wire to the proximal ascending thoracic aorta . the ostium of the selected coronary artery was engaged by the gc and pci was performed . we defined procedural success as the successful implantation of stent(s ) with final thrombolysis in myocardial infarction flow grade 3 and residual stenosis < 30% , despite the selection of the gc .",
"all patients underwent diagnostic coronary angiography using a 5 fr . conventional catheter through a 5 fr . patients who required primary percutaneous coronary intervention ( pci ) were excluded because preparation of a sheathless gc that is composed of two pieces ( a catheter and a central dilator ) requires more time than a conventional one - piece gc . all procedures were performed in the left ra unless the patient had a history of previous angiography through the right ra .",
"a loading dose of 600 mg clopidogrel and 300 mg aspirin was given to all patients at least three hours before the procedure . we administered 5,000 units of heparin through the ra after insertion of the 5 fr . introducer sheath . an additional dose of 5,000 units heparin was given through the same route before pci .",
"the ra was punctured using a 20-g venous needle at a point 5 - 10 mm proximal to the styloid process after subcutaneous infiltration with 0.6 ml of 2% lidocaine . a 5 fr . normal saline ( 10 ml ) with 200 g of nitroglycerine was injected into the ra through the introducer sheath to prevent ra spasm . angiography of the ra was performed after injection of normal saline ( 10 ml ) with 200 g of nitroglycerine . a 30- to 40-mm long segment of ra from the tip of the introducer sheath was selected for the determination of the mean diameter . the mean of the maximal and minimal diameter of the selected segment of ra was used to determine the size of the ra using a computer - assisted quantification method ( ge , us ) . because the outer diameter of the 5 fr . introducer sheath was approximately 2.3 mm in diameter , a small ra was defined as a diameter 2.3 mm .",
"after the diagnostic angiography , the sheath was exchanged for the sheathless catheter over a standard 150 cm j - tipped 0.035-inch ( terumo , japan ) wire . the shape and size of the sheathless gc the sheathless gc was composed of two parts : a hydrophilic catheter and a central dilator . the sheathless gc with the central dilator was advanced along the 0.035-inch wire to the proximal ascending thoracic aorta . the ostium of the selected coronary artery was engaged by the gc and pci was performed .",
"we defined procedural success as the successful implantation of stent(s ) with final thrombolysis in myocardial infarction flow grade 3 and residual stenosis < 30% , despite the selection of the gc .",
"",
"",
"a total of 25 patients ( 29 lesions ) with a small ra who underwent pci using a sheathless gc were included in this study . the mean age was 66.110.2 years , and nine ( 36.0% ) patients were men . approximately half of the patients had a history of hypertension ( 52.0% ) and diabetes mellitus ( 52.0% ) . eleven ( 44.0% ) patients had stable angina , 12 ( 48.0% ) had acute coronary syndrome , and two ( 8.0% ) had ischemic heart failure . twenty ( 69.0% ) lesions were located in the left anterior descending ( lad ) coronary artery . according to the modified american college of cardiology / american heart association criteria , most of the lesions were type b2 ( 27.6% ) or c ( 37.9% ) . a 6.5 fr . power backup ( pb ) 3 cm sheathless gc was used in approximately half of the cases ( 51.7% ) . most of the lesions were implanted with a zotarolimus - eluting stent(s ) ( 48.2% ) or everolimus - eluting stent(s ) ( 37.9% ) . one lesion consisting of restenosis of a previously implanted drug - eluting stent was treated using balloon angioplasty with a cutting balloon . the mean total length of the stents was 36.819.9 mm and the mean diameter was 2.960.43 mm . two of three bifurcated lesions were treated with a kissing balloon technique and one lesion was treated with two stents by using a modified t - stenting technique . two of the successfully treated lesions required conversion to a conventional gc after insertion of the 6 fr . amplatz left ( al ) 0.75 sheathless gc in the right coronary artery ( rca ) was treated by conversion to 6 fr . these two sheathless gcs did not engage the coronary arteries and provided poor guiding support ; however , the main reason for conversion to a conventional gc was a limitation in gc shape selection . the two failed lesions were chronic total occlusions ( cto ) in the lad that could not be crossed with a guidewire supported by a microcatheter . only one patient , who developed ra spasm during coronary angiography using a conventional 5 fr catheter , complained of forearm pain during pci . although there was no immediate access site complication including hematoma and bleeding , two patients lost pulse in the ra used as the access site without hand ischemia during a median 357 ( 140 - 432 ) days of follow - up .",
"our study shows the feasibility of tri using a sheathless gc in 25 consecutive patients ( 29 lesions ) with small ras ( diameter 2.3 mm ) . the procedural success rate of tri is comparable to that of transfemoral coronary intervention with the benefit of lower rates of bleeding and fewer vascular complications.1)2 ) however , a larger gc and introducer sheath can not be used in some patients because of the small diameter of their ra . saito et al.3 ) demonstrated that the ras were smaller than the outer diameter of a 6 fr . they also reported that when the ratio of the ra inner diameter to the cannulated sheath outer diameter was less than 1.0 , the incidence of flow reduction was increased . they therefore suggested that smaller catheters should be considered to prevent ra occlusions or narrowing . with the sheathless gc system , one can use the larger - bore gc in patients with a small ra without using an introducer sheath and thereby minimizing radial discomfort.4 ) yoo et al.5 ) have shown that the mean ra diameter measured by ultrasound was 2.660.44 mm ( male : 2.690.40 mm , female : 2.430.38 mm ) in korean patients . although direct comparison is difficult because we did not use ultrasound to measure ra diameter , the mean diameter of the ra in our study was 1.820.27 mm , which is smaller than the mean ra diameter in korean patients and smaller than the outer diameter of the sheathless gc . despite this finding this patient developed severe ra spasm before using the sheathless gc and the operator has difficulty in performing diagnostic coronary angiography with the conventional 5 fr . however , the operator did not experience any difficulty in manipulating the catheter during pci . despite the above - mentioned results , a disadvantage in using a sheathless gc was noted . because sheathless gcs slide easily within vessels due to the hydrophilic coating , disengagement of the catheter could happen in cases requiring good guiding support . in our study , the sheathless gc frequently slipped away from the ostium in two cases of rca intervention , despite the small size of the ra . mamas et al.6 ) fixed the sheathless gc to the forearm at the point of entry to the ra using a tegaderm adhesive dressing to avoid slippage during the procedure . even if this solution could be helpful in preventing the slippage of gc , it could also be very dangerous if the patient were to move unconsciously as it may result in an aortic or coronary dissection . two studies have reported successful use of a sheathless gc in complex interventions with large bore catheters including rotablation , crush stent bifurcation lesions , 7 fr . proximal protection , thrombectomy devices , and simultaneous kissing stenting.7)8 ) in our study , we successfully performed three complex procedures including two in which the kissing balloon technique was used and one in which the modified t - stenting technique was used . most recently , mamas et al.6 ) reported a 100% procedural success using the sheathless gc in 100 patients . the primary difference in our study is that we enrolled only patients with small radial arteries , because the use of a sheathless gc is more beneficial for these patients . although we failed to treat two cases of cto lesions which required catheter conversion from sheathless to conventional , these results were not due to the gc itself but to limitations in gc selection with different shapes . only al , pb , hotkey stick , and judkins left gcs were available at our institute , and the shapes of catheters were slightly different from those of conventional catheters . during a median 357 days of follow - up , two patients ( 8% ) developed ra occlusion , and this is consistent with a previous report of an asymptomatic ra occlusion rate of 5 - 10%.9 ) because the outer diameter of the sheathless gc is smaller than that of the conventional gc , we expected a lower incidence of ra occlusion , and our results may be related to the fact that we included only patients with small ras and some of the patients had a ra with a diameter smaller than the outer diameter of sheathless gcs . even though the sheathless gc could be beneficial in forearm pain , the risk of ra occlusion should be considered in treating patients with small ras . although the use of the sheathless gc is feasible in cases of primary pci , this system requires more time to assemble because it is composed of two parts , and the introducer sheath must be removed before inserting it . first , although we measured the diameter of the ra by angiography after using a vasodilator , this intervention could not completely prevent vasospasm . this fact could result in a smaller ra diameter than the diameter measured by non - invasive methods such as ultrasound . second , we documented the presence of forearm pain only when the patient complained of forearm pain and did not use a pain scale such as the visual analogue scale or the 4-category verbal rating scale . finally , this was not a randomized trial to compare the sheathless gc with the conventional gc . the use of a sheathless gc was feasible in almost clinical settings for patients with small ras regardless of complexity or severity of the lesion . however , disengagement of the gc and limitations in the setting of primary pci should be taken into account .",
"the use of a sheathless gc was feasible in almost clinical settings for patients with small ras regardless of complexity or severity of the lesion . however , disengagement of the gc and limitations in the setting of primary pci should be taken into account ."
] | background and objectivestransradial coronary angiography and intervention are increasing in frequency due to lower major vascular access site complications and the potential for early mobilization . however , the small size of the radial artery ( ra ) is a major limitation of this technique . a sheathless guiding catheter ( gc ) has recently been introduced that has a 1 - 2 french smaller diameter compared with the corresponding introducer sheath . this catheter also has a hydrophilic coating along its entire length . we evaluated the feasibility of using a sheathless gc in patients who have small radial arteries.subjects and methodsthe procedural results were evaluated in patients with small radial arteries ( diameter < 2.3 mm ) who underwent transradial coronary intervention using a sheathless gc.resultsa total of 25 ( male : 9 ) patients with 29 lesions were enrolled . the mean ra diameter was 1.810.26 mm . 44% of the patients had stable angina and 50.0% had acute coronary syndrome . the procedural success rate was 93.1% . two patients ( 6.9% ) had chronic total occlusive lesions that could not be crossed with a guide - wire despite good guiding support . an intravascular ultrasound could be used for all of the treated lesions . multi - vessel intervention was performed in 29.2% of the patients . two bifurcated lesions were treated with a kissing balloon technique , and one with a modified t - stenting technique . no catheter related complications were reported.conclusionthe use of a sheathless gc is feasible in patients with small radial arteries without catheter related complications . |
[
"as most of the human genes with multiple exons express more than one transcript , alternative splicing is considered to be a major mechanism for producing a complex proteome from a limited number of genes ( 1 ) . the different transcripts of one gene can be translated into functionally different protein isoforms ( 2 ) or can be degraded by nonsense - mediated mrna decay ( 3 ) . the regulation of alternative splicing plays a role in several important processes such as the formation and function of synapses ( 4 ) , axon guidance in drosophila ( 5,6 ) and t - cell activation ( 7 ) . furthermore , defects in alternative splicing are causative for a number of human diseases ( 8,9 ) and thought to contribute to cancer development ( 10 ) . while much research focused on larger alternative splice events such as exon skipping , it recently became clear that numerous alternative splice events result in only subtle changes of the mrna and of the protein ( 1214 ) . the most widespread type is the alternative splicing at acceptor sites with the pattern nagnag ( n stands for a , c , g , or t , throughout the paper we write t instead of u also when referring to an rna sequence ) ( 12,15,16 ) . in such a motif , both ags represent potential alternative acceptor sites which result in transcripts that differ by only 3 nt ( the nag ) . ( est)/mrna data 16% of all nagnags and noteworthy 39% of the tandem acceptors with a haghag pattern ( also denoted plausible nagnags , h stands for a , c , or t ) are currently known to be alternatively spliced . furthermore , we recently found evidence for alternative splicing at donor splice sites with the motifs gtngtn , gcngtn and gtngcn ( denoted as gyngyn donors , y stands for c or t ) where both gt / gc donors are used ( 17 ) . we denote a tandem splice site as confirmed if the usage of both splice sites is represented by at least one est / mrna and unconfirmed otherwise . although the term tandem splice site refers to any pair of neighboring splice sites , in our database we collected data about nagnag acceptors and gyngyn donors . apart from their frequency , subtle alternative splice events are of interest since several cases are known to result in functionally different protein isoforms ( 16,1822 ) and alternative nagnag splicing in the untranslated region ( utr ) can affect the translational efficiency ( 23 ) . moreover , the effect for the protein might be drastic since a premature stop codon can be created ( 12,17 ) . many nagnag acceptors are conserved between human and mouse and the ratio of the two splice forms can be highly controlled in a tissue - specific manner ( 12,16,24 ) . furthermore , snps that affect a nagnag acceptor can be relevant for human disease as demonstrated for the abca4 gene ( 25 ) and suggested for many other genes ( 26 ) . while previous databases on alternative splicing do not store such subtle splice events ( 2729 ) , recent databases contain confirmed tandem splice sites ( 3032 ) . however , they do not contain unconfirmed tandem splice sites and do not allow to search for tandem splice sites with specific features . to facilitate further experimental studies as well as large - scale bioinformatics analyses of tandem splice sites , we have developed a relational database , tassdb ( tandem splice site database ) , which provides large collections of gyngyn donors and nagnag acceptors in eight species . since these subtle splice events can easily be overlooked in experimental systems ( a 3 nt difference between two bands is barely visible on an agarose gel ) and additional alternative splice events are likely to be missed in current est data , tassdb also stores unconfirmed tandem splice sites . a user interface allows to search for genes of interest and to get all relevant information about the respective tandem splice sites . it is also possible to search for genes harboring gyngyns / nagnags with specific features . finally , tassdb annotates nagnags that are affected by a snp and also contains 51 tandem acceptors whose nagnag pattern can only be observed in another snp - allele and not in the human genome reference sequence .",
"as alternatively spliced nagnag acceptors and gyngyn donors occur in a large number of lineages including vertebrates , flies and nematodes , tassdb stores information about the tandem splice sites of eight species : homo sapiens , canis familiaris , mus musculus , rattus norvegicus , gallus gallus , danio rerio , drosophila melanogaster and caenorhabditis elegans . our annotation pipeline is based on transcript - to - genome mappings taken from the ucsc genome browser ( 33 ) . apart from the refseq annotation that was used for all species , we additionally used ensembl transcripts for human , rat , chicken , zebrafish , the ucsc knowngene set for human , mouse , rat ( 34 ) , flybase transcripts for drosophila and wormbase transcripts for c.elegans . intron structure as well as the annotation of the open reading frame was taken from the ucsc annotation . to identify alternatively spliced nagnags and gyngyns , we used blast against all ests and mrnas from the respective species as described in refs ( 12,17 ) . the primary aim of tassdb is to provide information that is specific for the tandem splice site and the putative alternative splice event . thus , we collected the following data : the splice site motif , its genomic locus , its location in the transcript ( 5/3-utr or cds with intron phase 0/1/2 ) , the impact of the splice event on the protein , the sequences and length of the up-/downstream exon and the intron , and information about the ests / mrnas that indicate usage of one of the two splice sites . as the degree of similarity of a splice site to the overall consensus is an important criterion to distinguish alternatively from non - alternatively spliced nagnag acceptors ( 15 ) , we also computed the maximum entropy scores for both splice sites in a tandem ( 35 ) . the basic design of tassdb was driven by the idea to separate splice site specific data from transcript specific data . for example , the gyngyn / nagnag motif , the genomic locus and the splice site scores are independent of transcript annotation . however , features such as intron phase , protein impact and est confirmation depend on the annotation and the exon for example , the intron 13 of the phf1 gene that contains a cagcag acceptor is in intron phase 2 according to the annotation of nm_024165 . due to skipping of the upstream 95 nt exon , thus , the protein impact of the cagcag is the insertion / deletion ( indel ) of a ser in nm_024165 but indel ala in nm_002636 ( figure 1a ) . another example is the cagcag acceptor of intron 1 of the cbx1 gene having two alternative first exons ( represented by the transcripts enst00000225603 and nm_006807 ) . we found est evidences for alternative cagcag splicing if the upstream first exon is used ( enst00000225603 ) but not if the downstream first exon is used ( nm_006807 ) ( figure 1b ) . whether this is a biological phenomenon or simply the consequence of a lack of sufficient est data , deserves further research . ( a ) example of a nagnag acceptor whose protein impact differs in the annotation of two transcripts . ( b ) example of a nagnag acceptor that is only confirmed according the exon - intron structure of one but not a second transcript . the most frequent use of tassdb might be a search for tandem splice sites of a given gene . to this end , tassdb provides a quick search interface where a user only specifies a gene symbol or a transcript accession and gets the entire information of both confirmed and unconfirmed gyngyns and nagnags for this gene . a more advanced task is to select tandem splice sites with specific features for further experimental or computational analysis . to this end , tassdb provides an advanced search interface where the user can restrict the search to gyngyns or nagnags with the following features : ( i ) pattern of the splice site , ( ii ) number of ests / mrnas that match both splice forms , ( iii ) location in the utr or in the coding sequence ( cds ) ( as well as specific intron phases ) , and ( iv ) protein impact ( figure 2 ) . thus , it is easy to formulate queries such as : ( i ) show all confirmed nagnags that result in single amino acid events . ( ii ) show all tandem splice sites where both splice forms are represented by at least three ests / mrnas and that are located in the 5-utr . the result of the search consists of two parts : ( i ) summary table of affected genes and their number of tandem splice sites and ( ii ) detailed tables with information about the tandem splice sites . the detailed result tables also provide links to the ests / mrnas for both splice forms as well as links to the ucsc genome browser . if the transcript specific data differ between transcripts , tassdb will show detailed result tables with more than two columns ( figure 1 ) . features that differ between transcripts are shown in black while those that are equal in all transcripts are shown in grey colour . screenshot of the advanced search interface : one can search for genes harboring tandem splice sites with a specific pattern [ such as gtngcn for tandem donors or haghag ( plausible ) for tandem acceptors ] , a certain number of ests / mrnas matching both splice forms , a location in the utr or cds and a specific protein impact . as snps that affect nagnag acceptors are predictive for variation in alternative splicing , tassdb also annotates the snp data found in our previous study ( 26 ) including 51 polymorphic tandem acceptors whose nagnag pattern is not visible in the genome reference sequence . such an example is the appbp1 gene where acceptor pattern of intron 6 is aaacag in the human reference genome sequence . the snp rs363209 leads to a second allele with an aagcag pattern , thus this g - allele creates a novel tandem acceptor . tassdb always contains the sequence with the nagnag acceptor ( in this case the g - allele ) . finally , tassdb provides an interface where the user can send an arbitrary sql select query to the database . the relational database schema with table and thus , tassdb can be used to retrieve large datasets for further computational analysis of tandem splice sites . it is evident that tandem splice sites are widespread in all eight species and that with the exception of c.elegans for nagnags numerous of them are already known to be alternatively spliced . summary of the current content of tassdb total number of transcripts used for detecting tandem splice sites .",
"as alternatively spliced nagnag acceptors and gyngyn donors occur in a large number of lineages including vertebrates , flies and nematodes , tassdb stores information about the tandem splice sites of eight species : homo sapiens , canis familiaris , mus musculus , rattus norvegicus , gallus gallus , danio rerio , drosophila melanogaster and caenorhabditis elegans . our annotation pipeline is based on transcript - to - genome mappings taken from the ucsc genome browser ( 33 ) . apart from the refseq annotation that was used for all species , we additionally used ensembl transcripts for human , rat , chicken , zebrafish , the ucsc knowngene set for human , mouse , rat ( 34 ) , flybase transcripts for drosophila and wormbase transcripts for c.elegans . intron structure as well as the annotation of the open reading frame was taken from the ucsc annotation . to identify alternatively spliced nagnags and gyngyns , we used blast against all ests and mrnas from the respective species as described in refs ( 12,17 ) .",
"the primary aim of tassdb is to provide information that is specific for the tandem splice site and the putative alternative splice event . thus , we collected the following data : the splice site motif , its genomic locus , its location in the transcript ( 5/3-utr or cds with intron phase 0/1/2 ) , the impact of the splice event on the protein , the sequences and length of the up-/downstream exon and the intron , and information about the ests / mrnas that indicate usage of one of the two splice sites . as the degree of similarity of a splice site to the overall consensus is an important criterion to distinguish alternatively from non - alternatively spliced nagnag acceptors ( 15 ) , we also computed the maximum entropy scores for both splice sites in a tandem ( 35 ) . the basic design of tassdb was driven by the idea to separate splice site specific data from transcript specific data . for example , the gyngyn / nagnag motif , the genomic locus and the splice site scores are independent of transcript annotation . however , features such as intron phase , protein impact and est confirmation depend on the annotation and the exon for example , the intron 13 of the phf1 gene that contains a cagcag acceptor is in intron phase 2 according to the annotation of nm_024165 . due to skipping of the upstream 95 nt exon , thus , the protein impact of the cagcag is the insertion / deletion ( indel ) of a ser in nm_024165 but indel ala in nm_002636 ( figure 1a ) . another example is the cagcag acceptor of intron 1 of the cbx1 gene having two alternative first exons ( represented by the transcripts enst00000225603 and nm_006807 ) . we found est evidences for alternative cagcag splicing if the upstream first exon is used ( enst00000225603 ) but not if the downstream first exon is used ( nm_006807 ) ( figure 1b ) . whether this is a biological phenomenon or simply the consequence of a lack of sufficient est data , deserves further research . ( a ) example of a nagnag acceptor whose protein impact differs in the annotation of two transcripts . ( b ) example of a nagnag acceptor that is only confirmed according the exon - intron structure of one but not a second transcript .",
"the most frequent use of tassdb might be a search for tandem splice sites of a given gene . to this end , tassdb provides a quick search interface where a user only specifies a gene symbol or a transcript accession and gets the entire information of both confirmed and unconfirmed gyngyns and nagnags for this gene . a more advanced task is to select tandem splice sites with specific features for further experimental or computational analysis . to this end , tassdb provides an advanced search interface where the user can restrict the search to gyngyns or nagnags with the following features : ( i ) pattern of the splice site , ( ii ) number of ests / mrnas that match both splice forms , ( iii ) location in the utr or in the coding sequence ( cds ) ( as well as specific intron phases ) , and ( iv ) protein impact ( figure 2 ) . thus , it is easy to formulate queries such as : ( i ) show all confirmed nagnags that result in single amino acid events . ( ii ) show all tandem splice sites where both splice forms are represented by at least three ests / mrnas and that are located in the 5-utr . the result of the search consists of two parts : ( i ) summary table of affected genes and their number of tandem splice sites and ( ii ) detailed tables with information about the tandem splice sites . the detailed result tables also provide links to the ests / mrnas for both splice forms as well as links to the ucsc genome browser . if the transcript specific data differ between transcripts , tassdb will show detailed result tables with more than two columns ( figure 1 ) . features that differ between transcripts are shown in black while those that are equal in all transcripts are shown in grey colour . screenshot of the advanced search interface : one can search for genes harboring tandem splice sites with a specific pattern [ such as gtngcn for tandem donors or haghag ( plausible ) for tandem acceptors ] , a certain number of ests / mrnas matching both splice forms , a location in the utr or cds and a specific protein impact . as snps that affect nagnag acceptors are predictive for variation in alternative splicing , tassdb also annotates the snp data found in our previous study ( 26 ) including 51 polymorphic tandem acceptors whose nagnag pattern is not visible in the genome reference sequence . such an example is the appbp1 gene where acceptor pattern of intron 6 is aaacag in the human reference genome sequence . the snp rs363209 leads to a second allele with an aagcag pattern , thus this g - allele creates a novel tandem acceptor . tassdb always contains the sequence with the nagnag acceptor ( in this case the g - allele ) . finally , tassdb provides an interface where the user can send an arbitrary sql select query to the database . the relational database schema with table and thus , tassdb can be used to retrieve large datasets for further computational analysis of tandem splice sites .",
"it is evident that tandem splice sites are widespread in all eight species and that with the exception of c.elegans for nagnags numerous of them are already known to be alternatively spliced . summary of the current content of tassdb total number of transcripts used for detecting tandem splice sites .",
"as tandem splice sites seem to occur in all species allowing alternative splicing , it would be desirable to include information for other species . in the future , we plan to include bos taurus , xenopus tropicalis , takifugu rubripes and anopheles gambiae as more ests and annotated genes become available . furthermore , information about conservation of these splice events in other species as well as more data about the protein impact may be included . since the database was designed to store information about any tandem splice site , an extension to tandem splice sites that are more than 3 nt apart is conceivable ."
] | subtle alternative splice events at tandem splice sites are frequent in eukaryotes and substantially increase the complexity of transcriptomes and proteomes . we have developed a relational database , tassdb ( tandem splice site database ) , which stores extensive data about alternative splice events at gyngyn donors and nagnag acceptors . these splice events are of subtle nature since they mostly result in the insertion / deletion of a single amino acid or the substitution of one amino acid by two others . currently , tassdb contains 114 554 tandem splice sites of eight species , 5209 of which have est / mrna evidence for alternative splicing . in addition , human snps that affect nagnag acceptors are annotated . the database provides a user - friendly interface to search for specific genes or for genes containing tandem splice sites with specific features as well as the possibility to download large datasets . this database should facilitate further experimental studies and large - scale bioinformatics analyses of tandem splice sites . the database is available at . |
[
"congenital heart defects / diseases contribute substantially to morbidity and mortality in childhood , especially in the third - world countries where facilities for management are often deficient.1 about 35,000 infants ( 1 out of every 125 ) are born with heart defects every year in the united states.2 the incidence in the tropics is not expected to differ from the 8 - 10 per 1000 live - births documented in the developed world.3 the defect may be so slight that the baby may be asymptomatic for many years after birth , or so severe that it is life threatening . heart defects are the leading cause of birth defect - related deaths.4 however ; the use of echocardiography has improved description of congenital heart diseases and their early diagnosis.5 this , has led to dramatic increases in survival of children with serious heart defects . cor triatriatum is a rare congenital cardiac anomaly , in which a fibromuscular membrane divides the atrium in two . it was first reported in 1868.6 cor triatriatum , a heart with 3 atria ( triatrial heart ) , is a congenital anomaly in which the left atrium ( cor triatriatum sinistrum ) or right atrium ( cor triatriatum dextrum ) is divided into 2 parts by a fold of tissue , a membrane , or a fibromuscular band.7 however , variable types of subtotal cor triatriatum are also noted , with only the right or left pulmonary veins draining into the upper chamber.8 cor triatriatum represents 0.1% of all congenital cardiac malformations and may be associated with other cardiac defects in as many as 50% of cases . examples of associated cardiac defects include atrial septal defect , persistent left superior vena cava with an unroofed coronary sinus , partial anomalous pulmonary venous connection , ventricular septal defect and more complex cardiac lesions such as tetralogy of fallot , atrioventricular canal and double outlet right ventricle . associated bicuspid pulmonary valve , aortic valve atresia and heterotaxy have also been described.9 congenital pulmonary vein stenosis is a very rare association with cor triatriatum.10 the morbidity and mortality of cor triatriatum sinistrum is high in those who are symptomatic in infancy . this is due to the severely restrictive opening in the accessory membrane and the association with major cyanotic or acyanotic congenital heart lesions . significant sequel is unusual with cor triatriatum dextrum as it is not commonly associated with life - threatening symptoms or major congenital cardiac defects .",
"a female baby seen on the second day of life was delivered by a 25-year - old primiparous youth corper . the mother attended antenatal clinic in federal medical centre owerri from the 16 week of gestation . however , during the 8 week of pregnancy , the mother had threatened abortion for which some drugs were given ( injections and tablets names unknown ) at a hospital in lagos . she also had some liquid herbal preparation at 8 months of gestation ; other drugs she took were essentially haematinics . she gave birth to a 3.6-kg baby girl who cried immediately after , and breastfeeding commenced . the child was transferred to the special care baby unit from the postnatal ward on account of history of fever on day 2 of life . examination revealed a full - term newborn , febrile ( 38.1 ) with a respiratory rate of 100 cycles per minute , acyanotic , heart rate of 110 beats / min heart however , the child completed a course of antibiotics ( ampicillin sulbactam and gentacin ) and , with clinical improvement , was discharged home . at follow - up at the 2 week of life , the child weighed 3.5 kg , heart rate was 130 beat / min and a grade 3 pansystolic murmur was heard , following which a chest radiograph and electrocardiograph ( ecg ) was requested . at 1 month of life , a review of ecg showed : heart rate : 128 beats / min , t-18 , which suggested supraventricular arrhythmia , abnormal right superior axis deviation . murmur was still grade 3/6 , pansystolic maximal at the left - lower sternal edge . echocardiograph was subsequently requested and the result showed that a 2d echocardiogram was done [ figure 1 ] with the following results : echocardiogram showing the distal chamber ( x ) and the left atrium ; the right atrium ( ra ) , left ventricle ( lv ) , and right ventricle ( rv ) separate left atrium with dividing membranous running in the direction of long axis of left atrium close to the lateral wall . mitral valve draining the larger , more medial chamber , normal atrio - ventriculo - arterial connection . high velocity turbulent flow in the main artery noted ( pa vmax = 335 cm / s pg = 45 mm ) . secundum atrial septal defect [ figure 1 ] the child is presently being followed - up regularly . during her last visit , at 7 months of age , she weighed 9.6 kg , length was 73 cm , occipito - frontal circumference was 47 cm and mid - upper - arm circumference was 15 cm ( all within normal for age ) . cardiovascular examination revealed a child with heart rate of 120 beats / min , apex beat located at the 4 left intercostals space , with a grade 3/6 systolic murmur heard loudest at the upper left sternal edge . the respiratory rate was 42 cycles / min and no organs palpably enlarged on digestive system examination .",
"this was the first case of a five - chambered heart seen and managed in the federal medical centre owerri . the case demonstrates the need for comprehensive evaluation of patients and provision of cardiac investigative facilities ( x - ray , ecg and echocardiograph machines ) in health facilities . in our patient , it was an incidental finding at a routine follow - up clinic . subsequent investigative evaluations led to the confirmation of the diagnosis of a five - chambered heart in a child who has remained asymptomatic . the dearth of facilities in our hospital is obvious here , where the patient had to be referred to the university of nigeria teaching hospital enugu for echocardiograph . clinical manifestations are often delayed due to the presence of a large opening ; and include an asymptomatic murmur . finding is mostly incidental on routine cardiac imaging ; it therefore highlights the need for exhaustive evaluation and management because such conditions , although rare , can still be found here . in conclusion , we reported a case of an asymptomatic congenital - heart defect a five - chambered heart - cor triatriatum , an extremely rare condition ."
] | five - chambered heart is extremely rare in children . we report a case of asymptomatic five chamber heart detected in infancy . the patient is 2-day - old and managed in a special care baby unit ( scbu ) for neonatal sepsis . during routine follow - up at the age of 1 month , she was found to have an asymptomatic murmur . echocardiograph reported five - chambered heart , concluding that it is cor triatriatum , supravalvular pulmonary stenosis and secundum atrial septal defect . the child is still been followed - up and is still asymptomatic at 7 months . five - chambered heart , although rare , can occur even if asymptomatic . |
[
"colorectal cancer ( crc ) is the second leading cause of cancer related death worldwide , making it a fine and attractive area for oncologists to study ( 1 , 2 ) . in numerous cancers including crc , it has been documented that aberration of the growth factor signaling pathways specifically transforming growth factor- ( tgf- ) pathway play a vital role in tumor initiation , progression and metastasis ( 3 - 7 ) . therefore , it has become a proper target for cancer therapy ( 8 - 13 ) . it is has been accepted that a major growth factor such as tgf- , which has a wide range of effects on key physiological events , must be under extended regulation to control its expression and function . this regulation should include mechanisms that allow a variety of effects depending on special cellular and tissue contexts ( 14 - 16 ) . recently , a new layer of cellular mechanisms as microrna ( mirna)-mediated gene expression has been identified that is implicated in the post transcriptional negative regulation ( 17 - 20 ) . the mirnas were well - known to interact with signaling pathway components and to involve in multiple cellular processes as well as initiation , progression and metastasis of human cancers ( 21 - 25 ) . increasing evidences have revealed that cancer - associated mirnas can function as oncogenes or tumor suppressors ( 18 , 20 ) . the mirnas - mediated regulation networks can strictly influence the growth factors signaling pathways ( 24 , 25 ) . there are several studies showing relationship of tgf- with diverse micrornas ( 26 - 29 ) . in addition , it has been shown that basic cell signaling pathways adjust the activity of the related components in mirnas biogenesis pathway to achieve a fine mirnas expression pattern ( 28 ) . recent emerging evidence suggests manipulation of growth factors signaling by special inhibitors can alter mirnas expression in cancer cells in vivo and in vitro ( 30 - 35 ) . several strategies based on either restoration of silenced mirnas or inhibition of overexpressed mirnas has opened a new area of research in cancer therapy including crc . it has been proposed that restoration of normal equilibrium for cancer - related mirnas can inhibit colon tumor progression ( 36 , 37 ) . on the other hand , several reports imply that targeting of tgf- signaling pathway at late stages of carcinogenesis could be a helpful tool for treatment of human cancers such as crc , glioblastoma and breast cancer ( 4 , 8) . these studies show that a series of tgri kinase inhibitors such as sd-208 could be influential in treatment of a range of cancers ( 12 ) . our aim was to investigate the mirnas ( oncogene or tumor suppressor ) , whose expression might be altered due to inhibition of tgf- signaling pathway .",
"sw-48 cell line , a human colon adenocarcinoma cell line ( pasteur institute , tehran , iran ) was grown in 25 cm flask ( spl life sciences ; south korea ) containing rpmi-1640 medium ( gibco ; germany ) supplemented with 5% fetal bovine serum ( fbs ) ( gibco ; germany ) and 100 units / ml penicillin ( gibco ; germany ) . briefly , the cells were trypsinized in exponential growth phase and were seeded in 6-well flat - bottom plates ( spl life sciences ; south korea ) at a density of 510 cells / well ( 2000 l media / well ) . 48 hr after treatment with 0.5 , 1 and 2 m concentrations of sd-208 , the cells were harvested for total rna extraction . the protocol for establishing the xenograft model of colon cancer was approved by the committee on the ethics of animal experiments of tehran university of medical sciences ( ethical code number ; erc / s/277 ) as previously described ( 6 ) . 6-week - old female athymic c56bl/6 nude mice ( n= 8 per group ) were obtained from omid institute for advanced biomodels ( tehran , iran ) . after cell inoculation , xenograft tumors were allowed to achieve a size of 80 mm . then , the animals were randomly divided into two groups of 8 to receive either sd-208 ( 50 mg / kg / d ) or vehicle ( dmso - containing deionized water ) orally for three weeks . obtained tumors after isolating from animals , were fixed in formalin or frozen for histological staining and rna extraction , respectively . to confirm colon adenocarcinoma , tumor tissues tissues were excised and subjected to hematoxylin and eosin ( h&e ) staining ( dako , denmark ) as previously described ( 6 ) . either sw-48 cells or tumor tissues at the mentioned time points after treatment with sd-208 , were subjected for total rna extraction using trizol reagent ( invitrogen ; germany ) according to the manufacturer s instructions . extracted total rna four mirnas as potential onco - mirs ( mir-21 , 31 , 20a , 135b ) and four mirnas as potential suppressor - mirs ( let7-g , mir-133b , 145 , 200c ) involved in colon cancer , were selected from the sanger center mirna registry at http://www.sanger.ac.uk/software/rfam/mirna/index.shtml . microrna expression was analyzed by real - time quantitative polymerase chain reactions ( qpcr ) using the sybr green method ( parsgenom , iran ) . after polyadenylation of total rna and cdna synthesis , mirnas were expanded by the specific primers for mature forms according to the manufacturer s instructions . real - time pcr was performed on a bio rad cfx96 real - time pcr system . rnu6b was used as an endogenous ( internal ) control , and the data were normalized compared to this housekeeping gene . all reactions were performed in triplicate and the absence of contamination was verified using non - template controls . the standard error of means was computed and analysis of variance ( anova , tukey s post tests ) completed via graphpad prism 5.0 software . p - values less than 0.05 were considered to indicate statistically significant differences between data sets .",
"sw-48 cell line , a human colon adenocarcinoma cell line ( pasteur institute , tehran , iran ) was grown in 25 cm flask ( spl life sciences ; south korea ) containing rpmi-1640 medium ( gibco ; germany ) supplemented with 5% fetal bovine serum ( fbs ) ( gibco ; germany ) and 100 units / ml penicillin ( gibco ; germany ) . briefly , the cells were trypsinized in exponential growth phase and were seeded in 6-well flat - bottom plates ( spl life sciences ; south korea ) at a density of 510 cells / well ( 2000 l media / well ) . 48 hr after treatment with 0.5 , 1 and 2 m concentrations of sd-208 , the cells were harvested for total rna extraction .",
"the protocol for establishing the xenograft model of colon cancer was approved by the committee on the ethics of animal experiments of tehran university of medical sciences ( ethical code number ; erc / s/277 ) as previously described ( 6 ) . 6-week - old female athymic c56bl/6 nude mice ( n= 8 per group ) were obtained from omid institute for advanced biomodels ( tehran , iran ) . after cell inoculation , xenograft tumors were allowed to achieve a size of 80 mm . then , the animals were randomly divided into two groups of 8 to receive either sd-208 ( 50 mg / kg / d ) or vehicle ( dmso - containing deionized water ) orally for three weeks . obtained tumors after isolating from animals , were fixed in formalin or frozen for histological staining and rna extraction , respectively .",
"to confirm colon adenocarcinoma , tumor tissues tissues were excised and subjected to hematoxylin and eosin ( h&e ) staining ( dako , denmark ) as previously described ( 6 ) .",
"either sw-48 cells or tumor tissues at the mentioned time points after treatment with sd-208 , were subjected for total rna extraction using trizol reagent ( invitrogen ; germany ) according to the manufacturer s instructions . extracted total rna was stored at -80 c until use .",
"four mirnas as potential onco - mirs ( mir-21 , 31 , 20a , 135b ) and four mirnas as potential suppressor - mirs ( let7-g , mir-133b , 145 , 200c ) involved in colon cancer , were selected from the sanger center mirna registry at http://www.sanger.ac.uk/software/rfam/mirna/index.shtml . microrna expression was analyzed by real - time quantitative polymerase chain reactions ( qpcr ) using the sybr green method ( parsgenom , iran ) . after polyadenylation of total rna and cdna synthesis , mirnas were expanded by the specific primers for mature forms according to the manufacturer s instructions . real - time pcr was performed on a bio rad cfx96 real - time pcr system . rnu6b was used as an endogenous ( internal ) control , and the data were normalized compared to this housekeeping gene . all reactions were performed in triplicate and the absence of contamination was verified using non - template controls .",
"data analysis was performed using the 2-cct method . the standard error of means was computed and analysis of variance ( anova , tukey s post tests ) completed via graphpad prism 5.0 software . p - values less than 0.05 were considered to indicate statistically significant differences between data sets .",
"to assess the potential toxicity effects of sd-208 , the expression levels of mirnas was examined by real time rt - pcr ( table 1 ) . then the appropriate numbers of sw-48 cells were injected into 8 mice to develop tumors . following sd-208 treatment period , we could not observe any changes in animal behavior , body weight or lifespan compared to controls . these data suggest that sd-208 lacks toxic effects on animals ( data not shown ) . mirnas differentially expressed in sw-48 cells after 48 hr treatment with sd-208 colon adenocarcinoma confirmation the h&e staining confirmed marked cellularity with significant hyperchromatism and pleomorphism ( figure 1 ) . the pattern of adenocarcinoma was alike to the human origin ( figure 1 a , b ) . nude mice bearing developed sw-48 tumors were divided into two groups : sd-208 treatment ( a ) and vehicle ( b ) . hematoxylin and eosin staining of tumor tissues confirmed colon adenocarcinoma in both treated ( a ) and non - treated ( b ) tumor - bearing mice . the staining demonstrates marked cellularity with profound hyperchromatism and pleomorphism ( arrows ) and low differentiated tumor cells similar to human colon cancer expression pattern of selected onco / suppressor mirnas in colon adenocarcinoma sw-48 cell line real - time pcr analysis detected differentially expression of all selected mirnas in sw-48 cell line ( table 2 ) . among the studied mirnas , mirna-135b and let7-g expressed at the highest and lowest levels , respectively ( figure 2 ) . mirnas differentially expressed in sw-48-derived tumors after treatment with sd-208 electrophoresis of mirnas genes pattern expressed in sw-48 cell line . as shown , all selected onco / suppressor mirnas express differentially in sw-48 cell line alteration of the mirnas expression resulted by sd-208 treatment evaluation of mirnas expression by q - pcr showed that the expression of mir-135b significantly down - regulated after treatment by sd-208 ( p=0.006 , figure 3a ) . in the tumors treated with sd-208 , mir-135b expression also was down - regulated significantly ( p=0.018 ) , compared to control tumors ( figure 3b ) . our results showed that all the treated tumors express a lower number of mir-135b , but not other mirnas , compared to the control tumors . however , there was no change in cell proliferation or tumor size ( data not shown ) . the expression of mir-135b significantly was down - regulated either in cell culture ( a ) or developed tumors ( b ) in sd-208 groups compared to controls prediction of the target genes of mir-135b using bioinformatics analysis in order to determine the biological function of the down - regulated mirna , mir-135b , we further predicted the putative downstream targets of this mirna . we focused our attention on mir-135b because it was the only mirna affected by sd-208 either in vitro or in vivo . in silico analysis using targetscan ( http://www.targetscan.org/ ) showed that mir-135b potentially targets transcripts encoding known tumor - suppressor factors , such as apc ( adenomatosis polyposis coli ) , foxo1 ( forkhead transcription box1 ) , runx1 ( runt - related transcription factor 1 ) and esrra ( estrogen - related receptor alpha ) .",
"to assess the potential toxicity effects of sd-208 , the expression levels of mirnas was examined by real time rt - pcr ( table 1 ) . then the appropriate numbers of sw-48 cells were injected into 8 mice to develop tumors . following sd-208 treatment period , we could not observe any changes in animal behavior , body weight or lifespan compared to controls . these data suggest that sd-208 lacks toxic effects on animals ( data not shown ) . mirnas differentially expressed in sw-48 cells after 48 hr treatment with sd-208 colon adenocarcinoma confirmation the h&e staining confirmed marked cellularity with significant hyperchromatism and pleomorphism ( figure 1 ) . the pattern of adenocarcinoma was alike to the human origin ( figure 1 a , b ) . nude mice bearing developed sw-48 tumors were divided into two groups : sd-208 treatment ( a ) and vehicle ( b ) . hematoxylin and eosin staining of tumor tissues confirmed colon adenocarcinoma in both treated ( a ) and non - treated ( b ) tumor - bearing mice . the staining demonstrates marked cellularity with profound hyperchromatism and pleomorphism ( arrows ) and low differentiated tumor cells similar to human colon cancer expression pattern of selected onco / suppressor mirnas in colon adenocarcinoma sw-48 cell line real - time pcr analysis detected differentially expression of all selected mirnas in sw-48 cell line ( table 2 ) . among the studied mirnas , mirna-135b and let7-g expressed at the highest and lowest levels , respectively ( figure 2 ) . mirnas differentially expressed in sw-48-derived tumors after treatment with sd-208 electrophoresis of mirnas genes pattern expressed in sw-48 cell line . as shown , all selected onco / suppressor mirnas express differentially in sw-48 cell line alteration of the mirnas expression resulted by sd-208 treatment evaluation of mirnas expression by q - pcr showed that the expression of mir-135b significantly down - regulated after treatment by sd-208 ( p=0.006 , figure 3a ) . in the tumors treated with sd-208 , mir-135b expression also was down - regulated significantly ( p=0.018 ) , compared to control tumors ( figure 3b ) . our results showed that all the treated tumors express a lower number of mir-135b , but not other mirnas , compared to the control tumors . however , there was no change in cell proliferation or tumor size ( data not shown ) . the expression of mir-135b significantly was down - regulated either in cell culture ( a ) or developed tumors ( b ) in sd-208 groups compared to controls prediction of the target genes of mir-135b using bioinformatics analysis in order to determine the biological function of the down - regulated mirna , mir-135b , we further predicted the putative downstream targets of this mirna . we focused our attention on mir-135b because it was the only mirna affected by sd-208 either in vitro or in vivo . in silico analysis using targetscan ( http://www.targetscan.org/ ) showed that mir-135b potentially targets transcripts encoding known tumor - suppressor factors , such as apc ( adenomatosis polyposis coli ) , foxo1 ( forkhead transcription box1 ) , runx1 ( runt - related transcription factor 1 ) and esrra ( estrogen - related receptor alpha ) .",
"in this study , we evaluated the effect of a tgf- receptor kinase inhibitor , sd-208 , on some potential onco / suppressor - mirnas expression in crc . sd-208 is a tgf- signaling pathway inhibitor that could exert anticancer effects on several tumor cells by reduction of growth rate or modification of other cell functions ( 6 , 9 , 12 ) . some investigators revealed sd-208 reduces tumor growth and metastasis in different cancers ( 9 , 12 ) , whereas , others showed this agent regulates the growth of tumors without changes in proliferation , apoptosis or angiogenesis and can not reduce proliferation of cells ( 8) . another study reported that sd-093 ( as an sd-208 analog ) failed to alter morphology and growth rate of pancreatic carcinoma cells ( 38 ) . also it has been reported that sd-208 has no effect on the growth of primary and metastatic r3 t mammary tumors in athymic nude mice ( 9 ) . these findings indicate that anti - cancer effect of sd-208 may be not due to suppression of cell growth and proliferation ( 36 ) . since efficacy of this inhibitor is a controversial issue in cancer treatment , we hypothesized the unknown mechanism(s ) including alteration of cancer - related mirnas might be involved . several chemopreventive agents have been shown to modulate the expression of numerous mirnas in cancer cells that lead to sensitization of cancer cells to chemotherapeutic agents ( 39 , 40 ) , suggesting the potential of mirnas as targets for anti - cancer drugs ( 18 , 20 ) . hence , evaluation of the possible effects of chemotherapeutic drugs on the expression profile of mirnas may have an important outcome for cancer therapy strategies ( 21 , 33 ) . although a number of studies have shown that chemotherapy drugs alter mirnas expression in many cancer cells , there is no report on the effect of tgf- receptor kinase inhibitors on mirnas in human crc . we selected some mirnas that have already been confirmed to function as onco - mir ( mir-21 , mir-31 , mir-20a , and mir-135b ) or suppressor mir ( mir-133b , mir-145 , mir-200 and let7-g ) in crc ( 36 - 39 ) . the present study focused on the alteration of these mirnas in colon cancer treated by sd-208 . expression analysis of mirnas by a q - pcr revealed that expression of mir-135b significantly down - regulated after in vitro treatment with sd-208 ( p=0.006 ) . in the tumor tissues treated with sd-208 , mir-135b expression significantly the results showed that all the treated tumors significantly expressed a lower number of mir-135b , but not other oncogenic - mirnas , compared to controls ( p=0.018 ) . interestingly , the mir-135b has been documented as a tumor promoting factor and to play a role in migration and metastasis in different cancers as well as crc ( 37 - 39 ) . in order to address the question of how can the possible molecular mechanisms of the mir-135b on crc cell signaling pathways be defined , we performed an in - silico study . in silico analysis using targetscan ( http://www.targetscan.org/ ) showed that mir-135b potentially targets key tumor - suppressor genes involved in crc : apc and foxo1 . apc and foxo1 genes have also been validated as targets of mir-135b using luciferase reporter assay ( 41 ) , hence , we would like to discuss these genes whose functions could potentially affect the cell signaling in crc . apc gene acts a tumor suppressor the inactivation of which is the key initiating event in colorectal carcinogenesis ( 42 ) . recently , one study demonstrated that up - regulation of mir-135b in crc is associated with low apc mrna levels ( 42 ) . in the present study , we advocate a novel molecular mechanism : a kinase inhibitor molecule can reduce mir-135b expression , by which apc activation could be mediated . moreover , it has been reported that mir-135b affects foxo1 as an endogenous target and suppresses protein expression . several lines of evidence indicate that foxo transcription factors might play an important role in tumor development ( 41 , 43 ) . on the other hand , foxo1 alteration by mir-135b can affect sensitivity to chemotherapeutic drugs , such that tumor cells overexpressing mir-135b were more resistant to specific anticancer drugs . these results suggest the possibility that mir-135b may confer chemoresistance to tumor cells through foxo1 modulation ( 41 ) . therefore , it is rational to hypothesize that the properties of anti - cancer drugs may be related to their alteration of mirna profiles ( 43 , 44 ) . for example , suppression of mir-21 has been shown to sensitize mcf-7 cells to topotecan ( 44 ) . as well , 5-fu was reported to be able to modify the expression of several mirnas in human colon cancer cells ( 44 ) . overall , we primarily predicted that combination of sd-208 and one anticancer drug such as 5-fu , may show stronger inhibition of colon tumor cell growth by modification of onco - mirs . additionally , as a novel approach in crc therapy , pre - treatment by sd-208 could improve chemosensitivity in resistant cancerous cells . however , the mechanism by which these agents alter mirna expression may be dependent on genomic context .",
"the receptor kinase inhibitor sd-208 may partially inhibit colon tumorigenesis as well as chemoresistance by alteration of mirnas . hence , the tgri kinase inhibitor - based treatment may possibly uphold chemosensitivity in resistant colon cancer cells ."
] | objective(s):transforming growth factor- ( tgf- ) is involved in colorectal cancer ( crc ) . the sd-208 acts as an anti - cancer agent in different malignancies via tgf- signaling . this work aims to show the effect of manipulation of tgf- signaling on some mirnas implicated in crc.materials and methods : we investigated the effects of sd-208 on sw-48 , a colon adenocarcinoma cell line . the cell line was treated with 0.5 , 1 and 2 m concentrations of sd-208 . then , the xenograft model of colon cancer was established by subcutaneous inoculation of sw-48 cell line into the nude mice . the animals were treated with sd-208 for three weeks . a quantitative real - time pcr was carried out for expression level analysis of selected oncogenic ( mir-21 , 31 , 20a and 135b ) and suppressor - mirnas ( let7-g , mir-133b , 145 and 200c ) . data were analyzed using the 2-ct method through student s t - test via the graphpad prism software.results:our results revealed that sd-208 could significantly down - regulate the expression of one key onco - mirna , mir-135b , in either sw-48 colon cells ( p=0.006 ) or tumors orthotopically implanted in nude mice ( p=0.018 ) . our in silico study also predicted that sd-208 could modulate the expression of potential downstream tumor suppressor targets of the mir135b.conclusion:our data provide novel evidence that anticancer effects of sd-208 ( and likely other tgf- inhibitors ) may be owing to their ability to regulate mirnas expression . |
[
"nanotechnology deals with the production and stabilization of various types of nanoparticles ( 1 ) . plants or natural resources have been found to be a good alternative method for nanoparticles synthesis , since this method does not use any toxic chemicals and does not require the use of high pressure , energy , and temperature . this green chemistry process has numerous benefits , including environmental friendliness , cost - effectiveness , and suitability for pharmaceutical and biomedical applications . at present , several groups of researchers concentrate on biomimetic approaches such as plant or plant leaf extracts , nuts , microorganisms and yeast to synthesize the metal nanoparticles called \" green chemical or phytochemical \" approach ( 2 - 5 ) . antibacterial activity of the silver ion has been well established ( 6 ) and ag is currently used to control bacterial growth in a variety of applications , including dental work , catheters , and burn wounds ( 7,8 ) . in fact , ag ions and ag - based compounds are highly toxic to microorganisms , showing strong biocidal effects on as many as 12 species of bacteria including e. coli ( 9 ) . apart from these antimicrobial activities , ag - nps are also known to possess antifungal , anti - inflammatory , antiviral , anti - angiogenesis and antiplatelet properties ( 10 , 11 ) . the betel ( piper betle ) is the leaf belonging to the family piperaceae . the p. \n betle leaves possess antifungal , antiseptic , antihelmintic , antihypertensive etc . , 2011 claim that ethanolic extract of p. betle leaves show antibacterial activity against some food borne pathogens ( 13 ) . the aim of this study was to synthesize agnps using aqueous leaves extract of p. betle , characterized the agnps and evaluated the antibacterial activity of ag - extract nanoparticles against some gram positive and gram negative bacteria .",
"\n collection of materials \n fresh young leaves of p. betle were collected from the local market of noakhali , bangladesh . silver nitrate ( agno3 ) , nabh4 and aniline were collected from the laboratory of department of pharmacy , noakhali science and technology university ( nstu ) . \n preparation of p. betle leaf extract \n about 30 g of freshly , taxonomically authenticated healthy leaves of p. betle were collected in january 2014 from noakhali district of bangladesh . the leaves were washed thoroughly with double distilled water , cut into fine pieces and boiled with 150 ml double distilled water for 8 - 10 min . finally , extract of leaves was stored at refrigerator at 4 c till further use . \n biosynthesis of silver nanoparticles \n ag nanoparticles were made according to the recipe described in the literature ( creighton , 1979 ; suh js et al . ; briefly , a 100-ml aqueous solution of 1.0 x 10 m silver nitrate was mixed with a 300-ml aqueous solution of 2.0 x 10 m sodium borohydride . triply distilled water was used for solutions , and both solutions were chilled to ice temperature before mixing . by mixing both solutions , ag ions were reduced and clustered together to form monodispersed nanoparticles as a transparent solution in aqueous medium . the solution was stirred repeatedly whenever some dark color appeared for approximately an hour until it became stabilized . at this point this solution of ag nanoparticles was so stable that it did not change color for as long as several months without any stabilizing agent . because the particle concentration of the solution is only 3.3 nm , it was concentrated 10 times using a rotary vacuum evaporator . \n preparation of ag - extracts nanoparticles \n these above two solutions were mixed continuously for 30 min by magnetic stirrer and then stood for 2 h. after that uncoated ag - extract nanoparticles were prepared . \n coating of ag - extract nanoparticles with polyaniline \n coating on the extract - agnps were done according to the k. gopalakrishnan , 2012 ( 14 ) . after that 68 ml ( 6 % ) of h2o2 was added slowly at room temperature . the final product was filtered , washed with distilled water and then dried at room temperature . finally , samples were ready for further analysis ( antimicrobial activity ) . \n the reaction mixture turned into dark brown color from its initial brownish - yellow color within 20 min of mixing . the reduction of pure silver ions was monitored by measuring uv - vis spectra of the reaction mixture . the absorption spectra of the samples were taken 240 to 540 nm using a uv vis spectrophotometer ( hitachi , model u-2800 spectrophotometer ) . water was used as the blank . again , spectrum was recorded in ftir ( ir prestige-21 , shimadzu ) in the range of 4000500 cm at a resolution of 4 cm . tem observations were carried out on an h-7100 electron microscope ( hitachi , tokyo , japan ) . \n test microorganisms \n authentic pure cultures of staphylococcus aureus atcc 25923 , salmonella typhi atcc 14028 , escherichia coli atcc 25922 and pseudomonas aeruginosa atcc 27853 were obtained from the department of microbiology , nstu , bangladesh . \n antimicrobial activity using kirby - bauer s disc diffusion method \n antibacterial activities of the ag - extract nanoparticles were determined according to kirby - bauer s disc diffusion method ( 2006 ) with slight modifications . the petri dishes were flooded with mueller hinton agar and after solidification of agar 0.1 ml of diluted inoculums were spread over mueller hinton agar in the dishes using sterile l spreader to achieve confluent growth of test organisms and allowed to dry for 10 min . the sterile readymade discs loaded with p. betle extract , agnps solution , uncoated agnps , coated ag - extract nps . the plates were then incubated at 37 c for 36 h. the plates were observed for the zone of inhibition . after incubation at 35 c for 18 h , the different levels of zone of inhibition were measured .",
"\n characterization of the synthesized ag nanoparticles \n \n evaluation of ag - nps by visual assessment \n the formations of silver nanoparticles were confirmed through visual assessment . within 20 min of the reaction , color of the mixture turned into dark brown from its initial brownish yellow color . the appearance of dark brown color may be due to the reduction of agno3 ( 17 ) . ( a)agnps solution ( b)aqueous extract of p. betle ( c ) ag - extract nps \n evaluation of ag - nps by uv spectrum \n uv vis spectrum of reaction mixture at different wavelengths ranging from 300 to 700 nm showed strong absorption peak with centering at approx . 400 nm ( figure 2 ) indicated the formation of aqueous extract coated ag - nps . uv visible spectrum of agnps \n evaluation of ag - nps through ft - ir spectra \n the ft - ir spectra were used to identify the possible biomolecules ( including functional group ) responsible for the reduction of the agions and capping of the p. betle formed ag - nps . figure 3 , showed the ftir spectra of p. betle aqueous extract and bio - synthesized ag - nps . ft - ir spectrum for curve ( a ) red color- p. betle aqueous extract ; and curve ( b ) ag - extract nanoparticles the possible functional groups of leaf extract involved in coating nanoparticle are identified by ftir analysis . the intense absorption peaks at 3400 cm ( curve - a , red color ) and 3291.67 cm ( curve - b , black color ) correspond to n - h stretching of primary amine . the band observed at 3059.23 cm ( curve - b ) represents = c - h stretching . the weak band observed at 2917.46 cm and 2848.98 cm ( both in curve - b ) indicates the h - c - h asymmetric and symmetric stretching of alkanes . the band observed at 2340.72 cm and 2369.65 cm ( both in curve - a ) , which are nearly the same band in curve - b , denotes the presence of hydrogen bonded oh stretching of carboxylic acids in leaf extract which may be a reducing / coating agent for silver nanoparticles . the band at 1617.38 cm ( curve - a ) and 1600.02 cm ( curve - b ) represents n - h bending vibration of primary amine . the peak occurs at 1496.83 cm ( curve - b ) for n - h bending vibration of sec . amine and at 1447.64 cm ( curve - b ) c - h bending vibration of alkane ( ch3 ) . the band observed at 1387.84 cm and 1379.16 cm ( both in curve - b ) represent n = o stretching of nitro groups of leaf extract coated on nanoparticles . the arising of functional groups in ftir spectrum indicates proper coating of leaf extract on silver nanoparticles . the bands at 1296.22 , 1249.93 , 1175.66 , 1155.41 cm ( curve - b ) , which are nearly the same in curve a , denotes c - h stretching vibration of ester . beside , c - o stretch occurs at 1072.47 , 1026.17 ( curve - b ) where first is stronger and broader than the second . the band at 843.89 , 829.43 , 602.78 , 668.36 cm shows c - h bending vibration of alkynes . the band at 751.31 cm and 691.51 cm represents the ortho substituted and mono substituted aromatic stretching respectively . the ft - ir results imply that the ag - nps were successfully synthesized and capped with bio - compounds present in the p. betle extract by using a green method . the tem image in figure 4 shows that ag - nps were well dispersed with a spherical structures and particle size ranging from 10 to 30 nm with some deviations . of the total particles , approximately 20 % particles were of 10 nm , 50 % were of 20 nm and remaining 30 % particles tem image of bio functionalized agnps \n assessment of antibacterial activities \n antibacterial activity of p. betle formed ag - nps on s. aureus atcc 25923 , e. coli atcc 25922 , s. typhi atcc 14028 , p. aeruginosa atcc 27853 values are the mean of three replicates sd ( standard error ) . antibacterial activity of p. betle formed ag - nps on ( a ) s. aureus atcc 25923 ( b ) e. coli atcc 25922 ( c ) s. typhi atcc 14028 ( d ) p. aeruginosa atcc 27853 graphical representation of the antibacterial activity of p. betle formed ag - nps on s. aureus atcc 25923 , e. coli atcc 25922 , s. typhi atcc 14028 , p. aeruginosa atcc 27853 the antibacterial activity of the aqueous extracts of p. betle leaves were analyzed against both gram - positive and gram - negative bacteria , which are presented in ( figure 6 , table 1 ) . after analyzing the above results , it is clear that gram positive bacteria s. aureus is more susceptible than other experimental species of gram negative bacteria - e. coli , s. typhi , p. aeruginosa . maximum zone of inhibition 32.780.64 mm was found for s. aureus , whereas norfloxacin showed maximum 32.150.40 mm zone of inhibition for s. aureus . again , maximum zone of inhibition 29.550.45 mm was found for s. typhi , 27.120.38 mm for e. coli and 21.950.45 mm for p. aeruginosa .",
"we have demonstrated a good method for developing a simple , safe , cost - effective , and ecofriendly preparation of agnps using aqueous extract of p. betle . the biosynthesized silver nanoparticles have spherical shapes and the particle size ranges from 10 to 30 nm approximately . the ftir spectra revealed the involvement of hydroxyl moieties and n - h bonding in the formation of ag - nps . they showed potential antibacterial activity against both gram - positive and gram negative bacteria . in our study we also found , gram positive bacteria are more susceptible on ag - extract nps rather than gram negative bacteria . application of these synthesized agnps based on our findings may lead to valuable discoveries in various fields , including medical devices and in the pharmaceutical and biomedical industries . the results obtained by this study can not be directly extrapolated to human ; further studies should be undertaken to elucidate the exact mechanism of action by which agnps - extracts exert their antimicrobial effect which can be used in drug development program for safe health care services ."
] | plants or natural resources have been found to be a good alternative method for nanoparticles synthesis . in this study , polyaniline coated silver nanoparticles ( agnps ) synthesized from piper betle leaves extract were investigated for their antibacterial activity . silver nanoparticles were prepared from the reduction of silver nitrate and nabh4 was used as reducing agent . silver nanoparticles and extracts were mixed thoroughly and then coated by polyaniline . prepared nanoparticles were characterized by visual inspection , ultraviolet - visible spectroscopy ( uv ) , fourier transform infrared spectroscopy ( ft - ir ) , transmission electron microscopy ( tem ) techniques . antibacterial activities of the synthesized silver nanoparticles were tested against staphylococcus aureus atcc 25923 , salmonella typhi atcc 14028 , escherichia coli atcc 25922 and pseudomonas aeruginosa atcc 27853 . uv vis spectrum of reaction mixture showed strong absorption peak with centering at 400 nm . the ft - ir results imply that ag - nps were successfully synthesized and capped with bio - compounds present in p. betle . tem image showed that ag - nps formed were well dispersed with a spherical structures and particle size ranging from 10 to 30 nm . the result revealed that ag - extract nps showed 32.780.64 mm zone of inhibition against s. aureus , whereas norfloxacin ( positive control ) showed maximum 32.150.40 mm zone of inhibition for s. aureus . again , maximum zone of inhibition 29.550.45 mm was found for s. typhi , 27.120.38 mm for e. coli and 21.950.45 mm for p. aeruginosa . the results obtained by this study ca nt be directly extrapolated to human ; so further studies should be undertaken to established the strong antimicrobial activity of ag - extract nps for drug development program . |
[
"registration details of all 2,431 horses registered with the british palomino \n society were collected for the period 19832007 inclusive . of these animals , a further 207 animals were \n removed from the analysis as the true coat colour described for one or more parents was \n impossible to identify from the colour supplied . a further 39 animals ( shaded in grey in \n table 1table 1.colour combinations which have produced a registered palomino in the society \n within the last 25 years ) were removed from the analysis since parents with these combinations of \n details can not produce palomino offspring ( e.g. chestnut chestnut ) . however animals where \n there was ambiguity regarding the exact colouration ( e.g. grey which could be represented by \n one or more recognised coat colour ) , were kept in the analysis , provided they could be \n explained by one of the possible sources of palomino offspring listed in . details \n of the animal s name and the coat colour of both parents were collated . throughout the year the society hold shows varying from small county shows to a large \n annual national championship . many classes at local shows may only have one or two horses \n exhibited . to ensure that the results were comparing like with like , the data analysed \n focused entirely on the british palomino national championship show , where each class \n generally has more animals exhibited than would be the case in local shows . at this show \n there are two major categories ( ridden and in - hand ) with in - hand classes placing more \n emphasis on colouration of horses ( 80% of available marks ) . since the national championship \n has the greatest number of exhibitors and the emphasis on colour is greatest for in - hand \n classes , the investigation into show success was restricted to animals placed in the in - hand \n classes at the national championships in the following nine categories : under 148 cm \n stallion , mare , yearling , 2 & 3 year old ; over 148 cm stallion , mare , yearling , 2 & \n 3 year old and geldings 4 years and over . registration details for all animals placed ( i.e. top four prizes ) in \n any of these classes were consulted from the database . in the first instance , this analysis \n took no account of which prize an animal won and also took no account of how many times an \n animal won a prize ( e.g. in consecutive years ) . it also meant that any animal which had been \n placed but did not fall into the group of 801 ( e.g. one of the 1,630 animals where both \n parents could not be identified ) were not included in the analysis of prize winners . the \n relative distribution of parental coat colours between all 801 animals registered and the 90 \n which had been placed at shows was calculated . analysis was performed to compare relative values of parental coat colour \n between those animals registered with the society , and those placed at the national show . \n those combinations for which the expected value was less than 5 were treated as a single \n group in analysis , meaning that five groups were used : chestnut cremello ; chestnut dun ; \n chestnut palomino ; palomino palomino ; and all others . due to certain factors having expected values which were low , this analysis was repeated \n using fisher s exact probability test .",
"table 1 shows that the largest number of \n registered palominos in this work , where the coat colour of both parents could be \n identified , came from a chestnut cremello mating , which is the only parental cross which \n guarantees a palomino offspring . since 356 of the animals ( i.e. 44% ) in this study were this \n type of cross , these data are supportive of the hypothesis that a large proportion of \n palominos registered with the society were intentionally bred for their colouring . table 2table 2.colour combinations which have produced a prize - winning palomino at the society s \n show within the last 25 years shows that the largest number of the palominos placed at least once at the \n national championships also came from a chestnut cremello mating . hence of the 90 \n ( following removal of 1 animal shaded in grey ) animals placed during this time , 60 ( i.e. \n 67% ) resulted from the only mating type guaranteed to give palomino offspring . both tables show that a large number of animals either registered with the society or \n placed at the national championship are the result of a chestnut cremello mating . \n moreover , the percentage of horses resulting from a chestnut cremello mating is higher for \n animals placed at the show than it is for the list of animals registered . given this \n observation a calculation was performed to determine if the number of chestnut \n cremello animals which were placed at the national championship was significantly higher \n than the figure based on that expected from registration details . since the expected number \n of some parental combinations was low ( i.e. less than 5 ) the only pair - wise combinations \n which could be used to derive an expected value were : chestnut cremello ; chestnut dun ; \n chestnut palomino ; and palomino palomino . all other combinations where an animal had \n been registered with the society ( e.g. bay palomino ) were treated as a single expected \n value . this resulted in the two datasets being different ( p=2.8 10 ) with \n proportionally more of the chestnut cremello matings being successfully exhibited relative \n to those registered . when the analysis was repeated using fisher s exact probability test to \n compensate for the fact that certain expected values were low , this also suggested that the \n differences between the populations was significantly different ( p=4.5 \n 10 ) . it is also interesting to note from table 2 \n that every single animal which was placed at the show over the last 25 years whose parents \n coat colours could be identified had at least one parent which was a palomino , a chestnut or \n a cremello , and 77 of the 90 had both parents falling into one of these colourings . when the analysis was restricted to only those horses which won first prize in a particular \n class at the national championships , only 35 horses could be identified where the \n colouration of both parents had been recorded ( table \n 3table 3.colour combinations which have produced a palomino which won first prize in its \n class at the society s show within the last 25 years ) . of these animals 22 ( 63% ) the \n remaining animals were chestnut bay ( 4 ) ; palomino palomino ( 3 ) ; chestnut palomino ( 2 ) \n and 1 each of black palomino , chestnut dun , chestnut skewbald and cremello grey . \n thus the values for considering chestnut cremello animals winning first prize versus those \n for any of the four places , are relatively similar ( 67% versus 63% ) . the second category investigated was one which extended beyond the national championship , \n and looked at a points scheme , whereby horses are awarded a certain number of points every \n time that they are placed at any show at which points are available . here analysis was \n restricted to horses which finished in the top eight for their cumulative score for any \n particular year . this allowed only 22 horses to be studied where the colouration of both \n parents could be identified . of these horses , 13 ( 59% ) were the product of a chestnut \n cremello mating with the remaining horses being palomino palomino ( 5 ) ; chestnut palomino \n ( 2 ) ; and cremello bay ( 2 ) . however , interestingly of the 7 horses which won the annual \n points scheme ( with one of the horses winning it in two consecutive years ) , only one horse \n ( a chestnut palomino ) was not the result of a chestnut cremello mating .",
"this work is constrained by some potential limitations in terms of conclusions which may be \n drawn . for example , judging of animals always has a degree of human subjectivity associated \n with it . moreover , many animals which are registered with the society may never be \n exhibited . hence it is possible that some of the animals which could have been prize - winning \n stock were not given the opportunity to fulfil their potential . in addition , due to \n restricted information being provided to the society by owners at the time of registration , \n only around a third of horses registered with the society met the criteria regarding \n parental information needed for inclusion in these analyses . despite these possible \n limitations , one observation is very interesting , that the showing success achieved by the \n only possible parental combination which guarantees a palomino foal is disproportionally \n larger than that seen for registration of foals with the society . this is true for all \n definitions of success investigated : horses winning any prize at the national championship ; \n horses winning first prize at the national championship ; horses which finished in the top 8 \n of the annual points scheme ; and horses which won the annual point scheme . the reasons for this are uncertain , as there are a range of shades which are acceptable for \n society membership and a range of parental combinations which can achieve a palomino \n offspring . this is \n true for both the initial inspection at the time of society registration , and also for \n horses being exhibited at shows . part of the reason for this is that the colour of the horse \n can vary ( e.g. bleaching of hair colour following periods in the sun ) . however , it appears that the possible \n shade , or shades , of coat colour resulting from chestnut cremello matings are also those \n which are most likely to appeal to judges at shows . this in turn poses an additional \n question ; has the society s ideal colour definition been influenced in favour of matings \n which are most likely ( or even guaranteed ) to produce a palomino foal ?"
] | although various combinations of parental coat colours can produce a palomino foal ,
examination of records of the british palomino society suggest that many animals
registered with the society resulted from matings which maximise the likelihood or even
guarantee a palomino foal . when show records were examined , it was clear that the
colouration preferred by judges corresponds to that of the only pair - wise parental
combination guaranteeing a palomino foal . |
[
"vascular complications are the most frequent adverse outcomes associated with percutaneous coronary intervention ( pci ) via the femoral artery . they contribute to in - hospital morbidity , mortality , and costs ; and furthermore , are associated with increased long - term risk of myocardial infarction and death . vascular complications include bleeding , pseudoaneurysm formation , hematoma , arterio - venous fistula , retroperitoneal bleeding , and other femoral arterial injuries requiring procedural or surgical intervention . abdominal wall hematoma is a rare condition that can give rise to an acute abdomen . in this report , we describe a case of a 73-year - old woman who developed an abdominal wall hematoma , which is a rare but serious complication of a pci via the femoral approach .",
"a 73-year - old woman , with a past medical history of hypertension , diabetes mellitus for 40 years , and chronic kidney disease stage 5 , because of diabetic nephropathy , presented to the emergency department with dyspnea ( nyha iv ) . the patient had the following vital signs : blood pressure : 155/63 mmhg ; pulse : 93 beats per minute ; respiratory rate : 28 breaths per minute ; and her body temperature was 36.0. on physical examination , the patient had no notable findings , other than bilateral expiratory rales and neck vein distention . an electrocardiogram was within normal limits . a chest x - ray revealed marked cardiomegaly and pulmonary edema . laboratory tests showed the following : white blood cell count : 10300/mm , hemoglobin : 8.3 g / dl , platelet count : 250000/mm , blood urea nitrogen : 63 mg / dl , creatinine : 4.4 mg / dl , brain natriuretic peptide : 483 pg / ml , creatine kinase isoenzyme mb : 2.0 ng / ml , and troponin - i : 0.10 ng / ml . the patient received emergency hemodialysis because of pulmonary edema refractory to medical therapy , including high - dose furosemide infusion . after stabilizing the patient s volume status by regular hemodialysis , she received coronary angiography for the evaluation of ischemic heart disease on the 19th day of admission . the patient took aspirin ( 300 mg ) and clopidogrel ( 300 mg ) loading dose 12 hours before the procedure . when the 0.025-inch straight guidewire ( 45 cm , terumo , tokyo , japan ) for a 4 french sheath was advanced , some resistance was felt . we then checked the fluoroscopy and found that the guidewire was introduced into the circumflex iliac artery ( fig . 1a ) . we promptly pulled the guidewire back from the circumflex iliac artery and advanced it into the abdominal aorta under fluoroscopic guidance . the external iliac artery and circumflex iliac arteries were intact , there were no changes in the patient s vital signs , and no abdominal symptoms were found , therefore , we continued the coronary angiography without incident . ( a ) hydrophilic guidewire is unintentionally introduced into the circumflex iliac artery ( arrow ) . the circumflex iliac artery is intact and there is no evidence of perforation ( arrow ) . coronary angiography revealed significant stenosis in the middle and distal segments of the right coronary artery and the middle segment of the left anterior descending artery . after 7000 iu of heparin was administered intravenously , we performed a pci at the middle and distal right coronary artery and the mid - left anterior descending artery with an activated clotting time ( act ) of more than 300 seconds , without any immediate complications . because the act remained prolonged fourteen hours after pci , the patient complained of a right abdominal pain , with mild swelling of her right abdomen . we started hydration with normal saline and performed a transfusion of 2 pints of packed red blood cell because of an abrupt drop of hemoglobin from 9.3 to 7.3 g / dl over 12 hours . the sheath site was clear with no evidence of bleeding , hence , we performed an abdominal computed tomography angiography to identify other causes of the bleeding , which revealed a right lateral abdominal wall hematoma about 5 cm in diameter ( fig . the right circumflex iliac artery was located in the hematoma , but there was no evidence of active extravasation of contrast media . the patient s vital signs remained stable after hydration and transfusion , so we decided to closely observe her . however , the patient still complained of abdominal pain and ecchymotic patches appeared on her abdomen 3 days after the procedure ( fig . , the patient underwent intermittent hemodialysis with minimal use of heparin and had her hemoglobin checked daily . the patient was discharged uneventfully after 26 days of hospitalization ( 7 days after pci ) . she was discharged on aspirin ( 100 mg ) , clopidogrel ( 75 mg ) , rosuvastatin ( 10 mg ) , losartan ( 50 mg ) , and carvedilol ( 6.25 mg ) . transverse ( a ) and coronal ( b ) section show right - sided abdominal hematoma and circumflex iliac artery ( arrows ) .",
"abdominal wall hematoma is a rare but potentially serious vascular complication that may develop after cardiac and peripheral angiographic procedures.1 ) predisposing factors include increased sheath size , repeat or multiple punctures of the artery , concomitant use of anticoagulants , advanced age , being female , and hypertension.2)3 ) there are two types of abdominal wall hematomas : spontaneous and iatrogenic . iatrogenic hematomas often occur when the circumflex iliac artery is perforated during the insertion of the guidewires , although this is a rare complication.4 ) these hematomas are distinguished from retroperitoneal hematomas , which occur when a physician unintentionally punctures the inferior epigastric artery or cannulates the femoral artery too superiorly . there have been cases of spontaneous abdominal wall hematomas in patients with some predisposing factors , although the incidence is very low.5)6 ) the common symptoms of abdominal wall hematoma are the sudden onset of abdominal pain and swelling , which usually occurs several hours after the procedure . because of its rarity , abdominal wall hematoma can be mistaken for several common acute abdominal conditions , such as appendicitis , sigmoid diverticulitis , perforated ulcers , ovarian cyst torsion , tumors , and incarcerated inguinal hernias.7 ) diagnosis can be made clinically by the appearance of an obvious swelling or bruising , or may include non - specific findings , such as anemia and fever . imaging studies help to confirm the diagnosis and exclude intra - abdominal hemorrhage.8 ) contrast - enhanced ct can detect and evaluate active bleeding from a rupture site . even in patients without contrast extravasation at the bleeding site as observed on a ct , angiography could be a useful imaging technique to identify an active bleeding point.9 ) conservative management , including bed rest and analgesics , is appropriate for most stable patients . however , when a patient has evidence of sustained bleeding , angiographic interventions or surgery should be considered.10 ) in order to prevent vascular complications , such as abdominal wall hematomas or pseudoaneurysms , puncturing the femoral artery under fluoroscopy guidance may be considered.11 ) after the artery has been successfully punctured , the guidewire must be smoothly advanced through the cannula . the cornerstone of safe sheath engagement is to stop when resistance is encountered during the insertion of the guidewire . difficulty in advancing the guidewire may occur when the wire enters a small branch vessel . after confirming the location of a wire by fluoroscopy , one can then retract the wire , spin it gently , and try advancing it again . in this situation , one must consider angiography to assess for the occurrence of complications , such as vessel perforation and dissection . when vascular complications are suspected , pci should be delayed with a discontinuation of antithrombotic agents , as well as close observation of the patient . because hydrophilic guidewires tend to unintentionally engage small vessels , replacing the straight hydrophilic guidewire with a j - tipped wire can be one strategy for preventing the perforation of small vessels . in general , it can not be overemphasized that it is important to closely observe patients who have undergone pci , especially with those with predisposing factors for bleeding , even without any evidence of immediate vascular complications . in the present case , there was an unusual development of an abdominal wall hematoma after a pci , in the absence of immediate vascular complications . thus , we suggest that the following may be causative factors of a delayed abdominal wall hematoma following a pci : injury to the circumflex artery during guidewire insertion and the subsequent prolonged act associated with the use of periprocedural heparin in patients with chronic kidney disease . this case reminds medical professionals of the importance of close observation and proper evaluation of complications after percutaneous coronary intervention , even if the rates of these complications are very low . fluoroscopy - guided femoral artery puncture and guidewire insertion may reduce the rate pci - related vascular complications . when vascular complications are suspected during the procedure , a staged pci should be considered to prevent periprocedural vascular complications and ensure a patient s safety . with more coronary angiographic procedures being performed , it is important for clinicians to consider the possibility of abdominal wall hematoma in this situation , especially when the patient has many predisposing factors ."
] | abdominal wall hematoma is a rare but potentially serious vascular complication that may develop after coronary angiographic procedures . in particular , an oblique muscle hematoma caused by an injury of the circumflex iliac artery is very rare , yet can be managed by conservative treatment including hydration and transfusion . however , when active bleeding continues , angiographic embolization or surgery might be needed . in this study , we report an uncommon case of injury to the circumflex iliac artery by an inappropriate introduction of the hydrophilic guidewire during the performance of a percutaneous coronary intervention . |
[
"for the invasive treatment of symptomatic aortic stenosis several attractive options became available beyond conventional cardiosurgical implantation of stented bioprostheses or mechanical valves . besides stentless prostheses , in particular transcatheter procedures are of growing importance . nevertheless the number of implanted stented bioprostheses in germany expanded or at least remained stable over the last years . thus , 9.704 bioprostheses were implanted in germany in 2010 , according to 84% of all implanted prostheses in aortic position . implantation of bioprostheses was associated with a 30-day - mortality of 3,3 % , which is higher than for mechanical valves ( 1,5% ) due to the fact that patients for bioprostheses are significantly older or suffer from more complex co - morbidities . the purpose of this review is to summarize the features of the currently available bioprostheses in the light of competing procedures .",
"there has been a continuous development to improve the design of stented bioprostheses with respect to hemodynamic profile , biological durability and ease of implantation . various designs are available , allowing a valve selection according to individual patient factors or anatomical criteria including techniques for intra - annular and supra - annular positioning [ 3 , 4 ] . it would have the same biological and hemodynamic properties as a normal valve and would not undergo degeneration . stented bioprostheses have proven to be effective even in small aortic roots regarding hemodynamic improvement , left ventricular mass reduction and improvement of the patient s quality of life . in vitro examinations showed pericardial valves to be slightly superior to porcine valves with regard to gradient and orifice area . associated with the scalloped designs of stented bioprostheses a tension - free implantation with avoidance of paravalvular leaks can be expected . implantation techniques evolved over the last decades which resulted in short cross - clamp times in normal findings . surgeons learned that meticulous care in decalcifying the aortic annulus and sizing helps to prevent paravalvular leaks . additionally , accurate sizing prevents a patients - prosthesis - mismatch which could result in poor postoperative clinical performance . avoiding the use of running suture for stented valve implantation the evolvement of low profile valves reduces the risk of coronary occlusion in patients with a small distance between annulus and coronary ostia .",
"the currently available and established bioprostheses show rates of degeneration at 20 years around 15% in patients aged 65 or higher . the freedom from repeat aortic valve replacement reaches over 85% after 20 years in patients older than 60 years and 65% in all age groups . along with these convincing results of durability and freedom of re - implantation stented bioprostheses became also attractive for younger patients . if a repeated valve replacement is necessary due to functional deterioration the operative mortality is acceptable with 4 to 6% and is mainly due to active endocarditis and comorbidities . lately transcatheter aortic valve implantation ( tavi ) with valve - in - valve implantation into the degenerated xenograft showed to be an additional option in high risk patients with the need for redo valve replacement .",
"stentless porcine valves were initially believed to have superior hemodynamic properties resulting in more effective reduction of left ventricular mass and better clinical performance according to nyha class . these findings could nt be yet approved by long - term follow up investigations [ 15 , 16 ] . bearing this in mind calls the more demanding implantation technique of stentless prostheses in question . stented bioprostheses are still used more commonly than stentless ones because of their relative ease of implantation , their extensively documented long - term results , and the low risk associated with reoperation . another biological approach is the use of an autograft like the ross procedure , where the patient s pulmonic valve is transferred to the aortic position . these pulmonic autografts have excellent hemodynamic properties as well as low rates of thrombosis , degeneration , and endocarditis . the ross procedure is suitable for children and young adults because it is compatible with further growth of the aortic root . nevertheless since the pulmonary valve has to been replaced by a bioprosthesis it is a demanding two valve procedure with prolonged cross clamping times . aside from this , special means are necessary for pulmonary autograft stabilization to prevent its degeneration .",
"there are only a few current randomized trials comparing the long - term results of biological and mechanical valves . a large - scale review revealed no difference in survival rates at 10 years and a slightly higher survival rate at 15 years for patients with mechanical prostheses . the reoperation rate for mechanical valves in the aortic position is less than 5% at 10 years and less than 10% at 15 years , while the corresponding figures for bioprostheses are 10% and 30% , respectively . hemorrhagic complications are significantly more common in patients with mechanical valves because of anticoagulation . chronic atrial fibrillation is no longer a contraindication to bioprostheses since permanent oral anticoagulation can be avoided if concomitant ablative surgery results in permanent conversion to sinus rhythm . end stage renal failure was also defined a contraindication to bioprostheses since a rapid degeneration was feared due to altered metabolism in these patients . it has been found that life expectancy is already curtailed to such an extent that bioprosthesis degeneration often does not occur in the remaining lifetime . the supposed advantage of the longer durability of a mechanical valve is also offset by the potential complications of oral anticoagulation , especially because anticoagulation is more difficult to manage in dialysis patients than in others . nevertheless aortic valve replacement using a tissue valve remains controversial for patients younger than 60 years since there are studies reporting reduced mid - term results . some younger patients are averse to oral anticoagulation and therefore prefer a biological valvular prosthesis . thus , younger patients opting for a bioprosthesis can enjoy a normal quality of life without anticoagulation for many years but may need to undergo a second valve replacement procedure with an acceptable degree of risk .",
"implantation of conventional prostheses can be performed through a limited direct access like a hemi - sternotomy or a lateral access . reported large series show that aortic valve operations can be safely performed in experienced centers . substantial progress in valve technology led to the development of self - expanding valves . since a few years a number of bioprostheses are available for suture - less implantation which is usually combined with a limited surgical access . . future will show the benefits of this procedure characterized by short cross clamping times and whether it can coexist with tavi procedures . ",
"after its clinical inauguration by cribier in 2002 the transcatheter aortic valve implantation gained widespread use in high risk patients with aortic stenosis . in germany a massive increase of its application can be observed ; in 2010 nearly every fourth aortic valve replacement was performed as a tavi procedure . the partner trial was a randomized trial comparing tavi with standard - of - care therapies in high risk patients . a 2-year follow - up of patients in the partner trial supports lately tavi as an alternative to surgery in high - risk patients . the two treatments were similar with respect to mortality , reduction in symptoms , and improved valve hemodynamics , but paravalvular regurgitation was more frequent after tavi and was associated with increased late mortality . there are a growing number of publications reporting promising short term results in high risk patients . nevertheless there is still a lack of evidence that tavi is superior to open valvular replacement as the gold standard regarding long - term results . current guidelines recommend the use of tavi restricted to patients with contraindications for open surgery or inacceptable perioperative risks .",
"current studies reveal that bioprostheses of the most recent generation last longer than earlier types . because life expectancies in general have risen , more and more elderly patients are presenting for valve replacement and for these patients a bioprosthesis is usually chosen . in addition the cost effectiveness of stented bioprostheses appears unbeatable and the surgical ease of implantation allows for cross - clamp times between 30 and 60 minutes . overall , even in face of more innovative biological alternatives the implantation of stented bioprostheses is still a very interesting option and represents actually the most frequent valve implantation technique for aortic stenosis . especially in the light of growing use of interventional valve replacement there is the urgent need for complete nationwide registry with adequate long term follow up , quality of life information and relevant subgroup analysis to define new standards in the treatment of patients with aortic stenosis ."
] | introductionbiological stented prostheses are currently the main type of prosthetic valve used for aortic valve replacement . the ratio of bioprotheses to mechanical prostheses has switched in the last 15 years ; the percentage of biological prostheses implanted has risen from 30 % to 85 % . moreover the total number of implanted stented bioprostheses remained stable over the last years despite competing procedures like stentless prostheses or transcatheter aortic valve implantation.methodsa literature search of all published aortic valve replacement studies was performed from january 2000 through may 2012.resultsthe recommendations guiding the type of heart valve replacement have been revised in recent years . of particular interest are the new generation of biological prostheses with extended durability , a decrease in mortality of reoperation and an increase in life expectancy . comorbidities such as chronic renal insufficiency or chronic atrial fibrillation are no longer contraindications to bioprostheses.conclusionoverall , even in face of more innovative biological alternatives the implantation of stented bioprostheses is still a very interesting option and represents actually the most frequent valve implantation technique for aortic stenosis . |
[
" if you can measure the problem than half of the problem is solved . the psychological dependence is seen in cases of use of illegal drugs , alcohol and tobacco . the use of tobacco in india has witnessed varied patterns , which include smoking , chewing , applying , sucking and gargling , and so on . each of these patterns of consumption is governed by the geographic area , economic status , sociocultural , and religious influences . forms of tobacco chewing include , pan ( piper betel leaf filled with sliced areca nut , lime , catechu , and other spices chewed with or without tobacco ) , pan - masala or gutakha ( a chewable tobacco containing areca nut ) , and mishri ( a powdered tobacco rubbed on the gums as toothpaste ) . despite the growing societal and legal restrictions on tobacco consumption , people are consuming tobacco in various forms . alcohol is known to be a potentially dangerous drug , and society still accepts it as such . on the other hand interestingly , diagnostic and statistical manual of mental disorders , 4 edition , text revision ( dsm - iv - tr ) has included nicotine related disorders in its list of mental disorders since 2000 . according to chadda and sengupta , the harmful effects of tobacco had been recognized historically in 16 century by king james i of england , shah abbas of persia and the mughal emperor jahangir of india , who tried to ban the consumption of tobacco among public . chattopadhayya has mentioned in his study that the famous indian sikh guru gobind singh also prohibited smoking for the members of the sikh community . he said , wine is bad , indian hemp ( bhang ) destroys one generation , but tobacco destroys all generations . tobacco use has been considered a religious taboo by the sikhs since then . however , despite historical attempts to ban tobacco , its use has continued to grow in popularity as a non - productive time - pass . mentioned that tobacco smoking or chewing and associated nicotine dependence is a complex syndrome involving physiological , psychological and behavioral processes . ashley et al . have stated , although nicotine is blamed for chemical causing high level of dependence , but certain byproducts and additives in tobacco are also responsible for dependence . a survey was conducted by subramanian et al . to study pattern of distribution of tobacco consumption in india . almost 35 million tobacco users attempt to quit every year , but only about 6% are successful for more than just a month . many quitting programmes need to measure how much an individual is psychologically dependent on tobacco . keeping in mind the above reasons and need , our study was directed to measure the psychological dependence , which is the root cause of high tobacco consumption among the rural population . it aimed at identifying which form of tobacco consumption ( smoking or smokeless ) is causing psychological dependence and which particular age group in rural population is psychologically more dependent on tobacco . the motive was to draw the attention of the tobacco cessation centers so that they can target at specific age group in rural population , with a particular tobacco consumption habit . this study will help and simplify the job of tobacco cessation centers by high - lighting the risk group in relation to high psychological dependence for tobacco consumption .",
"subjects with the habit of tobacco smoking or tobacco chewing were selected from a rural area and catchment area of dental college , with a population of nearly 2000 people . the study was approved by ethical review board of pravara institute of medical sciences ( pims ) deemed university . the procedures followed were in accordance with the ethical standards of the responsible committee of pims university on human experimentation . inclusion and exclusion criteria : subjects with the psychologically sound mind and willing to participate in this study after explanation about study the survey was conducted during the regular dental health checkup camp , which was organized for villagers . during this health checkup camp , the tobacco consumption habit was assessed by direct questioning and by clinical examination . for clinical assessment presence of stains of tobacco chewing and tobacco smoking over teeth , and oral mucosa the assessment of habit of tobacco consumption continued for enrolled subjects during dental health check up until 25 subjects with each 20 - 30 years , 31 - 40 years , 41 - 50 years , and 51 and above years of age for tobacco chewing and tobacco smoking separately were included in the survey . hence , overall all these 200 subjects were divided into following groups as : group i-100 subjects with tobacco smoking habit group ii-100 subjects with the use of smokeless tobacco both groups were further subdivided into following subgroups based on age : group a - with age ranging between 20 years to 30 years group b - with age ranging between 31 years to 40 years group c - with age ranging between 41 years to 50 years group d - with age including 51 years and above a standard questionnaire format of fagerstrom test for nicotine dependence ( ftnd revised version ) for smoking [ table 1 ] given by heatherton et al . and smokeless form of tobacco [ table 2 ] given by ebbert et al . the subjects were asked to answer the questions as per their experience of tobacco consumption and calculate the total point score . questionnaire form of ftnd revised version for smoking form of tobacco questionnaire form of ftnd revised version for smokeless form of tobacco 7 - 10 : person is highly dependent on nicotine and may benefit from a smoking cessation program based on treatment for nicotine addiction . 4 - 6 : person has low to moderate dependence on nicotine ; however , this does not rule out a smoking cessation program based on treatment for nicotine addiction . below 4 : person has low to moderate addiction , but is not likely to need nicotine replacement therapy . the calculated scores for all subjects were then statistically analyzed by using the karl pearson correlation ( r ) test and student 's t - test for the distribution of psychological dependence among the rural population . the data was analyzed by using the statistical software systat by cranes software private limited , bangalore , india ( www.systat.org ) .",
"7 - 10 : person is highly dependent on nicotine and may benefit from a smoking cessation program based on treatment for nicotine addiction . 4 - 6 : person has low to moderate dependence on nicotine ; however , this does not rule out a smoking cessation program based on treatment for nicotine addiction . below 4 : person has low to moderate addiction , but is not likely to need nicotine replacement therapy . the calculated scores for all subjects were then statistically analyzed by using the karl pearson correlation ( r ) test and student 's t - test for the distribution of psychological dependence among the rural population . the data was analyzed by using the statistical software systat by cranes software private limited , bangalore , india ( www.systat.org ) .",
"the statistical analysis of the study data revealed that tobacco chewing habit is more common and for a long duration in the subjects below the age of 40 years in rural population . subjects above 50 years of age were more indulged with the tobacco smoking habit as compared to tobacco chewing habit [ table 3 ] . distribution of mean and sd values of the duration of habit and ftnd score ( points ) in all groups under study when we compared group i with group ii for psychological dependence for tobacco use , statistical analysis revealed that people are highly dependent on tobacco smoking after age of 40 years ( 5.24 2.31 ; [ table 3 ] ) . study data revealed that , form of tobacco consumption ( either smoking or smokeless form ) does not have any influence over psychological dependence for age groups of 20 - 30 years and 31 - 40 years . a positive correlation [ table 4 ] was observed between duration of habit and ftnd score in all age groups , irrespective of the type of habit of tobacco consumption . this positive correlation indicates that , as the duration of habit increases , psychological dependence also increases [ figure 1 ] . this correlation found to be stronger in group ic that is in the age range of 41 - 50 years where correlation coefficient ( r ) is 0.4278 [ table 5 ] . after applying student t - test , this correlation in all the groups karl pearson correlation ( r ) between duration of habit and ftnd score in all groups comparison of the mean value of duration of habit and fagerstrom test for nicotine dependence score in all groups comparison of mean values of duration of habits and ftnd score in group ic and iic the comparison of ftnd scores for older adults ( 40- 50 years ; [ table 5 ] ) and those above 50 years [ table 6 ] in rural population revealed that , though there was no significant difference in duration of habit between group ic and iic , there was highly significant difference observed in relation to psychological dependence among these individuals . by applying student 's unpaired test there was a highly significant difference observed between the proportions of duration of habit and ftnd score in group i d and iid ( p < 0.01 ) . so after the age of 40 years , the rural population seemed to be highly dependent on tobacco smoking as compared to tobacco chewing . comparison of mean values of duration of habits and ftnd score in group i d and ii d",
"every year , millions of tobacco users try to quit the habit , but only few succeed in their attempt what might happen in tobacco addicts is probably that , in an effort to adjust and feel normal , the brain does actually alter its physical neuro - circuitry to meet the changed chemical onslaughts of nicotine , dopamine , adrenaline , acetaldehyde etc . the number of neuro - receptors and transporters available to receive nicotine will diminish . at the same time , extra acetylcholine receptors develop . withdrawal from nicotine upsets this delicate balance . the dopamine and adrenaline levels are all wrong , and the brain signals a feeling of depression and anxiety . studies have been conducted by surekha and thorat et al . to see the level of consumption of tobacco among the rural population . these studies are descriptive in nature , mainly focusing on the percentage distribution of tobacco consumption among the rural population . the present study , mainly focused on measuring the nicotine dependence among the rural population , hence that the particular age group and the type of tobacco consumption habit associated with the psychological dependence can be targeted for cessation . epidemiological surveys conducted earlier in relation to habit of tobacco consumption showed that , mean age of addiction for male smokers was 27.2 years and for chewers it was 22.8 years . the corresponding ages for the surveys conducted later they were 32.0 years and 25.3 years respectively . looking at these statistical values , the present study was designed to enroll even a lesser age of 20 years , for measurement of psychological dependence . younger age groups of rural areas showed a higher psychological dependence for tobacco chewing as compared to tobacco smoking [ table 3 ] . the high frequency of tobacco chewing in young people could be attributed to some of following reasons : \n younger age group of the rural population is not so familiar with the trend of tobacco smoking especially cigarette smoking due to cost factormanually made cheaper tobacco chewing products such as mawa , gutakha , tobacco quid etc . , are more preferredpeer pressurein rural population bidi smoking has become a definite trend for older ones and not much accepted by younger populationyounger individuals can hide their habit of tobacco consumption by preferring tobacco chewing rather than tobacco smoking . \n younger age group of the rural population is not so familiar with the trend of tobacco smoking especially cigarette smoking due to cost factor manually made cheaper tobacco chewing products such as mawa , gutakha , tobacco quid etc . , are more preferred in rural population bidi smoking has become a definite trend for older ones and not much accepted by younger population younger individuals can hide their habit of tobacco consumption by preferring tobacco chewing rather than tobacco smoking . the above observations are correlating with the study conducted by kishore et al . , in rural population of district wardha . they found that the majority of the boys were engaged in tobacco chewing ( 69.74% ) type of tobacco consumption . the exposure of the habit of tobacco use in adolescents was influenced by various factors such as peer pressure , friends , elders , boys trying to follow hero images , feeling strong and powerful when using tobacco and last but not the least , for fun . the present study has revealed that tobacco smoking habit , especially , bidi smoking is more common after the age of 40 years among the rural population . the mean duration of habit and ftnd score is high [ table 3 , figure 1 ] for tobacco smoking as compared to tobacco chewing after the age of 40 years . the reasons for such a shift of pattern of tobacco consumption could be as follows : \n bidi is known as the poor man 's cigar and is also very well accepted as a trend among older individuals in the rural population.since most of the old individuals lose their teeth , and are unable to chew hard tobacco , this physical disability could be a cause for a shift of habit pattern . \n bidi is known as the poor man 's cigar and is also very well accepted as a trend among older individuals in the rural population . since most of the old individuals lose their teeth , and are unable to chew hard tobacco , this physical disability could be a cause for a shift of habit pattern . the literature search for high dependence on bidi smoking revealed that the nicotine concentration in the tobacco of bidi was significantly greater ( 21.2 mg / g ) , than the tobacco from the commercially filtered ( 13.5 mg / g ) and unfiltered cigarettes ( 16.3 mg / g ) . therefore , it is logical to presume that bidi smokers are at a risk of becoming nicotine dependent . based on these findings malsona et al . deter a popular belief among us teens that bidis are a safe alternative to commercial cigarettes . the literature states that tobacco associated oral cancer is commonly seen in people above 40 years of age . subsequently , as per the present study findings , a hypothesis can be derived that , in rural areas , people above 40 years of age with tobacco smoking habit are at a higher risk for developing oral cancer due their high psychological dependence .",
"present study highlights \n tobacco chewing habit is more prevalent among young individuals of the rural population.the type of habit either tobacco chewing or tobacco smoking does nt have any effect over psychological dependence among individuals below 40 years of age . hence , the young individuals should be targeted for tobacco cessation therapy irrespective of type of habit of tobacco consumption.individuals above 40 years of age show a high psychological dependence for tobacco smoking as compared to tobacco chewing , and these individuals are at a risk for developing oral cancer due to higher tobacco consumption.hence , it is of prime importance to target such individuals for quitting tobacco consumption habit . \n the type of habit either tobacco chewing or tobacco smoking does nt have any effect over psychological dependence among individuals below 40 years of age . hence , the young individuals should be targeted for tobacco cessation therapy irrespective of type of habit of tobacco consumption . individuals above 40 years of age show a high psychological dependence for tobacco smoking as compared to tobacco chewing , and these individuals are at a risk for developing oral cancer due to higher tobacco consumption . hence , it is of prime importance to target such individuals for quitting tobacco consumption habit .",
"present study is a grass root level based questionnaire survey to measure the psychological dependence of the rural population for tobacco consumption habit . the first step towards tobacco cessation is to know how much an individual is psychologically dependent on tobacco . based on the dependence level , the programme of tobacco cessation should be adequately implemented . among the rural population tobacco smoking habit these findings could be a stepping stone for opening of tobacco cessation centers in rural area , which can target the rural population to put an end to the habit and hereafter reduce the incidence of oral cancer . the good news about the psychological part of addiction is that the mind can actually over - ride the brain and body . right at the time , a tobacco user decides to quit smoking , he / she has there itself begun to gain some control over the addiction ."
] | background : in india most of the tobacco cessation centers are concentrating only on urban population , whereas , literature reveals that it is rural population , which shows high frequency of consumption of tobacco . it is well known that high frequency of tobacco consumption is associated with psychological dependence . this study aimed at identifying , which form of tobacco consumption ( smoking or smokeless ) is associated with psychological dependence and is associated with which particular age group in rural population.materials and methods : it was a questionnaire based survey where 200 subjects were enrolled . revised version of standard fagerstrom test for nicotine dependence ( ftnd ) was given to each subject to answer . the collected data was statistically analyzed by using karl pearson correlation ( r ) test and student 's t-test.results:study showed that subjects above 40 years of age are psychologically highly dependent on tobacco smoking as compared to tobacco chewing . tobacco chewing is more prevalent among the younger population ( 20 - 30 years of age ) and type of habit does not have any influence over psychological dependence below 40 years of age . a positive correlation was observed between duration of habit and psychological dependence in all age groups irrespective of type of the habit of tobacco consumption.conclusion:this study attempts at creating a new avenue for the tobacco cessation centers where they can target their efforts towards rural population particularly people above 40 years of age with a tobacco smoking habit so that they can actually reduce the burden of a number of people at risk for developing tobacco associated oral cancer . |
[
" while decreases in both breast cancer incidence and mortality have been apparent in recent years , the societal and economic impact of this malignancy continues to be enormous . positive associations between environmental and individual factors and increased risk of breast cancer development have been alleged for at least a century . several progresses were made in understanding the underlying mechanisms of cancer development and some drugs were recently approved for the preventive approach of this disease . thus , the current thinking is that prevention is a highly feasible approach to breast cancer control . despite several factors which increase the woman ' risk ( gender , age , and family history ) are not changeable , other modified risk factors such as alcohol intake , dietary fat , obesity in postmenopausal age , and hormonal stimulations have been identified and for these reasons interest in strategies to prevent breast cancer remains strong and intriguing . cancer chemoprevention is defined as the use of natural , synthetic , or biochemical agents to reverse , suppress or prevent carcinogenic process to neoplastic disease . the epithelial carcinogenesis is a multistep , multipath , and multiyear disease of progressive genetic and associated tissue damage ( figure 2 ) . in detail , the carcinogenetic process starts with unspecified accumulations of genetics events which lead to a progressive dysplastic cellular appearance with genotypic and phenotypic alterations , deregulated cell growth , and finally cancer . this process is similar in every epithelial cancer , and the ability to arrest one or the several of these steps may impede or delay the development of cancer .",
"although the precise mechanism that causes breast cancer is not fully established itis recognized that hormones play a significant role in almost 70% of cases and current chemopreventive strategies have targeted hormonally responsive breast cancers . estrogen is well established as a promoter of cell division in the breast , where it causes proliferation of both normal and malignant cells . the two major classes of antiestrogenic drugs , the selective estrogen receptor modulators ( serms ) and the aromatase inhibitors ( ais ) , have been recently used for their activity in breast cancer prevention .",
"this class of drugs includes in particular tamoxifen ( tam ) and raloxifene , acting as both estrogen agonist and antagonists . tamoxifen citrate is the first generation of serms that competes with circulating estrogen for binding the estrogen receptor ( er ) . like tamoxifen , also raloxifene , a second generation of serms , has both estrogen agonist and antagonist properties . tam has been in clinical use for breast cancer treatment for more than 30 years to reduce the risk of both recurrence and contralateral neoplasia , 42% and 47% , respectively . these data lead to choose tam as a potential chemopreventive agent , and several studies were conducted in last decades in this particular setting . the bcpt nsabp-1 was a placebo - controlled trial of tam in more than 13000 women at high risk of breast cancer . women were randomized to receive tamoxifen 20 mg / die or placebo for 5 years . this trial was closed early after the interim analysis showed a 49% reduction in incidence of invasive breast cancer in the treatment arm . moreover , the highest level of benefits was observed in patients with precancerous lesions as lcis ( relative risk = 0.44 ) and atypical ductal hyperplasia ( relative risk = 0.14 ) . tamoxifen appeared able to reduce breast cancer incidence also in healthy brca2 carriers by 62% but not in brca1 . the study showed also an increased risk of endometrial cancer and thrombotic events , and these conclusions suggested that despite its extraordinary preventive efficacy the utilization of tam in this particular setting should be extremely individualized . the results of this study were the first to show the benefit of tam in breast cancer prevention . in addition , 3 european tamoxifen prevention trials have been completed and have reported long - term follow - up data of the effect of this agent in bc incidence : the italian tamoxifen prevention study , the royal marsden hospital tamoxifen randomized chemoprevention trial , and the international breast cancer intervention study ( ibis)-1 . although they differ in many details in study design and other , these trials were similar enough to be evaluated together in an overview of their main outcomes . their combined data indicate an overall 30 to 40% reduction in breast cancer er - positive incidence following 5 years of tam versus placebo ( figures 3 and 4 ) , and these effects remains also after more than ten years of followup . the serious adverse events that occurred with tam were as anticipated from previous adjuvant trials , an increase of endometrial cancers and venous thromboembolic events ( vtes ) . other expected tam - associated toxicities were observed as cataracts , hot flushes , and vaginal discharge . the data from the nsabp p-1 trial , which showed a reduction in both invasive and noninvasive breast cancers , led to the 1998 us food and drug administration ( fda ) approval of tam for reduction of breast cancer incidence in high - risk women . however , the adverse effects of this drug have hampered its uptake by women at increased risk . when tam 's benefits are balanced against its major toxicities , younger women at very high risk and possibly hysterectomized postmenopausal women appear to be the best candidates for preventive tam . a simple and economic approach to retain tamoxifen efficacy while reducing the risks may be a dose reduction . in a study conducted by our group , standard dose of tamoxifen ( 20 mg / die ) and two differ lower doses ( 10 mg / die and 10 mg on alternate days ) were administered for 2 months in a cohort of more than 120 healthy women , and changes in serum biomarkers regulated by the er were evaluated . no evidence for a concentration - response relationship was observed for most of these biomarkers . the concept of dose reduction was further supported by the observation of tamoxifen as very high tissue distribution ( 560 times its blood concentrations ) and a prolonged half - life . moreover , the low - dose concept has been confirmed in a preoperative trial in which 120 breast cancer women were treated with either 20 , 5 , or 1 mg / die of tam for 4 weeks before surgery . the effects of these different doses of tam on proliferation were analyzed using the ki67 expression as the main surrogate endpoint marker . interestingly , the change in ki67 expression induced by lower doses of tamoxifen was comparable to that achieved with the standard dose , implying that low - dose tam retains its antiproliferative activity . moreover , several blood biomarkers of tam estrogenicity associated with the risk of breast cancer , cardiovascular disease and bone fracture showed a dose - response relationship , and suggesting that this approach may be associated with reduced , positive and negative oestrogenic effects of tam . these fundamental data provide a strong rationale for the formal assessment of low - dose tam in preventive setting , and for these reasons we started two phase iii randomized placebo trials ( actually ongoing in our institute ) in order to assess the efficacy of 5 mg / die of tam in high - risk women as current hrt ( hot study ) and with breast intraepithelial neoplasia ( ien ) . raloxifene , a second generation of serms has reduced the incidence of breast cancer in preclinical models and several clinical trials evaluated it for the prevention of osteoporosis and heart disease [ 2022 ] . raloxifene , which has a well - established and favourable effect on bone metabolism , was in fact initially approved ( by fda ) for the prevention and treatment of osteoporosis in postmenopausal women . in the multiple outcomes of raloxifene evaluation ( more ) trial , raloxifene ( 60 mg or 120 mg compared to placebo ) shows a 30% reduction in the risk of vertebral fracture in postmenopausal women with osteoporosis . one of the secondary endpoints of the study was the incidence of breast cancer in this target of population , and in raloxifene - treated group the risk of invasive breast cancer was significantly reduced by 72% ( rr = 28 ; 95% ci 0.170.46 ) that becomes 62% after 4 years of followup in the continuing outcomes relevant to evista ( core ) trial . as was noted in the tamoxifen trials , the benefits appeared to be specific only to receptor - positive invasive breast cancer . an increasing risk in thromboembolic events included dvt ( deep venous thrombosis ) and pulmonary embolism as observed in a raloxifene study ( rr = 3.1 ; 95% ci 1.56.2 ) , but unlike what occurs in tamoxifen there was no difference in the incidence of endometrial carcinoma compared with placebo arm [ 23 , 24 ] . results of more and core trials led researchers to conduct a comparative , randomized phase iii study of raloxifene versus tamoxifen in more than 19000 postmenopausal women at increased risk for breast cancer . the study of tamoxifen and raloxifene ( star ) trial or nsabp - p2 compared 20 mg of tamoxifen daily to 60 mg of raloxifene daily for 5 years with the incidence of breast cancer as a primary endpoint . the secondary end points included noninvasive breast cancer , uterine malignancies , thromboembolic events , fractures , cataracts , quality of life , and death from any cause . interestingly , although no untreated control group was included , there was no difference in the incidence of the disease between the two groups ( rr : 1.02 ; 95% ci : 0.8281.28 ) . furthermore , while there was a difference between the two treatment groups for the rate of in situ(ductal and lobular ) breast cancer , this was not shown to be statistically significant ( rr : 1.40 ; 95% ci : 0.9892.00 ) . conclusive results based on the risk reduction seen in the bcpt for tamoxifen show that both drugs reduced the risk of developing invasive breast cancer by about 50% . while tamoxifen reduced the incidence of lcis and dcis , raloxifene did not have an effect on these diagnoses . a mechanism to explain the difference in noninvasive breast cancer incidence is unknown , but long - term follow - up results for the star trial may result in additional information regarding this issue . regarding the side effects , more uterine malignancies occurred in the tamoxifen arm and no statistically significant differences were noted between the 2 groups relative to the incidence of any cardiovascular events . more recently , results from the raloxifene use for the heart ( ruth ) study affirmed the benefit of raloxifene with regard to reduced risk of breast cancer . this trial , designed to focus on heart disease , randomized more than 10,000 postmenopausal women with coronary health disease or multiple coronary health disease risk factors to receive either raloxifene 60 mg per day or placebo . data from the star trial and the other raloxifene / placebo trial resulted in the approval of raloxifene by the us food and drug administration for a reduction in the risk of invasive breast cancer in postmenopausal women with osteoporosis and reduction in the risk of invasive breast cancer in postmenopausal women at high risk of invasive breast cancer . no data are currently available on the use of raloxifene in patients with brca1 or brca2 mutations , nor was raloxifene approved for women with a previous invasive breast cancer or for the treatment of invasive breast cancer . however , the approval of raloxifene gives an important new option to postmenopausal women beyond that of tamoxifen , one that avoids an excess of endometrial cancers and reduces the risk of thromboembolic events .",
"high circulatory estrogen levels , as well as high aromatase levels in breast tissue , have been known to increase breast cancer risk . thus , inhibition of aromatase would be expected to decrease estrogen production and ultimately estrogen - related breast carcinogenesis . in adjuvant setting , third generation of ais ( anastrozole , letrozole , and exemestane ) has been found to superior to tamoxifen and be able to reduce the incidence of contralateral breast cancers by 37 to 55% [ 2833 ] . these agents have resulted in improved disease - free survival and are associated with fewer life - threatening side effects than serms . thus , the third - generation aromatase inhibitors ( ais ) have been introduced into the treatment of breast cancer , and their greater efficacy compared to tamoxifen , along with a more favorable side - effect profile , makes them attractive agents for use in breast cancer prevention [ 35 , 36 ] . the international breast cancer intervention ( ibis)-ii prevention trial , direct consequence of atac trial , is actually ongoing and is comparing anastrazole ( ana ) to placebo in 6000 postmenopausal women at increased risk to breast cancer . a second complimentary study ( ibis - ii ) will look at the role of ana in affected postmenopausal women who underwent a locally excised ( or mastectomy ) hormone receptor - positive intraductal neoplasia with clear margins . in this second group , both arms address the ability of ana to reduce the incidence of first primary invasive breast cancers . another prevention trial with ais ( map3 ) is actually underway with exemestane ( exe ) . authors are comparing placebo or exe , or exe plus celecoxib for 5 years in more than 5000 high - risk postmenopausal women . in september 2004 the disclosure of an excess of adverse cardiovascular events in the cox-2 inhibitor arm has recommended authors to revised the study design . they modified it in two different arms ( exemestane vs placebo ) and a new simple size of 4.560 . despite this , the map3 study was reopened to accrual in march 2005 with a revised sample size of 4,560 and two arms , exe 25 mg / d alone and placebo . the primary endpoint is the incidence of breast cancer specifically to determine if exe is able to reduce invasive breast cancer by 65% compared to placebo . these data obtained by adjuvant trial provide a rational for exploring ais in prevention setting . they are superior to tamoxifen , and we hypothesized that the major of er - positive breast cancer ( but not for er negative ) can be prevented by these drugs . moreover , they are also well tolerated than tamoxifen without uterine and thrombotic effects , but they do lead to bone mineral loss . these effects should be contrasted by the use of bisphosphonates .",
"although a number of antiestrogenic agents are being extensively tested in clinical trials , all these agents affect the endocrine pathway and suppress only the development , of estrogen receptor ( er)-positive breast cancer . they have no effect in reducing the risk of er - negative breast cancer , which accounts for 2030% of breast cancers and has a poor prognosis . thus , it is worth identifying new pathways , biomarkers , and agents that are effective in the treatment and prevention of these subtypes . with the accumulating knowledge in understanding the biology of cancer development several classes of a new generation of chemopreventive agents modulating the nonendocrine biochemical pathways have been developed and many of these are still currently under investigation . these agents include retinoids , epidermal growth factor receptor ( egfr ) , tyrosine kinase inhibitors ( tkis ) , cyclooxygenase-2 ( cox-2 ) inhibitors , bisphosphonates , vitamin d receptor ( vdr ) , statins , peroxisome proliferator- activated receptor ( ppar ) , and others . a complete summary of involved agents , with their specific pathways , is shown in table 1 and a brief state of the art of the more compounds involved are analyzed below . retinoids are natural and synthetic derivative of vitamin a ( retinol ) that have profound effects on development , metabolism , differentiation , and cell growth . the retinoid , the most widely studied in chemoprevention clinical trials , is the synthetic amide of retinoic acid n-(4-hydroxyphenyl ) retinamide ( 4-hpr ) , or fenretinide . fenretinide has been found to exert significant chemopreventive activity in various in vitro and in vivo studies [ 3942 ] . a phase iii clinical trial , using 4-hpr to reduce the incidence of secondary breast cancer in almost 3000 patients , was published in 1999 and showed no difference in contralateral and ipsilateral breast cancers ; however , a posthoc analysis suggested a significant treatment interaction with menopausal status . in particular , it showed a 35% reduction in premenopausal women and an opposite trend in postmenopausal women . moreover , the 15-year follow - up of this trial substantially confirmed these results , and the risk reduction is of the order of 50% in women aged 40 years or younger and persists for 10 years after retinoid cessation . moreover , 4-hpr was observed to reduce secondary tumours in premenopausal women irrespective of the hormone receptor status of the primary cancer , suggesting that retinoids have a potential chemopreventive effect on er - negative and er - positive breast cancers . recently , also a new rxr - selective retinoid , commonly named as rexinoids , has been studied as cancer preventative agent . preclinical studies in fact have demonstrated that this compound is able to maintain the chemopreventive efficacy of the retinoids , also in er - negative setting , but with substantial minor toxicity [ 45 , 46 ] . the egfr is one of a family of four closely related receptors ( egfr or erbb-1 , her-2/neu or erbb-2 , her-3 or erbb-3 , and her-4 or erbb-4 ) that uses tyrosine kinase activity and contributes to a large number of processes involved in tumour survival and growth , including cell proliferation and inhibition of apoptosis , angiogenesis , and metastasis , thus making it an attractive target for cancer prevention and treatment , because agents that are able to block the erbb - signaling pathways are promising in the treatment and prevention of breast cancer . in particular , the researchers focused their attention to egfr - her-1 and her-2 pathways , because the mechanism of resistance to antioestrogen therapy is usually associated with an increased expression of her-1 and her-2 receptors . inhibition of tyrosine kinase activity , with tkis , involved in the egfr signaling cascade could be the right pathway for the treatment and prevention of er - independent breast . one involves blockade of this activity with monoclonal antibodies ( trastuzumab ) , whereas the second involves the tkis . amplification of the her2 gene and overexpression of it 's related protein have been found in almost 30% of human breast cancer and it is generally correlated with poorer outcomes compared with tumors her2 negative [ 49 , 50 ] . moreover , there is substantial evidence of an inverse correlation between her2 expression and hormone receptor . in an effort to improve the prognosis of these her2 + cancers , research has focused therapies directly against this pathway and in particular included the monoclonal antibodies trastuzumab ( herceptin ) . trastuzumab has largely showed its benefit in adjuvant therapy ; in particular , it is able to increase the clinical benefit of first - line chemotherapy in metastatic her-2 breast cancer , and this benefit seems to be irrespective of the er status . the drug is generally well tolerated , but its possible cardiotoxicity and its route of administration ( intravenously ) make it difficult to propose it to healthy women as chemoprevention . apart from the monoclonal antibodies directed against the extracellular receptor domain of her-2 , there is another way to contest erbb activity . as previously explained , the use of small molecules inhibit intracellular tyrosine kinase activity , named tkis . tkis have several advantages over monoclonal antibodies such as oral bioavailability , potentially less toxicity , and ability to inhibit truncated forms of egf receptors . \n lapatinib ( tykerb ) is a reversible small - molecule tki that targets both her-2 and egfr tyrosine kinase . it is able to interrupt signal transduction from both egfr and her-2 receptors , and because of its dual - receptor activity it has been evaluated in several phase ii and iii trials in various forms of breast cancer [ 5860 ] . moreover , in the prevention setting , it showed a significant delay in the er - negative mammary tumors development . this preventive action was seen in premalignant mammary lesions , and this suggests a drug efficacy also in initiation and progression of breast carcinogenesis . \n gefitinib ( iressa ) , another egfr tyrosine kinase inhibitor that suppressed er - negative mammary tumor formation in mmtv - erbb2 transgenic mice . its mechanism of action is complex and involves cell cycle , angiogenesis , and growth factors [ 62 , 63 ] . moreover , results of preclinical and clinical studies about breast cancer treatment remain controversial [ 64 , 65 ] , but in preventive setting , the ability of gefitinib to inhibit the proliferation at the early stages of breast cancer and also in the normal adjacent epithelium could be the rationale for using this compound in prevention trial . the inducible isoenzyme cox-2 is expressed in invasive and in situ breast cancers cells , and several epidemiological studies have shown the inverse relationship between nonsteroidal , anti - inflammatory drugs ( nsaids ) and cancer incidence [ 68 , 69 ] . cox-2 is the main target of nsaids , and despite the mechanism by which it contributes to tumor formation is not fully understood , it is possible to hypothesize an involvement of a multidisciplinary process which involves proliferative stimulation , mutagen production , and apoptosis inhibition . the cox-1 and cox-2 pathway , which converts arachidonic acid to prostaglandin , is involved in the development and growth of several different neoplastic lesions , and it is frequently overexpressed not only in invasive breast cancer but also in adjacent intraductal neoplasia ; therefore , it might be an early event in mammary tumorigenesis . a meta - analysis , published in 2001 , demonstrated that nsaids were associated with a 20% reduction of breast cancer risk , and the same results were confirmed in a more recent publication [ 72 , 73 ] . these data suggested the chemopreventive potential ( including breast cancer ) of anti - inflammatory drugs . celecoxib , a selective cox-2 inhibitor , reduced the incidence and multiplicity of dmba - induced mammary tumors in rat models by 68 and 86% , respectively . nimesulide , another selective cox-2 inhibitor , significantly reduced the incidence and multiplicity of phip and nmu - induced rat mammary tumors . similar effects were observed with aspirin , but the level of evidence for both of agents on breast cancer incidence is , at present , too small to justify their use solely as a preventive therapy and insufficient to make any recommendations . bisphosphonates , the drugs of choice for the treatment of osteoporosis , act on the mevalonate pathway and for this reason are currently of considerable interest in the treatment and prevention of breast cancer . their mechanism of action involved osteoclasts , and in particular , they are able to inhibit their activity . thus they have proven efficacy in control of breast cancer bone metastases and also in bone loss induced by other treatment as ais . moreover , interestingly recent two cohort studies showed a reduction of 30% in breast cancer incidence in bisphosphonates users [ 80 , 81 ] , irrespective of hormonal status . bisphosphonates are generally well tolerated , but randomised prevention trials with composite endpoints in women with osteopenia and increased risk of a new breast cancer are required to fully investigate the risk - benefit profile of these drugs . poly(adp - ribose ) polymerases ( parps ) are a family of enzymes that play a key role in the repair of dna damage . in particular , the most important seems to be parp enzymes ( parp-1 and parp-2 ) [ 83 , 84 ] . a key role for parp-1 and parp-2 is maintaining genomic integrity , in particular , repair of single strand dna lesions and breaks using the base excision repair ( ber ) pathway . the inhibition of these enzymes leads to accumulation of dna single - strand breaks , which can lead to dna double - strand breaks at replication forks [ 85 , 86 ] . normally , these breaks are repaired and a key component of this mechanism comprises the tumour - suppressor proteins brca1 and brca2 . in brca mutated cells , this dna repair ability is lost and the aberrations drive to carcinogenesis . consequently , the requirement for a brca mutation to be present for a parp inhibitor to be effective constitutes a synthetic lethal strategy selectively affecting mutant tumour cells comprising brca1-brca2 , which are 1000-fold more sensitive than others [ 8789 ] . recent preclinical studies have shown encouraging results , and at present parp inhibitors are usually studied in combination with other cytotoxic agents [ 90 , 91 ] . the only published study with a parp inhibitor as a single - agent treatment is a phase i trial with olaparib in patient with brca - associated cancer , which showed a good efficacy to inhibit parp activity and that it has few side effects compared conventional chemotherapy . the efficacy of a particular risk group as the mutation carriers and the relative good tolerability make these agents well suited for cancer prevention . further investigations should be proposed in brca mutation carriers to assess the ability of this class of agents to prevent cancer , evaluate the safety profile , and reduce the incidence of breast cancer . there is increasing evidence that presence of hyperinsulinemia and insulin resistance increased breast cancer risk , worsen , the prognosised and partly explained the obesity - breast cancer risk association in postmenopausal women [ 9398 ] . several epidemiological and observational studies have confirmed the relationship between insulin levels and cancer induction [ 99 , 100 ] . insulin may promote tumorigenesis via a direct effect on epithelial tissues , or indirectly by affecting other modulators , such as insulin - like growth factors , sex hormones , and adipokines [ 101 , 102 ] . thus , there is a great interest in exploring the possibility that antidiabetic therapies , which lower insulin levels , could decrease breast cancer incidence or its related mortality . metformin , a biguanide derivative , is the most commonly used drug worldwide to treat type ii diabetes . epidemiological studies have shown a significant risk reduction in cancer incidence and mortality in diabetic patients on metformin , relative to other antidiabetic drugs , including positive results specifically in breast cancer [ 103105 ] . it may impact cancer through a direct ( insulin - independent ) activation of ampk - mtor pathway mechanism or indirect effect ( insulin - dependent ) reducing hepatic gluconeogenesis obtaining lower circulating insulin levels with inhibition of proliferation cells and protein synthesis over increase apoptosis ( figure 5 ) . several preclinical studies have confirmed these effects of metformin in vitro and in vivo and showed a significant reduction of both breast epithelial cell proliferation and protein synthesis [ 106 , 107 ] . in particular , it is confirmed that metformin produces a significant repression of cell proliferation , and moreover , they also found that this effect was different in human breast cancer cell lines if related to either positive or negative ers . they in fact detected a complete cell growth repression in er - positive cell lines , although only a partial inhibition was detected in er - negative phenotypes . these data suggest that , although er - negative cells are not as sensitive as er - positive ones , both of them show a reduction in cell growth under metformin treatment . several important phase ii and iii studies are actually ongoing in the world in order to confirm and clarify these promising settings .",
"many molecularly pathways and the correlated targeted drugs are actually in development for advanced cancer therapy , and they have potential activity and tolerability also in cancer chemoprevention setting . the identification of new potential molecular targets and the development of agents aimed at these targets within cancer have already had a significant impact on advanced cancer therapy and provide a wealth of opportunities for chemoprevention . there is substantial evidence that together with the epithelial cells alterations the microenvironment dysfunction is crucial for carcinogenesis , and this makes the microenvironment an interesting target for breast cancer chemoprevention . in particular , there are many excellent publications which consider microenvironment as a good target for cancer therapy , but the application of chemoprevention to control the tumour microenvironment during the early stages of carcinogenesis is not yet adequately analyzed . we will briefly explain a recent progress that indicates that the effects of chemopreventive agents on the microenvironment are an important aspect of their preventive action and that many classes of agents , which showed to have significant chemopreventive actions on epithelia , also have similar useful actions on the microenvironment . many molecular targets inside the microenvironment with the correlated drugs are summarized in the table 2 . these transcription factors and their associated regulatory proteins are an ideal target of chemoprevention , and in particular three attractive pathways as the nuclear factor b ( nfb ) , hypoxia - inducible factor 1 ( hif-1 ) , and pi3-mtor are analyzed in this section . nuclear factor-b pathway plays important roles in the control of cell proliferation , differentiation , apoptosis , inflammation , stress response , cell signaling transduction , and other physiological processes , but it is also critically involved in the processes of development and progression of cancers [ 110113 ] . oxidative stress is defined as an increase in intracellular reactive oxygen species ( ros ) such as h2o2 , superoxide , and hydroxyl radical and . these findings suggest that oxidative stress activates nf - kappab activity in the cells [ 114 , 115 ] . moreover , nfb is activated not only by the ros but also by various carcinogen and tumor promoters , and these are the reasons why nfb is overexpressed and activated in various cancers , especially in the poorly differentiated . experimental studies have shown that natural antioxidant compounds including isoflavones , indole-3-carbinol ( i3c ) , 3,3-diindolylmethane ( dim ) , curcumin , epigallocatechin-3-gallate ( egcg ) , rosveratrol , curcumin and others seems to be able to inhibit the activity of nf - kappab and the growth of cancer cells and also to induce apoptosis , suggesting that nf - kappab could be a target for cancer prevention [ 117121 ] . similarly , hif-1a master regulator in the control of tissue homeostasis , crucial in adaptive responses to tissue oxygenation including energy status , glucose , and iron metabolism as well as growth factor signaling [ 122 , 123]is a key target for the prevention and treatment of cancer . interest in the role of hif-1 in cancer has grown exponentially over the last two decades , as this factor activates the transcription of many genes that code for proteins involved in several pathways intimately related to cancer [ 124126 ] . hypoxia - inducible factor-1 ( hif-1 ) plays a central role in the adaptation of tumor cells to hypoxia by activating the transcription of genes , which regulate several biological processes . for these reasons , hif-1 is considered a potential target for cancer therapy , and , recently , many efforts to develop new hif-1-targeting agents have been made [ 127130 ] . interestingly , they are recently identified by increased hif-1 expression ( relative to adjacent normal tissue ) in 13 tumor types , including lung , prostate , breast , and colon carcinoma . moreover , hif-1 was also overexpressed in preneoplastic and premalignant lesions , such as colonic adenoma , breast ductal carcinoma in situ , and prostate intraepithelial neoplasia . these data show that overexpression of hif-1 may occur very early in carcinogenesis , before histologic evidence of angiogenesis or invasion , and suggest that hif-1 might be a biomarker of carcinogenesis and a suitable target for cancer chemoprevention . because hif-1 seems to have an important function in carcinogenesis several , approved anticancer drugs ( e.g. , topotecan , imatinib mesylate , trastuzumab , ns398 , celecoxib , and ibuprofen ) inhibit hif-1 activity . moreover , also several natural products ( e.g. , resveratrol , genistein , apigenin , and berberin ) have also been found to inhibit the activity of this transcription . in this setting it is important to say that : however , the use of hif-1 inhibitors in cancer chemoprevention might be associated with toxicity . an excessive inhibition of hif-1 may produce adverse effects , as hif-1 regulates many cellular processes under physiologic conditions [ 125 , 132 ] . therefore , although hif-1 inhibitors may represent a useful source of chemopreventive agents , the potential toxicity associated with these agents should be considered carefully , especially when chemopreventive interventions are aimed at preventing cancer in healthy populations . the mammalian target of rapamycin ( mtor ) is a signaling kinase of the phosphatidylinositol 3-kinase / protein kinase b or pi3k pathway that mediates cell growth and metabolism and coordinates cell cycle progression in response to genetic , epigenetic , and environmental conditions . pathways involved in mtor signaling are dysregulated in precancerous human tissues , including breast cancer , and is associated with the development of resistance to endocrine therapy [ 133135 ] and to the anti - human epidermal growth factor receptor-2 ( her2 ) monoclonal antibody trastuzumab [ 136 , 137 ] . phase i trials have demonstrated that mtor inhibitors are fairly well tolerated with the most frequent drug - related toxic effects being acne - like maculopapular rash , mucositis , and stomatitis , all of which were reversible on discontinuation of treatment . rapamycin and its analogues , the rapalogues , decrease tumor growth in many xenograft models , including those with breast cancer cell lines [ 139 , 140 ] . thus , preclinical data have confirmed the antitumor activity of rapamycin and the rapalogues and have suggested that patients with breast cancer may especially respond to mtor inhibitors . phase i - ii clinical trials have demonstrated that everolimus ( rad-001 ) , an mtor inhibitor with demonstrated preclinical activity against breast cancer cell lines , has been shown to reverse akt - induced resistance to hormonal therapy and trastuzumab . it has promising clinical activity in women with her2-positive , her2-negative , and estrogen receptor - positive breast cancer when combined with her2-targeted therapy , cytotoxic chemotherapy , and hormonal therapy , respectively . the involvement of mtor pathways in precancerous lesions makes the mtor signaling an intriguing target for chemopreventive intervention . thus , several recent preclinical studies explored also the possibility of a chemopreventive action through the mtor inhibition . in one of this , rapamycin showed chemopreventive activity against mammary gland tumors in transgenic mice , bearing activated erbb2 ( her-2/neu ) receptor either alone ( neuyd ) or with vegf expression , where it dramatically inhibited tumor formation in neuyd mice . these results seem to suggest the mtor inhibition as a possible chemopreventive strategy against metachronous tumors or recurrence in high - risk patients , whose primary tumors overexpressed erbb-2 , or in patients showing dysregulation of the pi3k / akt / mtor signaling pathway . another recent preclinical study evaluated chemopreventive effects of rapamycin in a transgenic mouse model of human breast carcinogenesis , where it significantly inhibited growth of mammary intraepithelial neoplasia outgrowths , invasive tumor incidence , and tumor burden . finally , some natural products , such as epigallocatechin gallate ( egcg ) , caffeine , curcumin , and resveratrol , have been found to inhibit mtor as well and are actually under investigations in this setting .",
"in conclusion , the success of chemopreventive approach depends on a tumor - specific risk model for identifying high - risk subjects , increasing preclinical drug test over the development novel and more safety chemopreventative agents , and identifying new surrogate endpoint using molecular pathways and new targets of drugs activity . safety is a very important point to take into account , because several large randomized prevention trials in several cancers have shown that major adverse events can prevent widespread public acceptance of active chemoprevention agents . despite the success of action showed for example in endocrine intervention is a promising starting point in order to continue to evolve with the rapid integration of molecular approaches into research and clinical practice . it is urgent to find active agents in other fields as nonhormone - responsive lesions . the personalized approaches in advanced cancer therapy and the evolution of molecularly targeted will streamline chemoprevention research and facilitate the development of rational , effective , and safe preventive drugs , involving different pathways and with the ability to modify carcinogenesis in early phases ."
] | in 1976 , sporn has defined chemoprevention as the use of pharmacologic or natural agents that inhibit the development of invasive breast cancer either by blocking the dna damage that initiates carcinogenesis , or by arresting or reversing the progression of premalignant cells in which such damage has already occurred . although the precise mechanism or mechanisms that promote a breast cancer are not completely established , the success of several recent clinical trials in preventive settings in selected high - risk populations suggests that chemoprevention is a rational and an appealing strategy . breast cancer chemoprevention has focused heavily on endocrine intervention using selective estrogen receptor modulators ( serms ) and aromatase inhibitors ( ais ) . achieving much success in this particular setting and new approaches as low - dose administration are actually under investigations in several topics . unfortunately , these drugs are active in prevention of endocrine responsive lesions only and have no effect in reducing the risk of estrogen - negative breast cancer . thus , recently new pathways , biomarkers , and agents likely are to be effective in this subgroup of cancers and were put under investigation . moreover , the identification of new potential molecular targets and the development of agents aimed at these targets within cancer have already had a significant impact on advanced cancer therapy and provide a wealth of opportunities for chemoprevention . this paper will highlight current clinical research in both er - positive and er - negative breast cancer chemoprevention , explaining the biologic effect of the various agents on carcinogenesis and precancerous lesions , and finally presenting an excursus on the state - of - the - art about new molecular targets under investigations in breast cancer settings . |
[
"we included 3,615 french men and women , aged 3065 years , with baseline fasting glycemia ( fg ) < 6.1 mmol / l , who participated in the 9-year follow - up d.e.s.i.r . participants provided written informed consent , and the protocol was approved by the ethics committee of bictre hospital , kremlin - bictre , france . incident hyperglycemia was identified by an fg 6.1 mmol / l or treatment for diabetes , and incident diabetes was identified by an fg 7.0 mmol / l or treatment of diabetes during at least one of the three follow - up examinations ( years 3 , 6 , and 9 ) . smoking , dietary habits , degree of physical activity , and alcohol consumption were assessed using a self - administered questionnaire . mean daily intake of water , wine , beer or cider , and sweet beverages was categorized in the questionnaire into six mutually exclusive levels : none , < 0.5 , 0.5 to 1 , 1 to 1.5 , 1.5 to 2.0 , and > 2 l. in the present analyses , the levels were grouped into three classes : < 0.5 , 0.5 to 1 , and > 1 l. other clinical and biological measurements are presented in the supplementary methods . results are presented as means ( sd ) or median ( 25th75th percentiles ) for quantitative variables and as percentages for qualitative variables . baseline means and percentages were compared between the three w - intake classes using anova or tests . logistic regression models were used to determine odds ratios ( ors ) and 95% cis corresponding to the comparison of incident hyperglycemia in middle and high classes of w - intake in comparison with the lowest class . adjustment variables were either known risk factors for type 2 diabetes or factors associated ( p < 0.10 ) with hyperglycemia and w - intake in our population .",
"we included 3,615 french men and women , aged 3065 years , with baseline fasting glycemia ( fg ) < 6.1 mmol / l , who participated in the 9-year follow - up d.e.s.i.r . participants provided written informed consent , and the protocol was approved by the ethics committee of bictre hospital , kremlin - bictre , france . incident hyperglycemia was identified by an fg 6.1 mmol / l or treatment for diabetes , and incident diabetes was identified by an fg 7.0 mmol / l or treatment of diabetes during at least one of the three follow - up examinations ( years 3 , 6 , and 9 ) .",
"smoking , dietary habits , degree of physical activity , and alcohol consumption were assessed using a self - administered questionnaire . mean daily intake of water , wine , beer or cider , and sweet beverages was categorized in the questionnaire into six mutually exclusive levels : none , < 0.5 , 0.5 to 1 , 1 to 1.5 , 1.5 to 2.0 , and > 2 l. in the present analyses , the levels were grouped into three classes : < 0.5 , 0.5 to 1 , and > 1 l. other clinical and biological measurements are presented in the supplementary methods .",
"results are presented as means ( sd ) or median ( 25th75th percentiles ) for quantitative variables and as percentages for qualitative variables . baseline means and percentages were compared between the three w - intake classes using anova or tests . logistic regression models were used to determine odds ratios ( ors ) and 95% cis corresponding to the comparison of incident hyperglycemia in middle and high classes of w - intake in comparison with the lowest class . adjustment variables were either known risk factors for type 2 diabetes or factors associated ( p < 0.10 ) with hyperglycemia and w - intake in our population .",
"baseline characteristics of the 3,615 normoglycemic participants are presented according to their class of w - intake ( table 1 ) . among them , during follow - up , 565 subjects became hyperglycemic and 202 developed diabetes . the daily w - intake was negatively associated with the risk of new - onset hyperglycemia , even after adjustment for multiple metabolic risk factors . compared with daily w - intake of < 0.5 l , ors were 0.64 ( 95% ci 0.490.83 ) and 0.73 ( 0.550.97 ) for classes of 0.51.0 l and > 1.0 l , respectively ( p = 0.003 ) . after further adjustments for intake of other beverages , the ors were slightly attenuated : 0.68 ( 0.520.89 ) and 0.79 ( 0.591.05 ) for classes of 0.51.0 l and > 1.0 l , respectively ( p = 0.016 ) ( table 1 ) . with the two upper classes combined , the or was 0.72 ( 0.560.92 ) ( supplementary fig . 1 ) . there was no interaction with several important characteristics , including those related to self - reported alcohol or tobacco consumption ( supplementary table 1 ) . baseline characteristics of the study population and risk for new - onset hyperglycemia during follow - up , by classes of mean daily w - intake data are means ( sd ) or medians ( 25th75th percentiles ) for continuous variables and percentages of patients for categorical variables . thzd , thiazidic diuretics ; furo , furosemide ; homa - ir , homeostatic model assessment index of insulin resistance ; homa - b , homeostatic model assessment index of insulin secretion . hypertension was defined as systolic or diastolic blood pressure > 140 or 90 , respectively , or treated with antihypertensive drugs . ors ( 95% cis ) for the association between daily w - intake at baseline and the risk of incident hyperglycemia ( fasting plasma glucose 6.1 mmol / l or treatment for diabetes ) are presented according to two statistical models ; variables for adjustment were either known risk factors for type 2 diabetes or factors associated ( p < 0.10 ) with hyperglycemia and w - intake in our population . model 1 : adjusted for age , sex , bmi , baseline fg , physical activity , smoking status , triglycerides , homa - ir , and total cholesterol . model 2 : further adjusted on self - reported intake of other fluids ( i.e. , volumes of beer or cider , sweet drinks , and wine consumed per day ) . the c - reactive protein was available for only 181 , 466 , and 333 subjects in the three classes of w - intake , respectively . * * hdl cholesterol and ldl cholesterol were not available for 28 and 26 subjects , respectively . the same trend , although nonsignificant , was observed for the association with new - onset diabetes : compared with participants with a daily w - intake < 0.5 l , ors for those drinking 0.51.0 l and > 1.0 l water per day were 0.68 ( 95% ci 0.411.15 ) and 0.75 ( 0.431.32 ) , respectively , p = 0.36 .",
"risk for hyperglycemia was negatively and independently related with self - reported w - intake in normoglycemic middle - aged individuals from the french general population however , the association was moderately attenuated when important metabolic risk factors and potential confounders were introduced as covariables in the analysis , including intake of other classes of beverages with known adverse long - term effects ( sweet and alcohol - containing drinks ) . our data support the novel idea that vasopressin , besides its role in urine concentration , is also an important actor in glucose homeostasis ( 1 ) . the negative association of w - intake and risk for hyperglycemia was relevant among many subsets of participants , and those reporting a low w - intake ( < 0.5 l ) had a higher risk for hyperglycemia ( for example , participants in the high physical activity group ) ( supplementary table 1 ) . this indicates that identification of individuals with a w - intake of < 0.5 l may be widely relevant to target preventive interventions regarding the metabolic risk . diabetes incidence was low and statistical power was thus limited ; 24-h urine volume was not measured , but the urinary density was inversely associated with self - reported w - intake , arguing for the validity of the questionnaire ( table 1 ) . in addition , we can not exclude residual confounding : healthier behaviors correlating with higher water drinking could account for the observed association . finally , only volunteers were included and the results may not be extrapolated to the general population . knowing the rise of vasopressin in diabetes , its effect on glycemia , gluconeogenesis , and glucagon release , it is surprising that no attention had been given to vasopressin as a possible risk factor for hyperglycemia and diabetes until a recent report of an association between copeptin and the incidence of diabetes ( 1,4,5,14 ) . our study extends this observation , drawing attention to a low w - intake as a possible new risk factor for impaired glycemia . it suggests that an increase in w - intake , an easy and costless intervention , could prevent or delay the onset of hyperglycemia and subsequent diabetes . hopefully , our study will serve as a benchmark to design appropriate clinical trials testing the efficacy of this intervention in people who report drinking < 0.5 l of water per day , as did almost 20% of the participants in this cohort .",
""
] | objectivewater intake alters vasopressin secretion . recent findings reveal an independent association between plasma copeptin , a surrogate for vasopressin , and risk of diabetes.research design and methodsparticipants were 3,615 middle - aged men and women , with normal baseline fasting glycemia ( fg ) , who were recruited in a 9-year follow - up study . odds ratios ( ors ) and 95% cis for the incidence of hyperglycemia ( fg 6.1 mmol / l or treatment for diabetes ) were calculated according to daily water intake classes based on a self - administered questionnaire.resultsduring follow - up , there were 565 incident cases of hyperglycemia . after adjustment for confounding factors , ors ( 95% cis ) for hyperglycemia associated with classes of water intake ( < 0.5 l , n = 677 ; 0.5 to < 1.0 l , n = 1,754 ; and > 1.0 l , n = 1,184 ) were 1.00 , 0.68 ( 0.520.89 ) , and 0.79 ( 0.591.05 ) , respectively ( p = 0.016).conclusionsself - reported water intake was inversely and independently associated with the risk of developing hyperglycemia . |
[
"although patients who undergo dialysis suffer from a complex illness , there are compelling reasons to believe that the inadequate removal of organic waste is an important contributing factor to the illness itself . nevertheless , randomized trials examining the impact of increased clearance of traditional uraemic solutes have yielded disappointing results . the haemodialysis study ( hemo ) failed to show any significant reduction in mortality with an increased dialysis dose . in contrast , in a post \n hoc analysis , the level of 2-microglobulin ( representative of middle molecules ) was found to be predictive of the relative mortality risk . furthermore , the results from a recent prospective , randomized and controlled study comparing online haemofiltration ( hf ) and haemodialysis ( hd ) have shown a significant difference in mortality in favour of hf , in spite of a very low kt / v in the convective procedure ( 1.07 0.06 with hf vs 1.42 0.06 with hd ) . this further confirms a series of observational studies that had already demonstrated that , in terms of patient survival , techniques capable of increasing middle - molecule clearance , such as haemodiafiltration ( hdf ) , hold an advantage over the conventional hd . in recent years , scientists have been increasingly convinced that a large number of high - molecular - weight toxins increase their plasma concentration during uraemia and are responsible for a number of dialysis co - morbidities , such as an immune system imbalance , itching and so on . hence , the interest of clinicians , followed by that of industry , in a new class of dialysis membranes aimed at enhancing the transport capabilities ( clearance ) of middle , large and even protein - bound molecules by using all the available membrane separation phenomena : diffusion , convection and adsorption , by designing and developing both high - performance protein - leaking dialyser , we mean the dialyser capable of removing large molecules on the basis of convection enhancement ( super - flux ) or adsorption capabilities .",
"the main aim of a dialysis filter is to better reproduce the physiological process of glomerular ultrafiltration . dialysis membrane clearance , however , is based on concentration differences rather than the convective separation of solutes and low - molecular - weight proteins from large serum proteins and blood elements . in an attempt to replicate glomerular ultrafiltration and the removal of middle molecules in high - flux dialysers , a significant increase in porosity has been obtained in order to remove large - molecular - weight solutes . hand in hand with the increase in porosity and the efficiency of mass transfer , there is a concomitant increase in the membrane ultrafiltration coefficient . the optimization of these properties has produced dialysers that allow for rapid solute fluxes and clearance profiles akin to those achieved across human glomeruli . the other significant feature of high - flux membranes , particularly the synthetic membranes , is that they tend to be more biocompatible . the properties of a dialyser , on the physical or biocompatible level , are related to its microstructural and macrostructural characteristics . microstructural aspects refer to the characteristics acting on the molecular scale ( i.e. the chemical modification of the side chains , thickness of the hollow fibre wall , membrane porosity ) . macrostructural properties refer to the properties acting on a length scale greater than molecular dimensions ( i.e. surface area , packing density , boundary layers adjacent to the membrane solution interfaces , shape and configuration of the hollow fibres , spacing and sterilization techniques ) . the so - called high - flux membranes are prepared with hydrophobic base materials , including polyacrylonitrile , polysulphone , polyaryethersulphone , polyamide and polymethylmethacrylate with various hydrophilic components . nevertheless , there are some examples of cellulose - based high - flux membranes , such as cellulose triacetate . in view of the large hydraulic permeability of synthetic membranes , the bidirectional water flux across the dialysis membranes is maximized ( figure 1 ) . under conditions of diffusive hd , at the proximal end of the dialyser , the sum of hydrostatic osmotic and oncotic pressure results in a large water movement from the blood to the dialysate . at the distal end of the hollow fibres , hence , the large volume of water leaving the blood and crossing into the dialysate at the proximal side is offset by the water backfiltration from the dialysate to the blood on the distal side . however , a larger and more important amount of small- and middle - molecule removal can be obtained in hdf . in hdf , with the further use of dialysate , a relatively free ultrafiltration is allowed , and there is a large volume of ultrafiltrate with no significant backfiltration from the dialysate . the amount of ultrafiltrate that offsets the fluid loss that the patient has to shed must be replaced by the direct intravenous substitution fluid infusion . in hf , all the water movements are from the blood to the dialysate compartment , and solute clearance is by convection alone . moreover , the removal with large - pore ( i.e. high - flux ) membranes is related to diffusion , convection and , in some cases , as discussed in the following , adsorption . this mechanism adds capacity to remove components with a pathophysiological potential , such as 2-microglobulin , cytokines and protein - bound uraemic toxins ( pbut ) . diagram of the internal backfiltration ( a ) and backdiffusion ( b ) phenomenon in a high - flux dialyser . a schematic description of the pressure plays that leads to the onset of the backfiltration phenomenon . at the filter blood inlet , there is a water movement from the blood to the dialysate , due to the interplay of the hydrostatic , osmotic and oncotic pressures , as well as the dialysate pressure . at the outlet , the equilibria are inverted : the dialysate pressure and oncotic pressure grow , while the blood hydrostatic pressure is reduced . the latter is reflected in the lower activated serum complement levels , a lower intradialytic reduction in white cell counts , a lower oxygen radical production , and a reduction in the release of interleukin-1 and tumour necrosis factor in the course of dialysis . on the other hand , this reduced cytokine production along with decreased bioincompatibility has been used to account for the fewer dialysis - related symptoms , in particular less intradialytic hypotension observed with high - flux techniques . preliminary studies with high - flux dialysers have shown varying results upon the haemoglobin response , the increased 2-microglobulin clearance , and a reduction in advanced glycation end products , peroxidation products and homocysteine levels . however , only a few of these studies are randomized , none of them is blind and the comparison is often made with older - generation low - flux membranes . moreover , there are no clear and unequivocal data showing that improved biocompatibility and excellent larger - molecule clearance translate into improved patient symptoms and better survival . the same can be said of techniques such as hf or hdf based on the use of high fluxes attainable with high - flux dialysers . on the latter issues , however , a whole strand of literature is coming out in favour of the convective techniques , which is not only based on observational studies , as in the past , but on randomized controlled trials . the recent membrane permeability outcome ( mpo ) , a study in which 647 incident dialysis patients were randomly allocated to high - flux or low - flux dialysis membranes , demonstrated that the improved 2-microglobulin clearance led to an improved survival in those with albumin < 4 g / dl , with a 37% reduction in the mortality risk with the high - flux membrane . the european acetate - free biofiltration ( afb ) study has shown better survival in patients with mild hypertension treated for 4 years by means of an acetate - free biofiltration as compared with conventional dialysis . even the online hf performed by a high - flux dialyser does not only appear to have a superior cardiovascular stability but also a better survival as compared with hd . recently , the idea that the removal of a distinct class of uraemic toxins , such as 2-microglobulin , factor d , leptin and adrenomedullin , while minimizing albumin loss , could improve treatment outcome in end - stage renal disease ( esrd ) patients has led to the development of a series of dialysers known by the name of super - flux. super - flux dialysers have been designed to maximize convective transport by increasing the pressure drop along the membrane fibres .",
"the same toxic substances directly bind with protein ( pbut ) , originating from high - weight complexes ( 50200 kda ) potentially involved in important uraemia co - morbidities such as itching and altered immune response [ 1821 ] . removing pbut from the blood by means of diffusion and convection ( containing the albumin loss ) is virtually impracticable ; however , pbut can be removed by using the adsorptive properties of particular biomaterials . a number of adsorption techniques are well known in the world of blood purification : with selectivity or without selectivity , working with plasma or whole blood , consisting of fibres or solid spheres . in this context , only dialysers made with a synthetic membrane having adsorption capabilities should be taken into account . synthetic membranes , such as polysulphone , are usually asymmetric ( figure 2left ) ; this means that , on a membrane thickness of 30 microns , just a 1-micron layer is responsible for the separation process , while 29 microns have structural functions alone . synthetic membranes such as polysulphone are usually asymmetrics , which means that , on a membrane thickness of 30 microns , a layer of 1 micron only is responsible for the separation process , while 29 microns have structural functions only . pmma , conversely , is a symmetric membrane , in which the whole thickness is involved in the separation process allowing middle - molecule adsorption . another class of synthetic membranes , i.e. polymethylmethacrylate ( pmma ) , is characterized by a symmetric structure ( figure 2right ) . in this case , the pores are larger , longer and winding , designed to trap different substances . moreover , in some cases , an ionic treatment of the inner surface may enhance this adsorption mechanism . pmma adsorption capabilities have been demonstrated both in vivo and in vitro . among others , campistol and co - workers have shown that pmma bk removes 2-microglobulin by adsorption , while high - flux polysulphone does so by filtration , using radiolabelled 2-microglobulin and scintigraphic analysis ( figure 3 ) . kawanishi measured interleukin ( il)-6 removal from different membrane mini - modules isolating convection and adsorption contributions . scintigraphic image ( from campistol et al . ) of the dialyser ( pmma vs polysulphone ) after the end of the dialysis session , using 131i - labelled 2-microglobulin .",
"super - flux dialysers based on enhanced convection or adsorption , at least on the theoretical plane , could be widely used in clinical situations in which , apart from toxins of small molecular size , large quantities of mediators and toxic products are also produced , with a negative biological effect at a middle high molecular weight , or which are rapidly bound to the proteins . these filters make it possible to treat septic patients with acute renal failure and simultaneously provide the control of uraemia and fluid status as along with cytokine removal . in the field of haematological diseases , particularly in myeloma , early yet encouraging results have already been obtained in the light chain removal . hd with super - flux dialysers has been shown to be more effective than high - flux dialysis in reducing plasma homocysteine . however , an important side effect of super - flux dialysers , or at least some of them , might be plasma protein loss , and not only that of albumin but also coagulation factors , growth factors and hormones . hence , before opening the door to these new filters , it will be necessary to develop strategies in use to achieve a good clearance of waste and harmful products , while minimizing the risk of a huge loss of substances , such as proteins , useful for our organism 's biochemical homeostasis ."
] | although patients undergoing dialysis have a complex illness , there are compelling reasons to believe that the inadequate removal of organic waste is an important contributing factor to the illness itself . this paper focuses on the transport phenomena that occur within a dialyser . an attempt is made to clarify how transport phenomena are related to the performance of a dialysis session and how they depend on the membrane characteristics . our study offers some discussion points on the complex issue of defining what the best parameters could be in comparing the efficiency of different membranes . the new high - flux dialysers have improved larger - molecule clearance and biocompatibility . membrane performance is a very hard process to evaluate , and different membranes can only be compared by establishing adequate points of comparison . at the same time , the points of comparison themselves may change depending on the type of co - morbidities of the specific patient who is considered for membrane selection . this editorial ( together with all the papers presented in this issue ) seeks to focus on the membrane 's own merits in improving the dialysis therapy . |
[
"the genes doublesex in drosophila and mab-3 in caenorhabditie elegans were first identified as transcription factors containing a conserved zinc finger - like dna binding domain ( dm domain ) , which plays a key role in sexual development 1 - 3 . many organisms have multiple dmrt ( doublesex and mab-3 related transcriptional factor ) genes , the number of which varies between species . for example drosophila , caenorhabditis elegans , fish , mice and human have four , eleven , six , seven and eight copies respectively 4 - 9 . from arthropods to nematodes to vertebrates , most dmrt genes are expressed in gonads and play roles in sex determination , which serves as a rare example of conserved mechanisms underlying sex regulation during evolution . previous research with dmrt1-deficient mice strongly demonstrated that this gene was required for testis differentiation after determination , but dispensable for ovary development 11 . in birds , dmrt1 is sex - linked 12 , 13 on chromosome z and there is higher dosage of the gene in males ( zz ) as compared with females ( zw ) 10 , 13 - 15 . the expression of dmrt1 in turtles and alligators was found to be related to sexual differentiation and was higher in developing male gonads than in female ones as well 16 . furthermore , the dmrt1y / dmy gene , which is the homolog of dmrt1 in medaka , transposed to chromosome y and became a master gene in male differentiation 17 , 18 . however , evidence is being accumulated that some proteins in the dmrt family are involved in non - gonadal development . a null mutation for the gene dmrt1 , an ancient conserved gene common to sex - determining pathways , resulted in profound abnormalities in the development of anterior neural plate derivatives in ciona 19 . both dmrt2a and dmrt2b are expressed in presomitic mesoderm and developing somites and contribute to somitogenesis and the creation of left - right asymmetry in the lateral - plate mesoderm 20 - 23 . in chicken and mice , dmrt3 is expressed similarly in the forebrain , spinal cord , and nasal placode 24 , while dmrt3 in zebrafish is expressed in the olfactory placode and the neural tube 25 . xenopus dmrt4 is expressed in the developing olfactory system and is required for neurogenesis 26 . in addition to dmrt1 , dmrt7 expression is restricted to embryonic gonads and adult testis 9 . dmrt7 deficient mice show male infertility with spermatogenic arrest at the pachytene stage and defects in regulation of sex chromatin 28 , 29 . kawamata m , et al . reported a possible post transcriptional role of poly - adenylation in dmrt7 expression 30 . however , the transcriptional mechanisms regulating dmrt7 need to be studied further , which will contribute substantially to our understanding of the pathway of sex differentiation and spermatogenesis . here deletion and site - directed mutagenesis were used to identify regions of the promoter that are required for transcriptional activity . emsa and chip analysis was employed to determine the binding relationship between transcription factor nf - y and the dmrt7 promoter . finally , our study showed that nf - y up - regulated the expression of dmrt7 by binding to two tandem ccaat - boxes in the proximal promoter region of the gene .",
"in silico sequence analysis . transcription factor binding sites were predicted using matinspector ( www.genomatrix.de ) and tfsearch ( www.cbrc.jp/research/db/tfsearch.html ) . six deletion mutants of the mouse dmrt7 promoter were constructed using pcr cloning from mouse genomic dna and primers : forward primer , 5'tatacgcgtctagaggtcacacacaaaatcagaag3 ' for construct -948/+116 , 5'tgcacgcgtaaaggcaggctaaaaagcctgcc3 ' for construct -407/+116 , 5'gggacgcgtcagcctcgctctggctgaggt3 ' for construct -245/+116 , 5'ttgacgcgtcggagaagcgggtaggcaagaaa3 ' for construct -104/+116 , 5'cggacgcgtattgcaaaccctattggctgcgc3 ' for construct -60/+116 , 5'ctcacgcgtccttgtgtgaaggagcgagcgg3 ' for construct + 1/+116 , and a common reverse primer , 5'cacaagcttcacagcctcgagccgaatcacag3 ' . pcr products were double - digested with mlui and hindiii and cloned into the mlui - hindiii site of the pgl3-basic vector ( promega , madison , wi ) . site - directed mutagenesis for two ccaat boxes was performed using the following primers as follows : mut1 for ccaat box1 mutant : 5'tgcaaaccctctgatctgcgcggcgccg3 ' and 5'cggcgccgcgcagatcagagggtttgca3 ' ; mut2 for ccaat box2 mutant , 5'gtgcttggagctcctgattccttgtgtg3 ' and 5'cacacaaggaatcaggagctccaagcac3 ' ; mut1/2 for both ccaat box 1 and 2 mutants using mut1 as a template : 5'gtgcttggagctcctgattccttgtgtg3 ' and 5'cacacaaggaatcaggagctccaagcac3 ' . all constructs were sequenced . for the construction of expression plasmids , the full - length cdnas of mouse wild - type nf - ya , nf - yb and nf - yc were pcr - amplified from mouse testis cdnas and cloned into ecori site of the pcx - egfp vector by replacing the egfp fragment to generate expression plasmids ( pcx - nfya , pcx - nfyb and pcx - nfyc ) using primers : , 5cgtgaattcgccatggagcagtata3 and 5ctcgaattcttaggaaactcggatga3 for nf - ya ; 5atagaattcatcatgacaatggacgg3 and 5 tccgaattctcatgaaaactgaatttg3 for nf - yb ; 5gccgaattcaaaatgtccacagaag3 and 5ctcgaattctcagtctccagtcacct3 for nf - yc . the mouse dominant negative plasmid for nf - ya ( nf - yam29 ) was a generous gift from dr . gc-1 ( a cell line from type b spermatogonia of mouse and show characteristics of a stage between type b spermatogonia and primary spermatocytes ) and cos 7 cells ( a cell line was obtained by immortalizing a cv-1 cell line derived from kidney cells of the african green monkey ) were maintained in high glucose dulbeccos modified eagles medium supplemented with 10% fetal bovine serum , plated in 48-well plates and transfected using lipofectamine2000 ( invitrogen , carlsbad , ca , usa ) . the cells were transfected with 0.4 g of each deletion construct ( -948/+116 , -407/+116 , -245/+116 , -104/+116 , -60/+116 , or + 1/+116 ) along with 10 ng / well prt - tk ( an internal control ) . for luciferase assays , 0.2 g of construct -60/+116 or mutated constructs , and 0.2 g nf - y expression vectors ( nf - ya , nf - yb and nf - yc ) or the dominant negative nf - y plasmid ( nf - yam29 ) were co - transfected into the cells . empty vector pgl3-basic or pcx ( pcx - egfp without the egfp coding sequence between two ecori sites ) was added to equalize the final dna content in each well . luciferase activity was measured 24 hours after transfection using the dual - luciferase reporter assay system ( promega , madison , wi , usa ) and a modulus single tube multimode reader ( turner biosystems , sunnyvale , ca , usa ) following the manufacturer 's protocol . oligonucleotides corresponding to the ccaat box1 and box2 of the dmrt7 promoter were synthesized and annealed into double strands . their sequences are as follows : 5tgcaaaccctattggctgcgcggcgccg3 and 5cggcgccgcgcagccaatagggtttgca3 for oligo1 ; 5tgcaaaccctctgatctgcgcggcgccg3 and 5cggcgccgcgcagatcagagggtttgca3 for oligo1-ccaat mut ; 5gtgcttggagctcattggtccttgtgtg3 and , 5cacacaaggaccaatgagctccaagcac3 for oligo2 ; 5gtgcttggagctcctgattccttgtgtg3 and 5cacacaaggaatcaggagctccaagcac3 for oligo2-ccaat mut . radiolabeled probes were generated by incubation of 250 ng annealed oligonucleotides with 20 ci [ p ] datp in the presence of t4 polynucleotide kinase ( promega , madison , wi , usa ) for 1 h at 37c , and were subsequently separated from free nucleotides for purification using a g-50 column ( amersham biosciences , uppsala , sweden ) . mouse testis nuclear extract used for electrophoretic mobility shift assays was prepared as described previously 31 . then incubated at room temperature for 30 min with a 100,000 dpm radiolabeled probe and 1 g poly ( di - dc ) in a buffer of 10 mmol / l tris - hcl , ph 7.5 , 50 mmol / l nacl , 1 mmol / l dithiothreitol , 1 mmol / l edta , and 5% glycerol . for supershift experiments , binding reactions were subsequently incubated with anti - nf - ya ( abcam inc . , cambridge , ca , usa ) for 30 min at room temperature . for competition experiments , the unlabeled competitor oligos ( in 50-fold molar excess ) samples were resolved in 5% polyacrylamide gels in 0.5% tbe running buffer at 10 v / cm for 2 h. the dried gel was exposed to a phosphorimager cassette and scanned with typhoon 9200 instrument ( ge - healthcare , amersham bioscience , uppsala , sweden ) . ( chip ) and quantitative real - time pcr . samples of mouse testis and liver were chopped into small pieces with a scalpel in cold phosphate - buffered saline ( pbs ) and cross - linked in 1% formaldehyde - pbs for 15 min with constant shaking . the tissues were rinsed in cold pbs and homogenized with a dounce homogenizer in 1 ml cold cell lysis buffer ( 10 mm tris - cl , ph 8.0 , 10 mm nacl , 3 mm mgcl2 , 0.5% np-40 ) supplemented with protease inhibitors ( roche diagnostics ltd , mannheim , germany ) . the cells were incubated at 4c for 5 min to allow the release of the nuclei . after lysis in the buffer ( 1% sodium dodecyl sulfate [ sds ] , 5 mm edta , 50 mm tris - cl , ph 8.1 ) , sonication was performed with a sonic dismembrator model 100 sonicator ( fisher scientific , inc . , the supernatant chromatin after centrifugation was immunoprecipitated with no antibody ( beads only ) , preimmuno igg ( igg ) and anti - nf - ya ( abcam inc . , cambridge , ca , usa ) , together with protein g plus - agarose ( santa cruz , biotech , ca , usa ) respectively . dna isolated from the immunoprecipitated complex was amplified by pcr with primers flanking both ccaat boxes . the primer sequences are : 5agaagcgggtaggcaaga3 and 5cagtggcgaagaggaacg3. the amplified pcr fragments were analyzed on a 2% agarose gel . a region of 257 bp around 10 kb downstream of the first exon of the dmrt7 was amplified as a control with primers : 5aataagtttccaaccgtgaagt3 and 5tatccaaggagatgggtaagtg3. the pcr products were cloned into t - easy vector ( promega , madison , wi , usa ) and sequenced for confirmation . precipitated dna in the chip assay was amplified by quantitative real - time pcr using the multichannel rotorgene 3000 ( corbett research , australia ) . the cycling conditions were : 5 min at 94c ; 45 cycles of 94c , 20 s ; 60c , 20 s and 72c , 15 s in a 25 l reaction mix containing sybr green i. the p1 region primers were 5agaagcgggtaggcaaga3 ; and 5cagtggcgaagaggaacg3. the p2 region primers were 5aataagtttccaaccgtgaagt3 ; and 5tatccaaggagatgggtaagtg3. each sample was performed in triplicate at least . data were analyzed by the software rotor - gene version 4.6 and then plotted in microsoft excel . aliquots of tissue extracts ( 50 mg ) were separated by electrophoresis in 10% sds - polyacrylamide gel ( page ) and transferred onto a 0.45 m membrane ( hybond - p ; amersham pharmacia biotech ) . , san diego , ca ) and -actin was used as an internal control ( 1:1000 , santa cruz biotech , ca , usa ) . membranes were incubated with primary antibody for 1 h at room temperature , washed in tbst and probed with hrp conjugated secondary antibody ( 1:10000 , santa cruz biotech , ca , usa ) . after several washes in tbst , detection of the secondary antibody was performed using the supersignal chemiluminescent substrate system ( pierce , rockford , usa ) .",
"aliquots of tissue extracts ( 50 mg ) were separated by electrophoresis in 10% sds - polyacrylamide gel ( page ) and transferred onto a 0.45 m membrane ( hybond - p ; amersham pharmacia biotech ) . dmrt7 was detected by dmrt7 antibody ( 1:500 , genway biotech , inc . , san diego , ca ) and -actin was used as an internal control ( 1:1000 , santa cruz biotech , ca , usa ) . membranes were incubated with primary antibody for 1 h at room temperature , washed in tbst and probed with hrp conjugated secondary antibody ( 1:10000 , santa cruz biotech , ca , usa ) . after several washes in tbst , detection of the secondary antibody was performed using the supersignal chemiluminescent substrate system ( pierce , rockford , usa ) .",
"to characterize functional elements in the dmrt7 promoter , the sequence from -407 to + 116 of dmrt7 was run in matinspector and tfsearch to find putative transcriptional elements . several possible transcription - factor binding sites , which included ap-1 , sp1 , gata1 , e2f and ccaat box , were identified ( figure 1a ) . blast alignment of the promoter region of mouse , rat , and human dmrt7 genes revealed two highly conserved ccaat boxes : the ccaat box1 ( -48/-44 ) and the ccaat box2 ( -7/-3 ) ( figure 1b ) . to determine the functional elements required for promoter activity , six 5'-deletion mutants ( -948/+116 , -407/+116 , -245/+116 , -104/+116 , -60/+116 and + 1/+116 ) were constructed and analyzed for promoter activity using luciferase reporter in gc-1 and cos 7 cells ( figure 1c ) . the deletion of the region between -245 and -104 appears to increase promoter activity in gc-1 cells , whereas the opposite result was obtained in cos 7 cells . to explain this discrepancy , we speculate that there could be other gc-1 specific transcription factors that could bind to this region and play a negative role in dmrt7 promoter activity . deletion of the -60 to + 1 sequence markedly decreased the activity , indicating the region of the -60 to + 1 is essential for promoter function ( figure 1c ) . two highly conserved ccaat boxes were located in this region . to confirm the role of both ccaat boxes , the mutation of ccaat box1 in -60/+116 construct resulted in a decrease of approx.60 - 70% compared to the promoter activity of -60/+116 construct , the ccaat box2 mutation in -60/+116 construct approx.70 - 80% . nearly no activity was observed in the double mutations of both boxes in -60/+116 construct . however , the double mutations of both ccaat boxes in the -948/+116 region resulted in only a decrease of approx.40 - 50% compared to the promoter activity of -60/+116 construct . although there may be other important cis - regulatory sites upstream of the -60/+116 , which may compensate the loss of these ccaat boxes ( figure 1d ) , the region of the -60/+116 including two highly conserved ccaat boxes is important for the promoter function . these results showed that both ccaat box1 and ccaat box2 are important for transcriptional activation of the mouse dmrt7 gene . transcription factor prediction using the matinspector and tfsearch showed that potential transcription factor nf - y may bind to the ccaat boxes . to determine if nf - y binds to the ccaat boxes , electrophoretic mobility shift assays were carried out using nuclear extracts prepared from mouse testis and double stranded oligonucleotides . incubation of probe1 spanning from -58 to -31 ( containing ccaat box1 ) with the extract gave rise to the formation of a dna - protein complex ( figure 2 lane1 ) , which could be competed by the addition of an excessive amount of unlabelled oligo1 dna ( figure 2 lane5 ) , but not by the oligo1 dna with mutated ccaat box ( figure 2 lane7 ) . furthermore , addition of nfya antibody to the binding reaction caused the disappearance of the specific dna / protein complex and the appearance of the super - shift band ( figure 2 lane3 ) . these results indicate that the ccaat box1 within the promoter region is capable of binding with transcription factor nf - ya in vitro . a similar result was also observed in incubation of probe2 spanning from -20 to + 8 ( containing ccaat box2 ) with mouse testis nuclear extract ( figure 2 ) . these results indicate that transcription factor nf - ya can bind to dmrt7 promoter in vitro . to further determine whether nf - y binds to the mouse dmrt7 promoter in vivo , we performed chromatin immunoprecipitation analysis . because dmrt7 protein was only detected in testis ( figure 3a ) , we chose the testis for chip analysis . as shown in figure 3b , a 160 bp of dna fragment was amplified from the precipitate by nf - ya antibody from testis , but not from control tissue liver or negative control immunoprecipitations using no antibody ( beads only ) or normal rabbit igg . the amplified fragment was confirmed by sequencing . to rule out the possibility of non - specific binding of the nf - ya antibody , an additional pcr amplification of a distinct genomic region was performed on all of the precipitated chromatin dnas , which showed no amplification out of the nf - ya - binding region ( figure 3b , d ) . a quantitative chip pcr was also performed to quantify the binding extent of nf - ya on the dmrt7 promoter ( figure 3c ) . these results indicate that nf - y specifically binds to the dmrt7 promoter in vivo . to investigate the role of transcription factor nf - y in the activation of the dmrt7 promoter , both gc-1 and cos 7 cells were co - transfected with luciferase reporter driving by wild - type dmrt7 promoter ( -60/+116 construct ) or its mutants for ccaat sites , and nf - ya / b / c expression plasmids . the luciferase activity increased obviously when a wild - type promoter construct ( -60/+116 ) was co - transfected with nf - ya / b / c ( figure 4a ) . however , the luciferase activity was not upregulated obviously when co - transfected with mutants for ccaat box1 or box2 and was not upregulated absolutely when co - transfected with double mutants for ccaat box1 and box2 ( figure 4a ) . this result indicated tandem arrangement of the ccaat box1 and box2 may ensure maximum promoter activity of the dmrt7 . in addition , replacing the nf - ya / b / c expression plasmid with the dominant - negative construct ( nf - yam29 ) resulted in a marked reduction of luciferase activity in a dosage - dependent manner ( figure 4b ) . nf - yam29 has three amino acid substitutions at the c - terminal region of the nf - ya , which impairs its dna binding and acts as a dominant - negative mutant by sequestering the nf - yb / yc subunits into a defective complex 32 .",
"to characterize functional elements in the dmrt7 promoter , the sequence from -407 to + 116 of dmrt7 was run in matinspector and tfsearch to find putative transcriptional elements . several possible transcription - factor binding sites , which included ap-1 , sp1 , gata1 , e2f and ccaat box , were identified ( figure 1a ) . blast alignment of the promoter region of mouse , rat , and human dmrt7 genes revealed two highly conserved ccaat boxes : the ccaat box1 ( -48/-44 ) and the ccaat box2 ( -7/-3 ) ( figure 1b ) . to determine the functional elements required for promoter activity , six 5'-deletion mutants ( -948/+116 , -407/+116 , -245/+116 , -104/+116 , -60/+116 and + 1/+116 ) were constructed and analyzed for promoter activity using luciferase reporter in gc-1 and cos 7 cells ( figure 1c ) . the deletion of the region between -245 and -104 appears to increase promoter activity in gc-1 cells , whereas the opposite result was obtained in cos 7 cells . to explain this discrepancy , we speculate that there could be other gc-1 specific transcription factors that could bind to this region and play a negative role in dmrt7 promoter activity . deletion of the -60 to + 1 sequence markedly decreased the activity , indicating the region of the -60 to + 1 is essential for promoter function ( figure 1c ) . two highly conserved ccaat boxes were located in this region . to confirm the role of both ccaat boxes , the mutation of ccaat box1 in -60/+116 construct resulted in a decrease of approx.60 - 70% compared to the promoter activity of -60/+116 construct , the ccaat box2 mutation in -60/+116 construct approx.70 - 80% . nearly no activity was observed in the double mutations of both boxes in -60/+116 construct . however , the double mutations of both ccaat boxes in the -948/+116 region resulted in only a decrease of approx.40 - 50% compared to the promoter activity of -60/+116 construct . although there may be other important cis - regulatory sites upstream of the -60/+116 , which may compensate the loss of these ccaat boxes ( figure 1d ) , the region of the -60/+116 including two highly conserved ccaat boxes is important for the promoter function . these results showed that both ccaat box1 and ccaat box2 are important for transcriptional activation of the mouse dmrt7 gene .",
"transcription factor prediction using the matinspector and tfsearch showed that potential transcription factor nf - y may bind to the ccaat boxes . to determine if nf - y binds to the ccaat boxes , electrophoretic mobility shift assays were carried out using nuclear extracts prepared from mouse testis and double stranded oligonucleotides . incubation of probe1 spanning from -58 to -31 ( containing ccaat box1 ) with the extract gave rise to the formation of a dna - protein complex ( figure 2 lane1 ) , which could be competed by the addition of an excessive amount of unlabelled oligo1 dna ( figure 2 lane5 ) , but not by the oligo1 dna with mutated ccaat box ( figure 2 lane7 ) . furthermore , addition of nfya antibody to the binding reaction caused the disappearance of the specific dna / protein complex and the appearance of the super - shift band ( figure 2 lane3 ) . these results indicate that the ccaat box1 within the promoter region is capable of binding with transcription factor nf - ya in vitro . a similar result was also observed in incubation of probe2 spanning from -20 to + 8 ( containing ccaat box2 ) with mouse testis nuclear extract ( figure 2 ) . these results indicate that transcription factor nf - ya can bind to dmrt7 promoter in vitro . to further determine whether nf - y binds to the mouse dmrt7 promoter in vivo , we performed chromatin immunoprecipitation analysis . because dmrt7 protein was only detected in testis ( figure 3a ) , we chose the testis for chip analysis . as shown in figure 3b , a 160 bp of dna fragment was amplified from the precipitate by nf - ya antibody from testis , but not from control tissue liver or negative control immunoprecipitations using no antibody ( beads only ) or normal rabbit igg . the amplified fragment was confirmed by sequencing . to rule out the possibility of non - specific binding of the nf - ya antibody , an additional pcr amplification of a distinct genomic region was performed on all of the precipitated chromatin dnas , which showed no amplification out of the nf - ya - binding region ( figure 3b , d ) . a quantitative chip pcr was also performed to quantify the binding extent of nf - ya on the dmrt7 promoter ( figure 3c ) . these results indicate that nf - y specifically binds to the dmrt7 promoter in vivo .",
"to investigate the role of transcription factor nf - y in the activation of the dmrt7 promoter , both gc-1 and cos 7 cells were co - transfected with luciferase reporter driving by wild - type dmrt7 promoter ( -60/+116 construct ) or its mutants for ccaat sites , and nf - ya / b / c expression plasmids . the luciferase activity increased obviously when a wild - type promoter construct ( -60/+116 ) was co - transfected with nf - ya / b / c ( figure 4a ) . however , the luciferase activity was not upregulated obviously when co - transfected with mutants for ccaat box1 or box2 and was not upregulated absolutely when co - transfected with double mutants for ccaat box1 and box2 ( figure 4a ) . this result indicated tandem arrangement of the ccaat box1 and box2 may ensure maximum promoter activity of the dmrt7 . in addition , replacing the nf - ya / b / c expression plasmid with the dominant - negative construct ( nf - yam29 ) resulted in a marked reduction of luciferase activity in a dosage - dependent manner ( figure 4b ) . nf - yam29 has three amino acid substitutions at the c - terminal region of the nf - ya , which impairs its dna binding and acts as a dominant - negative mutant by sequestering the nf - yb / yc subunits into a defective complex 32 .",
"dmrt7 is a member of the dm domain family of genes , which encodes proteins with a conserved dna binding dm domain . in addition to dmrt1 , some dm domain proteins such as dmrt3 , dmrt4 and dmrt7 may be involved in sexual development . dmrt7 mrna could be detected in testis and fetal ovary but not in other tissues 9 . the expression of dmrt7 protein was detected in testis 29 , but not in the fetal ovary . dmrt7 mutants were infertile with spermatogenic arrest at the pachytene stage , while the mutant females showed normal fertility 28 , 29 . possible post transcriptional role of poly - adenylation in dmrt7 expression regulation was previously proposed 30 . because transcriptional regulation of the gene dmrt7 during spermatogenesis is an important process , in this study , we have explored promoter function of the gene and found that nuclear factor - y ( nf - y ) regulates transcription of mouse dmrt7 gene through binding to two conserved ccaat boxes in its proximal promoter region . deletion analysis of the 5 ' flanking region of the mouse dmrt7 revealed crucial positive elements between -60 and + 1 , in which two evolutionarily conserved ccaat boxes ( the ccaat box1 and box2 ) were identified . the conservation of transcription factor binding sites between orthologue gene promoters may indicate their highly significant roles in maintaining transcriptional regulation of dmrt7 gene . further site - directed mutagenesis and functional analysis were performed to confirm their role in maintenance of promoter function of dmrt7 . the results suggest that binding by nf - y to these two tandem ccaat boxes is important for regulation of the basal transcription of the dmrt7 gene in the mouse testis . nf - y protein ( also known as cbf ) binds with high specificity to the ccaat sequence and is a ubiquitous heteromeric transcription factor 33 . nf - y is a complex composed of three subunits : nf - ya ( cbf - b , hap2 in yeast ) , nf - yb ( cbf - a , hap3 ) and nf - yc ( cbf - c , hap5 ) , which are all required for dna - binding 34 - 36 . both nf - yb and nf - yc have conserved histone folding motifs resembling h2b - h2a and their heterodimerization is essential for nf - ya association 33 , 37 . nf - ya is a regulatory subunit of the trimeric complex , whose levels vary in different cell types and/or growth conditions 38 . it has been suggested that nf - y can gain access to its genomic locations even in the absence of methyl histone marks and then leads the positioning of methyl histone marks typical of active chromatin independently 39 . a number of mammalian promoters have been shown to contain ccaat boxes and have been regulated by nf - y alone or together with other transcriptional factors 41 - 44 . in accordance with these results , the transcription factor nf - y may activate the mouse dmrt7 gene and play an important role in the regulation of dmrt7 expression in testis . this , therefore , suggests that nf - y regulation of dmrt7 plays a functional role in spermatogenesis . in summary , we have found two important ccaat boxes in the 5 ' flanking region of the mouse dmrt7 promoter . nf - y is a major transcriptional activator of the dmrt7 gene through binding to these two ccaat boxes . these results provide evidence of the regulatory mechanisms that control the expression in testis of the mouse dmrt7 gene and will form the basis for understanding mammalian spermatogenesis ."
] | dmrt7 , a member of the dmrt family of genes , is required for spermatogenesis . however , promoter functions of the gene dmrt7 remain unknown . we have cloned and characterized the proximal promoter region of the mouse dmrt7 gene . functional analysis of the 5 ' flanking region by sequential deletion mutations revealed crucial positive elements between -60 and + 1 , in which two highly conserved and tandem ccaat boxes : the ccaat box1 ( -48/-44 ) and the ccaat box2 ( -7/-3 ) are located . site - directed mutagenesis studies demonstrated that both ccaat boxes are indispensable to the promoter activity . electrophoretic mobility shift assays ( emsas ) and gel - supershift assays indicated that transcription factor nf - y binds to the promoter . chromatin immunoprecipitation ( chip ) analysis demonstrated that nf - y interacts in vivo with the promoter of the dmrt7 gene in testis . co - transfection and reporter analysis showed that over - expression of nf - ys increased transcription of the dmrt7-luc gene whereas expression of a dominant - negative nf - ya decreased the transcription . this suggests that nf - y can activate the dmrt7 promoter . these results provide evidence of a transcription regulatory mechanism that controls dmrt7 gene expression in mouse testis . |
[
"primary retroperitoneal germ cell tumors account for approximately 30% of extragonadal germ cell tumors ( egcts ) and for about 10% of all primary malignant retroperitoneal tumors . many studies have demonstrated an association between diffuse bilateral testicular microlithiasis ( tm ) and gonadal germ cell tumors and egcts [ 2 , 3 ] . nevertheless , it is still uncertain whether ultrasound surveillance is really necessary in patients with tm in the absence of other risk factors such as previous testicular cancer , a history of cryptorchidism or testicular atrophy . we report the cases of a 33- and a 39-year - old man presenting with a retroperitoneal extragonadal tumor and bilateral tm without a focal testicular mass .",
"a 39-year - old man with a 6-month history of lumbar pain came to our hospital to perform an mri examination in order to rule out a lumbosacral hernia . the mri images showed no slipped disks , but we unfortunately detected a voluminous retroperitoneal solid mass . therefore , we decided to perform a total body ct to better characterize the mass and its relationship to adjacent structures . ct images showed a large heterogeneous retroperitoneal mass with curvilinear calcifications and a marked inhomogeneous enhancement after intravenous contrast medium injection due to the presence of necrotic - colliquative areas . this lesion displaced the left renal vein cranially , the abdominal aorta anteriorly and towards the right , and infiltrated the inferior vena cava , the left renal vein , and the left psoas muscle ( fig . 1 ) . the patient 's -fetoprotein , lactate dehydrogenase , and beta subunit of human chorionic gonadotropin levels were 2.680 iu / l ( normal , 90180 iu / l ) , 279 ng / ml ( normal , 07.5 ng / ml ) , and 4 miu / ml ( normal , < 5 miu / ml ) . we performed a scrotal ultrasonography ( us ) to rule out that this mass was a retroperitoneal metastasis of a primary testicular tumor : us showed bilateral classic tm ( defined as more than 5 calcifications scattered throughout the testicle ) , without a focal lesion ( fig . 2 ) . comparing the current ultrasound images with previous us testicular images ( the patient underwent a scrotal us when he was 25 years old because of a testicular trauma ) the patient underwent a ct - guided biopsy and at histology , an immature teratoma was diagnosed .",
"a 33-year - old man came to our emergency department complaining of abdominal pain , vomiting , weight loss and mild jaundice . the patient 's serum -fetoprotein , lactate dehydrogenase , and beta subunit of human chorionic gonadotropin levels were 2.470 iu / l ( normal , 90180 iu / l ) , 232 ng / ml ( normal , 07.5 ng / ml ) and 3 miu / ml ( normal , < 5 miu / ml ) . besides , the serum markers of cholestasis were high : conjugated bilirubin was 2 mg/100 ml ( normal , < 0.2 mg/100 ml ) , -glutamyl transpeptidase 70 iu / l ( normal , 130 iu / l ) and alkaline phosphates 300 iu / l ( normal , < 170 iu / l ) . ct and mri examinations showed a giant retroperitoneal mass made up by multiple necrotic - colliquative fluid areas with a multilocular aspect , which dislocated the inferior vena cava anteriorly and with possible infiltrating signs ; it also compressed the portal vein and the common bile duct with moderate dilatation of the intrahepatic ducts ( fig . 3 ) . the patient was sent to do an us to rule out the presence of a primary testicular tumor , which revealed bilateral tm without a focal hypoechoic lesion ; the microcalcification pattern was quite similar to that of a past ultrasound exam that was performed when the patient was 22 years old because of a suspected varicocele . the patient underwent a ct - guided biopsy and at histology , a yolk sac tumor was diagnosed .",
"an egct is by definition a germ cell neoplasm , displaying one of the histologic types associated with gonadal origin , but located outside the gonads . the most widely accepted theory suggests that egcts arise from primordial germ cells misplaced during their migration to the gonads . it remains uncertain , however , whether such tumors develop primarily at extragonadal sites or represent metastases of a primary testicular tumor . regarding the latter case , egct may have developed from burned out testicular tumors or they may just be metastatic lesions from primary testicular tumors that were not detected at the time of the diagnosis . a burned out gonadal primary tumor is a regressed tumor which is seen as an echogenic scar or a hypoechoic tissue on testicular ultrasound and which clinically presents with metastasis . histologically , egcts comprise seminomas ( 3040% ) and nonseminomatous tumors ( 6070% ) in men and dysgerminomas and nondysgerminomas in women . nonseminomatous germ cell tumors ( nsgcts ) include teratoma , embryonal carcinoma , endodermal sinus tumor ( yolk sac tumor ) , choriocarcinoma , and tumors with mixed histology . -fetoprotein is produced by endodermal sinus tumors , either alone or in association with other types of germ cell tumors . these are useful serum markers in the diagnosis , prognosis , and follow - up of patients with germ cell tumors . the majority of the egcts occur in men , except benign mature teratoma , which occurs with equal frequency in men and women . egcts are usually seen in children or young adults , and typically arise in midline locations . in adults , the most common sites of primary egcts are , in descending order , the mediastinum , the retroperitoneum and the cranium . in children , primary retroperitoneal germ cell tumors account for about 10% of all primary malignant retroperitoneal tumors and about 3040% of egcts . egcts are often seen in or near the midline , especially between the t6 and s2 vertebrae . patients may present with metastases : brain , liver , lungs and bones are the common sites of metastases . seminoma is rare in the retroperitoneum and is seen as a large , lobulated , well - defined homogeneous solid mass with fibrous septa and ring - like or speckled calcifications . nsgcts are depicted as heterogeneous tumors with areas of hemorrhage , necrosis , and heterogeneous enhancement . flow voids as well as invasion of adjacent structures that are due to hypervascularity may be seen . primary testicular malignancy and egcts are often associated with tm [ 2 , 8 ] . this is an uncommon pathologic condition that is detected by scrotal us and is defined as the presence within the substance of the testis of 5 or more speckled bright foci , 12 mm in diameter , with little or no acoustic shadowing ; the microcalcifications usually affect both testes , but may be unilateral and can be focal or diffuse [ 3 , 4 ] .",
"j. richenberg and n. brejt affirm that ultrasound surveillance is unlikely to benefit patients with tm in the absence of other risk factors ; on the contrary , in the presence of additional risk factors ( previous testicular cancer , a history of maldescent or testicular atrophy ) , patients are likely to be under clinical and ultrasound surveillance . nevertheless , it is still controversial whether performing sonographic surveillance is better than regular testicular self - examination in adult patients with classic tm and the absence of any known testicular tumor . in this setting , on the basis of our direct experience , we highlight the importance of annual ultrasonographic surveillance of the testis and retroperitoneal space in patients with occasionally detected tm . besides , taking into account the increased risk of metachronous testicular malignancy in patients with previous egct [ 6 , 9 ] , we recommend yearly testicular ultrasound follow - up after surgical removal of retroperitoneal gonadic tumor .",
""
] | many studies have demonstrated an association between diffuse bilateral testicular microlithiasis ( tm ) and gonadal and extragonadal germ cell tumors . nevertheless , it is still uncertain whether ultrasound surveillance is really necessary in patients with tm in the absence of other risk factors such as previous testicular cancer , a history of cryptorchidism or testicular atrophy . we report the cases of a 33- and a 39-year - old man presenting with a retroperitoneal extragonadal tumor . the first patient underwent an mri examination in order to rule out a lumbosacral hernia : mri images showed no slipped disks but a voluminous retroperitoneal solid mass . the histological analysis revealed an immature teratoma . the second patient came to the emergency department complaining of abdominal pain , vomiting , weight loss and mild jaundice : ultrasound examination showed a large , ill - defined heterogeneous abdominal mass , confirmed by ct and mri examination . the histology diagnosed a yolk sac tumor . in both patients , the testicular sonography was performed to rule out a focal lesion , but it displayed bilateral tm without a focal testicular mass . based on our direct experience , we highlight the importance of annual ultrasonographic surveillance of the testis and the retroperitoneal space in patients with occasionally detected tm . |
[
"central nervous system ( cns ) lymphoma can present as either secondary , representing 1 to 7% of lymphomas , or primary , representing 0.2 to 2% of lymphomas.1 secondary cns lymphoma ( scnsl)is currently defined as lymphoma not originating from within the cns , and may be an isolated recurrence within the cns or may be part of the systemic progressive disease.2 additionally , scnsl may be further categorized as leptomeningeal , parenchymal , or as a combination of the two.3 in particular , an isolated relapse within the cns is rare , with retrospective cohorts typically numbering between 10 and 30 patients.4 \n 5 \n 6 \n 7 furthermore , due to a lack of clinical data on isolated scnsl recurrence , features of the disease , a standard treatment regiment , and overall prognosis have yet to be elucidated.4 \n 8 \n once the diagnosis has been established , treatment options for cns lymphoma can be broadly divided into chemotherapy , radiation , and surgery . surgical resection of cns lymphoma is generally a last resort and only offered in cases when the lesion is causing extreme mass effect and herniation syndromes . unfortunately , the standard chemotherapy regimens used in the treatment of systemic lymphomas have shown only little effect in prophylaxis or direct treatment of cns lymphomas.9 these drugs ( anthracyclines , vinca alkaloids , and some alkylating agents ) have poor blood brain penetration , and their toxicity profiles limit the dose at which they can be delivered to overcome this . methotrexate and cytarabine , in contrast , have poor blood brain barrier penetration but can be delivered at sufficient concentrations to overcome this and provide adequate concentration to the cns.10 initial studies showed improved overall survival from treatment with high - dose methotrexate and radiation at time of diagnosis , with response rates of up to 80 to 90% and 5-year median survival times in primary cns lymphoma.11 subsequent studies comparing high - dose methotrexate alone and combination high - dose methotrexate and radiation failed to prove robust survival benefit with combination therapy , especially in patients > 60 years of age , a growing segment of the disease.11 \n 12 \n 13 \n in addition , responses to radiation treatment have been found to be short lived and have failed to increase overall survival.14 the role of radiation therapy for cns lymphoma has shifted from initial treatment to salvage therapy over the past several decades.9 \n 15 treatment paradigms established for primary cns lymphoma have been used in the treatment of scnsl ; however , the failure rate remains high , with overall survival typically on the order of 2 months.16 \n more recently , more aggressive regimens have been suggested . these include surgical resection that has been shown to provide survival benefit in a single trial within a subset of patients who had a single cns lesion in a noneloquent , surgically accessible region.17 although there is no standard dosing for methotrexate , cns concentration and response rates have been shown to be related to infusion rate.18 more specifically , methotrexate area under the curve has been shown to be an independent predictor of clinical outcome.19 personalized dosing based on age , gender , and creatinine clearance has been proposed.10 blood brain barrier disruption methods in combination with chemotherapeutic agents that have been used successfully in systemic lymphomas has shown promise in early pilot studies and are currently being tested in larger centers.20 \n 21 similarly , intrathecal administration of methotrexate , cytarabine , or rituximab has shown some early promise , but further data are still required . administration of intrathecal chemotherapy is generally reserved for patients with leptomeningeal disease and positivity on cerebrospinal fluid ( csf ) testing , although large retrospective series have been equivocal on this topic.22 \n 23 \n",
"once the diagnosis has been established , treatment options for cns lymphoma can be broadly divided into chemotherapy , radiation , and surgery . surgical resection of cns lymphoma is generally a last resort and only offered in cases when the lesion is causing extreme mass effect and herniation syndromes . unfortunately , the standard chemotherapy regimens used in the treatment of systemic lymphomas have shown only little effect in prophylaxis or direct treatment of cns lymphomas.9 these drugs ( anthracyclines , vinca alkaloids , and some alkylating agents ) have poor blood brain penetration , and their toxicity profiles limit the dose at which they can be delivered to overcome this . methotrexate and cytarabine , in contrast , have poor blood brain barrier penetration but can be delivered at sufficient concentrations to overcome this and provide adequate concentration to the cns.10 initial studies showed improved overall survival from treatment with high - dose methotrexate and radiation at time of diagnosis , with response rates of up to 80 to 90% and 5-year median survival times in primary cns lymphoma.11 subsequent studies comparing high - dose methotrexate alone and combination high - dose methotrexate and radiation failed to prove robust survival benefit with combination therapy , especially in patients > 60 years of age , a growing segment of the disease.11 \n 12 \n 13 \n in addition , responses to radiation treatment have been found to be short lived and have failed to increase overall survival.14 the role of radiation therapy for cns lymphoma has shifted from initial treatment to salvage therapy over the past several decades.9 \n 15 treatment paradigms established for primary cns lymphoma have been used in the treatment of scnsl ; however , the failure rate remains high , with overall survival typically on the order of 2 months.16 \n more recently , more aggressive regimens have been suggested . these include surgical resection that has been shown to provide survival benefit in a single trial within a subset of patients who had a single cns lesion in a noneloquent , surgically accessible region.17 although there is no standard dosing for methotrexate , cns concentration and response rates have been shown to be related to infusion rate.18 more specifically , methotrexate area under the curve has been shown to be an independent predictor of clinical outcome.19 personalized dosing based on age , gender , and creatinine clearance has been proposed.10 blood brain barrier disruption methods in combination with chemotherapeutic agents that have been used successfully in systemic lymphomas has shown promise in early pilot studies and are currently being tested in larger centers.20 \n 21 similarly , intrathecal administration of methotrexate , cytarabine , or rituximab has shown some early promise , but further data are still required . administration of intrathecal chemotherapy is generally reserved for patients with leptomeningeal disease and positivity on cerebrospinal fluid ( csf ) testing , although large retrospective series have been equivocal on this topic.22 \n 23 \n",
"a 36-year - old man presented to his primary care physician with complaint of a soft nontender mass on the left side of his neck . the patient reported that he noticed this mass enlarging for the past year but had attributed it to an infectious process . an initial chest x - ray identified a left supraclavicular mass compressing the trachea and causing a rightward deviation . additionally , a computed tomography ( ct ) scan of the chest and neck , with and without contrast , was performed for follow - up , with evidence of diffuse lymphadenopathy ( fig . 1a ) , specifically , the supraclavicular , paratracheal , prevascular , lesser sac , left axilla , parasternal , and mesenteric chain nodes . a head ct scan with contrast performed at the same time was negative for any intracranial involvement . ( a ) pretreatment axial chest computed tomography ( ct ) with contrast revealing a prevascular lymph node mass ( solid arrow ) during the initial diagnosis of b - cell lymphoma . ( b ) postchemotherapy axial chest ct with contrast illustrating near - complete resolution of the previously seen prevascular lymph node mass ( dotted arrow ) . the patient was subsequently scheduled for a ct - guided biopsy of the supraclavicular lesion . the results of the biopsy were consistent with b cell lymphoma . following the biopsy confirmation , the patient completed six cycles of outpatient rituximab , cyclophosphamide , hydroxydaunorubicin , oncovin , and prednisone therapy . at his last outpatient oncology visit , the patient did not experience any cognitive symptoms , and he had no extranodal involvement at diagnosis or follow - up . the patient 's lactate dehydrogenase level was not measured as a part of his follow - up . this would place the patient at a low risk for developing a secondary cns lymphoma relapse.8 \n 24 \n approximately 7 months posttreatment , the patient was hospitalized at an outside medical center following a 1-week period of worsening mental status . on admission , the patient was found to have elevated serum sodium levels in the 160s , and further work - up revealed a suprasellar mass on head ct ( fig . upon arrival to our institution , the patient was found to have diabetes insipidus . with a known history of systemic lymphoma , ct scan of the chest , abdomen , and pelvis displayed marked interval improvement in the degree of lymphadenopathy with near - complete resolution of the previous mediastinal lymphadenopathy ( fig . a brain magnetic resonance imaging ( mri ) revealed a homogeneously enhancing suprasellar mass with surrounding edema ( fig . ( a ) preoperative axial head computed tomography ( ct ) without contrast from an outside institution revealing a 2.6-cm suprasellar mass ( solid arrow ) . ( b ) postoperative axial head ct without contrast illustrating the results of the right frontal orbital craniotomy for debulking and biopsy ( dotted arrow ) . \n preoperative ( a ) axial and ( b ) coronal t1-weighted cranial magnetic resonance imaging with contrast , revealing a 3-cm suprasellar mass with surrounding edema ( solid arrows ) . the patient was taken for a right fronto - orbital craniotomy and translaminar terminalis approach for biopsy of the lesion ( fig . histologically , the samples showed highly cellular clumps of lymphocytes on hematoxylin and eosin staining ( fig . c ) , and immunohistochemical studies were positive for bcl2 , bcl6 , cd10 , cd20 , and cd79a ( fig . 5a 5f ) highlighted the proliferation of 5 to 10% of the neoplastic cells present in the biopsy . the patient was placed on high - dose methotrexate , and his mental status improved . unfortunately , the patient 's condition progressed and he succumbed to his illness . \n histopathology of the biopsied suprasellar mass under ( a ) low magnification ( 50 ) and ( b , c ) high magnification ( 200 ) revealing highly cellular clumps of lymphocytes consistent with diffuse large b - cell lymphoma ( hematoxylin and eosin ) . \n immunohistochemistry of the biopsied suprasellar mass stained positive for ( a ) bcl2 , ( b ) bcl6 , ( c ) cd10 , ( d ) cd20 , ( e ) cd79a , and ( f ) ki-67 , all consistent with diffuse large b - cell lymphoma ( 200 ) .",
"the incidence of scnsl in the general population ranges from 4 to 23%.2 \n 25 \n 26 \n 27 the factors that most significantly influence the incidence rate of scnsl include the variant of primary lymphoma , involvement of more than one extranodal site , a serum lactate dehydrogenase level greater than three times the normal limit , an advanced stage of the systemic disease , and a high international prognostic index.2 \n 3 \n 28 \n 29 other studies have found that no one indicator of scnsl is reliable on its own , but that the combination of several factors can help elucidate the risk of developing scnsl and the need for possible prophylaxis . in particular , initial involvement of the breast , testis , and bone marrow with primary disease are heavily associated with an increased risk of developing scnsl.30 populations with the highest risk are those with immune deficiencies , either innate or acquired . in the 1980s , a steep increase in the incidence of scnsl paralleled the increase in incidence of human immunodeficiency virus and autoimmune deficiency syndrome . however , with the advent of highly active antiretroviral therapy in the mid-1990s , the incidence has decreased and remained fairly steady since that time . the age of diagnosis of both primary and secondary cns lymphoma has been steadily increasing , focusing more studies on treatment of an elderly population.31 \n 32 \n 33 \n 34 \n 35 \n as previously mentioned , the histologic grade of the primary lymphoma differentially influences the risk of developing scnsl . depending on whether the primary lymphoma is classified as indolent , aggressive , or highly aggressive , there is a 3% , 9% , and 27% risk , respectively , of developing scnsl.36 with specific regard to diffuse large b - cell lymphoma ( dlbcl ) , the incidence has been reported as 5% , but interestingly , when the primary lymphoma is of the mediastinal large b - cell variant , the risk of scnsl climbs to 19% , as in this case . although most scnls present with leptomeningeal disease , dlbcl most often presents with parenchymal disease.3 indolent lymphomas usually carry a low risk of recurrence , but when cns disease has been found , it is usually after the histologic transformation to a more aggressive variant.27 \n 37 \n 38 furthermore , presence of at least two of these : bone marrow , skin involvement , and b symptoms , increases the risk of scnl in indolent primary lymphomas to 7%.8 \n 24 \n 28 \n the characteristic clinical presentation of scnsl is a new - onset headache ( 50% ) , palsies of cranial nerves iii , iv , vi , and vii , changes in mental status ( 29% ) , and even coma and seizures ( 2329%).39 it typically presents within 6 months of diagnosis of the primary lymphoma , which is typically confirmed with csf studies and imaging.25 \n 26 flow cytometry , however , is more sensitive than csf cytology , and polymerase chain reaction studies can be used for further confirmation.37 \n 40 mri is the current gold standard for localizing the recurrence because it has superior sensitivity compared with ct . parenchymal lesions usually present with homogeneously enhancing superficial or periventricular lesions , but ring enhancement patterns can also be seen , especially in the population with acquired immunodeficiency syndrome . scnsl is characterized as an isolated recurrence 50% of the time ; although most of these patients go on to develop systemic recurrences within several months . isolated cns recurrence has a worse prognosis than cns disease at the time of diagnosis , suggesting an alternative disease mechanism.41 survival is slightly better in isolated cns recurrence when compared with systemic recurrence , which is the major cause of death in secondary cns lymphoma . unfortunately , the median survival time is < 6 months when no treatment has been administered . treatment and cns prophylaxis after the discovery of primary lymphoma is an area of active investigation . based on the results of the large retrospective ricover-60 trial , intravenous ( iv ) rituximab is added to cyclophosphamide , doxorubicin , vincristine , and prednisolone ( chop ) therapy because it has shown a decreased incidence of scnsl from 6.9 to 4.1%.24 \n 25 \n 26 \n 39 \n 40 \n 41 \n 42 \n 43 another study found that a regimen of acvbp with iv methotrexate ( mtx ) may also be superior to standard chop therapy.30 the use of iv mtx has been shown to increase survival times for isolated scnsl , especially for parenchymal scnsl.44 despite these results , a strong consensus has yet to be reached on the indications for , efficacy of , and means of cns prophylaxis . this is partially due to the retrospective nature of the studies to date and the variance in treatment regimens among the different studies . also , the histopathology of the primary lymphoma is a determining factor in the efficacy of treatment . for example , although iv rituximab decreased the incidence of scnsl overall , it does not seem to influence the incidence of scnsl in dlbcl ( 30% ) . interestingly , the patient in this case did not meet the criteria for increased risk of developing scnsl , yet he still developed the disease . this leads us to believe that indeed no one factor is a definitive indicator that a patient will progress to a scnsl . the classification of mediastinal dlbcl may have elevated the patient 's risk of progression to scnsl ; however , his lack of other indicative risk factors made this an uncommon occurrence in an already uncommon condition . despite the unusual presentation in this case ( panhypopituitarism ) , the patient did have an isolated cns relapse within 6 months , and the mental status change resolved in response to mtx treatment .",
"isolated scnsl is a rare disease in which standardized treatment guidelines have yet to be developed . this case is one particular example where a patient designated as low risk for developing scnsl did progress to an isolated occurrence of the disease . additionally , although treatment extended the patient 's survival time and resolved the change in mental status , the disease continued to progress and the patient succumbed to his illness ."
] | isolated secondary central nervous system lymphoma ( scnsl ) relapse is a rare disease . consequently , standardized treatment regimens have yet to be developed . we present an interesting case of isolated scnsl presenting with altered mental status and panhypopituitarism in a patient at low risk of developing the disease . we also review the related literature and discuss newer , more aggressive treatments for primary cns lymphoma and scnsl . |
[
"the cellular thiol - disulfide redox environment is defined by protein thiols ( psh ) and disulfides ( psox ) as well as low molecular weight thiols and disulfides . in mammalian cells , by far the most abundant low molecular weight sulfhydryl molecule is glutathione ( gsh ) . together with its disulfide ( gssg ) , this pair is often referred to as the cellular thiol - disulfide redox buffer . in the cytosol of eukaryotic cells , glutathione is highly reducing with a ratio of gsh to gssg of at least 3,000 [ 1 , 2 ] , and consequently the majority of protein cysteines are found as psh . the high concentrations of psh and gsh in this compartment are important in the cellular defense against thiol oxidants , during thiol - disulfide stress , formation of mixed disulfides between protein and glutathione ( pssg ) serves as a mechanism for protecting psh and gsh from irreversible oxidation . in contrast to cytosolic proteins , secretory proteins often contain disulfide bonds , and the glutathione redox pool in the secretory compartments of the cell is found to be considerably more oxidizing than the cytosolic pool . disulfide bond formation is an essential step for the correct folding of many secretory proteins , and in eukaryotic cells their folding and assembly takes place in the endoplasmic reticulum ( er ) . in this compartment , molecular chaperones and enzymes for disulfide bond formation and glycosylation support protein folding . the maintenance of a proper er redox environment is crucial for the folding of secretory proteins . if the redox environment becomes too reducing , the formation of disulfide bonds is hampered . if too oxidizing , folding intermediates with nonnative disulfide bonds can accumulate . a number of oxidoreductases , which may have different functions and/or substrate or tissue specificities in the assistance of folding secretory proteins , the best characterized oxidoreductase is protein disulfide isomerase ( pdi ) , which introduces , reduces , and reorganizes disulfide bonds in a broad variety of substrate proteins . the oxidative pathway remains unresolved , but pdi may be reoxidized by a number of enzymes including pdi peroxidases , gpx7 and gpx8 , peroxiredoxin 4 , and the flavoprotein ero1 ( endoplasmic reticulum oxidoreductin 1 ) , for review see [ 10 , 11 ] . professional secretory cells are specialized in producing secretory proteins and are characterized by their abundant er . one example is the terminally differentiated b cell , also referred to as plasma cell , which secretes enormous amounts of antibodies , that is , immunoglobulins ( ig ) . while resting b cells do not secrete antibody , they do express a membrane - bound ig on their cell surface as a subunit of the b cell receptor , which upon binding of antigen activates a signaling cascade that can lead to differentiation into antibody - secreting plasma cells . the differentiation is accompanied by many morphological changes to accommodate production of large amounts of secreted antibody . this includes a general increase in cell volume with a preferential expansion of the er . in addition , the differentiation is accompanied by dramatic changes in the proteome of the cell [ 13 , 14 ] ; as expected , the er proteins are significantly up - regulated . igm is typically secreted as disulfide - linked pentamers or hexamers of a subassembly consisting of two identical heavy chains ( ) and two light chains ( ) . the pentameric holoprotein in addition contains a j - chain , which the hexamer does not . as each subassembly contains 16 disulfide bonds and the j - chain contributes 4 disulfide bonds , ros production is increased during b cell differentiation and counterbalanced by a strong antioxidant response . we set out to investigate how this enormous load on the secretory machinery affects the global thiol - disulfide environment of the b cell . we have applied a previously developed method for quantitative determination of the absolute levels of psh , psox , and pssg on all cellular proteins ( including membrane proteins ) in cultured mammalian cells , and combined these data with quantifications of gsh and gssg in the same cells . in this way , we have obtained a picture of the global changes in cellular thiol - disulfide redox status during differentiation of the resting b cell into an antibody - secreting plasma cell .",
"quantitative studies of the cellular redox status involve a variety of technical challenges due to the reactive nature of the sh group . great care must be taken to avoid artificial air oxidation and to eliminate cross - reactivity between the thiol and disulfide specific reagents , which can otherwise lead to deceptive conclusions . by applying a previously developed technology that carefully considers these technical pitfalls , we can quantitatively determine the cellular levels of total sulfhydryl equivalents in low molecular mass thiols and in protein . the key features of the experimental approach are illustrated in figure 1 . to avoid perturbation of the cellular thiol - disulfide status during cell lysis and sample preparation , cells were acidified by the addition of tca to a final concentration of 10% , resulting in immediate protein denaturation and precipitation . this combination of rapid trapping and deprotonation simultaneously unfolds redox enzymes , some of which have low thiol pka and are fairly acid - stable , and quenches generic thiols by protonation . to fully exploit the strength of our approach , we did not facs - sort cells before analysis , nor did we homogenize and fractionate cells . the tca pellets were solubilized by sonicating in appropriate buffers with high concentrations of sds or urea to quantify the different sulfhydryl species in all cellular proteins including membrane proteins . psh and psox levels were determined with a highly sensitive hplc assay based on the thiol quantification agent 4-dps . the total value of protein cysteines ( total ps ) was calculated by the addition of psh and psox and to verify the method , this value was also determined experimentally . for experiments performed on resting b cells , there is an excellent agreement between the experimentally determined value and the calculated sum of the experimentally determined psh and psox ( data not shown ) . finally , pssg levels were selectively quantified by the use of the thiol derivatization agent sbd - f . the sbd - gs derivative is highly fluorescent and can be quantified specifically due to its unique retention time in an hplc chromatogram . in addition to protein sulfhydryls , the total protein content of each sample was determined and used as a common denominator to compare the individual samples . this is a crucial step as it eliminates any bias from a possible uneven division of the tca pellet into fractions . furthermore , the requirement for a common denominator in this study is particularly important , as it also eliminates any bias due to morphological differences between cell samples . the total protein content was quantified using a method based on complete hydrolysis in hcl followed by quantification of released amino acids with ninhydrin . this constitutes a highly reproducible and sensitive method and , with a proper standard , it yields numbers that can be calibrated to amino acids in protein . furthermore , the ninhydrin assay is independent of protein solubility and hence includes both soluble and membrane proteins . thus , all the following data will be shown as sulfhydryl per amino acid ( sh / aa ) . as a model for b cell differentiation , we used a previously established system based on the murine b cell lymphoma 1.29 which can be induced by lipopolysaccharide ( lps ) to secrete igm [ 13 , 19 ] . to obtain a well - defined reference point for the differentiation of b cells into plasma cells , we quantified the thiol - disulfide status in uninduced b cells to obtain a reference point for differentiation into plasma cells . cells were seeded to a density of 0.2 10 cells / ml , and samples for redox quantification were taken each day during the next four days . although cell density increased considerably during this period , the protein redox state remained constant throughout the experiment ( figures 2(a ) and 2(b ) ) . in addition , levels of pssg , gssg , and gsh remained constant ( data not shown ) , and we concluded that the global thiol - disulfide status is independent of cell density . accordingly , the mean value of data obtained for each of the redox species during the four days was calculated , and the relative distributions of the different protein and glutathione sulfhydryl equivalents are given in table 1 . from these data , we concluded that the vast majority of cellular sulfhydryl equivalents exists in the reduced thiol form with only 5% and 9% of the ps and gs equivalents engaged in disulfide bond formation , respectively . together , these data describe the total thiol - disulfide environment of resting b cells , and we used them as reference point for studying the differentiation into antibody - secreting plasma cells . in the remaining part of this study interestingly , the distribution of thiol and disulfide equivalents in resting b cells is very similar to that of hek ( human embryonic kidney ) cells , where 6% of the ps equivalents were found as psox and 8.5% of the gs equivalents were found as gssg . in addition , our observation that cellular pssg levels are extremely low is supported by results in hek and hela cells . it should be mentioned that although cells are grown in the presence of -mercaptoethanol , which was detected in the tca supernatant and also in very small amounts in the tca pellet , it did not interfere with the glutathione or pssg measurements because fluorescent -mercaptoethanol derivatives were separated efficiently from gs derivatives by hplc ( data not shown ) . resting 1.29 cells were treated with lps to induce differentiation into antibody - secreting plasma cells . samples were prepared for global thiol quantification after 1 , 2 , 3 , and 4 days of lps treatment . from the sh / aa of total ps equivalents ( figure 3(a ) ) , we find that the frequency of cysteine residues in proteins is fairly constant ( ~2% ) throughout the differentiation . this is in excellent agreement with the experimentally determined values for other mammalian cell lines as well as calculated values for eukaryotes in general hansen [ 3 , 20 ] . the sh / aa for total ps was expected to be largely unaffected during differentiation as the igm monomer has a cysteine frequency of 2.5% ( igm has 1,540 amino acids , of which 38 are cysteines ) . although the absolute value of total ps equivalents remained unchanged throughout the experiment , the distribution of protein thiols and disulfides was influenced by the lps - induced cell differentiation . the percentage of protein thiols engaged in disulfide bond formation remained largely unaffected for two days after lps induction , but at day three the psox values had doubled , and a total increase by a factor of 3.3 was found at day four ( figure 3(b ) ) . likewise , after a lag time of two days , on day three pssg had increased by a factor of 2.2 , but in contrast to psox , the pssg value did not increase further on day four ( figure 3(c ) ) . interestingly , the ratio of pssg to psox remained essentially unchanged throughout the experiment ( figure 3(d ) ) . quantification of soluble glutathione equivalents revealed that the absolute concentrations of gssg remained largely unaffected ( figure 4(a ) ) , but the fraction of oxidized gs equivalents ( gs in gssg ) relative to total gs equivalents ( total gs ) increased from 8.8% to 14.5% ( figure 4(b ) ) . this was caused by a gradual decrease in gsh ( figure 4(a ) ) resulting in an overall decrease of 56% in ( total gs ) at day 4 compared to day 0 . the gs equivalents were not recovered as pssg , which throughout the study remained a minute fraction of total gs equivalents ( figure 4(c ) ) . to rule out that the decrease in intracellular gs was caused by an increase in dying cells , the level of apoptotic and necrotic cells was measured using flow cytometry and staining with the cell - impermeable dye propidium iodide ( pi ) . although the fraction of viable ( pi - negative ) cells decreased during the differentiation by a factor of 1.5 ( supplementary material figure 1 available online at http://dx.doi.org/10.1155/2013/898563 ) , it could not account for our observed decrease in intracellular glutathione ( see supplementary material text ) . as the decrease in intracellular gs was not explained by an increase in cell death , we measured whether gs equivalents were secreted by the cells . no glutathione was detectable in a blank medium sample ( data not shown ) ; media from uninduced cells , however , contained measurable amounts of glutathione , and the values increased significantly on day three and four after induction ( figure 4(d ) ) . it should be noted that these numbers are only rough estimates and that the values are most likely underestimated due to extracellular gs degradation catalyzed by -glutamyl transferase . from the data shown in figures 4(a ) and 4(d ) , the increase in extracellular gs / aa equivalents at day 4 relative to day 0 was calculated to ( 0.23 0.1 ) 10 while the decrease in intracellular gs / aa was calculated to ( 0.46 0.05 ) 10 . as the two numbers are in the same size range , it is possible that the differentiating cells secrete glutathione ( details are given in supplementary material text ) .",
"the transformation of resting b cells into antibody - secreting plasma cells involves an extensive expansion of the er and both er resident proteins and proteins involved in redox balance are up - regulated linearly during differentiation . how cells cope with this sudden increase in secretory activity has been the subject of numerous studies [ 22 , 23 ] . this study , for the first time , provides a quantitative overview of the cellular thiol - disulfide status during differentiation of resting b cells into antibody - secreting plasma cells . we applied a previously developed method to quantify soluble gsh and gssg as well as protein thiols and disulfides in cells . importantly , the method includes both soluble and membrane proteins , which precludes bias due to morphological changes during b cell differentiation . we find that the differentiation process affects the global protein thiol - disulfide status with an increase factor of 3.3 in the fraction of oxidized protein thiols at day 4 of differentiation , compared to day 0 . the effects on the glutathione redox status are less significant with an increase factor of 1.6 in the fraction of oxidized gs equivalents . the changes in glutathione redox state were caused by a general depletion of gs equivalents from differentiating b cells . the differentiation of b cells into plasma cells has been studied in great detail at the proteomic level [ 13 , 14 ] . , the cell prepares by ensuring that metabolic capacity and secretory machinery can cope with the mass production of antibody molecules . we did not find any change in protein thiol - disulfide status until the third day of activation , when the fraction of psox increased by a factor of 2.2 . the kinetics for the change in protein redox state were identical to the kinetics for igm production . our results suggest that a general expansion of the er does not affect protein redox status until an extensive production of cargo proteins is initiated . the increase of igm production at day three is possibly preempted by a process known as proactive unfolded protein response ( proactive upr ) . the upr is a stress signaling process that is initiated when unfolded polypeptides accumulate in the er . this process leads to an up - regulation of er chaperones and folding enzymes which prevents er stress . while unfolded protein stress ( or er stress ) is not involved in the initial expansion of the er in professional secretory cells [ 13 , 14 ] , it is essential for b cell differentiation [ 26 , 27 ] . upr - induced oxidases such as ero1 may facilitate the change in protein redox state on the third day of differentiation to initiate disulfide - dependent igm polymerization and its subsequent secretion . initially gssg was thought to provide oxidizing equivalents for disulfide bond formation , but after identification of the ero1 proteins this hypothesis was discarded . instead , gsh now is considered to be involved in the isomerization of nonnative disulfide bonds [ 2830 ] to consume excess oxidizing equivalents produced by the ero1 proteins and to activate ero1 by reducing its regulatory disulfides . consequently , the abundance of gssg in the er is altogether assumed to be at least partially caused by ero1 activity . the mechanisms by which the er maintains its gsh / gssg redox balance are unknown . excess gssg could be reduced by an er resident glutathione reductase , it could be transported to the cytosol for reduction or it could be secreted from the cells . during b cell differentiation ero1 is up - regulated by factors of 3.0 and 2.4 at day 3 and 4 , respectively , and consequently we expected gssg levels to increase . surprisingly , gssg levels remained constant throughout differentiation , but the overall cellular glutathione redox status did become more oxidizing gradually ( figure 4(a ) ) . this was the result of a depletion of total gs equivalents at the expense of gsh ( figure 4(b ) ) . there are three possible explanations for the decrease in total intracellular gs , ( 1 ) differentiation of b cells leads to secretion of gs equivalents , ( 2 ) gsh is irreversibly oxidized to sulfinic or sulfonic acids , which is not detected by the quantification method , and ( 3 ) gs equivalents are released by the fraction of pi positive cells . we found an increase in extracellular gs on days 3 and 4 of the differentiation that was of about the same magnitude as the intracellular decrease ( figure 4(d ) ) . this result supports model ( 1 ) and suggests that gsh converted to gssg by the up - regulation of ero1 proteins and is exported to the media . this export could serve as a mechanism for relieving cells from any oxidative load caused by up - regulation of ero1 proteins . we can , however , not make any certain conclusions regarding the cause of intracellular gs depletion , as the levels of extracellular gs could in principle be explained by the fraction of pi - positive cells releasing their intracellular gs content to the media ( see supplementary material text ) . due to the extremely reducing glutathione redox potential of the cytosol , the vast majority of pssg is expected to be found in the oxidizing compartments of the cell . in a study of liver microsomes , 50% of the gs equivalents were found as pssg , suggesting that a major fraction of the glutathione in the er is associated with protein . however , this fraction was subsequently estimated to be significantly lower ( i.e. , less than 2% pssg ) based on whole - cell quantification with the assumption that no pssg is found in the cytosol . under the same assumption ; that is , that all pssg equivalents are found in the er and that the concentrations of gs equivalents are the same in all cellular compartments , we can estimate that the maximal fraction of pssg is relative to total gs equivalents in the er , in fully differentiated b cells . the er volume is reported to constitute at least 10% of total cell volume in antibody - secreting b cells and , accordingly , maximally 7% ( 0.7%/10% ) of the gs equivalents in er are found as pssg . thus , even in highly active secretory cells , pssg only constitutes a minor fraction of total gs equivalents of the er . these results support the notion that the er glutathione redox environment is more reducing than previously assumed . it is generally assumed that the level of gssg is critical for the amounts of pssg formed . interestingly , we found that the ratio of pssg to psox was independent of differentiation ( figure 3(d ) ) , suggesting that the oxidizing compartments of the cell maintain a constant level of pssg , and consequently , that the er glutathione redox status is tightly regulated throughout differentiation . this may be explained by the activation of oxidative stress during the early stage of b cell differentiation and followed by a strong antioxidant response [ 16 , 36 ] . maintenance of a proper er glutathione redox environment can be a crucial factor in securing the correct folding of igm . in this study , we have for the first time characterized the changes in thiol - disulfide state during differentiation of b cells . in general , the differentiation does not cause massive thiol - disulfide stress to the cells . the steady state levels of pssg are maintained at very low levels , even in fully differentiated cells , and the overall protein redox state is not affected until late in differentiation , when large - scale igm production has started and the er stress response has been activated .",
"1.29 cells were maintained in suspension as described in and after 2 days , cell culture medium was replaced by fresh medium . for differentiation , cells were cultured in the presence of 20 g / ml lps ( sigma ) . three independent cultures were induced with lps and samples were taken after 1 , 2 , 3 , or 4 days of differentiation . as a control , samples from 3 independent cultures grown without lps were collected as well . each day after lps activation , samples were collected for flow cytometric analysis . cells were stained with pi ( sigma ) and flow cytometry data were obtained with facscalibur ( bd biosciences ) and analyzed using cellquest software ( bd biosciences ) . cells were harvested by centrifugation followed by a wash step with 10 ml dulbecco 's 1x pbs ( paa laboratories ) to eliminate traces of protein from the media . cells were resuspended in 1 ml ice - cold 10% ( w / v ) tca and incubated on ice for 30 minutes followed by centrifugation . the supernatant , used for quantification of gsh and gssg , was immediately frozen in n2 and kept at 80c until later use . the tca pellet , used for protein thiol quantification , was washed in 10% tca by four cycles of sonication and centrifugation . before the final centrifugation step , the suspension was divided in four to quantify psh , psox , pssg , and total ps . the psh , pssg , and total ps samples were immediately frozen in n2 and kept at 80c until later use . the psox sample was directly solubilized and alkylated by sonicating the pellet in 500 l of 5% sds , 1 mm edta , 20 mm nem ( sigma ) in 0.5 m tris - cl ph 8.3 . the alkylation was allowed to proceed for at least 20 min before the sample was transferred to 80c . thiol and disulfide species in tca supernatant and tca pellet fractions were quantified as described in . briefly , psh samples were solubilized in 5% sds , 1 mm edta in 0.4 m sodium citrate , ph 4.5 and protein thiols were quantified by the addition of 4-dps ( sigma ) to a final concentration of 0.5 mm followed by hplc analysis . for quantification of psox , samples alkylated with nem were reduced by the addition of bh ( sigma ) to a final concentration of 3.3% ( w / v ) . prior to quantification with 4-dps , bh was destroyed by the addition of hcl , as described in . total ps was quantified by solubilizing the pellet in 5% sds , 1 mm edta , and 0.5 m tris - cl ph 8.3 , reducing all thiols with bh , followed by thiol quantification with 4-dps . the pssg sample was solubilized in 6 m urea , 8 mm edta , and 200 mm bicine ph 9.2 . disulfides were reduced with 2.1 mm thp ( calbiochem ) and thiols were derivatized by the addition of 6.4 mm sbd - f ( fluka ) for 1 hour at 60c . to compare samples , total protein content was determined by using a ninhydrin based assay . an hplc assay based on thiol derivatization with n-(1-pyrenyl)maleimides ( fluka ) was used to quantify gssg and total gs ( gsh + gssg ) from the supernatant as described in . for quantification of secreted glutathione , proteins in media from harvested cells were precipitated by the addition of tca to 10% ( v / w ) and incubated on ice for 30 minutes followed by centrifugation ."
] | plasma cells produce and secrete massive amounts of disulfide - containing antibodies . to accommodate this load on the secretory machinery , the differentiation of resting b cells into antibody - secreting plasma cells is accompanied by a preferential expansion of the secretory compartments of the cells and by an up - regulation of enzymes involved in redox regulation and protein folding . we have quantified the absolute levels of protein thiols , protein disulfides , and glutathionylated proteins in whole cells . the results show that while the global thiol - disulfide state is affected to some extent by the differentiation , steady - state levels of glutathionylated protein thiols are less than 0.3% of the total protein cysteines , even in fully differentiated cells , and the overall protein redox state is not affected until late in differentiation , when large - scale igm production is ongoing . a general expansion of the er does not affect global protein redox status until an extensive production of cargo proteins has started . |
[
"cutaneous horn ( synonyms ; cornu cutaneum : cornu humanum ) is a conical , hyperkeratotic protrusion that often resembles an animal horn . the term cutaneous horn is a morphologic designation referring to unusually cohesive keratinized material and not a true pathologic diagnosis . the earliest documented case of cutaneous horn , or cornu cutaneum , was that of an elderly welsh woman in london who was displayed commercially as an anomaly of nature in 1588 . there were several other accounts of cutaneous horns in the sixteenth and seventeenth centuries , including those described by danish anatomist thomas bartholin in 1670 . illustrations from that time portray these growths as grotesque , and numerous natural and supernatural theories arose regarding their etiology . for centuries cutaneous horns have been a subject of curiosities and controversies . in the late eighteenth century , the london surgeons everard home and his brother - in - law john hunter are generally credited with the characterization of cutaneous horns as a medical disorder . though cutaneous horn has been described at various sites , horn over the penis is very rare and represents the most unusual site . the first case report of a penile horn was published as early as 1854 . since then there has been sporadic reporting of cases by dermatologists , surgeons and urologists mainly for curiosity and various conditions which may present as a penile horn .",
"cutaneous horn occurs mainly in individuals who are above 50 years of age and penile horns are no exception to this rule . they are common in males after 50 years and probably coincide with the age group of occurrence of penile cancer . to this date lowe and mc cullogh reported that penile horn may be benign in 4256% of cases , premalignant in 2237% or frankly malignant in 2022% .",
"cutaneous horn is a morphologic designation for a protuberant mass of keratin produced by unusual cohesiveness of keratinized material . it is rather intriguing to note that why only few patients develop penile horn when compared with other patients with similar disease . the roles of chronic irritation , phimosis , surgical trauma and radiotherapy that have been implicated in penile horn formation have also been found to predispose to carcinoma penis . the emphasis is on the long - standing phimosis with chronic , prolonged preputial inflammation ; however , it has also been seen in circumcised men . adult circumcision has been found to precede horn formation by a period ranging from 2 weeks to a year . the analysis of the cases reported so far do not reveal any common factor that predisposes to the development of horn over the underlying pathology . the occurrence of horn in different disorders ranging from benign viral disease to malignant carcinoma further augments the view that the keratinous growth probably represents a reactionary event , which does not depend on the underlying pathology . pseudoepitheliomatous , keratotic and micaceous balanitis is another rare disease , which has been found to be associated with penile horn . it was , originally described by jacob and civatte who considered it to be benign . similarly , verrucous carcinoma is another tumor which has been found to be associated with penile horn . this tumor is a highly keratinizing tumor , and this probably predisposes for penile horn formation . the progression of cutaneous horn to malignancy though has been reported probably represents the manifestation of underlying tumor . causes of penile horn the role of human papillomavirus ( hpv ) in penile carcinoma is well studied . the hpv 16 and 18 are implicated as the causative agents . in penile horns that arise from malignancies such as verrucous carcinoma ,",
"penile horns present as elongated , keratinous , white or yellowish projections that range from a few millimeters to centimeters in size arising from the glans penis [ figures 1 and 2 ] . traumatic breakage of the horn is rare and can occur due to the projectile nature of the growth . hard keratotic mass arising from glans penis the patients seek treatment for the disfigurement and difficulty posed during intercourse . in general horns arising from malignant lesions tend to be harder on their bases due to the inflammatory process . their surface is rough , irregular , laminated or fissured , the ends pointed , blunt or clubbed . the color varies ; it is usually grayish - yellow , but may be even blackish . commonly they are small in size , a fraction of an inch or an inch or thereabouts in length , but exceptionally attain considerable proportions . the base , which rests directly on the skin , may be broad , flattened , or concave , with the underlying and adjacent tissues normal or the papill hypertrophied ; and in some cases there is more or less inflammation , which may be followed by suppuration . they are , as a rule , painless but become painful when knocked or irritated .",
"the histopathology of the cause is diagnostic in most cases . from the histopathological point of view cutaneous horn can be classified as benign , premalignant and malignant based on the origin . it consists of closely agglutinated epidermic cells , forming small columns or rods . in the columns they have their starting - point in the rete mucosum , either from that lying above the papilla or that lining the follicles and glands . keratinous mass overlying the epidermis ( 40 ) part two is the underlying pathology beneath the keratotic mass .",
"though histopathology is diagnostic certain other investigations are required particularly in patients with underlying malignancy . approximately one - third of penile cutaneous horns are associated with an underlying malignancy , and so magnetic resonance imaging is helpful when there is uncertainty regarding the depth of infiltration or proximal extension .",
"as kaposi noted more than a century ago , cutaneous horns can be removed by simple detachment and cauterization of the papillary base . stage one is establishing the diagnosis and next stage is a definitive treatment based on the histopathology . penile horn can hide either benign or malignant lesions . therefore , what is really important is not the cutaneous horn itself , but the subjacent disease . hence , it is justifiable to perform a local surgical excision for the histopathological diagnosis of its base . a wide local surgical excision is performed on the lesion in case of suspected malignancy to obtain the histopathological diagnosis . though various methods including electrosurgical excision , laser and cryosurgery , have been described as effective laser therapy with carbon dioxide or neodymium : yttrium aluminum garnet laser leaves lesser scarring with more cosmetic results . they are not preferred as they alter the histopathology of the lesion . in case of a benign lesion , excision of the horn would suffice . in case of verrucous carcinoma , wide local surgical excision should be followed up regularly . if the biopsy reveals squamous cell carcinoma , the treatment of choice is partial or complete penectomy with urethral diversion and perineal urethrostomy .",
"the penile horn continues to fascinate the dermatologists and surgeons alike because of the morphological appearance and presentation . the penile horn is only a morphological entity and the true pathology masked by it ."
] | cutaneous horn refers to unusually cohesive keratinized material and not a true pathologic diagnosis . though cutaneous horn has been described at various sites , horn over the penis is very rare and represents the most unusual site . the role of chronic irritation , phimosis , surgical trauma and radiotherapy have been implicated in penile horn formation . penile horns present as elongated , keratinous , white or yellowish projections that range from a few millimeters to centimeters in size arising from the glans penis . histopathology of the keratotic mass reveals nothing but keratin . the underlying mass may vary from verruca vulgaris to squamous cell carcinoma . the treatment is based on the pathology . |
[
"the turnover rate ( employee separations ) of healthcare workers has created a cycle of exhaustion and discontent . high turnover affects the institution 's ability to consistently provide high - quality care and increases institutional costs related to the recruitment , orientation , and lower productivity of newly hired staff .",
"this is an oklahoma university medical system ( oums ) performance improvement educational intervention study . we will use a 5-year longitudinal design with repeated measures to examine the effect of diffusion of the heartmath healthcare program revitalizing care techniques within oums . the variables include pre and post training scores on the personal and organizational quality assessment questionnaire ( poqa - r ) , scores on the independently administered oums annual employee engagement survey , and separations from oums as reported by the human resources department as turnover rates . the training sessions included a 5-hour presentation with a 2-hour follow - up program provided 2 or more weeks later . participants received an emwave2 training reinforcement device to use during the time period between the first training and the follow - up training . data from the emwave2 will provide personal reinforcement to the user and will not be collected or analyzed by the investigators .",
"the most significant measured result noted after training 90% of the nursing leadership , vice presidents , directors , and managers and 93% of the oncology staff was the continued decline of the turnover rate to < 14% for the overall oncology oums service line within the first year of the program being instituted . this was an improvement from a 2009 high of 73% for one of the oncology service lines with a 34% at the time of training , when newly hired people were beginning to leave again , plateauing and even increasing the rate at that time . engagement scores for the oncology unit improved from the previous year , and the poqa scores for both the leadership group and the oncology group showed many significant improvements during the time of measurement ."
] | background : the turnover rate ( employee separations ) of healthcare workers has created a cycle of exhaustion and discontent . high turnover affects the institution 's ability to consistently provide high - quality care and increases institutional costs related to the recruitment , orientation , and lower productivity of newly hired staff.methods:this is an oklahoma university medical system ( oums ) performance improvement educational intervention study . we will use a 5-year longitudinal design with repeated measures to examine the effect of diffusion of the heartmath healthcare program revitalizing care techniques within oums . the variables include pre and post training scores on the personal and organizational quality assessment questionnaire ( poqa - r ) , scores on the independently administered oums annual employee engagement survey , and separations from oums as reported by the human resources department as turnover rates.employees of the oums were trained in cohorts of less than 20 . the training sessions included a 5-hour presentation with a 2-hour follow - up program provided 2 or more weeks later . participants received an emwave2 training reinforcement device to use during the time period between the first training and the follow - up training . data from the emwave2 will provide personal reinforcement to the user and will not be collected or analyzed by the investigators.results:the most significant measured result noted after training 90% of the nursing leadership , vice presidents , directors , and managers and 93% of the oncology staff was the continued decline of the turnover rate to < 14% for the overall oncology oums service line within the first year of the program being instituted . this was an improvement from a 2009 high of 73% for one of the oncology service lines with a 34% at the time of training , when newly hired people were beginning to leave again , plateauing and even increasing the rate at that time . engagement scores for the oncology unit improved from the previous year , and the poqa scores for both the leadership group and the oncology group showed many significant improvements during the time of measurement . |
[
"whenever lesions in the ascending aorta and aortic arch have from direct aortic cannulation , arterial cannulation via the femoral artery has been used for a long time . however , because retrograde aortic dissection and nonperfusion into the true lumen are possible , the technique of selective antegrade perfusion under deep hypothermia using the axillary artery has become a standard perfusion method . axillary artery cannulation , however , has some drawbacks , including technical problems . limitations of deep hypothermia have also been reported . the benefits of using selective perfusion under moderate hypothermia for brain protection have been reported in recent years . reported that cannulation via the brachial artery , instead of the axillary artery , could be useful for a good operative field , a short operation time , and brain protection . methods for protecting the brain during surgeries of the ascending aorta and the aortic arch have been developing , but remain controversial . antegrade perfusion via the axillary artery shows better results than retrograde perfusion via the femoral artery ; nevertheless , both of them have benefits and drawbacks . we tried to use antegrade and retrograde perfusion at the same time , with the aim of avoiding the fatal problems of either method alone . also we expected the brachial artery approach to be easier than that of the axillary artery . we report our clinical experiences using the ascending aorta and aortic arch replacement with perfusion via the brachial and femoral arteries under moderate hypothermia .",
"forty - six consecutive patients underwent replacements of the ascending aorta and aortic arch between july 2005 and may 2010 . we reviewed 36 patients who had been operated using a perfusion method via the right brachial and femoral artery under moderate hypothermia . ten patients were excluded because deep hypothermia or two cerebral perfusions including the left common carotid artery were used . we analyzed the preoperative diagnoses , operations , cardiopulmonary bypass time , selective antegrade cerebral perfusion time under circulatory arrest , lowest core temperature , operation mortality rate , and neurologic deficits by retrospectively reviewing the medical records . we defined the postoperative neurologic states showing delirium , irritability , or confusion during the postoperative days with normal brain computed tomography or mri findings as minor neurologic dysfunction , and the states among the above with definite lesions in brain ct or mri , or motor dysfunctions , as major neurologic dysfunction . we positioned the patients in supine position with the right arm abducted , and made incisions in the right axillary and inguinal area to expose the right brachial and the femoral artery at the same time in the manner by tasdemir et al . . after performing a median sternotomy and exposing the aorta and heart , we administered heparin and inserted cannulae into the right brachial and femoral artery . we directly inserted a 12-fr cannula ( fem - flex ii , edwards lifesciences , usa ) into the brachial artery , or an anastomosed 8-mm graft ( intergard , intervascular , usa ) to the brachial artery in an end - to - side manner when it was small . we directly inserted an 18-fr cannula ( fem - flex ii , edwards lifesciences , usa ) into the femoral artery . by reviewing the preoperative ct , we decided to use the femoral artery , which was connected to the true lumen . we connected the cardiopulmonary bypass circuit to the two cannulae using a y - shaped tube . venous cannulae were inserted into the ivc and svc . with the cardiopulmonary bypass running and the rectal temperature lowered to 24 , we stopped femoral artery perfusion and maintained 40% of total perfusion via the right brachial artery . after blocking the aortic arch vessels with vascular clamps , we performed aortotomy and directly infused cardioplegic solution into the coronary artery ora . without clamping , we anastomosed the distal aorta , which was open , to a prosthetic bypass graft in an end - to - end manner . we anastomosed the aortic arch vessels , including the innominate artery , to the side of the prosthetic graft in the shape of an island simultaneously or to the prosthetic graft with 4 branches ( intergard , maquet gmbh & co. , germany ) in an end - to - end manner , according to the range of the lesions . after finishing the anastomoses of the aortic arch , we anastomosed a 10-mm sized prosthetic graft to the side of the prosthetic graft in an end - to - side manner and used it as an arterial perfusion line . we then clamped the proximal side and started perfusion antegradely . while raising body temperature , we performed proximal anastomosis of the aorta . we verified that cerebral oxygen saturation ( cerebral oximeter , invos monitor rs 232 , somanetics , usa ) was constantly maintained at a certain standard during the entire operation , including during cerebral perfusion .",
"the mean age of the patients was 61.9 years ( 29 to 79 years ) , and 19 were male and 17 were female . the preoperative diagnoses were acute type a aortic dissection in 31 ( 86% ) patients , and aortic aneurysm without dissection in 5 ( 14% ) patients . there were 3 patients who were in preoperative shock with a creatinine level elevated to over 2.5 , showing renal dysfunction ( table 1 ) . we performed ascending aorta replacement in 9 cases ( 25% ) , ascending aorta and hemiarch replacement in 13 cases ( 36% ) , ascending aorta and total arch replacement in 13 cases ( 36% ) , and total aortic arch replacement in 1 case ( 3% ) . operations which were performed simultaneously were a coronary bypass graft in 3 cases , aortic valve replacement in 2 cases , and aortic root reimplantation in 1 case . mean cardiopulmonary bypass time was 209.485.1 minutes , and selective antegrade cerebral perfusion time under the circulatory arrest was 36.124.2 minutes . five patients died within the first 30 days after operation ( mortality rate , 13.8% ) . the causes of death were diffuse hypoxic brain damage in 1 , acute myocardial infarction in 1 , mediastinitis in l , bleeding in 1 , and low cardiac output in l. there were 2 ( 5.5% ) cases of minor neurologic dysfunction defined as delirium , irritability , or confusion during the postoperative days without brain ct and mri abnormalities . there were 6 ( 16.6% ) cases of major neurologic dysfuction , with patients showing motor dysfunction or definite brain lesions in brain ct or mri . diffuse hypoxic brain damage occurred in 1 patient , left brain infarction in 3 patients , and right brain infarction in 2 patients . of the 6 patients who had major neurologic dysfunctions , 3 patients had preoperative unconsciousness or brain infarction . other complications were one case of reoperation due to bleeding , one case of mediastinitis and one case of vocal cord palsy . there were no complications related to the cannulation of the right brachial artery in the axillary area . in 3 cases ,",
"perfusion techniques for protecting the brain during surgeries of the ascending aorta and aortic arch have been controversial for a long time , but are constantly being developed . the complementary addition of retrograde cerebral perfusion has produced better operation results . though this technique continues to be used widely , has shown through animal experiments that retrograde cerebral perfusion can not supply complete perfusion to brain tissues . for this reason , surgeries using antegrade perfusion techniques started to be reported , demonstrating good operative results . recently , selective antegrade cerebral perfusion using the axillary artery became a standard perfusion technique for performing ascending aorta and aortic arch operations [ 1,13 - 15 ] . a wide review of the literature shows that axillary artery cannulation has produced better results in the protection of the brain than the femoral artery cannulation . however , gulbins et al . pointed out that there is a lack of evidence for the axillary artery to be recommended as a standard cannulation site . direct cannulation into the femoral artery in acute type a aortic dissection can cause retrograde dissection or malperfusion to the true lumen . dissection of the innominate artery may also occur during axillary artery cannulation , as imanaka et al . we therefore tried to perform antegrade and retrograde perfusion simultaneously , in order to provide against the fatal shortcomings of each approach . applying deep hypothermia requires ample time to raise and lower the temperature and may cause some side effects . wilde reported that deep hypothermia could keep coagulation down , and change the components of blood . cooper et al . reported that deep hypothermia could suppress the function of vascular endothelial cells and be involved in cell death , consequently bringing about multiple organ dysfunction . to avoid the drawbacks of deep hypothermia , some trials used selective cerebral perfusion under moderate hypothermia , resulting in excellent brain protection . we performed surgeries while lowering the core temperature to around 24 , but we did not block cerebral perfusion during the entire time of operation . this allowed us to perform operations without the concern of brain damage , and required little time for raising and lowering the core temperature and for cardiopulmonary bypass . there were 3 cases of renal dysfunction , which we believe to be related to preoperative renal dysfunction due to shock , and to be independent of the temperature during operation . reported that using the brachial artery instead of the axillary artery for arterial cannulation could provide a good operative field , save operation time , and show good brain protection . it took 10 to 15 minutes to cannulate the artery directly and 25 to 30 minutes to connect a prosthetic graft to the brachial artery when it was very small . according to our experiences , the cannulation of the brachial artery was easier and supplied a cleaner operative field than that of the axillary artery . the incidence of major cerebral dysfunctions was a bit higher ( 6 cases , 16.6% ) . this resulted from our inclusion of 3 cases in which the state of preoperative unconsciousness or brain infarction could have been identified . there was diffuse hypoxic brain damage in 1 case , left brain infarction in 3 cases , and right brain infarction in 2 cases , so we supposed that only right cerebral perfusion might not be the cause of brain damage . the mortality rate ( 13.8% ) was also higher than in previous studies , resulting from a higher rate of acute aortic dissection in our study group . even though methods of brain protection for ascending aorta and aortic arch operations are continuously progressing , there is still much debate about which sites are good to cannulate for arterial access , and to what degree it would be effective and safe to lower temperatures . . noted that additional methods for brain protection are needed , since cerebral perfusion through the right axillary artery can not supply enough perfusion to the left brain hemisphere in some people , pointing out that the development of circle of willis could be incomplete embriologically . kazui et al . suggested the \" kazui technique \" , in which antegrade cerebral perfusion is performed with catheters inserted into the three aortic arch branches during aortic arch replacement . olsson and thelin suggested bilateral cerebral perfusion via the right axillary artery and the left common carotid artery by inserting a supplementary catheter into the left common carotid artery during circulatory arrest . the authors have also inserted supplementary catheters into the left common carotid artery and the left subclavian artery recently , and will be reporting the results .",
"using the right brachial and the femoral arteries as routes for arterial access under moderate hypothermia showed satisfactory results when there were lesions which made direct cannulation into the ascending aorta difficult during ascending aorta and aortic arch replacements . further studies are needed for to improve bilateral cerebral perfusion for more complete brain protection ."
] | backgroundselective antegrade perfusion via axillary artery cannulation along with circulatory arrest under deep hypothermia has became a recent trend for performing surgery on the ascending aorta and aortic arch and when direct aortic cannulation is not feasible . the authors of this study tried using moderate hypothermia with right brachial and femoral artery perfusion to complement the pitfalls of single axillary artery cannulation and deep hypothermia.materials and methodsa retrospective analysis was performed on 36 patients who received ascending aorta or aortic arch replacement between july 2005 and may 2010 . the adverse outcomes included operative mortality , permanent neurologic dysfunction and temporary neurologic dysfunction.resultsof these 36 patients , 32 ( 88% ) were treated as emergencies . the mean age of the patients was 61.9 years ( ranging from 29 to 79 years ) and there were 19 males and 17 females . the principal diagnoses for the operation were acute type a aortic dissection ( 31 , 86% ) and aneurysmal disease without aortic dissection ( 5 , 14% ) . the performed operations were ascending aorta replacement ( 9 , 25% ) , ascending aorta and hemiarch replacement ( 13 , 36% ) , ascending aorta and total arch replacement ( 13 , 36% ) and total arch replacement only ( 1 , 3% ) . the mean cardiopulmonary bypass time was 209.485.1 minutes , and the circulatory arrest with selective antegrade perfusion time was 36.124.2 minutes . the lowest core temperature was 242.1. there were five deaths within 30 post - op days ( mortality : 13.8% ) . two patients ( 5.5% ) had minor neurologic dysfunction and six patients , including three patients who had preoperative cerebral infarction or unconsciousness , had major neurologic dysfunction ( 16.6%).conclusionwhen direct aortic cannulation is not feasible for ascending aorta and aortic arch replacement , the right brachial and femoral artery can be used as arterial perfusion routes with the patient under moderate hypothermia . this technique resulted in acceptable outcomes . |
[
"the risk revolution is one of the most significant advances that have occurred in medicine over the past decades . in the current state of incomplete knowledge of most human diseases , the probabilistic approach allows us to make accurate predictions for a group of individuals presenting with specific attributes or exposures . risk assessment has become increasingly important in the prevention of chronic diseases and has recently been applied to oral diseases due to the realization that severe forms of the two most prevalent dental diseases , i.e. , caries and periodontal disease are clustered in a minority of the population who are hypothesized at being at higher risk . consequently , a new paradigm emerging to control dental disease involves identification and targeting high risk individuals and intercepting the disease process . cigarette smoking has long been associated with a variety of oral conditions including periodontal diseases . experimental evidence accumulated over the last two decades has indicated that cigarette smoking is a true risk factor for periodontitis . smokers have both increased prevalence and more severe extent of periodontal disease compared to non - smokers . tobacco and some of its volatile and non - volatile components have been found to affect human gingival fibroblasts . among the multiple volatile components , some reactive aldehydes are thought to have a prominent cytopathic effect , resulting in a dose dependent human gingival fibroblast inhibition of cell adhesion related to morphological alteration of cytoskeletal structure . acrolein , a very reactive compound is a volatile flammable liquid with a pungent , choking disagreeable odor . in cigarettes , experimental data suggests that acrolein is detrimental to human gingival fibroblasts ( hgf ) survival and consequently to the oral connective tissue . they are well recognized to have a high cytotoxic and genotoxic effect on cultured human bronchial epithelial cells and fibroblasts , as well as on human skin fibroblasts . this in vitro study is focused on the toxic nature of a volatile smoke component - acrolein on the proliferation and attachment of human gingival fibroblasts .",
"human gingival fibroblasts ( hgf ) strains from healthy subjects with non - inflamed gingiva which did not bleed on probing were utilized . a split thickness flap was raised at the donor site using bard parker no-15 and careful dissection was carried out [ figure 1a ] . a conventional method was preferred over punch biopsy to delineate the epithelium from the underlying connective tissue . the biopsy tissue was collected in the sterile test tube containing dulbecco 's modified eagle 's medium ( dmem ) and transported to the laboratory . ( a ) procuring gingival connective tissue ; ( b ) human gingival fibroblast in a mono layer ; ( c ) human gingival fibroblasts - acrolein treated ( 1:100000 molar ) ; ( d ) human gingival fibroblasts - acrolein treated(1:10000 molar ) after 3 washes in dmem supplemented with gentamycin , the tissues were minced into small pieces plated in petri dishes . trypsin - versene - glucose ( tvg ) solution containing 0.25% trypsin was added and incubated at 37c for 2 hours . the tvg was discarded , and the cells resuspended in dmem containing 10% fetal calf serum ( fcs ) , and were then seeded into 25 cm tissue culture flask and incubated at 37c in an atmosphere of 5% co2 . the confluent layer of cells obtained was designated as first passage cells . human gingival fibroblasts were seeded in 96 well microtitration plate at a density of 45,000 cells / well in dmem containing 10% fcs . about 24 wells seeded with 45,000 cells per well formed the sample group wherein three groups of 8 wells were treated with 10 , 310 and 10 m acrolein respectively in an atmosphere of 5% co2 and at a temperature of 37c . untreated cell cultures , obtained from the same biopsies as the test fibroblast cells , were utilized as the control group and the acrolein treated cells were considered as the study group . the attached cells at each of the different concentrations of acrolein were removed with 0.25% trypsin and evaluated by a neubauer hemocytometer . human gingival fibroblasts were seeded in 96 well microtitration plates at a density of 10,000 cells / dish in dmem with 10% fcs . cells were incubated for 24 hours at a temperature of 37c in an atmosphere of 5% co2 to allow attachment to the plate . culture wells were rinsed once to remove unattached cells and the culture medium was changed to fresh dmem with 10% fcs at 37c . cell cultures were incubated in the presence of 10 310 , 10 , 310 and 10 concentrations of acrolein . the wells were trypsinized ( 0.25% ) to remove the cells and then counted using a hemocytometer . the suspension was mixed thoroughly to disperse the cells and a small sample ( 20 l ) was collected into the tip of a pasteur pipette and transferred to the edge of the hemocytometer chamber . the cells lying within this 1 mm area were counted and analyses was made using the formula c = n / v where c is the cell concentration ( cells / ml ) , n is the number of cells counted and v is the volume counted ( ml ) . a total of 5 squares were counted using a slide of depth 0.1 mm and an area of 1 mm and values obtained using the equation c = n10/5 . the cell cultures were studied for morphology before counting , using an inverted phase contrast microscope ( leica , w. germany ) and photomicrographed . human gingival fibroblasts between 3 to 6 passages were grown to confluency . for the attachment assay , the cell cultures seeded in a 96 well microtitration plates at a density of 45,000 cells / well . they were then incubated at concentrations of 10 ( c1 ) , 310 ( c2 ) , 10 ( c3 ) acrolein in an atmosphere of 5% c02 and at a temperature of 37c . the proliferation assay that was carried over a 5-day period incubated cells at concentrations of 10 ( c1 ) , 310 ( c2 ) , 10 - 5 ( c3 ) , 310 - 6 ( c4 ) , 10 - 6 ( c5 ) acrolein in an atmosphere of 5% co2 and at a temperature of 37c . a total of 5 squares were counted and the concentration of human gingival fibroblast was evaluated using the formula c = n10/5 for 1 ml of suspension . in the present study , geometric mean and standard deviation were estimated for each study group after log transformation . the mean values were compared by one - way analysis of variance ( anova ) and further multiple range tests by tukey's- honestly significant difference ( hsd ) were employed to identify the significant groups at 5% level .",
"a split thickness flap was raised at the donor site using bard parker no-15 and careful dissection was carried out [ figure 1a ] . a conventional method was preferred over punch biopsy to delineate the epithelium from the underlying connective tissue . the biopsy tissue was collected in the sterile test tube containing dulbecco 's modified eagle 's medium ( dmem ) and transported to the laboratory . ( a ) procuring gingival connective tissue ; ( b ) human gingival fibroblast in a mono layer ; ( c ) human gingival fibroblasts - acrolein treated ( 1:100000 molar ) ; ( d ) human gingival fibroblasts - acrolein treated(1:10000 molar )",
"after 3 washes in dmem supplemented with gentamycin , the tissues were minced into small pieces plated in petri dishes . trypsin - versene - glucose ( tvg ) solution containing 0.25% trypsin was added and incubated at 37c for 2 hours . the tvg was discarded , and the cells resuspended in dmem containing 10% fetal calf serum ( fcs ) , and were then seeded into 25 cm tissue culture flask and incubated at 37c in an atmosphere of 5% co2 . the confluent layer of cells obtained was designated as first passage cells .",
"human gingival fibroblasts were seeded in 96 well microtitration plate at a density of 45,000 cells / well in dmem containing 10% fcs . about 24 wells seeded with 45,000 cells per well formed the sample group wherein three groups of 8 wells were treated with 10 , 310 and 10 m acrolein respectively in an atmosphere of 5% co2 and at a temperature of 37c . untreated cell cultures , obtained from the same biopsies as the test fibroblast cells , were utilized as the control group and the acrolein treated cells were considered as the study group . the attached cells at each of the different concentrations of acrolein were removed with 0.25% trypsin and evaluated by a neubauer hemocytometer .",
"human gingival fibroblasts were seeded in 96 well microtitration plates at a density of 10,000 cells / dish in dmem with 10% fcs . cells were incubated for 24 hours at a temperature of 37c in an atmosphere of 5% co2 to allow attachment to the plate . culture wells were rinsed once to remove unattached cells and the culture medium was changed to fresh dmem with 10% fcs at 37c . cell cultures were incubated in the presence of 10 310 , 10 , 310 and 10 concentrations of acrolein . the wells were trypsinized ( 0.25% ) to remove the cells and then counted using a hemocytometer .",
"the suspension was mixed thoroughly to disperse the cells and a small sample ( 20 l ) was collected into the tip of a pasteur pipette and transferred to the edge of the hemocytometer chamber . the cells lying within this 1 mm area were counted and analyses was made using the formula c = n / v where c is the cell concentration ( cells / ml ) , n is the number of cells counted and v is the volume counted ( ml ) . a total of 5 squares were counted using a slide of depth 0.1 mm and an area of 1 mm and values obtained using the equation c = n10/5 . the cell cultures were studied for morphology before counting , using an inverted phase contrast microscope ( leica , w. germany ) and photomicrographed . human gingival fibroblasts between 3 to 6 passages were grown to confluency . for the attachment assay , the cell cultures seeded in a 96 well microtitration plates at a density of 45,000 cells / well . they were then incubated at concentrations of 10 ( c1 ) , 310 ( c2 ) , 10 ( c3 ) acrolein in an atmosphere of 5% c02 and at a temperature of 37c . the proliferation assay that was carried over a 5-day period incubated cells at concentrations of 10 ( c1 ) , 310 ( c2 ) , 10 - 5 ( c3 ) , 310 - 6 ( c4 ) , 10 - 6 ( c5 ) acrolein in an atmosphere of 5% co2 and at a temperature of 37c . a total of 5 squares were counted and the concentration of human gingival fibroblast was evaluated using the formula c = n10/5 for 1 ml of suspension . in the present study , geometric mean and standard deviation were estimated for each study group after log transformation . the mean values were compared by one - way analysis of variance ( anova ) and further multiple range tests by tukey's- honestly significant difference ( hsd ) were employed to identify the significant groups at 5% level .",
"the human gingival fibroblast attachment evaluated at three hours indicated that acrolein caused a dose dependent inhibition of cell attachment [ table 1 ] . at low concentration of acrolein ( 10 - 5 ) as the concentration of acrolein increased ( 10 - 4 ) , the cells rapidly lost their attachment capacity [ table 2 ] . the number of cells attached / well decreased from a mean value of 29,930 in c3 group ( 10 - 5 ) to 20,505 in c1group ( 10 ) also the mean values in c3 ( 29,930 ) and c2 ( 27,441 ) were significantly higher compared to c1 ( 20,505 ) [ table 3 ] . in the present study , the human gingival fibroblast proliferation evaluated at five days indicated that the untreated cell cultures ( control group ) proliferated from 10,000 cells / well to an average of 29,697 cells / well [ table 4 , figure 2b ] . in the acrolein treated cell cultures ( study group ) , the proliferation ability decreases from 21,184 cells / well in the c5 ( 10 ) group to 10,154 in the c1 ( 10 ) group [ table 5 ] . further statistical evaluation indicates that : \n the mean value in the control group ( 29,697 ) is significantly higher than the mean values in the study group.the mean values of c5 ( 21,184 ) and c4 ( 20,068 ) are significantly higher than the mean values in c3 ( 16,691 ) , c2 ( 16,244 ) and c1 ( 10,154).further the mean values of c3 and c2 are significantly higher than c1 [ table 6 ] . thus a dose - dependent inhibition of proliferation is seen and at very high concentration ( 10 ) of acrolein a complete inhibition of proliferation is noted . \n the mean value in the control group ( 29,697 ) is significantly higher than the mean values in the study group . the mean values of c5 ( 21,184 ) and c4 ( 20,068 ) are significantly higher than the mean values in c3 ( 16,691 ) , c2 ( 16,244 ) and c1 ( 10,154 ) . further the mean values of c3 and c2 are significantly higher than c1 [ table 6 ] . thus a dose - dependent inhibition of proliferation is seen and at very high concentration ( 10 ) of acrolein a complete inhibition of proliferation is noted . human gingival fibroblast attachment in acrole in treated cell cultures ( study group ) ( a ) dose - related effects of acrolein on human gingival fibroblast attachment ; ( b ) dose - related effects of acrolein on human gingival fibroblast proliferation mean , standard deviation and test of significance of mean values between different study groups for attachment assay ( one - way anova ) mean , standard deviation and test of significance of mean values between different groups for attachment assay ( tukey- hsd ) human gingival fibroblast proliferation in acrolein treated cell culture mean , standard deviation and test of significance of mean values between different groups for proliferation assay ( one - way anova ) mean , standard deviation and test of significance of mean values between different groups for proliferation assay human gingival fibroblasts seen in the control group are spindle shaped , oriented in a parallel manner forming a cohesive layer [ figure 1b ] . in contrast , the test group shows disruption of the fibroblast cytoskeleton leading to loss of shape and orientation . there is a dose dependent increase in vacuolisation and degeneration of the nucleus observed [ figure 1c and d ] .",
"periodontal diseases are opportunistic infections caused by specific periopathogenic microorganisms and their metabolic products . the onset , progress , and severity are determined by the individual host response modulated by various factors . the current complex model maintains a bacterial etiology taking into consideration individual susceptibility as well as environmental and host response influences . the current list of risk indicators and putative risk factors is being shaped by ongoing research efforts , and multiple attributes and exposures have been associated with increased odds of periodontitis . this has led to the current understanding that periodontitis is a multifactorial disease whose clinical manifestations are the result of specific interactions between particular genetic susceptibility traits and environmental factors . experimental evidence accumulated over the last two decades has indicated that cigarette smoking is a true risk factor for periodontitis . tonetti has indicated that this environmental exposure has been associated with 2 - 3 fold increase in the odds of developing clinically detectable periodontitis . regression analyses done by zambon et al . , have shown that the relative risk of attachment loss among 25 - 74 year subjects with a history of moderate smoking was 2.77 and 4.75 for heavy smokers . periodontal disease is the result of an imbalance between tissue destruction and repair . in health , fibroblasts are responsible for the production and maintenance of the connective tissue matrix . they are the predominant cells of the periodontal ligament and have an important role in the development , function and regeneration of the tooth support . in consideration of the important role played by fibroblasts in the periodontal ligament homeostasis , they have been described by tencate as the architect , builder , and caretaker of the periodontal ligament . in recent years , many clinical and epidemiological studies have indicated that cigarette smoking significantly increases the risk factor for periodontal disease , especially in younger people . haber et al . , have demonstrated that the noxious effect of cigarette smoking , rather than poor oral hygiene and increased plaque , act directly on periodontal tissues . evidence indicates that tobacco and some of its volatile and non - volatile components have been found to affect many types of cells including gingival fibroblasts . among the volatile components of cigarette smoke some reactive aldehydes have a prominent cytopathic effect . grafstrom et al . , have recognized them to have a high cytotoxic and genotoxic effect on cultured human bronchial epithelial cells and fibroblasts , and inhibit both fibroblast - mediated gel contraction and fibronectin production . acrolein , one subtype of several aldehydes present in cigarette smoke is a very reactive volatile compound . in cigarettes , acrolein being a cytotoxic agent induces microtubule depolymerisation , and triggers feedback inhibition of new tubulin synthesis affecting cell adhesion and proliferation . the adhesion capacity and organization of the cytoskeleton microtubules and vimentin associated filaments in cultured human gingival fibroblasts , we examined the attachment , proliferation and morphology of human gingival fibroblasts in culture after exposure to acrolein . for this study , , recognized that it is present in small , but significant or toxic quantities in cigarette smoke . human gingival fibroblast strains from healthy subjects with non - inflamed gingiva who were never exposed to tobacco were included in the study . the criteria for selecting the particular age group was based on studies by haber and monterio da silva which have indicated that cigarette smoking significantly increases the risk factor for periodontal disease especially in younger people . these results are in agreement with the study done by rota who stated that acrolein caused a dose - dependent inhibition of human gingival fibroblast adhesion strictly related to the morphological alterations of cytoskeletal structures , and by cattaneo who stated that acrolein caused a dose dependent inhibition of human gingival fibroblast attachment and proliferation when subjected to different concentrations of acrolein ranging from 10 to 10 . further evidence is obtained from a study by poggi , which indicated that acrolein produced a dose - dependent decrease in cell replication and adhesion by causing a disruption of microtubules , vimentin intermediate filaments and actin filaments . thus , maurizio s. tonetti stated that although no direct causative role of cigarette smoke on periodontal diseases has been proven , a connection is considered to be plausible .",
"this study confirms the hypothesis that cigarette smoke is a significant risk factor in the development and progression of periodontal disease and impairs the ability of gingival fibroblasts to maintain the integrity of the periodontal connective tissue ."
] | aim : tobacco and some of its volatile and non - volatile components have been found to affect many types of cells including human gingival fibroblasts . the aim of this present study was to estimate the effect of acrolein , a volatile fraction of cigarette smoke on the attachment , proliferation and ultra structure of human gingival fibroblasts in culture.materials and methods : human gingival fibroblasts strains obtained from healthy subjects aged 20 - 30 years , were grown to confluency and utilized between 3rd -6th passages . the cell cultures seeded in 96 well microtitration plates at a density of 45,000 cells / well were incubated with acrolein at concentrations of 10 - 4 , 310 - 5 and 10 - 5 . attachment ability was evaluated after three hours using neubauer hemocytometer . for the proliferation assay cell cultures seeded at a density of 10,000 cells / well were incubated at concentrations of 10 - 4 , 310 - 5 , 10 - 5 , 310 - 6 , 10 - 6 and cell count determined after 5 days using a hemocytometer . cell morphology was examined under phase contrast microscope.results:acrolein produced a dose - dependent cytotoxic effect on human gingival fibroblasts with complete inhibition of attachment and proliferation at higher concentrations.conclusion:this supports the hypothesis that cigarette smoke is a great risk factor in the development and progression of periodontal disease . |
[
"\n\t\t\t\t despite significant advances in our understanding of paediatric pain and the publication of pain management guidelines by several leading paediatric bodies in recent years , multiple studies and reviews show that pain in children continues to be poorly managed . as maclean et al . ( 2007 ) note , there remains a gap between what we know to be effective , easily implemented pain management strategies , and what is actually practiced . given these findings are based on their review of pain management practices in a paediatric teaching hospital in a high income country , it is perhaps not surprising this gap is larger in low income countries where resources , in their broadest sense , are more constrained . some barriers to managing a child 's pain are common to a wide variety of health care settings , such as lack of provider training in the recognition , assessment and management of pain , and attitudes and beliefs regarding pain and its management . other barriers likely play a significant role mainly in low income countries where resources in terms of manpower , equipment , and medications , are in chronic short supply and must be balanced across the competing needs of patients presenting to providers practicing in these settings . despite these issues , given the current state of knowledge in this area , and the wide variety of options now available for managing paediatric pain , many of these barriers can be overcome through adaptation of published guidelines to address the unique needs and barriers of specific health care settings . this paper describes the development of a paediatric analgesia and sedation protocol , tailored to the specific setting of the medical research council ( mrc ) paediatric ward in the gambia , west africa . although a combined paediatric and adult protocol was ultimately developed , only the paediatric portion is reported here . for clarity of presentation , the protocol development process will be described in 3 steps . however , it is important to note , that an iterative process was employed beginning with a recognized need to improve pain management expressed by local clinical staff , and with feedback from local providers sought and incorporated throughout the development process .",
"as noted above , protocol development began with an expressed desire for a pain management protocol tailored to the mrc paediatric ward , to facilitate efforts by clinical staff toward improving pain management . as a first step , key local informants including the senior clinician of the hospital , the matron , and another senior nurse , were interviewed to gain a comprehensive understanding of the hospitals resources , current practices and staff level of training , medication availability , and cost implications . two important considerations emerged from this consultation process , which were shortage of airway support capabilities and limited staff training in pain assessment and monitoring . to further assess the airway capabilities on the ward , sufficient airway equipment was located to organize two complete airway kits , which included oral airways , bag - valve - masks , intubation medications and equipment . discussions with physician and nursing staff , revealed both had little training or experience in pain management . for this reason it was felt that a more directive and structured protocol , with a strong educational component to accompany roll out of the protocol was needed . the second step in development of the protocol began with a review of published paediatric analgesia and sedation guidelines , the evidence base for their development where possible , and consultation with experts in paediatric sedation and analgesia . as most published guidelines were developed in and for high income health care settings , during the review process and again in consultation with key local informants a list of issues relevant to paediatric pain management on the mrc ward was identified . concerns were identified with respect to several unique attributes of the gambian population , specifically the relative high prevalence of hemoglobinopathies [ 3 , 4 ] and under - nutrition particularly in the first 2 years of life . it was notable that despite the importance of cultural in perceptions and beliefs with respect to pain , no cultural issues were identified as important to pain management efforts in this setting . hemoglobinopathies , like sickle cell anemia and glucose-6-phosphatase deficiency ( g6pd ) , are relatively common in the gambia [ 3 , 4 ] and present challenges for managing pain . many established guidelines and experts recommend against sedation in sickle disease patients , and sickle trait patients with low oxygen saturations , unless anaesthesia is in attendance . given anaesthesia support is not available at the mrc , these were included as absolute contraindications to sedation in the mrc protocol . of additional concern is the potential for local anaesthetic induced methemoglobinemia . for a variety of reasons , including effectiveness , hemodynamic safety requiring no special monitoring , and availability of inexpensive preparations , local anaesthetics are ideal for management of brief painful procedures . while a variety of local anaesthetics have been reported to induce methemoglobinemia , reported cases have occurred mainly in very young infants or where excessive quantities of topical anaesthetic are used . although an uncommon complication and relatively easily managed in the general population with methylene blue , treatment of methemoglobinemia is significantly more complicated in individuals with g6pd deficiency where methylene blue can cause acute hemolysis and more intensive care , including exchange transfusions , may be required . given the high incidence of g6pd in the gambian population , cost and time required for testing , and potential for this serious complication whose treatment is beyond the resource capacity of the setting , use of topical anaesthetics was strictly limited to children at least 6 months of age and within recommended dosing guidelines . guidelines and experts generally recommend 3 months of age corrected for prematurity ; however , given the prevalence of under - nutrition and difficulties in accurately assessing both age of gestation and date of birth in this setting , the age restriction was broadened to ensure minimum safety guidelines were observed . based on the findings of the first two stages of protocol development outlined above , a draft protocol was created and circulated to key local informants and an expert in paediatric pain management for feedback and amendment . perhaps not surprising considering the iterative nature of the development process , with the exception noted below , no major changes were suggested . at this stage the draft appeared as a numbered list of process steps with considerations at each step outlined within the section . for example , within the analgesia section , all available options were listed with their indications , contraindications , and dosages . while this format was modelled after other published protocols , and meant to emphasize options and provider choice , feedback from key local informants suggested that a more limited and algorithmic approach , presented as a flow chart would facilitate adoption of the protocol , particularly early on in the course of the campaign to improve pain management . based on this feedback the protocol was reworked into a flow chart ( see figure 1 ) , with the original protocol with small amendments included as a detailed reference or guide . the amended draft was again circulated to key local informants and the pain management expert , with no further revisions suggested . as a final step in the development of the protocol , the protocol was presented to the physician group at academic rounds , and at a staff meeting to the nursing and health attendant staff , with minor changes to the protocol incorporated as a result of feedback from these sessions .",
"in addition to the final product , that is , the paediatric pain management protocol tailored to the mrc ward , other benefits were gained through the process of development . as a result of the equipment survey , two airway kits were created and placed together with other basic resuscitation equipment into a strategic location within the unit for ready access . equally important is early evidence that through the educational and feedback sessions , further interest in improving patient care was fostered among clinical staff . as one physician reported i encountered a case today where i would normally not have considered pain management , but after the session the other day , i decided i better do something . as clemmer and spuhler ( 1998 ) have argued , the purpose of creating protocols is greater than reducing practice variation , it also creates new paradigms and changes the culture in which health care is delivered , with the protocol itself designed to be transient , and the development process and the changes it produces , more important than the product itself . however , to ensure successful implementation of the protocol and ongoing improvements in paediatric pain management , further steps are needed . ongoing education of clinical staff , particularly early in the implementation process and as new staff are hired , is essential to ensure safe and appropriate pain management procedures . intermittent reassessment and revision based on experiences in using the protocol is needed to allow for adaptation as the needs of the patients served and the resources and options available change .",
"despite some progress in recent years , pain continues to be undertreated globally , particularly in children , and particularly in low income countries . published guidelines based on best available evidence , can and should be adapted to allow for optimal pain management given the resources and capabilities of a given health care setting . it is hoped that the development process and protocol described here will not only help to improve care on the mrc ward , but serve as an example to others working toward improving pain management in similar health care settings ."
] | despite recent advances in our understanding of paediatric pain and its management , pain continues to be undertreated globally , particularly in children and in low income countries . this article describes the development of a paediatric analgesia and sedation protocol , tailored to the specific setting of the medical research council ( mrc ) paediatric ward in the gambia , west africa . an iterative process was used throughout development , with inputs from the medical literature , local providers , and pain experts , incorporated to ensure a safe , effective , and locally appropriate protocol . we demonstrate that evidence - based published guidelines , can and should be adapted to allow for optimal pain management given the resources and capabilities of specific health care settings . it is hoped that the process and protocol described here , will not only help to improve care on the mrc ward , but serve as an example to others working toward improving pain management in similar health care settings . |
[
"h. pylori infection is reported to include pathologic changes of the stomach , including edema and congestive surface epithelium . a characteristic event in gastritis is the infiltration of the subepithelial gastric lamina propria by phagocytes , mainly neutrophils and macrophages , that produce large amounts of reactive oxygen species ( ros ) . ros activate the oxidant - sensitive transcription factor nf-b , which induces expression of the inflammatory genes , oncogenes , and cell - cycle regulators . h. pylori - induced gastric mucosal injury and inflammation are mediated by proinflammatory cytokines such as interleukin ( il)-8 and il-1 as well as inflammatory enzymes , including inducible nitric oxide synthase ( inos ) . transcription of these inflammatory mediators is regulated by the oxidant - sensitive transcription factor nf-b [ 610 ] . nf-b is an inducible transcription factor composed of p50/p65 ( heterodimer ) or p50 ( homodimer ) . nf-b is retained in the cytoplasm by binding to the inhibitory protein ib. extracellular stimuli trigger rapid degradation of ib by proteasomes , allowing nf-b to translocate into the nucleus and bind to the dna sites of target genes , including il-8 , il-1 , and inos . . h. pylori - elicited neutrophils produce ros , which subsequently injure gastric mucosal cells . ros cause peroxidation of membrane lipids , thus increasing the level of lipid peroxide ( lpo ) in the damaged tissues . we previously demonstrated that lpo production increases in parallel with il-8 production in h. pylori - infected cells . myeloperoxidase ( mpo ) is more abundantly expressed in neutrophils than other cells and thus , is used as a biomarker for neutrophil infiltration . in neutrophils , . therefore , high levels of lpo and increased mpo activity could reflect oxidative damage and inflammatory responses of cells . korean red ginseng , which is the steamed root of a 6-year - old korean ginseng ( panax ginseng meyer ) , is used in asian countries as a traditional medicine for the treatment of various diseases , including inflammatory disorders [ 1618 ] . an in vitro study showed that korean red ginseng inhibited adhesion of h. pylori to gastric epithelial cells . korean red ginseng extract ( rge ) inhibits h. pylori - induced oxidative damage in gastric epithelial cells . previously we showed hepatoprotective effects of korean red ginseng in rats and mouse liver , which may be contributed by its antioxidant activity . therefore , the antioxidant or anti - inflammatory effects of rge , containing ginsenosides , may protect gastric mucosa from inflammation caused by h. pylori infection . in the present study , we investigated whether rge protects against h. pylori - induced gastric inflammation in mongolian gerbils . animal models for h. pylori infection have been developed to replicate many features of human gastric inflammation and carcinogenesis in order to test potential therapeutic agents for the prevention and treatment of h. pylori - associated gastric disease . the mongolian gerbil model is the best animal model for this purpose because h. pylori infection induces chronic gastritis , gastric ulcers , and intestinal metaplasia in these animals . mongolian gerbils develop gastric neoplasia and gastric cancer after chronic infection by h. pylori strain 7.13 , as used in the present study . after the infection of gerbils with h. pylori , we determined : the changes in lpo level , which is an index of oxidative membrane damage ; the activity of mpo , a biomarker of neutrophil infiltration ; the induction of inflammatory mediator keratinocyte chemoattractant factor ( kc ) , an il-8 homolog in rodents ; il-1 ; inos ; and the phosphorylation of ib , which reflects the activation of nf-b . in addition , viable h. pylori colonization in the stomach , changes in food intake and body weight , stomach weight / total body weight , and histological analysis of gastric mucosa were compared between animals that received rge and those that did not .",
"five - wk - old male specific - pathogen - free mongolian gerbils ( mgs / sea ) with an average weight of approximately 40 g were purchased from charles river laboratories ( wilmington , ma , usa ) . gerbils were housed in polypropylene cages on hard wood chip bedding in groups of five / cage . the animals were maintained in a temperature - controlled room ( 22 2c ) with a 12-h light protocols were reviewed and approved by the institutional animal care and use committee of the yonsei university medical center ( seoul , korea ; permit no . all animals were maintained in the specific pathogen - free facility at yonsei university medical center . bacteria were grown on horse blood agar plates containing 4% columbia agar base ( oxoid , basingstoke , hampshire , uk ) , 5% defibrinated horse blood ( hemostat labs , dixon , ca , usa ) , 0.2% -cyclodextrin , 10 g / ml vancomycin , 5 g / ml cefsulodin , 2.5 u / ml polymyxin b , 5 g / ml trimethoprim , and 8 g / ml amphotericin b at 37c under microaerophilic conditions . a microaerobic atmosphere was generated using a campygen sachet ( oxoid ) in a gas pack jar . for liquid culture , h. pylori was grown in brucella broth ( difco & bbl diagnostics , franklin lakes , nj , usa ) containing 10% fbs ( gibco - brl , grand island , ny , usa ) . 10 bacteria were collected and resuspended in 500 l of brucella broth for the infection of each animal . a standardized water extract of korean red ginseng was prepared and supplied by the korea ginseng corporation ( daejeon , korea ) as described previously . the content of crude saponin in rge is approximately 7% , and it is composed of the following ginsenosides : 8.27 mg / g of rb1 , 3.22 mg / g of rb2 , 3.90 mg / g of rc , 1.09 mg / g of rd , 2.58 mg / g of re , 1.61 mg / g of rf , 2.01 mg / g of rg1 , 1.35 mg / g for ( 20s)-rg2 , 1.04 one wk after inoculation with h. pylori , mongolian gerbils were fed control ain76a diet ( research diets , inc , new brunswick , nj , usa ) or a diet containing rge ( 200 mg rge / each gerbil ) for 6 wk . as a negative control , mongolian gerbils that were not inoculated with h. pylori were fed the control diet ain76a . gerbils that were inoculated with h. pylori were fed the control diet ain76a and considered as a positive h. pylori control . this level of rge supplementation ( 200 mg rge / gerbil ) was adapted from previous studies showing the protective effect of rge against oxidative stress - mediated epithelial damage . body weight and food intake were measured every wk during the experimental period . at the end of experimental period , gastric mucosal tissues were examined histologically and h. pylori colonization was confirmed . for biochemical analyses , gastric mucosal samples were homogenized in 10 mm tris buffer ( ph 7.4 ) . the homogenates were used for determining lpo level , mpo activity , and protein levels of kc , inos , phospho - specific ib and ib. for mrna level of kc , il-1 , and inos , total rna was isolated from a gastric mucosal sample by the guanidine thiocyanate extraction method . rge supplementation had no effect on any of these parameters in animals not infected with h. pylori , determined in our preliminary study . the number of viable h. pylori in the animal stomach was determined as previously described . after the animals were fasted for 24 h , they were euthanized , and their stomachs excised . the stomach was dissected along the greater curvature and washed with 0.01 m phosphate - buffered saline ( pbs , ph 7.4 ) and then divided longitudinally into two halves . one half of each stomach was homogenized in 10 ml of pbs using a polytron . the plates were incubated at 37c under microaerobic conditions for 5 d. the colonies were counted and the number of viable h. pylori was expressed as colony forming units / g of tissue . the other half of each stomach was fixed in 10% neutral buffered formalin and embedded in paraffin . paraffin sections were cut into 4-m slices and stained with hematoxylin and eosin for morphological observation . morphological features of the gastric antrum and body were graded using the following four - point scale : grade 0 ( normal ) , grade 1 ( mild ) , grade 2 ( moderate ) , and grade 3 ( severe ) . four aspects of gastric lesions were recorded according to the updated sydney system : polymorphonuclear leukocytes ( pmns ) infiltration ; chronic inflammation , such as mononuclear cell infiltration and lymphoid nodule formation ; intestinal metaplasia and hyperplasia ; and formation of heterotopic proliferative glands . lpo levels were measured by colorimetric assay as thiobarbituric acid reactive substances and the results were expressed as pg / mg protein . one unit of mpo activity was defined as the activity required to degrade 1 mol of peroxide / min at 25c . mrna expression of inos and kc was assessed using real - time reverse transcription - polymerase chain reaction ( rt - pcr ) analysis . total rna isolated from mucosal homogenate was reverse transcribed into cdna and used for pcr with mongolian gerbil - specific primers for kc , il-1 , inos , and -actin . sequences of kc primers were cacccgctcgcttcttc ( forward primer ) and atgctcttggggtgaatcc ( reverse primer ) . for inos , the forward primer was gcatgaccttggtgtttgggtgcc and the reverse primer was gcagcctgtgtgaacctggtgaagc . for -actin , real - time rt - pcr reactions were prepared using taqman reagents ( applied biosystems , foster city , ca , usa ) for inos , kc , and -actin . a dna engine ( ptc-200 ) and its system interface software ( mj research , waltham , ma , usa ) were used to run samples and analyze data . the -actin gene was amplified in the same reaction and served as the reference gene . kc and inos mrna levels were reported relative to those of animals not inoculated with h. pylori that were fed the control diet . kc and inos mrna values for the negative control group were set equal to 1 . the level of kc in gastric mucosal tissues was measured using an enzyme - linked immunosorbent assay and a mouse kc assay kit ( ibl , gunma , japan ) . total cell extracts were prepared from gastric mucosa and separated by sds - polyacrylamide gel electrophoresis under reducing conditions . after blocking using 5% nonfat dry milk , the membranes were incubated with anti - inos ( santa cruz biotechnology , santa cruz , ca , usa ) , anti - phospho - ib , anti - ib ( cell signaling technology , inc . , beverly , ma , usa ) , and anti - actin antibodies ( santa cruz biotechnology ) . the immunoreactive proteins were visualized using anti - mouse secondary antibody conjugated to horseradish peroxidase , followed by enhanced chemiluminescence ( amersham ) . cary , nc , usa ) . statistical differences between groups were determined using one - way analysis of variance and newman keuls test . all values were expressed as the mean standard deviation for 10 gerbils in each group .",
"in order to examine gross changes of h. pylori - infected mongolian gerbils consuming rge dietary supplements , food intake and body weight change were determined every wk during the experimental period . the weight gain and food intake were similar in all three groups ( data not shown ) . this finding was supported by previous studies showing that h. pylori infection did not affect either body weight or food intake in mongolian gerbils . to determine whether rge inhibits h. pylori colonization in gastric mucosa , the number of viable h. pylori in the stomachs of gerbils infected with h. pylori were determined after 6 wk of dietary supplementation with rge ( fig . in addition , stomach wet weights were compared between groups at the end of the experiment ( fig . animals infected with h. pylori had significantly more h. pylori colonization and greater stomach weight than noninfected animals . rge supplementation had no effect on the number of viable h. pylori in the stomach . h. pylori - induced increases in the stomach weight tended to be smaller in the rge - treatment group than in the control - diet group , but this difference was not significant . rge had no antibacterial effect and did not reduce pathologic changes of the stomach , such as edema , in animals infected with h. pylori . in h. pylori - infected animals , moderate to severe gastritis was accompanied by pmn infiltration , mainly neutrophil infiltration , and by lymphoid follicle formation in the mucosa and submucosa . the hyperplasia and mucous - gland metaplasia of epithelial cells in infected animals were obvious ( fig . 2a , middle panel ) in comparison with the normal gastric mucosal regions of noninfected animals ( fig . the gastric mucosal lesions of rge - supplemented animals showed less evidence of inflammatory cell infiltration , hyperplasia , and intestinal metaplasia than those of infected animals fed the control diet ( fig . 2a , right panel ) . h. pylori - induced chronic inflammation was reduced by rge treatment . however , none of these differences between h. pylori - infected animals that were supplemented with rge and those that were fed the control diet were significant . taken together , rge improved the histological grade of pmn infiltration , intestinal metaplasia , and hyperplasia in mongolian gerbils , which suggests that rge has an anti - inflammatory effect against h. pylori - induced gastric inflammation . 3a , mpo activity in gastric mucosa was increased by h. pylori infection , and was attenuated by rge supplementation . the reduced mpo activity in the gastric mucosal tissues of the rge - treatment group was associated with reduced infiltration by neutrophils ( fig . 2 ) . rge supplementation inhibited h. pylori - induced neutrophil infiltration in the gastric mucosal lesions of mongolian gerbils . the level of lpo , an oxidative damage index , was higher in the gastric mucosal tissues of h. pylori - infected animals than that in noninfected animals ( fig . rge supplementation suppressed the h. pylori - induced increase in the lpo level of gastric mucosal tissues . to investigate the inhibitory effects of rge against h. pylori - induced inflammation , the expression levels of important inflammatory mediators ( kc , il-1 , inos ) were determined in the gastric mucosal tissues of animals infected with h. pylori that were and were not supplemented with rge . as shown in fig . 4 , the mrna expression of kc , il-1 , and inos in gastric mucosal tissues was greater in h. pylori - infected animals than in non - infected animals . il-1 , and inos was significantly lower in the rge - treatment group than in the control - diet group . protein levels of kc and inos induced by h. pylori infection were also lower in the rge - treatment group than in the control - diet group , as determined by enzyme - linked immunosorbent assay and western blotting , respectively ( fig . 5b , the level of phospho - ib was greater in the h. pylori - infected groups than in the noninfected group , and was lower in the rge - treatment group than in the control - diet group . ib , which was lower in the h. pylori - infected groups than in the noninfected group , was maintained in the rge - treatment group . this suggests that rge supplementation may inhibit nf-b activation by suppressing phosphorylation of ib in the gastric mucosal tissues of h. pylori - infected mongolian gerbils .",
"the present study demonstrates that dietary supplementation of rge fed to mongolian gerbils for 6 wk improves h. pylori - induced gastric lesions , as determined by histological observation . rge moderated the h. pylori - induced increase in neutrophil infiltration , mpo activity , lpo level , and the expression of inflammatory mediators ( kc , il-1 , inos ) . rge was also associated with a reduction in i phosphorylation relative to that measured in animals fed the control diet . this demonstrates that rge has an anti - inflammatory effect on h. pylori - induced gastric inflammation in mongolian gerbils . however , the number of viable bacteria obtained from the gastric mucosal tissues of h. pylori - infected animals fed a diet supplemented with rge was not different from that obtained from animals receiving a control diet without rge . rge may not have an antibacterial effect on h. pylori colonization in the gastric mucosa of mongolian gerbils . a previous study demonstrated that panaxytriol isolated from ginseng was effective in inhibiting h. pylori growth with an mic of 50 g / ml . however , our preliminary study using gastric epithelial ags cells showed that rge did not affect the growth of h. pylori for 24 h culture ( data not shown ) . in addition , long - term exposure of rge to the cells and animals infected with h. pylori is necessary to determine whether rge has bactericidal / bacteriostatic effect . even though rge has no cytotoxic effect on the bacterium , rge may be beneficial for preventing and inhibiting the development of the gastric inflammation induced by h. pylori infection by reducing oxidative stress and suppressing the expression of inflammatory mediators in gastric mucosa . kc , an il-8 homolog , is a neutrophil chemoattractant that is involved in murine inflammation by stimulating neutrophil infiltration into infected tissues . increased activity of mpo represents neutrophil infiltration to the infected tissues and propagation of inflammation . h. pylori - associated gastric mucosal injuries , including inflammation , are attributed to the activated neutrophils that adhere to postcapillary venules and subsequently migrate into the interstitium . we found that h. pylori infection increased kc expression and mpo activity , suggesting increased infiltration of neutrophils into gastric mucosal tissues of mongolian gerbils . the results are supported by histological observation showing neutrophil infiltration in h. pylori - infected gastric mucosa in the present study . because rge supplementation reduced kc expression , rge may attenuate gastric inflammation by suppressing kc - mediated neutrophil infiltration into h. pylori - infected gastric mucosal tissues of mongolian gerbils . rge supplementation inhibited the expression of the inflammatory mediators ( inos , kc , and il-1 ) that was induced by h. pylori infection . increased activity of inos and high levels of kc and il-1 have been observed in the gastric mucosa of patients with chronic gastritis and gastric adenocarcinoma . neutrophil infiltration is positively correlated with the expression of inos and inflammatory cytokines in gastric mucosa . these studies showed that the upregulation of inos , kc , and il-1 by h. pylori infection might be associated with neutrophil infiltration . ros are produced from the activated neutrophils in h. pylori - infected gastric mucosa . ros activate oxidant - mediated transcription factors such as nf-b , which induces the expression of inos , kc , and il-1. therefore , rge inhibits the expression of inflammatory cytokines including inos , kc , and il-1 by suppressing the neutrophil infiltration caused by h. pylori infection in the gastric mucosa of mongolian gerbils . because the expressions of inflammatory mediators are critical for gastric inflammation and carcinogenesis , rge may prevent the development of the gastric inflammation and gastric cancer that is associated with h. pylori infection . phosphorylation of ib is required for nf-b activation , which regulates the expression of kc , il-1 , and inos . phosphorylation of ib acts as a trigger for ib degradation , allowing the nuclear translocation of nf-b and the expression of nf-b target genes . even though the mongolian gerbil model is good for studying gastric inflammation and gastric cancer induced by h. pylori infection , there are few antibodies reported in the studies using mongolian gerbils . due to lack of antibodies , it is difficult to examine the serum levels of inflammatory mediators such as cytokines , which is a noninvasive way to confirm gastritis . therefore , we assessed the phospho - specific form of ib as a biomarker of nf-b activation in the present study . several studies have demonstrated that h. pylori induces the expression of proinflammatory mediators such as kc , il-1 , and inos through the activation of nf-b . in the present study , the results suggest that rge inhibits the expression of kc , il-1 , and inos in the h. pylori - infected gastric mucosal tissues of mongolian gerbils by suppressing the phosphorylation of ib , and thus inhibits nf-b activation . lipid peroxidation is involved in the pathogenesis of gastric diseases , including gastritis , that are associated with h. pylori infection . in the present study , the lpo level in the gastric mucosal tissues of mongolian gerbils was increased by h. pylori infection . the inhibitory effect of rge on increases in lpo levels induced by h. pylori infection may be related to a reduction in mpo activity in the gastric mucosal tissues of animals supplemented with rge . the main source of ros production may be host neutrophils that are activated by h. pylori \n . therefore , rge may decrease the production of ros and lipid peroxidation through inhibition of kc - mediated neutrophil infiltration in h. pylori - infected gastric mucosa . previously , we found that h. pylori itself activates nadph oxidase to produce ros in gastric epithelial cells , resulting in the induction of nf-b - mediated expression of il-8 , il-1 , and inos [ 68 ] . therefore , rge may inhibit nadph oxidase and thus suppress the ros production that activates nf-b and induces expression of il-8 , il-1 , and inos in gastric epithelial cells . further study should be undertaken to determine whether rge inhibits ros production by suppressing nadph oxidase in h. pylori - infected gastric epithelial cells or gastric mucosal tissues . the present study suggests that rge attenuates h. pylori - induced expression of inflammatory mediators without affecting the number of viable h. pylori . therefore , it is assumed that rge suppresses h. pylori - induced inflammation including nf-b activation and expression of inflammatory mediators , without direct action on h. pylori . even though the first choice of the h. pylori therapy is eradication of the bacteria by antibiotics , the complete clearance of the bacteria is difficult in most patients . the inhibition of h. pylori - induced expression of inflammatory mediators by rge may be useful for prevention of inflammation and possibly carcinogenesis mediated by the h. pylori infection . our findings demonstrate that h. pylori induced oxidative stress ( determined by lpo levels in gastric mucosa ) , inflammation ( examined by expressions of cytokines and inos , histologic observation of neutrophil infiltration , and mpo activity ) , and proliferation ( observed by histologic hyperplasia ) , which were inhibited by rge treatment . the precise mechanism of rge on proliferation , mucosal destruction , inflammation , oxidative stress , and any presence of dysplasia or metaplasia should be determined to evaluate the anti - inflammatory effect of rge using various gastric epithelial cells infected with h. pylori . in conclusion , rge supplementation inhibits neutrophil infiltration and lipid peroxidation , determined by mpo activity and lpo level , and attenuates the induction of inflammatory mediators ( kc , il-1 , inos ) , which results in suppression of h. pylori - induced gastric inflammation in mongolian gerbils . therefore , rge may be beneficial for the prevention and treatment of h. pylori - associated gastric inflammation .",
""
] | helicobacter pylori - induced gastric inflammation includes induction of inflammatory mediators interleukin ( il)-8 and inducible nitric oxide synthase ( inos ) , which are mediated by oxidant - sensitive transcription factor nf-b . high levels of lipid peroxide ( lpo ) and increased activity of myeloperoxidase ( mpo ) , a biomarker of neutrophil infiltration , are observed in h. pylori - infected gastric mucosa . panax ginseng meyer , a korean herb medicine , is widely used in asian countries for its biological activities including anti - inflammatory efficacy . the present study aims to investigate whether korean red ginseng extract ( rge ) inhibits h. pylori - induced gastric inflammation in mongolian gerbils . one wk after intragastric inoculation with h. pylori , mongolian gerbils were fed with either the control diet or the diet containing rge ( 200 mg rge / gerbil ) for 6 wk . the following were determined in gastric mucosa : the number of viable h. pylori in stomach ; mpo activity ; lpo level ; mrna and protein levels of keratinocyte chemoattractant factor ( kc , a rodent il-8 homolog ) , il-1 , and inos ; protein level of phospho - ib ( which reflects the activation of nf-b ) ; and histology . as a result , rge suppressed h. pylori - induced mrna and protein levels of kc , il-1 , and inos in gastric mucosa . rge also inhibited h. pylori - induced phosphorylation of ib and increases in lpo level and mpo activity of gastric mucosa . rge did not affect viable h. pylori colonization in the stomach , but improved the histological grade of infiltration of polymorphonuclear neutrophils , intestinal metaplasia , and hyperplasia . in conclusion , rge inhibits h. pylori - induced gastric inflammation by suppressing induction of inflammatory mediators ( kc , il-1 , inos ) , mpo activity , and lpo level in h. pylori - infected gastric mucosa . |
[
"fungal infections represent today a serious and notyetsolved health problem even in industrialized countries ( sternberg , 1994 ; edmond et al . , 1999 ; zaoutis et al . , 2005 ; pfaller and diekema et al . , 2007 ) not only hiv infection , but lifeprolonging technologies invasive technologies , therapy prior to organ transplantation and anticancer drugs have provided an opportunity for fungi to colonize and cause disease in humans . in europe , fungal infections account for 17% of the intensive care unit infections ( rupp , 2007 ) and in the usa , deaths caused by fungal infections have increased from the 10th most common cause of death among hospitalized individuals to 7th in the last 10 years ( martin et al . , 2003 ) . and not only the incidence but the diversity of pathogenic fungi encountered as etiological factors of fungal infections has increased in the last years in immunocompromissed individuals . in these patients , eradication of the infection relies in chemotherapy . while superficial infections caused by dermatophytes are relatively simple to eradicate , treatment of deep invasive mycosis is more complex as the therapeutic arsenal available is more limited . polyenes and azoles ( and only recently echinocandines ) are the frequent choice and pharmacokinetics limits , in some cases , their utility while the development of resistance against azoles , the most common agents , may limit their usefulness in the coming years ( sanglard et al . , 1995 ; the identification of novel therapeutic approaches to fight against disease is therefore of primary importance in basic research . the main reason for this relies on its common niche , as this fungus inhabits the human gastrointestinal and urogenital tract in a significant part of the population , where it behaves as a harmless commensal organism ( odds , 1988 ) . however , upon alteration of the host defences , c. albicans disseminates within the human body gaining access to internal organs and causing severe infections ( called candidiasis ) . candida albicans thus behaves as an opportunistic pathogen . the ability of this fungus to change its morphology from a yeastlike ( unicellular ) to a filamentous ( hyphal or mycelia ) form ( a property called dimorphism ) is environmentally regulated by factors , such as the temperature ( lee et al . , 1975 ) , the ph ( soll et al . , 1978 ; odds , 1994 ) or the availability of nutrients ( gow and gooday , 1982 ) , and plays a major , albeit nonexclusive , role in its ability to produce disease ( ryley and ryley et al . , 1990 ; lo et al . , 1997 ; kobayashi and cutler , 1998 ; romani , 2004 ) . spores ( resting conidia ) of a. fumigatus are ubiquitous in the environment and are continuously inhaled and deposited in the lungs where they are phagocytosed and eliminated . however , in the impaired immune individuals , conidia germinate and destroy alveolar macrophages , mature into germ tubes and hyphae that can in turn invade vessels and disseminate hematogenously ( latge , 1999 ) . due to the mechanism of dissemination of spores ( air ) , infections are difficult to control even in carefully controlled environments and may lead to death of the patient . cryptococcus neoformans is the most common cause of fungal infections of the central nervous system . cryptococcus neoformans is a basidiomycete yeastlike fungus found in the environment that can infect and cause disease in a wide variety of animal hosts , insects , birds and humans ( perfect and casadevall , 2002 ) . infection in humans also occurs by inhalation of basidiospores that enter the lungs , either proliferating immediately or establishing a dormant infection that can be reactivated at a later stage depending on the host . a characteristic feature of this fungus is the presence of a capsule , which is unique in fungal pathogens and impedes phagocytosis in the absence of host antibodies ( mcfadden et al . , the capsule enables dissemination of c. neoformans to the central nervous system , where it generates a fatal meningoencephalitis if untreated . finally , histoplasma capsulatum , is a dimorphic specie frequently encountered in the environment as saprophyte . moldproduced spores that are inhaled germinate in the lung where they are converted to a yeast form , which is a process absolutely required for pathogenicity ( medoff et al . while the biology ( life cycle , metabolism and morphogenesis ) of all these fungal species greatly differ , they also share certain common features that enable a successful colonization of the human host and are able to counteract its defence mechanisms . such features are frequently called virulence factors and they comprise metabolic , structural and morphological features ( navarrogarca et al . , 2001 ) among others , although it has been proposed that only those involved in the direct interaction with host cells should be considered as true virulence factors ( odds et al . , 2003 ) . their identification is an active area of research as they may provide the basis for the development of novel therapies to treat fungal infections ( alonsomonge et al . , 2003 ) . while several virulence traits have been identified in many fungal species , the cell wall is still the most promising target in drug discovery for different reasons . first , it is unique to the fungus , and therefore , fulfils a priori the requirement of selectivity for drug discovery . second , it is an essential structure to the cell , whose inhibition leads to cell death and most frequently lysis . third , and most importantly , it is the most external structure present in the fungal cell and therefore , mediates the interaction of the fungus with the mammalian host cells . as a consequence , it is involved in adhesion , colonization , signaling and immune recognition , and therefore plays a major role during infection . we aim to summarize here the structural and functional aspects of the cell wall in fungal pathogens . we highlight recent findings that indicate the relevance of the cell wall in the interaction with the host immune cells and how this process is essential to prime and develop a protective immune response ( romani , 2004 ) and contributes significantly to the control and pathology of the infection ( casadevall and pirofski , 1999 ; casadevall and pirofski , 2001 ) .",
"the cell wall is an essential structure that maintains the viability of fungal cells , conferring their typical morphology and protecting the cell against external injuries . as the most external cellular structure of pathogenic microorganisms , it also carries important antigenic determinants and mediates adhesion to the host tissues , being therefore crucial to initiate colonization and therefore , cause disease ( calderone and fonzi , 2001 ; sundstrom , 2002 ) . the cell wall is the structure sensed by the host immune cells . as a consequence , it participates in triggering and orchestrating the whole innate and adaptive immune response against the microorganism . it is normally a multilayered structure composed by glucans , dglucose polymers with 1,3 , 1,6 and 1,3 ( in the case of histoplasma , see below ) linkages that account for 5060% of the total cell wall . a minor , but essential , component is chitin , a 1,4 nacetylglucosamine polymer ( 12% ) while mannan ( also called phosphopeptidomannan ) is composed of mannoproteins and represents about 3540% of it . the 1,3 glucan and chitin moiety are mainly responsible for providing the cell wall strength and appear as a dense inner layer by transmission electron microscopy . the synthesis of both polymers is coordinated and regulated in response to different environmental conditions . drugs or stress conditions that alter the amount of one of these components frequently trigger a mechanism that increases the synthesis of the others , thus providing the necessary strength to maintain cell integrity ( ram et al . , 1998 ; lagorce et al . , the external outer layer is composed of mannoproteins and appears much lighter , being largely responsible for determining the porosity of the cell wall . 1,3 glucan is distributed through the cell surface and is covalently linked to some chitin chains , providing a scaffold to which mannoproteins are also covalently attached ( fig . 1 ) . the outer layer is composed of cell wall proteins ( cwps ) that are attached to the inner layer via glycosylphosphatidylinositol ( gpi ) or internal repeat domains ( pir ) linkages . in c. albicans , the most external part of the cell wall is mainly composed of mannoproteins , also called cell wall proteins ( cwps ) , which are normally highly glycosylated ( either o or nglycosylated ) with mannosecontaining polysaccharides ; carbohydrates can account for up to 90% of their molecular mass . oglycosylation occurs among fungi at serine and/or threonine residues and involves the addition of mannoses through 1,2 or 1,3 ( as occurs in s. cerevisiae ) type linkages . as the linkage of some cell wall proteins to 1,3 glucan can be cleaved by treatment with alkalis , it has been hypothesized that ochains are involved ( kapteyn et al . , 1999 ) . nglycosylation takes place at asparagine residues ; the inner core of the added glycan moiety is composed of 1,6 mannose to which moieties are sequentially incorporated . in c. albicans , cwps frequently contain internal repeats ( named pircwps ) that are directly linked to 1,3 glucan , whereas others contain a glycosylphosphatidylinositol derivedstructure ( gpicwps ) and are attached to the 1,6 glucan . interestingly , a different type of linkage ( 1,2 type ) does exist ( suzuki et al . , 1995 ; kobayashi et al . 2003 ) , and it has been shown to play a role in protection against disseminated candidiasis ( dromer et al . , 2002 ) . hyphae of a. fumigatus contain four major carbohydrate polymers : chitin , galactomannan , branched 1,3/1,6 glucans and linear 1,3/1,4 glucans ( fontaine et al . , 2000 ) . the complex composition of the conidial cell wall is incompletely defined ( bernard and latge , 2001 ) , but in contrast to hyphae , conidia have other morphologically distinct features : an outermost layer ( paris et al . , 2003a , b ) and an inner cell wall layer that is exposed during the swelling ( tronchin et al . , 1995 ) , a process that can occur within macrophages ( philippe et al . , 2003 ) and participates in infection . the outer conidial cell wall consists largely of hydrophobic proteins and is lost when conidia develop into filaments . the cell wall of mycelia , which has been more extensively characterized , consist of branched 1,3 glucan covalently bound to chitin , 1,3 and 1,4 glucans and galactomannan ( fontaine et al . , 2000 ) . the most distinctive feature of cryptococcus neoformans is the polysaccharide capsule ( janbon , 2004 ) . the presence of a polysaccharide capsule gives to this fungus some pathogenic attributes comparable to those of classical encapsulated bacteria such as streptococcus pneumoniae , haemophilus influenzae and neisseria meningitidis . the polysaccharide capsule of c. neoformans is highly antiphagocytic , poorly immunogenic and is essential for virulence , as deduced from the avirulence of strains in which key components of its biosynthetic pathway have been deleted ( chang and kwonchung , 1994 ; chang et al . , 1996 ) . the capsule of c. neoformans contains two major polysaccharides , glucuronoxylomannan ( gxm ) and galactoxylomannan ( galxm ) . gxm is a linear 1,3 mannan with a 1,2 glucuronic acid residue attached at every third mannose ( cherniak et al . , 1988 ) . each trisaccharide of the backbone is also substituted with up to four xyloses , which are either 1,2 or 1,4linked ( cherniak et al . xylosylated mannoses tend not to be acetylated ( cherniak et al . , 1988 ; janbon et al . , 2001 ; moyrand et al . , gxm forms a complex and large molecularweight structure that involves the selfassociation of molecules and the selfentanglement of different fibres ( turner and cherniak , 1991 ; mcfadden et al . gxm is also released from the capsule and accumulates in tissues during infection , blocking effective immune responses and contributing to the pathology of the disease ( vecchiarelli , 2000 ) . high concentrations of gxm in tissue were hypothesized to cause dysfunction of cellular processes ( graybill et al . , 2000 ) because of the high viscosity achieved in tissues . however , recent studies suggest that this does not occur at concentrations that are relevant in vivo ( mcfadden et al . , 2006 ) . galxm is an 1,6 galactan that contains branches of 1,3 galactose1,4 mannose1,3 mannose . in turn , the branch sugars can be linked to 1,3 or 1,2 xylose . whereas all sugars in gxm and most of the sugars in galxm are in the pyranose configuration the cell wall of histoplasma yeast contain primarily three polysaccharides : chitin , glucans ( 1,3 , 1,6linked and 1,3glucan ) ( domer , 1971 ; reiss , 1977 ) . immunofluorescence localization in crosssections of wildtype yeast cells with 1,3 and 1,3glucanspecific antibodies show a nonhomogeneous spatial distribution . although some overlap exists between 1,3 glucan and 1,3 glucan , the cell wall is somewhat layered , with 1,3 glucan being more external .",
"recognition of pathogens by the innate immunity requires the identification of pathogenassociated molecular patterns ( pamps ) . these structures represent surface determinants that are absent in mammalian cells and are sensed by specific structures ( called pattern recognition receptors prrs ) present on the surface of the immune cells ( underhill and ozinsky , 2002 ; underhill , 2004 ) . different prrs recognize different pamps and contribute in this way to the generation of a balanced response against microorganisms ( underhill , 2003b ) ( fig . 2 ) . this figure depicts the multiple receptors that act either alone or simultaneously as sensors for different cell wall components of fungal cells walls . receptor engagement induces intracellular signals that lead either to endocytosis and phagocytosis signalling or both of them . tolllike receptors ( tlrs ) are cell membrane associated ( tlr1 , tlr2 , tlr4 , tlr5 y tlr6 ) or intracellular ( tlr3 , tlr7 , tlr8 y tlr9 ) prr receptors . several tlrs have been implicated in the recognition of fungal components : tlr2 was initially described to play a role in zymosan ( a glucan enriched particle ) recognition ( underhill et al . , 1999 ) . recent studies have shown that tlr2 recognizes phospholipomannan ( plm ) ( jouault et al . , 2003 ) , while tlr4 recognizes olinked mannans ( netea et al . , 2006 ) . tlr6 is involved in the recognition of zymosan ( underhill , 2003a ) while tlr9 detects fungal dna ( wagner , 2001 ) . in addition to tlrs , ctype lectin receptors ( clrs ) are mainly membranebound receptors that also recognize polysaccharide structures from fungal cells : dectin1 recognizes glucans ( brown and gordon , 2001 ) , whereas the macrophage mannose receptor ( mr ) and dcsign ( dendritic cellspecific icam3grabbing nonintegrin ) recognize nlinked mannans ( stahl and ezekowitz , 1998 ; cambi et al . , 2003 ) . structurally , prrs normally have an extracellular pathogenrecognition domain [ the leurich repeat ( lrr ) domain in tlrs and the ctype lectin domain ( cld ) in clrs ] ( fig . 2 ) . the intracellular signalling domain ( the tlrinterleukin 1 receptor , tir domain ) of tlrs and the immunoreceptor tyrosinebased activationlike motif ( itam ) from some clrs , such as dectin1 , are responsible for transducing the intracellular signals that are ultimately responsible for the functional activity of the receptor . although ubiquitous , the amount of each individual prrs differs greatly for each type of immune cell , stage of growth / differentiation and biological specie ( netea et al . , 2008 ) . pattern recognition receptors are differentially expressed in the surface of immune cells ( fig . phagocytes are essential components of the innate system in the control of the fungal infection as they contribute to eliminate the microbe . monocytes express high levels of tlrs on their cell membranes and moderate levels of clrs . macrophages present high expression levels of tlrs and clrs and dcs , which are essential for antigen processing and presentation to t cells , and also express most of the prrs that are important for the recognition of fungal pathogens . by contrast , neutrophils show moderate expression of tlrs and a high expression of phagocytic receptors . thus , the mixture of prrs that is expressed by each of these cell types contributes to generate the initial response following recognition of fungal pathogens . the main cells of the host innate immune response are monocytes , macrophages , neutrophils and dendritic cells . tlr , tolllike receptors ; mr , mannose receptor ; fcr , fc receptor ; cr3 , complement receptor . due to the localization of mannoproteins and mannans in the outermost part of the fungal cell wall , mannan detection may be expected to be one of the first steps in the recognition mediated by immune system cells . however , other components such as glucan and chitin ( at an inner level ) also influence the recognition of fungal cells by leucocytes . we will summarize how this process occurs in the different fungal species with special emphasis in the model fungal pathogen c. albicans .",
"both mannans and mannoproteins from the c. albicans cell wall have important immunostimulatory activities ( garner et al . , 1994 ; gomez et al . , 1996 ; gomez et al . , 2000 the ctypelectin mr was among the first described prrs for fungi ( stahl and ezekowitz , 1998 ) . it was the first receptor on the surface of macrophages to be described as a mannan receptor ( wileman and stahl , 1986 ; stephenson and shepherd , 1987 ) . the mr recognizes carbohydrates with terminal mannose , fucose or glcnac ( taylor et al . , 2005a ) . recognition of the pamp occurs via the carbohydraterecognition domain ( crds ) present in the extracellular region of the receptor ( linehan et al . , 2000 ) . in vitro studies have demonstrate that the mr preferentially recognizes linked oligomannoses with branched , rather than linear , structures ( kery et al . , 1992 ) . a recent study has demonstrated that in monocytes and macrophages , the mr recognizes branched nbound mannans from c. albicans ( netea et al . , 2006 ) . no significant differences were found between normal and mr/ ( knock out ) mice using a experimental model of infection with c. albicans , although knockout mice had higher average fungal burdens in some of the organs , they were competent in inflammatory cell recruitment and antibody production , indicating that the mr is not required for the normal host defence during disseminated candidiasis or even for phagocytosis ( lee et al . , 2003 ) . by contrast , recognition of the shorter linear structures of obound mannan is mediated by tlr4 ( netea et al . , 2006 ) with the resultant production of appropriate cytokines ( tada et al . , 2002 ) . dcsign is a receptor that is specifically expressed on the cell membrane of dcs ( cambi et al . , 2003 ) and some subpopulations of tissue macrophages ( soilleux et al . , 2002 dcsign recognizes carbohydrates such as high mannose structures in a cadependent manner with specificity being achieved through unique interactions with its ligands and tetramerization of the receptor ( koppel et al . , it has been shown recently that dcsign is able to bind c. albicans in dcsigntransfected cell lines and in human monocytederived dcs ; this results in the internalization of c. albicans in specific dcsignenriched vesicles , which are distinguishable from those containing the mr , also expressed in dcs ( cambi et al . , 2003 ) . the linked mannose structures on the surface of c. albicans are recognized by the mr , tlr4 and dcsign , and 1,2 mannosides , present in mannoproteins and plm ( fradin et al . , 2008 ; mille et al . , 2008 ) , are recognized through tlr2 ( jouault et al . , 2003 ) . a recent study has shown that galectin3 , a slectin involved in the recognition of 1,2 mannosides on the surface of the cell ( fradin et al . , 2000 ) , can discriminate between pathogenic c. albicans and nonpathogenic s. cerevisiae , and that an association between galectin3 and tlr2 is involved in this process ( jouault et al . , 2006 ) . dendritic cells are able to recognize the different morphologies of c. albicans and generate a different response : yeast cells trigger il12 production and activate a protective th1 response , whereas hyphal forms repress these processes but trigger il4 production . dendritic cells pulsed with the yeast forms were able to generate an antifungal protective immunity , indicating that dcs can sense and differentiate between both morphologies and types of response that can lead to eradication of the microbe or acquisition of a commensalism state ( d'ostiani et al . another lectin family member , dectin2 , has also been described to function as a receptor for c. albicans mannans ( ariizumi et al . , 2000 ) . dectin2 is present on tissue macrophages , langerhans cells and dcs ( taylor et al . , 2005b ) . due to its short intracytoplasmic tail this receptor seems to be mainly involved in the recognition of c. albicans hyphae ( sato et al . candida albicans mannan is also recognized by other proteins , called collectins , which are all secreted as large multimeric complexes . at least three collectins , mannosebinding lectin ( mbl ) , surfactant protein a ( spa ) and surfactant protein d ( spd ) , have been implicated in antifungal immunity . mannosebinding lectin is a serum protein that recognizes selected terminal monosaccharides , such as mannose , fucose and nacetylglucosamine ( turner and hamvas , 2000 ) . fungal binding by mbl triggers a protease cascade through the mblassociated serine proteases ( masp1 and masp2 ) that leads to activation of the complement pathway and deposition ( or opsonization ) of complement components , such as c3b , on the microbial surface , thereby promoting opsonic fungal recognition ( kilpatrick , 2002 ; holmskov et al . , 2003 ) mbl plays an important role in the firstline defence against c. albicans without the need for opsonophagocytosis by dcs , in which a direct interaction of mbl with c. albicans results in agglutination and accelerated complement activation via the lectin pathway , leading to inhibition of growth ( ip and lau , 2004 ) . however , a recent work indicates that the lectin pathway of complement activation in human neutrophils is important for the opsonophagocytosis of yeasts but not of bacteria ( brouwer et al . , 2008 ) . spa and spd recognize a broad range of microbes , including h. capsulatum , a. fumigatus , c. albicans and c. neoformans ( kishore et al . , 2006 ) , but they do not trigger complement activation and their primary role appears to involve microbial agglutination . the figure shows the activation of the complement cascade in response to fungal mannan recognition mediated by mbl . conidia of a. fumigatus are recognized specifically by dcsign as demonstrated using stable transfectants and monocytederived dcs . binding and internalization of a. fumigatus conidia correlates with dcsign surface expression levels and is abolished in the presence of a. fumigatusderived cell wall galactomannans ( serranogomez et al . , 2004 ) . the clinical relevance of this interaction is emphasized by the presence of dcsign in lung dcs and alveolar macrophages , and further illustrated by the dcsigndependent attachment of a. fumigatus conidia to the cell membrane of il4treated monocytederived macrophages ( serranogomez et al . , 2004 ) . on the other hand , conidia have been shown to adhere to langerhans cells in a dose and timedependent manner involving in this interaction a receptor with galactomannan structure specificity ( persat et al . , 2003 ) . recent studies suggest a therapeutic role of ex vivoadministered mbl , possibly through mblmediated complement activation and other protective mechanisms aimed both directly at the pathogen , and indirectly through modulation of the host inflammatory responses ( kaur et al . , 2007 ) . manoproteins of this fungal pathogen are efficiently recognized by dcs and competitive mannosylated inhibitors and calcium chelators interfere with tcell stimulation . furthermore , using transfected cell lines , the type ii ctype lectin receptor dcspecific icam3grabbing nonintegrin ( cd209 ) was shown to have affinity for cryptococcus mannoproteins . dendritic cells are also able to stimulate mannoproteinspecific t cells , suggesting that dcs provide a crucial link between innate and adaptive immune responses to c. neoformans via a process that is dependent upon the efficient uptake of mannoprotein by mrs ( mansour et al . , 2006 ) . however , in the presence of macrophages , binding of encapsulated c. neoformans is minimal in absence of opsonins . following incubation in serum , c. neoformans potently activates complement , resulting in surface deposition of the third component of complement . macrophages bind and phagocytose opsonized c. neoformans via three major complement receptors ( cr ) for c3 fragments , designated cd35 ( cr1 ) , cd11b / cd18 ( cr3 ) and cd11c / cd18 ( cr4 ) . antibody in normal human serum generally lacks opsonic activity , although vaccination can elicit anticapsular antibodies that are opsonic . the major component of cryptococcal capsule , gxm , is shed from the fungus and circulates in the blood and cerebrospinal fluid of patients with cryptococcosis . gxm binding to macrophage receptors triggers activation of nuclear factorkb ( nfb ) , but not mitogenactivated protein kinases ( mapk ) .",
"as stated before , the skeletal component of the cell wall of the majority of fungal pathogens is based on a core structure of 1,3 glucan covalently linked to 1,6 glucan and chitin . these polymers form hydrogen bonds between adjacent polysaccharide chains to form a threedimensional network of microfibrils . it is generally accepted that these skeletal components of the cell wall are found close to the cell membrane in an inner layer ; however , some chitin and glucan can be present throughout the thickness of the whole wall . candida albicans cell wall comprises approximately 60% glucan ( klis et al . , 2001 ) . although initially thought to be hidden under the mannoprotein external layer , recent evidences suggests that glucans are indeed exposed on the cell surface although restricted to specific regions , such as bud scars ( gantner et al . , 2005 ) . glucans can stimulate leucocytes in vitro , which induces cytotoxic and antimicrobial activities as well as the production of proinflammatory mediators , cytokines and chemokines ( brown and gordon , 2005 ) . glucans are released into the circulation during systemic fungal infections ( obayashi et al . , 1995 ) . cr3 is an integrin that recognizes pathogens opsonized by ic3b ( the inactivated form of complement component c3b ) and glucans . carbohydrate recognition is mediated by a lectin domain ( diamond et al . , 1993 ; 1996 ) , which is distinct from the normal ligandbinding site ( the i domain ) of cr3 ( diamond et al . , 1993 ) . the lectin domain mediates recognition of both the yeast and hyphal forms of c. albicans ( forsyth et al . , 1998 ; forsyth and mathews , 2002 ) , as well as several other fungi . recognition by cr3 does not trigger protective host responses , such as the respiratory burst ( wright and silverstein , 1983 ) , and can repress proinflammatory signals ( wright and silverstein , 1982 ; brandhorst et al . , dectin1 is a transmembrane receptor that contains a nonclassical extracelular ctype lectin domain that specifically recognizes 1,3 glucans ( brown and gordon , 2001 ; brown , 2006 ) and which is expressed in the surface of myeloid cells ( monocyte / macrophage , dcs and neutrophil lineages ) ( taylor et al . , 2002 ; brown , 2006 ) . it was initially demonstrated that this receptor triggers the phagocytosis of glucan containing particles when expressed on the surface of nonphagocytic cells ( brown and gordon , 2001 ) and that significantly contributes to the immunological response against fungal glucans ( brown et al . , later , it was shown that this molecule , which is expressed at low levels on macrophages but higher levels on dendritic cells , was recruited to phagosomes containing zymosan ( brown et al . dectin1 can recognize several fungi , including c. albicans yeast , although it does not appear to recognize c. albicans hyphae ( gantner et al . , 2005 ) . the cytoplasmic tail of dectin1 contains an itam , which can mediate various protective responses through spleen tyrosine kinase and caspase recruitment domain protein 9 ( syk card9)dependent pathways , such as the stimulation of interleukin 2 ( il2 ) , il10 ( rogers et al . , 2005 ) , il6 and il17 production ( leibundgutlandmann et al . , 2007 ) . although sykdependent signalling from dectin1 is sufficient for these responses , stimulation of the mapk nfb pathways , with subsequent production of proinflammatory cytokines , such as tumour necrosis factor ( tnf ) , requires collaborative signalling with the tlr2 receptor ( brown et al . a recent study suggests that phagocytosis of c. albicans by neutrophils can be mediated by the recognition of the cell wall component 1,6 glucan ( rubinbejerano et al . , 2007 ) . beads coated with 1,6 glucan are well ingested by neutrophils , and the treatment of yeast cells with 1,6 glucanase results in a reduced phagocytosis . this recognition appears to be mediated by cr3 following opsonization by c3d fragments that bind 1,6 glucan . in a. fumigatus dectin1 is involved in generating inflammatory responses to specific morphological forms of this organism both in vitro and in vivo . aspergillus fumigatus possesses a cell wall significantly made up of glucans ( similar to c. albicans ) ( beauvais and latge , 2001 ) . alveolar macrophages are critical for recognizing and reacting to a. fumigatus leading to production of proinflammatory cytokines such as tnf , il1 , ccl3/mip1 , cxcl2/mip2 , il6 , gmcsf and gcsf , all of which are significantly attenuated by blocking dectin1 with monoclonal antibodies ( steele et al . , 2005 ) . in addition , tlr2 plays an accessory role with dectin1 in mediating the alveolar macrophage inflammatory response to live fungal cells . resting conidia are inhaled into the lung and go through phenotypic changes that lead to recent evidences suggest that the inflammatory response triggered by alveolar macrophages is different depending on the morphological stage and glucan exposure of the fungal cells recognized . in this sense , cytokine and chemokine production mediated by dectin1 occurs only during the swelling and germination of conidia ( steele et al . , this result confirms that no specific morphology is intrinsically associated in fungi with virulence , as it was already known from the clinical experience with fungi . dectin1 recognition of germ tubes also stimulates tnf production in the absence of tlr2 and myd88 signalling ( gersuk et al . , 2006 ) . an interesting observation is that yeast cells normally mask the glucan to immune cells . when c. albicans cells are switched to a filamentous mode of growth under host environmental conditions , they mask glucan that is exposed in yeast cells and , as a consequence , they are unable to activate dectin1 mediated defences ( gantner et al . , 2005 ) . this result suggests the appealing possibility that fungi have evolved to escape immune system recognition through the masking of specific components of the cellular surface that could be able to trigger an effective antifungal response . in fact , a recent screening in s. cerevisiae for the enhanced recognition by glucan antibodies has led to the identification of several genes involved in this process and , among them , some signalling pathways controlling cell integrity ( wheeler and fink , 2006 ) . a similar behaviour has been observed in other fungal pathogens . in a. fumigatus resting conidia are ingested by macrophages but generate a reduced and controlled immune response without absence of reactive oxygen species . this is consistent with the fact that glucan is also masked in this cellular type . in contrast , maturing conidia and germ tubes are able to bind dectin1 and generate a productive antifungal response in collaboration with tlrs ( gersuk et al . , 2006 ) . in h. capsulatum , the less common polysaccharide , 1,3 glucan , has been correlated with pathogenicity or linked directly to virulence by a yetunknown mechanism . histoplasma capsulatum exposes 1,3glucan in the outermost layer of cell wall and contributes to pathogenesis by concealing immunostimulatory glucans from detection by host phagocytic cells . production of proinflammatory tnf by phagocytes is suppressed either by the presence of the 1,3 glucan layer on yeast cells or by rna interference based depletion of the host glucan receptor dectin1 . thus , it has revealed an important mechanism by which h. capsulatum thwarts the host immune system ( rappleye et al . , 2007 ) . by contrast , little is known regarding glucan recognition in c. neoformans . a recent work , however , suggests that dectin1 is not required for the host defence to c. neoformans as the authors did not found significant differences in the clinical course and cytokines production between dectin1 genedeficient and control mice , suggesting that dectin1 is not essential for the development of host protective responses to the fungal pathogen ( nakamura et al . , 2007 ) .",
"on one hand , chitin , a less studied polysaccharide component of the c. albicans cell wall , induces recruitment of immune cells that principally release il4 and il13 ( van der graaf et al . , 2006 ) . little is known about the recognition pathways of chitin , its role during c. albicans infections and recognition receptors . on the other hand , bacterial and fungal dna that is poorly methylated , in contrast to mammalian dna , has been proposed to be instrumental in the recognition of nonself dna by tlr9 ( wagner , 2001 ) . although the recognition of fungal dna has not been properly demonstrated , the involvement of tlr9 in the recognition of c. albicans is supported by the observation that cytokine production from cd4 + t cells from tlr9/ mice is skewed ( higher il4 , lower ifn ) compared with cytokine production from cd4 + t cells derived from wildtype mice upon challenge with c. albicans yeast ( bellocchio et al . , 2004 ) . no studies have investigated the possible role of rna recognition systems ( that is , tlr3 , tlr7 and tlr8 ) in the host response to c. albicans infection . although the surface structures being recognized by the host cells are beginning to be determined precisely , much more work is needed to understand the interaction of fungal pamps with their receptors on the host cell membrane . for example , little is known about the recognition of components of the fungal cell wall like chitin , surface proteins or products that are secreted by fungal cells . recognition of the different morphologies associated with fungi promises to be an attractive area for future research as they are important evasion mechanisms . in this sense , it is important to note the differential exposure of several structures of the cell wall ( such as glucan ) , depending on the fungal morphology with mannans and glycans acting as shields that may mask immune responses . although both mannans and glucans can induce proinflamatory signals , the parallel stimulation of the mannan and glucan recognition pathways has a synergistic effect on the amplification of the immune response . may therefore provide essential information in order to develop novel antifungal therapies and a challenge for basic research . it is clear that the pathogen host interaction results in a bidirectional talk , where both the microorganism and the host cells are in a permanent dialogue , influencing each other 's behaviour . the identification of the key components of such interplay at the molecular level ( signals , mechanisms and responses ) will have important consequences in the future and will surely allow better approaches to treat fungal infections .",
"although the surface structures being recognized by the host cells are beginning to be determined precisely , much more work is needed to understand the interaction of fungal pamps with their receptors on the host cell membrane . for example , little is known about the recognition of components of the fungal cell wall like chitin , surface proteins or products that are secreted by fungal cells . recognition of the different morphologies associated with fungi promises to be an attractive area for future research as they are important evasion mechanisms . in this sense , it is important to note the differential exposure of several structures of the cell wall ( such as glucan ) , depending on the fungal morphology with mannans and glycans acting as shields that may mask immune responses . although both mannans and glucans can induce proinflamatory signals , the parallel stimulation of the mannan and glucan recognition pathways has a synergistic effect on the amplification of the immune response . may therefore provide essential information in order to develop novel antifungal therapies and a challenge for basic research . it is clear that the pathogen host interaction results in a bidirectional talk , where both the microorganism and the host cells are in a permanent dialogue , influencing each other 's behaviour . the identification of the key components of such interplay at the molecular level ( signals , mechanisms and responses ) will have important consequences in the future and will surely allow better approaches to treat fungal infections ."
] | summaryfungal infections are a serious health problem . in recent years , basic research is focusing on the identification of fungal virulence factors as promising targets for the development of novel antifungals . the wall , as the most external cellular component , plays a crucial role in the interaction with host cells mediating processes such as adhesion or phagocytosis that are essential during infection . specific components of the cell wall ( called pamps ) interact with specific receptors in the immune cell ( called prrs ) , triggering responses whose molecular mechanisms are being elucidated . we review here the main structural carbohydrate components of the fungal wall ( glucan , mannan and chitin ) , how their biogenesis takes place in fungi and the specific receptors that they interact with . different model fungal pathogens are chosen to illustrate the functional consequences of this interaction . finally , the identification of the key components will have important consequences in the future and will allow better approaches to treat fungal infections . |
[
"mutations in psen1 and psen2 genes , which encode polytopic proteins termed presenilin 1 ( ps1 ) and presenilin 2 ( ps2 ) , respectively , cause autosomal dominant early - onset familial alzheimer 's disease ( fad ) . both ps1 and ps2 proteins ( ps ) share about 63% homology with the highest similarity in the transmembrane domains where most of the fad - linked mutations are found [ 2 , 3 ] . since the first report of mutation in the psen1 on chromosome 14 , about 170 mutations have been identified , making mutations in psen1 the most common cause of autosomal dominant early - onset ad . in the case of psen2 , 18 mutations have been reported so far , although not all have been confirmed to be pathogenic [ 2 , 5 ] . as a probable explanation for the disparity between the two genes , defects in psen2 function may be offset by the normal function of its homolog psen1 . in support of this view , psen2 null mice do not exhibit the phenotypic and functional defects seen in mice lacking psen1 gene . psen1 knockout ( ko ) mice are lethal , and disruption of psen2 and psen1 genes causes earlier embryonic lethality compared to psen1 ko [ 610 ] . as supported by mouse model studies , it appears that ps1 contributes largely to total -amyloid ( a ) production in the brain [ 11 , 12 ] . ps is the catalytic subunit of -secretase , the enzyme responsible for intramembraneous cleavage of amyloid precursor protein ( app ) to generate peptides . fad - linked ps variants enhance the production of highly fibrillogenic a42 peptides that are deposited early in the brains of patients with ad . ps is ubiquitously expressed in the nervous system and peripheral tissue and found localized in secretory and endocytic organelles in all cell types , as well as synaptic structures in neurons [ 14 , 15 ] . as predicted from its broad pattern of expression , ps 's function extends far beyond processing of app and the pathogenesis of ad . for example , ps 's catalytic function is required for intramembraneous -secretase cleavage of notch receptors , which releases the notch intracellular domain ( nicd ) . nuclear signaling mediated by nicd is essential during mammalian development ; mice with ablated psen1 alleles die in late embryogenesis and exhibit phenotypes reminiscent of mice lacking notch 1 [ 6 , 7 ] . thus , ps - dependent activation of notch signaling is essential for early development . transgenic expression of fad - linked mutant ps1 fully rescues the developmental phenotypes in mice with psen1 deficiency [ 16 , 17 ] , supporting the notion that fad - linked ps1 variants are functional , but acquired deleterious properties that have profound pathophysiological consequences . candidate approaches and proteomic studies have identified a wide spectrum of type i membrane proteins that undergo -secretase cleavage , including notch ligands , deleted in colorectal cancer ( dcc ) , and cadherins ( reviewed in [ 13 , 1821 ] ) . uniformly these substrates all undergo an ectodomain shedding by -secretases , which in many cases is triggered by the binding of extracellular ligands . interestingly , several noncatalytic -secretase - independent functions have been assigned to ps , such as its role in regulating intracellular calcium homeostasis ( reviewed in ) . synapses are continuously reconfigured , both structurally and functionally , during embryonic development and throughout adult life , forming the basis for learning and memory [ 23 , 24 ] . neuronal inability to exhibit such plastic changes has been proposed to be a root cause for various psychiatric and neurodegenerative disorders such as ad [ 23 , 25 , 26 ] . not surprisingly , the duration and severity of cognitive impairments in ad patients closely parallels the extent of synaptic loss , leading to the notion that synaptic dysfunction is a critical element in the pathophysiology of ad . notably , memory and cognitive decline observed in ad patients correlate better with the synaptic pathology than either a plaque load or tangle density , and synapse loss appears to precede neuronal degeneration . findings from several laboratories suggesting that a might play a critical role in synaptic dysfunction have added significant information to the traditional amyloid cascade hypothesis of ad [ 28 , 29 ] . a can affect synaptic transmission [ 3033 ] , synaptic protein localization , ampa and nmda receptor trafficking [ 35 , 36 ] , and spine formation [ 35 , 3739 ] . fad - linked mutations in ps1 were originally thought to enhance the production of a42 peptides by a gain - of - function mechanism . however , it is becoming clear that fad - linked ps1 variants also exhibit partial - loss - of - enzymatic - function observed as diminution of a40 peptide production and defects in the extent of processing certain other transmembrane substrates ( reviewed in [ 40 , 41 ] ) . for example , fad - linked ps1 mutations are thought to attenuate -secretase processing and generate reduced levels of the intracellular domains of app , notch , n - cadherin , ephb2 , and epha4 [ 4245 ] . taken together , it is plausible that fad - linked mutations in ps1 exert pathophysiological effects on the synapses by elevating a42 levels and by a-independent mechanisms involving altered processing of -secretase substrates involved in synaptic function . this paper discusses findings from various animal models that reveal the role of ps and fad - linked ps mutations in synapse formation and function .",
"several mouse models ( reviewed in ; see http://www.alzforum.org/res/com/tra/ ) and a few rat models [ 4750 ] have been developed in order to recapitulate the main pathological features of ad and elucidate the mechanisms by which fad - linked ps mutations contribute to ad pathogenesis . a variety of mouse models have been characterized such as mice expressing fad - linked ps variants harboring point mutations or deletion mutation [ 51 , 52 ] , and fad - linked psen1 knock - in ( ki ) [ m146v variant , i213 t variant and p264l variant ] , and e10 loop deletion ki . these fad - ps1 single transgenic or ki mouse models do not exhibit significant a deposition in the brain . therefore , the phenotypes described in these fad - ps1 single transgenic mice are not due to classical a pathology . in an attempt to reproduce more closely the human ad pathology , psen1 ki coexpressing app swedish mutant and hyperphosphorylated tau mutants have been made . in order to study the physiological function of ps , ko models of psen1 and psen2 [ 610 ] , psen1 conditional ko [ 5860 ] , as well as double psen1 and psen2 conditional ko mice have also been created . in order to examine amyloid pathology , transgenic mice expressing app mutants in a ps null background have been developed ; such as psen1 conditional ko coexpressing app v717i variant and app v717f variant . in these models , a deposition is attenuated by the lack of ps1 expression and consequent loss of -secretase activity . besides their utility in examining proteolytic processing of app into a40 and a42 peptides in vivo and phenocopying pathological hallmarks of ad ( amyloid deposition and tau phosphorylation ) , these models have been extensively used to examine changes in synaptic transmission , synaptic plasticity , and associated signaling . in addition , several groups have generated drosophila models ( reviewed in ) , and caenorhabditis elegans models ( reviewed in ) expressing human ps1 or ps2 bearing fad - linked mutations , in an effort to understand mechanistic contribution of ps to ad pathology and neuronal dysfunction .",
"synaptic transmission and long - term potentiation ( ltp ) contribute to several forms of memory storage . using slice preparations from transgenic mice , we and others have demonstrated that expression of fad - linked ps1 does not alter basal synaptic transmission , but leads to higher degree of ltp induction in the hippocampus ( [ 57 , 6569 ] reviewed in ) . however , one group has reported impairment of synaptic transmission associated with an increase of paired - pulse facilitation , an index of presynaptic release , in neurons of 6 month - old psen1 m146v ki mice . ltp induction by high - frequency stimulation in hippocampal ca1 area was also enlarged in this animal model . interestingly , in psen1 m146v ki animal model , ltp induced by carbachol ( a muscarinic agonist ) was reduced in ca1 hippocampal area , suggesting that fad - linked ps1 variant might interfere with cholinergic cellular cascades as well . the ki mouse models allow us to examine the functional properties of molecules associated with pathology when they are expressed at endogenous levels without any alteration in their spatial or temporal pattern of expression . therefore , ki animal models give us the opportunity to rule out pathophysiological consequences ( such as protein misfolding ) associated with aberrant overexpression of proteins associated with human genetic disorders . interestingly , it has been described that the lack of ps function or overexpression of ps1 mutant was also associated with changes in presynaptic function . we have observed an increase of spontaneous miniature excitatory postsynaptic current in cortical neurons isolated from psen1 ko mice , while others have reported that expression of mutant ps1 in cultured hippocampal neurons depresses synaptic transmission by reducing the number of synapses . another group has also observed that ps1 deficiency increases synaptic release and affects the number and docking of synaptic vesicles . it was also shown that basal transmitter release was increased at the neuro - muscular junction in drosophila lacking ps expression . however , even though basal synaptic transmission seems to be intensified in this later model , synaptic strength and plasticity were impaired after posttetanic potentiation . as a likely consequence , , it has been reported that ltp induction declines more rapidly in ca1 hippocampal area of mice with only one allele of psen1 . in agreement with these observations , it has been recently found that a ca3-dependent presynaptic form of ltp in the hippocampus was attenuated in double psen1 and psen2 conditional ko mice . intriguingly , single psen1 conditional ko mice do not show major changes in brain plasticity , suggesting that expression of ps2 might be sufficient to overcome the 6080% loss of ps1 in the forebrain of these animals . first of all , it becomes apparent from these studies that ps is an essential element for the normal synapse function . second , it becomes evident that ps dosage is a critical component for ps - dependent cellular function(s ) . indeed , ps1 expression is developmentally regulated in rodent brain , reaching a peak of expression during the critical period of synaptogenesis between postnatal days 7 to 14 . accordingly , we can stipulate that ps - dependent substrates expressed during embryogenesis or early in development may significantly contribute to synaptic physiology . in this regard , it also remains to be established whether differences in ps - dependent proteolysis of developmentally regulated molecules might underlie changes in synaptic function later on in life . a well - known example is a condition where stress - induced early life biochemical events influence life - span changes in cognitive function and ad - associated abnormalities . accordingly , it has been proposed that age - related decline in cortical cholinergic function in ad patients might have developmental origins . finally , it has also been speculated that ps - dependent modulation of signaling pathways that are important in development may contribute to the neurodegenerative process . taken together , studies from various laboratories suggest that ps is specifically involved in cellular component(s ) necessary for synaptic transmission and plasticity , and that fad - linked mutations in ps1 may disrupt the normal cascade of synaptic events .",
"a distinct feature of the nervous system is the intricate network of synaptic connections among neurons . the changes in the strength and efficacy of existing synapses , as well as remodeling of connectivity through the loss and gain of synapses in the neuronal network , are believed to be the basis of learning and memory in the brain . interestingly , ltp has been associated with the increase in spine formation and spine head growth , whereas long - term depression ( ltd ) has been associated with spine shrinkage and retraction . the morphology of dendritic spines is known to change in response to several factors including learning , age , hormones , and disease conditions . in addition to their morphological plasticity , spine - like protrusions also display rapid motility , changing shape and size in a matter of seconds to minutes . this morphological plasticity suggests that long - term memory might be encoded by alterations in spiny structures and associated synaptic contacts . collectively , these events are critically important in synaptogenesis , in modulating of existing synapses , as well as in long - term synaptic plasticity [ 83 , 84 ] . it has been reported that a is closely associated with a decrease of spine formation and motility [ 35 , 37 , 85 ] . overproduction of a in ps mutant transgenic mice coexpressing the swedish app mutant causes age - associated decrease of synaptic excitability [ 57 , 86 , 87 ] and spine collapse [ 38 , 88 ] . however , it has also been reported that acute a application ( less than 4 h ) was associated with an increase of filopodia and growth cones in hippocampal cultures . in support of this idea , it was shown that application of low levels of a is associated with an increase of ltp , whereas higher concentration of a reduced synaptic potentiation [ 32 , 90 ] . collectively , these observations suggest that a might have dual roles on synapse formation . conflicting results have also been observed in regard to spine morphology in neurons lacking ps expression . treatment with compound e , a -secretase inhibitor ( 10 nm ; 24 h ) , produced an increase of spine - like protrusions in isolated neurons [ 71 , 91 ] ; whereas the density of spines was found to be decreased upon prolonged treatment with the same inhibitor ( 50 nm ; seven days ) . in addition , neurons lacking both ps1 and ps2 expression have marked diminution in spine density . to further support the effect of -secretase inhibition on dendritic spines , recent in vivo study showed that -secretase inhibitor treatment in wild - type mice significantly reduced the number of spine density in somatosensory cortex , while -secretase inhibitor treated app null mice did not exhibit any effect . these findings suggest that app - dependent mechanism may underlie the ps - dependent morphological changes observed . the apparent discrepancy between inhibitor treatment and loss of ps expression on spine density may be also due to differential effects of inhibitors that target mainly -secretase and genetic inactivation of ps that results in reduced -secretase - dependent and -independent function . all together , these observations support the idea that ps gene dosage and the level of expression may differentially influence synaptic morphology . although the molecular mechanisms that underlie these morphological changes are not completely understood , emerging evidence supports at least two important signaling pathways that have been linked to dendrite spine formation and ad etiology : ( 1 ) camp - dependent activation of pka has been shown to be critical for the maintenance of the late phase of ltp , and downstream phosphorylation of creb has been linked to formation of new spines . interestingly , it has been shown that a inhibits pka / creb pathway , ( 2 ) the rho family of small gtpases , well - known regulators of the actin cytoskeleton , has profound influence on spine formation . among the members of this family rac1 , cdc42 , rnd1 , and ras promote spine formation and growth , whereas rap and rhoa induce shrinkage and loss of spines [ 80 , 95 ] . p21-activated kinase ( pak ) is a downstream signaling effector of the rho / rac family of small gtpases and has been shown to be associated to spine formation and memory consolidation . a recent paper by shuai and colleagues suggests that the act of forgetting might also be linked to activation of the rac pathway , using a simplistic model of olfactory learning in the fruit fly drosophila . with the help of genetic manipulation , they were able to distinguish changes in rac activity during passive memory decay , interference learning , and reversal learning , which are three different forms of forgetting events . in drosophila olfactory memory model , it appears that camp / pka and rac / pak - dependent memory acquisition and forgetting events are independent , as suggested by this group and others [ 98 , 99 ] . in a more complex system , as it has been proposed in the mammals , it seems that memory consolidation might mechanistically require both pathways [ 96 , 100 , 101 ] . as demonstrated by several groups , rac signaling cascade in the brain is directly linked to an increase of spine formation through subsequent activation of pak leading to f - actin polymerization and changes in membrane morphology . besides the known involvement of camp / pka / creb activation cascade , rac / pak - dependent cellular events also appear to be intimately associated with the process of memory consolidation , at least in rodents . it is very exciting to think that perhaps similar cellular pathways as the one described above may be relevant to human disorders associated with memory dysfunction . one of the known hallmarks of ad is that patients do forget recent events , therefore , they are unable to consolidate their new memory . in our lab , we have shown that the lack of ps function or expression in cortical neurons produced an increase of steady - state levels of creb and rac / pak cascade activation , which was also associated with an increase of spine - like protrusions . even though our study shows increase of phosphorylated creb especially in dendritic area , more recently , shen and collaborators have shown that creb transcription was indeed reduced in ps deficient neuron through ps - independent mechanism . are these signaling events meaningful in the context of ad ? perhaps . as discussed above , recent studies support the idea that fad - linked mutations in ps1 might cause a partial loss of function [ 40 , 41 ] . it still remains to be determined whether rac / pak signaling is altered in neurons expressing fad - linked ps1 variants . if this is the case , one might want to consider the possibility that changes in camp / pka / creb or rac / pak signaling in neurons might represent some of the earliest cellular dysfunctions that are relevant to synapse elimination and associated cognitive decline in ad .",
"\n -secretase - dependent ps function mediates transmembrane proteolysis of several substrates including app , n- and e - cadherins , -protocadherin , cd44 , dcc , ephrin / eph receptors , leukocyte - common antigen related , nectin-1 , and syndecan ( reviewed in [ 18 , 20 , 21 ] ) . many of these substrates function as cell - adhesion molecules or cell surface receptors and are known for their diverse functions during development and are involved in axon guidance , neuronal outgrowth and synaptogenesis [ 103113 ] . in addition , these molecules are also well known to be coupled to diverse intracellular signaling pathways [ 20 , 44 , 45 , 108110 , 114118 ] . it has been proposed that app can affect synaptic function by its dual roles via its cell adhesive properties or through its putative receptor - like intracellular signaling components [ 112 , 116 , 117 ] . indeed , it has been shown that accumulation of the app intracellular domain can mediate a phosphoinositide - dependant calcium signaling . several other substrates of -secretase are also coupled with intracellular signaling events that can potentially influence synaptic function . for example , eph receptors and n - cadherin are known to be coupled to rac and creb signaling , respectively [ 45 , 115 , 117 , 120 , 121 ] . lack of ephb expression or kinase - defective ephb is associated with a reduction in glutamatergic synapses and abnormal spine development [ 120122 ] . it has also been shown that three substrates of ps , namely erbb4 , -protocadherin , and leukocyte - common antigen related , are associated with psd-95 clustering at the synapse [ 123 , 124 ] and ampa receptor function . consistent with these findings , we have previously reported that the lack of ps function increases axodendritic contacts , which was accompanied by increases of psd-95 clusters , spine - like protrusions , and ampa receptors - mediated synaptic transmission [ 71 , 91 ] . moreover , ps1 ko neurons and wt neurons treated with -secretase inhibitors exhibited increases in the extent of camp / pka activation [ 71 , 91 ] . camp / pka signaling plays a critical role in regulating short and long - term synaptic physiology . it has been demonstrated that stimulus - induced activation of pka pathway can also affect the synaptic morphology ; therefore , it can indirectly affect basal synaptic transmission . thus , there exists a close relationship between increased phosphorylation of pka substrates and enhanced synaptic transmission in neurons lacking ps function [ 71 , 91 ] . signaling downstream of dcc , the netrin receptor , is also modulated by -secretase activity . upon binding of the ligand netrin , dcc undergoes metalloprotease - dependent ectocomain shedding , which generates a membrane - tethered dcc c - terminal fragment ( ctf ) derivative , consisting of the transmembrane segment and the intracellular domain . dcc ctf undergoes intramembraneous proteolysis by -secretase , and accumulation of dcc ctf in neuroblastoma cells treated with -secretase inhibitors stimulates neurite outgrowth [ 71 , 129 ] . -secretase processing of dcc attenuates camp - dependent signaling cascades associated with dcc ctf . in this case , it is clear that -secretase terminates intracellular signaling associated with dcc . however , it remains to be determined if -secretase cleavage of other substrates would significantly impact cellular functions , especially pertaining to synaptic process , through termination of receptor - mediated signaling events ( see our proposed model in figure 1 ) . \n more recently , it was found that epha4 undergoes ps - dependent endoproteolytic process , and epha4 ctf accumulates following inhibition of -secretase activity or in cells lacking ps expression . accumulation of epha4 ctf was found tightly linked to an increase of spine - like protrusions in hippocampal cultures . overexpression of an inactive rac form abolished the enhancement of dendritic spines in neurons and lamellipodia formation in nih3t3 cell lines . in addition , this study showed that overexpression of membrane - tethered epha4 intracellular domain was also associated with an increase of lamellipodia formation in nih3t3 cell lines . all together , these results suggest that enhanced accumulation of epha4 intracellular domain may induce rac - dependent signaling events that regulate cell morphology . it is clear that loss of intramembraneous proteolysis of -secretase substrates leads to the accumulation of their membrane - tethered cytosolic domains . the ctfs of certain substrates might serve as membrane anchors to facilitate the recruitment of signaling proteins in a manner that enhances phosphorylation of downstream signaling substrates . one of the signalings that have been implicated with ps function is gsk3 ( reviewed in ) . it is well established that ps1 can interact with the gsk3/-catenin complex [ 131133 ] . however , besides this direct physical interaction with ps1 , it is known that gsk3 is a ligand - receptor signaling molecule downstream of the activation of phosphatidylinositol-3-kinase pathway ( reviewed in ) . specifically , it has been shown that gsk3 signaling is important for axon specification and elongation during the establishment of neuronal polarity ( review by ) . in addition , it has been reported that decrease of gsk3 activity parallels ltp induction paradigms , whereas inhibition of phosphatidylinositol-3-kinase and subsequent activation of gsk3 lead to decrease of ltp (; reviewed in [ 130 , 137 ] ) . decreased phosphorylation of gsk3 at the ser 9 residue , indicative of an increase of gsk activity , was also observed in ps1-deficient neurons as well as in ps1 neurons carrying fad - linked mutations [ 69 , 138141 ] . alteration of phosphatidylinositol-3-kinase /akt signaling cascade has been proposed to be the link between gsk3 activity and ps function [ 138 , 140 , 142 ] . interestingly , increase of gsk3 activity also leads to hyperphosphorylation of tau protein , which underlies one of the known pathological hallmarks of ad , namely the tangle formation ( reviewed in ) . it has been proposed that membrane microdomains rich in cholesterol and sphingolipids , termed lipid rafts , might influence -secretase activity and processing of substrates ( reviewed in ) . lipid rafts play an important role in the maintenance of synapses through dendritic spine formation and ampa receptor function . raft - dependent mechanisms facilitate trafficking of receptors in and out of the synapse and regulate synapse function ( reviewed in ) . lipid rafts are known to serve as membrane platforms that compartmentalize diverse receptor - mediated signaling . indeed , it was found that critical regulation of signaling associated with erbb4 , dcc , and epha4 , three -secretase substrates , involves their recruitment into lipid raft microdomains [ 45 , 146 , 147 ] . based on the differences in spatiotemporal distribution of -secretase complexes and substrates [ 148 , 149 ] , different ps - dependent substrates might be subjected to different level of proteolysis depending on their membrane microdomain distribution at a given time during embryonic development and in adult life .",
"besides a direct interaction of -secretase substrates with intracellular phosphorylation cascades , one of the key features of ps function is its role in intracellular ca homeostasis ( reviewed in [ 22 , 150 , 151 ] ) . several studies have concluded that fad - linked ps mutant expression in transfected cells and cultured neurons is associated with enhanced ca release from endoplasmic reticulum store . it has been reported that neurons generated from psen1 m146v ki mice exhibit an increase of ip3-evoked ca responses in brain slices as early as in one month old . this ca dysregulation appears to be specific to intracellular endoplasmic reticulum store since it does not affect the voltage - gated ca entry . however , it has been shown that l - type ca channel may be involved after stress induction at the neuromuscular junction in drosophila larvae expressing fad - linked ps1 mutant . accordingly , in this model system , the level of synaptic plasticity and memory paradigm was normal following heat shock stimulation or endoplasmic reticulum stress , but reduced after 24 h of stimulation recovery . these results suggest that mutation in ps might alter synaptic behavior following recovery of stress conditions . it has been also proposed that ps might serve as a passive ca leak channel in the endoplasmic reticulum and fad - linked ps variants might fail to exhibit this property . using reconstituted planar lipid bilayers , tu and collaborators demonstrated that ps by itself could form low - conductance divalent ion channels , which was not the case in several mutated forms of ps . it remains to be determined if results from these experimental conditions are applicable to in vivo situations that are relevant to the disease state . more recently , stutzmann and collaborators have established that the ryanodine receptor - evoked ca release ( especially through ryr2 isoform ) was increased in ca1 hippocampal slices of psen1 m146v ki mice coexpressing swedish app and hyperphosphorylated tau mutants . as a consequence , they observed an aberrant increase of ryanodine - dependent presynaptic neurotransmission , along with increases of long - term synaptic plasticity . conversely , shen and collaborators have observed a decrease of ryanodine - dependent presynaptic release in hippocampal neurons of ps - deficient mice . all together , stutzmann group concluded from their study that significant ca alterations are present at an early age even though ca homeostasis appears to be maintained . compensatory mechanisms seem likely to take place in order to maintain normal synaptic function in early age . however , these subtle ca - mediated alterations may have profound impact later on that can affect synaptic and cognitive functions in disease states .",
"however , it is becoming clear that fad - linked mutations in ps proteins affect diverse physiological processes in addition to promoting the production of highly fibrillogenic a42 peptides . the identification and characterization of -secretase substrates and the mechanistic details on the successive cleavage of substrates by the -secretase have enhanced our understanding of how partial loss - of - function associated with fad - linked ps mutations can in fact lead to a gain of activities with reference to intracellular signaling associated with certain substrates such as dcc , erbb4 , and epha4 . at least in some cases , lack of -secretase processing leads to profound changes in synaptic structure and functions as a consequence of sustained intracellular signaling by substrate ctfs . as details begin to emerge on additional -secretase substrates , it will be possible to determine whether -secretase cleavage of neuronal receptors is indeed a regulatory step that modulates physiological signaling downstream of ligand binding and ectodomain shedding . still , the major task is to establish whether or not altered signaling directly contributes to ad pathogenesis and/or ad - related synaptic dysfunction ."
] | mutations in psen genes , which encode presenilin proteins , cause familial early - onset alzheimer 's disease ( ad ) . transgenic mouse models based on coexpression of familial ad - associated presenilin and amyloid precursor protein variants successfully mimic characteristic pathological features of ad , including plaque formation , synaptic dysfunction , and loss of memory . presenilins function as the catalytic subunit of -secretase , the enzyme that catalyzes intramembraneous proteolysis of amyloid precursor protein to release -amyloid peptides . familial ad - associated mutations in presenilins alter the site of -secretase cleavage in a manner that increases the generation of longer and highly fibrillogenic -amyloid peptides . in addition to amyloid precursor protein , -secretase catalyzes intramembrane proteolysis of many other substrates known to be important for synaptic function . this paper focuses on how various animal models have enabled us to elucidate the physiological importance of diverse -secretase substrates , including amyloid precursor protein and discusses their roles in the context of cellular signaling and synaptic function . |
[
"familial hypocalciuric hypercalcemia ( fhh ) is a heterogenic , autosomal dominantly inherited disorder characterized by hypercalcemia with ( relative ) hyperparathyroidism , and hypocalciuria 1 . classically , fhh is caused by inactivating mutations in the gene encoding the calciumsensing receptor ( casr ) on chromosome 3q13 , termed fhh type 1 ( fhh1 ) 2 , 3 , 4 . recently , further two fhh phenotypes have been identified ; fhh2 have been shown to be caused by inactivating mutations in the gene encoding subunit alpha11 of the g protein ( gna11 ) on chromosome 19p13.3 and fhh3 by mutations affecting codon 15 ( p.arg15leu , p.arg15cys , and p.arg15his ) in the gene encoding the adaptor protein 2 sigma subunit ( ap2s1 ) on chromosome 19q13.32 5 , 6 . however , it is an important differential diagnosis to primary hyperparathyroidism ( phpt ) . due to the biochemical similarity to mild phpt , patients are at risk of being referred to parathyroidectomy ( ptx ) which does not benefit patients with fhh1 . new data , however , suggest that fhh3 is associated with hypercalcemic symptoms in > 20% of patients 10 , thus giving rise to suspicion that mutations in ap2s1 have more deleterious effects . at the time of writing , 55 index cases of fhh3 have been reported 6 , 10 , 11 , 12 , 13 . we now report a family with fhh3 among whom two brothers had ptx performed due to suspected phpt with one of the brothers having a concomitant diagnosis of a neuroendocrine tumor ( net ) . the study is conducted in accordance with the helsinki declaration and approved by the health research ethics committee in the central denmark region ( no .",
"the index case , a male born in 1976 , was diagnosed with hyperparathyroid hypercalcemia at the age of 36 ( table 1 ) . despite only moderate hypercalcemia ( ionized calcium 1.48 mmol / l ) , he had numerous symptoms possibly attributable to hypercalcemia including tiredness , a progressive feeling of muscle weakness , and pain in the upper extremities . dxa scans showed a normal bmd at the hip ( tscore 0.3 ) and mild osteopenia at the lumbar spine ( tscore 1.3 ) and forearm ( tscore 1.3 ) 14 . creatinine clearance ratio ( cccr = 0.005 ) , a genetic test was performed for fhh1 , which is in accordance with the diagnostic guidelines for phpt 15 . family screening revealed a father with intermittently elevated serum levels ( total calcium 2.522.62 mmol / l).the oldest brother ( born 1971 ) refused testing , whereas another brother ( born 1973 ) had normocalcemia . biochemical characteristics of the fhh3 family means of the biochemical measurements of affected members in the fhh3 family . cccr , calcium creatinine clearance ratio . * treated with cinacalcet . * * treated for hypoparathyroidism . besides hypercalcemic symptoms , the index patient also had gastrointestinal symptoms ( 46 loose stools per day ) , leading to a colonoscopy , which showed an intussusception of the terminal ileum . histological examination showed a radically excised intermediategrade net , which was immunohistochemically positive for cd56 , chromogranin a , and synaptofysin . the cooccurrence of hyperparathyroid hypercalcemia and a net leads to suspicion of a multiple endocrine neoplasia ( men ) syndrome , but additional genetic tests did not reveal mutations in cdc73 , ret , protooncogene , or men1 . biochemical testing and scans of the pituitary gland and the pancreas showed no signs of additional tumors . due to the patients young age and the clinical suspicion of a men1 syndrome , the hyperparathyroid hypercalcemia was considered as a state of phpt and he was referred to ptx . prior to surgery , neck ultrasound suggested an enlarged parathyroid gland on the right inferior side of the thyroid gland , but a parathyroid scintigraphy ( pertechnetate/99mtcmibi ) did not support the finding . subtotal ptx was performed in march 2014 with removal of the upper right and lower left glands , as well as half of the upper left gland and the thymus gland . following the second operation , calcium and pth levels remained elevated and the patient had sustained complaints of hypercalcemic symptoms . accordingly , treatment with cinacalcet was initiated causing normalization of serum calcium levels and symptomatic relief . due to the improved wellbeing following normalization of calcium levels , a third ptx was performed 6 months later with removal and partial autoimplantation of the remaining halfgland on the right thigh ( vastus lateralis , m. quadriceps femoris ) . subsequently , the patient developed hypoparathyroidism , but despite consistent needs for treatment , he reported an improved wellbeing . due to the complicated course of the index patient , his brother ( born 1971 ) who initially refused biochemical screening reconsidered and had biochemical tests performed showing hyperparathyroid hypercalcemia ( table 1 ) . he only had weak complains of tiredness . due to the occurrence of a men1like syndrome in the family , he was tested for mutations similar to the index case and underwent colonoscopy without any pathological findings . further examinations revealed a cccr = 0.005 , no renal calcifications , normal bmd ( except for a hip tscore of 1.1 ) 14 . the lower right gland was not identified , but as pth fell from 17.0 to 3.7 pth increased , however , to supranormal levels within 10 days following surgery with persistently elevated ionized calcium levels ( 1.391.46 we therefore screened the two brothers for mutations in ap2s1 and gna11 and found a c.44g > a substitution in ap2s1 resulting in p.arg15his , a mutation previously reported to cause fhh3 6 , 10 , 11 . screening of the remaining family revealed that the brothers had inherited the mutation from their father , whereas the mother , a brother , and three children were mutation negative ( fig . the histopathological analysis of the glands from the index patients showed one gland with a focus of hyperplasia , two glands with diffuse hyperplasia , and an intrathyroidal process diagnosed as a parathyroid adenoma . the hyperplasia in one gland was characterized by dense fibrosis with hyperplasia of both chief and oxyphil cells and loss of lipid cells . in the other glands , hyperplasia was also present and characterized by loss of lipid cells and increased amount of chief cells . the adenoma showed uniform waterclear cells with solid growth pattern and few scattered isles of oxyphil cells . the removed glands from the brother also showed hyperplasia , which in one gland was characterized by loss of lipid cells and hypercellularity of both chief cells and oxyphil cells , whereas the other two glands were characterized by a more normal fat distribution although still with hypercellularity of oxyphil and chief cells ( fig . histological pictures of the parathyroid glands from the index patient ( a c ) and his brother ( d ) . ( a ) gland from the index patients showing diffuse hyperplasia characterized by loss of lipid cells and increased amount of chief cells . ( b ) gland from the index patient showing a hyperplastic area in an otherwise normal gland . ( c ) intrathyroid parathyroid adenoma characterized by uniform waterclear cells , a solid growth pattern , and with no lipid cells . ( d ) gland from the brother of the index patient showing a mixed oxyphil and chief cell hypercellularity .",
"the histopathological analysis of the glands from the index patients showed one gland with a focus of hyperplasia , two glands with diffuse hyperplasia , and an intrathyroidal process diagnosed as a parathyroid adenoma . the hyperplasia in one gland was characterized by dense fibrosis with hyperplasia of both chief and oxyphil cells and loss of lipid cells . in the other glands , hyperplasia was also present and characterized by loss of lipid cells and increased amount of chief cells . the adenoma showed uniform waterclear cells with solid growth pattern and few scattered isles of oxyphil cells . the removed glands from the brother also showed hyperplasia , which in one gland was characterized by loss of lipid cells and hypercellularity of both chief cells and oxyphil cells , whereas the other two glands were characterized by a more normal fat distribution although still with hypercellularity of oxyphil and chief cells ( fig . histological pictures of the parathyroid glands from the index patient ( a c ) and his brother ( d ) . ( a ) gland from the index patients showing diffuse hyperplasia characterized by loss of lipid cells and increased amount of chief cells . ( b ) gland from the index patient showing a hyperplastic area in an otherwise normal gland . ( c ) intrathyroid parathyroid adenoma characterized by uniform waterclear cells , a solid growth pattern , and with no lipid cells . ( d ) gland from the brother of the index patient showing a mixed oxyphil and chief cell hypercellularity .",
"\n ap2s1 mutations causing fhh3 have recently been reported and only sparse data are available on patients with fhh3 . we believe that the disease courses of the patients reported raise several clinical important issues . first of all , the index case represents the first reported association between a net and fhh3 . secondly , our report supports the previously reported notion on some patients with fhh3 having symptomatic hypercalcemia . finally , to avoid unnecessary surgery and risk of postsurgical hypoparathyroidism , our report calls for increased awareness of the presence of mutations in other genes than the casr , which may cause fhh . the cooccurrence of a net and hyperparathyroid hypercalcemia in a relatively young patient leads to the suspicion of a men1 syndrome . men1 is autosomal dominant inherited and is characterized by phpt , pancreatic tumors , pituitary tumors , and more seldom nets typically located to the adrenal gland , or derived from the embryonic foregut 16 , 17 . our index patient presented with assumed phpt , which is typically the first manifestation of men1 and occurs in 95% of cases 18 , 19 . in addition , he had a net ( formerly known as carcinoid ) , which have been reported to occur in 4% of men1 patients 16 , 19 , 20 . in retrospect , the clinical men1 diagnosis was not clearcut , with several lines of evidence suggesting that our index patient was most likely a socalled phenocopy , that is , a phenotype resembling men1 without being it 21 , 22 . the net found in our index patient was located to the hindgut , which is very rare in men1 . in addition , the patient was negative for all mutations known to cause men1 , although about 515% of considered men1 cases are genetically unverified 17 , 23 , 24 . furthermore , only the index patient had affection of more than one organ , and as the penetrance of men1 is close to 100% in patients older than 50 years , it is unlikely that the 71yearold father should be unaffected 20 , 25 . the low cccr is also not typical for phpt , but can occur due to low vitamin d. according to thakker et al . , men1 phenocopies are seen in up to 10% of cases with the causative mutations found in other genes including cdc73 and casr . consequently , the absence of mutations in the men1 gene should lead to analysis of these genes 26 . our case adds ap2s1 to the genes that need to be considered , when examining a clinical , but genetically unverified men1 patient . in addition to the biochemical findings , the presumed diagnosis of phpt was supported by symptoms , which could be attributable to hypercalcemia . reports of coexisting fhh1 and phpt have previously been published 27 , 28 , 29 . it may therefore be considered whether the index patient had developed phpt superimposed on his inherited fhh3 , which is supported by the histopathological findings showing multiple gland affection with both adenoma and hyperplasia . no previous reports on histopathological findings in parathyroid glands from fhh3 patients report adenomas , but only diffuse hyperplastic or normal glands 10 , 11 , 30 . however , the findings of similar serum calcium levels , pth levels , and low cccr in the index patient and his brother ( table 1 ) do not support that the index patient had developed phpt on top of his inherited fhh3 . rather , our findings support previous reports on hypercalcemic symptoms in approximately 20% of fhh3 patients . ap2s1 mutations are associated with different phenotypes , where p.arg15his give cause to the mildest phenotype , that is , the lowest degree of elevated calcium levels , and also the least degree of hypocalciuria 10 . interestingly , no correlations have been found between genotype and symptoms , and it can be speculated whether the reported symptoms are induced by iatrogenic factors as proposed by marx et al . who found a similar level of hypercalcemic symptoms among fhh1 patients in 1981 31 . however , further characteristics of fhh3 patients need to be performed in order to clarify whether fhh3 is indeed associated with a more severe course , as well as whether there is any correlation to neuroendocrine tumors . in conclusion , we have reported the first case with cooccurrence of fhh3 and a net in the distal ilium . although our index case was most likely a phenocopy , resembling an atypical men1like syndrome , we believe that further attention should be paid to whether fhh3 may be associated with other endocrine tumors . furthermore , our cases underline the importance of considering fhh3 in families with hyperparathyroid hypercalcemia , including patients with a clinical suspicion of men1 who are mutationnegative , as this may spare patients for the worry of being diagnosed with a cancer susceptibility syndrome and ptx .",
"the authors declare that there is no conflict of interest regarding the publication of this manuscript ."
] | key clinical messagefamilial hypocalciuric hypercalcemia type 3 should be considered as differential diagnosis in patients with suspected primary hyperparathyroidism and/or suspected multiple neoplasia syndrome , as correct diagnosis will spare the patients for going through multiple futile parathyroidectomies and for the worry of being diagnosed with a cancer susceptibility syndrome . |
[
"in a network querying problem , one is given a small network , corresponding to a known pathway or a complex of interest . the goal is to identify similar instances in a large network , where similarity is measured in terms of sequence or interaction patterns . previous approaches to the query problem required precise information on the interaction pattern of the query and were usually limited to small queries ( 24 proteins ) . pathblast a server for querying linear pathways within a protein protein interaction ( ppi ) network ( 1)was subsequently extended to allow searching for more general structures ( 2 ) . a general framework for subnetwork querying was developed ( 3 ) , but it is applicable only to very small queries due to its complexity . two other methods are netmatch , a cytoscape ( 4 ) plugin implementing the work of ferro et al . ( 5 ) that utilizes fast heuristics for subgraph isomorphism to identify approximate matches of queries within a collection of networks , and netgrep ( 6 ) , a system for searching networks for patterns corresponding to small sets of proteins with specified attributes and topology . the torque server implements a novel method for querying protein networks that does not require information on the interconnections ( topology ) among the query proteins ( 7 ) ( figure 1 ) . this makes torque applicable in broader scenarios , such as querying complexes or pathways whose topologies are not completely known , or even when querying from species for which ppi information is not available . ( 8) also studied queries with no topology information , but since their method is enumerative it was applied to very small queries ( 24 proteins ) . it was tested extensively on hundreds of queries of known complexes from a variety of species ( 7 ) . it was shown to yield far more matches than the qnet topology - based approach ( 2 ) , while providing results that are highly functionally coherent . \n the network induced by the vertices labeled a , b , c , d and e is a match to the query , where vertex c is an insertion and query element 4 is deleted . ( a ) the query proteins ; ( b ) the queried network . colored vertices in the network match nodes of the same color in the query . the network induced by the vertices labeled a , b , c , d and e is a match to the query , where vertex c is an insertion and query element 4 is deleted .",
"the torque web server implements the algorithms in ( 7 ) for querying protein sets across species . it combines three approaches : a dynamic programming method utilizing color coding , integer linear programming and a fast heuristic based on shortest paths . torque automatically selects the best method to apply at each stage and outputs the highest scoring match . scores are based on the underlying network structure , on interaction confidence values and on sequence similarities between matching proteins . the input for torque consists of : \n a query set of proteins in species a;their protein sequences;a ppi network for species b;the sequences of the network proteins . \n a query set of proteins in species a ; their protein sequences ; a ppi network for species b ; the sequences of the network proteins . all inputs are in simple text format : \n the query set can be entered directly as a comma - delimited or whitespace - delimited list.protein sequences are given in the standard fasta format.the ppi network is given as a text file , where each row represents an interaction and contains the ids of the interacting pair and a confidence value for it in the range [ 0 , 1 ] . \n the query set can be entered directly as a comma - delimited or whitespace - delimited list . the ppi network is given as a text file , where each row represents an interaction and contains the ids of the interacting pair and a confidence value for it in the range [ 0 , 1 ] . it is possible to use a single fasta file ( input 2 ) for many queries , if it contains the sequences for all proteins in all queries . when the query field is left blank , torque will use all the proteins in input 2 as the query . if input 1 contains uniprot protein ids ( www.uniprot.org ) , their sequences need not be entered in input 2 ; instead , torque automatically retrieves them from the uniprot database . for several target species , currently , the server supports this option for the three target species saccharomyces cerevisiae , drosophila melanogaster and homo sapiens . the user can indicate one of these target species instead of providing inputs 3 and 4 . the user can control two parameters of the algorithm , setting a trade - off between speed and sensitivity . the user can set the threshold for blast similarity ( e - value ) . by setting a lower threshold , less homologs will be identified for the query proteins , making the algorithm faster but less sensitive . the second parameter is a threshold for the confidence values of ppi network edges provided as part of input 3 . edges whose confidence value is lower than the threshold are discarded ; hence , this parameter determines the sparsity of the target network and affects the number of possible matches and the running time . the running time of torque is typically a few minutes , but may be up to an hour , depending on the size and other properties of the query ( for more details , see ( 7 ) ) . if several queries are submitted to the server at the same time , they are queued and executed sequentially . rather than waiting for the results online , they can be accessed later , in two ways : \n when a torque job is started , it is assigned a nine - digit job i d . this i d can be used to access the results later from the main torque page.before submitting a query , the user may enter an email address . once torque has finished processing the query , the results will be sent to the email address provided . when a torque job is started , it is assigned a nine - digit job i d . this i d can be used to access the results later from the main torque page . before submitting a query once torque has finished processing the query , the results will be sent to the email address provided . the web server generates a web page ( figure 2 ) with the image of the top - scoring match for the query in the target network , as well as an auxiliary file in.sif format that can be viewed using the cytoscape software ( 4 ) . the content of the.sif file includes , for each edge , a numerical value representing the confidence in the interaction it represents , as provided in the input . the image shows the subgraph induced by the top - scoring match in the ppi network . each vertex is labeled with its protein name in the ppi network and its matching query protein , if such exists . insertion vertices are shown in gray , and proteins from the query for which there was no match in the solution ( deletions ) are listed separately . \n the following example uses as query the mouse dna synthesome complex , downloaded from the corum website ( http://mips.gsf.de/genre/proj/corum/index.html ) . this 13-member complex was queried in the yeast network ( 5430 proteins , 39 936 interactions ) . examining the subnetwork identified by torque we find that it is functionally coherent ( nucleotidyltransferase activity , p < 1.4e 10 ) and significantly intersects the yeast alpha dna polymerase : primase complex , supporting its biological plausibility .",
"the input for torque consists of : \n a query set of proteins in species a;their protein sequences;a ppi network for species b;the sequences of the network proteins . \n a query set of proteins in species a ; their protein sequences ; a ppi network for species b ; the sequences of the network proteins . all inputs are in simple text format : \n the query set can be entered directly as a comma - delimited or whitespace - delimited list.protein sequences are given in the standard fasta format.the ppi network is given as a text file , where each row represents an interaction and contains the ids of the interacting pair and a confidence value for it in the range [ 0 , 1 ] . \n the query set can be entered directly as a comma - delimited or whitespace - delimited list . the ppi network is given as a text file , where each row represents an interaction and contains the ids of the interacting pair and a confidence value for it in the range [ 0 , 1 ] . it is possible to use a single fasta file ( input 2 ) for many queries , if it contains the sequences for all proteins in all queries . when the query field is left blank , torque will use all the proteins in input 2 as the query . if input 1 contains uniprot protein ids ( www.uniprot.org ) , their sequences need not be entered in input 2 ; instead , torque automatically retrieves them from the uniprot database . for several target species , currently , the server supports this option for the three target species saccharomyces cerevisiae , drosophila melanogaster and homo sapiens . the user can indicate one of these target species instead of providing inputs 3 and 4 . the user can control two parameters of the algorithm , setting a trade - off between speed and sensitivity . the user can set the threshold for blast similarity ( e - value ) . by setting a lower threshold , less homologs will be identified for the query proteins , making the algorithm faster but less sensitive . the second parameter is a threshold for the confidence values of ppi network edges provided as part of input 3 . edges whose confidence value is lower than the threshold are discarded ; hence , this parameter determines the sparsity of the target network and affects the number of possible matches and the running time .",
"the running time of torque is typically a few minutes , but may be up to an hour , depending on the size and other properties of the query ( for more details , see ( 7 ) ) . if several queries are submitted to the server at the same time , they are queued and executed sequentially . rather than waiting for the results online , they can be accessed later , in two ways : \n when a torque job is started , it is assigned a nine - digit job i d . this i d can be used to access the results later from the main torque page.before submitting a query , the user may enter an email address . once torque has finished processing the query , the results will be sent to the email address provided . when a torque job is started , it is assigned a nine - digit job i d . this i d can be used to access the results later from the main torque page . before submitting a query once torque has finished processing the query , the results will be sent to the email address provided .",
"the web server generates a web page ( figure 2 ) with the image of the top - scoring match for the query in the target network , as well as an auxiliary file in.sif format that can be viewed using the cytoscape software ( 4 ) . the content of the.sif file includes , for each edge , a numerical value representing the confidence in the interaction it represents , as provided in the input . the image shows the subgraph induced by the top - scoring match in the ppi network . each vertex is labeled with its protein name in the ppi network and its matching query protein , if such exists . insertion vertices are shown in gray , and proteins from the query for which there was no match in the solution ( deletions ) are listed separately . \n",
"the following example uses as query the mouse dna synthesome complex , downloaded from the corum website ( http://mips.gsf.de/genre/proj/corum/index.html ) . this 13-member complex was queried in the yeast network ( 5430 proteins , 39 936 interactions ) . examining the subnetwork identified by torque we find that it is functionally coherent ( nucleotidyltransferase activity , p < 1.4e 10 ) and significantly intersects the yeast alpha dna polymerase : primase complex , supporting its biological plausibility .",
"the torque web server allows users to run topology - free queries on predefined or user - provided target networks . the result is a subnetwork of the target network most similar to the query , and is presented both graphically and as a downloadable text file .",
") ; german - israel foundation grant ( to r.s . ) ; postdoctoral fellowship from the edmond j. safra bioinformatics program at tel aviv university ( to f.h . ) . funding for open access charge"
] | torque is a tool for cross - species querying of protein protein interaction networks . it aims to answer the following question : given a set of proteins constituting a known complex or a pathway in one species , can a similar complex or pathway be found in the protein network of another species ? to this end , torque seeks a matching set of proteins that are sequence similar to the query proteins and span a connected region of the target network , while allowing for both insertions and deletions . unlike existing approaches , torque does not require knowledge of the interconnections among the query proteins . it can handle large queries of up to 25 proteins . the torque web server is freely available for use at http://www.cs.tau.ac.il/bnet/torque.html . |
[
"cutaneous metastases are defined as dermal or hypodermal neoplastic tissue that has no contiguity with the primary tumor . skin metastases from internal neoplasms are an uncommon clinical finding with an overall incidence of 5.3% and the most common cause is breast cancer with an incidence of 23.9%.1 in general , skin metastases of breast cancer affect the dermis and histologically appear as malignant ductal epithelial cells in sheets , cords , glands , or are arranged in a diffuse infiltrate.2 the finding of transepidermal elimination on cutaneous metastases is exceptional and has only been reported in a few cases.3,4 mehregan classified transepidermal elimination into three types , and the elimination of dermal tumor nests corresponds to type 3 which involves an active interaction between epidermis and dermal connective tissue.5 although transepidermal elimination is the histological feature of the classical perforating disorders , it is also described in other cutaneous conditions and in tumors such as melanocytic nevus,6 eccrine poroma,7 malignant melanoma,8 pilomatricoma,9 and metastatic carcinoma.3,4 in this report we present a case of perforating cutaneous metastasis from breast cancer with mucin 1 ( muci ) expression .",
"in february 2010 , a 48-year - old argentine woman had undergone tumorectomy in her left breast with diagnosis of an invasive ductal carcinoma with low nuclear and histological differentiation grades ; estrogen ( er ) and progesterone ( pr ) receptors were negative and her2/neu was positive . in september 2011 , a mastectomy with immediate breast reconstruction was performed due to local tumor recurrence and the patient received systemic chemotherapy . in march 2012 physical examination revealed an erythematous nodule that was 4 cm in diameter , polylobulated , and with ulcerated surface on the chest region . multiple erythematous painful nodules from 5 mm to 2 cm were distributed on her chest and over the reconstructed breast ( figure 1 ) . a skin biopsy of one of the small lesions revealed skin metastasis from breast carcinoma ( er - pr - her2/neu+ ) . muci expression was studied and a strong reaction was found with a mixed pattern at the plasma membrane and in the cytoplasm ( figure 2 ) . tumor cells in the papillary dermis appeared to penetrate through the epidermis , suggesting transepidermal elimination . the epidermis showed no signals of ulceration ( figure 3 ) , and in some malignant cells , a muci moderate reaction was found .",
"cutaneous metastases from breast carcinoma usually appear months to years after the diagnosis and treatment of the primary malignancy.10,11 the most common localizations are in the chest wall and abdomen , but they can also be found in the scalp and extremities.10 the clinical presentations vary over a wide range of different patterns . nodules are the most common manifestation ( 80% ) , followed by telangiectatic carcinoma ( 11% ) , erysipeloid carcinoma ( 3% ) , en cuirasse carcinoma ( 3% ) , alopecia neoplastica ( 2% ) , and a zosteriform type ( 0.8%).12 a diagnosis of cutaneous metastases is based on the clinical manifestations and the histopathologic study of the lesions . histopathologically , cutaneous metastatic nodules show malignant cells in the dermis arranged in nests surrounded with desmoplastic stroma.2 in our patient , clinically , the skin lesions were nodules , but histologically , tumor cells were not restricted to dermal nests since they also showed perforation and transepidermal elimination . altered structures of the dermis and foreign material like neoplastic cells or external substances mehregan5 classified transepidermal elimination into three types which differ in the mechanism of removal . in type 1 , nonmotile cells or small particles , which produce minimal or no dermal reaction , can be caught between keratinocytes and carried to the epidermis surface during corneocyte differentiation . in type 2 , motile cells or microorganisms actively migrate into the epidermis and are subsequently eliminated with normal desquamation similar to type 1 . the phenomenon of transepidermal elimination occurs in certain dermatoses in which altered structures of the dermis and foreign substances induce an inflammatory response causing the release of collagenases , elastases , and proteases . this inflammatory response generates alteration of the matrix with necrosis and perforation , and can also stimulate pseudoepitheliomatous hyperplasia of the epidermis and subsequent formation of transepidermal perforating canals with elimination of the dermal material.4,5 in a case reported by ohnishi et al,3 breast cancer cutaneous metastases with transepidermal elimination presented with epidermotropism of neoplastic cells and pagetoid spread , features that our patient did not show . on the other hand , abbas et al4 published a case of perforating cutaneous metastasis from an ovarian carcinoma which showed malignant cells in the dermis and hypodermis with areas of transepidermal elimination without epidermotropism . immunohistochemical staining of the tumor cells was positive for muci , as we report in our case . almost all breast cancer cells express muci1316 although benign breast neoplasms and normal breast cells express this mucin as well.17,18 it is considered that muci nonapical expression , as well as its overexpression , are the hallmarks of muci reactivity in breast cancer cells.19 although contradictory results have been found between muci expression and survival in breast cancer patients , more than 70% of studies on tumor samples have found that the presence of any muci in the majority of tumor cells is associated with an improved prognosis.20 in relation to subcellular localization of muci , it has been observed that patients with tumors with the lineal ( membrane ) pattern have better survival.21 23 rahn et al20 reported that aberrantly localized muci in the tumor cell cytoplasm or nonapical membrane is associated with a worse prognosis . in a previous report , we found a significant decrease of muci apical expression frequency according to histological as well as nuclear grade increment . in this sense , it is known that histological grade is an accurate predictor of tumor behavior.24 the presence of apical membrane staining would indicate that muci targeting pathways are intact , and it has been associated with better prognosis that is possibly related to functional differentiation of the tumor.24 rahn et al20 also found a significantly lower mean nuclear grade in tumors with high muci expression ( 50% ) . coincidentally , in the primary tumor of our patient , a high nonapical muci expression along with low nuclear and differentiation grades was observed . muci may alter the interaction between tumor cells and their environment , changing the composition . it has been observed that muci cytoplasmic tail interacts with -catenin through a similar motif to that found in e - cadherin and inhibits the formation of an e - cadherin--catenin complex , reducing cell cell adhesion.19 similar to abbas et al,4 it is possible that in our case , the contributing factors to transepidermal elimination could be related to a tumor dermis interaction in which the epidermis does not seem to be implicated . the physical effect by the expanding tumor and the inflammatory response are factors to be considered . also , the possibility of a vascular compromise resulting in necrosis and ulceration of the epidermis as well as muci expression may play a role ."
] | breast cancer is the most common cause of cutaneous metastases from internal malignancies . generally , the neoplastic cells are located in the dermis or hypodermis , while a finding of transepidermal elimination on cutaneous metastases is exceptional . in this report we present a patient with perforating cutaneous metastases from breast cancer with mucin 1 expression . cutaneous , bone , lung , and hepatic lesions were detected two years after the diagnosis of the primary tumor . |
[
"patients with copd or asthma frequently experience exacerbations of their illness . studies from norway and the uk have shown that each year ~50% of copd patients experience an exacerbation that leads to a visit to a general practitioner ( gp ) , in - hospital treatment , or self - administered treatment with antibiotics or systemic corticosteroids.1,2 in a study from the united states , ~25% of asthma patients reported to use a short course with oral corticosteroids during a period of 3 months.3 treatment with systemic corticosteroids is recommended in both severe copd exacerbations4,5 and asthma attacks.6,7 such medication counteracts the inflammatory response in the bronchial tree , and by doing so , alleviates the accompanying bronchial obstruction . in asthma attacks , there is firm evidence for a favorable effect of systemic corticosteroids,6 for copd exacerbations the evidence refers mainly to clinical trials in hospitalized patients.4 in copd guidelines , the criteria for starting such treatment are not clear cut , but it is often recommended when symptoms are not relieved after stepping up treatment with inhaled bronchodilators.8 benefit from systemic corticosteroid treatment has to be weighed against adverse effects , such as increased fragility of the bones and increased blood levels of glucose.4 improvement in lung function has been a main outcome measure in studies on the effects of systemic corticosteroids.9,10 this implies that the acute deterioration of lung function associated with the exacerbation is a main target for the systemic corticosteroids . it would , therefore , probably be useful , when deciding on prescribing systemic corticosteroids , to know whether the patient actually suffers from increased bronchial obstruction and if so , to which degree ? however , doing spirometry in the acute phase of a copd exacerbation is not recommended in the global initiative for chronic obstructive lung disease ( gold ) guidelines,5 and it might not be convenient in all cases with asthma attacks . other sources of information that could reflect increased bronchial obstruction could be the symptoms of the patient , as well as chest findings and assessment of oxygen saturation ( spo2 ) by pulse oximetry . the aim of this study was to describe how these clinical findings are associated with a decrease in lung function during exacerbations . we also wanted to find out whether the strength of these associations would be affected when they could be described in terms of change from stable state .",
"this observational prospective study was carried out in seven general practice offices in the north and south of norway . patients aged 40 years or older registered in the electronic medical record with a diagnosis of asthma or copd ( or both ) in the previous 5 years were identified , and a random sample of 1,111 patients was invited to participate . of the 380 patients who met for baseline registration between april 2009 and march 2010 , 376 were considered to be in a stable phase of their disease and were included in the study . out of those , 210 were diagnosed with asthma by their gps , 74 with copd , and 92 with both asthma and copd.11 they were all asked to visit their gp within 23 days if they experienced exacerbations of their lung disease the following 12 months . all participants gave written consent , and the study was approved by the regional committee for medical and health research ethics in north norway . respiratory symptoms the previous week and relevant quality of life items were examined using the norwegian translation of the clinical copd questionnaire ( ccq).12 in the ccq , the symptoms short of breath at rest , short of breath doing physical activities , coughing , and production of phlegm were classified into scores from 0 ( never ) to 6 ( almost all the time ) , and a mean score of respiratory symptoms was calculated . the ccq also contains questions on depression and concern about the disease getting worse with the same score system and four questions on activity limitation due to the illness , also with a score system from 0 ( not limited at all ) to 6 ( totally limited ) . smoking habit and hospitalizations due to the lung disease the previous year were reported on a separate questionnaire . on a pop - up questionnaire in the electronic medical record the examining gp recorded comorbidities and treatment given , including antibiotics and systemic corticosteroids for exacerbations the previous year . exacerbation of asthma or copd the year before baseline was defined as exacerbations that were treated with antibiotics and/or systemic corticosteroids or ended with hospitalization , a definition previously used for copd exacerbations.1 the gps also reported the presence of wheezes , crackles , diminished breath sounds , and prolonged expiration after auscultation of the lungs . c - reactive protein ( crp ) was analyzed using near patient tests : afinion as100 analyzer , orion quickread crp , or abx micros crp , which all could display values down to 8 mg / l . spo2 was measured by a digital handheld pulse oximeter , onyx ii model 0550 ( nonin medical , inc . , spirometry was carried out after the pulse oximetry , following the european respiratory society / american thoracic society guidelines.13 spirare sps310 spirometers ( diagnostica as , oslo , norway ) were used . post - bronchodilator spirometry was carried out 20 minutes after inhalation of 0.4 mg salbutamol . the post - bronchodilator forced expiratory volume in 1 second ( fev1 ) and forced vital capacity ( fvc ) were used in the analyses . norwegian reference values for spirometry were applied.14 the participants filled in the ccq , this time concerning the previous 24 hours . respiratory symptoms the previous 24 hours were also reported by the gps based on history taking on a pop - up questionnaire and shortness of breath , coughing , phlegm production , and wheezing were classified into three grades : 1 ) not present or as normal , 2 ) more bothersome than normal , and 3 ) very bothersome . chest findings , the crp value , and pulse oximetry were recorded as done at baseline . lung function testing was also carried out with the same procedure , but post - bronchodilator spirometry was not carried out . a significant drop in fev1was defined as a drop of 10% from baseline15 and of at least 200 ml . how such a drop in fev1 was associated with baseline characteristics and symptoms , signs and test results at exacerbation was analyzed by chi - square test , fischer s exact test ( dichotomous variables ) , and mann whitney test ( the ccq variables ) . significant decreases in spo2 were defined as a reduction of at least 2% to 95% and 92% , respectively . likelihood ratios were calculated for findings significantly associated with the fixed drop in fev1 using online software ( m.k . associations with percentage change in fev1 from baseline were analyzed by linear regression making it possible to have the degree of change as outcome .",
"this observational prospective study was carried out in seven general practice offices in the north and south of norway . patients aged 40 years or older registered in the electronic medical record with a diagnosis of asthma or copd ( or both ) in the previous 5 years were identified , and a random sample of 1,111 patients was invited to participate . of the 380 patients who met for baseline registration between april 2009 and march 2010 , 376 were considered to be in a stable phase of their disease and were included in the study . out of those , 210 were diagnosed with asthma by their gps , 74 with copd , and 92 with both asthma and copd.11 they were all asked to visit their gp within 23 days if they experienced exacerbations of their lung disease the following 12 months . all participants gave written consent , and the study was approved by the regional committee for medical and health research ethics in north norway .",
"respiratory symptoms the previous week and relevant quality of life items were examined using the norwegian translation of the clinical copd questionnaire ( ccq).12 in the ccq , the symptoms short of breath at rest , short of breath doing physical activities , coughing , and production of phlegm were classified into scores from 0 ( never ) to 6 ( almost all the time ) , and a mean score of respiratory symptoms was calculated . the ccq also contains questions on depression and concern about the disease getting worse with the same score system and four questions on activity limitation due to the illness , also with a score system from 0 ( not limited at all ) to 6 ( totally limited ) . smoking habit and hospitalizations due to the lung disease the previous year were reported on a separate questionnaire . on a pop - up questionnaire in the electronic medical record the examining gp recorded comorbidities and treatment given , including antibiotics and systemic corticosteroids for exacerbations the previous year . exacerbation of asthma or copd the year before baseline was defined as exacerbations that were treated with antibiotics and/or systemic corticosteroids or ended with hospitalization , a definition previously used for copd exacerbations.1 the gps also reported the presence of wheezes , crackles , diminished breath sounds , and prolonged expiration after auscultation of the lungs . c - reactive protein ( crp ) was analyzed using near patient tests : afinion as100 analyzer , orion quickread crp , or abx micros crp , which all could display values down to 8 mg / l . spo2 was measured by a digital handheld pulse oximeter , onyx ii model 0550 ( nonin medical , inc . , spirometry was carried out after the pulse oximetry , following the european respiratory society / american thoracic society guidelines.13 spirare sps310 spirometers ( diagnostica as , oslo , norway ) were used . post - bronchodilator spirometry was carried out 20 minutes after inhalation of 0.4 mg salbutamol . the post - bronchodilator forced expiratory volume in 1 second ( fev1 ) and forced vital capacity ( fvc ) were used in the analyses .",
"the participants filled in the ccq , this time concerning the previous 24 hours . respiratory symptoms the previous 24 hours were also reported by the gps based on history taking on a pop - up questionnaire and shortness of breath , coughing , phlegm production , and wheezing were classified into three grades : 1 ) not present or as normal , 2 ) more bothersome than normal , and 3 ) very bothersome . chest findings , the crp value , and pulse oximetry were recorded as done at baseline . lung function testing was also carried out with the same procedure , but post - bronchodilator spirometry was not carried out .",
"a significant drop in fev1was defined as a drop of 10% from baseline15 and of at least 200 ml . how such a drop in fev1 was associated with baseline characteristics and symptoms , signs and test results at exacerbation was analyzed by chi - square test , fischer s exact test ( dichotomous variables ) , and mann whitney test ( the ccq variables ) . changes from baseline were found by subtracting baseline values from the values at exacerbation . significant increase in crp was defined as an increase of at least 10 mg significant decreases in spo2 were defined as a reduction of at least 2% to 95% and 92% , respectively . likelihood ratios were calculated for findings significantly associated with the fixed drop in fev1 using online software ( m.k . associations with percentage change in fev1 from baseline were analyzed by linear regression making it possible to have the degree of change as outcome .",
"during the 1-year follow - up period , 109 patients visited their gp due to one or more exacerbations . for patients who visited the gp with several exacerbations , the first exacerbation was , as a rule , included in the analysis . however , 21 patients were excluded due to incomplete data from the exacerbations , in most cases because spirometry was not done . seventeen gps took part in the examinations of the 88 included patients at baseline , whereas 34 gps shared the examinations during the exacerbations , and 41 patients ( 47% ) were examined by the same gp both times . the mean age of the patients at baseline was 63 years , and 66% were female . a copd diagnosis ( or both asthma and copd ) had been given to 48 ( 55% ) patients at baseline , and patients with a copd diagnosis had significantly more frequent history of exacerbation the previous year . they were also different from the patients in the asthma group in other ways ( table 1 ) . the distribution of fev1 at baseline and at exacerbation is shown in figure 1 , with predicted mean values of 76.1% and 70.8% , respectively . among the asthma patients , the corresponding fev1% predicted values were 87.5 and 83.0 and among the copd patients , 61.2 and 54.7 . the distribution of change from baseline is shown in figure 2 . a significant drop in fev1 at exacerbation ( 10% and at least 200 ml ) the patients with this drop in lung function had more frequent copd diagnosis at baseline than those without ( p=0.04 , table 2 ) . during spirometry at baseline 75 patients ( 85% ) expired for more than 6 seconds , at exacerbation the corresponding number was 67 ( 76% ) . ten of the 13 patients who reported very bothersome wheezing had a significant drop in fev1 ( p=0.001 , table 2 ) . in the asthma group , only two patients had this symptom , but a significant drop in fev1 was found in both . an abnormal finding by chest auscultation was found in 68 patients ( 77% ) , and a new sign ( not recorded at baseline ) was found in 48 patients ( 55% ) . any abnormal chest sign , whether new or not , was recorded more frequently in patients with a significant drop in fev1 ( table 2 ) compared with other patients . crackles was associated with a drop in fev1 , whereas wheezes was not . in 26 patients ( 30% ) , one or more of the four chest signs were recorded both at baseline and exacerbation , and with similar frequency whether the same gp performed the auscultation at both occasions , 24% and 34% , respectively ( p=0.3 ) . spo2 values 92% were found in 11 patients , and in 10 of these , the saturation had dropped 2% or more between baseline and exacerbation . this drop in spo2 was associated with a significant drop in fev1 ( p=0.02 ) . there was a median increase in ccq score of 1.25 for respiratory symptoms between baseline and exacerbation , but no difference was found between the patients with a significant drop in fev1 and the other patients ( table 3 ) . the diagnostic value of findings , significantly indicating a drop in fev1 , is shown in table 4 . the asthma and copd subgroups did not differ when it came to likelihood ratios of very bothersome wheezing experienced by the patients and crackles on auscultation . a diagnostic value of spo2 dropping to below 93% was only found in the copd group . when the percentage drop in fev1 was used as outcome in univariable linear regression , the fev1/fvc ratio was the strongest predictor among the baseline characteristics ( table 5 ) . treatment with long - acting beta - agonist / inhaled corticosteroids seemed to slightly counteract the drop in fev1 , but this association was not statistically significant . very bothersome wheezing during exacerbation , as experienced by the patient , was the strongest indicator of change in fev1 among the symptoms , and prolonged expiration and any abnormal auscultation finding were now stronger indicators than crackles . a decrease in spo2 of at least 2% to a value of 92% was still strongly associated with a drop in fev1 .",
"we have attempted to find alternatives to spirometry in assessing drop in lung function during asthma and copd exacerbations . one strong indicator of a significant drop in lung function was increased wheezing as experienced by the patient . as far as we know , this finding has not been reported previously to be a sign of a drop in lung function . patient experienced wheezing was a stronger predictor of drop in lung function than were wheezes on auscultation . decreased spo2 measured as spo2 92% was also strongly associated with a drop in fev1 . only one copd patient had spo2 92% at baseline , telling us that this is a relevant finding for primary care . a drop in fev1 was most frequently found in the patients with a copd diagnosis , and the fev1/fvc ratio at baseline was strongly associated with a change in lung function in the linear regression , indicating that the severity of the copd should be taken into account .",
"we have attempted to find alternatives to spirometry in assessing drop in lung function during asthma and copd exacerbations . one strong indicator of a significant drop in lung function was increased wheezing as experienced by the patient . as far as we know , this finding has not been reported previously to be a sign of a drop in lung function . patient experienced wheezing was a stronger predictor of drop in lung function than were wheezes on auscultation . decreased spo2 measured as spo2 92% was also strongly associated with a drop in fev1 . only one copd patient had spo2 92% at baseline , telling us that this is a relevant finding for primary care . a drop in fev1 was most frequently found in the patients with a copd diagnosis , and the fev1/fvc ratio at baseline was strongly associated with a change in lung function in the linear regression , indicating that the severity of the copd should be taken into account .",
"as part of a prospective study with baseline examinations , we were able to collect post - bronchodilator spirometry at stable state in all patients . the spirometry was well performed , and although fewer patients expired for more than 6 seconds during exacerbation than at baseline , there are reasons to believe that valid fev1 values were obtained . the cutoff level of 10% for drop in fev1 may be regarded as arbitrary , and the results are strengthened by using the percentage drop in fev1 as continuous outcome variable in linear regression . however , we did not find any great benefit of taking the baseline findings into account . one good reason for doing this is the difficulties in differentiating between asthma and copd in many patients with obstructive lung disease.11,16 a second justification is the similar challenges in the two diseases when it comes to treating exacerbations with oral corticosteroids . this is rather a small clinical study , and the results should be interpreted with caution . not all patients who were assessed during exacerbation were included , due to incomplete data collection in the practices . whereas the collection of baseline data was well organized , the participating practices were not always as prepared when it came to the exacerbations . this has probably not resulted in any systematic selection bias influencing the association between findings and drop in lung function .",
"we have not found studies evaluating wheezing , as experienced by patients , as a sign of drop in lung function , only as an independent predictor of copd in general.17 wheezing is not one of the items in score sheets for health status in copd patients , such as the ccq12 and the copd assessment test ( cat)18 and neither in the exacerbations of chronic pulmonary disease tool ( exact).19 decreased spo2 during copd exacerbations has been shown in previous studies,20,21 but decreased spo2 has not previously been linked to the magnitude of drop in fev1 . a strong link between reduced fev1 and reduced pulse oximetry values has been shown in several studies , also among asthma and copd patients in general practice.22 introduction of pulse oximeters in primary care was recommended in 2010,23 and our results support this development . in a previous publication from this project , we showed that decreased spo2 predicted treatment with oral corticosteroids.24 there was , however , no association between patient experienced wheezing and the prescribing of oral corticosteroids ( among the 13 patients with very bothersome wheezing , 6 [ 46.2% ] were treated with oral corticosteroids , compared to 40% in the remaining patients ) . one may question why not just spirometry can be used in the assessment of lung function during asthma and copd exacerbations . it was successfully applied in this study and has also been performed in other studies without reports of adverse experiences.9,10 the recommendation in the gold guidelines , not to use spirometry during exacerbations,5 is probably based on experiences from hospital and with severely ill outpatients . in primary care , the majority of copd patients have a mild or moderate disease , as was also the case in this study . when a spirometry result from stable state is available and performed within the previous year , a new spirometry can usually give a valid measure of drop in lung function . however , coughing may force the patient to terminate the expiratory maneuver too early , and this may explain why the expiration lasted less than 6 seconds more frequently during exacerbation than at baseline in this study . clinical assessment without spirometry is often needed . to find wheezes by auscultation of the chest wheezes were recorded as present or absent , but their intensity in terms of number and duration was not documented . consequently , when wheezes were recorded as present in both stable state and during exacerbation , we had no information about the change in the intensity . the difficulties in interpreting auscultation findings also relate to crackles and prolonged expiration , which were stronger indicators of a drop in fev1 than wheezes in this study . to ask primary care patients with asthma or copd exacerbations about wheezing seems to be a simple and a rational approach when assessing change in lung function . . increased wheezing and low pulse oximetry values are probably useful to take into account when treatment with oral corticosteroids is considered . however , we do not know to which degree treatment with oral corticosteroids should be based on a drop in fev1 . more studies are needed to help identify the clinical findings that can be helpful in the difficult decision to prescribe this potent medication ."
] | backgroundwhen assessing patients with exacerbation of asthma or copd , it may be useful to know the drop in forced expiratory volume in 1 second ( fev1 ) compared with stable state , in particular when considering treatment with oral corticosteroids . the objective of the study was to identify indicators of drop in fev1 during exacerbations.methodsin this prospective multicenter study from primary care , patients diagnosed with asthma or copd were examined at stable state and during exacerbations the following year . symptoms , chest findings , and pulse oximetry were recorded , and spirometry was performed . a fixed drop in fev1 ( 10% and 200 ml ) and percentage change in fev1 were outcomes when possible indicators were evaluated.resultsthree hundred and eighty patients attended baseline examination , and 88 with a subsequent exacerbation were included in the analysis . thirty ( 34% ) had a significant drop in fev1 ( 10% and 200 ml ) . increased wheezing was the only symptom associated with this drop with a likelihood ratio of 6.4 ( 95% confidence interval , 1.921.7 ) . crackles and any new auscultation finding were also associated with a significant drop in fev1 , as was a 2% drop in oxygen saturation ( spo2 ) to 92% in the subgroup diagnosed with copd . very bothersome wheezing and severe decrease in spo2 were also very strong predictors of change in fev1 in linear regression adjusted for age , gender , and baseline fev1% predicted.conclusionincreased wheezing , as experienced by the patient , and a decreased spo2 value strongly indicated a drop in lung function during asthma and copd exacerbations and should probably be taken into account when treatment with oral corticosteroids is considered . |
[
"diagnostic lumbar puncture ( dlp ) is a frequent procedure used in the diagnosis of neural system disorders . post - lumbar puncture syndrome is a common complication of dlp occurring in about 340% of patients [ 14 ] . post - lumbar puncture headache ( plph ) is the predominant symptom of this syndrome , probably resulting from the leakage of cerebrospinal fluid into the epidural cavity through the post - puncture opening in the dura mater . the loss of cerebrospinal fluid causes a drop off in intracranial pressure ( icp ) , causing compensative dilatation of cerebral vessels , which is reflected by the headache [ 13 , 5 ] . this theory has one significant weakness , namely that plph do not occur in every patient following dlp . transcranial doppler ultrasonography ( tcd ) enables us to assess blood flow in the intracranial arteries non - invasively . assuming that tcd parameters are influenced both by changes in cerebral vessel diameters and by fluctuations in icp [ 68 ] , we aimed to verify if dlp resulted in significant changes in cerebral blood flow ( cbf ) that could be visualized by tcd . therefore , we identified a group of subjects who developed plph following dlp and compared their pre- and post - puncture blood flow parameters with respective values of plph - free subjects .",
"this study included patients at the department of neurology , who required a scheduled dlp . exclusion criteria from this group included emergency lumbar punctures , inadequate temporal bone windows , stenosis of the middle cerebral arteries , hemodynamically significant stenosis of the common carotid arteries , atrial fibrillation , and patients who were immobilized . all the procedures were approved by the local ethics committee of the ludwik rydygier collegium medicum in bydgoszcz . tcd was performed 24 h before dlp and repeated within 24 h after the procedure . lumbar puncture was done following standard protocol by one of 11 physicians employed at the department . plph was diagnosed according to the international classification of headache disorders ( ich - ii ) guidelines . the presence and severity of plph was evaluated for 5 days , on a daily basis , using a numeric rating scale ( nrs ) . sixty - six patients were enrolled to this study , including 37 men and 29 women . the mean age of these patients was 47.4 16.5 years ( range from 16 to 88 , table 1 ) . patients were subjected to diagnostic procedures due to cranial mononeuropathy ( n = 12 ) , polyneuropathy ( n = 7 ) , multiple sclerosis ( n = 13 ) , vertigo ( n = 7 ) , diffuse injuries of the brain or spinal cord ( n = 9 ) , epilepsy ( n = 5 ) , and other reasons.table 1clinical characteristics of patients who developed post - lumbar puncture headache ( plph ) and in plph - free individualsparameterplph - free ( n = 45)plph ( n = 21)p valueage in years , mean sd49.3 17.843.2 12.50.16women , n ( % ) 13 ( 28.9)16 ( 76.2)0.00031men , n ( % ) 32 ( 71.1)5 ( 23.8)0.00026history of headache , n ( % ) 9 ( 20)14 ( 66.7)0.00021 tension - type headache , n ( % ) 6 ( 13.3)11 ( 52)0.00034 migraine without aura , n ( % ) 3 ( 6.7)2 ( 9.5)0.21 other type of headache , n ( % ) 0 ( 0)1 ( 4.8)arterial hypertension , n ( % ) 12 ( 26.67)3 ( 14.29)0.26diabetes , n ( % ) 9 ( 20)2 ( 9.5)0.29hypercholesterolemia , n ( % ) 15 ( 33.3)4 ( 19.1)0.23hematocrit in % , mean sd41.8 3.339.1 3.90.006hemoglobin in g / l , mean sd14.2 1.313.0 1.50.001 clinical characteristics of patients who developed post - lumbar puncture headache ( plph ) and in plph - free individuals lumbar puncture was performed in the lateral recumbent position , using the intervertebral space between l4 and l5 or between l5 and s1 , with the aid of a 22-gauge needle ( bd spinal needle quincke type point ) . all the procedures were performed between 11 and 12 a.m. following the procedure , the patients were ordered to stay in bed for 8 h. tcd was performed using a pioneer apparatus ( nicolet / eme ) with a 2-mhz probe . following localization of the temporal window , the middle cerebral artery ( mca ) was identified . the probe was placed so as to record the peak possible velocity from the vessel . the measurements included mean velocity ( vmean ) , peak systolic velocity ( vmax ) , and gosling s pulsatility index ( pi ) at 5456 mm , in the left and right mca . all tcds were performed by the same physician being experienced in neurosonology and unaware of plph presence and severity in patients examined . mean values of normally distributed variables were compared with student s t test for independent samples , whereas the variables whose distributions were not normal were compared with the non - parametric mann distributions of discrete variables were compared between the groups with the aid of test . calculations were performed using statistica 7 ( statsoft , poland ) software , and statistical significance was defined as p 0.05 .",
"this study included patients at the department of neurology , who required a scheduled dlp . exclusion criteria from this group included emergency lumbar punctures , inadequate temporal bone windows , stenosis of the middle cerebral arteries , hemodynamically significant stenosis of the common carotid arteries , atrial fibrillation , and patients who were immobilized . all the procedures were approved by the local ethics committee of the ludwik rydygier collegium medicum in bydgoszcz .",
"tcd was performed 24 h before dlp and repeated within 24 h after the procedure . lumbar puncture was done following standard protocol by one of 11 physicians employed at the department . plph was diagnosed according to the international classification of headache disorders ( ich - ii ) guidelines . the presence and severity of plph was evaluated for 5 days , on a daily basis , using a numeric rating scale ( nrs ) . sixty - six patients were enrolled to this study , including 37 men and 29 women . the mean age of these patients was 47.4 16.5 years ( range from 16 to 88 , table 1 ) . patients were subjected to diagnostic procedures due to cranial mononeuropathy ( n = 12 ) , polyneuropathy ( n = 7 ) , multiple sclerosis ( n = 13 ) , vertigo ( n = 7 ) , diffuse injuries of the brain or spinal cord ( n = 9 ) , epilepsy ( n = 5 ) , and other reasons.table 1clinical characteristics of patients who developed post - lumbar puncture headache ( plph ) and in plph - free individualsparameterplph - free ( n = 45)plph ( n = 21)p valueage in years , mean sd49.3 17.843.2 12.50.16women , n ( % ) 13 ( 28.9)16 ( 76.2)0.00031men , n ( % ) 32 ( 71.1)5 ( 23.8)0.00026history of headache , n ( % ) 9 ( 20)14 ( 66.7)0.00021 tension - type headache , n ( % ) 6 ( 13.3)11 ( 52)0.00034 migraine without aura , n ( % ) 3 ( 6.7)2 ( 9.5)0.21 other type of headache , n ( % ) 0 ( 0)1 ( 4.8)arterial hypertension , n ( % ) 12 ( 26.67)3 ( 14.29)0.26diabetes , n ( % ) 9 ( 20)2 ( 9.5)0.29hypercholesterolemia , n ( % ) 15 ( 33.3)4 ( 19.1)0.23hematocrit in % , mean sd41.8 3.339.1 3.90.006hemoglobin in g / l , mean sd14.2 1.313.0 1.50.001 clinical characteristics of patients who developed post - lumbar puncture headache ( plph ) and in plph - free individuals lumbar puncture was performed in the lateral recumbent position , using the intervertebral space between l4 and l5 or between l5 and s1 , with the aid of a 22-gauge needle ( bd spinal needle quincke type point ) . the volumes of collected cerebral fluid ranged from around 610 ml . all the procedures were performed between 11 and 12 a.m. following the procedure , the patients were ordered to stay in bed for 8 h. tcd was performed using a pioneer apparatus ( nicolet / eme ) with a 2-mhz probe . following localization of the temporal window , the middle cerebral artery ( mca ) was identified . the probe was placed so as to record the peak possible velocity from the vessel . the measurements included mean velocity ( vmean ) , peak systolic velocity ( vmax ) , and gosling s pulsatility index ( pi ) at 5456 mm , in the left and right mca . all tcds were performed by the same physician being experienced in neurosonology and unaware of plph presence and severity in patients examined .",
"mean values of normally distributed variables were compared with student s t test for independent samples , whereas the variables whose distributions were not normal were compared with the non - parametric mann distributions of discrete variables were compared between the groups with the aid of test . calculations were performed using statistica 7 ( statsoft , poland ) software , and statistical significance was defined as p 0.05 .",
"post - lumbar puncture headache was observed in 21 out of 66 patients who underwent dlp ( 32% ) , whereas symptoms of post - lumbar puncture syndrome were not noted in the remaining 45 subjects ( 68% ) . in most patients ( 86% ) , the symptoms manifested on the first day following dlp , on average 17.7 10.2 h after the procedure ( range 744 h ) . plph persisted 5.5 1.8 days on average ( range 210 days ) . female patients predominated amongst the plph cases ( 16 , compared to five men , p < 0.0003 ) . most patients who developed plph ( n = 14 ) had a history of headaches , mostly tension headaches . the mean age of patients with plph was lower than for unaffected individuals ( 43.2 vs. 49.3 years ) , but this difference was insignificant ( table 1 ) . in both groups of patients , no significant differences were observed in vmean , vmax and pi between the right and left mcas both before dlp and following this procedure ( table 2).table 2pre- and post - puncture values ( mean sd ) of mean velocity ( vmean ) , peak systolic velocity ( vmax ) , and gosling s pulsatility index ( pi ) in the right ( mca r ) and left ( mca l ) middle cerebral arteries of patients who developed post - lumbar puncture headache ( plph ) and in plph - free individualsplph - free ( n = 45)plph ( n = 21)p valuepre - puncture vmean , mca r ( m / s)55.2 9.771.9 24.90.0002post - puncture vmean , mca r ( m / s)55.5 12.658.4 20.20.47p value0.860.0004pre - puncture vmean , mca l ( m / s)55 12.0169.12 22.560.0015post - puncture vmean , mca l ( m / s)54.2 13.259.4 19.10.19p value0.700.008pre - puncture vmax , mca r ( m / s)89.9 16.2109.3 36.90.004post - puncture vmax , mca r ( m / s)91.1 21.589.8 30.10.84p value0.700.0002pre - puncture vmax , mca l ( m / s)89.8 19.4104.3 32.20.03post - puncture vmax , mca l ( m / s)88.7 20.490.7 28.00.74p value0.740.009pre - puncture pi , mca r0.99 0.200.86 0.140.01post - puncture pi , mca r1.0 0.210.89 0.120.03p value0.460.41pre - puncture pi , mca l0.98 0.220.84 0.130.01post - puncture pi , mca l0.99 0.230.86 0.130.01p value0.430.65 pre- and post - puncture values ( mean sd ) of mean velocity ( vmean ) , peak systolic velocity ( vmax ) , and gosling s pulsatility index ( pi ) in the right ( mca r ) and left ( mca l ) middle cerebral arteries of patients who developed post - lumbar puncture headache ( plph ) and in plph - free individuals in patients who developed plph , bilateral pre - puncture values of vmean and vmax were significantly higher and pi was significantly lower compared to unaffected individuals . no significant differences were observed between these groups in terms of post - puncture vmean and vmax , but the post - puncture pi was still significantly lower in plph cases ( table 2 ) . moreover , hemoglobin concentration and hematocrit values were significantly lower in patients who developed headache compared to unaffected individuals ( table 1 ) . in plph cases , the post - puncture values of vmean and vmax were significantly lower than the respective baseline parameters . significant puncture - related changes in bilateral vmean and vmax were not observed in patients who did not develop plph . after the puncture , a slight increase in pi was observed bilaterally in both groups , but these changes lacked statistical significance ( table 2 ) . when study results were stratified according to patient gender , significant post - puncture changes in vmean and vmax were observed only in women ( p < 0.01 and p < 0.07 in right and left mca , respectively ) . a significant inverse correlation was present between plph severity on nrs and bilateral pre - puncture pi ( fig . 1).fig . 1correlation between post - lumbar puncture headache ( plph ) severity on numeric rating scale and pre - puncture gosling s pulsatility index ( pi ) in the left middle cerebral artery correlation between post - lumbar puncture headache ( plph ) severity on numeric rating scale and pre - puncture gosling s pulsatility index ( pi ) in the left middle cerebral artery",
"post - lumbar puncture headache is believed to result from cerebrospinal fluid leakage through the post - puncture opening , with a subsequent decrease in intracranial pressure and cerebral vessel dilatation [ 13 , 5 ] . this theory was confirmed by our study . following the puncture , we observed significant decreases in vmean and vmax in bilateral mcas of patients who developed plph when compared to their respective pre - puncture values . the drop off in vmean and vmax observed in this group of patients may result from the dilatation of intracranial vessels , a consequence of lowered icp . similar puncture - related decreases in vmax in patients with plph were previously described by gobel et al . , but only affecting the right mca . in our study , significant puncture - related changes in vmean and vmax were not observed in bilateral mcas of plph - free individuals . presumably , the loss of cerebrospinal fluid in these patients was not significant enough to be reflected by compensative dilatation of cerebral vessels . the value of pi illustrates the resistance of a vascular bed ( supplied by a given artery ) when examined by tcd . there is a linear relationship between changes in pi and icp . a decrease in pi may result both from lowered icp and from vascular dilatation [ 7 , 8 ] . assuming that the loss of cerebrospinal fluid with further decrease in icp is the reason for plph , pi should decrease during the early phase of post - lumbar puncture syndrome . reactive dilatation of cerebral vessels due to decreased icp should result in further pi drop off . we did not observe significant puncture - related changes in pi , both in patients who developed plph and in unaffected individuals . presumably , icp fluctuations were slight or transient and therefore we failed to record them . noticeably , baseline ( pre - puncture ) pi values in patients who later developed plph were significantly lower compared to subjects free of this condition . this finding suggests that compensative dilatation of cerebral vessels does not accompany every decrease in icp but is rather characterized by low values of this parameter . there exist linear relationships between pi or vmax changes and changes in icp in cerebral vessels . pi is known to decrease and vmax to increase with lowered icp [ 7 , 8 ] . thus , it is likely that the baseline icp in patients who later developed plph was lower than in unaffected individuals . consequently , further icp drop off due to cerebrospinal fluid loss might result in compensative vascular dilatation in patients with plph . a relatively higher baseline icp in plph - free individuals might in turn protect them against intracranial hypotension and resulting post - puncture headache . this theory was supported by a significant correlation observed in our study , between pre - puncture pi and plph severity : the lower the baseline pi ( and indirectly icp ) the more severe the plph . in cases with plph , baseline vmean and vmax values were higher and pi lower than in unaffected individuals . vmean and vmax are known to decrease with age [ 6 , 11 ] . consequently , higher baseline values of these parameters in plph patients might be associated with the higher age of this group , compared to unaffected individuals . in our study , age differences between these two groups were insignificant , and therefore , unlikely to be responsible for the results found in this experiment . the predominance of women amongst the plph patients might be another potential reason for flow velocity differences observed between affected and unaffected individuals . higher vmean and vmax values were previously demonstrated in females compared to males and these differences were attributed to higher values of cbf in women [ 11 , 12 ] . additionally , our study revealed significantly lower hematocrit and hemoglobin values in plph subjects than in unaffected individuals . a lowered hematocrit is known to enhance flow velocity , and decreases pi due to reduced resistance . consequently , decreased hematocrit values might be responsible for higher values of vmean and vmax and lower pi observed in the plph cases . , hematocrit values do not influence flow velocities unless they are below 35% . in conclusion , the findings of this study partially confirm the theory behind the etiology of plph stated in the introduction , and suggest that higher baseline values of vmean and vmax and low pi in bilateral mcas predispose patients to this condition . additional risk factors of plph were observed to include female gender , history of headaches , and decreased hematocrit and hemoglobin levels . finally , within the 24 h following puncture , significant decreases in vmean and vmax were observed in bilateral mcas of patients who developed plph ."
] | the aim of this study was to verify if diagnostic lumbar puncture ( dlp ) in post - lumbar puncture headache ( plph ) patients is related to significant changes in cerebral blood flow which could be visualized by transcranial doppler ( tcd ) . sixty - six patients were enrolled in this study . tcd was performed 24 h before dlp and repeated within 24 h after the procedure . the measurements included mean velocity ( vmean ) , peak systolic velocity ( vmax ) , and gosling s pulsatility index ( pi ) , in the left and right middle cerebral artery ( mca ) . plph was observed in 21 patients ( 32% ) . no significant differences were noted in vmean , vmax and pi between the right and left mcas both before dlp and following this procedure . in patients who developed plph , bilateral pre - puncture values of vmean and vmax were significantly higher and pi was significantly lower compared to unaffected individuals . no significant differences were observed between these groups in terms of post - puncture vmean and vmax , but the post - puncture pi was still significantly lower in plph cases . in plph cases , the post - puncture values of vmean and vmax were significantly lower than the respective baseline parameters . a significant inverse correlation was present between plph severity and bilateral pre - puncture pi . in conclusion , this study revealed that higher baseline values of vmean and vmax and low pi in bilateral mcas predispose patients to plph . |
[
"the mammalian transcriptome and proteome is far more diverse than expected from one geneone mrnaone protein paradigm ( 1 ) . this diversity arises due to the generation of multiple transcripts from a gene using alternative transcriptional and splicing events . alternative transcriptional events that involve use of multiple promoters and/or transcriptional termination result in multiple pre - mrnas from the same gene that can further undergo alternative splicing to generate a plethora of transcript variants corresponding to a single gene ( 2 ) . therefore , a gene can yield transcript variants that differ in either their regulatory utrs or / and protein coding regions ; thereby expanding the complexity of mammalian genomes ( 35 ) . in particular , the role of alternative promoter activity is critical in transcriptional regulation , as their precise utilization allows the balanced expression of corresponding pre - mrna variants in different cell and/or developmental contexts . in fact , recent evidence suggests that at least half of the mammalian genes use alternative promoters generating multiple transcript variants ( 3,5 ) . therefore , identifying all possible gene promoters , their usage and epigenetic modification states in specific cell populations , tissues and their developmental stages and disease conditions is critical to understanding a diversity of physiological processes associated with normal and diseased states . several high - throughput technologies , such as cap analysis gene expression ( cage ) , chromatin immunoprecipitation ( chip ) followed by microarray analysis ( chip chip ) , ( 6,7 ) , and more recently , chip coupled with sequencing ( chip - seq ) ( 8) and sequencing of cdnas ( rna - seq ) ( 5 ) , are enabling the genome - wide identification of alternative promoters and their patterns of use . however , these high - throughput approaches need to be applied with caution because of the inherent problems with each method ( 9 ) . in our recent study , we have shown that a combination of chip - seq and computational technique provides a better approach to annotate active promoters ( 9,10 ) . although epd database ( 11 ) provides curated promoter sequences for eukaryotic organisms , it does not provide promoter activity information at tissue / cell centric level . in this update of mpromdb we have removed chip chip results and added active rnap - ii promoters identified after analyzing six different cell types of human and 10 different cell / tissue types of mouse chip - seq experiments performed with rnap - ii antibody . in addition , we have added enrichment profile of various transcription factors obtained from chip - seq data sets . these promoters along with their annotations are provided as a user - friendly database , where each known and chip - seq promoter is linked to a new interface for visualization of enrichment profile . here , we describe the updates of our mpromdb , which enables users to study promoter activity at tissue / cell centric level for human and mouse genome .",
"in this update , we have added ( i ) a comprehensive knowledgebase of known and novel promoters , ( ii ) promoters identified from rnap - ii chip - seq experiments , ( iii ) advance search and filter options and ( iv ) visualization of chip - seq profiles and promoters using gbrowse ( 12 ) . the comprehensive promoter knowledgebase was generated from various known gene models ( refseq , vega , ensembl , mgi and ucsc known genes ) , predicted gene models ( aceview , tromer , mgc , sgp , sib , genscan , geneid , n - scan and augustus abinitio ) , orthologous gene model ( xenoref ) , genbank mrnas , spliced ests , cage promoters and mrna - seq tags ( figure 1 ) . the gene models , mrnas and spliced ests were downloaded from ucsc genome browser database ( 13 ) , cage promoters location were downloaded from fantom4 project ( 14 ) and mrna - seq raw reads were downloaded from ncbi geo database . we have also added promoter regions of recently discovered non - coding genes class ( lincrna ) transcribed by rnap - ii ( 15,16 ) . the total number of records in the knowledgebase can be found in table s1 . \n deep sequencing datasets were downloaded from ncbi geo server and processed by our analysis and annotation pipeline . novel promoters are compared to various existing experimental and predicted gene promoter regions and status of novel promoters is deposited in the relational tables . the database is integrated with open source genome browser ( gbrowse ) to visualize the promoter and various chip - seq enrichment profiles . deep sequencing datasets were downloaded from ncbi geo server and processed by our analysis and annotation pipeline . novel promoters are compared to various existing experimental and predicted gene promoter regions and status of novel promoters is deposited in the relational tables . the database is integrated with open source genome browser ( gbrowse ) to visualize the promoter and various chip - seq enrichment profiles . the rnap - ii chip - seq data sets includes the data generated at our lab ( 9 ) and data sets from various published and unpublished studies available freely at ncbi geo database . the human rnap - ii chip - seq data sets include six different cell lines : cd4 + t , hela s3 , k562 , nb4 , lymphoblastoid and jurkat , whereas mouse samples include five different tissues and five different cell types : brain , liver , lung , spleen , kidney , embryonic stem cell ( v6.5 ) , mouse embryonic fibroblasts b4 , mouse embryonic fibroblasts b6 , bone marrow - derived macrophages and 3t3-l1 ( 9,1723 ) . the ncbi geo accession numbers of the data sets are provided in table s2 . on the downloaded chip - seq data sets , we apply our pipeline ( figure 1 ) that includes alignment , identification of significant enriched regions , promoter prediction and annotation . bowtie program ( 24 ) was applied to map reads to the reference genome ( mm9 version for mouse and hg18 version for human ) , allowing up to two mismatches . we obtained 174 777 943 and 333 192 049 uniquely mapped reads for mouse and human genome respectively ( table s3 ) . significant peaks were identified using our three steps procedure as described in ( 9 ) at p - value = 0.01 . after identification of significant rnap - ii bound peaks we apply our recently published program for prediction of rnap - ii bound promoters ( 10 ) . following promoter prediction , we performed promoter annotation using our reference promoter knowledgebase as summarized in figures s1 and s2 . finally , we identified 48 366 mouse and 42 893 human promoters bound by rnap - ii where 39% and 42% of the promoters in mouse and human respectively were annotated as novel promoters ( table 1 ) . in case the predicted chip - seq promoters lie within 1 to 0.5 kb of known tss or within the first exons of known transcripts , they are defined as novel promoters. it is worth noting that 65% and 90% of novel promoters in mouse and human , respectively , are supported by additional sources ( novel gene models , mrnas , spliced ests , cage tags and orthologous gene model ) ( table s4 ) . \n table 1.summary of rnap - ii bound promoters identified in various tissues / cell types for human and mouse using chip - seq data setsspeciestissue / cell typeno . of known promotersno . of novel promotersno . of tissue/ cell - specific promotersno . of cpg promotersno . of bidirectional promotersno . of total promotersmousebrain15 9485270397813 864137321 218liver12 3193189164210 421125015 508kidney15 0594632199512 879134819 691spleen908921218068273106711 210lung15 3735142193513 986137420 515embryonic stem cell(v6.5)11 8952880274512 063131414 775mouse embryonic fibroblasts b410 558226127310 898124112 819mouse embryonic fibroblasts b611 887276170610 886123714 648bone marrow - derived macrophages ( untreated)13 320397787012 038129817 297bone marrow - derived macrophages ( 2 h)12 647371356611 846129416 260bone marrow - derived macrophages ( 4 h)13 119404168811 926129217 1603t3-l1 cells ( untreated)848913731138597103898623t3-l1 cells ( day 1)868416261548803107293103t3-l1 cells ( day 2)850815931748415104210 1013t3-l1 cells ( day 3)837415401368371103599143t3-l1 cells ( day 4)69761422194679384883983t3-l1 cells ( day 6)4039144392740305115482total29 51718 84917 90224 587180148 366humanjurkat cells7417140354176537928820k562 cells16 4108012642216 918132024 422lymphoblastoid cells19 6178998662920 682131128 615nb4 cells12 925294491613 650115615 869hela_s3 cells13 9823502210114 812121217 484cd4 + t cells14 3294137133615 740122018 466cd4 + t cells ( 2 h)7354126717479558828621cd4 + t cells ( 12 h)11 470238937712 740117213 859total24 96717 92618 49627 488150142 893 summary of rnap - ii bound promoters identified in various tissues / cell types for human and mouse using chip - seq data sets furthermore , our analysis has identified promoters for 15 493 and 14 266 protein - coding genes in mouse and human respectively . a gene is defined as protein coding if it has at least one protein - coding transcript in refseq / vega gene models , or else it is a non - coding gene . please note that a protein coding gene can generate transcript variants that are non - coding rnas . we also observed that 40% and 36% of protein coding genes in mouse and human are expressed from alternative promoters ( table 2 ) . surprisingly , 37% of promoters in mouse and 43% of human promoters were identified in a single cell / tissue suggesting that they are cell / tissue - specific promoters . additionally , we analyzed the cpg - richness and bidirectionality of the promoters and found that 51% and 64% of promoters are cpg - rich and there are 1801 and 1501 bidirectional promoters in mouse and human respectively . additionally , we also provide significant enrichment profiles of various factors ( mouse oct4 , cebpa , chd7 , c - myc , ctcf , esrrb , foxa1 , foxa2 , gfp , klf4 , n - myc , nr5a2 , p300 , rbbp5 , setdb1 , sirt1 , sox2 , stat3 , stat4 , stat6 , suz12 , tbp , tbx3 , tcfcp2i1 , wdr5 , zfx ; human oct4 , cbp , ctcf , ets1 , klf4 , nanog , p300 , pcaf , phf8 , pparg , runx , sox2 , stat1 , tfii , tip60 , znf263 , suz12 , mof , igf1r , nfkb ) calculated from different published and unpublished chip - seq datas ets ( table s5a and b ) . \n ( a ) mpromdb main search page where a user can perform search based on either entrez gene id / symbol or specific tissue / cell type and the resulting page is shown in ( b ) and ( c ) , respectively . ( d ) user can visualize the chip - seq profile for any promoter displayed on ( b ) or ( c ) by clicking on the promoter position link . \n table 2.alternative promoter usage for active protein - coding genes in mouse and humanprotein - coding genesmouse ( % ) human ( % ) 1-promoter genes9290 ( 60)9051 ( 63.44)2-promoter genes3490 ( 22.5)3192 ( 22.37)3-promoter genes2707 ( 17.5)2023 ( 14.18)total15 49314 266 screenshots of mpromdb and search results . ( a ) mpromdb main search page where a user can perform search based on either entrez gene id / symbol or specific tissue / cell type and the resulting page is shown in ( b ) and ( c ) , respectively . ( d ) user can visualize the chip - seq profile for any promoter displayed on ( b ) or ( c ) by clicking on the promoter position link . alternative promoter usage for active protein - coding genes in mouse and human mpromdb as a web - based application has many layers : the core application ( designed in django ) , a backend database ( mysql ) , a visualization component ( gbrowse ) and a web server ( apache ) ( see supplementary file 1 ) . the promoter information corresponding to a particular gene can be retrieved from the database using entrez geneid or gene symbol . we also provide additional search and filter options such as selection of tissue / cell type , tissue / cell specific promoters , known / novel promoters and coding / non - coding gene promoters . the gene search query returns result at two different levels ( see figure 2 , supplementary file 2 , supplementary tables s6 and s7 ) . the first level provides information ( promoter position , cpg type and bidirectional type ) regarding all promoters of the queried gene that are present in the promoter knowledgebase . the second level of search result lists all promoters identified from chip - seq data sets for the queried gene . visualization of the promoter position and chip - seq data enrichment profile is implemented using gbrowse ( 12 ) , an open source genome browser platform . gbrowse is simple but highly configurable web - based genome browser , which provides a fast and customizable interface for visualizing data that is stored in a backend database , as well as the data that is uploaded by the user . gbrowse is lighter than ucsc genome browser and offers many advantages especially in displaying the results and tracks . some of the features unique to gbrowse are : glyphs and balloons to represent different features , organizing features sub categories to more depth , multi - language support , view genbank , chado and biosql feature databases , third party loading . on gbrowse the identified promoter location and enrichment profile of the analyzed chip - seq data sets are shown ( figure 2d ) . further , users can directly type the genome coordinates or gene symbol on gbrowse for searching . users have an option to turn on / off the tracks that are displayed on the genome browser .",
"in this update , we have added ( i ) a comprehensive knowledgebase of known and novel promoters , ( ii ) promoters identified from rnap - ii chip - seq experiments , ( iii ) advance search and filter options and ( iv ) visualization of chip - seq profiles and promoters using gbrowse ( 12 ) . the comprehensive promoter knowledgebase was generated from various known gene models ( refseq , vega , ensembl , mgi and ucsc known genes ) , predicted gene models ( aceview , tromer , mgc , sgp , sib , genscan , geneid , n - scan and augustus abinitio ) , orthologous gene model ( xenoref ) , genbank mrnas , spliced ests , cage promoters and mrna - seq tags ( figure 1 ) . the gene models , mrnas and spliced ests were downloaded from ucsc genome browser database ( 13 ) , cage promoters location were downloaded from fantom4 project ( 14 ) and mrna - seq raw reads were downloaded from ncbi geo database . we have also added promoter regions of recently discovered non - coding genes class ( lincrna ) transcribed by rnap - ii ( 15,16 ) . the total number of records in the knowledgebase can be found in table s1 . \n deep sequencing datasets were downloaded from ncbi geo server and processed by our analysis and annotation pipeline . novel promoters are compared to various existing experimental and predicted gene promoter regions and status of novel promoters is deposited in the relational tables . the database is integrated with open source genome browser ( gbrowse ) to visualize the promoter and various chip - seq enrichment profiles . deep sequencing datasets were downloaded from ncbi geo server and processed by our analysis and annotation pipeline . novel promoters are compared to various existing experimental and predicted gene promoter regions and status of novel promoters is deposited in the relational tables . the database is integrated with open source genome browser ( gbrowse ) to visualize the promoter and various chip - seq enrichment profiles . the rnap - ii chip - seq data sets includes the data generated at our lab ( 9 ) and data sets from various published and unpublished studies available freely at ncbi geo database . the human rnap - ii chip - seq data sets include six different cell lines : cd4 + t , hela s3 , k562 , nb4 , lymphoblastoid and jurkat , whereas mouse samples include five different tissues and five different cell types : brain , liver , lung , spleen , kidney , embryonic stem cell ( v6.5 ) , mouse embryonic fibroblasts b4 , mouse embryonic fibroblasts b6 , bone marrow - derived macrophages and 3t3-l1 ( 9,1723 ) . the ncbi geo accession numbers of the data sets are provided in table s2 . on the downloaded chip - seq data sets , we apply our pipeline ( figure 1 ) that includes alignment , identification of significant enriched regions , promoter prediction and annotation . bowtie program ( 24 ) was applied to map reads to the reference genome ( mm9 version for mouse and hg18 version for human ) , allowing up to two mismatches . we obtained 174 777 943 and 333 192 049 uniquely mapped reads for mouse and human genome respectively ( table s3 ) . significant peaks were identified using our three steps procedure as described in ( 9 ) at p - value = 0.01 . after identification of significant rnap - ii bound peaks we apply our recently published program for prediction of rnap - ii bound promoters ( 10 ) . following promoter prediction , we performed promoter annotation using our reference promoter knowledgebase as summarized in figures s1 and s2 . finally , we identified 48 366 mouse and 42 893 human promoters bound by rnap - ii where 39% and 42% of the promoters in mouse and human respectively were annotated as novel promoters ( table 1 ) . in case the predicted chip - seq promoters lie within 1 to 0.5 kb of known tss or within the first exons of known transcripts , they are defined as novel promoters. it is worth noting that 65% and 90% of novel promoters in mouse and human , respectively , are supported by additional sources ( novel gene models , mrnas , spliced ests , cage tags and orthologous gene model ) ( table s4 ) . \n table 1.summary of rnap - ii bound promoters identified in various tissues / cell types for human and mouse using chip - seq data setsspeciestissue / cell typeno . of known promotersno . of novel promotersno . of tissue/ cell - specific promotersno . of cpg promotersno . of bidirectional promotersno . of total promotersmousebrain15 9485270397813 864137321 218liver12 3193189164210 421125015 508kidney15 0594632199512 879134819 691spleen908921218068273106711 210lung15 3735142193513 986137420 515embryonic stem cell(v6.5)11 8952880274512 063131414 775mouse embryonic fibroblasts b410 558226127310 898124112 819mouse embryonic fibroblasts b611 887276170610 886123714 648bone marrow - derived macrophages ( untreated)13 320397787012 038129817 297bone marrow - derived macrophages ( 2 h)12 647371356611 846129416 260bone marrow - derived macrophages ( 4 h)13 119404168811 926129217 1603t3-l1 cells ( untreated)848913731138597103898623t3-l1 cells ( day 1)868416261548803107293103t3-l1 cells ( day 2)850815931748415104210 1013t3-l1 cells ( day 3)837415401368371103599143t3-l1 cells ( day 4)69761422194679384883983t3-l1 cells ( day 6)4039144392740305115482total29 51718 84917 90224 587180148 366humanjurkat cells7417140354176537928820k562 cells16 4108012642216 918132024 422lymphoblastoid cells19 6178998662920 682131128 615nb4 cells12 925294491613 650115615 869hela_s3 cells13 9823502210114 812121217 484cd4 + t cells14 3294137133615 740122018 466cd4 + t cells ( 2 h)7354126717479558828621cd4 + t cells ( 12 h)11 470238937712 740117213 859total24 96717 92618 49627 488150142 893 summary of rnap - ii bound promoters identified in various tissues / cell types for human and mouse using chip - seq data sets furthermore , our analysis has identified promoters for 15 493 and 14 266 protein - coding genes in mouse and human respectively . a gene is defined as protein coding if it has at least one protein - coding transcript in refseq / vega gene models , or else it is a non - coding gene . please note that a protein coding gene can generate transcript variants that are non - coding rnas . we also observed that 40% and 36% of protein coding genes in mouse and human are expressed from alternative promoters ( table 2 ) . surprisingly , 37% of promoters in mouse and 43% of human promoters were identified in a single cell / tissue suggesting that they are cell / tissue - specific promoters . additionally , we analyzed the cpg - richness and bidirectionality of the promoters and found that 51% and 64% of promoters are cpg - rich and there are 1801 and 1501 bidirectional promoters in mouse and human respectively . additionally , we also provide significant enrichment profiles of various factors ( mouse oct4 , cebpa , chd7 , c - myc , ctcf , esrrb , foxa1 , foxa2 , gfp , klf4 , n - myc , nr5a2 , p300 , rbbp5 , setdb1 , sirt1 , sox2 , stat3 , stat4 , stat6 , suz12 , tbp , tbx3 , tcfcp2i1 , wdr5 , zfx ; human oct4 , cbp , ctcf , ets1 , klf4 , nanog , p300 , pcaf , phf8 , pparg , runx , sox2 , stat1 , tfii , tip60 , znf263 , suz12 , mof , igf1r , nfkb ) calculated from different published and unpublished chip - seq datas ets ( table s5a and b ) . \n ( a ) mpromdb main search page where a user can perform search based on either entrez gene id / symbol or specific tissue / cell type and the resulting page is shown in ( b ) and ( c ) , respectively . ( d ) user can visualize the chip - seq profile for any promoter displayed on ( b ) or ( c ) by clicking on the promoter position link . \n table 2.alternative promoter usage for active protein - coding genes in mouse and humanprotein - coding genesmouse ( % ) human ( % ) 1-promoter genes9290 ( 60)9051 ( 63.44)2-promoter genes3490 ( 22.5)3192 ( 22.37)3-promoter genes2707 ( 17.5)2023 ( 14.18)total15 49314 266 screenshots of mpromdb and search results . ( a ) mpromdb main search page where a user can perform search based on either entrez gene id / symbol or specific tissue / cell type and the resulting page is shown in ( b ) and ( c ) , respectively . ( d ) user can visualize the chip - seq profile for any promoter displayed on ( b ) or ( c ) by clicking on the promoter position link .",
"mpromdb as a web - based application has many layers : the core application ( designed in django ) , a backend database ( mysql ) , a visualization component ( gbrowse ) and a web server ( apache ) ( see supplementary file 1 ) . the promoter information corresponding to a particular gene can be retrieved from the database using entrez geneid or gene symbol . we also provide additional search and filter options such as selection of tissue / cell type , tissue / cell specific promoters , known / novel promoters and coding / non - coding gene promoters . the gene search query returns result at two different levels ( see figure 2 , supplementary file 2 , supplementary tables s6 and s7 ) . the first level provides information ( promoter position , cpg type and bidirectional type ) regarding all promoters of the queried gene that are present in the promoter knowledgebase . the second level of search result lists all promoters identified from chip - seq data sets for the queried gene . visualization of the promoter position and chip - seq data enrichment profile is implemented using gbrowse ( 12 ) , an open source genome browser platform . gbrowse is simple but highly configurable web - based genome browser , which provides a fast and customizable interface for visualizing data that is stored in a backend database , as well as the data that is uploaded by the user . gbrowse is lighter than ucsc genome browser and offers many advantages especially in displaying the results and tracks . some of the features unique to gbrowse are : glyphs and balloons to represent different features , organizing features sub categories to more depth , multi - language support , view genbank , chado and biosql feature databases , third party loading . on gbrowse the identified promoter location and enrichment profile of the analyzed chip - seq data sets are shown ( figure 2d ) . further , users can directly type the genome coordinates or gene symbol on gbrowse for searching . users have an option to turn on / off the tracks that are displayed on the genome browser .",
"in future , we plan to include epigenetic histone modifications profile identified from chip - seq data sets that are currently available at ncbi geo and integrate it to our promoter knowledgebase . we will also continue to collect rnap - ii and transcription factors chip - seq data sets from a wider variety of tissues and cell types to routinely update mpromdb . we also plan to include other mammalian data sets , and add additional features and search options to the frontend of the database . in conclusion , mpromdb will provide integrated transcriptional regulatory information for mammalian genomes in an easily accessible way . we believe that the updates will facilitate large - scale chip - seq data analysis and contribute toward the elucidation of mammalian transcriptional regulatory networks .",
"",
"nhgri / nih grant ( # r01hg003362 ) ; american cancer society research scholar grant ( # rsg-07 - 097 - 01 to r.d . ) ; and philadelphia healthcare trust . r.d . holds a philadelphia healthcare trust endowed chair position . funding for open access charge : national institutes of health grant ( # r01hg003362 to r.d . ) ."
] | mpromdb ( mammalian promoter database ) is a curated database that strives to annotate gene promoters identified from chip - seq results with the goal of providing an integrated resource for mammalian transcriptional regulation and epigenetics . we analyzed 507 million uniquely aligned rnap - ii chip - seq reads from 26 different data sets that include six human cell - types and 10 distinct mouse cell / tissues . the updated mpromdb version consists of computationally predicted ( novel ) and known active rnap - ii promoters ( 42 893 human and 48 366 mouse promoters ) from various data sets freely available at ncbi geo database . we found that 36% and 40% of protein - coding genes have alternative promoters in human and mouse genomes and 40% of promoters are tissue / cell specific . the identified rnap - ii promoters were annotated using various known and novel gene models . additionally , for novel promoters we looked into other evidences genbank mrnas , spliced ests , cage promoter tags and mrna - seq reads . users can search the database based on gene id / symbol , or by specific tissue / cell type and filter results based on any combination of tissue / cell specificity , known / novel , cpg / noncpg , and protein - coding / non - coding gene promoters . we have also integrated gbrowse genome browser with mpromdb for visualization of chip - seq profiles and to display the annotations . the current release of mpromdb can be accessed at http://bioinformatics.wistar.upenn.edu / mpromdb/. |
[
"many potential therapies for severe and/or chronic wounds fail as a result of poor vasculature . hence , strategies to improve blood vessel supply into a wound bed are thought to promote wound healing . transplantations of mesenchymal stem cells ( mscs ) have shown great potential as a therapeutic agent for the treatment of a range of disorders , including wound healing , and have become the subject of numerous clinical trials . however , whilst the safety of msc transplantation does not seem to be an issue , the effectiveness of such treatment has exhibited considerable variability . this variation in effect is problematic when translating preclinical research into msc - based clinical therapy . we recently demonstrated that human msc - conditioned medium ( msc - cm ) was stimulatory to epidermal and fibroblast cell adherence and migration . other reports suggest that msc are pro - angiogenic also through their paracrine activity on endothelial cells . whilst there are reports that msc are capable of endothelial differentiation , engraftment into new vasculature is low in vivo . hence , these and other studies have contributed to recent thought that the predominant regenerative activity of mscs is due to their secretion of factors that stimulate endogenous cells at wound sites . in this investigation , we have examined the effects of msc - cm on endothelial cells , using the cell line eahy-926 as a model system . we report that msc - cm promotes endothelial cell adhesion and migration , but that these effects show considerable donor - donor variability . further , we have identified extracellular matrix ( ecm ) proteins that are secreted by mscs using maldi / tof - tof mass spectrometry . we provide data to suggest that ecm composition plays a major role in the donor - donor variation we have seen . these findings demonstrate proof of principle of the need to screen the msc secretome in order to optimise the application of mscs in the clinic .",
"cell culture and mass spectrometry of conditioned medium eahy-926 endothelial cells were maintained in dmem / f12 culture medium ( invitrogen , paisley , uk ) supplemented with 10% ( v / v ) fetal calf serum ( fcs ) ( invitrogen ) and 1% ( v / v ) penicillin and streptomycin ( invitrogen ) , incubated at 37c and in a humidified atmosphere containing 5% ( v / v ) co2 . passaging was performed at ~90% confluence and cells were re - seeded at 1 x 10 cells / cm . mscs were isolated from the iliac crest biopsies of bone marrow donors following ethical approval and with informed consent , as previously described . the adherent cell population obtained was consistent with the characteristics of mscs laid out by the international society for cellular therapy ( isct ) . conditioned medium was generated from msc cultures of equal cell number in serum free conditions , using dmem / f12 supplemented with insulin , transferrin and selenium ( invitrogen ) . protein content of msc cm was determined by maldi - tof / tof mass spectrometry as previously described . characterization of msc after three passages in culture , bone marrow derived cells were assessed by immunoprofiling for cd markers and by examining their differentiation potential to form osteoblasts , adipocytes and chondrocytes , by staining with alkaline phosphatase , oil red o , and toluidine blue respectively as per the criteria established for a msc phenotype by the isct . coating of culture plates culture plates were coated with msc - cm or type - i collagen , decorin , or fibronectin ( all sigma - aldrich ) . protein solutions were diluted in pbs to 0.2mg / ml and added to each well ( 50l for 96-well plates , 500l for 24-well plates ) . these were refrigerated for 24 hours before being rinsed with pbs immediately prior to use . cell adherence / spreading coated 24-well tissue culture plates were seeded with 2x10 eahy-926 endothelial cells in dmem / f12 supplemented with 1% penicillin / streptomycin ( sigma - aldrich ) and 1% its - x ( sigma - aldrich ) and incubated for 2 hours at 37c and 5% co2 before digital images were captured ( progres cf , jenoptik ) and analysed using image - j software . scratch assays were established using previously published methods , in protein - coated tissue culture plates ( as described above ) . cell migration was automatically captured and analysed at hourly intervals using an incucyte live - cell imaging system ( essen bioscience ) . data were tested for significance using the mann - whitney u test . those differences that fell within a 95% , 99% or 99.9% confidence interval were considered to be significant , indicated by asterisks within figures ( * p<0.05 * * p<0.01 * * * p<0.001 ) .",
"bone marrow cells obtained from iliac crest biopsies showed characteristics consistent with those expected of msc ( figure 1 ) . msc - cm coating of culture plates resulted in the significant enhancement of the spreading of eahy-926 endothelial cells upon the culture surface . this result was subject to a marked inter - donor variability , with conditioned media generated by both msc-1 and msc-3 resulting in a significantly greater degree of eahy-926 endothelial cell spreading than that generated by msc-2 ( figure 2a , 2b ) . eahy-926 endothelial cell adherence on fibronectin coated plates was most advanced after two hours , compared to plates coated in either type i collagen or with decorin ( figure 3 ) . on type i collagen - coated plates , the presence of msc - cm appeared to enhance the rate of eahy-926 endothelial cell migration into scratch - wounds compared to unconditioned media ( figure 4a , left ) . eahy-926 endothelial cells in msc - cm closed scratch - wounds to a significantly greater degree than those in unconditioned media over a 12-hour time course ( figure 4b , left ) . once again , the degree of this msc - cm mediated enhancement of eahy-926 endothelial cell migration was subject to inter - donor variability . conditioned medium generated by msc-1 ( and msc-3 ) elicited a greater degree of scratch - wound closure than msc-2 over 12 hours ( figure 4b , left ) . cells isolated from bone marrow meet the minimum criteria for identification as msc.cells are immunoreactive for cd73 , cd90 and cd105 , whilst lacking immunoreactivity for cd14 , cd34 and cd45 , as shown by histograms obtained by flow cytometry , and readily differentiate to form osteoblasts , adipocytes and chondrocytes in vitro . representative phase contrast images are shown of cells following tri - lineage differentiation and staining with alkaline phosphotase , oil red o , and toluidine blue ( top , left to right ) . msc - cm coating of culture plates influences eahy-926 endothelial cell adherence and spreading.a : msc - cm coating of culture plates influences eahy-926 endothelial cell adherence and spreading . after 4 hours in culture eahy-926 endothelial cells were observably more spread on culture plates coated with msc - cm than on plates coated with unconditioned ( control ) medium . b : after 4 hours in culture the average cell area was significantly greater for eahy-926 endothelial cells on msc - cm coated culture plates and 389m2 than those cells on unconditioned ( control ) medium coated culture plates . data shown are means sem in relative units ( * * * = p<0.001 mann whitney u test ) . ecm protein coating of culture plates influences eahy-926 endothelial cells adherence and spreading.after 4 hours in culture eahy-926 endothelial cells were observably more spread on culture plates coated with fibronectin than on plates coated with type i collagen or decorin . b : after 4 hours in culture the average cell area was significantly greater for eahy-926 endothelial cells on fibronectin compared to those cells on either type i collagen or decorin . data shown are means sem in relative units ( * * = p<0.01 , * * * = p<0.001 , mann whitney u test ) . eahy-926 endothelial cells closed scratch wounds faster in msc - cm than in unconditioned medium on type i collagen , fibronectin , and decorin coated culture plates . \n a : eahy-926 cells on fibronectin coated culture plates closed scratch wounds significantly faster than those on either type i collagen or decorin . b : after 12 hours eahy-926 endothelial cells in msc - cm had closed scratch wounds by a significantly greater degree than those in unconditioned control medium . 12 hours post - scratching , eahy-926 endothelial cells on plates coated fibronectin had closed scratch wounds by a significantly greater degree than those on either type i collagen or decorin . on fibronectin and decorin , medium conditioned by msc-2 on type one collagen , medium conditioned by msc-2 was associated with significantly reduced scratch closure compared to msc-1 . all three were found to contain fibronectin , collagen type i , collagen type vi , and lumican , whilst cartilage oligomeric matrix protein ( comp ) and sparc were present in two out of three msc - cm and laminin , decorin , heparan sulphate proteoglycan ( hspg ) and igfbp-1 were each only observed in one msc - cm ( table 1 ) . of these , hence , not only was there clear inter - donor variability in the ecm components of the msc secretome , but the presence of these proteoglycans seemed to be associated with a reduction in the efficacy of msc - cm . when type i collagen , decorin and fibronectin were used as culture substrata , the degree of eahy-926 endothelial cell spreading appeared to be similar upon both type i collagen and decorin and greatly enhanced upon fibronectin ( figure 2a , 2b ) . similarly , scratch - wound closure by eahy-926 endothelial cells in unconditioned media appeared to be similar upon type i collagen and decorin , but markedly greater upon fibronectin ( figure 4a , 4b ) . in the presence of each ecm substrate the presence of msc - cm resulted in significantly enhanced scratch wound closure compared to unconditioned media ( figure 4b ) . as seen previously upon type i collagen coated culture plates , the degree of closure upon both decorin and fibronectin coated plates was either significantly or near significantly ( p=0.057 by mann whitney u test ) less in the presence of medium conditioned by msc-2 , compared to medium conditioned by either msc-1 or msc-3 ( figure 4b ) . mass spectrometry of msc - cm from 3 separate donors.maldi-tof/tof mass spectrometry of msc - cm detected variable protein content between media conditioned by msc from three different patient donors .",
"we have previously shown that msc - cm promotes the migration of skin cells in a wound healing model , and identified numerous potentially beneficial factors that may contribute to this effect . in vivo wound healing is , however , a complex process influenced by a host of cellular events , including angiogenesis . if msc can stimulate endothelial cells as suggested here and elsewhere this supports their potential use in the treatment of cutaneous wounds . in these experiments , this is similar to previous studies in which msc - cm has been shown to stimulate angiogenesis , supporting the investigation of msc - cm as a pro - angiogenic agent . although it is possible for proliferation of eahy-926 endothelial cells to have contributed somewhat to the closure of the scratch wounds , these scratch assay experiments were performed over the course of 12 hours . the reported doubling time for these cells is over 25 hours . to significantly affect the rate of scratch wound closure , those cells at the leading edge of the scratch margins would be required to undergo repeated doublings , and this is unlikely to have had a major influence on scratch wound closure over the time course of these studies . mass spectrometry of msc - cm revealed numerous factors ( including fibronectin and collagen ) in medium conditioned by each of the three msc examined and some , including laminin and decorin , in one or two but not all three of the msc - cm samples . of these ecm components , fibronectin , collagen and laminin are known to promote or support angiogenesis . unusually , in these experiments collagen did not seem to induce any observable cell response when compared to decorin . fibronectin and collagen contain protein motifs are known to mediate angiogenesis by integrin receptor signaling in vivo and in vitro . decorin inhibits endothelial cell migration and tubule formation in vitro \n and inhibits the pro - angiogenic effects of vegf . lumican interferes with 21 receptor activity and inhibits angiogenesis both in vitro and in vivo . whilst lumican was present in each of the msc - cm used in these investigations , decorin was only found within the msc - cm that consistently showed significantly less enhancement of eahy-926 endothelial cell migration . as the method ( maldi - tof / tof mass spectrometry ) used to detect these protein components within msc - cm was not quantitative , it was not possible to determine whether differences in concentrations of each ecm component were related to efficacy of the conditioned media . msc - cm coating of culture plates enhanced eahy-926 endothelial cell adherence , as did coating with fibronectin . cell adherence to these substrata was examined in an indirect fashion , by assessing the average area of cells in the immediate - early period after seeding . as cells settle upon a permissive substrate they spread out from the rounded morphology observed in suspension to adopt a flattened morphology that is usually seen in vitro in adherent cell populations . after prolonged periods of time , cells in culture , including endothelial cells , synthesize matrix molecules that may also promote cell adhesion , potentially masking the initial effects of the original substrate being investigated . of the matrix proteins detected in msc - cm by maldi - tof / tof mass spectrometry , fibronectin was observed to have a profound effect upon cell adherence , similar to those findings concerning cell migration . however , the addition of msc - cm to endothelial cell scratch assays performed upon fibronectin coated culture plates resulted in a further enhancement of endothelial cell migration , suggesting that fibronectin may not be solely responsible for the entire effect . further experiments investigating the effects of msc secreted growth factors and cytokines individually , and in combination , may reveal their relative contribution to the enhancement of endothelial cell migration . the relatively low number of individual donors examined during this study is a clear limitation , and although the results presented support the conclusions that ( i ) msc donor variation and secretome composition may account for differential effects of mscs on endothelial cells , and ( ii ) that this variation should be taken into consideration in msc - based regenerative medicine , subsequent investigation of greater numbers of samples is required to further authenticate these findings .",
"angiogenesis depends on endothelial cell migration and the actions of endothelial cell chemotactic factors , e.g. vegf and il-8 , and ecm proteins such as collagens , fibronectin and laminin . many of these pro - angiogenic factors have been found to be present within the msc secretome both within this investigation and in previous studies . these experiments have showed that msc - cm enhances both the rate of endothelial cell migration and the adherence of these cells to their culture surface , and that this effect was , in part , mediated by the presence of fibronectin . the effects of msc - cm upon endothelial cell migration were not entirely induced by fibronectin , as suggested by the further enhancement of eahy-926 endothelial cell migration by msc - cm in the presence of exogenous fibronectin . factors such as interleukin ( il)-8 , vegf , and laminin have all been shown to be stimulatory to endothelial cells and these factors have been shown to be present within msc - cm . it seems likely that these known mediators of angiogenesis might contribute to the effects of msc - cm upon eahy926 endothelial cells observed in these investigations . overall , the data presented here support the hypothesis that msc may stimulate the formation of new vasculature , and that this may be an important aspect of msc - mediated enhancement of wound healing .",
""
] | mesenchymal stem cells ( mscs ) stimulate angiogenesis within a wound environment and this effect is mediated through paracrine interactions with the endothelial cells present . here we report that human msc - conditioned medium ( n=3 donors ) significantly increased eahy-926 endothelial cell adhesion and cell migration , but that this stimulatory effect was markedly donor - dependent . maldi - tof / tof mass spectrometry demonstrated that whilst collagen type i and fibronectin were secreted by all of the msc cultures , the small leucine rich proteoglycan , decorin was secreted only by the msc culture that was least effective upon eahy-926 cells . these individual extracellular matrix components were then tested as culture substrata . eahy-926 cell adherence was greatest on fibronectin - coated surfaces with least adherence on decorin - coated surfaces . scratch wound assays were used to examine cell migration . eahy-926 cell scratch wound closure was quickest on substrates of fibronectin and slowest on decorin . however , eahy-926 cell migration was stimulated by the addition of msc - conditioned medium irrespective of the types of culture substrates . these data suggest that whilst the msc secretome may generally be considered angiogenic , the composition of the secretome is variable and this variation probably contributes to donor - donor differences in activity . hence , screening and optimizing msc secretomes will improve the clinical effectiveness of pro - angiogenic msc - based therapies . |
[
"due to the fact that the majority of pancreatic cancers are unresectable upon diagnosis , curative intent is rarely a goal of treatment , rather increasing survival , time to progression , and quality of life are more realistic goals . without treatment , median survival for patients with an advanced stage of disease ranges from 3 to 4 months , whereas in patients receiving chemotherapy with single - agent gemcitabine , median survival times between 4.9 and 7.2 months have been reported in randomized phase iii studies . gemcitabine has been the solo player in the field of pancreatic cancer , treatment after replacing 5-fu since 1997 , and is still regarded as one standard of care for the first - line systemic chemotherapeutic treatment of patients with advanced pancreatic cancer worldwide . so far , only two randomized phase iii trials have demonstrated a significant prolongation of survival with the use of gemcitabine - based combination therapy with either erlotinib or capecitabine . eventually , progression will occur and the real challenge will be how to treat a patient with advanced pancreatic cancer failing to respond or progressing after gemcitabine . there is no evidence - based treatment recommendation for these patients . the national comprehensive cancer network guidelines for pancreatic adenocarcinoma currently recommend second - line chemotherapeutic treatment after gemcitabine failure in selected patients using , for example , single - agent capecitabine or a combination therapy of fluorouracil , leucovorin and oxaliplatin ( folfox- ) like regimen . to date , there is no large randomized trial confirming the survival advantages of second - line chemotherapy over best supportive care , yet the preliminary results from a small randomized german study comparing bsc alone versus 5-fu , folinic acid , and oxaliplatin plus bsc after gemcitabine failure showed a prolongation of median survival by approximately 2.6 months with the use of chemotherapy ( 2.3 versus 4.9 months ) . these data were supported by a japanese study that reported a median survival time of approximately 1.9 months after failure of first - line gemcitabine in 74 patients with pancreatic cancer ( of whom 97% received no second - line treatment ) . many protocols containing oxaliplatin , 5fu , and leucovorin , as folfox , flox , and 3-week bolus 5fu plus leucovorin and oxaliplatin , are known . preclinical data suggested that the 5-fu plus oxaliplatin combination is more cytotoxic when 5-fu is given as a short exposure , which gives a rationale for exploring the toxicity and efficacy of such protocols in advanced pancreatic cancer . in the current study , we conducted a randomized trial to compare two protocols ; flox and the 3-weeek bolus protocol regarding toxicity , response rate , and time to progression as primary end points , then overall survival as secondary endpoints .",
"patients with advanced unresectable or metastatic pancreatic adenocarcinoma were enrolled under the following eligibility criteria . \n ( i ) patients with histologically or cytologically proven locally advanced or metastatic pancreatic adenocarcinoma , ( ii ) with at least 1 bidimensionally measurable lesion ( world health organization ( who ) criteria ) ; ( iii ) eastern cooperative oncology group ( ecog ) ps of 1 - 2 ; ( iv ) tumor progression after first line gemcitabine ( whether gemcitabine pretreated or gemcitabine resistance ) ; ( v ) absence of severe uncontrolled cardiovascular , metabolic , infectious , or neurological diseases ; ( vi ) adequate bone marrow reserve ( neutrophil count > 1.5 10/l , platelet count > 100.000/mm and hb > 10 g / dl ) ; ( vii ) adequate liver function ( serum bilirubin < 1.5 mg / dl , serum transaminases < 2x the upper limit of normal ) ; ( viii ) adequate renal function ( serum creatinine < 1.5 mg / dl ) ; ( ix ) and age between 18 and 75 years . all participating patients were required to give written informed consent , and ethical approval from moc committee was obtained before the start of the whole procedure . \n exclusion criteria \n histologic types other than adenocarcinoma.neuropathy ctcae grade 1.ototoxicity > ctcae grade 2.serious , active comorbidity , including any of the following : unstable angina and/or nyha class ii iv congestive heart failure requiring hospitalization within the past 12 months , transmural myocardial infarction within the past 12 months , acute bacterial or fungal infection requiring iv antibiotics , chronic obstructive pulmonary disease exacerbation or other respiratory illness requiring hospitalization or precluding study therapy , hepatic insufficiency resulting in clinical jaundice and/or coagulation defects , active gastrointestinal ( gi ) ulcers , gi bleeding , inflammatory bowel disease , or gi obstruction , inadequately controlled hypertension , defined as systolic bp > 150 mm hg and/or diastolic bp > 90 mm hg on antihypertensive medications , serious cardiac arrhythmia on medication ( well - controlled atrial fibrillation on medication allowed ) , and history of hypertensive crisis or hypertensive encephalopathy . \n serious , active comorbidity , including any of the following : unstable angina and/or nyha class ii iv congestive heart failure requiring hospitalization within the past 12 months , transmural myocardial infarction within the past 12 months , acute bacterial or fungal infection requiring iv antibiotics , chronic obstructive pulmonary disease exacerbation or other respiratory illness requiring hospitalization or precluding study therapy , hepatic insufficiency resulting in clinical jaundice and/or coagulation defects , active gastrointestinal ( gi ) ulcers , gi bleeding , inflammatory bowel disease , or gi obstruction , inadequately controlled hypertension , defined as systolic bp > 150 mm hg and/or diastolic bp > 90 mm hg on antihypertensive medications , serious cardiac arrhythmia on medication ( well - controlled atrial fibrillation on medication allowed ) , and history of hypertensive crisis or hypertensive encephalopathy . all patients were subjected to staging procedures consisted of medical history , physical examination , echocardiography , serum chemistry panel , complete blood picture , cea , and ca 19 - 9 . extent of disease was determined by chest x - rays , computed tomography and/or nuclear magnetic resonance , and endoscopy as needed . patients were randomly assigned to one of the treatment regimens ( block randomization at 4 ) , where 24 patients were enrolled for each treatment group . oxaliplatin 85 mg / m was administered as a 2-hour infusion before lv and fu on days 1 , 15 , and 29 of the treatment cycle . lv 500 mg / m was administered as a 2-hour intravenous infusion weekly for 6 consecutive weeks ( on days 1 , 8 , 15 , 22 , 29 , and 36 of the treatment cycle ) , followed by a 2-week rest period . fu 500 mg / m was administered as an intravenous bolus 1 hour after the lv infusion was begun and was administered weekly for 6 weeks ( on days 1 , 8 , 15 , 22 , 29 , and 36 of the treatment cycle ) , followed by a 2-week rest period . 2-hour intravenous infusion of oxaliplatin 40 mg / m was followed by bolus leucovorin 250 mg / m and bolus 5-fu 500 mg / m . each course consisted of weekly administrations for 3 consecutive weeks followed by a week of rest . therapy continued until disease progression , unacceptable toxicity , patient 's refusal , or a maximum of 6 courses . all patients received intravenous dexamethasone 8 mg , ondansitrone 8 mg as antiemetic prophylaxis . therapy was withheld in case of a platelet count of less than 100.000/mm or a neutrophil count of less than 1.500/mm or for bilirubin greater than 1.5 times the upper reference level ( url ) or transaminases greater than 3 times the url . during the entire study period , patients received full supportive care to control pain or other symptoms , with careful recording of the treatment . oxaliplatin was reduced in the event of persistent paresthesia / dysesthesia between cycles or with pain lasting for > 7 days according to staff physician 's decision . when paresthesia / dysesthesia with either pain or functional impairment persisted between cycles , oxaliplatin was discontinued . measurable disease response was assessed by recist criteria . partial response ( pr ) , stable disease ( sd ) , and progressive disease ( pd ) were determined according to these criteria . the sum of pr and sd was reported as disease control rate ( dcr ) . os was estimated from the date of first treatment to the date of death or the last followup . clinical benefit assessment was based on patients and physician - reported improvement of cancer - related symptoms and/or stabilization of improvement of ps . the ttp was calculated from the first treatment infusion to the first objective evidence of disease progression assessed by ct scan measurements or early death or date of clinical deterioration and patient not assessable for response . ttp and os since the start of treatment were estimated on an intent - to - treat basis and analyzed according to the kaplan - meier method . comparison between survival curves was done through log rank test to estimate p value utilizing graphpad prism version 5 software . the required number of patients for this phase ii study was determined according to a jehan phase ii optimal design for a goal of 20% true clinical benefit ; with - and -error probability of 0.05 and 0.20 , respectively , an accrual of 24 patients assessable for response was planned .",
"forty - eight patients with unresectable or metastatic pancreatic cancer pretreated with gemcitabine ( including gemcitabine resistance or gemcitabine pretreated ) in ain shams university hospitals were included along the period between october 2008 and september 2011 . sixteen males out of total twenty - four cases were encountered in flox arm compared to 17 in 3-week bolus arm . grade 3 or 4 toxicities experienced by at least 5% of patients according to treatment arm are summarized in table 2 . two cases of neutropenia exceeding grade 2 ( but no febrile neutropenia ) were observed ; one in each treatment groups . grade 3 anemia was recorded in 3 patients ( 2 in flox arm , one in 3-week arm ) . no complete response was registered among all assessable 48 patients throughout the study duration for flox regimen , three patients ( 12.5% ) had partial response , five patients ( 21% ) had stable disease , and three out of 8 patients with pain at presentation ( 37.5% ) had clinical benefit . the median time to progression was 3.9 months ( 95% ci , 24.6 ) ( range : 1.55.5 ) . median survival time was 8 months ( 95% ci , 4.012 ) . \n for 3-week regimen , two patients ( 8% ) had partial response , five patients ( 21% ) had stable disease , and four out of 8 patients with pain at presentation ( 50% ) had clinical benefit as shown in table 3 . the median time to progression was 4 months ( 95% ci , 1.85 ) ( range : 1.26 ) . median survival time was 9 months ( 95% ci , 3.513 ) as shown in figures 1(a ) and 1(b ) . there was no statistical significance in progression - free survival between the 2 regimens ( p value by log rank test = .4619 ) , and so was the situation in overall survival ( p - value by log rank test = .5248 ) . although it was not planned as a target for the current study , yet it was an interesting issue to compare cost of chemotherapy per patient for every 8 weeks of treatment for each regimen . for flox regimen this cost was approximately 1200 usd versus 1400 usd for the 3-weeks regimen ( due to mainly the amount of discarded oxaliplatin in every injection time that was more in the second regimen ) as in table 4 .",
"advanced pancreatic cancer remains a rapidly lethal cancer , with a median survival of 6 months with currently approved therapies . the role of second - line chemotherapy after failure of first - line therapy in such cases is not well established , but a theoretical possibility exists in which salvage chemotherapy after the failure of first - line treatment may influence the survival . for the scale of patients with good performance status , progressing after first - line gemcitabine therapy , nccn recommends fluoropyrimidine - based chemotherapy . but for time being there is still a debate to treat or best supportive care ? a phase iii trial after failure of first - line gemcitabine compared bsc plus with biweekly oxaliplatin combined with weekly 5-fu as 24 hours infusion plus leucovorin , versus bsc alone . after the first 46 patients out of 165 planned , the bsc arm had to be closed because bsc alone was no longer accepted by participating centers , with a possible survival benefit for second - line chemotherapy : 21 weeks ( 95% ci ; .7 ; 23.3 ) versus 10 weeks ( 95% ci ; 7.7 ; 12.3 ) . so a second question is as the following : what is the best option of treatment ? adding oxaliplatin to continuous infusion fluoropyrimidine as a second - line salvage therapy for this category has been investigated in some phase ii trials [ 1012 ] . in a series of unselected patients the folfox4 regimen yielded a 14% pr rate with 38% of patients showing sd for a dcr of 57% . median duration of pr was 5.2 months , while median time to progression and overall survival was 4 and 6.7 months , respectively , but all the regimens of continuous infusion necessitate either hospitalization or pump application with their financial load upon health care system . this was the rationale to investigate regimens including oxaliplatin and bolus fluorouracil , with the theoretical premise of being as active as continuous infusion regimens , as well simpler in administration , less in cost , and better in toxicity profile . in the current study , two regimens of oxaliplatin and bolus fluorouracil have been investigated , flox regimen that was used in metastatic colorectal cancer with adequate efficacy and acceptable toxicity profile . the current study revealed nonprogression ( pr + sd ) in 33.5% for first regimen and 29% for second regimen , and 37.5% had clinical benefit ( flox regimen ) compared to 50% in 3-week regimen . median survival time was 8 months and 9 months for both regimens , respectively , with no statistically significant difference in progression - free or overall survival . two cases of neutropenia exceeding grade 2 ( but no febrile neutropenia ) were observed ; one in each treatment group . grade 3 anemia was recorded in 3 patients ( 2 in flox arm , one in 3-week arm ) . so it is the time for the 3rd question ; are these results comparable to those of folfox regimens ( infusion fluorouracil ) ? , 2007 , carried out a retrospective study including 42 patients who received standard folfox4 regimen biweekly until progression or unacceptable toxicity . the study revealed six partial responses ( 14% ) and 16 stabilizations ( 38% ) were recorded for a tumor growth control rate of 57% . the median time to progression ( ttp ) was 4 months ( range 17 months ) , and median overall survival ( os ) was 6.7 months ( range 29 months ) . a stabilization of performance status ( ps ) and a subjective improvement of cancer - related symptoms was recorded in 27 patients . the good nonprogression rate in this study may be attributed to the high percentage of responding patients in this study to the first line therapy ( 50% ) compared to 12% in our study . tsavaris et al . , 2005 , in a prospective phase ii study evaluated a second - line combination regimen of oxaliplatin together with leucovorin - modulated 5-fu in 30 patients and revealed an encouraging response rate of 23% with a corresponding disease - control rate of 53% . these data correlate well with the retrospective analysis from italy , which found a response rate of 14% together with a disease - control rate of 52% with the use of a folfox-4 regimen in gemcitabine - pretreated patients . another phase ii trial of oxaliplatin plus capecitabine in a series of 41 patients reported a pr in one case and sd in eight patients with a median os of 5.8 months , and a 6-month and 1-year survival rate of 48% and 22% , respectively . preliminary results of another trial of oxp/5-fu in a series of 23 patients have shown an os of 4 months . in a study on 23 gemcitabine pretreated patients with advanced pancreatic cancer revealed no objective response in all 17 assessable patients and 4 patients had stable disease , whereas 13 had tumor progression . the regimen was associated with 36% clinical benefit . in conclusion , combining oxaliplatin to bolus fluorouracil ( either in flox or 3-week regimens ) as a second line in gemcitabine pretreated patients with advanced or metastatic pancreatic adenocarcinoma showed encouraging efficacy , acceptable toxicity , and some clinical benefit specially when palliation or good quality of life is a target keeping in mind the simplicity in administration , the no need for hospitalization , and the less financial load specially with flox . further studies with large number of patients investigating the efficacy and tolerability of such bolus regimens in gemcitabine - pretreated pancreatic cancer patients are warranted ."
] |
objective . comparing activity of 2 regimens combining oxaliplatin to bolus modulated fluorouracil as second line treatment in advanced pancreatic adenocarcinoma pretreated with gemcitabine - containing schedule . methods . forty eight patients with advanced pancreatic adenocarcinoma were randomly assigned to receive either fu 500 mg / m2 iv bolus weekly 6 weeks plus leucovorin 500 mg / m2 iv weekly for 6 weeks during each 8-week cycle plus oxaliplatin 85 mg / m2 iv on weeks 1 , 3 , and 5 of each 8-week ( flox ) or receive weekly intravenous infusions of oxaliplatin 40 mg / m2 , 5-fu 500 mg / m2 , and leucovorin 250 mg / m2 ( 3 weeks on , 1 week off ) . results . non progression(pr+sd ) was found in 33.5% for first regimen and 29% for second regimen , and 37.5% had clinical benefit ( flox regimen ) compared to 50% in 3-weeks regimen . the median ttp was 3.9,4 months respectively . median os was 8 , 9 months for both regimens . only one case in 3-weeks arm suffered from grade iv diarrhea . two cases > grade 2 neutropenia were observed ; one in each treatment groups . grade 3 anemia was recorded in 3 patients ( 2 in flox arm , one in 3-weeks arm ) . conclusions . both regimens showed encouraging efficacy , acceptable toxicity , and clinical benefit . |
[
"primary peritonitis constitutes less than 1% of peritonitis and spontaneous bacterial peritonitis usually occurs in patients with comorbid conditions . in absence of comorbid conditions , including liver cirrhosis , immunosuppression , or nephrotic syndrome , primary peritonitis is rare , particularly in cases of healthy young subjects . primary peritonitis due to s. pyogenes is an unusual condition because streptococcus pyogenes usually causes pharyngitis , erysipelas , and necrotizing fasciitis . in this report , we present the first case to the best of our knowledge of primary peritonitis due to s. pyogenes in korea .",
"29-yr - old woman presented to the emergency room with lower abdominal pain on april 20 , 2011 . she had no travel history and had not taken any medication . on physical examination , she was alert and cooperative . her body temperature was 38 , blood pressure 80/60 mmhg , pulse 113 beats per minute , respiratory rate 20 breaths per minute , and oxygen saturation 99% while breathing ambient air . results of gynecological examination from gynecologists were also normal and no history of abnormal vaginal discharge was known . initial blood tests showed leukocyte count of 6,248/l , platelet count of 133,000/l , c - reactive protein ( crp ) level of 12.36 mg / dl , and procalcitonin level of 36.9 ng / ml . renal and liver function tests , clotting screen , and arterial blood gas were all within normal range . abdominal ct revealed edematous swelling of the intestinal wall and ascites with peritoneal enhancement suggesting peritonitis ( fig . as physical , laboratory , and radiologic findings suggested acute peritonitis , laparoscopy searching for etiology was performed . purulent ascites was found in the pelvic cavity but both ovaries and fallopian tubes were intact ( fig . there were no intra - abdominal abnormalities such as bowel perforation , appendicitis , or necrosis . reports of blood culture , ascites culture , and cervical swab culture showed gram - positive cocci . initial empiric antibiotics ( ampicillin / sulbactam 2 g/1 g every 6 hr ) switched to penicillin g ( 300 mu every 4 hr ) and metronidazole ( 500 mg every 8 hr ) .",
"primary peritonitis caused by streptococcus pyogenes is uncommon and rarely diagnosed in a healthy person without underlying diseases . spontaneous bacterial peritonitis due to streptococcus pyogenes in a cirrhotic child was reported in korea ( 1 ) but s. pyogenes peritonitis in a healthy person has not yet been reported in korea . therefore , this is the first case of primary peritonitis due to streptococcus pyogenes in a healthy person in korea . it is reported that most instances of spontaneous primary peritonitis are due to streptococcus pneumoniae ( 2 ) . there are a few cases describing s. pyogenes peritonitis in healthy women , even though the entry site of s. pyogenes in peritonitis is not uncertain . ( 3 ) suggested that in some women , s. pyogenes in peritonitis may be via the genital tract , despite lack of gynecological symptoms even though many studies have shown an absence of s. pyogenes as normal flora of the female genital tract . the hematogenous route may be an alternate , possibly from pharyngeal or cutaneous primary sites ( 3 ) . in this case , ascending genital infections was considered to be the entry site because of the positive cervical swab culture . the majority of primary peritonitis is diagnosed retrospectively when secondary causes are excluded after surgical approach ( 4 ) . preference for laparoscopy or laparotomy is established by the surgeon 's choice and laparotomy is predominantly performed in previous cases . however , farooq and ammori ( 5 ) claimed that laparoscopy could be used as a diagnostic tool in the management of generalized peritonitis . we chose laparoscopy as a diagnostic tool in this case because no significant abnormalities suggesting secondary peritonitis were found on abdominal ct . the severe infection of s. pyogenes requires a high index of suspicion , prompt diagnosis , and rapid initiation of appropriate antibiotics ( 6 ) . in this case , reports of blood culture , abdominal ascites culture , and cervical swab culture showed gram - positive cocci , so ampicillin / sulbactam was applied . after final result of culture confirmed s. pyogenes , antibiotics were switched to penicillin g and metronidazole . it is reported that some s. pyogenes serotypes are more commonly associated with invasive group a streptococcal disease than other gas isolates ( 7 - 9 ) . we did not obtain the serotype of s. pyogenes , so further study on s. pyogenes serotypes in primary peritonitis is required . in summary , we report the first case of primary peritonitis in korea in a young , healthy woman due to s. pyogenes . the port of entry was thought to be via the genital tract , despite no local symptoms . laparoscopy as a diagnostic tool was performed in this case and we recommend laparoscopy over laparotomy when no significant abnormalities suggesting secondary peritonitis are seen on abdomen computed tomography . an appropriate diagnostic approach and prompt antibiotic therapy is essential in primary gas peritonitis ."
] | we describe the first case of primary peritonitis in korea of a healthy person due to streptococcus pyogenes . in the absence of comorbid conditions , such as liver cirrhosis , immunosuppression , or nephrotic syndrome , primary peritonitis is uncommon in a young healthy woman . abdomen computed tomography revealed ascites in the lower abdomen and peritoneal enhancement suggesting peritonitis . in diagnostic laparoscopy , purulent ascites was found in the pelvic cavity but both ovaries and fallopian tubes were intact . there were no intra - abdominal abnormalities such as bowel perforation , appendicitis , or necrosis . the reports of blood culture , ascites culture , and cervical swab culture confirmed s. pyogenes . after use of antibiotics , the patient was cured and discharged without sequelae . |
[
"carbon monoxide ( co ) is a colorless , odorless , and nonirritant gas that is lighter than air , and it is a product of incomplete combustion of hydrocarbons.1 ) accidental , suicidal or homicidal intoxications with co have a long history . acute co poisoning is an important clinical problem and may lead large proportion of patients to fatal death . moreover , frequent neurologic and cardiovascular consequences have been described.2 - 4 ) the neurologic manifestations of co poisoning have been well described , and include headache , dizziness , weakness , nausea , and confusion.3)4 ) cardiac consequences have been reported , including arrhythmias and electrocardiographic alterations , acute myocardial infarction , pulmonary edema , and cardiogenic shock.5)6 ) among these , myocardial injury is common in patients with moderate to severe co poisoning,2 ) manifested as elevated cardiac biomarkers and the changes of regional wall motion abnormality in echocardiography.7 ) on the other hand , an association between thromboembolic accidents and co poisoning has been shown less frequently in the literatures.8 - 14 ) we report a co poisoning case complicated by intracardiac thrombus .",
"a 24-year - old female patient with no preexisting disease was brought to the emergency unit for altered mentality due to suicidal exposure to co. the duration of the exposure was unclear . she showed a good general appearance , the level of consciousness was alert : glasgow coma scale was measuring up to 15 . vital signs were blood pressure of 132/101 mmhg , pulse rate of 87/min , respiration rate of 20/min and body temperature of 35.4. oxygen saturation measured using pulse oxymetry was 100% when 15 l / min oxygen was applied through a reservoir bag mask . she was 164 cm tall and weighed 50 kg , and her body mass index was 18.6 kg / m . lower and upper limb arterial and venous examination revealed normal circulation . in detailed system examinations , no pathological neurologic signs were detected . laboratory analyses revealed the following : white blood cells , 21200/l ; blood urea nitrogen , 17 mg / dl ; creatinine , 0.75 mg / dl , and blood glucose , 101 mg / dl , d - dimer 0.28 ug / ml . cardiac enzymes were elevated ( ck : 3306 u / l , ck - mb : 90.6 ng / ml , troponin i : 1.899 ng / ml , lactate dehydrogenase : 334 u / l ) . arterial blood gas was performed and revealed ph 7.40 , paco2 33 mmhg , pao2 380 mmhg , hco3 20 mmol / l , and the fraction of carboxyhemoglobin 16.0% ( reference range < 2% ) . pain was mainly retrosternal , lasted for several minutes , with no aggravating or relieving factors , and no change in position or respiration . coronary computed tomography ( ct ) angiography performed to rule out coronary artery disease revealed normal coronary artery . transthoracic echocardiography on the same day showed moderately reduced ejection fraction ( 42% ) , and akinesia of left ventricular apex . stress induced cardiomyopathy or ischemic insult of left anterior descending artery were suspected . during comprehensive echocardiographic examination , echogenic mass with multiple nodularity in right atrium ( ra ) was identified . the size measured about 30 15 mm , and it appeared to be attached to the junction of superior vena cava . transesophageal echocardiography and cardiac magnetic resonance imaging ( mri ) were requested for further characterization of the mass . in mid - esophageal 140 degree view the mass was highly mobile and oscillating up and down across the tricuspid valve throughout the cardiac cycle ( fig . the foremost diagnosis to exclude in this patient was intracardiac thrombus , and therefore we started anticoagulation therapy immediately . cardiac mri 1 day after anticoagulation therapy showed delayed enhancement suggestive of a thrombus , and an obvious reduction in size of the thrombus to 8 mm ( fig . , she was questioned concerning recent potential precipitating conditions , such as surgery , immobilization and use of medications including oral contraceptives . furthermore , she was evaluated for genetic and connective tissue disease leading to thrombophilic conditions . complete lower extremity ultrasound and abdominopelvic ct was conducted for suspicion of peripheral vein thrombosis and it demonstrated no thrombosis in other organs . the follow - up transthoracic echocardiogram was done on sixth day after anticoagulation , and showed no residual thrombus in the ra and normalized left ventricular ( lv ) systolic function ( fig . the patient has been free of symptoms and there have been no clinical features of neurologic or thromboembolic complications during the 3-months of follow - up .",
"co poisoning has special impact on organs sensitive to oxygen deprivation such as the heart , brain , and kidney . myocardial injury assessed by ecg and cardiac enzyme elevation from moderate to severe co poisoning is common ( ~40% ) than expected.2 ) the proposed mechanism of global left ventricular dysfunction is tissue hypoxia and resultant myocardial stunning . the affinity of hemoglobin for co is more than 200 times greater than its affinity for oxygen , and competitive inhibition of oxygen release leads to tissue hypoxia.3 ) usually , the left ventricular dysfunction was transient and would be normalized with conventional treatment including high concentration of oxygen . in our case , left ventricular systolic dysfunction with regional wall motion abnormalities was associated with co poisoning and recovered with conventional therapy . in contrast , an association between thromboembolic accidents and co poisoning has been shown less commonly in the literatures . to our knowledge , this is the first korean case of acute co poisoning combined with ra thrombus formation . besides lv thrombus formation associated with transient apical ballooning of lv,15 ) there have been several reports regarding arterial and venous system thrombosis and related embolism including popliteal artery,8)9 ) superior sagittal sinus,10 ) vein of labbe,11 ) mesenteric artery,12 ) basillar trunk,13 ) and popliteal vein.14 ) a plausible explanation for thromboembolic events is the effect of co on platelets aggregation . co poisoning leads to some changes in blood vessel and co and nitric oxide exchange on platelet . disturbed mitochondrial mechanisms by no and its derivatives facilitate production of free oxygen radicals.16 ) oxidative stress enhanced by free oxygen radicals may lead to endothelial damage , and subsequent platelet aggregation.17 ) although the optimal therapy and duration of anticoagulation for co induced ra thrombus is still unknown , the use of anticoagulant therapy in the acute phase and until complete resolution of thrombus appears to be appropriate in patients with atrial thrombus.18)19 ) in conclusion , myocardial injury is common in co poisoning . thromboembolism could occur in cardiac chambers and peripheral vessels , although it was less frequent . therefore , patients presented with co poisoning should undergo echocardiographic examination followed by serial ecg and cardiac enzyme evaluation . careful examination should be performed for the assessment of intracardiac thrombus , in addition to the exact evaluation of ventricle function ."
] | carbon monoxide is a nonirritant , odorless , colorless gas . its effects are prominent in organs most sensitive to oxygen deprivation , such as the heart , brain , and kidney . although less frequently , an association between thromboembolic events and carbon monoxide poisoning has been shown in the literatures . in this case , we report a case of atrial thrombus associated with carbon monoxide poisoning . |
[
"kindler syndrome ( ks ) is a rare autosomal recessive genodermatosis , which was first described in a 14-year - old girl in 1954 by kindler and later by forman et al . in 1989 . more than 120 cases have been reported since the original report by kindler ; the largest series being a cluster of 26 patients identified within a tribe in the bocas del toro province on the northwestern caribbean coast of panama . the syndrome is a combination of features of inherited blistering skin disorders ( e.g. , dystrophic epidermolysis bullosa ) and congenital poikilodermas ( e.g. , rothmund - thompson syndrome ) and should be differentiated due to clinical overlap with hereditary acrokeratotic poikiloderma ( hap ) and dystrophic epidermolysis bullosa . apart from the skin changes , changes in the oral and conjunctival mucosa , phimosis and radiological changes , namely a dome - shaped skull ( turricephaly ) , rib and mandibular abnormalities have been reported . other features that vary between cases include acral hyperkeratosis , nail dystrophy , webbing and contractures of the fingers and toes , alopecia , actinic changes , pigmentation of lips and onchodystrophy . the association of aggressive periodontitis with ks was based on a single case in 1996 and later confirmed with a larger population of patients . a number of oral features have been described , such as gingival swelling , advanced periodontal bone loss , mild - to - severe gingivitis , dental caries , and leukokeratosis of buccal mucosa . dental findings had been briefly reported for kindler patients in dermatologic and pediatric publications including oral lesions , atrophy of buccal mucosa , limited oral opening , malocclusion , dystrophic teeth , ankyloglossia , bleeding gums , lip erosions and geographic tongue , atrophy of gingiva , erosion of the hard palate , gingival swelling and desquamative gingivitis .",
"a 16-year - old female patient presented with the chief complaint of bleeding gums , ulcerations of buccal mucosa , missing teeth and difficulty in swallowing . patient 's mother reported that she had two children ; one was healthy physically and mentally . both of her pregnancies and deliveries were normal , but history of the affected child revealed skin blisters beginning at the age of 3 months . these blisters were filled with clear fluid and left scars after their rupture , and occurred until the age of 1 year . cutaneous examination revealed multiple hypopigmented and a few hyperpigmented macules of variable sizes , distributed over his face , neck , trunk , and limbs [ figure 1 ] . skin over the hands and neck was dry , atrophic and photosensitive to the sunlight . areas of hyper- and hypo - pigmentation on face absence of palmar creases hyperkeratotic plaques on the flexures scarring was evident on the soft tissues of the buccal mucosa and tongue . tongue showed reduced mobility and was quite hard due to fibrosis [ figure 4 ] . in certain areas , erythema extended to mucogingival junction ; resulting in appearance of desquamative gingivitis [ figure 5 ] . desquamative gingivitis restricted mouth opening due to fibrosed commissures orthopantomograph showed areas of moderate bone loss around all the teeth present . multiple congenitally missing teeth , and retained deciduous teeth were reported [ figure 7 ] . orthopantomograph showing retained deciduous and congenitally missing permanent teeth histopathologic examination of atrophic skin lesions in patients with ks reveals nonspecific features of poikiloderma . the epidermis is flattened and atrophic ; edema is present at the dermoepidermal junction , and the basal layer shows focal vacuolization with basal cell degeneration . other histologic features include a prominence of dermal capillaries , pigmentary incontinence , and possibly , perivascular lymphocytic infiltrate .",
"a 16-year - old female patient presented with the chief complaint of bleeding gums , ulcerations of buccal mucosa , missing teeth and difficulty in swallowing . patient 's mother reported that she had two children ; one was healthy physically and mentally . both of her pregnancies and deliveries were normal , but history of the affected child revealed skin blisters beginning at the age of 3 months . these blisters were filled with clear fluid and left scars after their rupture , and occurred until the age of 1 year .",
"cutaneous examination revealed multiple hypopigmented and a few hyperpigmented macules of variable sizes , distributed over his face , neck , trunk , and limbs [ figure 1 ] . skin over the hands and neck was dry , atrophic and photosensitive to the sunlight . areas of hyper- and hypo - pigmentation on face absence of palmar creases hyperkeratotic plaques on the flexures",
"tongue showed reduced mobility and was quite hard due to fibrosis [ figure 4 ] . deep pockets with marked bleeding on minimal probing were present around the teeth . in certain areas , erythema extended to mucogingival junction ; resulting in appearance of desquamative gingivitis [ figure 5 ] .",
"multiple congenitally missing teeth , and retained deciduous teeth were reported [ figure 7 ] .",
"histopathologic examination of atrophic skin lesions in patients with ks reveals nonspecific features of poikiloderma . the epidermis is flattened and atrophic ; edema is present at the dermoepidermal junction , and the basal layer shows focal vacuolization with basal cell degeneration . other histologic features include a prominence of dermal capillaries , pigmentary incontinence , and possibly , perivascular lymphocytic infiltrate .",
"in 2003 , siegel et al . mapped the disease locus to band 20p12.3 by using linkage and homozygosity analysis in an isolated cohort of patients with ks . loss - of - function mutations were identified in the candidate gene flj20116 , which was renamed kindlin-1 ( kind1 ) . this gene encodes a 677-amino acid protein , kind1 , which is thought to play a regulatory role in inhibiting oversecretion of basement membrane components by basal keratinocytes at the dermoepidermal junction . an autosomal recessive pattern of transmission is usual , but sporadic cases are not uncommon . in ks , there is an unusual interruption and reduplication of the basement membrane and a broad reticular pattern of type vii collagen staining deep into the connective tissue beneath the basement membrane . it has also been suggested that ks and weary 's hap are variants of the same disease . however , the mode of inheritance , onset of blistering , photosensitivity and presence of eczema is different in these two syndromes . the level of ultrastructural cleavage for blistering appears to be junctional in ks and intraepidermal in hap . the dominant cutaneous findings in ks are increased skin fragility , acral blistering , photosensitivity , atrophy , and poikiloderma . although increased skin fragility may be explained by the weakening of basal keratinocyte - extracellular matrix adhesion , the pathomechanisms of other features such as photosensitivity and skin atrophy remain unclear . mucosal involvement is very common and may lead to urethral , anal and esophageal stenosis . our patient presented with acral blisters in the neonatal period and childhood , diffuse poikiloderma , skin fragility and atrophic changes , which were more prominent on skin exposed areas . a set of clinical diagnostic criteria has recently been proposed for this condition to facilitate clinical diagnosis . the major criteria are acral blistering in infancy and childhood , progressive poikiloderma , skin atrophy , photosensitivity , and gingival fragility , and/or swelling . the additional features of these criteria are nail dystrophy , ectropion , palmoplantar keratoderma , leukokeratosis of lips , squamous cell carcinoma , anhidrosis , skeletal abnormalities , and dental problems . according to the proposed criteria , the presence of four major criteria makes the diagnosis certain , the presence of three major and two minor criteria makes the diagnosis probable , and diagnosis is considered to be likely if two major and two minor / additional features are present . according to these criteria a definitive diagnosis of ks was made . several conditions that can cause blistering , cutaneous atrophy , and/or poikilodermatous skin changes must be differentiated from ks . ks might be difficult to differentiate from variants of epidermolysis bullosa in newborns . progressive improvement of blistering , photosensitivity , poikilodermatous changes , and cutaneous atrophy with age help to differentiate ks from epidermolysis bullosa . in dystrophic epidermolysis bullosa , there is a mutation in the gene encoding type vii0 collagen ( cola7a0 ) distinguishing it from ks . rothmund - thomson syndrome shows poikiloderma and photosensitivity like ks , but additional features like sparse hair , hypogonadism , and cataracts in the former condition distinguish it from ks . bloom 's syndrome is characterized by telangiectasia and photosensitivity with the presence of erythema on the face and other sun - exposed areas without showing true poikiloderma . short stature , recurrent infections , and increased frequency of hematological malignancies are also features of this disease . patients with cockayne 's syndrome develop erythema in photo - distributed areas , atrophy , and hyperpigmentation . the associated features of dwarfism , cachexia , progressive pigmentary retinopathy , deafness , and birdlike faces differentiate cockayne 's syndrome from ks . reticulated hyperpigmentation , nail dystrophy , and leukoplakia are characteristic features of dyskeratosis congenita . unlike ks , the pigmentary changes are not truly poikilodermatous and bullae are not an important feature of this rare genodermatosis . good wound care including the use of topical and systemic antibiotics for infected bullous lesions and ulcerations might reduce the morbidity . patients usually have a normal life span , but significant morbidity may be caused by secondary infections of congenital blisters ; mucosal involvement leading to urethral , anal and esophageal stenosis ; aggressive periodontitis , and ocular complications ."
] | kindler syndrome is a rare hereditary disorder , associated with skin fragility . the syndrome involves the skin and mucous membrane with radiological changes . the genetic defect has been identified on the short arm of chromosome 20 . this report describes a 16-year - old patient with classical features like blistering and photosensitivity in childhood and the subsequent development of poikiloderma . |
[
"central serous chorioretinopathy ( cscr ) is a chronic idiopathic condition affecting young to middle - aged patients with men affected more commonly than women . it is characterized by serous detachment of the neurosensory retina , with focal or multifocal areas of leakage of the retinal pigment epithelium ( rpe ) affecting the macular area . the exact cause of cscr is not clearly understood . nevertheless , it is associated with psychological stress and systemic corticosteroid therapy , which causes hyperpermeability of choriocapillaries , leading to dysfunctional degeneration of the rpe [ 1 , 2 ] .",
"a 23-year - old man presented with a sudden decrease of visual acuity of the right eye ( re ) 4 days after rhinoplasty for a deviation of the nasal septum . general anesthesia was induced with propofol 2 - 5 mg / kg i.v . and sufentanil 0.5 g / kg i.v . no corticosteroids , antibiotics or other postoperative treatment was used . at presentation , best - corrected visual acuity of the re was 6/9 with metamorphopsia . fundus examination revealed a well - delineated serous elevation of the macula and fluorescein angiography ( fa ) showed a focal rpe leakage . the optical coherence tomography ( oct ) sections through the macula depicted a mild neurosensory retinal detachment with an increase in retinal thickness equal to 245 m ( fig . two weeks later , without any treatment , a gradual improvement of the symptoms was assessed . one month after the operation , visual acuity of the re returned to 6/6 and the neurosensory retinal detachment disappeared . also , fa revealed the disappearance of rpe leakage and the retinal thickness of the macula measured with oct was 183 m ( fig .",
"cscr is a multifactorial disease with controversial etiopathology and it is usually associated with steroid use , pregnancy and stress . the exact mechanism by which glucocorticoids are involved in the development of cscr is still unknown . it is possible that a constitutionally determined susceptibility of the posterior blood - retinal barrier must be present so that , under the effect of exogenous or endogenous glucocorticoids , cscr develops . found elevated values of urinary free cortisol in patients suffering from cscr not exposed to exogenous glucocorticoids and without biological signs of endogenous cushing 's syndrome . psychologic stress has been known to produce hypothalamic - pituitary - adrenal axis abnormalities like endogenous cortical excess , which has been found in some patients with cscr . in fact , the use of imidazole derivatives like oxy- and xylometazoline , which directly stimulate alpha - receptors and are more alpha-2-selective , are associated with the manifestation of cscr [ 6 , 7 ] . in our case , the use of xylometazoline may have enhanced the post - traumatic stress and induced adrenergic stimulation leading to an increase in the choroidal circulation and alteration of the pump action of the rpe , which is related with the development of the cscr . however , the simultaneous increase in choroidal resistance has no effect on choroidal blood flow , which will be regulated to be maintained constant . in summary , we present a case of cscr after rhinoplasty , which to the best of our knowledge has not been previously reported . this case shows a possible association between the postoperative stress or the use of xylometazoline and cscr and widens the spectrum of drugs associated with the occurrence of the disease .",
""
] | we report a case of central serous chorioretinopathy after rhinoplasty for deviation of the nasal septum in a 23-year - old caucasian man . the patient complained of deterioration of vision in the right eye 4 days after rhinoplasty . at presentation , visual acuity of the right eye was 6/9 with metamorphopsia . fluorescein angiography revealed a focal retinal pigment epithelium leakage and optical coherence tomography an increase in macular thickness to 245 m . the left eye was normal . one month after the operation , without any treatment , visual acuity returned to 6/6 , the leakage of the retinal pigment epithelium disappeared and the macular thickness returned to 183 m . to the best of our knowledge , central serous chorioretinopathy after rhinoplasty has not been previously reported . this case report shows a possible association between the postoperative stress and central serous chorioretinopathy . moreover , it widens the spectrum of drugs associated with the occurrence of the disease . |
[
"one of the most common anomalies in newborn infants is cleft lip and/or cleft palate ( cl / p ) . cdc recently estimated that each year in the united states ( us ) , about 2,650 babies are born with a cp and 4440 babies are born with a cl with or without a cp . isolated orofacial clefts or clefts that occur with no other major birth defects are one of the most common types of birth defects in the us . to understand the role of environmental and genetic factors in the development of clefts , many authors provide evidence in the form of epidemiological data on the prevalence of oral clefts . vanderas reviewed studies published in english and reported the incidence of cl and cp among different races . cooper et al . reported asian ( chinese , japanese , and other asian ) oral - facial cleft birth prevalence based on the published reports . the prevalence rates of cl / p were lower than 2/1000 live births , but the rates differed from population to population . some investigators have reported different prevalence rates of cl / p from region to region . the prevalence rates of cl / p in the central highlands of madagascar were greater than those in the coastal region . studied regional variations of live births with oral clefts in the netherlands and found that the overall live birth prevalence was significantly higher in the northern netherlands than in the rest of the country . in the middle east , the incidence has variably been reported as 0.3 - 2.19/1000 live births . iran is a large country in the middle east , with many different ethnic groups . the major groups are persian , azari , kurd , lur , baloch , arab , turkmen , bakhtiari , qashqai , mazandaran , guilan , tali , and pashtu . the reported prevalence of oral clefts among the iranian population varies from 0.86 to 3.73/1000 births . the prevalence at birth of clefts and associated malformations among the 19,369 live births in a maternity hospital in shiraz city ( south of iran ) was 1.03/1000 . a 7-year retrospective study in a maternity hospital in tehran ( capital of iran ) showed that the overall incidence was 2.14/1000 from 11,651 live births . reported the birth prevalence of oral clefts among three main ethnic groups in gorgan in the northern of iran . of 37,951 live births in the largest hospital in gorgan , the overall prevalence of oral clefts was 0.97/1000 live births . the prevalence of oral clefts in the sistani was higher than that in the fars and turkmean group , 1.47 , 0.86 , and 0.88/1000 , respectively . the prevalence of cl / p among live births in yazd province ( center of iran ) was 0.86/1000 births . a study was carried out in hospitals of hamedan city ( west of iran ) by zandi and heidari . cp is the second most common birth defect . in spite of several studies about the prevalence of this , no investigation evaluated this prevalence in the west and north - west area of iran . twelve provinces from 31 provinces of iran are in the west and north - west area , with different ethnic groups : azari , kurd , lur , bakhtiari , qashqai , guilak , and fars . the aims of the present study are to ascertain the prevalence of cl / p among live births among four provinces in the west and north - west of iran with different ethnic / cultural .",
"in a cross - sectional study ; over 5 years from 2008 to 2012 , we select four provinces such as [ figure 1 ] east azarbaijan , kurdestan , gilan , and markazi have different ethnic / cultural , and the prevalence of oral clefts was not reported in them until now . the people of east azarbaijan , kurdestan , gilan , and markazi are azari , kurd , gilak , and fars , respectively . the capital cities of them are tabriz , sanandaj , rasht , and arak city , respectively . at the 2011 census by the statistical center of iran , the population of tabriz , sanandaj , rasht , and arak were , 1,695,094 , 450,167 , 918,445 , and 599,634 , respectively . the population under study included all infants born alive in the university hospitals from the medical universities with a maternity unit in each of the capital cities from these four provinces . all hospitals have registered medical information of patients according to the code in the international classification of diseases ( icd 10 revision ) . in the hospital , the physicians report all birth defects , and the medical record center registers the code of defect and other information of patients . we gathered information of infants with cl / p who were born in hospitals , including the date and place of birth , gender , and type of clefts . the relevant icd-10 diagnosis codes of cp , cl , cl / p are q35 , q36 , and q37 , respectively . the cleft birth/1000 live births was calculated separately for all provinces and all years , during 2008 - 2012 . four west and north - west provinces of iran that the capital city of them included in this study the data were performed using spss software v19 . prevalence was calculated by using the percentages of cl / p in the total sample . in addition , to study the effect of the place and date of birth , type of clefts , and gender that were tabulated from the infants with cl / p , prevalence was compared between the different groups using chi - square and fisher 's exact test .",
"prevalence was calculated by using the percentages of cl / p in the total sample . in addition , to study the effect of the place and date of birth , type of clefts , and gender that were tabulated from the infants with cl / p , prevalence was compared between the different groups using chi - square and fisher 's exact test .",
"during the study , 52 infants with cl with or without cp ( cl / p ) or cp were born alive in hospitals with a maternity unit in four cities in the west and north - west of iran [ table 1 ] . in total , there were 107,317 registered live births during 2008 - 2012 . the prevalence during 2008 - 2012 in rasht , arak , sanandaj , and tabriz cities was 557 , 352 , 503 , and 559/1,000,000 live births , respectively ( p = 0.000 ) like prevalence of arak is less than others significantly [ table 2 ] . frequency of clefts live births in four west and north - west cities of iran from 2008 - 2012 based on sex and cleft type frequency ( annual prevalence of clefts per 1000 live births ) of cl / p in four west and north - west cities of iran from 2008 - 2012 according to the annual prevalence of clefts birth , the highest prevalence of clefts occurred in rasht city , and the electronic reports of live - birth infants of arak city had not any reports of children with clefts in 2011 . annual clefts birth prevalence among the four provinces was statistically different ( p < 0.05 ) . table 3 and figure 2 demonstrate the incidence of clefts in the four provinces during 2008 - 2012 . ( prevalence of clefts per 1000 live births ) in four west and north - west cities of iran from 2008 - 2012 the annual prevalence of cl / p in four west and north - west cities of iran from 2008 - 2012 overall , of 52 infants with cl / p or cp , there was cp ( 23 ; 44.2% ) more common , followed by cl / p ( 19 ; 36.6% ) and cl ( 10 ; 19.2% ) . the prevalence of clp was greater in arak city and tabriz city , and the incidence of cl was greater in sanandaj city , and cp was greater in rasht city , whereas we did not get any electronic reports of infants with cl in rasht city among live births who were born in the hospital with a maternity unit during 2008 - 2012 [ table 2 ] . there were statistically significant differences among the four provinces in the prevalence of cl and palate based on the cleft types : cl , cp , and , clp like there were a statistically significant difference among the four provinces in prevalence of cp ( p = 0.003 ) . of the 52 infants with clefts , 24 ( 46.15% ) were girls and 28 ( 53.85% ) were boys [ table 4 ] . the greatest prevalence of girls with clefts was in rasht city and the boys with clefts was in arak city . the prevalence of cl / p based on sex was statistically different between the four provinces ( p < 0.05 ) . frequency ( prevalence of clefts per 1000 live births ) in four west and north - west cities of iran from 2008 - 2012 by gender there is a significant relationship between sex and cleft types ( p = 0.017 ) . from 19 infants with clp , 26.3% of infants were females , and 73.7% were males , clp was found most frequently in males ( p = 0.016 ) . and of 23 infants with cp , 56.5% of infants were females and 43.5% were males ( p = 0.45 ) . of 10 infants with cl ,",
"this study was conducted to explore the prevalence of cl / p in the capital cities of four provinces in the west and north - west of iran by using electronic medical information from the hospitals . until now , the prevalence of oral clefts was not reported for the population of four provinces : markazi , east azarbaijan , kurdestan , and gilan . several studies have reported the prevalence of cl / p in the iranian population since 1986 . the main purpose of the current study is to explore the distribution and prevalence of cl / p and type of clefts in the capital city of four provinces synchronously from 2008 to 2012 . the overall prevalence of cl / p in the population of four capital cities of four provinces in the west and north - west of iran was 0.48/1000 live births . we used only electronic records ( hospital - based ) of children who were born in hospitals and eventually were diagnosed . so probably those children who were not diagnosed at birth in the hospital were not registered . there was a wide variation in the incidence of cl / p from 2008 to 2012 , and from city - to - city . the highest incidence of cl / p occurred in rasht city of gilan province ( 1.27/1000 ) in 2011 . zandi and heidari also reported the prevalence of cleft anomalies , ranging from 0.42/1000 in 1994 to 1.70/1000 in 1998 from hamedan city in iran . with respect to ethnicity , the prevalence of oral cleft in gorgan city ( in iran ) has been reported . in fars , turkamean , and sistani , the prevalence of cl / p was 0.86 , 0.88 , and 1.47/1000 , respectively . according to cooper et al . , the prevalence of live births with cleft anomalies is different from population to population . in this study , there were statistically significant differences among the four provinces in the frequency of clefts ( p = 0.000 ) and cleft types ( p = 0.000 ) . the prevalence of cp in rasht was more than that of other types of clefts . similarly , elliott et al . reported that there was regional variance in clefts within nine zambian provinces . in the present study , overall , cp was more common ( 44.2% ) , followed by cl / p ( 36.6% ) and cl ( 19.2% ) . most previous studies , reported that the prevalence of cl / p was higher than other types of oral clefts as well as the iranian investigators reported that the prevalence of cl / p was higher . some studies reported the equal distribution of males and females with cl / p . in the present study , differences in distribution among boys and girls with various types of cleft , cl , cp , and cl / p , cp was found most frequently in females , and cl / p was found most frequently in males . the majority of the studies similarly reported that cl / p was significantly more common in males than in females , and cp was more common in females than in males .",
"we explored the prevalence of cl / p in four capital cities of the west and north - west provinces of iran synchronously from 2008 to 2012 . overall , there were differences among the four cities in the prevalence of oral clefts . conversely , the effect of gender on the prevalence of cl / p also showed regional differences . the different gender effects on the prevalence of cl / p from city - to - city may be explained by environmental and/or genetic factors affecting the development of oral clefts . this investigation was supported by grant 91 - 02 - 32 - 18216 from the vice - chancellor for research of iran university of medical sciences .",
"this investigation was supported by grant 91 - 02 - 32 - 18216 from the vice - chancellor for research of iran university of medical sciences .",
"",
"nj contributed in the conception of the work , conducting the study , revising the draft , approval of the final version of the manuscript , and agreed for all aspects of the work . shj contributed in the conception of the work , drafting and revising the draft , approval of the final version of the manuscript , and agreed for all aspects of the work ."
] | background : one of the most common anomalies in newborn infants is cleft lip and/or cleft palate ( cl / p ) . in spite of several studies about the prevalence of this , no investigation evaluated this prevalence in the west and north - west of iran . with due attention to different ethnic groups in this area , the aim of this study is to investigate whether the distribution of cl / p live births varies regionally in this area of iran.materials and methods : a cross - sectional study was conducted using hospital registry records to identify all children born with cl / p . the hospitals with a maternity unit were selected in the capital cities of four provinces in the west and north - west of iran , east azarbaijan , kurdestan , gilan , and markazi . the population under study included all infants born alive from 2008 to 2012.results:during the study period , 107,317 live births were registered in the hospitals with a maternity unit of four cities , and 52 infants ( 0.485/1000 live births ) were born with cl / p . the prevalence in rasht , arak , sanandaj , and tabriz cities was 0.557 , 0.352 , 0.503 , and 0.559/1000 live births , respectively ( p < 0.05 ) , and in cleft types ( p < 0.05 ) . of the 52 infants who were born with cl / p , 24 ( 46.15% ) were girls and 28 ( 53.85% ) were boys ( p > 0.05 ) , whereas the prevalence of cl / p based on sex was statistically different among the four provinces ( p < 0.05).conclusion : this study shows regional variations in the birth prevalence of clefts and various cleft types . the different effects of gender on the birth prevalence of cl / p from city - to - city may be explained environmentally and/or by genetic factors affecting the development of oral clefts . |
[
"cardiovascular diseases ( cvds ) account for about 30 percent of all deaths worldwide , and hyperlipidemia , hypertension , and smoking are well known as the three major risk factors of the mortality rates of cvds . regarding the advances in the study and understanding of the mechanisms involved in the positive and negative effects of botanical drugs on health and diseases , one of the areas which has gained attention in recent years is the protective and destructive effects of herbal agents on the cardiovascular system . based on the previous experimental studies and existing traditional and folk medicine knowledge about some of the cardiovascular beneficial effects concerning rosa damascena l. ( rd ) and quercus infectoria ( qi ) , we have selected these two herbal drugs for the present study . the q. infectoria olivier ( fagaceae ) is a shrub that grows in asia minor , iran , and greece . the galls of q. infectoria have analgesic cns depressant , antiparkinsonian , antidiabetic [ 35 ] , anti - inflammatory , and antioxidant activity . recently , the hepatoprotective effects of q. infectoria galls against ccl4-induced tissue damage have been reported . rosa damascena l. is a small plant , that is cultivated all over the world due to its scent and visual beauty . the theraputical effects of rosa damascena l. are due to its anti - inflammatory , analgesic , hypnotic , and antispasmodic [ 9 , 11 ] properties . antioxidant and antidiabetic [ 12 , 13 ] , heart inotropic , usefulness in treatment of menstrual bleeding , antitussive , tracheal relaxant , and relaxing activity are the other effects that attributed to rosa damascena l. considering the beneficial effects of quercus infectoria and rosa damascena l. reported in the literature , the administration of these agents especially in the eastern societies is growing . in the present study we investigated the effects of chronic administration of quercus infectoria and rosa damascena l. on the hemodynamic , heart performance , lipid profile , and plasma atherogenic indices of rabbits with / without hyperlipidemia to elucidate the outcome of a long - term consumption of these agents on the cardiovascular system .",
"experiments were conformed to the national guidelines for conducting animal studies ( ethic committee permission no . 86/123ka kerman university of medical sciences , iran ) and were performed on 36 new zealand white rabbits weighing between 2.5 and 3.5 kg . sodium thiopental was purchased from biochemie ( austria ) and cholesterol from merck ( germany ) . galls of quercus infectoria ( qi ) and flowers of rosa damascena l. ( rd ) were collected during the spring of 2012 from isfahan and kerman ( provinces of iran ) , respectively ; they were identified and confirmed by the botany department of bahonar , university of kerman , iran . the galls of qi and air - dried flowers of rd ( 300 g ) were grinded and macerated in 1000 ml methanol at room temperature for 3 days . then the mixtures were filtered and evaporated in vacuum to yield a waxy mass extract from rd and a powder mass extract from qi . rabbits were kept under appropriate animal care and were randomly divided into 6 groups as control ( ctl ) , rd , qi , hyperlipidemic ( h ) , hyperlipidemic+rd ( h+rd ) , and hyperlipidemic+qi ( h+qi ) . the rd and qi groups were fed with normal rabbit chow supplemented with 1.5 g rd and qi extracts , respectively , in each kg of the diet for 45 days . this dosage was calculated based on the current using pattern among consumers and previous studies . cholesterol ( 0.5% ) and hydrogenated vegetable oil ( 16% ) were added to the diet of the hyperlipidemic ( h ) groups during the 45 days of this experiment . the h+qi and h+rd groups received 1.5 g qi and rd extracts , respectively , in each kg of their diet in addition to cholesterol and hydrogenated vegetable oil during the study . the fasting blood sample was taken from ear vein on the first and the 46th day of the experiment in order to measure the plasma total cholesterol ( tc ) , low - density lipoprotein ( ldl ) , high - density lipoprotein ( hdl ) , and the triglyceride ( tg ) levels by routine laboratory methods . the atherogenic indices of plasma , as markers of plasma atherogenicity , were calculated as tc / hdl and ldl / hdl . at the end of the experiment , animals were anaesthetized by the injection of sodium thiopental ( 50 mg / kg , ip ) and were maintained with a 1% halothane in a 30% o269% n2o mixture during the surgical procedure . deep anesthesia was confirmed and maintained throughout the surgery as judged by the absence of withdrawal response to a pinch stimulus applied to the hind limbs . a heparinized saline - filled ( 7 units / ml ) cannula was connected to a pressure transducer , and a powerlab analog to digital converter ( ad instruments , australia ) was inserted into the left carotid artery to record the heart rate and arterial blood pressure ( bp ) . the other cannula which went through the right carotid artery was inserted into the left ventricle , and the left ventricular pressure ( lvp ) was recorded . the gaseous anesthesia was discontinued at the end of the surgery , and the time window for animal recovery from the surgery was 30 min . the mean arterial pressure ( map ) was calculated by map = pd + ( ps pd)/3 formula , where pd is the diastolic arterial pressure and ps is the systolic arterial pressure . the maximum velocity of contraction ( max dp / dt ) and the maximum velocity of relaxation ( min dp / dt ) were calculated from the left ventricular pressure pulse . pressure - rate product ( prp ) , an indirect measure of myocardial oxygen demand , was determined as the product of the heart rate and mean arterial pressure ( ( mapheart rate) 1,000 ) . comparisons were performed between basal and final values in each group by student 's paired t - test and among the different groups by one - way anova which was followed by the post hoc tukey 's test .",
"the levels of basal plasma lipids and basal atherogenic indices of the different groups had no significant difference . consumption of normal chow alone or along with rd or qi for 45 days did not cause any significant change on the lipid profile and atherogenic indices of the ctl and qi groups . the triglyceride level , however , showed significant increase in the rd group ( p < 0.01 ) . the high - fat diet induced hyperlipidemia as significant increase in the tc , ldl , and tg and atherogenic indices in all groups compared to its related basal values ( table 1 , figures 1 and 2 ) . the qi administration along with the hyperlipidic diet decreased the tc and ldl when compared to the h and h+rd groups ( p < 0.001 and p < 0.01 , resp . ) . the level of ldl was also reduced in the h+rd group ( p < 0.01 versus h group ) . the level of tg was enhanced in the h group compared with the ctl group ( p < 0.01 ) ; however , the consumption of qi attenuated this effect ( p < 0.05 versus h group ) ( table 1 ) . two atherogenic indices of plasma , tc / hdl and ldl / hdl , significantly increased in the h and h+rd groups ( p < 0.001 versus ctl and rd groups ) . tc / hdl showed nonsignificant increase in the h+qi group ( p < 0.055 compared to qi group and p = 0.058 compared to the ctl group ) ( figure 1 ) . the ldl / hdl ratio was associated with a lesser increase in the h+qi group than that of the h and h+rd ( p < 0.01 when compared to the ctl and qi groups ) ( figure 2 ) . at the end of this study , the comparison of the blood pressure among the different animal groups did not show any significant effect of rd or qi ( each alone ) on this parameter . yet , in those animals which received a combination of rd and high - fat diet , systolic , diastolic , and the mean arterial pressures increased significantly whenever it was compared to its corresponding groups , that is , the ctl , rd , and h. in this study , the high - fat regimen alone or plus qi had no significant effect on the blood pressure compared to its matching groups ( figure 3 ) . the heart rate , pulse pressure , the maximum velocity of heart contraction ( + dp / dt max = max dp / dt ) , and the maximum velocity of heart relaxation ( dp / dt max= min dp / dt ) did not show any significant difference among the animal groups ( table 2 ) . the prp was greater in the h+rd and h+qi groups ; however , this index was only significant in the h+rd , when compared to the rd group ( p < 0.05 ) ( table 2 ) . the left ventricular developed pressure ( lvdp ) and the left ventricular systolic pressure ( lvsp ) increased significantly in the h+rd group compared to the ctl and rd groups ( p < 0.05 and p < 0.0001 , resp . ) and in the h+qi groups ( p < 0.01 versus qi groups ) . the lvdp and lvsp also increased in the h groups compared to the rd group ( p < 0.05 ) . the h and the h+rd groups showed maximum levels of left ventricular end diastolic pressure ( lvedp ) ; on the contrary , the qi group showed a minimum level of this parameter . in addition , the lvedp had dropped in the h+qi group compared to the h group ( p < 0.05 ) ( figure 4 ) .",
"this study aimed to assess the influence of the chronic administration of a methanolic extract of two famous herbal drugs , that is , rosa damascena l. and quercus infectoria , on hemodynamic , heart performance , lipid profile , and plasma atherogenic indices of rabbits with / without high - fat diet . the results revealed the obvious beneficial effect of qi on harmful outcomes of a hyperlipidic diet as the attenuation of plasma atherogenic indices , the prevention of hyperlipidemia , and the improvement of the cardiovascular performance . on the other hand , the rd administration showed a mild decreasing effect on plasma lipid profile and the atherogenic indices . however , the administration of rd along with a high - fat diet increased the index of myocardial oxygen consumption and the risk of hypertension . the inhibition of pancreatic lipase ( pl ) as a pivotal enzyme in the intestinal absorption of triglycerides and hmg coa reductase , the other important enzyme , that is , involved in the endogenous cholesterol biosynthesis , is the target of the pl inhibitors and statins , respectively . in vitro experiments indicated that especially qi and to some extent rd have inhibitory effect on pancreatic lipase and hmg coa reductase enzyme . the results of previous and present in vivo studies obviously have confirmed the antilipidemic effect of qi , but rd had no considerable effect . therefore , a part of the antilipidemic and antiatherogenic effects of qi revealed in the present study may mediate through inhibition of pl and hmg coa reductase enzymes . in addition , qi contains some bioactive agents , and its main component is tannin . this phenolic compound is able to precipitate proteins [ 28 , 29 ] , for example , pl enzyme , and hence may provide a portion of antilipidemic and antiatherogenic effects of qi . previous studies showed that the use of high - lipid diet contains 1% cholesterol for 8 and 10 weeks and had no significant effect on the blood pressure , heart rate , prp , max dp / dt , and min dp / dt indices of rabbits . still , even 4 weeks of a high - cholesterol regimen increases the vascular resistance and decreases the endothelium - dependent vasodilatation . consistent with the previous reports , in our study , 45 days of a highfat diet had no significant effect on hemodynamic and heart performance of the h group compared to the ctl group . however , coadministration of rd and high - fat diet was associated with an increase in the blood pressure , lvsp , and lvdp . the positive chronotropic and inotropic effect of rd has been observed in the isolated heart of guinea pigs . this effect apparently is mediated through the stimulation of -adrenoceptor [ 33 , 34 ] . the opening of the calcium channels and the elevation of the intracellular camp levels like the effect of phosphodiesterase iii inhibitors are likely to be the other possible mechanisms which may be involved in the inotropic effect of rd . cardiac output , in turn , is the product of stroke volume and heart rate . the increase of heart contractility leads to the increase of stroke volume and consequently the blood pressure . in our study , a nonsignificant increasing trend of max dp / dt as an index of heart contractility in the h+rd group was observed . the discrepancy between our findings and the results of boskabady et al . related to the chronotropic effect of rd may come from the two different conducting methods , in vivo method versus isolated heart method , and hence influence of endogenic factors such as autonomic nervous system feedback in our study . the combination of the negative effect of hyperlipidemia on the vascular vasodilatation along with the partial increase of heart contractility due to positive inotropic effect of rd is a likely reason for explaining the high blood pressure and lvsp in the h+rd group . however , there is the possibility of unknown effects of rd on the arterial vessel that should be investigated in future studies .",
" the results of this study revealed the significant antilipidemic and antiatherogenic effects of qi but not rd . this may be partly mediated by the inhibition of pl and hmg coa reductase enzymes . regarding some side effects of synthetic lipid - lowering drugs , for example , myopathy and liver damages for statins [ 25 , 37 ] and gastric irritation , flushing , hyperuricemia , dry skin , and abnormal liver function for pl synthetic inhibitors , qi can be considered as a new candidate for reducing plasma lipids in future human studies . in addition , the use of rd along with a high - fat diet increased the risk of hypertension in rabbits . if our results can be extrapolated to human , this adverse effect of rd in cases with hyperlipidemia context should be considered and investigated ."
] | according to the use of quercus infectoria ( qi ) and rosa damascena l. ( rd ) for therapeutic purposes and lack of adequate information about their cardiovascular effects , we investigated the cardiovascular indices of rabbits which chronically pretreated with these agents . animal groups were control group ( ctl ) , rd and qi groups with normal chow plus 1.5 g rd and qi extracts , respectively , in each kg of the diet for 45 days ; hyperlipidemic ( h ) group received high - fat diet for 45 days ; h+rd and h+qi groups received high fat diet plus qi and rd extracts , respectively . blood pressure was greater in h+rd group than ctl , rd , and h groups . left ventricular developed pressure and left ventricular systolic pressure increased significantly in h+rd group versus ctl and rd groups ( p < 0.05 and p < 0.0001 , resp . ) and in h+qi groups ( p < 0.01 versus qi groups ) . left ventricular end diastolic pressure ( lvedp ) showed significant reduction in h+qi group versus h group . qi attenuated the values of total cholesterol , ldl , tg , and atherogenic indices of plasma when coadministrated with a high - fat diet . the results suggest the antilipidemic and antiatherogenic effects of qi . in addition , the use of rd along with a high - fat diet may increase the risk of hypertension in rabbits . |
[
"multicentric reticulohistiocytosis ( mrh ) is a rare multisystem syndrome characterized by polyarthritis and papulonodular skin lesions with typical dermal infiltration of histiocytes and multinucleated giant cells . the disease may involve the skin , tendon sheath , synovium , bone , liver , salivary gland , kidney , lymph node , heart and lung . in mrh , an association with hyperlipidemia ( 3058% ) , a positive skin tuberculin test ( 1250% ) , systemic vasculitis and autoimmune disease has been described . of utmost clinical importance such an association has been documented in up to 28% of all reported cases in the world literature , the most common being bronchial , breast , stomach , and cervical carcinomas . here , we report , for the first time , a case of mrh presenting with liver carcinoma , thus highlighting the association of mrh with malignant disease .",
"a 61-year - old man presented with a 4-month history of a nonpruritic rash , which started on his forearm and face after sun exposure and subsequently spread to the ear , scalp and upper chest , after which asymptomatic skin lesions appeared on the lateral margin of his finger . the patient denied any history of photosensitivity but complained of low - grade fever and painful swelling of the joints in his wrist , knee and ankle , accompanied by restricted activity for 1 month . he had a sensation of a foreign body in his pharynx with difficulty in swallowing for about 1 month . the patient also had a history of hepatitis b , which was diagnosed in the 1970 's , and severe knee joint pain with bony spurs , which were confirmed by x - ray , for at least 2 years . treatment with hydroxychloroquine and thalidomide for solar dermatitis in other hospitals showed no therapeutic effect . physical examination showed a confluent erythematous eruption affecting his scalp , face , neck and the extensor aspect of his forearm , which was characterized by ruby - red , translucent and grouped papules ( fig . red nodules could also be found on the dorsum of the nose , lateral area of the fingers and tongue tip ( fig . an extensive laboratory evaluation , including white cell count , urinalysis , stool studies , renal function , electrolytes , cholesterol and triglycerides , erythrocyte sedimentation rate , antistreptolysin o level , rheumatoid factor and antinuclear antibody were normal . u / l ) , alt 125 u / l ( < 50 u / l ) , alp 159 u / l ) , ggt 100 u / l ( 345 u / l ) , total bilirubin 30 mol / l ( 3.420.4 mol / l ) , tba 21 mol / l ( < 6.8 mol / l ) and total protein , albumin and globulin were normal . hepatitis index studies showed hbsag(+ ) , hbsab < 0.2 iu / l ( > 10 iu / l ) , hbeab(+ ) , hbsab < hbeag( ) , hbeab(+ ) , hbcab(+ ) , hbcigm( ) , havigm( ) and hcv( ) . the afp level was significantly elevated ( 6,820 g / l , normal range < 10 type - b ultrasonic examination revealed a solid tumor ( 91 69 mm ) on the right lobe of the liver , which was suspected to be a small hepatocellular carcinoma . five - fu , oxaliplatin and thp were used as anticancer drugs . the afp level after the interventional treatment was 1,027.5 g / l , and the tumor mass decreased to 67 66 mm . the cutaneous symptoms improved significantly within 1 month ( several large nodules disappeared immediately ; later , the erythematous rash and grouped papules resolved and the patient 's arthralgia and swelling of joints gradually improved ) . skin biopsy on the right forearm showed infiltration of the dermis with polymorphic histiocytes and giant cells with the histiocytic marker cd68 was positive , as were leukocyte common antigen , hla - dr , lysozyme and vimentin ( fig . langerhans cell markers ( s-100 and cd1a ) were negative and the histological appearances were consistent with mrh .",
"mrh , often referred to as lipoid dermato - arthritis , was first reported in 1937 by weber and freudenthal . mrh is so rare that fewer than 300 cases have been reported in the literature . in 1969 , barrow and holubar first raised the question of whether there was an association between mrh and malignancy . snow and muller reported a malignancy rate of 25% in 133 cases of mrh reported in the literature until 1994 . eleven [ 6 , 7 , 8 , 9 , 10 , 11 , 12 , 13 , 14 , 15 ] of the 66 cases we reviewed ( english - language literature from 1995 until now ) had cancer and were evaluated for the following parameters : age , sex , type of neoplasm at presentation , duration preceding or following the diagnosis of cancer that mrh developed and treatment response of both the tumor and mrh . the results are presented in table 1 ( including the present case ) . for most of these cases ( including the present case ) , the onset of malignancy and mrh occurred within approximately 3 years , and in some cases , the onset of mrh also occurred in close proximity to the time of recurrence of a previously diagnosed malignancy [ 13 , 15 ] . this is the first case report of mrh with liver carcinoma . although the etiology of mrh is unknown , the possibility that mrh reflects a constellation of symptoms seen within paraneoplastic syndrome is supported by the frequency of associated neoplasm ( 18% based on our review ) , the remission of the lesions after tumor treatment ( 6 of 12 cases [ 6 , 7 , 8 , 10 , 11 , 12 ] ) and the onset of mrh just prior to the relapse of the neoplasm ( case no . 8 of table 1 ) ."
] | we report a unique case of multicentric reticulohistiocytosis ( mrh ) associated with liver carcinoma . a 61-year - old man presented with a 4-month history of nonpruritic , generalized , ruby - red papules and nodules , accompanied by fever , joint swelling and difficulty in swallowing . skin histology showed polymorphic histiocyte infiltration with typical ground glass cytoplasm . further immunohistochemical studies characterized the lesions as positive for leukocyte common antigen , hla - dr and cd68 . the patient had a history of hepatitis b , and systemic examination , including carcinoma index and type - b ultrasonic examination , revealed high levels of afp and a solid tumor , which was considered malignant , localized on the right lobe of the liver . treatment of the liver carcinoma resulted in a significant improvement of the skin symptoms . this is the first case study to report an association between mrh and liver carcinoma . a review of the english - language literature reveals the close linkage between mrh and malignancy . all patients with mrh should be evaluated and monitored carefully to determine the underlying neoplasm . |
[
"- 0194 ) , 23 patients from the department of pathology , gangnam severance hospital , were enrolled in this study . the patients ranged in age from 35 to 59 years old , with a mean age of 47 . fresh surgical samples of ptc with ( 13 cases ) or without ( 10 cases ) lt were collected from the records in the department of pathology with the patients agreement and the formal permission of the irb . the prognostic parameters ( tumor size , extra - thyroidal extension of ptc , and lymph node metastasis ) were analyzed . among the subtypes of ptc samples in this group , the nontumor portions were used for measuring the mrna quantities of the cytokines , and the ptc portions were subject to immunohistochemical staining of cip1 ( p21)/kip1 ( p27 ) for protein expression analysis , as described in more detail in later section . the nontumor portions of the patient samples were used to measure the mrna levels of the following cytokines : tumor necrosis factor ( tnf- ) , interferon ( ifn- ) , il-2 , il-4 , il-10 , and il-1. the 13 cases with concomitant ptc and lt were referred to as the objective group , and the 10 cases of ptc without lt were used as a reference or control group . quantitative real - time polymerase chain reaction ( pcr ) was performed according to the manual of lightcycler 480 real - time pcr system ( roche applied science , manheim , germany ) . the reference gene value ( actin and 18s rna ) and il-1 value were measured in every sample . although it is known to be meaningless to compare the levels of cytokines from the same specimen , the expressed cytokine levels could be ranked and compared in this research via a quantitative real - time pcr method . using the concept of relative quantification , the cytokine values were corrected for differences in quality and quantity by dividing the concentration of a target rna by the concentration of a reference rna in the same sample ( relative ratio = concentration of target / concentration of reference ) . the most common way to compare expression levels of different samples is to designate one of the samples as calibrator , where all other samples are compared to this calibrator . for normalization of the final results , the target / reference ratio of each sample is divided by the target / reference ratio of the calibrator sample : calibrator normalized ratio=(sample ; concentration of target / concentration of reference)/(calibrator ; concentration of target / concentration of reference ) . in the present work this means that the reference gene was calculated , but the target gene could not be detected despite many pcr amplification processes . in these cases , we adjusted these not detected values to zero ( 0 ) . the immunohistochemistry ( ihc ) of the p27 protein expression in the ptc tumor tissue from all 23 cases was analyzed using paraffin - embedded tissue . formalin - fixed paraffin - embedded sections ( 3 m thick ) were dewaxed in xylene and rehydrated through graded alcohols to water . antigen retrieval was performed in citrate buffer ( ph 6.0 ) within a microwave pressure cooker , and endogenous biotin detection was blocked with the avidin - biotin blocking kit ( vector laboratories inc . , burlingame , ca , usa ) . optimum primary antibody dilutions were predetermined , and appropriate positive control samples ( tissues known to be positive for the immunohistochemical marker ) and negative control samples ( test tissue sections without the addition of primary antibody ) were used for p27 ( novocastra , newcastle upon tyne , uk ) . after incubation , the slide was washed with phosphate buffered saline , and a secondary incubation was carried out with biotin anti - mouse / anti - rabbit igg followed by streptavidin - hrp ( signet pathology system , dedham , ma , usa ) for 30 minutes . when p27 immunoreaction was interpreted , only the nuclear staining on ptc cells was regarded as positive . its measurement was evaluated by the following two - tiered grading system : low grade ( negative staining or faint staining in less than 30% of the tumor cells ) and high grade ( positive staining in more than 30% of the tumor cells ) ( fig . nuclear p27 immunoreactivity was considered altered when the expression was less than 30% of previously published , clinically relevant levels . in 21 cases , the results of ihc were summarized in two groups : the cases with lt ( n=13 ) and the cases without lt ( n=8 ) . two cases were not performed , for the ihc sections for p27 were devoid of tumor tissue . the pearson chi - square test was used to examine the relationships of cytokines ( tnf- , ifn- , il-2 , il-4 , il-10 , and il-1 ) and p27 expression with the clinicopathological characteristics . all reported p - values were 2-sided , and the significance was set at .05 . all statistical tests were performed with spss ver . 17.0 ( spss inc . , chicago , il , usa ) .",
"- 0194 ) , 23 patients from the department of pathology , gangnam severance hospital , were enrolled in this study . the patients ranged in age from 35 to 59 years old , with a mean age of 47 . fresh surgical samples of ptc with ( 13 cases ) or without ( 10 cases ) lt were collected from the records in the department of pathology with the patients agreement and the formal permission of the irb . the prognostic parameters ( tumor size , extra - thyroidal extension of ptc , and lymph node metastasis ) were analyzed . among the subtypes of ptc samples in this group , the nontumor portions were used for measuring the mrna quantities of the cytokines , and the ptc portions were subject to immunohistochemical staining of cip1 ( p21)/kip1 ( p27 ) for protein expression analysis , as described in more detail in later section .",
"the nontumor portions of the patient samples were used to measure the mrna levels of the following cytokines : tumor necrosis factor ( tnf- ) , interferon ( ifn- ) , il-2 , il-4 , il-10 , and il-1. the 13 cases with concomitant ptc and lt were referred to as the objective group , and the 10 cases of ptc without lt were used as a reference or control group . quantitative real - time polymerase chain reaction ( pcr ) was performed according to the manual of lightcycler 480 real - time pcr system ( roche applied science , manheim , germany ) . the reference gene value ( actin and 18s rna ) and il-1 value were measured in every sample . although it is known to be meaningless to compare the levels of cytokines from the same specimen , the expressed cytokine levels could be ranked and compared in this research via a quantitative real - time pcr method . using the concept of relative quantification , the cytokine values were corrected for differences in quality and quantity by dividing the concentration of a target rna by the concentration of a reference rna in the same sample ( relative ratio = concentration of target / concentration of reference ) . the most common way to compare expression levels of different samples is to designate one of the samples as calibrator , where all other samples are compared to this calibrator . for normalization of the final results , the target / reference ratio of each sample is divided by the target / reference ratio of the calibrator sample : calibrator normalized ratio=(sample ; concentration of target / concentration of reference)/(calibrator ; concentration of target / concentration of reference ) . in the present work this means that the reference gene was calculated , but the target gene could not be detected despite many pcr amplification processes . in these cases",
"the immunohistochemistry ( ihc ) of the p27 protein expression in the ptc tumor tissue from all 23 cases was analyzed using paraffin - embedded tissue . formalin - fixed paraffin - embedded sections ( 3 m thick ) were dewaxed in xylene and rehydrated through graded alcohols to water . antigen retrieval was performed in citrate buffer ( ph 6.0 ) within a microwave pressure cooker , and endogenous biotin detection was blocked with the avidin - biotin blocking kit ( vector laboratories inc . , burlingame , ca , usa ) . optimum primary antibody dilutions were predetermined , and appropriate positive control samples ( tissues known to be positive for the immunohistochemical marker ) and negative control samples ( test tissue sections without the addition of primary antibody ) were used for p27 ( novocastra , newcastle upon tyne , uk ) . after incubation , the slide was washed with phosphate buffered saline , and a secondary incubation was carried out with biotin anti - mouse / anti - rabbit igg followed by streptavidin - hrp ( signet pathology system , dedham , ma , usa ) for 30 minutes . when p27 immunoreaction was interpreted , only the nuclear staining on ptc cells was regarded as positive . its measurement was evaluated by the following two - tiered grading system : low grade ( negative staining or faint staining in less than 30% of the tumor cells ) and high grade ( positive staining in more than 30% of the tumor cells ) ( fig . nuclear p27 immunoreactivity was considered altered when the expression was less than 30% of previously published , clinically relevant levels . in 21 cases , the results of ihc were summarized in two groups : the cases with lt ( n=13 ) and the cases without lt ( n=8 ) . two cases were not performed , for the ihc sections for p27 were devoid of tumor tissue .",
"the pearson chi - square test was used to examine the relationships of cytokines ( tnf- , ifn- , il-2 , il-4 , il-10 , and il-1 ) and p27 expression with the clinicopathological characteristics . all reported p - values were 2-sided , and the significance was set at .05 . all statistical tests were performed with spss ver . 17.0 ( spss inc . , chicago , il , usa ) .",
"the subtypes of the ptcs with lt were determined to be the most conventional ( 11/13 , 84.61% ) , and those of only two cases were follicular variants ( 2/13 , 15.38% ) . the tumor sizes ranged from 0.2 to 1.1 cm , with an average of 0.55 cm . of the 13 cases of this type , six cases showed extrathyroidal tumor extension ( et ) ( 6/13 , 46.15% ) , and two cases presented with lymph node metastasis ( 2/13 , 15.38 % ) . the subtypes of the ptcs with lt were all conventional ( 10/10 , 100% ) . tumor sizes ranged from 0.1 to 1.5 cm , with an average of 0.61 cm . there were three cases with lymph node metastasis ( 3/10 , 30% ) . in all 23 cases , the cytokine immune profiles were summarized into two groups : the cases with lt ( n=13 ) and the cases without lt ( n=10 ) . the cytokines could have originated from inflammatory cells , thyroid tissue , and endothelial cells . in this research , after manipulating the data using the concept of a calibrator with il-1 , each sample of ptc with lt was compared ( table 1 ) . among the six cytokines analyzed , based on these factors , the cytokine expression in the ptc samples with lt represented a mixed th1 ( tnf- and ifn- ) and th2 ( il-4 and il-10 ) immunity . after manipulating data using the concept of a calibrator with il-1 , each sample of ptc without lt in contrast to the cases of ptc with lt , the cases without lt frequently exhibited nondetectable cytokine levels . among the six cytokines analyzed , the expression levels of ifn- , il-10 , and il-2 levels were too low to be measured . based on these data , the cytokines expressed in ptc without lt represented a mixed th1 ( tnf- ) and th2 ( il-4 and il-1 ) immunity . the prognostic parameters ( tumor size , et , and lymph node metastasis ) were not statistically related to lt , but the cases without lt had a tendency for lymph node metastasis ( table 3 ) . the cases with lt had enhanced expression of the cytokines ( tnf- , ifn- , il-4 , il-10 , and il-2 ) compared to the samples of ptc without lt . among the five cytokines , the expression levels of tnf- , ifn- , and il-4 were significantly higher in the cases with lt than in those without lt ( p<.05 ) . in terms of p27 as a surrogate marker for lymph node metastasis , the degree of p27 expression was not correlated with lymph node metastasis in this study ; high - grade expression of p27 had a tendency to occur in ptc cases with lt . in contrast , lymph node metastasis occurred slightly more frequently in ptc cases without lt . conclusively , the degree of p27 expression did not show any correlation with lymph node metastasis in this study ( p=.15 ) ( table 4 ) . due to this unexpected finding , which revealed in the insufficiency of the ptc cases without lt to serve as a reference group , this study adopted a new goal to use the ptc cases with lt to analyze the relationship between cytokine immune profiles and prognostic parameters . in addition , the ptc cases in this study were mostly microcarcinomas , which might represent the incipient phase of the tumors . the incipient phase of tumors must always have a limitation in representing proper tumor staging , such as tumor size , nodal metastasis , and tumor extension . hence , in this study , p27 was used as a surrogate marker of lymph node metastasis in the cases of microcarcinoma ( as an incipient carcinoma ) . therefore , the statistical analysis of this profiles solely made use of the ptc cases with lt . except for the il-4 cytokine , the expression levels of the cytokines tnf- , ifn- , and il-10 were lower in the cases with low - grade expression of p27 than those with high - grade expression of p27 , but there was no statistical significance ( table 5 ) . the cases with et had a tendency to demonstrate higher levels of cytokine expression than those with intrathyroidal tumor confinement ( table 6 ) . again , there was no statistical significance . in summary , although the data were not statistically significant , the trends follow a pattern where higher cytokine levels were present in the cases with high grade expression of p27 ( except for il-4 ) and et .",
"the subtypes of the ptcs with lt were determined to be the most conventional ( 11/13 , 84.61% ) , and those of only two cases were follicular variants ( 2/13 , 15.38% ) . the tumor sizes ranged from 0.2 to 1.1 cm , with an average of 0.55 cm . of the 13 cases of this type , six cases showed extrathyroidal tumor extension ( et ) ( 6/13 , 46.15% ) , and two cases presented with lymph node metastasis ( 2/13 , 15.38 % ) . the subtypes of the ptcs with lt were all conventional ( 10/10 , 100% ) . tumor sizes ranged from 0.1 to 1.5 cm , with an average of 0.61 cm . there were three cases with lymph node metastasis ( 3/10 , 30% ) . in all 23 cases , the cytokine immune profiles were summarized into two groups : the cases with lt ( n=13 ) and the cases without lt ( n=10 ) . the cytokines could have originated from inflammatory cells , thyroid tissue , and endothelial cells . in this research , after manipulating the data using the concept of a calibrator with il-1 , each sample of ptc with lt was compared ( table 1 ) . among the six cytokines analyzed , based on these factors , the cytokine expression in the ptc samples with lt represented a mixed th1 ( tnf- and ifn- ) and th2 ( il-4 and il-10 ) immunity . after manipulating data using the concept of a calibrator with il-1 , each sample of ptc without lt in contrast to the cases of ptc with lt , the cases without lt frequently exhibited nondetectable cytokine levels . among the six cytokines analyzed , the expression levels of ifn- , il-10 , and il-2 levels were too low to be measured . based on these data , the cytokines expressed in ptc without lt represented a mixed th1 ( tnf- ) and th2 ( il-4 and il-1 ) immunity .",
"the subtypes of the ptcs with lt were determined to be the most conventional ( 11/13 , 84.61% ) , and those of only two cases were follicular variants ( 2/13 , 15.38% ) . the tumor sizes ranged from 0.2 to 1.1 cm , with an average of 0.55 cm . of the 13 cases of this type , six cases showed extrathyroidal tumor extension ( et ) ( 6/13 , 46.15% ) , and two cases presented with lymph node metastasis ( 2/13 , 15.38 % ) .",
"the subtypes of the ptcs with lt were all conventional ( 10/10 , 100% ) . three cases with et were present ( 3/10 , 30% ) . tumor sizes ranged from 0.1 to 1.5 cm , with an average of 0.61 cm .",
"in all 23 cases , the cytokine immune profiles were summarized into two groups : the cases with lt ( n=13 ) and the cases without lt ( n=10 ) . the cytokines could have originated from inflammatory cells , thyroid tissue , and endothelial cells . in this research ,",
"after manipulating the data using the concept of a calibrator with il-1 , each sample of ptc with lt was compared ( table 1 ) . among the six cytokines analyzed , tnf- , il-4 , and ifn- were relatively well expressed . based on these factors , the cytokine expression in the ptc samples with lt represented a mixed th1 ( tnf- and ifn- ) and th2 ( il-4 and il-10 ) immunity .",
"after manipulating data using the concept of a calibrator with il-1 , each sample of ptc without lt was compared ( table 2 ) . in contrast to the cases of ptc with lt , the cases without lt frequently exhibited nondetectable cytokine levels . among the six cytokines analyzed , the expression levels of ifn- , il-10 , and il-2 levels were too low to be measured . based on these data , the cytokines expressed in ptc without lt represented a mixed th1 ( tnf- ) and th2 ( il-4 and il-1 ) immunity .",
"the prognostic parameters ( tumor size , et , and lymph node metastasis ) were not statistically related to lt , but the cases without lt had a tendency for lymph node metastasis ( table 3 ) . the cases with lt had enhanced expression of the cytokines ( tnf- , ifn- , il-4 , il-10 , and il-2 ) compared to the samples of ptc without lt . among the five cytokines , the expression levels of tnf- , ifn- , and il-4 were significantly higher in the cases with lt than in those without lt ( p<.05 ) . in terms of p27 as a surrogate marker for lymph node metastasis , the degree of p27 expression was not correlated with lymph node metastasis in this study ; high - grade expression of p27 had a tendency to occur in ptc cases with lt . in contrast , lymph node metastasis occurred slightly more frequently in ptc cases without lt . conclusively , the degree of p27 expression did not show any correlation with lymph node metastasis in this study ( p=.15 ) ( table 4 ) .",
"due to this unexpected finding , which revealed in the insufficiency of the ptc cases without lt to serve as a reference group , this study adopted a new goal to use the ptc cases with lt to analyze the relationship between cytokine immune profiles and prognostic parameters . in addition , the ptc cases in this study were mostly microcarcinomas , which might represent the incipient phase of the tumors . the incipient phase of tumors must always have a limitation in representing proper tumor staging , such as tumor size , nodal metastasis , and tumor extension . hence , in this study , p27 was used as a surrogate marker of lymph node metastasis in the cases of microcarcinoma ( as an incipient carcinoma ) . therefore , the statistical analysis of this profiles solely made use of the ptc cases with lt . except for the il-4 cytokine , the expression levels of the cytokines tnf- , ifn- , and il-10 were lower in the cases with low - grade expression of p27 than those with high - grade expression of p27 , but there was no statistical significance ( table 5 ) . the cases with et had a tendency to demonstrate higher levels of cytokine expression than those with intrathyroidal tumor confinement ( table 6 ) . again , there was no statistical significance . in summary , although the data were not statistically significant , the trends follow a pattern where higher cytokine levels were present in the cases with high grade expression of p27 ( except for il-4 ) and et .",
"this study revealed the presence of mixed th1 ( ifn- , tnf- , and il-2 ) and th2 ( il-4 and il-10 ) immunity in lymphocytes in cases of ptc with lt . although there is no statistical significance with a limited case number , this study could infer some meaningful results . in the cases with lt , the higher expression of cytokine levels had a tendency to be associated with high p27 immuno - reactivity ( table 5 ) . furthermore , except for il-4 , all cytokines were decreased in the cases with lt and p27 underexpression , which represents the increased possibility of lymph node metastasis . because il-4 is associated with aggressive ptc , the fact that all cytokine except il-4 were highly expressed in the cases with lt and increased p27 expression supports the hypothesis that high expression of cytokines except il-4 may contribute to anticancer effect on the ptc in terms of lymph node metastasis . in contrast , the cases with et revealed the higher expression of cytokines than those without et . based on these results , we propose that the higher expression of cytokines tnf- , ifn- , il-2 , and il-1 might inhibit nodal metastasis but not inhibit ( or possibly enhance ) the extrathyroidal extension . in view of helper t cell immunity , mixed th1 and th2 immunity seems to play a role in anticancer activity by inhibiting lymph node metastasis . there have been several studies on the immune profiles of thyroiditis . among them , phenekos et al . reported that ht and graves disease have two different helper t cell immunities . in their report , with the preferential expression of il-2 , ifn- , il-12 , and il-18 , a th1 pattern of immune response which is characteristic of cellular immunity , is dominant in ht . in contrast , ajjan et al . reported a mixed th1 and th2 immune response in ht cases . they reported that reverse transcription polymerase chain reaction results showed both th1 and th2 immunity . our findings demonstrated that il-4 expression , together with other cytokines , has a tendency to be higher in the cases with et . in contrast , in the cases with underexpression of p27 , which may represent lymph node metastasis , il-4 was higher than other cytokines . this may imply that il-4 contributes to the lymphatic spread of the tumor , a concept that is supported by vella et al . who demonstrated that il-4 levels were augmented in aggressive ptcs . they suggested that ptc cells receive protection from apoptosis by il-4 production in the activated t lymphocytes of thyroid glands . to determine which of these conflicting results in terms of both nodal metastasis and capsular tumor extension are correct , further study may be necessary to disclose the role of il-4 in ptc biological behavior . a previous work by yip et al . demonstrated with in vitro tests that il-1 was an anticancer factor , which suppressed the proliferation and reduced the invasive potential of human ptc cells . in this study , il-1 was found to be constitutively expressed in all cases and was used as a calibrator to compare cytokine levels among the cases . unfortunately , due to its use as a calibrator in this study , il-1 expression levels in each case could not be compared . it is generally accepted that there is a beneficial relationship between chronic lt and the biological behavior of ptc , which results in improved prognoses . paulson et al . suggested that chronic lt might have a protective role in tumor spread . supporting this evidence , mitsiades et al . reported that th1 cytokines , such as ifn- and tnf- , increase the sensitivity of both normal and neoplastic thyrocytes to fasl and trail , which lead to apoptosis . established that ht was associated with ptc , as was chronic inflammation with cancer in other locations . they also mentioned that the coexistence of ht in ptc cases introduced favorable clinical outcomes compared with those of ptc without ht . determined that patients with ptc and chronic lt had smaller tumor sizes , a lower incidence of capsular invasion , and a significantly lower incidence of lymph node metastases compared to patients without chronic lt . several studies have also indicated that antithyroid antibodies are able to recognize these malignant cells and destroy them in the same way that they destroy normal follicular cells , contributing to the low rate of clinical progression of these lesions . the p27 protein was first identified as an inhibitor of cyclin e / cdk2 complexes during transforming growth factor induced g1 arrest . the inhibitory roles of p27 towards cyclin / cdk complexes are weakened by phosphorylation directed by certain signal transduction pathways . the current model delineates that p27 suppresses tumorigenesis by inhibiting cyclin / cdk activity in the nucleus , but it exerts other functions in the cytoplasm that are potentially oncogenic . there have been several clinical studies describing the relationship between the expression of p27 and lymph node metastasis . reported that p27 expression in nonmetastasizing ptc was lower than that in normal thyroid tissue and higher than that in metastasizing ptc . our ihc analysis showed that p27 expression did not demonstrate any relationship to lymph node metastasis in ptc with lt , but this may be attributed to the early stage of the tumors , i.e. , our study mainly included patients with microcarcinomas . there may be a chance that even ptc cases with low expression of p27 were too incipient to reveal lymph node metastasis . with this limitation in the evaluation of the relationship between cytokine levels and nodal metastasis , the common p27 marker was used as a surrogate marker to represent the possibility of nodal metastasis in early phase ptcs . as aforementioned , after focusing on the cases with lt , the cases with low - grade expression of p27 tended to be associated with lower levels of cytokines than those with high - grade expression of p27 . this may implicate that the cases with lower levels of mixed th1 and th2 cytokines have a higher probability of having lymph node metastasis . considering the low cytokine expression in the cases with underexpression of p27 ( except for il-4 ) , our results indicate that mixed th1 and th2 immune cytokines have a tendency toward anticancer effects in terms of lymph node metastasis . to predict tumor prognosis from cytokine levels"
] | backgroundpapillary thyroid carcinoma ( ptc ) is frequently accompanied by lymphocytic thyroiditis ( lt ) . some reports claim that hashimoto s thyroiditis ( the clinical form of lt ) enhances the likelihood of ptc ; however , others suggest that lt has antitumor activity . this study was aimed to find out the relationship between the patterns of helper t cell ( th ) cytokines in thyroid tissue of ptc with or without lt and the clinicopathological manifestation of ptc . methodsfresh surgical samples of ptc with ( 13 cases ) or without ( 10 cases ) lt were used . the prognostic parameters ( tumor size , extra - thyroidal extension of ptc , and lymph node metastasis ) were analyzed . the mrna levels of two subtypes of th cytokines , th1 ( tumor necrosis factor [ tnf- ] , interferon [ ifn- ] , and interleukin [ il ] 2 ) and th2 ( il-4 and il-10 ) , were analyzed . because most ptc cases were microcarcinomas and recent cases without clinical follow - up , negative or faint p27 immunoreactivity was used as a surrogate marker for lymph node metastasis . resultsptc with lt cases showed significantly higher expression of tnf- ( p = .043 ) , ifn- ( p < .010 ) , il-4 ( p = .015 ) than those without lt cases . although the data were not statistically significant , all analyzed cytokines ( except for il-4 ) were highly expressed in the cases with higher expression of p27 surrogate marker . conclusionsthese results indicate that mixed th1 ( tnf- , ifn- , and il-2 ) and th2 ( il-10 ) immunity might play a role in the antitumor effect in terms of lymph node metastasis . |
[
"an 83-year - old woman presented with sudden visual loss that had developed in both eyes ( oculus uterque , ou ) the previous day . she did not complain of any associated headache , scalp tenderness , jaw claudication or constitutional symptoms such as weight loss , fever , malaise or sweats . her visual acuities included perception of light in the right eye ( oculus dexter , od ) and perception of hand motion in the left eye ( oculus sinister , os ) . fundus examination revealed mild retinal arterial narrowing and chalky - white disc swelling ou ( fig . the results of the hardy - rand - rittler test and ishihara test showed total dyschromatopsia ou . although electroretinography findings were within normal limits , visual evoked potentials showed delayed p100 latency ou . brain magnetic resonance imaging scans and angiography results showed diffuse bilateral stenosis of vertebral arteries and external carotid arteries without significant intracranial vessels stenosis . the crp level , esr and platelet count were elevated and measured to be 5 mg / dl ( upper normal limit , 0.5 mg / dl ) , 55 mm / h ( upper normal limit , 20 mm / h ) , and 510 k/l ( upper normal limit , 400 k/l ) , respectively . following a presumptive diagnosis of silent gca - associated aaion ou , the patient was hospitalized and treated with intravenous 250 mg methylprednisolone every 6 hours for 3 days . biopsy of the left temporal artery was performed , and 3 cm of the temporal artery was acquired . lymphocytes , epithelioid histiocytes , and multinucleated giant cells had diffusely infiltrated into the entire vessel wall , especially in the arterial wall media ( fig . after 7 days , the patient 's visual acuity os improved slightly to being able to count fingers . the crp level and esr decreased to 1.07 mg / dl and 30 mm / h , respectively . oral prednisolone therapy was slowly tapered down from 60 mg per day , and steroid treatment was maintained with deflazacort 30 mg per day . however , after 4 months , the patient 's visual acuities deteriorated to no light perception od and light perception os .",
"gca should be strongly suspected when patients greater than 50 years of age present with headaches . the incidence of gca in scandivian countries and north america ranges between 6.9 and 32.8 per 100,000 . however , the occurrence of gca is rare in african americans , hispanics , and asians [ 8 - 10 ] . there have only been a few reports of gca among asians [ 5,6,11 - 15 ] . in japan , a nationwide gca survey revealed an extremely low prevalence of 1.47 per 100,000 population , which is approximately 1 / 140 of that reported in the us . pereira et al . reported that gca was seen 20 times less frequently in asians than in caucasians . . stated that , for over a period of 22 years , only 7 patients were diagnosed with gca by temporal artery biopsy in a tertiary medical center in saudi arabia . the incidence of gca in asians was far lower than that in caucasians ; however , the incidence is now increasing in the asian population . after 36 years of no reported cases of gca , in 2010 , aui - aree et al . reported 4 gca cases in thailand . cullen et al . noted that of the 7 biopsy - confirmed gca cases reported over the past 10 years in singapore , 3 were reported in 2009 . this trend may be associated with an increase in the maximum life span of the asian population . suspected diagnosis of gca by rheumatologists and ophthalmologists , along with extensive laboratory tests , may be other important factors . however , a nation - wide epidemiologic study would be needed to clarify the association of life span and gca incidence in asians . in korea , only a few biopsy - confirmed gca cases have been reported ; however , there have been no gca - associated aaion cases so far . to our knowledge , this is the first biopsy - confirmed report of gca - associated aaion in korea . our patient was diagnosed with silent gca , and the clinical features overlapped with non - arteritic aion . when asian patients aged > 50 years present with acute visual loss and disc swelling and no other symptom , non - arteritic aion accounts for more than 90% of these cases . in such circumstances , laboratory parameters , such as esr , crp level and platelet count can serve as indicators in the diagnosis of gca . reported that the crp level has a sensitivity of 100% for gca , and the combination of crp level and esr has a specificity of 97% . in a large population - based cross - sectional study , documented that the odds of a positive biopsy were 1.5 times greater with an esr of 47 to 100 mm / h , 5.3 times greater with a crp of > 2.45 mg / dl , and 4.2 times greater with a platelet count of > 400,000 l . the above 3 parameters were elevated in our patient ( crp , 5 mg / dl ; esr , 55 mm / h ; and platelet count , 510 k/l ) . these test results are known to be normal in non - arteritic aion . in conclusion , although this disease is rare in asians , gca - associated aaion should be considered when an elderly patient presents with sudden visual loss and disc edema . gca should be suspected and laboratory tests should be performed , even in the absence of typical symptoms ."
] | giant cell arteritis ( gca ) is a rare disease among asians . arteritic anterior ischemic optic neuropathy , which accompanies gca , has not yet been reported in koreans . diagnosis of gca is difficult if typical symptoms other than visual loss are absent . here , we report a case of an 83-year - old korean woman presenting with sudden visual loss in both eyes ( oculus uterque , ou ) . her visual acuities included perception of light in the right eye ( oculus dexter , od ) and perception of hand motion in the left eye ( oculus sinister , os ) . the results of the hardy - rand - rittler test and ishihara test showed total dyschromatopsia ou . the goldmann perimetry test revealed a total field defect od and paracentral island os . fundus examination revealed chalky - white disc swelling ou . other systemic symptoms and signs were unremarkable . the erythrocyte sedimentation rate , c - reactive protein and platelet count were highly elevated . temporal artery biopsy revealed multiple lymphocytes and multinucleated giant cells in the arterial media layer . to our knowledge , this is the first report of gca in a korean that has been confirmed with temporal artery biopsy . in conclusion , silent gca can occur in koreans , and hence , elderly patients presenting with chalky - white disc swelling , and corresponding laboratory findings must be evaluated for gca . |
[
"the \n largest uncertainty in the influence of aerosol particles and \n clouds on the climate system is caused by aerosol cloud microphysics determine cloud albedo in \n the visible and infrared ( ir ) spectral ranges , cloud lifetime , and \n precipitation properties . cloud radiative \n properties are strongly linked to the microphysical state of clouds \n such as number concentration and size of liquid droplets and ice crystals . aerosol particles can act as cloud condensation nuclei ( ccn ) and \n as ice nuclei ( in ) influencing the aggregation state and the microphysical \n properties of cloud particles . knowledge on the glaciation of clouds \n is essential to estimate cloud radiative forcing on the climate system . in the atmosphere ice crystals form through heterogeneous \n and homogeneous \n ice nucleation . at temperatures below 235 k homogeneous nucleation \n takes place , whereas at higher temperatures ice does not form spontaneously . in this temperature range ice nucleation occurs \n heterogeneously ; i.e. , it is triggered by the presence of aerosol \n particles providing foreign surfaces that reduce the energy barrier \n for nucleation . several mechanisms are known by which aerosol \n particles catalyze \n the formation of the ice phase in clouds : deposition , condensation , \n contact , and immersion freezing . the deposition \n mode involves the growth of ice directly from the vapor phase , whereas \n condensation freezing occurs if the ice phase is formed immediately \n after condensation of water vapor on a solid particle as liquid intermediate . \n if an in has already been immersed in a droplet and causes freezing , \n the process is termed immersion freezing . contact freezing happens \n if a supercooled droplet freezes at the moment of contact with an \n in . in mixed - phase ( liquid and ice ) and cirrus clouds the dominant \n nucleation mechanism is suspected to be immersion or contact freezing , \n and to a lesser extent deposition nucleation . the ice nucleating ability of an aerosol particle in each of the \n four modes at fixed temperature and humidity conditions depends on \n its physicochemical properties , e.g. , surface structure , size , and/or \n chemical composition . although several requirements for an effective \n in have already \n been proposed decades ago , the exact mechanisms of nucleation are \n still not adequately understood . it is \n known that the ice nucleation efficiency of a particle is not necessarily \n determined by the entire particle but by so - called active sites on \n the particle s surface . however , information on the nature \n and location of active sites is still limited and a prediction of \n the ice nucleation efficiency of a particle based on its physicochemical \n properties is not yet possible . atmospheric mineral particles \n originate from arid regions such as deserts , from volcanic eruptions \n and from soil due to agricultural use . they are released into the \n air by the action of wind and are omnipresent in our atmosphere . recent studies confirm the importance \n of mineral dust particles \n for ice cloud formation . aerosol mass spectrometry suggested that \n 50% of the material in ice crystal residues in clouds over wyoming \n was composed of mineral dusts . another \n in situ study analyzed the residual particles within cirrus ice crystals \n and found an enrichment of mineral dust particles of 61% compared \n to their near - cloud abundance . natural dust particles rarely consist of pure mineral phases but \n are internal mixtures of diverse mineral components covered with other \n inorganic , organic , and/or biological substances . the main mineral \n dust particles found in the atmosphere are clays ( kaolinite , illite , \n montmorillonite ) , quartz , feldspars , and calcite . within the \n last years , extensive efforts have been made to better \n understand and predict the role of mineral dusts in the formation \n of atmospheric ice clouds . several laboratory studies on the ice nucleation \n activity ( ina ) of mineral dust particles have been performed by many \n groups . because different measurement techniques are applied , the \n comparison of the results is often challenging . an extensive comparison and overview of the studies on \n mineral dusts was given in recent years . most \n studies focused on clay minerals with kaolinite being the \n clay mineral studied most intensively . in all studies kaolinite shows \n ina in immersion freezing mode above 243 k. in a study of all common \n clay materials using the same method , illite was found to be the most \n active in followed by kaolinite and montmorillonite . the study by zimmermann et al . gives \n a good comparison between the ina of different minerals in the deposition \n mode . the ina of closely related materials , like the feldspars , was \n rather different . in fact , microcline ( k - feldspar ) needed the lowest \n supersaturation at 261 k to initiate ice formation ( i.e. , in activation ) . \n the species active at the lowest supersaturation were kaolinite , illite , \n hematite , and microcline . kaolinite and muscovite \n were found to be active at lower supersaturations and were therefore \n considered rather efficient in , whereas quartz and calcite were poor \n in . montmorillonite was found a good in below a temperature around \n 241 k. most of the laboratory studies on mineral dust either \n focused on \n clay minerals that are often obtained from natural samples or on purely \n natural dusts . concerning natural dusts , arizona test dust ( atd ) is \n the most widely used proxy within the field . initial freezing is reported \n around 249 k. another natural dust sample \n frequently studied is volcanic ash . many of these \n natural dusts are mixtures of different clays , quartz , and feldspars \n with varying composition . recently atkinson et al . performed \n the first comparative study on ice nucleation in the immersion mode \n looking not only at single minerals from the clay group but also at \n k - feldspar , na / ca - feldspar , quartz , and calcite as well . almost simultaneously \n yakobi - hanock et al . conducted a similar \n study on ice nucleation of 24 mineral samples in the deposition mode . \n both studies find the ice nucleating ability of k - feldspar exceptionally \n high compared to other minerals . in the immersion mode k - feldspar \n already nucleates ice at temperatures of 250.5 k whereas for the other \n minerals only lower nucleation temperatures were found . only recently was the ina of k - feldspar found \n to be even better than that of na / ca - feldspar ( 247 k ) . conclude that k - feldspar is the key \n component determining the ina of atmospheric mineral dusts . as already mentioned , the majority of the studies concentrated \n on the experimental description of the ice nucleation behavior of \n mineral dusts . in case of immersion freezing initial and/or median \n freezing temperatures are reported for a vast set of atmospherically \n relevant minerals . where the authors relate the ina of the different \n minerals to their particular surface charges . for example , they suggest \n that the in properties of clays , especially of the ice active kaolinite , \n might be due to electrostatic interactions between their charged surfaces , \n counterions and the polar water molecule . minerals with such ionic \n surfaces are believed to promote ice nucleation , as they are more \n likely to form hydrogen bonds with water molecules . shen et al . found fluorine mica as an example of extremely \n high ina . overall , \n a fundamental understanding of the heterogeneous ice nucleation \n on mineral dusts is still missing . for example , the nature of active \n sites is a matter of speculation only . the goal of our study \n was to investigate the ina of selected mineral \n particles as well as their chemical nature to identify possible characteristics \n of active sites . we performed experiments with the oil - immersion freezing \n method with pure and pretreated ( heated , enzymatic pretreated , milled ) \n dust particles . in addition , we characterized the particles with field \n emission gun scanning electron microscopy ( feg - sem ) and tunneling \n electron microscopy ( tem ) , energy - dispersive x - ray spectroscopy ( edx ) , \n x - ray powder diffraction ( xrd ) , and attenuated total reflection fourier \n transform infrared spectroscopy ( atr - ftir ) . combining these data we \n propose a possible explanation why specific minerals , in particular \n k - feldspars , are good in , whereas others are not . on the basis of \n the experiments , we propose a first interpretation of the nature of \n active sites .",
"oil - immersion \n freezing experiments under a cryomicroscope were \n carried out to test the ina of different mineral dust samples . in \n addition , the particles were characterized regarding their surface \n and bulk properties by the following set - ups . nucleation properties of the samples \n were obtained with an optical microscope and a homemade cryocell . \n the experimental setup has already been used in former studies , and \n a detailed description can be found elsewhere . here , only a short description of the principle is given . the core of the experiment is a thermoregulated cryocell consisting \n of a peltier element in a teflon box . the cryocell that has a glass \n window on top is placed on an olympus bx51 optical microscope desk \n below the objective . the mineral dust samples were studied in the oil - immersion \n mode : \n a drop of an oil matrix ( 8085 wt % paraffin , 1520 \n wt % lanolin ) with dispersed small water droplets ( 1040 m ) \n containing mineral dust particles was put on a glass slide and placed \n on the peltier stage . the peltier element was then chilled at a constant \n cooling rate , until all visible droplets were frozen . in earlier measurements , \n no influence of the cooling rate ( 0.110 k / min ) on the median \n freezing temperature was found within the uncertainty of the method , \n which is about 1 k ( see supporting information ) . whenever freezing of droplets was observed , a picture was taken \n and the respective temperature was recorded . frozen droplets can be \n easily distinguished from liquid ones as they appear dark due to increased \n light scattering and contain visible internal structures , such as \n edges or cubes . finally , each picture was analyzed to determine \n the fraction of \n frozen droplets , which was then plotted against temperature to obtain \n a nucleation curve characteristic for a specific sample . to compare \n different nucleation curves , we determined the median freezing temperature , t50 , which is the temperature where 50% of all \n droplets in the picture are frozen . this value is more reliable than \n the initial freezing temperature , which is the temperature where the \n first droplet freezes , because the latter may be influenced by statistical \n variations and is less reproducible . sem and tem measurements were performed \n at the ustem at the vienna university of technology . for sem , the \n milled mineral dust samples were put on a graphite plate and coated \n with 4 nm of au / pd alloy by sputtering ( program : 30s , 15 ma ) . the powder is placed on a steel sample holder and then inserted into \n an x - ray diffractometer ( panalyticalxpert pro ; bragg the 2 angle was varied between 5 and 120. \n as x - ray source , the cu k line was used in all the experiments \n ( 0.154 44 nm ) . all samples were used without further treatment \n prior to the xrd experiments except milling . the measuring time varied \n between 1 h for the single mineral samples and 3 h for the natural \n samples . the ftir study of the mineral samples \n was taken on a bruker vector 22 . at least 1000 scans were collected per sample to get a sufficient \n signal - to - noise ratio at 4 cm spectral resolution . the surface areas of the quartz \n and montmorillonite samples were measured using a commercial liquid \n nitrogen adsorption system ( asap2020 , micromeritics ) . data evaluation \n was based on the model by brunauer , emmett , and teller ( bet ) . the surface areas of the other mineral dust \n samples could not be measured as too little material was available . \n the geometrical surface area of those minerals was estimated on the \n basis of the sem images . in total the ina \n of 13 different mineral dust samples was investigated with the cryomicroscope . \n the studied samples are calcite , gypsum , three different quartz samples \n ( quartz i , quartz ii , quartz iii ) , microcline , albite , andesine , arizona \n test dust ( atd ) , montmorillonite , kaolinite , limestone , and volcanic \n ash ( table 1 ) . the ina of the mineral dust particles was investigated \n with pure \n ( as purchased ) and freshly milled , heat - treated , and enzyme - treated \n particles . three sets of experiments were performed with pretreated \n samples : first , the minerals were milled to initial sizes between \n 1 and \n 10 m with an agate mortar or a swing mill ( retsch mm400 ) . suspensions \n of mineral dust particles in milli - q water with concentrations of \n 20 and 50 mg / ml were prepared and then mixed with oil to obtain an \n emulsion . the water droplets in the emulsion were 1040 m \n in size and contained around 110 particles at a concentration \n of 20 mg / ml and about twice as much at concentrations of 50 mg / ml . \n second , the most ice \n nucleation active samples were selected and \n heated at 523 k for 45 h. in addition , the feldspars and quartz \n i were also heated at 373 and 773 k to control for surface alteration \n with temperature and to remove possible organic impurities , which \n are known to promote ice nucleation in some cases , and to ensure that \n the ina is only related to the mineral phases . for all temperature - treated particles the ina was determined \n before and after the heat treatment . third , selected samples \n were treated with enzymes to exclude the \n possibility that their ina is due to adsorbed biological impurities , \n and to specifically block nucleation sites . for observing the impact of specific blocking , it was important \n to select a submolecular coverage of the mineral surface . otherwise , \n the effect would not be related to the sites but would be due to the \n entire coverage only . as enzymes we used papain ( 2 mg / ml ) , pronase \n e ( 5 mg / ml ) , cellulose onozuka ( 5 mg / ml ) , and lipase ( 2 mg / ml ) , which \n break down proteins , polysaccharides , or lipids . three different enzymatic \n treatment experiments were performed . after each step ice nucleation \n measurements were performed : ( a ) first , each enzyme was added to separate \n suspensions of pure milli - q water and mineral dust particles and left \n for 35 h at incubation temperatures of 308 k ( lipase ) , 310 \n k ( pronase e , onozucka ) and 340 k ( papain ) , ( b ) second , the enzymes \n were added all at once to the suspensions and the samples were left \n in incubation in total for 5 h increasing the temperature stepwise , \n respectively , and ( c ) in the last step , the enzymes were added and \n nucleation measurements were conducted immediately without incubation .",
"in total , the ina of 13 mineral dust samples was \n investigated with \n the cryo - microscope ( table 1 and supporting information ) . the most active species with t50 values > 247 k are quartz i , microcline , \n atd , \n and kaolinite . all other samples had much lower t50 values ( < 242 k ) , but they were still higher than \n those for pure water , indicating that the nucleation activation barrier \n was still slightly reduced by the mineral dust particles . the minerals are grouped into nonsilicates , quartz , feldspar , \n clays , and natural samples . the most active dusts are quartz , microcline \n ( k - feldspar ) , atd , and kaolinite . three different feldspar \n samples were tested : albite ( na - feldspar ) , microcline ( k - feldspar ) , \n and andesine ( na / ca - feldspar ) . considerable differences in ina among \n the feldspars were found : microcline had a t50 value of 249 k , whereas the t50 values for andesine and albite were much lower : 240 and 239 k , respectively . \n to explain these differences the chemical bulk composition was analyzed \n with xrd and edx . the surface structure of microcline is rougher than that of albite , \n but no significant difference in the morphology of the samples could \n be identified . these impurities appear on some albite grains , whereas \n over 70% are highly pure albite . edx mapping over cracks did not reveal \n any migration of particular atoms to these sites . because the penetration \n depth of x - rays and the exciting electrons is larger than a few hundred \n nanometers , these analytical methods are not surface the microcline \n sample is crystalline and almost pure , except for the above - mentioned \n albite content . macroscopic defects \n observed in the microcline sample are as common as in albite and can \n therefore not explain the difference in the ina observed among the \n feldspars . the t50 for the most ice active quartz i sample was \n 249 k. the quartz ii and the quartz iii samples had t50 values of 239 and 235 k , respectively . the sem \n images of the quartz samples revealed that the quartz i sample ( figure 2a ) contained the largest fraction of particles with \n diameters below 1 m followed by quartz ii and quartz iii ( figure 2b , c ) . the diffractograms of all three tested -quartzes \n show that no other phase was present . the bet surface area of \n quartz i sample was 5.5 m / g . \n quartz ii had specific bet area of 2.0 m / g and quartz \n iii 0.5 m / g ( all measured before the initial freezing \n experiment , i.e. , prior to further milling ) . quartz i is shown in the top left image ( a ) , quartz ii at top right \n ( b ) , and quartz iii below ( c ) . gypsum and calcite became active \n in at low temperatures with t50 values \n of 239 and 237 k , respectively . the gypsum sample contained around \n 4% of caso40.5h2o , with the rest being \n pure caso42h2o ( gypsum ) , given by xrd \n quantification . montmorillonite had a t50 of 240 k. a determination of the exact mineral composition is difficult \n as the layered structure of montmorillonite is not directly observable \n in powder xrd . by this method the exact quantity of those two components in montmorillonite is unknown , \n but we expect less than 10% each . the atd sample \n had much smaller particle sizes than the other samples , with hardly \n any particles larger than 5 m . its composition ( based on powder \n xrd phase analysis and sem - edx ) was 1520% microcline , 1520% \n na / ca - feldspar , and 5060% quartz . minor components were quartz , other feldspars , titanium \n iron oxide , and aluminum oxides . the volcanic ash was almost inactive \n with a t50 of 238 k , but due to the k - feldspar \n content the initial freezing temperature was much higher ( figure s1 , supporting information ) . the natural kaolinite \n used in this study was no single mineral component sample , as it contained \n also quartz , muscovite , and halloysite . natural limestone showed \n the same ina as technical calcite with a t50 of 237 k , and it consisted only of calcite mineral on the basis \n of the xrd and ftir analysis . additional milling of the microcline \n sample increased the t50 marginally ( from \n 249 to 250 k ) . heat treatment of this sample reduces the activity \n again , leading to the normal median freezing range 249250 \n k. for albite , milling had no effect on the t50 , but the initial freezing temperature increased significantly \n as the albite sample contains some ( < 1% ) k - feldspar and more k - feldspar \n surface became available during milling . additional milling of both less \n active quartz samples ( quartz ii and iii ) increased their t50 values : after 4 min of milling in the metal \n swing mill the t50 values of the samples \n both changed to 241 k and after 2 min milling time an increase by \n up to 5 k was visible , whereas the activity of the quartz i sample \n did not further increase . the initial freezing temperatures of the \n samples quartz ii and iii increased from 242 to 246 k , respectively \n the surface areas of both \n minerals were about 3 m / g after milling . the absolute \n number of active surface nucleation site density ns was calculated using the relation given in eq 1 , where fice is the frozen \n fraction at the given temperature t and s is the particle surface per droplet obtained directly from bet specific \n surface area.1 active surface site density depending on temperature plotted \n for \n all quartz samples . quartz i shows the highest \n surface site density , and the original quartz iii sample shows almost \n no ina . quartz ii and iii where milled for 4 min , resulting in a drastic \n ina increase for quartz iii . nevertheless , within the \n measurement uncertainty the t50 change \n only marginally by heat treatments . temperature treatment of the quartz \n and the kaolinite samples did not show any significant change in freezing \n behavior . except for the particles \n treated with cellulose onozuka , the freezing curves of microcline \n changed drastically after enzymatic treatment . the t50 of the enzyme - treated microcline sample shifted to \n lower temperatures ( 240 k for microcline and 246 k for fine milled \n microcline ) compared to the pure microcline sample ( 249 k/250 k ) ( table \n s1 , supporting information ) . after \n heating the enzyme - treated microcline samples to 773 k , the t50 values returned almost to their initial values \n ( t50 after enzymes and heating : 248 k ) . \n the particles mixed with enzymes at low temperatures and direct freezing \n measurements resulted in the same t50 values \n as the enzyme - treated samples with incubation . for albite the \n same procedure was applied and no distinct loss \n in ina was observed . in addition , heat and enzyme treatment resulted \n in no freezing behavior change . a clear loss of ina could \n be observed for quartz i after the sample was treated with enzymes . \n although for treatment with papain the activity was almost unchanged , \n a treatment with lipase and pronase e clearly shifted the freezing \n curves to lower temperature values ( papain , 249 k ; pronase e , 247 \n k ; lipase , 247 k ) . when all enzymes were applied together , t50 was 244 k. the activity was always restored \n to the original level after 4 h heating at 773 k.",
"there is still no molecular description of the exact nature of \n nucleation sites on mineral dust particles in the literature . adsorption \n of water through surface oh groups of the silica is reported , which is in agreement with later studies on \n kaolinite . surface amphotericity and \n size matching between the ice structure and the solid surface has \n a strong influence on ina . obviously , it is not the perfect quartz \n surface itself that nucleates ice at a higher temperature ( see the \n low in activity of the coarse quartz iii ) , but rather local defects , \n which would support the concept of active sites . those defects may \n be atomic lattice distortions caused by impurities , leading to a better \n structure matching between the ice and the particle surface , or crystallographic \n dislocations . on the basis of the experiments , we suggest that the \n defect density is different in the three quartz samples , and that \n it is increased by mechanical milling , which is known to generate \n nucleation sites . this would explain \n the reported variations of ina , which range from quartz with t50 = 243 k being the second best in after the \n feldspars to studies finding quartz one \n of the worst in together with most oxides . the minerals investigated in this study exhibit median freezing \n temperature ( t50 ) values varying over \n a range of 13 k between the most ( atd , 250 k ) and least ( calcite , \n 237 k ) potent in ( figure 1 ) . structural analysis \n showed that there is no direct correlation of the ina with the crystal \n structure of the minerals . this is especially true for the feldspar \n group that showed considerable differences in their ina . milling of \n the samples increased the ina , which indicates that the freshly produced \n surfaces provide nucleation active sites that are not accessible otherwise . \n suppressing ina \n with specific enzymes with particular chemical functionalities , which \n can interact with possible surface functional groups on the minerals , \n was successful in several cases . subsequent heat treatment to remove \n the enzymes from the surface resulted in a reactivation of the nucleation \n activity of the respective mineral . all these experiments point \n to the crucial importance of the mineral \n surface itself and the involvement of the surface chemistry of these \n particles , as there is no spectroscopic evidence for any particularity \n to distinguish active surface sites of different quality . the ice nucleation \n property of specific quartz samples is not a result of their perfect \n quartz structure , but rather of local defects acting as nucleation \n sites . it is still not possible to study these sites directly with conventional \n methods , but some conclusions can be taken from the immersion freezing \n experiments carried out in this study . as the silanol groups thought \n to play an important role in the ice nucleation process are present in almost all silicates that show \n different t50 values in aqueous immersion , \n they alone do not act as good in . ice nucleation is rather a complex \n interplay between the forming ice structure and the local surface \n structure of the mineral particle and therefore the arrangement of \n the functional groups ( on the surface ) . the local electronic configuration , \n as well as distance and arrangement of functional groups influence \n the capability of a particle to act as good in . possible functional \n groups are metal - hydroxyl , fluorine , or ionic oxygen species . the functional groups need to be able to act \n as a hydrogen bond donor and/or acceptor . a certain particle surface \n is able to act as in , if the functional groups are arranged properly . \n here , we define a molecular site analogous to ( molecular ) catalysis \n as an arrangement of functional groups able to stabilize water molecules \n in an ice - like structure . a single molecular site may stabilize ice \n embryos , but to form a good nucleation site , a larger area with domains \n of molecular sites is needed . these domains nucleate ice at a given \n temperature , if the stabilized ice cluster is almost as large as the \n critical ice cluster at this temperature . the molecular sites are \n of different composition , size , and concentration on different minerals \n and samples . the assumption of specific molecular sites is based on \n the fact that with only partial surface coverage with enzymes the \n ina is lowered , but not totally lost . in addition , the ina of the \n mineral particles can be increased by increasing the available surface \n area . the higher ina of quartz i is attributed to an increased concentration \n of functional groups by the manufacturing ( milling ) process . for example , \n quartz iii froze almost heterogeneously before milling , whereas introducing \n further defects ( by milling ) increased the activity more than would \n be expected by just increasing the specific surface area . molecular \n sites are of different form and surface density on mineral dust particles . \n we assume that the domains of arranged molecular sites conform to \n a material specific distribution with larger domains , resulting in \n larger stabilized ice clusters and higher nucleation temperatures \n being less frequent . with this idea it is possible to explain the \n increase in nucleation temperatures with increasing surface area . the feldspar family has \n higher t50 values than the quartz sample \n of comparable surface area in agreement with atkinson et al . and yakobi - hancock et al . the structure of feldspars is \n closely related to quartz , but si is partly substituted by al . the \n sio4/alo4 tetrahedra in feldspar are slightly tilted due to the charge compensating \n cations ; surface distortions from the \n basic quartz structure may even be larger and defects ( in particular \n ionic defects ) are much more common , so more frequent molecular sites \n are expected for feldspars . nevertheless , the feldspars have \n quite large differences in t50 values \n with microcline being active at a much higher temperature in this \n study and in the study by atkinson et al . the latest studies showed also good ice nucleation activities in the deposition \n mode for the orthoclase phase of k - feldspar , so the increased activity \n of k - feldspar need not be phase specific . the sem images of the feldspar \n samples are quite similar and a morphological difference can not explain \n the different ice nucleation behavior . on the basis of the tem - edx \n measurements , if ice nucleation occurs at macroscopic defect sites \n such as cracks , it is not due to a local element accumulation , but \n rather to the steric configuration there . extrinsic ina by organic \n adsorbates on microcline or its inhibition \n on the plagioclases can be excluded on the basis of the enzymatic \n and temperature treatment experiments . the inhibition of ice nucleation \n sites by enzymes may be understood as steric hindrance or blocking \n of the site . further experiments revealed that the loss of ina is \n a result of a reversible active site hindrance / blocking and not a \n destruction , as the initial activity was regained after enzyme removal . \n our results indicate that the higher ina of the k - feldspar sample \n is an intrinsic property and not a result of adsorbed organic / biological \n material . the investigated feldspars have different counter \n cations with different ionic radii ( rk > rna rca ) . in addition the plagioclases ( na / ca - feldspars ) have a higher al / si \n ordering than the k - feldspars . the measurements leave only the \n conclusion that the difference \n in the ina of the feldspars is a result of the difference in ionic \n radius of the cations and therefore the local chemical configuration \n at the surface . the surface cations released into the surface bilayer \n may interact with water to enhance / inhibit ice formation . the resulting \n depletion of cations in the outermost layer may be different for each cation due to the differences in ionic \n radii . the ion charge density of the cations of the mineral was already \n suggested to influence ice nucleation on mineral surfaces . the cations around the surface have different \n affinity to water molecules and potential bonds are of different strength . \n surface calcium ions on calcite are known to bind the water quite \n tightly and thus inhibit ice nucleation by fixing the water molecules \n in ice structure mismatching locations . the difference in ina of microcline and the plagioclases may also \n be a result of the more random cation / aluminum distribution in the \n k - feldspars compared to the na / ca feldspars . the tendency of the surface to interact with water \n molecules is increased by this process as dangling bonds remain at \n the surface . the hydration shells of ca , na , and \n k ions have different sizes and shapes . ca and na belong to the chaotrope family ( structure breaking \n ions ) whereas k is a kosmotrope ( structure making ion ) . small ions with high charge density are considered to be chaotrope \n and have a strong interaction with water water \n hydrogen bonds are broken to form the hydration shells with larger \n residence times of water molecules compared to the shells of kosmotropic \n ions . these strong chaotrope - water interactions inhibit an ice - like \n structuring of water molecules in the vicinity of the ions . kosmotropes \n like k on the other hand have a weaker interaction with \n water than the intermolecular water water interaction . the \n k ions form hydration shells , but the water molecules \n are bonded more weakly and have high exchange rates . therefore , any \n thermodynamic phase change of water by k ions is kinetically \n less hindered than by chaotrope ions . in feldspar the cations \n released into the water stay close to the \n surface due to surface charging and charge compensation and are then \n able to interact with water molecules . in the case of ca and na , ice nucleation is inhibited by their chaotropic \n behavior , whereas k has a positive or at least a neutral \n effect . in addition , it was shown that koh is easily incorporated \n into the ice structure . the size of k is around the size of a h3o ion , whereas \n na and ca are far too small to fit well into \n the ice structure . this would further lower the negative effect of \n the k ions to the formation of ice - like structures close \n to the vicinity of the surface bilayer . this is in agreement with \n a former study where lower ice nucleation \n temperatures were found for micas containing al ions \n instead of k ions , where again the aluminum ion has a \n much higher charge density . our \n kaolinite sample contains \n small amounts of k - feldspar , which gives the sample most of its ina \n together with a slightly larger surface area . any exact explanation \n of the ice nucleation behavior of our montmorillonite sample is difficult , \n as exact mineral composition analysis and structure determination \n are lacking . a distinct phase identification by xrd was not possible \n due to the layered stacking structure of montmorillonite . on the basis \n of the sem - edx , the larger amounts of mg compared to \n k , na , and ca found suggest chaotropic \n influence of the magnesium ions if the surfaces of the mineral support \n ice - like arranged water molecules . nevertheless , the montmorillonite \n acts as a heterogeneous in , but at rather low temperatures compared \n to k - feldspar . as already reported , the calcite \n surface has a strong affinity to water molecules . the water molecules are tightly bound to the surface and \n can not arrange in ice - like structures . the water molecules are possibly \n bound to hydrolysis species , chemisorbed on the surface of calcite . in gypsum , the strong calcium water interaction \n may lead to a similar behavior . in agreement with the feldspars , \n the investigated volcanic ash \n acts as a rather poor in with a t50 of \n 238 k. the ash sample from the eyafjallajkull eruption 2010 \n is mainly composed of the weak in albite ( na - feldspar ) . the higher \n initial freezing temperature can be easily explained by the inhomogeneity \n of the sample . the titanium iron oxide which was found in the \n ash seems to have no influence on the ina , but no experiments on single \n minerals could be performed . this partly explains why in a former \n study volcanic ash showed both high in activity , as well as almost \n none . k - feldspar rich volcanic ash has \n a larger tendency to act as a good in than ash containing mainly plagioclases \n ( na / ca - feldspar ) . it can not be stated directly that only the mineral \n composition determines the ina as volcanic ash eruptions are often \n accompanied by sulfuric acid and other gases that may alter the surface \n and ice nucleation properties . the atd sample had a slightly larger surface area than the other \n dust samples , probably leading to a slightly overestimated t50 value compared to the other samples . still , \n the atd sample was a rather good in , which was not surprising due \n to its k - feldspar content . in addition , the quartz content may also \n act as in , depending on the preprocessing of the sample .",
"the feldspar family has \n higher t50 values than the quartz sample \n of comparable surface area in agreement with atkinson et al . and yakobi - hancock et al . for the deposition mode the structure of feldspars is \n closely related to quartz , but si is partly substituted by al . the \n sio4/alo4 tetrahedra in feldspar are slightly tilted due to the charge compensating \n cations ; surface distortions from the \n basic quartz structure may even be larger and defects ( in particular \n ionic defects ) are much more common , so more frequent molecular sites \n are expected for feldspars . nevertheless , the feldspars have \n quite large differences in t50 values \n with microcline being active at a much higher temperature in this \n study and in the study by atkinson et al . the latest studies showed also good ice nucleation activities in the deposition \n mode for the orthoclase phase of k - feldspar , so the increased activity \n of k - feldspar need not be phase specific . the sem images of the feldspar \n samples are quite similar and a morphological difference can not explain \n the different ice nucleation behavior . on the basis of the tem - edx \n measurements , if ice nucleation occurs at macroscopic defect sites \n such as cracks , it is not due to a local element accumulation , but \n rather to the steric configuration there . extrinsic ina by organic \n adsorbates on microcline or its inhibition \n on the plagioclases can be excluded on the basis of the enzymatic \n and temperature treatment experiments . the inhibition of ice nucleation \n sites by enzymes may be understood as steric hindrance or blocking \n of the site . further experiments revealed that the loss of ina is \n a result of a reversible active site hindrance / blocking and not a \n destruction , as the initial activity was regained after enzyme removal . \n our results indicate that the higher ina of the k - feldspar sample \n is an intrinsic property and not a result of adsorbed organic / biological \n material . the investigated feldspars have different counter \n cations with different ionic radii ( rk > rna rca ) . in addition the plagioclases ( na / ca - feldspars ) have a higher al / si \n ordering than the k - feldspars . the measurements leave only the \n conclusion that the difference \n in the ina of the feldspars is a result of the difference in ionic \n radius of the cations and therefore the local chemical configuration \n at the surface . the surface cations released into the surface bilayer \n may interact with water to enhance / inhibit ice formation . the resulting \n depletion of cations in the outermost layer may be different for each cation due to the differences in ionic \n radii . the ion charge density of the cations of the mineral was already \n suggested to influence ice nucleation on mineral surfaces . the cations around the surface have different \n affinity to water molecules and potential bonds are of different strength . \n surface calcium ions on calcite are known to bind the water quite \n tightly and thus inhibit ice nucleation by fixing the water molecules \n in ice structure mismatching locations . the difference in ina of microcline and the plagioclases may also \n be a result of the more random cation / aluminum distribution in the \n k - feldspars compared to the na / ca feldspars . as already mentioned , \n feldspar surfaces are cation deficient in \n aqueous solution . the tendency of the surface to interact with water \n molecules is increased by this process as dangling bonds remain at \n the surface . the hydration shells of ca , na , and \n k ions have different sizes and shapes . ca and na belong to the chaotrope family ( structure breaking \n ions ) whereas k is a kosmotrope ( structure making ion ) . small ions with high charge density are considered to be chaotrope \n and have a strong interaction with water . the weaker water water \n hydrogen bonds are broken to form the hydration shells with larger \n residence times of water molecules compared to the shells of kosmotropic \n ions . these strong chaotrope - water interactions inhibit an ice - like \n structuring of water molecules in the vicinity of the ions . kosmotropes \n like k on the other hand have a weaker interaction with \n water than the intermolecular water water interaction . the \n k ions form hydration shells , but the water molecules \n are bonded more weakly and have high exchange rates . therefore , any \n thermodynamic phase change of water by k ions is kinetically \n less hindered than by chaotrope ions . in feldspar the cations \n released into the water stay close to the \n surface due to surface charging and charge compensation and are then \n able to interact with water molecules . in the case of ca and na , ice nucleation is inhibited by their chaotropic \n behavior , whereas k has a positive or at least a neutral \n effect . in addition , it was shown that koh is easily incorporated \n into the ice structure . the size of k is around the size of a h3o ion , whereas \n na and ca are far too small to fit well into \n the ice structure . this would further lower the negative effect of \n the k ions to the formation of ice - like structures close \n to the vicinity of the surface bilayer . this is in agreement with \n a former study where lower ice nucleation \n temperatures were found for micas containing al ions \n instead of k ions , where again the aluminum ion has a \n much higher charge density .",
"the ice \n nucleation behavior of various mineral samples was investigated with \n a special focus on feldspars , which are known to be among the most \n ice nucleation active species . the feldspars are more ice nucleation active than most quartz samples , \n and k - feldspar is by far the most active in of the feldspar family . \n the size of the cation , and its binding energy toward water are the \n key factors determining ina . different quartz samples showed \n a large discrepancy of their ina . \n with the presented idea of domains of molecular sites able to bind \n and arrange water molecules in an ice - like structure acting as ice \n nucleation sites , we suggest that the history of the quartz particles \n and dust particles in general has an important influence . ina is enhanced \n by introducing more defects to a quartz surface by mechanical milling . \n the nucleation sites suggested here are not necessarily the same on \n each particle , but rather caused by a stochastic arrangement of functional \n groups which are able to bind water molecules . therefore , nucleation \n site sizes , as well as the corresponding nucleation temperature , conform \n to a statistical distribution . consequently , the freezing curves determined \n with our experimental setup can be shifted to higher temperatures \n by increasing the particle surface for active in like k - feldspar . \n still , an open task for future work will be to understand the processes \n that lead to site formation on the molecular level ."
] | mineral
dusts originating from earth s crust are known to
be important atmospheric ice nuclei . in agreement with earlier studies ,
feldspar was found as the most active of the tested natural mineral
dusts . here we investigated in closer detail the reasons for its activity
and the difference in the activity of the different feldspars . conclusions
are drawn from scanning electron microscopy , x - ray powder diffraction ,
infrared spectroscopy , and oil - immersion freezing experiments . k - feldspar
showed by far the highest ice nucleation activity . finally , we give
a potential explanation of this effect , finding alkali - metal ions
having different hydration shells and thus an influence on the ice
nucleation activity of feldspar surfaces . |
[
"sixty - three fecal samples were collected from laboratory ferrets ( mustela putorius furo ) at the national institute of infectious diseases , tokyo , japan , on may 24 , 2013 . these ferrets had been imported from a farm in the united states for influenza research 7 days before sample collection . fecal specimens were diluted with 10 mmol / l phosphate - buffered saline to prepare a 10% suspension , shaken at 4c for 1 h , and clarified by centrifugation at 10,000 g for 30 min . the supernatant was passed through a 0.45-m membrane filter ( millipore , bedford , ma , usa ) , and stored at 80c until use . rna was extracted by using the magna pure lc total nucleic acid isolation kit ( roche applied science , mannheim , germany ) according to the manufacturer s recommendations . reverse transcription was performed by using the superscript ii rnase h reverse transcription procedure ( invitrogen , carlsbad , ca , usa ) and primer tx30sxn as described ( 14 ) . ferret hev rna was detected by using a nested , broad - spectrum reverse transcription pcr ( 15 ) . sequences were similar to those detected in ferret serum samples in the united states ( 11 ) , which suggested that the laboratory ferrets were infected in the united states and then transported to japan . rna from 2 ferret hevs was randomly selected , and the full - length genome was amplified by using reverse transcription pcr with primers based on nucleotide sequences derived from strains from the netherlands and united states ( table 1 ) . sequence of the 5-terminal noncoding regions of the genome was determined by using rapid amplification of cdna ends kits ( invitrogen ) according to the manufacturer s instructions . all pcr products were purified by using the qiaquick pcr purification kit ( qiagen , valencia , ca , usa ) and cloned into the ta cloning vector pcr2.1 ( invitrogen ) . nucleotide sequencing was conducted by using an abi 3130 genetic analyzer automated aequencer ( applied biosystems , foster city , ca , usa ) . * values in parentheses indicate positions of the primer corresponding to the entire genome of hepatitis e virus ( jn998607 ) isolated from ferret . both ferret hev genomes consisted of 6,820 nt and a poly ( a ) tail ( genbank accession nos . ab890001 and ab890374 ) , and nucleotide sequence identity was 99.6% . genomic structure of strains from the united states was similar to that of 2 strains from the netherlands . the amino acid alignment of orf2 indicated that ferret hev orf2 has an additional 6 amino acids at the n terminus . however , because the seventh codon is aug , it is unclear which codon was used for the orf2 translation initiation . the orf1 of strains from the united states encodes 1,589 aa , which is 7 aa shorter than orf1 of both strains from the netherlands . in addition , the ferret hev strains from the united states have 2 aa insertions between amino acid residues 596597 ( thr ) and 631632 ( ile ) and 9 aa deletions in amino acid residues 645653 ( cys - leu - arg - ser - ser - pro - lys - pro - pro ) , which corresponds to those of strains from the netherlands . similar to ferret hev from the netherlands , an additional putative 183-aa orf 4 ( nt 30581 ) was found in strains from the united states . ab890375ab890379 ) showed that nucleotide identities among them were 98.9%99.5% , which indicated that genetically similar ferret hev strains had circulated at the ferret farm in the united states . nucleotide and deduced amino acid sequence identities between ferret hev from the united states and other hevs are shown in table 2 . the entire genome of strains from the united states shared relatively high nucleotide sequence identities ( 82.4%82.5% ) with strains from the netherlands . these trees showed that although strains from the united states were closely related to strains from the netherlands , they formed a new and distinct cluster ( figure ) . we observed similar phylogenetic clustering when we analyzed nucleotide sequences of orf1 and orf3 separately . although we can not conclude whether ferret hev from the united states is a new genotype , these results indicated that there is genetic variety in ferret hev . researchers should also bear in mind that some laboratory ferrets are contaminated with ferret hev . phylogenetic relationships among genotypes 14 and wild boar , rabbit , rat , avian , bat , and ferret isolates of hepatitis e virus . phylogenetic trees with 1,000 bootstrap replicates were generated by using the neighbor - joining method ( njplot 2.3 , http://njplot.sharewarejunction.com/ ) based on a ) the entire genome and b ) open reading frame 2 .",
"we amplified the entire genome of 2 ferret hev strains isolated from laboratory ferrets imported from the united states . nucleotide sequence comparisons showed that 2 ferret hev strains from the united states had high ( 99.6% ) identity and shared 98.6%100% identities with partial sequences of orf1 that were detected in the united states ( 11 ) , which indicated that genetically similar ferret hev was circulating in laboratory ferrets . although nucleotide sequence identities of the entire genome for strains from the united states and the netherlands was 82.4%82.5% , orf2 showed relatively high amino acid identities ( 94.2%94.8% ) , which suggested that isolated from the united states and the netherlands share similar antigenicity . ferret hev like particles derived from 1 of the isolates from the netherlands were cross - reactive with serum from hev - infected laboratory ferrets in the united states ( 11 ) . in conclusion , we isolated and identified 2 ferret hev strains from laboratory ferrets imported from the united states ."
] | the complete genome of hepatitis e virus ( hev ) from laboratory ferrets imported from the united states was identified . this virus shared only 82.4%82.5% nt sequence identities with strains from the netherlands , which indicated that the ferret hev genome is genetically diverse . some laboratory ferrets were contaminated with hev . |
[
"radial extracorporeal shock wave therapy ( rswt ) generates pressure waves through the \n collision of solid bodies1 . there are a few recent \n reports regarding the effectiveness of extracorporeal shock wave therapy ( eswt ) on \n neurogenic heterotopic ossification ( ho ) in the lower extremity , but to our knowledge , the \n use of eswt or rswt to treat neurogenic ho in the upper extremity has not been reported in \n the literature4 . we report 2 cases of rswt used to treat neurogenic ho in the upper extremities . in both \n cases , improvements in pain , range of motion ( rom ) , muscle strength , and hand function were \n observed . each patient gave their written informed consent and agreed to participate in the \n treatment . this case report was approved by the ethics committee of the sahmyook medical \n center .",
"a 49-year - old man was admitted to our physical medicine and rehabilitation ( pmr ) \n department . a subarachnoid hemorrhage ( sa ) occurred 10 months prior to admission and \n neurogenic ho of the left shoulder and elbow was diagnosed 2 months before his admission . he \n had been taking disodium etidronate 800 mg per day ( fig . \n 1.(a ) in case a , bone scan , x - ray , and musculoskeletal ultrasound demonstrate ho in the \n left shoulder and elbow . arrows indicate the ho \n sites.ho : heterotropic ossification ; subs : subscapularis ; cp : coracoid process ; un : ulnar \n nerve ; me : medial epicondyle ; olec : olecranon ) . in spite of the medication , he continued to complain of constant pain , limited rom , \n muscle weakness , and impaired hand function . rswt was administered to the inferior portion \n of the coracoid process of the left shoulder and the medial epicondyle ( me ) of the left \n elbow using ultrasonographic ( usg ) guidance . the target points of rswt were the ho area that \n could be seen with usg . ( a ) in case a , bone scan , x - ray , and musculoskeletal ultrasound demonstrate ho in the \n left shoulder and elbow . : heterotropic ossification ; subs : subscapularis ; cp : coracoid process ; un : ulnar \n nerve ; me : medial epicondyle ; olec : olecranon",
"a 52-year - old man with a 6-month history of hypoxic brain injury was admitted to our pmr \n and diagnosed with neurogenic ho of the right elbow ( fig . \n 1 ) . rswt was administered to the ho area including the me and olecranon of the \n right elbow using usg guidance . medications were not subsequently required due to a good \n response to rswt . in both cases , rswt was administered using the master plus mp 2000 ( storz , \n tgerwilen , switzerland ) , and the rswt protocol consisted of 3,000 pulses at a frequency of \n 12 hz during each treatment . the intensity level ranged from 25 bars , and it was \n administered 5 times a week for 4 weeks , a total of 20 treatments . during rswt , all other \n treatments , including physical and occupational therapy , were continued as usual . both \n patients were allowed to take previously prescribed oral medications but additional \n analgesics or antispastic medications were not permitted . pain assessed with the numerical rating scale ( nrs ) , rom , muscle strength assessed with the \n manual muscle test ( mmt ) , a hand evaluation test , and the jebsen - taylor hand function test \n were evaluated prior to each treatment , after treatment , and following 1 month of treatment . \n pain was reduced from 8 to 0 on the nrs , and the patients remained pain - free \n for 1 month after treatment . in case a , rom of flexion , abduction , adduction , internal rotation , and external rotation \n of the left shoulder and additionally , flexion of the left elbow was improved and \n maintained . the mmt result also showed improvement and the improvement was maintained for 1 \n month ( table 1table 1.range of motion , manual muscle test , hand evaluation test and , jebsen - taylor hand \n function test resultstestcase acase bbeforeafterfollow up upbeforeafterfollow uprange of motion()shoulderflexion 90140 * 145*extension 202020abduction90130 * 130*adduction1020 * 20*internal rotation6070 * 70*external rotation2060 * 60 * elbowflexion 90100 * 100 * 4080 * 85*extensionfullfullfullfullfullfullsupination7070706065 * 80*pronation7060606062 * 80*manual muscle testshoulderflexionfairfair+*fair+*extensionfairgood*good*abductionfairfair+*fair+*horizontal abductionfairfair+*fair+*horizontal adductionfairgood*good*elbow flexionfairgood*good*fairfairfairextensionfairgood*good*fairfairfairhand evaluation test grasp power ( kg)1420 * 18 * 121212lateral pinch ( kg)3.54.5 * 5.5 * 1.52.5 * 2*tripod pinch ( kg)23.0 * 2.5 * 211.5nine - hole pegboard ( sec)30.625.7 * 25.0 * 13865.1 * 58.7*purdue pegboard test ( number ) 1112 * 12 * 03 * 1*jebson - taylor hand function test \n ( sec)writing55.3445.00 * 43.71*ntntntcard turning9.317.87 * 8.76 * 11.0411.076.9*small common object12.1610.59 * 10.15*nt47.3 * 19.5*feeding13.8112.25 * 10.94*ntnt25*stacking checkers7.134.50 * 4.12*ntntntlarge light object ( sec)5.845.914.81 * 8.125.71 * 6.34*large heavy object ( sec)6.945.78 * 4.63 * 8.697.12 * 5.06*follow up period was 4 weeks . functional testing of hand strength and speed of hand movement showed \n improvements that were maintained at least for 1 month after the end of treatment ( table 1 ) . follow up period was 4 weeks . improved score ; nt : not testable ; \n affected side in case b , right elbow flexion , supination , and pronation were improved , the improvements \n were maintained for 1 month . in contrast to case a , improvement in the mmt result was not \n seen ( table 1 ) . in the hand function test , the \n strength of the hand and speed of hand movement improved , and these improvements were \n maintained at least for 1 month after the end of treatment ( table 1 ) .",
"ho is a complicated and significant medical problem characterized by abnormal growth of \n bone in soft tissues , commonly around large joints . in its severe form , the condition causes \n pain , limited rom , and loss of function in the affected joint . neurogenic ho is associated with injuries to the central nervous \n system , occurs 24 months after a neurological insult , and mainly affects the major synovial \n joints between spastic muscles6 . primary treatment is a combination of gentle passive rom exercises and bisphosphonate \n medication , such as disodium etidronate or nonsteroidal anti - inflammatory drugs . surgical \n excision may be considered for complicated cases , but surgical complications and \n postoperative recurrence are common4 . eswt has been described in several case reports as a new treatment strategy for neurogenic \n ho , but it has been restricted to the lower extremities7 . eswt has been shown to promote bone healing in stress fractures , \n avascular necrosis , and delayed and/or bony nonunion , and it has been widely used for \n managing the pain of various musculoskeletal conditions8 . eswt consists of a sequence of single sonic pulses characterized by \n high peak pressure ( 1001,000 bars ) of short duration ( 0.2 s ) and has a focused pressure \n field with deep penetration depth . compared with eswt , rswt is characterized by 110 bars of pressure of 0.20.5 ms duration \n and has a radial pressure field with shallow penetration depth . despite the physical \n differences , the stimulation effects and therapeutic mechanisms of eswt and rswt are almost \n the same1 . in our cases , pain , rom , muscle strength , and hand function improved although imaging \n studies with radiographs and bone scans showed no changes . this result is consistent with \n previous studies that reported improvement in pain and function without changes in imaging \n studies7 , 8 . based on the results of these studies , it is our opinion that \n imaging findings do not accurately reflect the pain and function caused by neurogenic \n ho . the mechanism of pain reduction with eswt or rswt is not well known and there are several \n hypotheses9 . eswt or rswt generates \n oscillations in tissue that lead to improvement of microcirculation and metabolic \n activity1 . immediate pain reduction \n after eswt could be the result of a hyperstimulation analgesic effect10 . the improvements observed in rom , mmt , and hand function of the present two cases could be \n associated with pain reduction , since proper management of pain caused by neurogenic ho with \n rswt could have been the cause of the improvements in rom and hand function . as reported by previous studies , in our cases , the improvements in pain , rom , mmt , and hand \n function were maintained for 1 month after the rswt treatment7 . the mechanism of the long - term maintenance of the improvements is \n not known but rswt in the early phase of neurogenic ho is effective at preventing \n progression . they were the inferior \n part of the coracoid process of the left shoulder and the me of the left elbow in case a , \n and the me and olecranon of the right elbow in case b. imaging guidance when administering \n rswt for treating neurogenic ho could help to correctly focus on the ho site and avoid the \n other vulnerable structures such as vessels and nerves2 , 10 . in conclusion , rswt improved the pain , rom , and hand function of two patients with upper \n extremity neurogenic ho . further studies are needed to support these results and to \n understand the mechanism behind the effectiveness of rswt , as well as to devise a protocol \n for rswt for neurogenic ho ."
] | [ purpose ] to report the effects of radial extracorporeal shock wave therapy ( rswt ) on
heterotopic ossification ( ho ) . [ subjects and methods ] two cases of neurogenic ho in the
upper extremity were administered rswt using the master plus mp 2000 ( storz ,
tgerwilen , switzerland ) and ultrasonographic guidance . the rswt protocol consisted of
3,000 pulses at a frequency of 12 hz during each treatment . the intensity level ranged
from 25 bars , and it was administered 5 times a week for 4 weeks , a total of 20
treatments . [ results ] rswt improved pain , range of motion , and hand function in 2 patients
with neurogenic ho in the upper extremity . [ conclusion ] further studies are needed to
support these results and to understand the mechanism and to devise the protocol of rswt
for neurogenic ho . |
[
"",
"stairway falls are a leading cause of injury in patients less than 5 years of age [ 1 , 2 ] . while the majority of these injuries occur when a child steps down the stairs , approximately 3 % of injuries will be associated with a caregiver falling while carrying a child . this specific mechanism has been shown to result in injury patterns that are more likely to necessitate hospitalization and more likely to involve trauma to the head and fractures to the extremities . while it is often necessary for a parent or caregiver to carry children in their arms while walking down stairs , the child may obstruct the caretaker s view on the stairway ( fig . this can lead to a fall by the caretaker and an injury to the child and/or caretaker . to date , several previous studies have been conducted evaluating stairway injuries in children , but none have focused on this specific mechanism ( fall from caregiver s arms ) or the injuries associated with these falls . the goal of this study was to identify injuries that may occur when a caretaker falls while carrying a child on a stairway , to understand the pathomechanics of this injury , and to perform a cost analysis of the injury.fig . d bird s eye view of how the child can obstruct the caretaker s view on the stairway a side view of the caretaker s unobstructed view on the stairway . d bird s eye view of how the child can obstruct the caretaker s view on the stairway",
"emergency department and orthopedic clinic records were reviewed between 2004 and 2012 to identify patients with an orthopedic injury after a fall from stairs . sixteen children were retrospectively found to have a fracture from a fall - in - arms injury sustained while a caregiver was going down stairs , and were included in this study . patient identification occurred at a routine weekly fracture conference , where every emergency department fracture in which the orthopedic service was consulted was presented . if the patient met the inclusion criteria , they were then added to the database . the following demographic and epidemiologic data were recorded for each patient : age , gender , location of injury , and mechanism of fall . additionally , radiographs were reviewed to assess fracture location , type , displacement , and treatment . cost analysis data was obtained from the hospital billing department and included all emergency department care , inpatient care , and subsequent follow - up . this study was granted a waiver of informed consent , including permission and assent , in accordance with 45 cfr 46.116(d ) and 45 cfr 46.408 , and a waiver of hipaa authorization per 45 cfr 164.512(i ) . the study was authorized by the local ethical committee and was performed in accordance with the ethical standards of the 1964 declaration of helsinki as revised in 2000 .",
"sixteen children presented to the emergency room and orthopedic clinic of our hospital after sustaining an injury when their caretaker fell while carrying them down the stairs . our billing records reveal that we , as an institution , treat approximately 9,500 fractures per year , giving an incidence of approximately 1 fracture by this mechanism per 5,000 fractures . interviews with the parents yielded information regarding the specifics of the fall and the possible pathomechanics of the child s injuries . the parent or caregiver noted in all cases that the child was being held in front as they descended the stairs . the child obscured their view and they missed a step and fell ( fig . the age at the time of injury averaged 14 months and ranged from 7 months to 51 months of age . eight ( 50 % ) sustained femur fractures , six ( 38 % ) sustained tibia fractures , and one ( 6 % ) sustained a metatarsal fracture . there was one both bone forearm fracture ( 6 % ) ; this occurred in the eldest child ( 51 months ) . four of these patients , however , required a reduction or manipulation , three of which were performed in the operating room . functionally , all patients did well , with no deficits noted at final follow - up . cost analysis was performed amongst our 16 patients to determine the financial burden accrued in relation to these accidental traumas ( table 1 ) . the average total charge of the treatment of the fractures was $ 6,785 ( standard deviation $ 11,183 ; range $ 948$45,876 ) . five of the 16 children ( 31 % ) had a skeletal survey , as the treating physicians were concerned about possible child abuse ; the average total charge for those receiving a skeletal survey was $ 7,024 . after a social service consultation and a skeletal survey were obtained in these cases , no patient was felt to be the victim of child abuse . for those children not requiring a skeletal survey , three children ( 19 % ) required a closed reduction of their femur fractures in the operating room ; their total care charges averaged $ 23,568 . for the children not treated in the operating room , the average charge was $ 2,912.table 1cost of fall - associated accidental traumasage ( months)sexfractured bone(s)costskeletal survey18mtibia / fibula$2,607no7ftibia$2,024no12ffemur$4,276yes10mfemur$7,861yes12mfemur$9,080no16ftibia$2,801no10mmetatarsal$1,328no17mfemur$19,748yes12ftibia / fibula$2,594no7ffemur$4,231yes51fulna$3,907no15.6 ( avg . age)$5,496 ( avg .",
"injuries incurred on stairs , particularly in patients under the age of five , can occur with relative frequency . three previous studies have been conducted that have evaluated stairway injuries in children [ 3 , 4 , 6 ] . included in these studies were primarily children who fell while walking on the stairs , and none focused on the variable of a caretaker falling while carrying a child . it was noted , however , in these studies that children who sustained injuries while being carried tended to have more severe injuries than those who fell while walking themselves down stairs . in our study , all patients identified had incurred a fracture , and nearly all of these involved the lower extremity . of the 16 children , half ( 50 % ) sustained femur fractures and 38 % sustained tibia fractures . these results show that the pattern of injury differs from that of a child who falls while walking down the stairs . however , a child who is dropped , or fallen upon , while being carried appears more likely to sustain a long bone fracture to the lower extremity . pierce et al . have the only series currently published that examines the incidence of femur fractures and falls down stairs . their series evaluated femur fractures that were due to a reported fall down stairs ( either solo or in a caretaker s arms ) , and evaluated a plausibility model to check whether they could identify cases of nonaccidental trauma . in their subgroup of caretaker falls , this mechanism most commonly caused buckle fractures , followed by transverse / short oblique fractures . they examined the energy absorbed by the patients during falls and noted that the greater number of stairs in the fall correlated to the fracture pattern type , noting that spiral fractures were associated with falls from 1 to 3 steps and buckle fractures with falls from 4 to 15 steps . in our study , we saw an even distribution of spiral and buckle fractures that may be associated with the variability in fall heights that were observed in our patient population . pierce et al . also employed a plausibility model to help identify if certain aspects taken from the history could be used as independent identifiers of child abuse . they found that if a caregiver could not give specific details about the fall dynamics as well as the position of the child before and after the fall , the child may have been a victim of abuse . although this model has not been validated , and was not employed here , it may provide guidance to treating physicians and can reduce costs and avoid exposing patients to unnecessary radiation from a skeletal survey . in our series , all caregivers were able to provide a detailed history regarding the nature of their child s injury , and subsequent non - accidental trauma work - ups suggested no cases of abuse . additionally , no child in our study had a concomitant injury other than the fracture . this is consistent with other studies , where abused children tended to have other injuries such as bruising as well head and trunk injuries . the total charge for the children who received a skeletal survey as part of their work - up was $ 7,024 . it is the duty of treating physicians whether they are primary care physicians , emergency room physicians , or orthopedists to be vigilant in the work - up of suspected nonaccidental trauma , and the skeletal survey is frequently the first test ordered following a history and physical . with that said , in cases where the caregiver can provide a clear history , the skeletal survey can be deferred to minimize costs and radiation exposure to the child . three children in our series had to go to the operating room for a surgical reduction . all of these were for diaphyseal femur fractures that were treated with a spica cast . the costs related to the treatment of these femur fractures dwarf the costs of the other patients in this series . when taken as two separate groups , the average charge for femur fracture treatment in the emergency room was $ 2,912 , compared to $ 23,568 for treatment in the operating room . this study does have limitations and is biased toward orthopedic injuries , as all of the cases reported were obtained through orthopedic emergency room consults and clinic visits . isolated injuries to the head or torso would not involve an orthopedic consult and thus were not included in this group . this most likely underestimates the total number of children seen at our hospital due to a fall down stairs while being carried by a caregiver . additionally , the number of children with relatively minor injuries who did not seek medical treatment further underestimates the true incidence of this mechanism of injury . this paper describes the type of orthopedic injuries sustained during a fall down stairs while in a caregiver s arms . what our study adds to the literature is that nearly one - third of the children underwent a skeletal survey due to concerns regarding child abuse . additionally , the average cost of these injuries was not insignificant and averaged $ 6,785 . thirdly , we believe that the pathomechanics of this injury are as follows : the caregiver descends the stairs carrying a child in front.the size of the child obscures the view of the subsequent stair ( fig . 1a d).the caregiver misses the step and falls.the momentum usually causes the caregiver and child to fall forward down the stairs ( fig . 2).fig . 2they miss the step and fall , often landing on the child as they fall the caregiver descends the stairs carrying a child in front . the size of the child obscures the view of the subsequent stair ( fig . the momentum usually causes the caregiver and child to fall forward down the stairs ( fig . 2they miss the step and fall , often landing on the child as they fall they miss the step and fall , often landing on the child as they fall with a better understanding of this mechanism , the treating er physician can avoid routine skeletal surveys when the parent describes a plausible sequence , as we note above . finally , with awareness of this mechanism , prevention of these injuries may be possible . our recommendations are for the caregiver to hold on to the handrail while traversing the steps . in addition to using the handrail , the caretaker s view of the stairs should be unobstructed ( fig . 3 ) . this can be accomplished by positioning the child on the opposite side of the body to the handrail . we hope that these recommendations serve to remind healthcare providers as to the dangers of carrying children on stairways . at times this may be necessary , and can be performed safely if the proper precautions are taken.fig . in addition to using the handrail , the caretaker s view of the stairs should be unobstructed the caregiver should hold on to the handrail while traversing the steps . in addition to using the handrail , the caretaker s view of the stairs should be unobstructed in conclusion , a fall in a caregiver s arms while going down stairs can result in multiple orthopedic injuries , particularly to the lower extremity . the costs of treating these injuries are not insignificant , averaging nearly $ 7,000 , and the suspicion of child abuse can be both costly and unnecessary in the case of a true accident . while descending the stairs with a child in their arms , the caregiver should hold the child to the side so as not to obscure their vision of the step with one arm , ideally holding the handrail with the other ."
] | backgroundthe purpose of this study was to describe fractures sustained by children and to analyze the associated costs when a caretaker falls down stairs while holding a child.materials and methodsbetween 2004 and 2012 , 16 children who sustained a fracture after a fall down stairs while being carried by a caregiver were identified . parents / caregivers were interviewed to see how the fall occurred , and a cost analysis was performed.resultsthe average age of the patients was 14.5 months ( 751 months ) . the lower extremity was involved in 15 of 16 fractures , with 8 involving the femur . the majority were buckle fractures , but all diaphyseal femur fractures were spiral . three patients required a reduction in the operating room . all fractures healed with cast immobilization . five patients underwent skeletal surveys , as the treating physicians were concerned about potential child abuse . the average cost of treatment was $ 6785 ( range $ 94845,876 ) . detailed histories from the caregivers showed that they missed a step due to the child being carried in front of the caregiver , obscuring their vision.conclusionsa fall in a caregiver s arms while going down stairs can result in multiple orthopedic injuries . the costs of treating these injuries are not insignificant , and the suspicion of child abuse can be both costly and unnecessary in the case of a true accident . while descending the stairs with a child in their arms , the caregiver should hold the child to the side so as not to obscure their vision of the step with one arm , ideally holding the handrail with the other.level of evidenceiv case series . |
[
"to date , four prostaglandin ( pg ) derivatives ( unoprostone , latanoprost , travoprost and bimatoprost ) have been marketed across the world . in addition , in 2008 tafluprost was marketed in some european countries and in japan . prost - type pg derivatives ( that is , pg derivatives other than unoprostone ) are now the drugs of first choice for the treatment of glaucoma because of their potent intraocular pressure ( iop)-lowering activity , the low likelihood of systemic adverse reactions , the once - daily application , and good patient adherence . as of end july 2009 , tafluprost has been approved in 21 countries . no preservative - free tafluprost preparation has yet been marketed in japan , even though both a preservative - containing preparation ( tapros ) and a preservativefree preparation ( taflotan ) have been marketed in other countries . this review will describe the pharmacological profile of tafluprost ( the latest pg derivative ) and also the clinical studies of this drug conducted across the world , while focusing especially on those conducted in japan .",
"( tokyo , japan ) , their original concept having been to develop a new product with an efficacy and safety comparable to or higher than those of latanoprost ( a prostanoid fp receptor agonist ) . prost - type pg derivatives ( ie , those other than unoprostone ) , were discovered as compounds that retained the 15-position hydroxyl group of natural pgf2 , and had high pharmacological activity . the hydroxyl group at the 15-position was considered indispensable for the manifestation of the activity of pgs.1 however , tafluprost is a novel pgf2 derivative in which the 15-position hydroxyl group is substituted by 2 fluorine atoms ( figure 1 ) . because of this substitution , ketonization by 15-hydroxy - dehydrogenase ( one of the major pathways involved in the metabolization of pgs ) does not occur with this compound . as a result , it is metabolized only through beta - oxidation of the alpha - chain of pg skeleton.2 because of this lack of one pathway for its metabolization , tafluprost may expected to have a prolonged action , but it has been shown to lack a tendency to accumulate.2 in pg derivatives other than bimatoprost , the alpha - chain ending of the pg skeleton has been isopropyl - esterified , and for this reason these derivatives are converted into an active form ( carboxylic acid form ) by corneal esterase , and penetrate rapidly into the anterior chamber of the eye . it has been reported that tafluprost not only has an affinity for the fp receptor that is about 12 times higher than that of latanoprost , but that it has almost no potential to bind to the other receptors.3 among the other pg derivatives , the affinity of travoprost for the prostanoid fp receptor has been reported to be 2.8 times as high as that of latanoprost.4 for both unoprostone and bimatoprost , the receptors on which they act were uncertain at the time of launch onto the market . however , each had been reported to have a low affinity for the prostanoid fp receptor.5,6 later , only nonmetabolized bimatoprost was found not to bind to the conventional fp receptor , but instead to the prostamide receptor , which is a complex receptor consisting of fp and splice - variant fp receptors.7 figure 2 shows images indicating the receptorbinding affinities of pg derivatives for various prostanoid receptors . a simple summary of these reports on the affinities of the existing pg derivatives for the fp receptor would be that tafluprost has the highest affinity for the fp receptor among the pg derivatives currently available ( notably , higher than that of latanoprost ) . we previously reported that the iop - lowering activity of each of these pg derivatives was absent in prostanoid fp receptor - knockout mice , indicating that the fp receptor is involved to a greater or lesser extent in the iop - lowering action of each pg derivative.8,9",
"the iop - lowering activity of tafluprost has been demonstrated both in ocular normotensive monkeys and in laser - induced ocular hypertensive monkeys.3 in the former the maximal iop reductions achieved with a single dose of tafluprost ( 0.00002 to 0.0025% ) were dose - dependent , with statistical significance being reached at doses of 0.0005 and 00025% , and the potency of tafluprost at 00005% was almost equal to that of latanoprost at 0005% ( figure 3).3 similarly , in laser - induced ocular hypertensive monkeys , single - dose applications of tafluprost ( 0.00002 to 0.0025% ) induced a dose - dependent iop reduction.3 when normotensive monkeys received repeated doses of tafluprost ( 0.0015% , 0.0025% , or 0.005% ) once daily for 5 days , this drug exhibited iop - lowering effects not only on the first day , but also on the third and fifth days of administration , without an attenuation of efficacy over time ( figure 4).3 when 0.005% of latanoprost was administered instead in the same study , the iop measured at 24 hours after each dose was equal to the baseline iop level . however , when any one of the above concentrations of tafluprost was administered , the iop levels at the trough - points on the third to fifth days were significantly lower than those in the vehicle - treatment group ( figure 4).3 these results suggest that the duration of action of tafluprost may become longer upon repeated dosing . like latanoprost , tafluprost lowers iop by stimulating the outflow of aqueous humor through the uveoscleral passway.3 although latanoprost and tafluprost lower iop through actions on the same receptor and through the same mechanism , the magnitude of the iop reduction in a given individual may differ between these two drugs . in our recent study on monkeys that had a low susceptibility to latanoprost and displayed an inadequate reduction of iop in response to latanoprost , the magnitude of the iop reduction induced by tafluprost ( 0.0015% ) was greater than that induced by latanoprost ( 0.005% ) in all ten monkeys tested.10 this suggests that switching to tafluprost may be useful in cases in which the iop reduction achieved with latanoprost is insufficient . one of the known adverse reactions to pg derivatives is pigmentation of the iris and/or eyelids . melanoma cells that had been incubated for 4 days in a medium supplemented with a high concentration of tafluprost failed to exhibit the elevated melanin content seen in cultures containing the same concentration of latanoprost ( figure 5).3 admittedly , a very high concentration of each drug was used in this study . nevertheless , the lack of reaction in the tafluprost - treated cells , despite the presence of such a reaction in the latanoprost - treated ones , may indicate ( a ) that the incidence of iris or eyelid pigmentation will be low with tafluprost and ( b ) that if such pigmentation does develop following treatment with this drug , it will not be severe . other data have raised the possibility that tafluprost might improve blood flow as well as other pg derivatives . for instance , izumi n et al11 noted that administration of tafluprost ophthalmic solution elevated feline retinal blood flow . moreover , in a rabbit model of disturbed blood flow induced by administration of endothelin-1 ( et-1 ) into the vitreous , an improvement in blood flow was demonstrated with tafluprost.12 indeed , when latanoprost , travoprost , or tafluprost ophthalmic solution was administered 2 hours before the intravitreous injection of et-1 , the disturbance of the retinal blood flow was significantly inhibited in all the groups . however , such a significant effect was observed only in the tafluprost - treated group when the same ophthalmic solutions were administered 4 hours before intravitreous injection of et-1 . this result suggests that the ocular blood flow - improving effect may be more prolonged with tafluprost than with latanoprost or travoprost . regarding the mechanism responsible for the blood flow improvement , dong y et al13 noted that tafluprost relaxed rabbit ciliary artery smooth muscle , and that the relaxation was not dependent on endothelium - derived factors . moreover , it apparently did not involve a reduction in agonist - induced ca influx or increased ca extrusion into the extracellular space . however , they did obtain evidence that the tafluprost - induced relaxation might be due , at least in part , to an inhibition of the capacitative entry of extracellular ca . since we really do not have sufficient means of measuring blood flow in animal models and human eyes , the clinical relevance of improvement of ocular blood flow by pg derivatives including tafluprost should be verified in the future study . in a recent study , kanamori et al14 reported neuroprotective effects of tafluprost . in a rat model in which retinal ganglion cell apoptosis was induced by serum - removal or by glutamate exposure they also noted that in a rat model of optic - nerve crush , treatment with tafluprost ophthalmic solution increased the survival rate of retinal ganglion cells .",
"clinical studies on tafluprost have been carried out both in western countries1419 and in japan , in each case using preservativecontaining tafluprost preparations . two phase i studies were conducted in england , one on healthy japanese men and one on healthy non - japanese men.15,16 the therapeutic concentration of tafluprost has been set at 0.0015% on the basis of results from phase ii dose - response study performed in japan . in japan , three phase iii clinical studies have been carried out using taflprost at that concentration ( 0.0015% ) . incidentally , for the dosage and administration of this drug , it is indicated that it should be administered once daily ( one drop / dose ) . of the three phase iii clinical studies conducted in japan , one was designed as a non - inferiority study aimed at comparing the efficacy of tafluprost with that of latanoprost . in that study a randomized , single - blind comparative study involving 109 patients with primary open angle glaucoma or ocular hypertension ( reference drug : latanoprost ophthalmic solution ) the magnitude of the iop reduction in the tafluprost and latanoprost treatment group after 4 week administration was 6.6 2.5 mmhg ( 27.6 9.6% ) and 6.2 2.5 mmhg ( 25.9 9.7% ) , respectively . thus endorsing the noninferiority of this drug versus latanoprost ( figure 6).20 moreover , the percentage of patients showing a reduction of 20% or more in iop was 80.4% in the tafluprost treatmentgroup against 70.6% in the latanoprost - treatment group . the second phase iii clinical study of tafluprost was designed as a long - term dosing study primarily aimed at evaluating its safety in prolonged use . in that study involving 351 patients with open angle glaucoma ( including normotensive glaucoma ) or ocular hypertension the magnitude of the iop reduction seen following treatment with tafluprost studied within the range 4.9 to 5.7 mmhg throughout the 52-week study period . thus , this drug exerted its iop - lowering effect in a stable manner during prolonged use ( see product overview : http://www.santen.co.jp/medical/common/pdf/info_package/tenpu/tapros.pdf ) . the third phase iii clinical study was designed as a comparative study aimed at evaluating the efficacy of tafluprost in patients with normal tension glaucoma . according to the results of the epidemiological survey of glaucoma in japan carried out in tajimi city , gifu prefecture in 2000 and 2001 ( often referred to as the tajimi study ) , the prevalence of glaucoma at ages over 40 is 5% in japan , and normal tension glaucoma accounts for more than 70% of all glaucoma cases.21 to date , however , no iop - lowering agent has been shown in clinical trials to be effective against normal tension glaucoma ( the most frequent type of glaucoma in japan ) . in unpublished randomized masked comparative study involving 94 patients with normotensive glaucoma ( reference drug : placebo ophthalmic solution ) , the magnitude of the iop reduction in the tafluprost - treatment group was 4.0 mmhg ( 95% confidence interval : 3.5 to 4.5 mmhg ) , and this was significantly greater than that in the placebo - treatment group ( figure 7 ) . for tafluprost versus latanoprost , noninferiority was demonstrated by anova ( and almost by ancova ) in a phase iii , 24-month study in patients with open - angle glaucoma or ocular hypertension.17 in addition , the iop - lowering efficacy of tafluprost in adjunctive use with timolol demonstrated by egorov and ropo.18 a clinical equivalence between preservativefree and preservative - containing prescriptions has been reported both by uusitalo h et al19 in healthy volunteers , and by hamacher t et al22 in patients with glaucoma or ocular hypertension . thus the penetration of tafluprost into the anterior chamber is apparently not affected by preservative benzalkonium chloride . at present , there are insufficient clinical data comparing tafluprost and other pg derivatives because of its short marketing history .",
"clinical studies on tafluprost have been carried out both in western countries1419 and in japan , in each case using preservativecontaining tafluprost preparations . two phase i studies were conducted in england , one on healthy japanese men and one on healthy non - japanese men.15,16 the therapeutic concentration of tafluprost has been set at 0.0015% on the basis of results from phase ii dose - response study performed in japan . in japan , three phase iii clinical studies have been carried out using taflprost at that concentration ( 0.0015% ) . incidentally , for the dosage and administration of this drug , it is indicated that it should be administered once daily ( one drop / dose ) . of the three phase iii clinical studies conducted in japan , one was designed as a non - inferiority study aimed at comparing the efficacy of tafluprost with that of latanoprost . in that study a randomized , single - blind comparative study involving 109 patients with primary open angle glaucoma or ocular hypertension ( reference drug : latanoprost ophthalmic solution ) the magnitude of the iop reduction in the tafluprost and latanoprost treatment group after 4 week administration was 6.6 2.5 mmhg ( 27.6 9.6% ) and 6.2 2.5 mmhg ( 25.9 9.7% ) , respectively . thus endorsing the noninferiority of this drug versus latanoprost ( figure 6).20 moreover , the percentage of patients showing a reduction of 20% or more in iop was 80.4% in the tafluprost treatmentgroup against 70.6% in the latanoprost - treatment group . the second phase iii clinical study of tafluprost was designed as a long - term dosing study primarily aimed at evaluating its safety in prolonged use . in that study involving 351 patients with open angle glaucoma ( including normotensive glaucoma ) or ocular hypertension the magnitude of the iop reduction seen following treatment with tafluprost studied within the range 4.9 to 5.7 mmhg throughout the 52-week study period . thus , this drug exerted its iop - lowering effect in a stable manner during prolonged use ( see product overview : http://www.santen.co.jp/medical/common/pdf/info_package/tenpu/tapros.pdf ) . the third phase iii clinical study was designed as a comparative study aimed at evaluating the efficacy of tafluprost in patients with normal tension glaucoma . according to the results of the epidemiological survey of glaucoma in japan carried out in tajimi city , gifu prefecture in 2000 and 2001 ( often referred to as the tajimi study ) , the prevalence of glaucoma at ages over 40 is 5% in japan , and normal tension glaucoma accounts for more than 70% of all glaucoma cases.21 to date , however , no iop - lowering agent has been shown in clinical trials to be effective against normal tension glaucoma ( the most frequent type of glaucoma in japan ) . in unpublished randomized masked comparative study involving 94 patients with normotensive glaucoma ( reference drug : placebo ophthalmic solution ) , the magnitude of the iop reduction in the tafluprost - treatment group was 4.0 mmhg ( 95% confidence interval : 3.5 to 4.5 mmhg ) , and this was significantly greater than that in the placebo - treatment group ( figure 7 ) . for tafluprost versus latanoprost , noninferiority was demonstrated by anova ( and almost by ancova ) in a phase iii , 24-month study in patients with open - angle glaucoma or ocular hypertension.17 in addition , the iop - lowering efficacy of tafluprost in adjunctive use with timolol demonstrated by egorov and ropo.18 a clinical equivalence between preservativefree and preservative - containing prescriptions has been reported both by uusitalo h et al19 in healthy volunteers , and by hamacher t et al22 in patients with glaucoma or ocular hypertension . thus the penetration of tafluprost into the anterior chamber is apparently not affected by preservative benzalkonium chloride . at present , there are insufficient clinical data comparing tafluprost and other pg derivatives because of its short marketing history .",
"the phase iii clinical trial of 4 weeks aimed at comparing to latanoprost revealed that the incidence of adverse reactions did not differ between those two treatment groups ( 40.0% and 48.1% , respectively , p = 0.443 , fisher s exact test ) . n = 55 ) , which was higher than that of latanoprost ( 13.0% , n = 54 ) , but not significant . of the total population studied in japan ( 483 patients ) , 326 patients ( 67.5% ) showed adverse reactions to tafluprost ophthalmic solution 0.0015% ( including abnormal changes in laboratory parameters ) . the most common adverse reactions reported were conjunctival hyperemia ( 151 cases , 31.3% ) , eyelash abnormalities ( 93 cases , 19.3% ) , itching sensation ( 85 cases , 17.6% ) , ocular irritation ( 65 cases , 13.5% ) , and iris pigmentation ( 39 cases , 8.1% ) . the adverse reactions were mild in more than 95% of all cases , and no severe adverse reaction was noted . like the other pg derivatives , this drug requires particular care when used for aphakic eyes or intraocular lensimplanted eyes , in patients with bronchial asthma or a history of it , in patients with endophthalmitis ( iritis , uveitis ) , or in pregnant , women , or lactating women , and so on . these adverse reactions by tafluprost were comparable to other new pg derivatives such as travoprost and bimatoprost . it contains 15 g tafluprost per ml , a concentration that is the lowest among the pg derivative preparations on the japanese market . it is a clear , colorless aqueous ophthalmic solution , with a ph of 5.7 to 6.3 and an osmotic pressure ratio of 1.0 to 1.1 . this product is intended to be stored at room temperature , and its expiration period is 3 years after manufacture . hyodo et al24 reported that this container was highly praised in an evaluation of various indicators of the impressions of users , and that elderly patients ( 65 years old ) could use it as easily as nonelderly patients . thus , since this ophthalmic solution can be stored at room temperature and is supplied in a highly comfortable container , there is expected to be high adherence of patients to the dosing instructions .",
"it contains 15 g tafluprost per ml , a concentration that is the lowest among the pg derivative preparations on the japanese market . it is a clear , colorless aqueous ophthalmic solution , with a ph of 5.7 to 6.3 and an osmotic pressure ratio of 1.0 to 1.1 . this product is intended to be stored at room temperature , and its expiration period is 3 years after manufacture . hyodo et al24 reported that this container was highly praised in an evaluation of various indicators of the impressions of users , and that elderly patients ( 65 years old ) could use it as easily as nonelderly patients . thus , since this ophthalmic solution can be stored at room temperature and is supplied in a highly comfortable container , there is expected to be high adherence of patients to the dosing instructions .",
"tafluprost 0.0015% ophthalmic solution contains a new pg analogue with an iop - lowering activity and safety comparable to those of latanoprost . since it can be stored at room temperature and is supplied in a container that patients find easy to handle , there is expected to be a high patient adherence to the dosing instructions ."
] | an elevated intraocular pressure ( iop ) is one of the most important risk factors for the development of glaucoma , which causes progressive optic neuropathy . lowering iop is currently the only therapeutic approach to the treatment of glaucoma . tafluprost , a novel prostaglandin analogue , was recently launched onto the market as an ocular hypotensive agent . tafluprost is potent in its affinity for the prostanoid fp receptor and in its intraocular lowering efficacy . moreover , it enhances the ocular hemodynamics and has neuroprotective effects . clinical studies have demonstrated its efficacy at decreasing intraocular pressure in patients with open - angle glaucoma or ocular hypertension . |
[
"sleep disorders and diurnal sleepiness are frequent in parkinson s disease.1 polysomnography studies have shown rapid - eye - movement ( rem ) sleep dysregulation with rem sleep onset on diurnal naps2,3 and loss of muscle atonia,4 which is defined as excessive amount of sustained or intermittent elevation of submental electromyographic tone or excessive phasic submental or limb electromyographic twitching.4 loss of rem atonia is a core phenomenon of rem sleep behavioral disorder ( rbd),5 a condition characterized by vigorous and injurious motor behaviors during rem sleep.6 the orexin system plays a key role in rem sleep regulation . the loss of orexin neurons results in narcolepsy - cataplexy , a condition characterized by severe diurnal sleepiness , rem sleep onset during daytime naps , and cataplexies . rem sleep without atonia ( rswa ) and rbd have also been reported to occur in narcolepsy.7 orexin neurotransmission has been shown to be altered in parkinson s disease ( pd).810 however , polysomnographic data were not available in these postmortem studies . furthermore , we showed that ventricular orexin levels were not correlated with mean sleep latency , suggesting that orexin deficit might not be involved in daytime sleepiness in pd.11 thus , the clinical expression of orexin deficit in pd remains unknown.12 the objective of this study was to determine whether orexin - a levels in ventricular cerebrospinal fluid ( csf ) from pd patients were correlated with rem sleep without atonia .",
"consecutive patients with idiopathic pd13 who were scheduled for deep brain - stimulation neurosurgery were invited to participate in the study , irrespective of whether they had sleep complaints . we did not include patients taking medications known to affect sleep or rem atonia or patients with sleep apnea syndrome defined as an apnea / hypopnea index greater than ten per hour of sleep . disease severity was assessed based on the motor subscore of the unified parkinson s disease rating scale iii after overnight withdrawal of dopaminergic treatment . the study was approved by the appropriate ethics committee , and informed consent was obtained from all patients prior to study inclusion . sleep recordings were obtained during attended polysomnography 1 week before the scheduled date of neurosurgery . polysomnography included electroencephalogram recordings ( c4a1 , c3a2 , and o1o2 leads ) , two electrooculograms , one submental electromyogram ( emg ) , and bilateral anterior tibialis emgs . also recorded were nasal pressure , oral airflow , thoracic and abdominal movements , and pulse oximetry . patients took their usual pd medications and were free to go to sleep when they wanted to . sleep stages were scored by two sleep specialists who had extensive experience with recordings in pd patients ( ab and xd ) , according to the modified american academy of sleep medicine criteria,14 with allowance for rswa . rswa was scored as previously described by lapierre and montplaisir.16 tonic chin - muscle activity during rem sleep was defined as chin emg amplitude greater than twice the amplitude measured during a baseline emg signal for atonia . phasic emg events were defined as any burst of activity lasting 0.35 seconds and having amplitude greater than four times the baseline emg signal . tonic and phasic emg activities were scored from the submental emg signal per 3-second mini - epochs of rem sleep containing or not containing any emg activity ( tonic , phasic , or a combination of both emg activities).17 we then reported loss of rem atonia as the percentage of rem sleep mini - epochs with any emg activity . ventriculography performed to assist in the proper placement of an electrode in the subthalamic nucleus require the removal of csf just before the injection of the contrast agent into the ventricle . in each of our patients , 3 ml of ventricular csf was immediately frozen and stored at 80c until use for the orexin - a assay8 orexin - a ( hypocretin-1 ) was measured in crude csf using a commercially available radioimmunoassay kit ( phoenix pharmaceuticals , belmont , ca , usa ) . the detection limit was 50 pg / ml , and intra - assay variability was 5% . correlations between orexin - a levels and sleep parameters were evaluated using spearman s rank - correlation test and the nonparametric mann - whitney test .",
"consecutive patients with idiopathic pd13 who were scheduled for deep brain - stimulation neurosurgery were invited to participate in the study , irrespective of whether they had sleep complaints . we did not include patients taking medications known to affect sleep or rem atonia or patients with sleep apnea syndrome defined as an apnea / hypopnea index greater than ten per hour of sleep . disease severity was assessed based on the motor subscore of the unified parkinson s disease rating scale iii after overnight withdrawal of dopaminergic treatment . the study was approved by the appropriate ethics committee , and informed consent was obtained from all patients prior to study inclusion .",
"sleep recordings were obtained during attended polysomnography 1 week before the scheduled date of neurosurgery . polysomnography included electroencephalogram recordings ( c4a1 , c3a2 , and o1o2 leads ) , two electrooculograms , one submental electromyogram ( emg ) , and bilateral anterior tibialis emgs . also recorded were nasal pressure , oral airflow , thoracic and abdominal movements , and pulse oximetry . patients took their usual pd medications and were free to go to sleep when they wanted to . sleep stages were scored by two sleep specialists who had extensive experience with recordings in pd patients ( ab and xd ) , according to the modified american academy of sleep medicine criteria,14 with allowance for rswa . rswa was scored as previously described by lapierre and montplaisir.16 tonic chin - muscle activity during rem sleep was defined as chin emg amplitude greater than twice the amplitude measured during a baseline emg signal for atonia . phasic emg events were defined as any burst of activity lasting 0.35 seconds and having amplitude greater than four times the baseline emg signal . tonic and phasic emg activities were scored from the submental emg signal per 3-second mini - epochs of rem sleep containing or not containing any emg activity ( tonic , phasic , or a combination of both emg activities).17 we then reported loss of rem atonia as the percentage of rem sleep mini - epochs with any emg activity .",
"ventriculography performed to assist in the proper placement of an electrode in the subthalamic nucleus require the removal of csf just before the injection of the contrast agent into the ventricle . in each of our patients , 3 ml of ventricular csf was immediately frozen and stored at 80c until use for the orexin - a assay8",
"orexin - a ( hypocretin-1 ) was measured in crude csf using a commercially available radioimmunoassay kit ( phoenix pharmaceuticals , belmont , ca , usa ) . the detection limit was 50 pg / ml , and intra - assay variability was 5% . each csf sample was tested in duplicate .",
"correlations between orexin - a levels and sleep parameters were evaluated using spearman s rank - correlation test and the nonparametric mann - whitney test .",
"we studied eight consecutive patients four males and four females whose clinical features are reported in table 1 . in all eight patients , surgery was performed under regional anesthesia between 10 am and 12 am . no patients or bed partners reported violent movements during sleep , although the spouse of patient # 7 reported limb and body jerking . orexin - a levels did not correlate with total sleep time ( p = 0.23 ) , rem duration ( p = 0.45 ) , or rem latency ( p = 0.66 ) . in contrast , orexin - a levels showed a significant positive correlation with the percentage of rem epochs without atonia , ie , percentage of 3-second mini - epochs classified as any ( = 0.83 , p = 0.027 ) ( figure 1a ) . as previously described6,17 rswa is considered clinically significant when any submental emg activity was present for more than 18% of the total rem sleep duration . according to this criterion , four of our patients had rswa ( # 2 , # 3 , # 4 , and # 7 ) . these four patients had higher median ( interquartile range ) orexin - a levels than the four patients with rem sleep atonia ( 235 pg / ml [ 215345 ] vs 94 pg / ml [ 44147 ] ; mann whitney test p = 0.036 , figure 1b ) .",
"we studied eight consecutive patients four males and four females whose clinical features are reported in table 1 . in all eight patients , surgery was performed under regional anesthesia between 10 am and 12 am . no patients or bed partners reported violent movements during sleep , although the spouse of patient # 7 reported limb and body jerking .",
"orexin - a levels did not correlate with total sleep time ( p = 0.23 ) , rem duration ( p = 0.45 ) , or rem latency ( p = 0.66 ) . in contrast , orexin - a levels showed a significant positive correlation with the percentage of rem epochs without atonia , ie , percentage of 3-second mini - epochs classified as any ( = 0.83 , p = 0.027 ) ( figure 1a ) . as previously described6,17 rswa is considered clinically significant when any submental emg activity was present for more than 18% of the total rem sleep duration . according to this criterion , four of our patients had rswa ( # 2 , # 3 , # 4 , and # 7 ) . these four patients had higher median ( interquartile range ) orexin - a levels than the four patients with rem sleep atonia ( 235 pg / ml [ 215345 ] vs 94 pg / ml [ 44147 ] ; mann whitney test p = 0.036 , figure 1b ) .",
"our results show a significant relationship between ventricular csf orexin - a levels and rem sleep characteristics in patients with pd . despite the small number of patients our results suggest that orexin - a signaling may be associated with loss of muscle atonia during rem sleep in patients with pd . to our knowledge , this is the first study of potential correlations between ventricular csf orexin - a levels and polysomnographic data in patients with pd . we undertook this study to investigate the physiological significance of altered orexin neurotransmission in pd , which has generated controversy.12 the strength of our study is the use of ventricular csf . a previous study in pd patients found that ventricular csf orexin levels correlated with the number of orexinergic neurons.9 furthermore , while a lumbar csf study failed to report a significant correlation between orexin levels and disease severity in a large group of 62 pd patients,18 a significant correlation was reported with ventricular samples.8 the main limitations of our study are the small number of patients and the absence of control subjects . we excluded patients taking sleep - altering medications and emg activities concurrent with respiratory arousals,19 which may have further limited bias in our study . in our study , pd patients with higher ventricular csf orexin levels exhibited larger numbers of rswa epochs than did patients with lower orexin levels , suggesting that preserved orexin drive may be involved in loss of rem atonia . these results are congruent with experiments demonstrating that orexin neurons are strongly involved in muscle - tone control . orexin neurons exert a facilitating influence on muscle tone , both directly via their projections on trigeminal motor neurons20 and spinal motor neurons21 and indirectly via the locus coeruleus neurons.22 orexin injections into the locus coeruleus increase muscle tone23 and interrupt pedunculopontine nucleus - induced muscle atonia.24 however , regulation of muscle atonia relies on complex relationships and interactions between the orexin system , the locus coeruleus ( in which orexin facilitates muscle activity ) , and the pontine inhibitory area ( in which orexin inhibits muscle activity ) . our results contrast with those obtained in narcolepsy - cataplexy , in which orexin levels negatively correlated with rswa.25 however , narcolepsy - cataplexy and pd are two different diseases , and the process leading to orexinergic neuron loss is likely different . orexin neurons are the primary target of an acute and specific neuronal aggression in narcolepsy , leading to a 90% reduction in the orexin neuron pool.26 in contrast , pd is a chronic , slowly progressive neurodegenerative disease , affecting primarily dopaminergic neurons , with a process not fully understood , leading to partial ( 23%60% ) orexin neuron loss.10 as an illustration , no cataplexy has been reported in pd patients , even in patients with undetectable orexin levels.8,12 our results are also in contrast with a recent study that found similar orexin lumbar levels in five rbd patients.27 however , these patients had idiopathic rbd and no sign of pd .",
"the loss of rem atonia in patients with higher orexin levels illustrates the complexity of the symptoms induced by altered orexin neurotransmission in pd.28 experimental trials of orexin antagonists could be of interest in the transgenic mouse model of rswa ."
] | objectivepatients with parkinson s disease frequently complain of sleep disturbances and loss of muscle atonia during rapid - eye - movement ( rem ) sleep is not rare . the orexin - a ( hypocretin-1 ) hypothalamic system plays a central role in controlling rem sleep . loss of orexin neurons results in narcolepsy - cataplexy , a condition characterized by diurnal sleepiness and rem sleep without atonia . alterations in the orexin - a system have been also documented in parkinson s disease , but whether these alterations have clinical consequences remains unknown.methodshere , we measured orexin - a levels in ventricular cerebrospinal fluid from eight patients with parkinson s disease ( four males and four females ) who underwent ventriculography during deep brain - stimulation surgery and performed full - night polysomnography before surgery.resultsour results showed a positive correlation between orexin - a levels and rem sleep without muscle atonia.conclusionour results suggest that high levels of orexin - a in parkinson s disease may be associated with loss of rem muscle atonia . |
[
"transcutaneous electrical nerve stimulation ( tens ) is the application of an electric \n current through the skin to stimulate the nervous system . this type of electrical \n stimulation activates spinal afferent pathways that connect to spinal gray matter of the \n dorsal horn modulating sensory afferent traffic . the electric current stimulates the \n underlying fibers producing painless paresthesias without causing damage to the skin1 , 2 . \n its application technique varies depending on several parameters and can be divided into \n high frequency ( 50 hz ) low intensity and low frequency ( 10 hz ) high intensity tens , both \n of which are used to relieve both acute and chronic pain3,4,5 . acupuncture is also widely used in clinical settings for the relief of pain caused by lower \n back injury , fibromyalgia , and headache disorders , among others . uniting the technique of \n acupuncture analgesia with electrotherapy , with certain modifications , has created \n electroacupuncture which is used as a substitute for conventional acupuncture , and in cases \n where clinical acupuncture alone has noeffect5 , 6 . low frequency tens is also called acupuncture like tens , because it interacting with the \n peripheral nervous system eliciting a pricking sensation , that is modulated by the frequency \n of electrical stimulation , the current intensity and the pulse duration . to present this \n kind of sensation , the \n procedure differs from classical electroacupuncture , as it does not use needles , only \n electrodes with a high intensity of the electrical current7,8,9 . currently , several terms are used to describe the transcutaneous \n electrical stimulation of acupoint . for example : acu - tens ( tens applied to an acupoint ) and \n teas ( transcutaneous electric acupoint stimulation ) that involves any electric current \n applied to acupoints10 . in this study , two different areas of electrodes , 1 cm and 15 cm , \n te5 ( waiguan ) and pc6 ( neiguan ) acupoints . according to chinese traditional medicine \n stimulation of the te5 acupoint is indicated for arthritis in the wrist and finger joints , \n and that of the acupoint pc6 is indicated for pain in the forearm , carpal tunnel , and wrist , \n median nerve palsy , and pain and contracture in the elbow and arm . this study analyzed \n whether the areas of electrodes elicit different effects . when tens is applied to acupoints \n frequency of 10 hz with sufficient intensity to promote muscle jerks . the latency of the \n pain threshold and its intensity in healthy subjects subjected to cold - induced pain was \n measured .",
"this was a single - blind , quasi - experimental study with a control and placebo . forty - eight \n subjects ( convenience sample ) were recruited from the departmental centres of the university \n federal of pernambuco ( ufpe ) . they were divided into three groups of 16 subjects , composed \n of both sexes aged between 18 and 30 years . the groups were formed by the allocation of the \n subjects who were verbally invited to particpate and sent to the laboratory . all of the \n participants provided their written informed consent . after reading and accepting the terms \n of the study , subjects were allocated to three groups : the 1 cm electrode group , \n the 15 cm electrode group , and the placebo group . the subjects were allocated by \n raffle in blocks of four to each group in succession . during the period of experimentation \n subjects showed no pathological state in the region subjected to cold - induced pain , did not \n use allopathic and/or homeopathic drugs , showed no intolerance or phobia at low \n temperatures , and the female subjects , were not in a state of pre - menstrual tension or \n menstrual flow . all experiments were performed in the laboratory of electrothermy at the department of \n physical therapy of the federal university of pernambuco . the first experimental group ( 8 \n males and 8 females ) was stimulated by acupuncture like tens on the te5 and pc6 acupoints \n with 1 cm electrodes ; the second experimental group ( 9 males and 7 females ) was \n also stimulated by acupuncture like tens on the same acupoints with 15 cm \n electrodes ; and the placebo group ( 10 females and 6 males ) were told they were receiving \n microcurrent stimulation of the deltoid muscle with a 15 cm electrode . the study \n received approval from the university federal of pernambuco s research ethical committee , \n under the registration of sisnep fr-294607 , caae-0315.0.172.000 - 9 based on resolution 466/12 \n national health council . the experimental intervention consisted of three stages ( six cycles ) which were termed \n pretreatment time ( cycles 1 and 2 ) , treatment time ( cycles 3 and 4 ) and post treatment time \n ( cycles 5 and 6 ) . each cycle lasted ten minutes , making a total of one hour trial . in the first cycle , subjects put their non - dominant hand in a container of warm water \n ( 37 c ) for five minutes . the temperature was maintained by an electrical water heater and \n constant measurement by mercury thermometer incoterm - l 212/04 . this procedure aimed to \n equalize the temperature of the hand of all subjects before the procedure of cold - induced \n pain . after this , the hands were removed from the container and placed into another with icy \n water 02c ( control performed by the mercury thermometer incoterm - l 212/04 ) . the time to \n pain threshold from when the individuals put their hands into the icy water to the moment \n when they expressed pain was measured in seconds by digital stopwatch ( cronobio sw2018 ) . \n the subjects were asked to keep their hands in cold water for thirty more seconds , during \n this time ( depending on the tolerance ) they were asked to describe the painful sensation \n using a visual analog scale ( values from 0 to 10 , where 0 corresponds to no pain and 10 \n refers to the maximum tolerable pain ) to assess pain intensity . after this they were allowed \n to take their hands out of the icy . after a rest interval , that varied among the individuals , butwas short enough to complete \n half the period of the last five minutes of the first cycle , the subjects again put their \n hands for 5 minutes in warm water , beginning the second cycle , followed immersion in cold \n water . procedure was repeated , completing two cycles of cold - induced pain , with pretreatment \n time , lasting twenty minutes . in the third cycle after wiring for tens , subjects again put their hands into the warm \n water for five minutes , and then into the container with cold water . the time to the pain \n threshold and pain intensity were measured , and the procedure was repeated for a fourth \n cycle , twenty minutes of tens application in total . acupuncture - like tens ( 10 hz ) was \n delivered with a balanced , asymmetrical , biphasic pulsed current ( tensys et9771 kld ) of 1 ms \n ( millisecond ) pulse duration , with sufficient intensity of electric current to cause muscle \n jerks when placed over the te5 and pc6 acupoints , located two from the wrist crease , on the \n posterior and anterior forearm , respectively . to standardize electrical stimulation the \n cathode was placed on the te5 and the anode on the pc6 acupoints . the electrical stimulation \n of acupuncture - like tens was pervormed with 1 cm and 15 cm \n electrodes . at the end of the treatment period , the subjects were subjected to two more cycles , the \n fifth and sixth following the same method described above , to evaluate the effect of tens \n post - treatment ( tens off ) . in the placebo group , subjects were subjected to the same procedure of the cold - induced \n pain test ( pre - treatment , treatment and post - treatment ) , but the electrodes were placed on \n the shoulder ( without connection to any acupoint ) on the belly of the anterior deltoid \n muscle and the individuals were told that they were receiving a microcurrent treatment , in \n which they would not feel any sensation . they were told that the microcurrent works with \n very low intensities , was imperceptible , and had a painkilling effect . they were connected \n to the first channel of the equipment , and the second channel was connected so that the \n lights on the device certified that the current was supposedly operating . however the data of the latency of the pain threshold are presented as the mean standard \n deviation ( sd ) . the results of pain intensity are presented as the average scores on the \n visual analog scale ( vas ) . the latency of the pain threshold between cycles within each \n group was examined using repeated measures one - way anova and the post hoc newman - keuls test . \n for the pain intensity , the analysis between cycles within each group was performed using \n the friedman test . the groups pain threshold latencies were compared one - way anova followed \n by , post hoc newman - keuls test , when necessary . the effect size was calculated using cohen s \n d formula to investigate the clinical significance .",
"a acupuncture - like tens with electrodes with an area of 1 cm showed effects on \n the pain threshold latency during application , while acupuncture - like tens with \n 15 cm electrodes showed effects after tens application . the placebo group \n showed no significant changes in any experimental phase ( table 1table 1.the latency threshold ( seconds ) of pain in the different periods of acupuncture \n tens with electrodes of 1 cm , 15 cm , and placeboelectrodespretreatmenttreatmentposttreatment1 cm30.9 8.945.78 11.8 * 39.5 11.615 cm25.5 7.732.0 12.936.3 13.0*placebo25.2 10.725.2 7.622.4 7.4anova and post hoc newman - keuls . results expressed in mean sd ( seconds ) * significant difference from pre - treatment the intensity of pain was reduced during tens treatment with 1 cm electrodes \n both in relation to the time before treatment and after treatment ( table 2table 2.pain intensity in the different periods of acupuncture - like tens with electrodes \n 1 cm , 15 cm , and placeboelectrodespretreatment(mean ranks)treatment(mean ranks)posttreatment(mean ranks)1 cm2.91.1**2.0 * 15 cm1.32.6 * 2.1placebo2.12.11.7friedman test . * significant difference from pre - treatment . * * significant difference \n from pre - treatment and post - treatment ) . with the 15 cm electrode the sensation of pain increased in \n relation to the time before treatment . in the placebo group * significant difference from pre - treatment . * * significant difference \n from pre - treatment and post - treatment table 3table 3.pain threshold latency ( seconds ) of the groupsplacebo1 cm15 cmpre - treatment22.4 7.425.2 10.725.2 7.6treatment39.5 11.6 * 30.9 8.945.8 11.8**post - treatment36.3 13.0 * 25.5 7.732.0 12.9anova and post hoc newman - keuls . * significant difference from the placebo group at \n pre - treatment . * * significant difference between the 15 cm group and placebo group shows the results of the pain threshold latency times of the groups . during \n the treatment , the 1 cm electrode group showed a longer pain threshold latency \n than the other two groups . after treatment the tens groups ( 1 cm and \n 15 cm ) electrodes showed pain threshold latencies longer than the placebo \n group . * significant difference between the 15 cm group and placebo group the effect size ( cohen s d ) with 1 cm electrodes was d = 0.98 pain and of \n 15 cm was d = 0.88 for the pain threshold latency time and respectively d = \n 0.96 and d = 0.91 post - treatment pain threshold latency time .",
"to induce experimental pain without causing tissue injury we used a model called the cold \n pressure test , also known as the cold - induced pain test . in this model pain is induced \n through local hypothermia , since low temperatures ( 04c ) cause to painful sensations \n through both vasoconstriction11 , 12 and the activation of thermal nociceptors \n ( a- and c fibers ) that signal potential tissue damage . this information is sent via the \n peripheral and central pathways to the somatosensory cortex11 . this information of pain has different representations in the \n cerebral cortex , a sensory version and a psychological one , that might be interpreted in \n this experiment as the pain threshold latency and pain intensity , respectively13 . this is due to the \n characteristics of electric current , that has low frequency and high intensity , activating \n the supra - segmental pathways of -endorphin and met - enkephalin14 . we found that the low frequency , high intensity tens was \n bearable , and prolonged the pain threshold latency in the acute phase , and that prolongation \n of the pain threshold latency was dependent on the size of the electrode . a previous study15 demonstrated that \n analgesia of 80 hz tens for pain induced by mechanical which was measured subjectively by \n subjects pressure was by increasing the intensity of electrical current . the frequency and pulse duration are \n also parameters that influence analgesia16 . in our study , it was found that the size of the electrode and its \n location affected analgesia . initially , a high threshold of stimulation was required for \n both electrodes at the respective coupled acupoints , that are distal from the muscular motor \n points of the forearm , and required high intensities to promote muscle twitch and sting \n sensation . a functional magnetic resonance imaging study of healthy subjects subjected to cold - induced \n pain , and demonstrated that the periaqueductal gray , the superior frontal gyrus , anterior \n cingulate cortex , thalamus , left insula , right inferior frontal gyrus and left inferior \n temporal gyrus were activated17 . these \n structures are related to the perception of the pain threshold , but not pain intensity . \n these structures are also activated when stimuli acupoints , by needles or by transcutaneous \n electrical current18 . as the action of acupuncture - like tens with 10 hz was relatively rapid at prolonging the \n pain threshold latency , during or after application , it suggests that it acts directly on \n a- and c fiber , promoting action potentials in them . this would have served as a mechanism \n of segment concurrence , which is usually seen as fibers a- mediating the stimulation of \n high frequency tens . when the painful stimulus of low temperature triggered the a- and c \n fibers they were already receiving electrical stimulus , leaving them less responsive to the \n cold stimulus . its influence on the pain threshold latency during and after tens \n application , may be due the concentration of the stimulus in the receptive field of the \n nerve endings being stimulated by electrical current , the smaller electrode focused on the \n acupoints , while the larger electrodes encompassed this area and most of the surrounding \n regions . these acupoints are stimulated by needles , classically , and they have a large \n concentration of mechanical stimuli in their areas . studies have shown that acupoints \n located in the areas of dermatomes , myotomes and sclerotomes which are pain afferents , are \n more effective than acupoints which are distant from them18 , 19 . in the placebo group , \n which received no electrical stimulation , no statistical differences were observed among the \n pre- , and during- , and post - treatment periods . table 3 compares the pain threshold latencies \n of the groups . during tens treatment , the 1 cm electrode group showed \n significant differences from the other two groups . this result corroborates the hypothesis \n that the concentration of eletrical stimulus in a small area is more effective than that \n over larger areas . acupuncture points have intrinsic neuronal properties , as well as increased conductance , \n low impedance , and high electric potential compared to other locations . it has been \n suggested that the meridians are more a functional concept than anatomical , a multiple \n system incorporating the physiological , neurological , endocrine and immune systems9 . the values show that the 1 cm electrode group showed a reduction in pain \n intensity during the tens treatment compared to pretreatment , while the 15 cm \n electrode group showed an increase in pain compared to pretreatment . as mentioned above , the \n pain threshold latency and pain intensity are mediated differently by the central nervous \n system11 . another study14 applied tens to the li4 \n ( he - gu ) and pc6 ( neiguan ) acupoints of subjects submitted to cold - induced pain with a \n current intensity of 3 ma , pulse duration of 300 s and frequency of 4 hz , and noted a \n reduction in pain intensity relative to a placebo group over periods of 30 to 170 seconds of \n cold - induced pain . some other studies1 , 20 have also reported significant changes in pain intensity with \n electroanalgesia , while , others11 , 21 , 22 \n have reported that the intensity of pain showed no significant change with the use of tens . \n items that differed in these works were the experimental pain models , parameters of \n electrical stimulation , location of the electrodes and the number of subjects involved in \n each experiment , as well as the recruitment and randomization methods . another controversial \n point is the measurement of pain using the visual analog scale since , even though it is \n widely used and accepted , its results tend to be contradictory . the 15 cm electrode group showed an increase in the sensation of pain \n intensity , rather than a reduction , during the tens treatment , but there was no significant \n difference in the timeof the pain threshold latency . in the \n case of the 1 cm electrode , the result was consistent . the intensity of pain is \n subjective measure which depends on the interpretation and previous experience of each \n individual . this may cause some confusion at the time of assessment , making it impossible to \n compare the results of pain intensity between groups . we suggest that as well as the \n measurement of pain intensity using the vas scale , some objective form of measurement is \n also used , such as the pain threshold latency , measurement of the conduction velocity of \n nociceptive fibers . the effect size , as calculated by cohen s d , of the 1 cm electrode group showed \n a percentage ranging from 88% to 98% when compared to the other groups , indicating that the \n 1-cm group , during the tens treatment , had this percentage of individuals with \n higher values than their respective control . at post - treatment the percentage was 9196% \n compared to the placebo group . this demonstrates there was a clinically significant \n difference between the 1 cm group and the placebo group . in the literature , we \n could find no other references reporting statistically significant results for this type of \n treatment . our findings support the view that acupuncture - like tens at 10 hz frequency , applied to pc6 \n and te5 acupoints with the parameters described above , increases the pain threshold latency \n during tens treatment with 1 cm electrodes and post - treatment with \n 15 cm electrodes . the pain intensity was reduced during tens treatment when \n applied to the acupoints with an electrode area of 1 cm . the effect size \n calculations show that tens applied to these acupoints were clinically significant . the \n combination of acupuncture - like tens and acupoints is a treatment choice for acute pain in \n the hand region ."
] | [ purpose ] this study assesse the effect of low frequency transcutaneous electrical nerve
stimulation ( tens ) of thete5 ( waiguan ) and pc6 ( neiguan ) acupoints on cold - induced pain .
[ subjects and methods ] forty - eight subjects were divided by convenience into three groups :
tens with electrodes of 1 cm2 area , tens with electrodes of area
15 cm2 and a placebo group . the study consisted of three phases : cold - induced
pain without electroanalgesia , cold - induced pain with electroanalgesia or placebo , and
cold - induced pain post - electroanalgesia or placebo . [ results ] acupuncture like tens
increased the pain threshold latency during treatment ( 45.7 11.7s ) compared to
pre - treatment ( 30.9 8.9s ) in the tens group with 1 cm2 electrodes . in the
tens group with 15 cm2 electrodes , the pain threshold latency increased at
post - treatment ( 36.2 12.9s ) compared to pre - treatment ( 25.5 7.4s ) . the placebo group
showed no significant changes . the group with 1 cm2 electrodes showed a
significantly higher pain threshold latency ( 45.7 11.7s ) than the other two groups . at
post - treatment , the pain threshold latencies of both the 1 cm2 ( 39.4 11.5s )
and 15 cm2 ( 36.2 12.9s ) tens group were higher than that of the placebo group
( 22.4 7.4s ) . [ conclusion ] acupuncture like tens applied to pc6 and te5 acupoints
increased the pain threshold latency . the pain intensity was reduced by tens with an
electrode area of 1 cm2 . |
[
"tetralogy of fallot ( tof ) is the most common form of cyanotic congenital heart disease . impairment in exercise tolerance after total repair of tetralogy of fallot has been frequently reported and speculated to be due to variable causes including residual right ventricular outflow tract ( rvot ) obstruction , branch pulmonary artery stenosis , pulmonary insufficiency , pulmonary pathology , and chronotropic incompetence . pulmonary regurgitation ( pr ) has been shown to be related to the use of transannular patch during rvot reconstruction and aggressive infundibulectomy involving the pulmonary valve annulus . adverse effects of pr include progressive dilatation of rv , reduced exercise capacity , arrhythmia , and sudden death . a number of children have premature ventricular beats after repair of the tetralogy of fallot . these beats are of concern in patients with residual hemodynamic abnormalities ; 24-hr electrocardiographic ( holter ) monitoring studies should be performed to be certain that occult short episodes of ventricular tachycardia are not occurring . exercise studies may be useful in provoking cardiac arrhythmias that are not apparent at rest . the aim of this study was to assess the exercise performance of young patients following the repair of tetralogy of fallot and to assess the influence of different variables related to the surgical repair on exercise testing .",
"this study was carried out at the children 's hospital , pediatric cardiology department , ain shams university in the period from march 2008 to february 2010 . it included 21 patients operated on for tetralogy of fallot compared to 15 healthy age- and sex - matched children . all patients underwent total correction for tof at ages ranging between 2 and 10 years . total correction was performed by closing the vsd and reconstruction of the rvot via either transatrial - transpulmonary or right ventriculotomy approaches . all patients were subjected to twelve - lead ecg to comment on rate , rhythm , p wave , axis , qrs duration , bundle branch block , and chamber enlargement . m mode , two - dimensional , and color doppler echocardiographic examination using ge health care ultrasound vivid 7 was done for all patients to comment on pulmonary valve regurgitation or residual stenosis , branch pulmonary arteries , right ventricular size , and function , residual vsd and leak across , movement of ivs , left ventricular function , and other associated cardiac anomalies . exercise stress testing was performed by using a schiller mtm-1500 treadmill using the modified bruce protocol .",
"the resting ecgs of all patients revealed normal sinus rhythm and rbbb , 16 patients with complete rbbb , and 5 patients with incomplete rbbb . qrs durations were prolonged but less than 180 msec in 19 patients , and more than 180 msec in only 1 patient . echocardiographic examination showed variable degrees of pulmonary regurge in 20 patients ( 95% ) ; severe pr in 12 patients , moderate pr in 2 patients , and mild pr in 6 patients . there was abnormal right ventricular dilation in 5 patients ( 23.8% ) detected by 2d echo . residual vsd was detected in 2 patients and branch pulmonary artery stenosis in 5 patients . three patients ( 14.2% ) developed exercise - induced uniform infrequent pvcs during stress testing . sustained ventricular tachycardia was not detected in any patient . while infrequent pvcs developed in 2 control subjects ( 13.3% ) . only one patient ( 4.7% ) of the study group developed exercise - induced complete heart block ( chb ) as detected by stress testing . there was no statistical significant difference between cases and control as regards the work time . cases showed lower work stage and time , but the difference did not reach a significant level p = 0.10 , 0.22 . while they showed significantly lower max sbp , max hr , max mets , and % of mets when compared to control p < 0.05 as shown in table 1 . cases with aortopulmonary shunt showed significantly lower work time , work stage , and max mets when compared with those without aortopulmonary shunt p < 0.05 . as shown in table 2 .",
"surgical correction of tof is directed at relieving all possible sources of right ventricular outflow tract obstruction . if anatomically and surgically possible , pulmonary valve function is preserved by avoiding a transannular patch . palliative aortopulmonary shunt procedures are performed prior to total correction to increase pulmonary blood flow in severely cyanotic infants . numerous 20 to 30 years follow - up studies have documented the excellent clinical results of surgical repair of tof . however , the nature of the repair leaves each patient with some degree of excessive hemodynamic burden because of residual defects , valvular abnormalities , or myocardial factors . resting ecgs of all patients revealed normal sinus rhythm and rbbb , 16 patients with complete rbbb , and 5 patients with incomplete rbbb , whereas no conduction disturbances were shown in the control group . this was in accordance to sarubbi et al . who assessed the exercise capacity in young patients after total repair of fallot tetralogy and found that all the patients presented complete rbbb , whereas no conductance disturbances were shown in the control group . patients with repaired tof frequently have right bundle - branch block with greatly prolonged qrs duration , usually attributed to the effects of cardiac surgery and this electric abnormality has been recognized not only as a risk factor for sudden cardiac death in these patients but also as a contributor to rv dysfunction . in our study pulmonary regurgitation was observed in 20 patients ( 95% ) , 12 of them ( 57% ) had severe pr and 8 ( 38% ) had mild - to - moderate pr . this is in accordance to eyskens et al . who found that all patients had variable degrees of pulmonary regurgitation on standard echocardiography after total correction of tof . pulmonary regurgitation has been attributed to the use of transannular patch during rvot reconstruction and aggressive infundibulectomy involving the pulmonary valve annulus . adverse effects of pr include progressive dilatation of rv , reduced exercise capacity , arrhythmia and sudden death . our study showed no statistical significant difference between cases and control as regards the work time . cases showed lower work stage and time but the difference did not reach a significant level . the maximal work time served as a criterion of exercise capacity when maximum o2 consumption can not be measured . this result showed that exercise capacity in patients undergoing surgical repair was generally good as compared with matched control subjects . this was in accordance to pietrucha and rudzinski who assessed the exercise capacity in 23 patients after surgical correction of tof ( 21 males and two female ) with mean age 14.9 2.9 years and 27 patients without any cardiac disorder ( 19 boys , 8 girls ) age- and sex - matched and found that workload achieved by patients after tetralogy of fallot correction was comparable to healthy subjects . found that intermediate - term exercise performance in patients who underwent primary complete repair of tof in early childhood was nearly normal . several previous studies observed an association between pulmonary regurgitation and exercise impairment in the form of decreased exercise time , vo2 max and maximum achieved mets when compared with normal control subjects during exercise stress testing . in our study , this relationship was not detected . however , our results are similar to samman et al . who were unable to demonstrate a relationship between the degree of pulmonary regurgitation and exercise capacity in patients with repaired tetralogy of fallot and ascribed these contradictory finding to the different methods used to measure the degree of pulmonary regurgitation in these studies in comparison with their study . also our results are in accordance to geva et al . who found that pr degree . found no correlation between the presence or degree of pulmonary regurgitation and its effect on exercise capacity after tof repair . as shown in our study , there was no relation between the degree of pulmonary regurge and the exercise capacity in short term followup . as impaired exercise tolerance after tof repair as detected by exercise stress testing ( decreased work time , work stage , max hr , and max achieved mets when compared with control subjects ) is multifactorial in origin ; patients with severe pulmonary regurge may have cardiovascular compensation with good chronotropic response to exercise while those with mild or no pr may have other causes that impair their exercise tolerance as chronotropic incompetence and lack of physical fitness . in the present study , cases with previous aortopulmonary shunt showed significantly lower exercise indices when compared to those without previous aortopulmonary shunt . study who found that prior aortopulmonary shunt procedures were not associated with reduced exercise performance after tof repair . impaired exercise performance in the patients with previous aortopulmonary shunts might be due to sever tof that necessitated the performance of a shunt . moreover , palliation by means of an aortopulmonary shunts that had been initially performed , leading to changes in the pulmonary vascular system , which is pathologically altered and can in turn , negatively affect exercise capacity . we discovered that only one patient ( 4.7% ) of our study group developed exercise - induced complete heart block ( chb ) as detected by stress testing . the chb revealed by his exercise test probably contributed to the growth impairment of that child .",
"exercise tolerance after total correction of fallot tetralogy is slightly impaired on short - term followup . thus abnormal cardiac function and haemodynamic abnormalities secondary to pr and residual defects appear after longer periods of followup . patients with previous aortopulmonary shunts showed lower exercise performance when compared to those without previous aortopulmonary shunt . the present study did not reveal any serious ventricular arrhythmias since it is seen in those patients with the longest period of follow up . postoperative exercise testing in patients with tof can unmask a complete heart block that was not elicited by the standard 12-lead ecg recording ."
] | tetralogy of fallot ( tof ) is the most common form of cyanotic congenital heart disease . the aim of this study was to examine the exercise performance of young patients following the repair of tof and to assess the influence of different variables related to the surgical repair on exercise testing . this study was conducted on 21 patients ( 16 males and 5 females ) operated on for tof compared to 15 healthy age- and sex - matched control children . the patients ' median age at time of the study was 8 years ( range 513 years ) while age at surgical repair was 5 2.1 years ( range 210 years ) . patients were subjected to 2d and color doppler echocardiographic examination . treadmill exercise stress testing was performed for all subjects according to modified bruce protocol . the resting ecgs of all patients revealed normal sinus rhythm and rbbb . cases had lower exercise capacity when compared to control subjects and those with aortopulmonary shunt showed significantly lower exercise performance when compared to those without aortopulmonary shunt . in conclusions , exercise tolerance after total correction of tof is slightly impaired on short - term followup with more affection among patients with previous aortopulmonary shunts . the present study did not reveal any serious ventricular arrhythmia . |
[
"since its original description by mc burney in 1894 , appendectomy has been one of the most common surgical procedures performed by surgeons . in the last decades , laparoscopic appendectomy was an increasingly accepted treatment method for acute appendicitis , particularly for obese or female patients . natural orifice transluminal endoscopic surgery ( notes ) is a new approach that allows for minimal invasive surgery through the natural orifices such as mouth , anus , or vagina . less incision on the abdomen helps to reduce surgical pain , analgesic requirement , recovery time , hernia formation , intra - abdominal adhesion , and surgical site infection . however , notes has several disadvantages and limitations with the currently available instruments , including limited access and less familiar working angles and operative views . in the past few years this study aimed to summarize the recent clinical appraisals , feasibility , complications , and limitations of transvaginal appendectomy for humans and to outline techniques .",
"electronic searches in december 2013 of the pubmed / medline , cochrane , google scholar , and ebscohost - academic search complete , including cinahl , used the key words [ ( vaginal or transvaginal ) and ( appendectomy or appendectomies or appendicectomy or appendicectomies ) ] . all the studies including congress proceedings and abstracts that describe the clinical course of patients were accepted for the analysis . two reviewers ( mehmet ali yagci and cuneyt kayaalp ) assessed the list of titles and/or abstracts of the scanned articles at pubmed / medline and cochrane using the key words in a function of [ all fields ] . if the articles met our inclusion criteria , full - text versions were obtained for assessment . if the articles were obviously irrelevant to the aim of this systematic review , they were excluded . additional studies were also excluded due to their content ( editorial letters , reviews , experimental studies , duplicated studies , technical notes not including patient data , and survey studies including questionnaires ) . after pubmed and cochrane searches , we scanned the ebscohost - academic search complete and google scholar databases with the same key words but using the [ title ] function . if any additional studies were found , they were added to the first search results . the unpublished , potentially relevant , trials at the registered trials database at https://www.clinicaltrials.gov/ were searched as well . the references of the selected relevant articles were cross checked to decrease the possibility of missing publications . transvaginal appendectomy was defined as a way of natural orifice translumenal endoscopic surgery for the appendix . all the patients were included , irrespective of age , region , race , obesity , comorbidities , or history of previous surgery . no restrictions were made on language , country , or journal . in cases of disagreement during the study selection and analysis data for affiliation , number of the patients , age , clinical findings , inclusion and exclusion criteria , body mass index , history of previous abdominal surgery , trocar sites ( pure or hybrid ) and types , scope site and types ( flexible or rigid ) , vaginal access and colpotomy closure techniques , intraoperative and postoperative complications , operating time , conversion to conventional laparoscopy or open surgery , postoperative pain , length of hospital stay , time off work , long term sexual function , and cosmetic satisfaction were recorded . a computer program including spreadsheet was used for records ( excel 2013 , microsoft windows ) . if there were any missing data , we tried to contact the authors via e - mail . data were tabulated in tables , and column sums were created with the numbers or the means standard deviations , or the ranges of relevant parameters . when studies reported the median and range , we estimated the mean and standard deviation using the method described by hozo et al . . basic calculations were used for the total numbers of the dichotomous outcomes and weighted means with ranges for the continuous outcomes . chi - square test or the fisher exact test ( if expected values were less than 5 ) and student 's t - test were used for statistical analysis of both dichotomous and continuous variables ( spss 13.0 ) .",
"a total of 154 articles were retrieved from the pubmed / medline database and no additional study was available in the cochrane library . after the elimination of the 96 irrelevant studies , google scholar , ebscohost - academic search complete , https://www.clinicaltrials.gov/ , and reference cross - checking defined 26 , 17 , 6 , and 2 studies , respectively ( figure 1 ) . after the elimination of repetitive studies in several databases or sources , seven studies were added to the previously selected 58 articles . studies including inadequate patient data , concomitant hysterectomy , experimental studies , and duplicated data were eliminated and finally 13 articles [ 315 ] were selected for the analysis ( figure 1 ) . two studies [ 10 , 11 ] belonged to the same clinical series and their data were complementary ( early and late results ) . as a result , we analyzed 12 clinical studies contained in 13 articles . some studies had duplicated results [ 1622 ] and their latest or the most comprehensive versions were accepted for the analysis [ 6 , 1013 ] . there were a total of 112 transvaginal appendectomies . studies originated in europe , north / south america , and asia , and two of them included international multicenter data [ 6 , 13 ] . publications were generally ( 11/13 ) in english but one was in german , and one was in japanese . the patients ' ages were generally in the mid - twenties or mid - thirties ; however , there was a large age range ( 1874 years ) . all the patients were in the american society of anesthesia ( asa ) i - ii scores . a diagnosis of complicated appendicitis ( perforation , abscess , and mass ) was usually an exclusion criterion . kg / m ) were also excluded , and the mean body mass index of the patients in this systematic review was 23.2 kg / m ( table 2 ) [ 4 , 79 , 13 , 14 ] . previous abdominal or pelvic surgery was not an exclusion criterion in all studies and 11% of the patients had a history of abdominal or pelvic surgery [ 9 , 15 ] . most of the cases ( 96% ) were of acute appendicitis , while others ( 4% ) were chronic appendicitis or incidental appendectomies . four of them were intraoperative complications : appendicular artery hemorrhage ( n : 3 ) and inability to sustain the pneumoperitoneum ( n : 1 ) . those cases required additional abdominal trocar access and were accepted as a conversion to conventional laparoscopy ( 3.6% ) , but no case required conversion to open surgery . postoperative complications occurred in five patients and all were treated by nonsurgical methods ( table 3 ) . intra - abdominal abscess , urinary retention , urinary infection , and dyspareunia were treated by percutaneous drainage plus antibiotics , foley catheter placement , antibiotics , and just waiting , respectively . the mean length of hospital stay was longer in the german series ( 3.4 days ) because of their national health system , [ 3 , 9 ] , and the mean length of hospital stay was 1.25 days for the rest of the studies . some studies used only the transvaginal access , called a pure or totally transvaginal appendectomy . others used an abdominal assistance ( usually a 5 mm umbilical trocar ) to the transvaginal access and are called a hybrid technique ( table 4 ) . pure transvaginal appendectomy was performed on only 22% of the cases and the remaining were hybrid procedures ( 78% ) . when we compared the operating time and the complications for both techniques , there were no differences . the operating times for pure [ 4 , 10 ] and hybrid [ 5 , 9 , 1215 ] techniques were 48.3 11.8 minutes and 49.6 25.5 minutes , respectively ( p = 0.83 ) . complication rates for pure [ 3 , 4 , 10 ] and hybrid [ 5 , 79 , 1215 ] techniques were 19.0% and 5.5% , respectively ( p = 0.09 ) . some authors used flexible endoscopes ( 20% ) and others preferred rigid laparoscopes ( 80% ) . operating times with flexible endoscopes [ 4 , 5 , 12 , 13 ] and rigid laparoscopes [ 9 , 10 , 1315 ] were 71.9 13.3 minutes and 45.2 21.6 minutes , respectively ( p = 0.0007 ) . complication rates for using flexible [ 35 , 8 , 12 , 13 ] and rigid [ 7 , 9 , 10 , 1315 ] scopes were 0% and 11.4% , respectively ( p = 0.33 ) .",
"transvaginal appendectomy during vaginal hysterectomy was first described in 1949 and , at the time , was performed by the gynecologists with the aim of incidental appendectomy [ 6 , 23 ] . those studies did not include the acute appendicitis cases and their primary objectives were the treatment of gynecological pathologies , not the appendix . in 2008 , the first transvaginal appendectomy without vaginal hysterectomy was reported by palanivelu and coworkers from india and after a short period of time three more cases were reported one from germany and two from georgia . interestingly , these first three separate reports of transvaginal appendectomies all described the totally transvaginal ( pure ) technique using only an endoscope [ 3 , 4 , 22 ] . in those cases , there was no abdominal trocar for assistance , nor was there any other transvaginal equipment except endoscopes . transection of the appendixes was done with scissors [ 3 , 4 ] or snares through the endoscopic channels . all the specimens were removed with the help of the endoscope and no extraction bags were used . reported that , before the first successful case , they experienced three prior conversions to conventional laparoscopic appendectomy due to technical difficulties with this pure endoscopic technique . bernhardt et al . used the same technique and reported that their case was not an acute appendicitis , but a recurring subacute appendicitis . we can conclude that , despite its minimal invasiveness , technical difficulties limit the application of the pure transvaginal technique to highly selected cases . but for now , this analysis revealed that this earliest described transvaginal appendectomy technique was the least commonly preferred one relative to others subsequently described . another technique for pure transvaginal appendectomy was reported using the placement of a single incision laparoscopic surgery ( sils ) port into the incised posterior vaginal fornix . the authors preferred a 5 mm 30 rigid telescope and two working ports ( 5 mm and 12 mm ) on the sils port . they divided the mesoappendix with a stapler or an energy device and the appendix was likewise divided with an endoscopic stapler . they reported almost half the operating time ( mean 44.4 minutes ) of the previously described endoscope - only pure transvaginal appendectomy . although this new technique seemed more adaptable to daily surgical practice , the authors warned that the sils port was inadequate as it was too short , which made placement difficult . they concluded that there was still room for innovation in the development of the technique . this analysis pointed out that hybrid procedures with umbilical port assistances were more common ( 72% ) than the pure transvaginal techniques . hybrid techniques had some advantages over pure ones , such as safer transvaginal introduction under direct vision , transumbilical view when necessary , and two directional working in the abdominal cavity . a hybrid procedure was started with pneumoperitoneum via a veress needle at the umbilicus and a 5 mm trocar was inserted via the umbilicus to inspect the abdominal cavity . after that a vaginal trocar ( 1015 mm ) was placed at the posterior fornix of the vagina . an additional working port was created in three different ways in the studies : ( i ) the channel of the laparoscope was used ; ( ii ) a second 5 mm trocar was inserted from the posterior fornix ; or ( iii ) a second 2.3 mm trocar was placed through the umbilicus . using a flexible endoscope instead of no clear benefits of flexible endoscopes over the rigid scopes were seen in this systematic analysis . transferring the surgeons from open surgery to laparoscopic surgery provided the patients with a more comfortable postoperative course and a more rapid recovery . however , its benefits on postoperative pain and patient recovery were not as amazing as in the previous transfer from open to laparoscopy . a recent meta - analysis found no difference on postoperative pain and length of hospital stay between the single port and the multiport laparoscopic appendectomies . natural orifice surgery is a novel technique that can have a positive influence on postoperative pain and recovery . an important drawback of this technique may be the unfamiliarity of the access to the abdomen for surgeons who are generally familiar with abdominal incisions or transanal surgeries . a second point that may keep surgeons away from this technique this systematic review demonstrated that , from the technical point of view , the equipment required for transvaginal appendectomy was not too distinct from the well - known existing conventional laparoscopic appendectomy equipment . there was no need for special equipment such as long trocars or flexible endoscopes . only two studies compared the results of transvaginal and conventional laparoscopic appendectomies [ 9 , 10 ] . despite the limited number of the patients in those studies , there was a trend towards shorter hospital stays [ 9 , 10 ] , quicker recovery , and less analgesic requirement for the transvaginal groups ( table 5 ) . recent meta - analyses including thousands of conventional laparoscopic appendectomies demonstrated that the wound infection rate was 3.34% and the length of hospital stay was 1.92.9 days [ 24 , 25 ] . when compared to those results , this systematic review demonstrated that transvaginal appendectomy can be a rational alternative to conventional laparoscopic appendectomy in selected patients . it has very low wound infection rates ( zero in this study ) and short hospital stays ( mean 1.9 days ) . today first , there is not enough data of this technique for the morbidly obese patients . there is a considerable amount of obese people in the western countries and transvaginal appendectomy studies are necessary including morbid obese patients . we believe that minimal invasive surgeries like transvaginal appendectomy can have a place for the morbid obese patients in future . secondly , the risk of delving into the cultural sensitivity of using the vagina as an access point , particularly in third world countries can be a limitation . this can be a problem even in the most promiscuous cultures where virginity still runs some amount of the population . as a conclusion , appendectomy is one of the most common emergency visceral surgical procedures . the early results of transvaginal appendectomy in this systematic review show some promise for improved postoperative pain and patient recovery . using hybrid techniques with rigid laparoscopes may provide an easier adaptation for surgeons to this novel appendectomy method . for now , transvaginal appendectomy looks suitable for nonmorbid obese patients ( bmi < 35 ) and noncomplicated appendicitis . of course , its potential advantages and disadvantages will become clearer in the future with comparative studies . more studies are also necessary on the role of transvaginal appendectomy in some subgroups like morbidly obese patients or perforated appendicitis ."
] |
background . natural orifice transluminal endoscopic surgery ( notes ) is a new approach that allows minimal invasive surgery through the mouth , anus , or vagina . objective . to summarize the recent clinical appraisal , feasibility , complications , and limitations of transvaginal appendectomy for humans and outline the techniques . data sources . pubmed / medline , cochrane , google - scholar , ebsco , clinicaltrials.gov and congress abstracts , were searched . study selection . all related reports were included , irrespective of age , region , race , obesity , comorbidities or history of previous surgery . no restrictions were made in terms of language , country or journal . main outcome measures . patient selection criteria , surgical techniques , and results . results . there were total 112 transvaginal appendectomies . all the selected patients had uncomplicated appendicitis and there were no morbidly obese patients . there was no standard surgical technique for transvaginal appendectomy . mean operating time was 53.3 minutes ( 25130 minutes ) . conversion and complication rates were 3.6% and 8.2% , respectively . mean length of hospital stay was 1.9 days . limitations . there are a limited number of comparative studies and an absence of randomized studies . conclusions . for now , nonmorbidly obese females with noncomplicated appendicitis can be a candidate for transvaginal appendectomy . it may decrease postoperative pain and enable the return to normal life and work off time . more comparative studies including subgroups are necessary . |
[
"breast cancer screening programmes are now an established part of the health care service of many countries . the continuous evaluation of this practice is based on observational studies , leading to the possibility of confounding and self - selection bias . to assess the effect of screening , breast cancer mortality in both screened and not screened women has to be compared ; this can be looked upon as the relative risk ( rr , or rate ratio ) of breast cancer mortality . confounding bias of the rr occurs when the prevalence of a risk factor ( or set of risk factors ) for breast cancer death is imbalanced across the compared groups . to adjust for the confounding effect , the prevalence of the risk factor(s ) has to become similar in both groups . usually age is the only risk factor measured when evaluating population - based breast cancer screening programmes , because information on date of birth and date of invitation of women is mostly available . this term covers both within - stratum confounding , for example too - broad age categories , and confounding due to unmeasured variables . self - selection bias can be regarded as a special form of residual confounding because participation may induce an imbalance in the risk factors for breast cancer death . having accounted for age , we clarified the influence of adjustment for residual confounding on the rate ratio of breast cancer death . we compared the mortality rate in the screened ( ms ) with not screened women ( mns ) . this results in an apparent screening mortality association ( rra ) that is seemingly real , but not necessarily so because of possible residual confounding bias . specific screening effect rrs , and a non - specific effect of the potential confounding factor(s ) c , which is reflected in the following formula . \n \\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$$ \\begin{aligned } { \\text{rr}}_{\\text{a } } & = { \\text{m}}_{\\text{s } } /{\\text{m}}_{\\text{ns } } \\\\ & = { \\text{rr}}_{\\text{s } } * { \\text{c } } \\\\ & = { \\text{rr}}_{\\text{s } } * \\left [ { { \\text{p } } _ { 1 } { \\text{rr}}_{\\text{c } } + \\left ( { 1-{\\text{p } } _ { 1 } } \\right ) } \\right]\\,/\\,\\left [ { { \\text{p } } _ { 2 } { \\text{rr}}_{\\text{c } } + \\left ( { 1-{\\text{p } } _ { 2 } } \\right ) } \\right ] \\\\ \\end{aligned } $ $ \\end{document } the quantity c thus represents the effect of the potential confounder(s ) among screened and the not screened women . the influence of c depends on the relative risk of breast cancer death rrc , the proportion p1 of screened women with the confounder present , and the proportion p2 of not screened women having the confounder . the formula is based on previous work by cornfield and colleagues , schlesselman and greenland . , that the apparent rra is 0.50 , and a risk factor producing a twofold increase in risk of breast cancer death ( rrc ) is present among 20% ( p1 ) of the screened group and 50% ( p2 ) of the not screened group . then , the non - specific part of the apparent screening effect is 0.20 * 2 + 0.80 * 1 = 1.20 among the screened women , and 0.50 * 2 + 0.50 * 1 = 1.50 among the not screened women . the ratio of these non - specific effects is 1.2/1.5 = 0.80 , which is the influence of confounding ( c ) among the screened and not screened groups . 1a heuristic device to address residual confounding in the mortality effect of breast cancer screening . both arrows on the left indicate the observed breast cancer mortality risk in the screened and not screened group , suggesting rra = 0.50 . we assume that a confounder with a twofold relative risk on breast cancer death ( rrc ) , is present among 20% ( p1 ) of the women in the screened group and among 50% ( p2 ) in the not screened group . the arrow on the right indicates the expected breast cancer mortality risk in the not screened population when the presence of the risk factor in that group is adjusted from 50% to 20% . 2 ) a heuristic device to address residual confounding in the mortality effect of breast cancer screening . both arrows on the left indicate the observed breast cancer mortality risk in the screened and not screened group , suggesting rra = 0.50 . we assume that a confounder with a twofold relative risk on breast cancer death ( rrc ) , is present among 20% ( p1 ) of the women in the screened group and among 50% ( p2 ) in the not screened group . the arrow on the right indicates the expected breast cancer mortality risk in the not screened population when the presence of the risk factor in that group is adjusted from 50% to 20% . 2 ) in the above calculation we used the cohort approach and the risk ratio ( or rate ratio ) as a measure of effect . however , this same method can be applied when the odds ratio ( or ) is the effect measure . control design has been increasingly used for the evaluation of screening programmes [ 612 ] . in the case control evaluation , the odds of having been screened versus not screened in the case group of breast cancer deaths is compared to the same odds in the control group of invited women from whom the cases originate .",
"as an example , we report on a case control study conducted within the nijmegen breast cancer screening programme which started in 1975 . after adjustment for age , we found that the breast cancer mortality rate in the screened group was 65% lower than that of the not screened group : or = 0.35 and 95% confidence interval ( ci ) = 0.190.64 . dense mammographic breast pattern , for which a high relative risk of 6 has been reported , is a likely candidate for being treated as a confounding factor . despite its strength , nevertheless , suppose its prevalence in all screened women is 5% ( p1 = 0.05 ) in contrast to a supposed 20% ( p2 = 0.20 ) prevalence in the not screened women , then , according to the formula , the apparent or of 0.35 would be adjusted to an or of 0.56 ( see also fig . 2 , left upper diagram).fig . 2diagrams of the adjustment for residual confounding in the effectiveness measurement of breast cancer service screening . mortality or = 0.35 ; panel b is for or = 0.50 and panel c for or = 0.75 . from top to bottom , the figures represent the adjusted ors for confounding factors with rrc = 6 , 4 , 2 and 1.5 , respectively . the x - axis displays the proportion ( p2 ) of the not screened population with the confounding factor . the lines displayed in the figures present the adjusted or for the confounding factor for p2 ranging from 0.0 to 0.6 , and four different points of departure for p1 of the screened population ( upper line at p1 = 0.05 , then p1 = 0.10 , p1 = 0.20 and the lowest line p1 = 0.35 ) . the y - axis in each figure depicts the expected ors adjusted for residual confounding diagrams of the adjustment for residual confounding in the effectiveness measurement of breast cancer service screening . panel a shows the baseline situation of an age - adjusted screening mortality or = 0.35 ; panel b is for or = 0.50 and panel c for or = 0.75 . from top to bottom , the figures represent the adjusted ors for confounding factors with rrc = 6 , 4 , 2 and 1.5 , respectively . the x - axis displays the proportion ( p2 ) of the not screened population with the confounding factor . the lines displayed in the figures present the adjusted or for the confounding factor for p2 ranging from 0.0 to 0.6 , and four different points of departure for p1 of the screened population ( upper line at p1 = 0.05 , then p1 = 0.10 , p1 = 0.20 and the lowest line p1 = 0.35 ) . the y - axis in each figure depicts the expected ors adjusted for residual confounding other risk factors for breast cancer like obesity , socio - economic status , nulliparity , late age at menopause , early age at menarche , and family history show a 1.5 to fourfold relative risk of breast cancer at most . we assume that the risk magnitude of the factors applies to the incidence and mortality alike . panel a shows the baseline situation of an age - adjusted screening mortality or of 0.35 ; panel b is for or = 0.50 and panel c for or = 0.75 . the expected values of the ors in order of decreasing magnitude are displayed on the y - axis in each figure : after adjustment for dense breast pattern rrc = 6 ; late age at menopause rrc = 4 ; nulliparity rrc = 2 ; and serious overweight rrc = 1.5 . the x - axis shows the proportion ( p2 ) of the not screened population with the confounding factor . in each figure , the lines present the or adjusted for the confounding factor with p2 ranging from 0 to 0.6 , and four different situations of the proportion ( p1 ) confounder in the screened group : the upper line is for a p1 = 0.05 , then p1 = 0.10 , p1 = 0.20 and the lowest line for a p1 = 0.35 . in practice ,",
"previous screening programme evaluations have qualitatively discussed the magnitude of residual confounding bias on their effectiveness estimate [ 6 , 9 , 10 , 12 ] or estimated the amount of bias due to self - selection [ 7 , 8 , 11 ] . we present an educated and pragmatic method to quantify the potential impact of residual confounding , and to de - bias the comparison of screened with unscreened groups , a method originally introduced by cornfield et al . . our results demonstrate that residual confounding has a minor influence on the observed screening effect . closely related to residual confounding the difference between these three biases is subtle ; the nuances seem to lie in the clarification of definable confounding factors or a combination of indefinable confounding factors . self - selection into screening may result in an imbalance of a combination of indefinable risk factors , causing a different background risk of dying from breast cancer in screened versus not screened women . healthy screenee bias may occur because some women in the not screened group , although invited for screening , may already have been diagnosed with cancer , while screened women were not diagnosed with breast cancer at the time of participation . both biases can be regarded as a form of residual confounding since participation in screening may be correlated with the baseline risk of dying from breast cancer . an estimate of the amount of self - selection can be obtained by calculating the ratio of the breast cancer deaths among not invited and not screened women . this calculation is not possible in a steady state situation of population based screening since there is no uninvited group . by using the implementation period of screening , we quantified a 0.84 lower background risk in not screened women compared with not yet invited women . duffy et al . proposed a factor based on data from the swedish and canadian screening trials , showing a 1.36 higher risk for not screened women . with these factors , the difference in background risk between not screened and screened women can be calculated by taking the percentage uptake in a programme into account . for instance , if we use duffy s factor of 1.36 and if the screening uptake is 80% , which is in accordance with most european programmes , not screened women have a 1.42 higher background risk compared with screened women . this factor actually represents c in our formula , it is the difference in background risk p1 = 0 and p2 = 1 . in this scenario an apparent or of 0.35 would be adjusted to 0.51 . however , using our factor of 0.84 , not screened women have a 0.80 lower background risk compared with screened women . in our scenario an apparent or of 0.35 would be adjusted to 0.28 . in cornfield s original paper apparent effect , then rra = c , and rrs = 1 . in our example we applied this method to adjust ors for combinations of p2 between 0 and 0.6 , and values of p1 = 0.05 , 0.10 , 0.20 and 0.35 . these values were chosen based on the expected prevalence of the risk factors in the female population , i.e. 5% for mammographic density , 10% for late age at menopause , 20% for nulliparity , and 35% for serious overweight . as , we aimed to challenge the age - adjusted screening effect , we developed scenarios where p1 was smaller than p2 . our calculation does not account for random error or uncertainties about the relation of risk factors and breast cancer . it is possible to correct for this by using more complex techniques based on a monte carlo and a bayesian approach . however , the aim of this study was to present a heuristic device to address residual confounding . in conclusion , in studies on breast cancer screening the mortality reduction ranges from 38 to 70% [ 612 ] . as we have shown , residual confounding does not have a great effect on these estimates of screening effectiveness . after having addressed for age , future breast cancer screening programme evaluations can ignore residual confounding ."
] | residual confounding , after adjustment for age , is the major criticism of observational studies on breast cancer screening effectiveness . we developed realistic scenarios for the prevalence and strength of risk factors on screened and not screened groups , and explored the impact of residual confounding bias . our results demonstrate that residual confounding bias is a minor issue in screening programme evaluations . |