Datasets:

xNoper

/

pubmed-sections-test

like 0

[ "cough is one of the most distressing symptoms in cancer patients with lung or mediastinal metastasis or due to complications of cancer treatment . twenty to 42% of cough do not respond to conventional medications and are referred to as refractory cough and these are often a medical challenge . it shows features such as abnormal throat sensation ( laryngeal parasthesia ) , increased cough sensitivity to tussigens ( hypertussia ) , and cough triggered by nontussive stimuli such as cold or talking ( allotusia ) . gabapentin is known to be effective in treating neuropathic pain with central sensitization and findings from the present case predicts its effectiveness in treating refractory cancer related cough . it further affirms the fact that vagal neuropathy may be associated with refractory chronic cough .", "a 15-year - old boy , who had previously been diagnosed with malignant spindle cell sarcoma , was referred to the department of palliative care and psycho - oncology for chronic refractory cough . following histopathological diagnosis of spindle cell sarcoma of right lower limb in the year 2014 , he had undergone surgery followed by radiotherapy for local control . in may 2015 , he presented to the clinical oncology department with a history of persistent dry cough of 6 months duration . a computed tomography scan of thorax [ figure 1 ] revealed a large heterogenous hypodense soft tissue mass ( 10.5 cm 10.3 cm ) in the right lower lobe with extension to the left atrium through the right inferior pulmonary vein . in addition , there were enlarged right paratracheal , subcarinal , and hilar lymph nodes . computed tomography scan of thorax showing the mass in the right lower lobe with extension to the left atrium through the inferior pulmonary vein the child had persistent cough for the duration of 6 months . the cough intensity on a numerical rating scale ( nrs ) was 10 ( out of 10 ) . each bout of cough lasted for 30 s and there were 20 such bouts in a day . cough was severe in the morning and was triggered by activities that involved walking , talking , or exposure to the cold environment . his eastern cooperative oncology group ( ecog ) performance status score at the time of presentation was 3 . a trial of codeine phosphate started by the primary treating team did not reduce cough but instead caused excessive drowsiness and giddiness due to which he had to stop the medicines . patient was started on gabapentin 50 mg 3 times a day and advised to increase the dose by 50 mg every 3 days until response was obtained or the child felt drowsy ( in the latter case , the drug dose would be decreased ) . the patient responded significantly well with 200 mg / day of gabapentin after 1 week without any side effects such as drowsiness or giddiness and he continues to improve . there was a decrease in the cough intensity to 2 ( out of 10 on nrs ) and both cough duration and bouts ( 2/day ) . the child is now able to enjoy his routine life and socialize with friends and relatives .", "patients with primary or metastatic cancer of the lung often present with distressing symptoms such as breathlessness and cough which significantly impacts their quality of life . there are multimodal options for treatment in cancer related cough which include corticosteroids , bronchodilators , brachytherapy , laser therapies , and opioids . our patient had an extensive mass crossing the mediastinum which precluded radiation to the mass as this involved significant risk to the mediastinal structures . opioids are commonly used in cancer patients for the management of pain , cough , and breathlessness . opioids act by stimulating the mu receptors in the cough centers of the brain and helps in suppressing the cough . in one study , slow release morphine sulfate showed a significant improvement in the cough related quality of life as compared to placebo and this was not associated with cough reflex sensitivity which is consistent with central action of morphine . the treatment , on the contrary , caused significant drowsiness and giddiness affecting his quality of life . cough reflex is mediated by the stimulation of the vagal primary afferent nerve distributed along the tracheobronchial tree . thus , rapidly adapting receptors of the vagal afferents are known to be evoked by mechanical stimuli and deformity in the airway epithelium , which results in cough . thus , an unresectable mass in the mediastinum acts as a constant source of irritation for the airway which in turn triggers cough . we used gabapentin in our patient with successful control in cough intensity , duration , and frequency . gabapentin is a lipophilic structural analog of the neurotransmitter gamma aminobutyric acid which is proven to have a central action . it is known to act on the alpha 2 and delta receptor of calcium channel inhibiting the release of neurotransmitters such as substance p , a tussigenic agent , and possibly inhibits the n - methyl - d - aspartate receptors . recent trials have shown the superiority of gabapentin in reducing the frequency and intensity of cough . peripheral cough sensitivity to capsaicin was not changed by gabapentin which proves its central effect . in the same study , there was a significant improvement in cough related quality of life in the gabapentin arm . the common side effects of gabapentin include dizziness , fatigue , headache , and confusion which was not reported by our patient .", "there is , thus , a need to explore the use of neuromodulatory agents in symptom conditions which are known to have a neural origin such as cough , pruritus , and hiccoughs .", "", "" ]

[ "dipeptidyl peptidase4 ( dpp4 ) inhibitors improve glycemic control in patients with type 2 diabetes by preventing degradation of two incretin hormones , glucagonlike peptide1 ( glp1 ) and glucosedependent insulinotropic polypeptide ( gip ) , that are secreted from the intestine on ingestion of various nutrients . recent studies have shown associations of dpp4 inhibitors efficacy with age and fasting plasma glucose levels , as well as baseline glycated hemoglobin ( hba1c ) and body mass index ( bmi ) , but clinical parameters that predict the efficacy of dpp4 inhibitors are largely unknown . the present study showed that alterations in hba1c level on administration of dpp4 inhibitors as monotherapy are associated with estimated intake of fish , estimated intake of dietary n3 polyunsaturated fatty acid ( pufa ) , and serum levels of eicosapentaenoic acid ( epa ) and docosahexaenoic acid ( dha ) .", "the protocol was approved by the ethics committee of kansai electric power hospital , and carried out in accordance with the principles of the declaration of helsinki . a total of 72 untreated japanese patients with type 2 diabetes ( the japan diabetes society criteria of 2010 ; age 64.6 11.3 years ; duration of diabetes 9.0 8.9 years ; baseline hba1c 7.2 0.7% ; bmi 24.5 4.3 kg / m ) who had been on diet and exercise therapies participated in the current study . dpp4 inhibitors ( sitagliptin , alogliptin or vildagliptin ) were given for 4 months and no other antidiabetic drugs were used during the period . a total of 59 patients received sitagliptin , 12 received alogliptin and one received vildagliptin . hba1c levels were determined before the initiation of dpp4 inhibitors and 4 months after the initiation of dpp4 inhibitors , and were shown in national glycohemoglobin standardization program values , as recommended by the japan diabetes society . fasting serum levels of dha , epa and arachidonic acid ( aa ) were determined based on fatty acid composition of total lipids including phospholipids , triglycerides and cholesteryl esters in the serum of 20 patients ( age 63.1 11.7 years ; duration of diabetes 6.7 5.7 years ; baseline hba1c 7.0 0.8% ; bmi 24.2 3.1 kg / m ) before initiation of dpp4 inhibitors . selfadministered 3day food records , which were recorded during the 4month period , were analyzed for estimated intake of various nutrients using healthy maker pro 501 ( mushroomsoft co. , ltd . , all statistical calculations were carried out using pasw statistics 18 ( sas institute inc . , cary , nc , usa ) , including linear regression analyses of the associations between changes in hba1c levels and various parameters . multiple linear regression analyses were carried out to identify the parameters potentially associated with hba1c reduction , and simple regression analyses were carried out to evaluate their contributions .", "in the present study , dpp4 inhibitors , similarly to previous reports , significantly reduced hba1c levels , but not bodyweight ( before initiation of dpp4 inhibitors 7.2 0.7% ; 4 months after initiation of dpp4 inhibitors 6.7 0.6% [ paired ttest , p < 0.01 vs before ] ) . multiple regression analysis of hba1c reduction ( hba1c ) taking into account sex , age , duration of diabetes , bmi , baseline hba1c and estimated intake of various food categories in 3day food records showed that hba1c was well correlated with baseline hba1c , but not with bmi ( table 1 ) . hba1c also showed a significant association with estimated intake of fish and seafood in the food records ( figure 1a and table 1 ) . among fish and seafood , estimated intake of fish , but not shellfish and other seafood , showed a significant association with hba1c ( table s1 ) . the beneficial effects of fish on human health have been partly attributed to pufa , such as epa and dha . hba1c was significantly correlated with estimated intake of epa and dha , along with baseline hba1c ( figure 1b and table s2 ) . as serum epa and dha levels might serve as markers for intake of corresponding fatty acids ( figure s1 ) , we analyzed associations of hba1c with serum epa and dha levels . serum levels of epa and dha , but not n6 pufa arachidonic acid , were well correlated with hba1c ( figure 1c ) . although hba1c reduction showed a significant association with estimated intake of milk products ( table 1 ) , we were unable to find nutrients in milk products , including saturated fatty acids , that were responsible for the association . multiple regression analysis regarding changes of glycated hemoglobin ( hba1c ) levels ( hba1c ) by taking into account sex , age , duration of diabetes , body mass index ( bmi ) , baseline hba1c ( national glycohemoglobin standardization program [ ngsp ] ) and estimated intake of various food categories in 3day food records in 72 patients with type 2 diabetes . statistical calculation was carried out using pasw statistics 18 ( sas institute inc . ) . b and denote nonstandardized and standardized regression coefficients , respectively . for analysis of changes of hba1c levels , the correlation coefficient squared ( r ) was 0.550 and the fvalue with 15 degrees of freedom was 3.499 for a pvalue of 0.003 . ( a ) correlation between estimated intake of fish and seafood with glycated hemoglobin ( hba1c ) reduction ( national glycohemoglobin standardization program [ ngsp ] , % ) 4 months after initiation of dipeptidyl peptidase4 inhibitors ( hba1c ; n = 72 ) . ( b ) correlation between estimated intake of eicosapentaenoic acid ( epa ) , docosahexaenoic ( dha ) with hba1c ( n = 72 ) . ( c ) correlation between serum levels of epa , dha and arachidonic acid ( aa ) with hba1c ( n = 20 ) . linear regression analyses were carried out to calculate the correlation coefficient ( r ) and pvalues .", "we find that changes of hba1c levels on administration of dpp4 inhibitors are associated with estimated intake of fish and estimated intake of dietary n3 pufa , as well as serum epa and dha levels . despite being a retrospective cohort study with a limited sample size , these findings are clinically important in two respects : ( i ) the efficacy of dpp4 inhibitors can be predicted by serum epa and dha levels ; and ( ii ) consuming more fish with diet therapy can enhance the efficacy of dpp4 inhibitors . furthermore , the current findings suggest that the differing efficacies of dpp4 inhibitors found among different ethnicities might be partly a result of differences in fish consumption . although many studies have shown the beneficial effects of dietary n3 pufa from fish , the mechanisms involving dietary n3 pufa in dpp4 inhibitor efficacy have not yet been investigated . although epa and dha have been shown to prevent excessive adiposity , thereby ameliorating insulin resistance in animal models , the effects of n3 pufa on glycemic control in type 2 diabetes itself are somewhat controversial . interestingly , it has been found that epa and dha enhance glp1 secretion , possibly through free fatty acid receptors , such as gpr120 , in glp1secreting cells and mice . it is thus possible that dietary n3 pufa and dpp4 inhibitors synergistically increase biologicallyactive glp1 levels to facilitate maintenance of glycemic control , but it remains to be determined whether epa and dha enhance glp1 secretion in patients with type 2 diabetes . in addition , whether the present findings hold true for dpp4 inhibitors in general is not known , as most of the patients in the current study received sitagliptin or alogliptin , and vildagliptin patients were limited . we find that the reduction of hba1c by dpp4 inhibitors significantly correlates with estimated intake of fish , estimated intake of epa and dha , and serum levels of epa and dha .", "figure s1 correlation between estimated intakesand serum concentrations of eicosapentaenoic acid ( epa ) anddocosahexaenoic ( dha ; n = 16 ) . table s1 association of glycated hemoglobin(hba1c ) reduction and estimated intake of fish , shellfish and other seafood table s2 association of glycated hemoglobin(hba1c ) reduction and estimated intake ofpolyunsaturated fatty acids click here for additional data file ." ]

[ "for patients with non - small cell lung cancer ( nsclc ) , physicians have long been puzzled by the task of identifying candidates who may suffer major postoperative cardiopulmonary complications if they were to undergo lung resection surgery . among the few available tests , the cardiopulmonary exercise test ( cpet ) is a standard tool to assess the surgical risk of patients with nsclc [ 13 ] . specifically , maximal oxygen uptake ( vo2max ) during symptom - limited exercise was found to be a more reliable than other parameters of spirometry , such as forced expiratory volume in 1 second ( fev1 ) or the ratio of fev1 against forced vital capacity ( fvc ) , to predict postoperative morbidity and mortality among nsclc patients . as an alternative to cpet , excise - based diagnostic tests , such as stair - climbing test ( sct ) , have been reported to be a safe , economical way to assess risk - associated factors of patients [ 47 ] . interestingly , for patients with nsclc , since sct requires patients to ride cycles , it is more stressful than cardiopulmonary exercise and can be considered as valid tool to detect any abnormalities in the oxygen transport system . thus , it is plausible that sct may be helpful in predicting cardiopulmonary complications after lung resection . however , definitive evidence is lacking to determine whether sct is superior to cpet to predict postoperative cardiopulmonary complications for patients with nsclc . in this study , we used statistical methods to assess whether the key parameters of sct , including exercise oxygen desaturation ( eod ) , may be independent and proficient prognostic factors predicting postoperative cardiopulmonary complications among patients with nsclc who received various extents of lung resection .", "in this study , all protocols were reviewed and approved by the ethics committee at the cancer hospital ( institute ) , chinese academy of medical sciences in beijing , china . a total of 413 patients with non - small cell lung cancer ( nsclc ) performer the stair - climbing test between january 2010 and july 2015 . we excluded 74 patients due to lack of complete clinical data , 53 patients were excluded because they failed to correctly perform the pulmonary function test , 12 patients were excluded as they received lung resection and esophagectomy at the same time , and 103 patients were excluded because they did not receive surgery afterwards . thus , 171 eligible nsclc patients were enrolled in this study , including 41 females and 130 males . none of the patients had received any antineoplastic therapy such as radiotherapy and/or chemotherapy in the 6 months prior to surgery . all patients in the study participated in the symptom - limited stair - climbing test preoperatively by climbing 5 floors from the 1 floor to the 6 floor in our surgical building . there are 20 steps and 1 intermediate landing between each floor , and each step is 0.153 m in height . the patients were instructed before the stair - climbing test and encouraged to climb the stairs as fast as they could without stopping to rest until they reached the highest floor possible . the maximum height ( to the 6 floor ) was 18.4 m. the test was complete when patients reached either the 6 floor or the patients presented an apparent symptom such as severe dyspnea with oxygen desaturation , severe leg fatigue , or chest pain , which indicated exhaustion and they could not climb any more . all patients were accompanied by 2 physicians all the time during the test , who would monitor their symptoms and recorded test results simultaneously . heart rate and capillary oxygen saturation were recorded before the test , at each floor during the test , and after resting for 15 min after completing the test , using a portable pulse - oxy meter with finger probe , called the autobox ( newtech , shenzhen , china ) . the resting oxygen saturation ( osat ) and lowest osat during the test were recorded and used to calculate the desaturation level . for air leak management , single thoracic drainage in the chest was induced into the 2 intercostal space , midclavicular line ( pneumonectomy ) , and the 7 intercostal axillary line ( wedge resection and lobectomy ) . with the exception of pneumonectomy , all the drainage tubes were put into the chest with the front - most end reaching the top of the chest . at the end of the operation , residual lung tissues were carefully examined , and then air - leak tissue was stitched by prolene thread until there was no air leak from the residual lung tissue . spirometry , flow - volume curves , and absolute lung volumes were measured using a pulmonary function test apparatus . the diffusion capacity for carbon monoxide ( dlco ) was determined using a standard single - breath technique . best results were selected in 2 acceptable measuring results at intervals of at least 510 min between 2 measurements . all patients underwent surgical resection for lung cancer by either thoracotomy ( n=129 ) or video - assisted thoracoscopic surgery ( vats , n=42 ) . procedures included pneumonectomy in 22 cases , lobectomy in 122 cases , and pulmonary wedge resection in 27 cases . postoperative treatment was focused on early mobilization , chest physiotherapy and physical rehabilitation , pain control , and antibiotic and anti - thrombotic prophylaxis . postoperative complications and deaths were defined as those occurring 030 days postoperatively , according to the guideline reported by bolliger et al . , smith et al . , and brutsche et al . . statistical analyses were performed using sas software ( sas institute , cary , nc ) . categorical variables of clinical characteristics are shown as percentages and were compared using the chi - square test . continuous variables are presented as means standard deviations and compared by use of the t test . the utility of the complication as a predictive marker for drainage tube length of postoperative stay and hospital stay was investigated using kaplan - meier analysis . logistic regression analysis was used to determine the association of preoperative factors with postoperative complications . factors with a significant difference in univariate analysis ( p value < 0.05 ) were measured again by multivariate analysis to determine their independence . a p value", "in this study , all protocols were reviewed and approved by the ethics committee at the cancer hospital ( institute ) , chinese academy of medical sciences in beijing , china .", "a total of 413 patients with non - small cell lung cancer ( nsclc ) performer the stair - climbing test between january 2010 and july 2015 . we excluded 74 patients due to lack of complete clinical data , 53 patients were excluded because they failed to correctly perform the pulmonary function test , 12 patients were excluded as they received lung resection and esophagectomy at the same time , and 103 patients were excluded because they did not receive surgery afterwards . thus , 171 eligible nsclc patients were enrolled in this study , including 41 females and 130 males . none of the patients had received any antineoplastic therapy such as radiotherapy and/or chemotherapy in the 6 months prior to surgery .", "all patients in the study participated in the symptom - limited stair - climbing test preoperatively by climbing 5 floors from the 1 floor to the 6 floor in our surgical building . there are 20 steps and 1 intermediate landing between each floor , and each step is 0.153 m in height . the patients were instructed before the stair - climbing test and encouraged to climb the stairs as fast as they could without stopping to rest until they reached the highest floor possible . the maximum height ( to the 6 floor ) was 18.4 m. the test was complete when patients reached either the 6 floor or the patients presented an apparent symptom such as severe dyspnea with oxygen desaturation , severe leg fatigue , or chest pain , which indicated exhaustion and they could not climb any more . all patients were accompanied by 2 physicians all the time during the test , who would monitor their symptoms and recorded test results simultaneously . heart rate and capillary oxygen saturation were recorded before the test , at each floor during the test , and after resting for 15 min after completing the test , using a portable pulse - oxy meter with finger probe , called the autobox ( newtech , shenzhen , china ) . the resting oxygen saturation ( osat ) and lowest osat during the test were recorded and used to calculate the desaturation level . for air leak management , single thoracic drainage in the chest was induced into the 2 intercostal space , midclavicular line ( pneumonectomy ) , and the 7 intercostal axillary line ( wedge resection and lobectomy ) . with the exception of pneumonectomy , all the drainage tubes were put into the chest with the front - most end reaching the top of the chest . at the end of the operation , residual lung tissues were carefully examined , and then air - leak tissue was stitched by prolene thread until there was no air leak from the residual lung tissue .", "spirometry , flow - volume curves , and absolute lung volumes were measured using a pulmonary function test apparatus . the diffusion capacity for carbon monoxide ( dlco ) was determined using a standard single - breath technique . best results were selected in 2 acceptable measuring results at intervals of at least 510 min between 2 measurements .", "all patients underwent surgical resection for lung cancer by either thoracotomy ( n=129 ) or video - assisted thoracoscopic surgery ( vats , n=42 ) . procedures included pneumonectomy in 22 cases , lobectomy in 122 cases , and pulmonary wedge resection in 27 cases . postoperative treatment was focused on early mobilization , chest physiotherapy and physical rehabilitation , pain control , and antibiotic and anti - thrombotic prophylaxis . postoperative complications and deaths were defined as those occurring 030 days postoperatively , according to the guideline reported by bolliger et al . ,", "statistical analyses were performed using sas software ( sas institute , cary , nc ) . categorical variables of clinical characteristics are shown as percentages and were compared using the chi - square test . continuous variables are presented as means standard deviations and compared by use of the t test . the utility of the complication as a predictive marker for drainage tube length of postoperative stay and hospital stay was investigated using kaplan - meier analysis . logistic regression analysis was used to determine the association of preoperative factors with postoperative complications . factors with a significant difference in univariate analysis ( p value < 0.05 ) were measured again by multivariate analysis to determine their independence .", "a total of 171 non - small cell lung cancer patients were included in the study . one of these deaths was a 75-year - old male and another was a 59-year - old female , whose exercise oxygen desaturation ( eod ) were both greater than 5 , and both died from respiratory failure 1 and 80.5 , respectively , days postoperatively despite being supported by mechanical ventilation . the third patient was a 64-year - old male who died from postoperative bleeding in the chest after a lobectomy . there was no air leak from the chest of patients for more than 2 days before closing the chest , and no patient had empyema . baseline information and the comparison between the complication group and the complication - free group are shown in table 2 . there were no significant differences in sex ratio , bmi , smoking , lung resection , spirometry measurements ( fev1 , mvv% , dlco and dlco% ) , or stair - climbing test results ( pre - climb sao2 , climbing - end sao2 , and climbing - end heart rate ) between the groups . while comparing those parameters between the complication group and the complication - free group , there were significant differences in age , fev1% , mvv , height of climbing , eod , and heart rate change between the 2 groups . finally , logistic regression analysis showed that eod and heart rate change were independent predictors of complications ( table 3 ) . a model for predicting the probability of postoperative complications based on logistic regression was hypothesized as : probability = e/(1+e ) , =1.136 + ( 0.114eod ) + ( 0.040heart rate change ) , in which e represented the base of natural logarithms and the was the regression coefficient in the logistic regression . the accuracy of the model was evaluated by use of the roc curve , which showed that the area under the roc curve ( auc ) was 0.750 ( 95% ci : 0.6680.831 ) ( figure 1 ) . if the cutoff probability value was larger than 0.193 , the patient was considered to have high risk of suffering from postoperative cardiopulmonary complications , and vice versa . patients without a postoperative cardiopulmonary complication had a median length of drainage time of 4.3 days ( 95% ci , 3.44.5 ) and a median length of hospital stay of 9.4 days ( 95% ci , 8.99.8 ) , as compared to 5.9 days ( 95% ci , 5.36.4 ) ( figure 2 , p<0.001 ) , and 13.1 days ( 95% ci , 10.915.3 ) ( figure 3 , p<0.001 ) for patients with postoperative complications .", "complications such as chronic obstructive pulmonary disease ( copd ) and coronary artery disease are very common among those patients , with high risk of surgical morbidity and mortality . thus , it is critical to perform preoperative assessment on cardiopulmonary function to predict the risk of postoperative complications and death . use of vital capacity for the prediction of surgical risk was first reported as early as 1955 . since then , lung functional testing has been used to predict the risk of postoperative complications and even mortality . the 2 most commonly used parameters of conventional pulmonary function test are fev1 and dlco , which were confirmed by univariate analysis in our study . however , multivariate analysis showed that fev1% was not an independent predictor of postoperative complications for patients with nsclc . before this study , poor exercise capacity has long been used as the major predictor of postoperative cardiopulmonary complications after lung resection in patients with nsclc . however , nsclc patients with poor exercise capacity not only have high risk of postoperative cardiopulmonary complications , but also have longer hospital stay . in the present study , our results showed that eod and heart rate change were independent predictors of postoperative cardiopulmonary complications for patients with nsclc , confirming the predictions from other studies . brunelli reported that complication rates in patients with and without eod > 4% and < 4% were 36% and 22% , respectively . in addition , a previous study by our team found the rate of postoperative cardiopulmonary complications was significantly higher in patients with eod 5% and heart rate change < 55 beats / min than that in the group with eod < 5% and heart rate change 55 beats / min . therefore , in the present study , we successfully established a model to predict the risk of postoperative cardiopulmonary complication using scts parameters of eod and heart rate change . it is worth noting that , in the present study , the patients without postoperative cardiopulmonary complication had a shorter hospital stay than those with postoperative cardiopulmonary complications . also , the patients without postoperative cardiopulmonary complication had a shorter drainage time than those with postoperative cardiopulmonary complications . the possible explanation is that a patient who has postoperative cardiopulmonary complications creates more pleural effusion than one does not , further confirming that sct may be an effective method to predict postoperative cardiopulmonary complications in nsclc patients . however , well - established formal cardiopulmonary exercise testing ( cpet ) is still be recommended for precise assessment of these patients with high eod or low heart beat change during the stair - climbing test .", "we provided definitive evidence that eod and heart rate change in sct are independent predictors for postoperative cardiopulmonary complications in nsclc patients . a follow - up study with a much larger patient pool however , based on the information of our study , it is highly recommended for all lung resection candidates with poor conventional function test results to perform a stair - climbing test ." ]

[ "total joint replacement usually represents the final route for treatment of degenerative disease of the knee . joint replacements are more and more frequent and routine these days thanks to , for example , the consequent aging of the general population , increased functional requirements , and the development and use of new materials and more sophisticated surgical techniques . in this context , there is a need to develop new protocols for management and use of transfusion therapies in the field of orthopedic surgery . transfusion of homologous blood are frequent and costly and expose patients to potential risks of infection [ 1 , 2 ] ; hence several methods have been proposed to avoid them [ 3 , 4 ] . preoperative blood donation and intra- and postoperative blood collection and administration of pharmaceutical agents to either reduce blood loss ( e.g. , tranexamic acid ) or stimulate the production of erythrocytes ( e.g. , erythropoietin ) have been proposed as alternative techniques to transfusion of homologous blood in various studies [ 3 , 4 ] . in the scientific literature , there are several reports of studies where reinfusion of blood collection in postoperative orthopedic surgery , especially in prosthesis surgery [ 514 ] , is analyzed . the aim of the present study was to verify the safety , the clinical efficacy , and the possible benefits of reinfusion of postoperatively collected autologous blood in total knee replacement procedures , with special emphasis on cost - benefit and reinfusion procedure , by comparing autologous blood transfusion with nonautologous blood transfusion .", "between 2011 and 2012 , one hundred twenty - four patients with a mean age of 71.2 6.8 years and a range between 50 and 84 years were included in the study . the first group consisted of a series of sixty - four consecutive patients ( male to female ratio 1 : 5 , range of age between 62 and 84 years ) , who underwent one stage unilateral total knee arthroplasty using a blood reinfusion device in 2012 . fifty - eight of these patients received autologous transfusion and six patients were excluded , five due to systemic pathologies . the control group consisted of sixty consecutive patients ( male to female ratio 1 : 3 , age ranging from 50 to 79 years ) . this population was operated on consecutively in 2011 but is not subjected to autologous blood reinfusion because we have been using this device since january 1 , 2012 . before any study - related measures were taken all patients read and signed informed consent for any possible transfusion of homologous red blood cell and a specific consent for reinfusion , after adequate information on possible risks and benefits of both methods . the manuscript was performed in accordance with the ethical standards of the 1964 declaration of helsinki as revised in 2000 ; for this type of study formal consent is not required . antibiotic prophylaxis was obtained by administration of ceftriaxone 1 g intramuscular injection once daily and teicoplanin 800 mg intravenous injection once daily , 30 minutes before inducing anaesthesia . antithrombotic prophylaxis was obtained by administration of enoxaparin sodium 4,000 i.u . once daily by subcutaneous injection for 35 days , 12 hours before surgery ; two patients had an urticarial reaction and therefore it has been replaced with fondaparinux sodium 2.5 mg once daily by subcutaneous injection for 35 days . patients were subjected to surgical intervention for unilateral primary arthroplasty knee , by implanting a zimmer 's nexgen cemented prosthesis or how medical 's triathlon prosthesis . surgery was carried out by the same surgeon on all patients ; a standard surgical procedure was performed including a longitudinal medial skin incision and median parapatellar quadriceps splitting approach . limb ischemia was achieved through temporary leg loop tire located at the root of the limb and the tourniquet was deflated after the step of cementing . postoperative pain was controlled with paracetamol 100 ml/10 mg endovenous with a 4-hour minimum interval between each administration . bellovac abt is a drainage system for postoperative collection , filtration , and reinfusion of shed autologous blood . it consists of all components required for collection and reinfusion of one unit of shed autologous blood . the initial negative suction pressure is 90 mmhg ( 12 kpa ) , generating safe and efficient drainage . once the recovery of shed blood is completed ( within < 6 hours ) the transfusion bag can be replaced with a collection bag for evacuation only , thus serving as a simple wound drainage ( card system technical bellovac abt for drainage and the recovery of the blood postoperative manufacturer : astra tech ab , via cristoni , casalecchio di reno ( bo ) ) . for all patients , we decided that a homologous transfusion therapy was only indicated for haemoglobin values below 8 g / dl . the study group consisted of a series of sixty - four consecutive patients with mean age 73.3 5.7 years ( 14 males and 50 females ) , while the control group consisted of sixty consecutive patients with mean age 69 7.2 years ( 18 males and 42 females ) . we excluded patients with systemic pathologies such as uncompensated diabetes mellitus , cancer , severe cardiovascular pathologies , immunodepression , anticoagulating or antiaggregating therapy , coagulation disorders including deep venous thrombosis , and ongoing infections . we considered as discriminating factors hemoglobin values < 12 g / dl for women and < 14 g / dl for men . length of surgery was 2.24 0.38 hours in the study group versus 2.06 0.32 hours ( p = 0.17 ) . hemoglobin values ( hb ; g / dl ) were checked preoperatively , immediately after surgery , on the first day and the second day after the operation , and on discharge . they were later compared between groups . in the study group , patients were subjected to a microbiological culture of a blood sample ( 20 ml ) from the bag of postoperative recovery , at the end of the procedure of reinfusion . in our hospital , the transfusion medicine unite has provided the following expense items : the cost of an autologous blood retransfusion system is around 68,00 , while the costs of an allogenic blood transfusion , including cross - matching , delivery , and refrigerated storage , are stated to be 270 . added costs of the postoperative drain and the abt system are 20 and 68 , respectively . all data are presented as mean sd or median ( iqr ) as appropriate . groups were compared using the one - way anova or t - test for normally distributed data and the nonparametric kruskal - wallis or mann - whitney u test for non - normally distributed variables .", "the study group consisted of a series of sixty - four consecutive patients with mean age 73.3 5.7 years , 14 male and 50 female , while the control group consisted of sixty consecutive patients with mean age 69 7.2 years , 18 male and 42 female ( p < 0.05 ) . the average body weight of the study group was 70.8 8.8 kg and 73.1 8.0 kg ( p = 0.43 ) . in the study group , all the patients received autologous blood transfusion . in the first six hours 400 122.4 ml ( min . 600 ) was collected and retransfused ; within 24 hours there was 198.5 142.4 ml of blood drained in the drainage . in the control group , because of the intraoperative use of a tourniquet , intraoperative blood loss was negligible in both groups . we noticed a reduction rate of allogeneic blood transfusion between the study and the control group ( 10.3% versus 30% ; p = 0.08 ) . six patients in the study group , four women and two men , were subjected to allogeneic transfusion , five patients received one unit of homologous blood between the second and fourth days postoperatively , and one patient received two units of homologous blood . , we registered 18 patients who received homologous blood transfusion ; each one had received a bag of homologous whole blood . the transfusion trigger in the abt group ( n = 6 ) was 7.5 0.1 g / dl , whereas that in the control group ( n = 18 ) was 7.3 0.2 g / dl ( p = 0.09 ) . one unit of red blood cells can be expected to result in a hemoglobin increase of 1 g / dl in a typical adult . in the abt group we recorded an increase in hemoglobin equal to 0.7 0.3 ( g / dl ) , after autologous transfusion . in this group we recorded an increase in hemoglobin equal to 1.3 0.2 ( g / dl ) ( n = 7 bags ) versus 0.9 0.1 ( g / dl ) ( n = 18 bags ) in the control group after homologous transfusion ( p < 0.01 ) . therefore , we noticed a greater rise in hemoglobin after homologous transfusion in the group given reinfusion ( figure 1 ) . the tourniquet time was 1.13 0.27 hours in study group versus 1.04 0.27 hours in control group ( p = 0.36 ) . in the study group the mean length of stay at the hospital ( los ) was 7.88 0.7 days , while it was 8.96 2.47 days for the control group ( p = 0.03 ) . really , we did not find any significant difference for hemoglobin count between groups from admission to hospital discharge ( table 1 and figure 2 ) ; as expected , we did not find any difference between groups considering the reduction in hemoglobin for study 's time points ( table 2 and figure 3 ) . \n the results of microbiological cultures performed on blood samples taken from the postoperative blood bag at the end of the procedure of reinfusion were negative in all cases . in our study a total knee replacement surgical procedure , along with the complementary use of a device for postoperative collection and reinfusion of shed blood resulted in an average reduction of the length of hospital stay equal to 1.08 0.76 days ( p = 0.03 versus control ) . the cost of an autologous blood retransfusion system is around 68,00 , while the costs of a allogeneic blood transfusion are stated to be 270 , including cross - matching , delivery , and refrigerated storage . in the present study , 18 allogeneic transfusions were given in the no - drainage group , while 7 allogeneic transfusions were given in the abt group , at a cost of 4.860,00 and 1.890,00 , respectively . the additional costs of the postoperative drain and the abt system were 20 and 68 , respectively , in either group at a cost of 1.160,00 ( n = 58 ) and 4.352,00 ( n = 64 ) . the average cost per patient turned out to be lower in the group receiving reinfusion ( 97.53 versus 103.79 ; p < 0.01 ) .", "primarily , autologous blood reduces the need for allogeneic blood transfusion ; furthermore , it prevents the transmission of viral diseases ( hepatitis c virus , hepatitis b virus , human immunodeficiency virus , and creutzfeldt - jacob virus ) , transfusion reactions , and transfusion errors [ 16 , 17 ] . the main advantage of postoperative collection and reinfusion of shed blood is this method 's simplicity ; hence it finds its application in traumatized patients . however , its main disadvantage is the risk of contamination during blood collection [ 8 , 18 ] . identify some possible complications of collection of red blood cells , such as nonimmunologic haemolysis , gas embolism , nonhaemolytic transfusion reaction , coagulopathies , contamination with drugs , the intraoperative use of washing solutions in the surgical site and infectious agents , cytokines , and other microaggregates . the risk of complications decreased due to improvement of techniques and practices as well as increased experience with autologous blood collection systems . cleveland clinic has performed a five - year retrospective study of complications , with both homologous and collected shed blood , noting that the incidence of complications with collected blood was around 0.027% compared to 0.14% of homologous blood . in our study the results of microbiological cultures performed on blood samples taken from the postoperative blood bag at the end of the reinfusion were negative in all cases . the purpose of collection of shed blood is to reduce or eliminate the need for homologous blood transfusion and the associated risk of infectious and noninfectious complications . during 2006 , a meta - analysis of the recovery of red blood cells in adult elective surgery showed that recovery of blood could reduce the need for homologous blood transfusion . the use of recovered red blood cells has reduced the exposure to allogeneic blood by 39% with an average saving of 0.67 units per patient . in 2013 a meta - analysis proved that the use of a postoperative autotransfusion reinfusion system reduced significantly the demand for allogeneic blood transfusions . it also cut the number of patients who needed allogeneic blood transfusions and the cost of hospitalization after total knee arthroplasty . collection of blood in orthopedic surgery results in greater safety and efficacy [ 2426 ] . 94 cases have been studied but a power analysis of the study was not performed ; however , we argue that the use of a device for autologous blood collection and washing results in an average reduction of 4 units of allogeneic blood and cost savings of an average of 406.84 dollars per patient . in the literature these authors suggest that autologous blood transfusion drains have no effect on the proportion of transfused patients in primary total knee arthroplasty [ 2834 ] . the postoperative hemoglobin levels , the length of hospital stay , and the adverse events are also comparable between groups . in our opinion autologous blood collection and reinfusion , by the use of postoperative systems , is a procedure that allows limiting the transfusion of homologous blood to patients undergoing tkr , improving the postoperative course from a psychophysical point of view and allowing an early transfer to rehabilitation unit . we noticed a reduction in allogenic blood transfusion between the study and the control group ( 10.3% versus 30% ; p = 0.08 ) . reinfusion group patients also displayed a reduction in the length of stay in hospital by 1.08 0.76 days ( p = 0.03 versus control ) . concerning costs , the question is whether savings derived from the reduction in allogeneic blood transfusion requirements outweighed the extra costs of the abt system . zacharopoulos et al . stated that use of the postoperative blood reinfusion systems is highly effective in reducing the demand for homologous blood transfusion for patients undergoing total knee replacement surgery , resulting in important cost savings in the management of these patients . a previous study observing patients undergoing tka found net savings in different cost scenarios of 5 to 106 per patient with the same abt system as used in this study and 52 to 50 per patient with another abt system . a review of cost - effectiveness on blood - saving measures stated that cell salvage had lower costs compared with all of the alternative blood - saving strategies except acute normovolemic dilution and concluded that autotransfusion may be a cost - effective method to reduce allogeneic transfusions [ 37 , 38 ] . the evidence that supports the use of red blood cell recovery in knee prosthesis is stronger and comprises randomized studies and one large retrospective review [ 39 , 40 ] . the average cost per patient was found to be lower in the group receiving reinfusion ( 97.53 versus 103.79 ; p < 0.01 ) . this work presents a lot of strengths such as the same characteristics of the sample , the surgical technique performed by the same surgeon , and the rigorous cost analysis ; on the contrary we are aware of some weaknesses such as the retrospective design .", "this study has confirmed the absolute safety of the device and the absence of bacteria in examined samples . our results emphasize the effectiveness of this procedure and have the characteristics of simplicity , low cost , easy reproducibility , and safety . in addition , this recovery system replaces the simple postoperative surgical drainage , representing a further saving of economic resources . finally we conclude that the use of the shed blood recovery system bellovac abt constitutes a valid device , which can find wide application in orthopedics , especially in the context of total knee replacement surgery ." ]

[ "this may be spontaneous or secondary to mechanical factors like vigorous scratching or combing the hair .", "a 19-year - old female patient presented with short , rough , and unruly hair on the scalp since childhood . patient gave a history of knots getting caught in fine - toothed comb whenever the scalp was combed with breakage of few hairs . there was no history of excessive cosmetic use or parlor activities for hair care . on examination , the scalp hairs were dry , curly , and short in length up to the nape of neck , transverse split ends ( trichoschisis ) were seen in majority of hairs [ figure 1 ] . microscopic examination of the hair shaft revealed knotted portions of hair ; no other shaft abnormalities were noted except for trichoschisis at the distal portion of the shaft [ figure 5 ] . short curly hair on the scalp small nodules on the distal portion of hair shaft sparse hair in the temporal region trichonodosis and trichoschisis in light microscopy", "there are two types , one rare variety of unknown etiology involves abnormally growing scalp and body hair with spontaneous trichonodosis which is predisposed to splintering and fracturing . the second commoner type , encountered in patients with normal scalp and body hair , is considered secondary to mechanical forces such as combing and brushing . the hairs in this type are dry and curly , but no abnormality in structure or growth pattern occurs . rarely , more than one knot is found on a single hair and most were a simple half hitch knot . when the hair of subjects with trichonodosis was combed or brushed , knots were observed to catch in fine toothed combs and to a lesser extent , in brushes . in those with extensive trichonodosis , breakage usually occurred at the knot , but proximal breakage and several uprooted telogen hairs were also seen . kinky hair tends to be flat in cross section , whereas curly or straight hair is oval to round . these flat or ribbon - shaped hairs do not lie flat on a level surface but remain spiral . this recoiling may lead to an entanglement which , by chance , forms a knot that results in trichonodosis . mechanical factors such as scratching , combing , washing or friction may produce tangling and knotting of hairs . the pubic and thigh regions are most frequently involved since curliness of the hairs in those areas predisposes them to knotting . if the knots are pulled excessively tight , transverse splintering of the hair shaft and simulation of trichorrhexis nodosa may result . these knots resemble the ova of body , head and pubic lice and light microscopic examination is necessary for differentiation . the nodules in trichonodosis are located distally , whereas the ova are located in the proximal shaft . acquired type of trichonodosis due to mechanical factors is a common occurrence but reported less in literature . spontaneous type of trichonodosis associated with abnormal scalp and body hair is a rare occurrence . this type starts at an early age and hair breaks away after a particular length due to the fracture of hair shaft at the knot . trichonodosis must be considered when patients with kinky hair complain of hair loss or breakage , and the cause is not apparent ." ]

[ "neural plasticity is the brain 's ability to change in response to normal developmental processes , experience , and injury . the mechanisms involved in plasticity in the nervous system are thought to support cognition , meaning that brain function is improved . there is evidence from neuroimaging that subjects achieving high scores on cognitive tasks compared to low performers complete these tests with lower cortical activation particularly in the frontal brain region [ 1 , 2 ] . hypothesis , assuming that experts with high cognitive performance are characterized by a more efficient cortical function . . suggest that this particular characteristic can only be inferred from brain activation , when experts and nonexperts are compared at similar behavioral performance . within the last years this hypothesis has been extended to experts of movement - related tasks . in this respect , standard eeg techniques have been used to investigate the effect of performance level on the allocation of cortical resources during motor tasks . during the preparation of a shot , haufler et al . observed less cortical activity in skilled shooters compared to novice subjects . in line with this finding , del percio et al . also found decreased cortical activity in experts prior to a shot requiring high precision and interpreted this observation as index for selective event- or task - related cortical activation . neural efficiency has also been confirmed in professional piano players , who completed a motor task involving finger movements with lower cortical activity than less skilled controls . although these findings consistently support the efficiency of cortical function in athletes , some evidences from tasks requiring movements in response to visual stimuli question the general applicability of this hypothesis . in this respect , hung et al . reported higher lateralized readiness potentials during posner 's visuoattentional task in elite tennis players compared to nonathletes . in line with these results , endo et al . showed that athletes had greater motor cortex activity than nonathletes during a task , in which subjects were asked to abduct the right index finger in response to visual stimuli . evidence from longitudinal studies investigating effects of motor training consistently supports the efficiency of cortical function in high performers , because motor cortex activity decreased despite improvements on task performance after a training period [ 5 , 10 , 11 ] . similarly , 4 weeks of endurance training in cyclists led to improved aerobic performance but decreased brain cortical activity during exercise . based on those findings , the neural efficiency hypothesis might also be applicable to endurance athletes . so far researches have not yet investigated efficacy of cortical function during exercise between subjects of different aerobic performance levels . however , the current state of research indicates that resting eeg rhythms predict neural efficiency during cognitive and sensorimotor tasks . alpha synchronization at rest represented by high eeg alpha power is related to increased cognitive and motor performance [ 13 , 14 ] . in line with these findings , elite karate athletes compared to nonathletes show higher alpha-1 power at parietal and occipital regions at rest with eyes closed . moreover , training levels also influence the reactivity to eyes opening , so that athletes maintain higher alpha power than nonathletes . whereas alpha is considered the dominant rhythm in the human brain during mental inactivity , beta activity is regarded as index of information processing at the cognitive level . in previous studies increased alpha power and/or decreased beta power , reflected by a higher alpha / beta ratio , were associated with a decreased level of arousal or vigilance [ 18 , 19 ] . this pattern is considered normal for the resting state due to a lack of task - specific activation demands . however , endurance exercise increases arousal due to preparedness for external input . applying the neural efficiency hypothesis , high cortical function despite minimal energy consumption should be indicated by an increased alpha / beta ratio in high performers . in previous trials , high and low performers were differentiated by their individual training levels or participation in competitions [ 4 , 15 , 21 ] . for endurance athletes , maximal oxygen consumption allows a more appropriate and objective classification , because this variable is considered gold - standard and predicts time - trial performance . this is due to the concept that an athlete 's maximal oxygen consumption is mainly determined by the oxygen delivery to the mitochondria and its utilization , which in turn are limiting the oxidative production of atp required for the energy supply of the working muscles . as neural efficiency is task - related , it is necessary to study brain cortical activity in athletes directly during endurance exercise . the majority of studies investigating brain function while moving predominantly examined subjects during cycling exercise , because it does not create stepping impacts that provoke strong neck muscle contractions and electrode movements . furthermore , experienced cyclists are thought to be able to maintain a stable body position even at demanding workloads , so that the likeliness of movement - related artefacts in the eeg signal is reduced . the present study investigates whether or not aerobic power has an effect on the alpha / beta ratio during exercise . additionally , the authors examine if resting eeg predicts brain cortical activity during exercise . in line with the neural efficiency hypothesis subjects with high maximal oxygen consumption", "cyclists and triathletes with a minimum cycling training volume of 4 hours per week were directly recruited from local sports clubs . eligible subjects had to be healthy , between 18 and 35 years , nonsmokers , and right handed . before the trial commenced all participants underwent health screening following the s1-guideline of the dgsp , which included personal anamnesis , orthopaedic assessment , and measurement of resting ecg and blood pressure . any complications limiting the performance or safety of exercise led to exclusion from the study . following the screening process , all study procedures were approved by the local ethics committee and followed the guidelines of the declaration of helsinki . two laboratory visits separated by 3 to 5 days were scheduled . in the first laboratory session aerobic and anaerobic performance the second visit included recording of eeg rhythms at rest and during endurance exercise at constant workload . based on maximal oxygen consumption measured on the first visit , the sample was split into a group of lower aerobic power ( low ; vo2max 49 ml / min / kg ; n = 15 ) and a group of higher aerobic power ( high ; vo2max 50 ml / min / kg ; n = 14 ) . environmental temperature was held constant at 20c and nutrition was standardized ( last main meal2 h ; 500 ml30 min ) . following the assessment of body weight , subjects completed an incremental test with spirometry ( cortex medical , metamax 3b , germany ) on a high performance cycling ergometer ( fes , germany ) . after a 5 min warm - up at 80 w ( f)/100 w ( m ) , the workload was increased by 25 w/3 min until volitional exhaustion . this was defined as the inability to maintain a cadence of at least 60 rpm at the given workload . heart rate and respiratory parameters were recorded continuously . using the enzymatic - amperometric method ( dr . mueller geraetebau , super gl ambulance , germany ) , lactate concentration was analysed in blood taken from an ear lobe after each increment . collected data were processed with winlactat ( mesics , germany ) . according to the dickhuth model , the individual anaerobic threshold ( pians ) additionally , vo2max was determined as highest value over a 30 s period . on the second laboratory visit eeg was recorded under the following conditions : resting with eyes closed while sitting on the ergometer ( 2 min ) and during cycling at constant load . the exercise protocol included a 5 min warm - up ( 80 w [ f]/100 w [ m ] ) , 30 min at 100% of the individual anaerobic threshold , and a 5 min cool - down at a low workload ( 80 w [ f]/100 w [ m ] ) . brain cortical activity was recorded over 1 min at 10 and 20 as well as 30 min and subjects maintained a cadence of 90 rpm . heart rate and cadence were displayed in real - time on a monitor placed in the subjects ' natural viewing direction . prior to the assessments , all subjects were instructed to stabilize their body position and avoid head movements and contractions of the jaw throughout the cycling exercise . using a breathable cap , active agcl electrodes were placed on the subject 's scalp to record eeg from frontal ( f3 , f4 , fz , f7 , and f8 ) , central ( c3 , c4 , and cz ) , and parietal ( p3 , p4 , pz , p7 , and p8 ) brain regions . the electrodes , which were positioned according to the international 10:20 system , were filled with an electrolyte gel to reduce impedance below 10 k. the eeg signal was amplified by the quickamp system ( brainvision , germany ) and sampled at 512 hz . following the data acquisition , the analyzer 2.0 ( brainvision , germany ) was used for processing the eeg recordings . after a reduction of the sampling rate to 256 hz , data were digitally band - pass filtered ( time constant 0.0318 s ; 24 db / octave ) and a frequency range of 3.0 to 40.0 hz remained for analysis . the recorded epochs represented the 10th , 20th , and 30th minutes during constant load cycling at pians . following a manual inspection the artefacts tagged by the software were either rejected or confirmed . subsequently , those segments were averaged individually within each recording period . by using a hanning window ( 20% ) , the eeg data were fast - fourier - transformed ( fft ) to calculate power values in the alpha ( 7.512.49 hz ) and beta ( 12.532 hz ) frequency domain . subsequently , the alpha / beta ratio was calculated and averaged over the epochs representing the recordings during exercise . accurate test - retest reliability for the alpha and beta power during cycling at 90 rpm has been reported with the eeg acquisition and processing methods used in the present study . prior to group comparisons , gaussian distribution of the collected data was verified by the shapiro - wilk test . one - way anova ( factor : group ) was used to compare anthropometric measures between medium and high fit subjects . the effect of maximal oxygen consumption on alpha / beta ratio was analysed by applying 2 ( group : low , high ) 2 ( condition : rest , exercise ) 3 ( region : frontal , central , and parietal ) anova . in a subsequent analysis frequency ( alpha , beta ) was included as additional factor to assess the effect of maximal oxygen consumption on eeg spectral power . in case of nonsphericity greenhouse - geisser correction was applied . between - subjects and within - subjects effects as well as interactions were reported and further analysed using fischer 's lsd post hoc test . subsequently , linear regression was used to predict brain cortical activity during exercise and maximal power from resting eeg . the adjusted pearson 's multivariate coefficient of determination and as standardized coefficient are provided . for all statistical analyses , an alpha level of p ", "brain cortical activity during exercise was recorded at 100% of the individual anaerobic threshold , which was 3.31 0.37 wkg and 2.74 0.45 wkg in high and low ( f(1,27 ) = 13.66 ; p = 0.001 ; eta = 0.336 ) , respectively . subjects with higher maximal oxygen consumption also reached greater maximal power ( 4.67 0.33 wkg versus 4.11 0.49 wkg ; f(1,27 ) = 13.28 ; p = 0.001 ; eta = 0.330 ) than the low group . the statistical analysis revealed main effects of group ( f(1,27 ) = 12.04 ; p = 0.002 ; eta = 0.308 ) , condition ( f(1,27 ) = 4.24 ; p = 0.049 ; eta = 0.136 ) , and region ( f(2,26 ) = 8.50 ; p = 0.002 ; eta = 0.239 ) on subjects ' alpha / beta ratio . moreover , there was an interaction of condition and region ( f(2,26 ) = 4.37 ; p = 0.025 ; eta = 0.139 ) . whereas alpha / beta ratio was increased at central brain region compared to parietal ( t(28 ) = 3.36 ; p = 0.002 ) and frontal sites ( t(28 ) = 2.74 ; p = 0.010 ) in the exercise condition , no regional differences were confirmed for the resting state . furthermore , alpha / beta ratio was significantly different between high and low at all electrode sites ( figure 1 ) in both the resting state ( frontal : t(28 ) = 2.86 ; p = 0.008 ; central : t(28 ) = 2.52 ; p = 0.018 ; parietal : t(28 ) = 2.67 ; p = 0.013 ) and the exercise condition ( frontal : t(28 ) = 3.19 ; p = 0.004 ; central : t(28 ) = 2.62 ; p = 0.014 ; parietal : t(28 ) = 2.37 ; p = 0.025 ) . when frequency was included as additional factor , interactions with condition ( f(1,27 ) = 11.37 ; p = 0.002 ; eta = 0.296 ) and group ( f(1,27 ) = 8.43 ; p = 0.007 ; eta = 0.238 ) were confirmed . compared to the resting state alpha ( t(28 ) = 7.39 ; p < 0.001 ) and beta power ( t(27 ) = 12.43 ; p < 0.001 ) were significantly increased across electrode sites during exercise . moreover , high showed less beta power than low ( t(28 ) = 2.45 ; p = 0.020 ) . the relation between resting eeg rhythms , brain cortical activity during exercise , and maximal power is shown in table 3 . whereas alpha / beta ratio at rest explained 57% of variance of alpha / beta ratio during exercise at frontal brain region , resting eeg at other electrode sites did not predict brain cortical activity during exercise . when frontal alpha / beta ratio at rest was used as the independent variable for the prediction of maximal power , the model was able to explain 15% of the variance compared to 18% and 26% for the use of central and parietal alpha / beta ratio , respectively .", "compared to the resting state , the alpha / beta ratio was decreased during cycling exercise as beta power increased more than alpha power . this change towards a higher level of arousal or vigilance has also been reported in a recent review by ludyga et al . . increased beta activity reflecting higher cortical activation might be the result of greater processing demands during exercise and the tendency of the sensorimotor system to maintain the current network set . the decrease of the alpha / beta ratio from rest to exercise was most pronounced at central brain region , where inter alia sensorimotor information of lower extremities is integrated . in this respect , the maintenance of pedaling movements is associated with increasing feedback from sensory afferents and feed - forward due to the recruitment of motor neurons [ 12 , 30 ] . although the magnitude of the changes in alpha / beta ratio from rest to exercise was similar between groups , high compared to low had a higher index in both conditions . differences between athletes of high and low training or performance levels have also been observed at rest previously [ 4 , 21 ] . . found enhanced cortical synchronization of pyramidal neurons reflected by increased alpha activity in elite karate athletes . as alpha power serves as an inverse indicator of mental alertness or arousal [ 18 , 19 ] , this implies that athletes are more efficient in posing cortical neurons into a nonoperative mode . consequently , it can be assumed that a lower level of arousal at rest , which was also observed in the present trial , is due to greater relaxation ability in subjects with higher maximal oxygen consumption . this is further supported by a lower beta power in high , because a decrease in beta power has been reported to be the eeg response to relaxation . by maintaining a low arousal at rest , attentional resources may be reserved for a subsequent recruitment in movement - related tasks and associated information processing . the present results support this assumption as high resting alpha / beta ratio was associated with high alpha / beta ratio at frontal brain region during exercise . in previous studies resting alpha and beta activity have also been related to different measures of cognitive and motor performance , so that neural efficiency in the resting state is suggested to predict task - related performance [ 13 , 14 ] . this is also applicable to endurance exercise as arousal at rest was directly related to maximal power during cycling . similar to the resting state , cyclists in high showed a higher alpha / beta ratio than low during exercise at the individual anaerobic threshold . this observation indicates that the neural efficiency hypothesis is applicable to endurance - trained athletes . the present findings are further supported by ludyga et al . , who confirmed a negative correlation between changes of aerobic performance and cyclists ' brain cortical activity after a 4-week training period . other studies have also shown that training elicits a decrease of cortical activity and the suppression of task - irrelevant cognitive processes [ 32 , 33 ] during different movement - related tasks . evidence from animal studies suggests that improved neural processing and increasing influence of the cerebellar thalamic cortical circuit are underlying mechanisms of training - induced enhancement of neural efficiency . in this respect , taniwaki et al . have proposed that this increased influence reflects a change from internal to increasingly external and automatic processing of motor tasks . the execution of highly automated movements , such as handwriting , does not require much attentional resources . therefore , the lower level of arousal during exercise in high could be explained by cycling becoming an increasingly automated process with training . the reservation of cortical sources in experts is further supported by the results of httermann and memmert , who showed that athletes compared to nonathletes had higher cognitive performance during cycling exercise of similar relative intensity . furthermore , improvements in circulatory capacity and cerebrovasculature have also been suggested as underlying mechanisms for differences in eeg spectral power between athletes and nonathletes [ 21 , 38 ] . maximal oxygen consumption is correlated with cerebral blood flow , which is considered as a proxy for assessing neurogenesis . this indicates an increased formation rate of new neurons and improved cerebral blood flow in high compared to low . these improvements elicited by endurance exercise are thought to improve energy supply by creating a more supportive and nutritive environment for the surrounding neurons . however , future research is necessary to investigate whether or not an optimized energy supply accounts for enhanced neural efficiency during exercise . a methodological concern of eeg recordings during exercise is the potential impact of physiologic and mechanical disturbances . to reduce the possibility and impact of artefacts , the present study used a data acquisition and processing approach , which has proven reliable . additionally , only experienced cyclists were included in the study , because their ability to stabilize the upper body at moderate to high intensity is necessary to reduce movement - related artefacts when eeg is recorded during exercise on a stationary bike . therefore , it remains unclear whether or not the development of the alpha / beta ratio over time was different between groups . nonetheless , the present results indicate a higher level of arousal in cyclists with lower aerobic fitness . as this was observed in both conditions , it can not be ruled out that differences in alpha / beta ratio during exercise between high and low are mainly due to the differences observed in the resting state . whereas previous studies also reported differences in alpha activity at rest between elite - athletes and nonathletes [ 15 , 16 , 40 ] , this is not supported by the present findings . this could be due to a lack of high differences in performance and/or training levels between groups and the low sample size of the present study . however , the differences in alpha / beta ratio confirmed between groups imply that this index is sensitive to small differences in aerobic power . nonetheless , further investigations with higher sample size and more aerobic fitness subgroups are warranted to test and extend the current findings . furthermore , it remains unclear whether or not other variables related to neural efficiency , such as cognitive performance and intelligence , have influenced the observed differences between high and low . in conclusion , cyclists with high aerobic fitness compared to peers with less aerobic fitness are able to complete submaximal cycling exercise with a lower level of brain cortical activity . this indicates enhanced neural efficiency in subjects with high aerobic power , possibly due to the inhibition of task - irrelevant cognitive processes . moreover the use of resting eeg rhythms as predictor for task performance is also applicable to cycling as resting state arousal predicted maximal power ." ]

[ "obesity is a major public health problem with over two - thirds of americans overweight and greater than one - third obese . while new data have suggested a leveling off of the prevalence of childhood obesity , 12.4% of kindergarteners are obese and overweight five - year olds are four times as likely as normal weight five - year olds to become obese [ 2 , 3 ] . it has been well documented that obesity leads to cardiac , metabolic , and other systemic health derangements . it has also been shown that these unfavorable changes may start as early as three years of age . well - child checks have long been recognized as opportunities to foster healthy growth and development . these regular visits , which are performed with a health care provider , traditionally occur during the newborn period , at one , two , four , six , nine , twelve , fifteen , eighteen , and twenty - four months and every year thereafter . the goal is to provide continuity of care and allow for anticipatory guidance to be given . recognizing that diet and nutrition are linked with obesity , it is important to address these topics . however , guidelines on nutrition counseling remain vague , and visit time is constrained by a multitude of other encouraged and essential components . yet studies show that when it comes to counseling during well - child checks , less is more and focusing on fewer topics is more effective . however , these are notably imprecise with regard to early and targeted interventions to prevent and treat obesity in pediatric populations . regarding nutrition counseling during well - child care within the first year of life , the american academy of pediatrics ( aap ) bright future guidelines contains goals for temporal introduction of foods rather than composition of diet . even at the one - year visit , surprisingly , there is no mention of nutrition guidance at the fifteen- or eighteen - month well - child checks and it is not until the two - year visit that the subject of obesity is first addressed in the guidelines . meanwhile , research shows that a rapid transition occurs between the one- and two - year well - child checks , when diet habits seemingly shift to favor fast foods , with the french fry as the number one consumed vegetable consumed by two - year olds . the world health organization ( who ) strongly advocates for exclusive breastfeeding in the first six months of life and offers recommendations on complimentary feeding habits . these include continuing on - demand breastfeeding until two years of age and starting at 6 months of age , gradually increasing the number of feedings , consistency , and variety of other foods . for a nonbreastfed child , who further recommends providing four to five meals per day , with one or two healthy snacks aimed to meet the child 's nutritional needs . these who guidelines are appropriately aimed toward a global audience , with an emphasis on preventing malnutrition and ensuring adequate growth . current literature on prevention and treatment for obesity has overwhelmingly focused on adolescent and school aged populations . the aap recommends screening for obesity starting at two years , while united states preventive services task force ( uspstf ) suggests waiting until age six [ 7 , 10 ] . these recommendations bypass a likely window of opportunity for primary prevention prior to the second year of life , and in the case of the uspstf prior to six years . given these vague universal recommendations , we hypothesize that significant variability exists in clinical practice . it has been demonstrated that there is variability among pediatric primary care practices regarding obesity counseling , attitudes , and perceptions . some prior studies have focused on family medicine primary care providers ' ( pcps ) beliefs and practices pertaining to childhood obesity . however , many of these studies have placed emphasis more specifically on evaluation of treatment modalities , perception of obesity as a disease , and physician training [ 1318 ] . further , much of the previous work on childhood obesity appears directed beyond the age of five years , with few interventions studied between two and six years of age . this study builds upon the existing literature by offering a family medicine perspective and focusing specifically on perceived barriers and anticipatory guidance discussed at the early well - child checks particularly those prior to the second year of life . this is further warranted as much of the current literature occurred prior to the updated 2008 aap bright futures guidelines [ 7 , 20 ] . given the recent emphasis on primary care and the likely influx of pediatric patients via the accountable care act , family physicians will continue to provide a substantial amount of care for pediatric populations . the goal of the present study is to assess the perception of family medicine pcps in a university based family medicine network surrounding the barriers of preventing and treating obesity in the young child and to analyze pcps reported behaviors at well - child checks . in addition , the present study allows for a comparison of attitudes and practice between family medicine pcps and pediatric pcps who participated in an earlier study using a similar survey .", "the sample included all family medicine physicians , physician assistants ( pas ) , and nurse practitioners ( nps ) at eleven family medicine duke primary care sites in duke university health systems . the survey used in the present study was developed based on a similar study performed in pediatric practices , current epidemiological literature , and recommendations from the american academy of pediatrics ( aap ) and the united states preventive services task force ( uspstf ) [ 6 , 10 , 11 ] . previous authors were contacted for permission to utilize a similar survey tool . the survey contained three independent sections , each with a brief introduction . the sections were as follows : ( i ) perceived barriers in treating obesity , ( ii ) current pcp practices at well - child checks , and ( iii ) demographic information . introductory phone calls with follow - up emails were sent in january 2012 , prior to the in - person survey administration . an agreed upon morning or lunch hour time was arranged to include a ten- minute presentation explaining the goals of the project , with subsequent survey administration to all pcps who attended the meetings . an agreement was made to present the study findings to the participating sites at the conclusion of the study . data collection was performed during january and february 2012 and the data were analyzed in march 2012 . demographic data are presented as percentages / proportions . for questions related to perceived barriers , we calculated the percentage of respondents who indicated how important each issue was on a likert scale 15 ( not important , slightly important , moderately important , very important , and critically important ) , as well as the combined percentage of those who responded either very important ( 4 ) or critically important ( 5 ) . for pcp behaviors assessing anticipatory guidance , multiple responses were accepted ( i.e. , mark all well - child checks that apply ) . this study was reviewed by the research advisory board of the primary care research committee and the institutional review board of duke university and was found to be an exempt study ( pro00034169 ) .", "surveys were completed by 56 of the 78 family medicine pcps ( 41 family medicine physicians , 8 physician assistants , and 7 nurse practitioners ) at the 11 participating clinics , for a 72% response rate . approximately 1/3 ( 35% ) were 4049 years old , 1/3 ( 33% ) were 3039 , 27% were 50 + years old , and 5% were twenty through twenty - nine years old . the majority of pcps were medical doctors or doctors of osteopathic medicine ( md / do ) ( 73% ) , with physician assistants and nurse practitioners making up 14% and 13% , respectively . the average reported body mass index ( bmi ) of respondents was 24.71 kg / m ( 7 of the 54 respondents did not complete the bmi measures ) . approximately 1/3 ( 33% ) of the pcps were classified as overweight and 0.6% were in the obese category . reported bmi closely mirrored pcps perception of their weight , as 30% indicated they were overweight and 2% believed they were obese . pcps were asked to rate the relative importance of specific barriers to preventing or treating overweight or obese children . these questions related to children of all ages and focused on many factors including the child , parents , family unit , influence of society , and pcp factors . the five barriers that were most often rated as either very important or critically important were as follows : ( i ) families do not get enough exercise ( 93% ) ; ( ii ) families often have fast food meals ( 86% ) ; ( iii ) parent is not motivated to change diet or lifestyle ( 81% ) ; ( iv ) families watch too much tv ( 79% ) ; and ( v ) child is not motivated to change diet or lifestyle ( 75% ) ( table 1 ) . the following barriers were rated as very important or critically important by 6072% of pcps : parent is unaware that child is overweight , parents are overweight so they are not concerned that child is overweight , families are too busy to eat home cooked meals , healthy foods are too expensive , tv advertisements promote unhealthy foods , pcps have limited time to discuss nutrition , and pcps are frustrated with the low success rate of treating overweight children . barriers that pcps were less likely to rate as very important or critically important were as follows : overweight child does not act sick , overweight child is a good eater , parents do not have time to shop for healthier foods , families are too busy to eat meals together , healthy lifestyle habits are too complicated to follow , published reports about diet and nutrition are often confusing , school lunches promote unhealthy eating habits , pcps ' time constraints , lack of training to treat overweight children , compensation for obesity treatment , access to nutritionists , and pcps ' weight status or body mass index ( table 1 ) . pcps were asked to mark all of the well - child checks in which they discuss a variety of health topics with patients . analyzing the barriers perceived by pcps as most important to preventing and treating obesity revealed trends regarding fast food consumption and physical inactivity . as shown in table 2 , even by their own report , most pcps did not discuss fast foods at or prior to the twelve - month visit . at the eighteen - month visit fast foods are discussed by 32% of pcps . meanwhile , the two - year visit is the first well - child visit at which the majority of pcps ( 68% ) discuss fast food . while the majority of pcps ultimately discuss this topic , the discussion is not undertaken by a majority of pcps at a specific encounter until the two- through five - year visits . fruit and vegetable discussion increases in frequency as the child ages , with a peak of 63% of pcps discussing this at the twelve - month visit , before dropping to 51% at the eighteen - month visit . between 22% and 26% of pcps discuss having 3 meals per day by the twelve - month visit , whereas 65% are discussing meal frequency at the two- through five - year visits . physical inactivity / exercise was another area of concern with 93% of pcps recognizing this as a contribution to obesity , yet this topic was discussed by at most 23% of pcps at and/or before the twelve - month visit . by the eighteen - month visit , at most 48% of pcps had ever discussed the topic with their patients or families . the two- through five - year visits are the first time at which the majority of pcps ( 68% ) discuss this topic . the percent of well - child visits where screen time is discussed closely mirrors physical activity / exercise , and a similar trend is seen regarding the discussion of fast foods ( table 2 ) .", "a major finding of the current study involved the relative importance pcps ascribe to perceived barriers in treating obesity . our results reproduced those of a previous study utilizing a similar survey but performed within a pediatric setting . our results confirm that family medicine pcps share the same top six concerns when dealing with perceptions surrounding obesity . these concerns center around physical inactivity , fast food consumption , and motivation to change . the barriers identified were in areas that were inconsistently addressed in practice , specifically prior to the two - year well - child check . despite the apparent lack of congruence between the identified barriers and the actions by pcps in clinical practice , furthermore , due to the self - reported nature , pcps may overestimate how often they address certain issues . a second major finding of the current study was the inconsistency pcps demonstrated concerning when discussion took place for physical activity , fruit and vegetable selection , screen time , juice , and other beverage choices . this study suggests that primary prevention interventions targeting obesity in practice are either misplaced or missed altogether in some cases , which is consistent with other recent studies demonstrating missed opportunity for primary prevention of obesity [ 2124 ] . as this study is representative of an academic practice population with close geographic proximity , further study on a larger scale and in other practice populations the aap recommendations make no mention of fruits and vegetables until the five- and six - year well - child visits . in another case , the aap guidelines suggest the discussion of having 3 meals per day at the nine- and twelve - month well - child checks . however , in this study , only 26% of pcps have this discussion specifically at or before the twelve - month well - child visit . interestingly 65% of pcps have this discussion at the two- through five - year well - child visits despite lack of specific recommendation to do so . pcps seem to be aware of existing guidelines but , in this example , delay the delivery . other than this specific recommendation at the five - year well - child visit , all of the earlier well - child visit nutrition and diet guidelines are relatively nonspecific regarding diet composition . this likely contributes toward the variability observed in this study , as many pcps chose to have discussions , such as fruits and vegetables , at differing well - child visits . therefore , we believe that it would be advantageous to the goals of obesity prevention and treatment to have early and targeted interventions that precede adoption of adverse lifestyle choices [ 2527 ] . although it is beyond the scope of this paper , innovative approaches in obesity treatment have been identified over the past decade [ 2830 ] . comparing this study of family medicine pcps with a similar study done with pediatric providers revealed some similarities in practice behavior . pcps behavior in both studies reflected the general aap anticipatory guidance guidelines pertaining to obesity [ 7 , 11 ] . however , the anticipatory guidance discussions were not consistently performed at specific visits in either study , with greater variability observed in this family practice study ( see table 2 ) . different methodologies were used in data collection , as the study for family medicine pcps was measured using a cumulative approach , whereas the pediatric study was measured at point of first intervention . in comparing these studies , we chose to use the most conservative estimates by summating the percentages of anticipatory guidance being discussed . for example , a single pcp may have indicated that they discussed fast food at both the four- and six - month visits . our study would count both of these as unique interventions being done by different pcps . consequently , these findings may offer a realistic representation or , otherwise , an overestimation of how often topics were discussed at well - child checks . the present study identifies discrepancies in pcps adherence to counseling guidelines for nutrition , exercise , and screen time . in regard to exercise and screen time , this study demonstrates similar increases in the percentage of pcps discussing these topics , with the majority doing so at the two- through five - year well - child checks , and a peak between the six- through eleven - year well - child checks . however , the aap guidelines suggest that a majority of pcps address each of these topics much earlier . it would be beyond the scope of this discussion to address all elements of the survey . therefore , the remainder of this discussion will focus on the results relevant to fast food counseling and nutrition and their role in obesity prevention . a surprising result from this study was that there is no clear consensus as to when pcps are having discussions about fast food . while a prior study indicated that 62% of pediatricians addressed fast foods at or prior to twelve - month well - child visits , this study shows that at most 39% of family physicians did so ( table 2 ) . these estimates suggest that there is still a large percentage of the population receiving no counseling on fast food during the entire first year of life . it is not until the two - year well - child visit that a majority of pcps discuss fast food . meanwhile , previous research has shown that there is a profound shift in dietary habits toward fast foods , such as french fries , that occurs between the one- and two - year well - child checks . to address fast food consumption , pcps could consider integrating a universal french fry discussion regularly at the twelve - month well - child care visit . given the recognition that food transitioning towards fast foods such as french fries occurs within the subsequent window from twelve months to twenty - four months , it might be beneficial to offer a specific intervention at this visit . furthermore , prior research has shown that a dedicated intervention targeting two - year olds and their families can significantly reduce bmi . the french fry discussion could take the form of a purposeful talk with family members about the importance of avoiding fast foods , fried foods , and sweetened beverages . for example , using motivational interviewing techniques has been shown to be effective in changing behavior relating to obesity , and this approach may address such a complex behavior [ 32 , 33 ] . this visit could additionally include handouts or printouts about alternative foods and snacks that are affordable and can be prepared quickly . rather , this should be an individualized discussion , in which family members are encouraged to voice their concerns and devise solutions that meet their unique situation . as such , we would not anticipate a discussion of this relevance requiring anything less than ten minutes of dedicated visit time . the goal of this discussion would be to leverage the patient - physician - family relationship to positively impact lifestyle choices for both the child and the family . further study is needed to examine actual obesity prevention and treatment guidelines in clinical practice and to discern the specifics , feasibility , and benefits of incorporating additional counseling into routine well - child care ." ]

[ "prostate cancer is a common malignancy and a main cause of cancer - related death in men . in 2014 in the united states , an estimated 233 000 new cases will be diagnosed and 29 480 men will die of the disease . in recent years , with the widely adopted prostate - specific antigen ( psa)-based screening and biopsy program , the majority of prostate cancer can be detected in the early stage and can be treated by radical prostatectomy . however , approximately 30% of prostate cancer patients will experience recurrence after the initial surgery and many of them will develop metastatic disease [ 47 ] . , the disease progresses relatively slow , but other cases grow aggressively and rapidly metastasize to other part of the body . currently , the major challenge in prostate cancer management is to predict the outcome of the disease accurately at the time of diagnosis , to identify who will need active treatment . clinical stage , psa , and gleason score are currently commonly used as prognostic indicators , but the accuracy is limited . it is well known that the initiation and progression of prostate cancer results from the accumulation of genetic and epigenetic changes . epigenetic changes are characteristic of nearly all human tumors , including prostate cancer , and include changes in dna methylation , micrornas , and histone modifications . identification of epigenetic changes involved in the initiation and progression of prostate cancer will identify novel diagnostic and prognostic biomarkers and therapeutic targets . although the exact mechanism of how these epigenetic changes arise in prostate cancer is not well understood , the fact that they occur much more frequently than genetic changes may make them useful as potential biomarkers . dna methylation is the best studied epigenetic modification in prostate cancers , which occurs at cpg islands in the promoter region of a number of genes and cause transcriptional silencing of gene expression . promoter hypermethylation of critical genes could be useful biomarkers and therapeutic targets for prostate cancer . the protocadherin8 gene is located on human chromosome 13q14.3 ; the gen product contains 6 extracellular cadherin domains , a transmembrane domain , and a cytoplasmic domain . protocadherin8 plays crucial roles in cell adhesion , signal transduction , proliferation , migration , and invasion [ 1924 ] . a growing number of studies have demonstrated that protocadherin8 functions as a tumor suppressor in human cancers [ 1924 ] . moreover , it is frequently inactivated by promoter methylation in bladder cancer , renal cell carcinoma , nasopharyngeal carcinoma , gastric cancer and breast cancer , and is associated with poor prognosis [ 1924 ] . however , the methylation status and its clinical significance in prostate cancer remain unclear . in the current study , we analyzed the methylation status of protocadherin8 in localized prostate cancer tissues using methylation - specific pcr ( msp ) . msp is a major technique for detecting gene methylation and can provide specific and sensitive results . we also evaluated its association with biochemical recurrence - free survival of patients with prostate cancer in order to analyze its potential as a biomarker in this disease .", "a total of 162 prostate cancer tissues were obtained from patients with early - stage prostate cancer during radical retropubic prostatectomy at the third hospital of hebei medical university between 1999 and 2008 . prostate tissues obtained from 47 patients with benign prostatic hyperplasia ( bph ) during transurethral resection of prostate at the same time in the same hospital were used as normal controls . none of the patients with prostate cancer received any form of anti - tumor therapy before surgery , and none received adjuvant therapy before recurrence . the samples were flash - frozen in liquid nitrogen at the time of collection and stored at 80c until used . biochemical recurrence was defined as the period between radical prostatectomy and the measurement of 2 successive values of serum psa level 0.2 ng / ml . the common clinicopathologic parameters were recorded , including preoperative serum psa , pathological stage , seminal vesicle invasion , gleason score , lymph node status , margin status , and follow - up data . the patients were followed up at intervals , ranging from 15 months to 60 months . this study was performed according to the declaration of helsinki and was approved by the ethics committee of the third hospital of hebei medical university ( no . genomic dna was isolated from frozen tissues using the dneasy tissue kit ( qiagen , valencia , ca ) . the isolated dna was modified with bisulfite using epitect bisulfite kit ( qiagen , valencia , ca ) and standard protocol as described previously . bisulfite modified dna was used for msp with primers specific for either methylated or unmethylated dna . methylated : forward 5-cggttattggttattcggttcc-3 and reverse 5-acgaactctaaaaacgcgcg-3. unmethylated : forward 5-ggtggttattggttatttggttt-3 and reverse 5-ccaacaaactctaaaaacacaca-3. amplifications were carried out using the following profile : 1 cycle of 95c for 5 min , 40 cycles of 95c for 30 s , 60c for 30 s , and 72c for 30 s , and 1 cycle of 72c for 5 min . in vitro methylated dna and unmethylated dna ( new england biolabs , beverly , ma , usa ) was used as methylation and unmethylation positive control , and water blanks were included with each assay as previously reported . msp products were separated in 2% agarose gel , stained with ethidium bromide , and visualized under ultraviolet illumination for analysis . samples were scored as methylation negative when bands were present only in the unmethylated dna lane and as methylation positive when methylated alleles were present in the methylated dna lane . statistical analysis was done using sas version 8.0 ( sas institute , cary , n.c . the difference of protocadherin8 methylation status between prostate cancer tissues and controls were evaluated using fisher s exact test . the associations between protocadherin8 methylation and clinicopathologic parameters were evaluated by chi - square test . for biochemical recurrence - free survival analysis , kaplan - meier survival analysis was used and the differences in survival were analyzed using the log - rank test . univariate and multivariate cox proportional hazard models were used to evaluate the prognostic effect of protocadherin8 methylation in prostate cancer .", "a total of 162 prostate cancer tissues were obtained from patients with early - stage prostate cancer during radical retropubic prostatectomy at the third hospital of hebei medical university between 1999 and 2008 . prostate tissues obtained from 47 patients with benign prostatic hyperplasia ( bph ) during transurethral resection of prostate at the same time in the same hospital were used as normal controls . none of the patients with prostate cancer received any form of anti - tumor therapy before surgery , and none received adjuvant therapy before recurrence . the samples were flash - frozen in liquid nitrogen at the time of collection and stored at 80c until used . biochemical recurrence was defined as the period between radical prostatectomy and the measurement of 2 successive values of serum psa level 0.2 ng / ml . the common clinicopathologic parameters were recorded , including preoperative serum psa , pathological stage , seminal vesicle invasion , gleason score , lymph node status , margin status , and follow - up data . the patients were followed up at intervals , ranging from 15 months to 60 months . this study was performed according to the declaration of helsinki and was approved by the ethics committee of the third hospital of hebei medical university ( no .", "genomic dna was isolated from frozen tissues using the dneasy tissue kit ( qiagen , valencia , ca ) . the isolated dna was modified with bisulfite using epitect bisulfite kit ( qiagen , valencia , ca ) and standard protocol as described previously . bisulfite modified dna was used for msp with primers specific for either methylated or unmethylated dna . methylated : forward 5-cggttattggttattcggttcc-3 and reverse 5-acgaactctaaaaacgcgcg-3. unmethylated : forward 5-ggtggttattggttatttggttt-3 and reverse 5-ccaacaaactctaaaaacacaca-3. amplifications were carried out using the following profile : 1 cycle of 95c for 5 min , 40 cycles of 95c for 30 s , 60c for 30 s , and 72c for 30 s , and 1 cycle of 72c for 5 min . in vitro methylated dna and unmethylated dna ( new england biolabs , beverly , ma , usa ) was used as methylation and unmethylation positive control , and water blanks were included with each assay as previously reported . msp products were separated in 2% agarose gel , stained with ethidium bromide , and visualized under ultraviolet illumination for analysis . samples were scored as methylation negative when bands were present only in the unmethylated dna lane and as methylation positive when methylated alleles were present in the methylated dna lane .", "statistical analysis was done using sas version 8.0 ( sas institute , cary , n.c . , usa ) the difference of protocadherin8 methylation status between prostate cancer tissues and controls were evaluated using fisher s exact test . the associations between protocadherin8 methylation and clinicopathologic parameters were evaluated by chi - square test . for biochemical recurrence - free survival analysis , kaplan - meier survival analysis was used and the differences in survival were analyzed using the log - rank test . univariate and multivariate cox proportional hazard models were used to evaluate the prognostic effect of protocadherin8 methylation in prostate cancer .", "in the current study , the methylation status of protocadherin8 in 162 prostate cancer tissues and 47 controls was detected by msp . protocadherin8 methylation was detected in 76 ( 46.9% ) prostate cancer cases ( figure 1 ) . however , no protocadherin8 methylation was found in the controls , and the difference between prostate cancer cases and controls was statistically significant ( p<0.0001 ) . subsequently , we linked the methylation status of protocadherin8 to clinicopathologic parameters in prostate cancer cases to elucidate its clinical significance . protocadherin8 methylation was significantly associated with advanced pathologic stage ( p=0.0122 ) , higher level of preoperative psa ( p=0.0004 ) , higher gleason score , ( p=0.0187 ) , positive lymph node metastasis ( p=0.0314 ) , and biochemical recurrence ( p<0.0001 ) . however , it was not significantly associated with age , surgical margin status , or seminal vesicle invasion . next , we examined the biochemical recurrence - free survival of patients with prostate cancer according to protocadherin8 methylation status to elucidate its prognostic value . interestingly , patients with protocadherin8 methylated had worse prognosis than patients without ( p<0.0001 , figure 2 ) . to further determine the associations between biochemical recurrence - free survival and potential risk factors , univariate and multivariate cox regression model analysis was performed . univariate cox regression analysis first showed that gleason score , preoperative psa level , pathologic stage , and protocadherin8 promoter methylation were risk factors for poor biochemical recurrence - free survival . these risk factors were entered into multivariate cox regression analysis , revealing that protocadherin8 methylation and gleason score were independent prognostic risk factors for biochemical recurrence - free survival of patients with prostate cancer .", "it is of great important to identify novel prognostic and predictive markers to understand this multifaceted disease process and to identify which patients need more aggressive treatment after initial curative surgery [ 6,7,1416 ] . dna methylation of cpg islands within the promoter region of genes is an alternative mechanism of gene silence to genetic changes and is frequently involved in the development and progression of many types of human cancers , including prostate cancer . aberrant promoter methylation of some genes that are normally unmethylated may be used as potential molecular markers for the diagnosis , surveillance , and prognosis in prostate cancer . protocadherin8 is a tumor suppressor gene and is frequently silenced by aberrant promoter methylation in several human cancers . to date , the association between promoter methylation of protocadherin8 and the prognosis of prostate cancer has not been reported . this is the first study to investigate the prognostic value of protocadherin8 methylation in prostate cancer based on a relatively large number of clinical samples . in the current study , we analyzed the methylation status of protocadherin8 in 162 prostate cancer tissues and 47 normal prostate tissues using msp . we demonstrated that protocadherin8 methylation appeared more frequently in prostate cancer tissues than in normal prostate tissues . moreover , when we analyzed the association between protocadherin8 methylation and traditional clinicopathologic features in prostate cancer , we found that protocadherin8 methylation was significantly correlated with advanced pathologic stage , higher level of preoperative psa , higher gleason score , positive lymph node metastasis , and the occurrence of biochemical recurrence . these results suggest that protocadherin8 methylation plays an import role in the progression of prostate cancer and may be associated with the poor prognosis . to verify this hypothesis , kaplan - meier survival analysis was performed , showing that the biochemical recurrence - free survival time of patients with protocadherin8 methylated was significantly shorter than patients without . moreover , univariate and multivariate cox regression analysis demonstrated that protocadherin8 methylation is an independent predictor of the prognosis of prostate cancer . these results suggest that the detection of protocadherin8 methylation in tumor samples after surgery may help identify the patients prone to recurrence and could be a novel predictor for disease course in prostate cancer patients . our present data demonstrated that aberrant promoter methylation of protocadherin8 occurred frequently in prostate cancer , but not in normal prostate tissues . this result indicates that protocadherin8 methylation is tumor - specific and may be an early event in prostate cancer . in addition , the clinical significance of protocadherin8 methylation in prostate cancer is similar to findings of studies on other cancers [ 1921 ] . our findings further verified the possibility of using protocadherin8 methylation as a potential biomarker in prostate cancer . studies are needed to investigate the cause of protocadherin8 methylation and to discover how to reverse the methylation status of protocadherin8 in prostate cancer .", "promoter methylation of protocadherin8 is a frequent event in prostate cancer , and is associated with traditional risk factors of poor prognosis and shorter biochemical recurrence - free survival time . the present results indicate that protocadherin8 methylation is an independent prognostic factor for biochemical recurrence - free survival in prostate cancer patients . our findings suggest that protocadherin8 methylation might be a useful prognostic biomarker and a potential therapeutic target for prostate cancer ." ]

[ "madelung 's disease is characterised by multiple disfiguring abnormal fat masses in the head , the neck , and the radix of upper limbs ; in 90% of cases it 's associated with alcohol abuse . the local injections of phosphatidylcholine / deoxycholate solution have been gaining an increasing consensus as a non - invasive method to shrink localized adiposities . the authors report their long term experience on the assessment of serial intralipotherapy with phosphatidylcholine / deoxycholate in two patients affected by madelung 's disease .", "two male patients suffering from madelung 's disease underwent serial intralipotherapy with phosphatidylcholine / deoxycholate ( lipostabil -nattermann pharma , cologne , germany ) . pre- and 6 months post - treatment dimensions were assessed by measuring three diameters in each lesion with a 7.5 mhz probe ultrasound ( us ) scan performed by the same operator .", "a 45-year - old man , smoker , without history of alcohol abuse , affected by multiple comorbidities , presented with symmetric huge lipomatosis of the head , neck , dorsum , posterior aspect of the arms and testicles . chest x - rays and head and neck magnetic resonance imaging ( mri ) confirmed the infiltrative distribution of the lipomatosis and excluded the involvement of the trachea and other deep structures . even if a previous surgical excision of some cervico - occipital adipose deposits had been successful , the patient , who was still physically and psychologically impaired , refused a further surgical treatment under general anaesthesia of the remaining untreated adipose deposits : these infiltrating masses were therefore addressed with serial intralesional lipostabil injections . under us scan control 5 ml of lipostabil were injected into the jugular , submandibular and right cheek masses , respectively . the injections were repeated monthly for an overall of three treatments per lesion [ figures 1 and 2 ] . case 1 , right cheek mass : ( a ) pre - treatment view ; ( b ) post - treatment view case 1 , submandibular and jugular masses : ( a ) pre - treatment view ; ( b ) post - treatment view a 49-year - old - man , with a history of alcohol abuse and multiple comorbidities presented with enormous bilateral axillary fat deposits and some unpleasant adipose deposits in the dorsum and the submental and supraclavear areas . the axillary masses were surgically addressed , with no evidence of recurrence at 4 years follow - up . three other smaller submental and bilateral supraclavear deposits were injected with 5 ml of lipostabil each under us scan control . the injections were repeated monthly for an overall of three treatments per lesion [ figures 3 and 4 ] . case 2 , bilateral supraclavear masses : ( a ) pre - treatment view ; ( b ) post - treatment view case 2 , submental mass : ( a ) pre - treatment view ; ( b ) post - treatment view", "a 45-year - old man , smoker , without history of alcohol abuse , affected by multiple comorbidities , presented with symmetric huge lipomatosis of the head , neck , dorsum , posterior aspect of the arms and testicles . chest x - rays and head and neck magnetic resonance imaging ( mri ) confirmed the infiltrative distribution of the lipomatosis and excluded the involvement of the trachea and other deep structures . even if a previous surgical excision of some cervico - occipital adipose deposits had been successful , the patient , who was still physically and psychologically impaired , refused a further surgical treatment under general anaesthesia of the remaining untreated adipose deposits : these infiltrating masses were therefore addressed with serial intralesional lipostabil injections . under us scan control 5 ml of lipostabil were injected into the jugular , submandibular and right cheek masses , respectively . the injections were repeated monthly for an overall of three treatments per lesion [ figures 1 and 2 ] . case 1 , right cheek mass : ( a ) pre - treatment view ; ( b ) post - treatment view case 1 , submandibular and jugular masses : ( a ) pre - treatment view ; ( b ) post - treatment view", "a 49-year - old - man , with a history of alcohol abuse and multiple comorbidities presented with enormous bilateral axillary fat deposits and some unpleasant adipose deposits in the dorsum and the submental and supraclavear areas . the axillary masses were surgically addressed , with no evidence of recurrence at 4 years follow - up . three other smaller submental and bilateral supraclavear deposits were injected with 5 ml of lipostabil each under us scan control . the injections were repeated monthly for an overall of three treatments per lesion [ figures 3 and 4 ] . case 2 , bilateral supraclavear masses : ( a ) pre - treatment view ; ( b ) post - treatment view case 2 , submental mass : ( a ) pre - treatment view ; ( b ) post - treatment view", "clinically , a significant progressive shrinkage together with a change from a soft to a harder consistency of the adipose masses was appreciated . no alterations were reported in serum lipid pattern 1 month after the last treatment . at 6 months follow - up all of the lesions appeared stable . dimension changes in the treated lesions as demonstrated by us scan 6 months after the treatment are reported in table 1 and figure 5 . no local and/or systemic side - effects were reported . in both patients , one treated lesion out of three showed a slow clinical progression and required surgical excision . all of the other treated lesions are clinically stable at 5 years follow - up . measures in centimetres of the three main diameters at us scan before and after 3 injections of lipostabil ultrasound scan images - case 1 , right cheek mass : ( a ) pretreatment ; ( b ) post - treatment", "madelung 's disease is a lipomatosis classified in type 1 , with adipose masses symmetrically distributed in the body and in type 2 , with a diffuse obese - like fat distribution . diagnosis is clinically based and mri , computed tomography , and us scan allow evaluation of the fat deposits distribution . our two cases belong to type 1 with evident deposits in the head and neck . both patients had their major masses surgically removed ; the smaller , but more visible ones were deliberately addressed non - surgically with lipostabil , in order to avoid or at least postpone further surgery . treatment of hyperlipidemias and fat emboli , but diffusely employed subcutaneously in an off - label regimen to reduce localised adiposity and the volume of lipomas . the off - label use of lipostabil for the treatment of localised adiposity is actually controversial in the literature . in 2010 , the united states food and drug administration ( fda ) cautioned medical spas against misleading consumers by false statements about drugs including phosphatidylcholine / deoxycholate that would eliminate fat in a procedure called lipodissolve . the fda keeps encouraging health care professionals and consumers to report any side - effects with the use of these drugs to the fda 's medwatch adverse event reporting program . it is approved for cardiological use to reduce cholesterol in some countries in europe , though not including the united kingdom . until date , lipostabil is not available in the italian market as the product trade registration was no longer provided by the manufacturer since may the 20 2004 . nevertheless , in italy , by the law 94/1998 the clinical use of phosphatidylcholine / deoxycholate is currently allowed as a galenical under the following strict circumstances : the treatment should be tailored on one individual patient , the physician should provide the patient a fully informed consent and the prescription should provide both the patient 's identity data and a reference number to the physician 's medical archive . its lipolytic action seems to be based on stimulation of lipase activity , emulsification and transport of triglycerides and a detergent action by its two main components , both causing cell membrane lysis , inflammation , fibrosis and degeneration of fat tissue . in one case acute renal failure and liver dysfunction have been reported as severe systemic side - effects following a single high dose subcutaneous injection . recently , it has been suggested that phosphatidylcholine might eventually have some therapeutic role in some cancers as animal studies indicate that deficiencies in choline and phosphatidylcholine may disrupt cell membrane signal transduction in ways that could lead to various cancers . furthermore , there is ample evidence that liver cancer is promoted in various animals by choline - deficient diets , and it has been shown that excess choline has a protective effect against carcinogenesis . known safety limits of phosphatidylcholine / deoxycholate compound are 15 mg / kg . a successful experience of serial intralipotherapy with a blend of lidocaine , aminophillin , l - carnitine , phosphatidylcholine and deoxycholate solution for the treatment of one patient affected by madelung 's disease is reported . according to the literature common off - label use of phosphatidylcholine / deoxycholate compound for localised fat deposits ranges between 1000 and 250 mg / session . our choice of lipostabil dosage , therefore , considered both the fat masses size and those safety limits . our results objectively demonstrated an average reduction of 42.5% in the three us scan measured diameters in all of the treated lesions 6 months after the treatment [ table 2 and figure 5 ] . percentage reduction of the masses at us scan in the three main diameters the 5 years clinical follow - up demonstrated the long - term functional and cosmetic stable results in 66% of the treated lesions . the treatment also proved to be safe as serum lipid status was not modified at 1 month since the last infiltration session . in madelung 's disease , the surgical approach is always invasive and often risky both for the anatomical complexity of the involved areas ( cervico - facial regions ) and for these patients general conditions , which are poor most of the time . the objectively demonstrated efficacy and safety of the treatment at the employed dosage together with its easy execution confirm the role of lipostabil as a non - invasive palliative reasonable therapeutic opportunity in madelung 's disease and an alternative to surgery in the more awkward locations of the disease .", "the phosphatidylcholine / deoxycholate compound needs wide investigation for new treatment uses and long - term studies and hence that the recommended dose and safe application technique can be standardised . the use of lipodissolve products should be considered an experimental treatment and be performed under strict medical control for both therapeutical and cosmetic purposes . our experience might , therefore , further contribute to the investigation of limits and possibilities of the clinical use of phosphatidylcholine / deoxycholate in the treatment of localised adiposities of any nature . according to our experience the inclusion of phosphatidylcholine / deoxycholate intralesional intralipotherapy in the armamentarium for the palliative treatment of madelung 's disease might be recommended to reduce the volume and limit the growth of the pathological adipose masses and to restrict the aggressive and often unacceptable anatomical consequences of the disease ." ]

[ "unawareness , lack of insight , or anosognosia refers to impaired awareness in persons with dementia [ 17 ] . awareness is multifactorial and likely modular [ 4 , 810 ] , with each domain separable and potentially unique . most of the literature on awareness in persons with dementia describes the clinical correlates of one awareness domain ( reviews by [ 1 , 4 , 11 ] ) , but the few studies that have contrasted awareness for different domains have found differential patterns of clinical correlates [ 1215 ] . this paper provides further support for the modality specific nature of awareness in dementia by contrasting the clinical correlates for awareness of balance in addition to more commonly measured awareness of day - to - day function and memory . awareness quantification remains elusive , and there is no consensus method for measuring awareness ( e.g. , [ 4 , 9 ] ) . awareness has been measured with clinician ratings [ 16 , 17 ] ; or based on discrepancy between self - report versus clinicians ' impression or versus informant report assessed with interview [ 10 , 18 ] or questionnaires [ 7 , 12 , 14 , 1921 ] ; or discrepancy between self - report and objective performance [ 21 , 22 ] , which , depending on the task , measures self - monitoring or metacognitive abilities . detail difficulties with patient / informant discrepancies and the assumption that caregiver informants ' or clinicians ' reports are a better reflection of reality . moreover , worry , anxiety , defensiveness , denial , or focus on more important problems can influence reflection for persons with dementia . caregivers ' reports may be more highly correlated with objective measures of cognition than patient self - reports , suggesting there is value in using patient / informant discrepancies . nevertheless , caregiver / patient discrepancies may be a better measurement of patients ' awareness of function , whereas clinician / patient discrepancies may be a better measure of patients ' awareness of cognition . due , in part , to measurement challenges when assessing awareness , the literature on the clinical correlates of awareness in persons with dementia is contradictory . most , but not all , of the cumulative data suggest increasing dementia severity is associated with reduced awareness [ 1 , 16 , 18 ] . others have found few group - based differences , but high individual variability in awareness declines when studied over one year , potentially because severity and awareness are mediated by cognitive reserve . other important clinical correlates of awareness include depression [ 18 , 21 , 22 , 25 ] , neuropsychiatric status [ 1921 , 26 ] caregiver burden [ 10 , 11 , 14 , 26 ] , activities of daily living , and neuropsychological status [ 12 , 19 , 20 , 22 , 2729 ] which demonstrate variability in associations with awareness across domains and measurement methods . models of awareness suggest awareness is mediated by the frontal lobes [ 2 , 3 ] or the right frontal lobe [ 30 , 31 ] , and lack of awareness is associated with other behavioural indicators of frontal dysfunction , such as increased apathy . localized imaging has implicated the orbitofrontal cortex , but most have implicated medial structures [ 34 , 35 ] , including the anterior and posterior cingulate in awareness . despite converging evidence for prefrontal involvement in awareness , awareness may or may not be associated with tests of executive function ( see review by ) . some studies demonstrate strong relationships between awareness and executive functioning [ 12 , 19 , 20 , 27 ] , with others reporting nonsignificant and trivial associations [ 19 , 29 ] . although clearly composite measures that rely on more basic cognitive functions , many summary scores from traditional tests of executive function are associated with the dorsolateral prefrontal circuit , and awareness has been associated with more midline [ 3436 ] or orbitofrontal aspects of the prefrontal cortex . contradictory data on the clinical correlates of awareness is also due to the assumption that awareness is a unitary construct ( see reviews by [ 4 , 8 ] ) . differential patterns of clinical correlates have been demonstrated for awareness of cognitive deficits versus awareness of behaviours [ 1215 ] , suggesting that awareness is modality specific . the primary purpose of this paper is to describe the clinical correlates of awareness of balance in addition to the more commonly measured awareness of function in basic and instrumental activities of daily living ( badls and iadls , resp . ) and awareness of memory . awareness of balance is important in persons with dementia due to its relation with fall risk . we hypothesize that awareness of balance will be associated with physical variables , such as gait , falls , and objectively measured balance . based on the conceptualization of markova and colleagues and work suggesting differential clinical correlates for awareness of specific domains [ 13 , 15 ] , we hypothesize that awareness of functional abilities , memory , and balance will have differential patterns of clinical correlates . a secondary purpose of this paper is to contrast awareness for balance , function , and memory for those diagnosed with mild cognitive impairment ( mci ) . reduced awareness has been demonstrated for persons at high risk for dementia , and specifically for persons with amnestic mci ( amci ) . moreover , since awareness appears to differ based on dementia subtype , awareness for balance , function , and memory could be differentially affected for participants diagnosed with dementia due to ad versus non - ad dementias . therefore , the final comparison will explore awareness in groups of persons diagnosed with amci , non - amnestic mci , ad , and non - ad dementias .", "patients were from an interdisciplinary memory clinic established to provide early stage dementia differential diagnoses for rural persons . for this irb approved study , patients who were diagnosed with no cognitive impairment were excluded , and only patients who received a diagnosis of dementia or a variant of mci were included . diagnoses in this specialty clinic were consistent with the review of diagnostic guidelines provided by the canadian consensus on the diagnosis and treatment of dementias using recent comprehensive blood work , ct head scan , and interprofessional assessment data from neurology , neuropsychology , and physical therapy . the assessment procedures included standardized approaches ( e.g. , questionnaires , neuropsychological testing ) and also family interviews for clinical history and interviews with the informal caregiver who accompanied patients to the clinic ( families were strongly encouraged to attend the assessment and patients were asked to bring someone who knew them well . in the unusual circumstance when patients attended the clinic alone , telephone interviews were conducted with someone who knew them well , but questionnaire data were not collected ) . the sample consisted of 259 patients ( in the clinic 's 6th data release ) , and the vast majority ( 74% ) reported their ancestry as european , 9% were first nations or metis , and 17% chose other , rather than selecting one of the aforementioned categories , african or asian ancestry . table 1 includes descriptive information for the total clinical sample ( n = 259 patients ) and details the subgroups based on diagnosis . patients with dementia due to ad was the most common diagnosis ( n = 113 ) , and another heterogeneous subgroup ( n = 100 ) was created of patients with non - ad dementias ( i.e. , vascular dementias , mixed dementias , diffuse lewy body disease , dementia due to parkinsons ' disease , huntington 's dementia , variants of frontotemporal lobar degeneration , and dementias not otherwise specified ) . in addition , a third group included patients diagnosed with amnestic ( single or multiple domain ) mild cognitive impairment ( amci ; n = 23 ) and a fourth group included patients diagnosed with nonamnestic mci ( non - amci ; n = 23 ; single or multiple domains , which included those with diagnoses of vascular cognitive impairment , no dementia ) . although most of the clinic data were focused on patients for diagnostic purposes , informal caregivers ( n = 244 ) provided important collateral and personal information . caregivers ( m age = 61.40 , sd = 14.63 ) were typically family members and most of many were females ( 64% ) : 33% were wives , 20% were husbands , 31% were daughters , 10% were sons of the patient , with a remaining 7% whose relationship status included grandchildren , nieces , nephews , or friends . \n clinical correlates of awareness measures \n \n ( 1 ) assessment of severity . the clinical dementia rating ( cdr ) is a standardized and psychometrically sound clinician - based rating scale ( 0 to 3 ; no impairment to severe impairment ) , but summing the box scores of the six rating areas of the cdr ( cdr - sob ) provides a more detailed quantitative measure of global dementia severity and is more sensitive to detecting changes in dementia severity over time . \n patients rated their performance on the reliable and valid lawton instrumental activities of daily living ( iadl higher scores indicating independent functioning ) . patients ' caregivers rated patients ' performance of adls on two psychometrically strong scales : the functional assessment questionnaire ( faq ) and the bristol adl questionnaire where higher scores indicate impaired performance . \n the neuropsychiatric inventory ( npi ) is a well - researched and psychometrically strong caregiver rating of patients ' behaviours and associated caregiver distress . the centre for epidemiologic studies of depression ( cesd ) , a reliable and valid screen of depression , was self - rated by patients , with four factors : ( 1 ) depressed affect ( 2 ) lack of positive affect ( 3 ) somatic / vegetative and ( 4 ) interpersonal measuring social disconnectedness . \n self - report of caregiver burden was assessed with the short form of the zarit burden interview , which was shown to be psychometrically similar to the longer versions . the global severity index from the brief symptom inventory ( bsi ) measured caregiver self - report of overall psychological distress . \n ( 5 ) assessment of physical variables . a comprehensivephysical therapy assessment included the psychometrically strong berg balance scale ( bbs ) and the performance oriented mobility assessment ( poma , which is a measure of gait and balance ) . caregiver and patient reports of falls within the past 6 months were combined with bbs to estimate the probability of falling . patient self - report on the activities - specific balance confidence ( abc ) scale measured self - reported confidence in balance while doing a variety of day - to - day activities . \n each patient received a comprehensive neuropsychological assessment ( see for a review of the strong psychometric properties of these tests ) , and selected measures of executive function and working memory were analyzed . the ability to alternate attention was measured with the trail making test part b ( tmt b ) . the ability to inhibit an automatic response was measured with the stroop interference score . cognitive flexibility with speeded retrieval of language - based knowledge was measured using animal naming and phonemic fluency ( benton oral word association test ) . digit span backward subtest from the wechsler adult intelligence scale 3rd edition ( wais - iii ) measured working memory . finally , the index scores from the repeatable battery for the assessment of neuropsychological status ( rbans ) were analyzed . \n awareness of functional deficits ( af ) was operationalized using patient / caregiver congruence on reports of the patient 's ability to independently perform six iadls : management of finances , use of telephone , use of transportation , shopping , meal preparation , and performance of housework ( patient self - report version of the lawton iadl scale ; and caregiver report of patient 's function from the bristol adl scale ) . for each iadl , congruence was ranked on a 5-point scale ; the congruence ranking was summed across the six iadl items for a total of 30 possible points , with higher scores indicating greater awareness . data were available for 201 participants , and as can be seen in table 1 , most patients had good awareness of their functional abilities . af was significantly higher in the two mci diagnostic groups when compared with the two groups with dementia diagnoses . \n awareness of memory ( am ) was based on congruence between patient 's self - reports of memory on a standardized scale ( self - rating of memory scale ) and performance on a neuropsychological test of new learning ( repeatable battery for assessment of neuropsychological status ; rbans delayed memory index score ) . the delayed memory measure was chosen since it best captured consolidation difficulties asked about in the self - rating of memory scale . both the self rating of memory standardized scores and the rbans index scores were transformed into a linear ranked scale from 1 to 5 , with 1 indicating the lowest self - rating of memory and the lowest memory performance . the am score was created based on the congruence in ranking between self - reported and objectively measured memory , with 5 indicating perfect congruence . complete data were available for 192 participants . as can be seen in table 1 , most participants ' am was at the mid - point of the scale , but the ad and the amci subgroups reported significantly lower am than the non - ad dementia and non - amci groups . \n awareness of balance ( ab ) was based on congruence between patients ' ratings of balance confidence on the abc scale and the probability of falling . the abc and probability of falling were each transformed into ranked scores with 1 indicating low confidence or high probability of falling and 4 representing high confidence or low probability of falling . the ab score was created based on the congruence in ranking between self - reported balance confidence and objectively measured probability of falling , with 1 indicating low congruence and 4 indicating perfect congruence . perfect congruence between balance confidence and objective measurement may not be sufficient for stability ; rather underestimation of balance ( i.e. , less confidence than objective measurement would support ) has been shown to be associated with greater stability ( e.g. , [ 38 , 65 ] ) . consistent with this premise , ab ranking of 5 represented an underestimation of balance confidence relative to objectively measured balance . approximately one third of the sample ( 36% ) reported equivalent balance confidence to measured stability , 27% reported greater balance confidence than would be supported by objective measurement ( i.e. , reduced awareness ) , and 37% reported an underestimation of balance , which may be appropriate awareness for maximal stability ( e.g. , [ 38 , 65 ] ) . although the sample size was relatively small , ab was high for all groups and did not differ significantly for patients with diagnoses of amci , non - amci , ad , or non - ad dementias ( see table 1 ) . zero - order correlations were completed separately for af ( table 2 ) , am ( table 3 ) , and ab ( table 4 ) . only variables with significant correlations were used to minimize specification errors ( potential over- or undercorrection ) as predictors in simultaneous multiple regression equations . for each measure of awareness , analyses were conducted for the overall sample , but also for each of the four diagnostic groups . descriptors of magnitude of association were consistent with guidelines for small , medium , and large effect sizes provided by cohen .", "as can be seen in table 2 , af was highly correlated with caregiver report of adls ( faq and bristol adl each large magnitude associations ) . together these data suggest af was highly associated , but not redundant , with more comprehensive measures of day - to - day function . similarly , am was highly associated , but not redundant with the measures used to create it . as can be seen in table 3 , these associations were strong for the non - ad dementia and two mci groups but trivial for the ad group . finally , ab also demonstrated moderate , but nonredundant , associations with the variables used to create it . as can be seen in table 4 , the association with the abc scale was a moderate magnitude overall and for all diagnostic groups except the non - amci group . also seen in table 4 , ab was associated with both fall history in the past 6 months for the larger samples and overall . ab was associated with probability of falling only for specific diagnostic groups and the overall sample . the cell sizes for the poma were below 10 for the mci groups , but the small association was significant for the overall sample . overall , the correlations provide evidence for the convergent validity for each of the derived awareness measures . of interest , each measure of awareness appeared orthogonal : awareness of function was not associated with either awareness of memory ( rs = 0.026 , p > 0.05 , trivial magnitude ) or balance ( rs = 0.207 , p > 0.05 , small magnitude ) , and the latter two measures of awareness are similarly not well associated ( rs = 0.153 , p > 0.05 , small magnitude ) . for the overall sample , regression diagnostics suggested the bristol adl - caregiver , npi - distress , and rbans immediate and total scale indices were multicollinear , so these variables were excluded from the regression equation . the remaining predictors of cdr - sob , iadl - patient , faq - caregiver , npi - severity , zbi , probability of falling , bbs , clock drawing , rbans language , and visuospatial / constructional indices accounted for a large proportion of af variance ( r = 0.688 , p < 0.001 ) . not all predictors were equally predictive , however , and only the faq - caregiver ( t = 4.64 , p < 0.001 ) and zbi ( t = 3.06 , p = 0.003 ) were significant predictors of af . equivalent regression procedures were conducted separately for the four diagnostic subgroups , and across these analyses only measures of function were significant predictors of af ( ad group faq - caregiver t = 3.29 , p = 0.002 ; non - ad group faq - caregiver t = 3.03 , p = 0.004 ; amci group iadl - patient t = 2.30 , p = 0.035 ; and non - amci group badl - caregiver t = 2.37 , p = 0.029 ) . awareness of memory demonstrated a different pattern of zero - order correlations ( see table 3 ) , and the results of the regression analyses also suggested that the clinical correlates of am clearly differed from those of af . for the overall sample , the initial regression diagnostics resulted in removal of npi - severity and distress in addition to the rbans total scale index score due to multicollinearity . the overall model accounted for a large proportion of variance in am ( r = 0.736 , p < 0.001 ) , but of the predictors ( iadl - patient , cesd overall , cesd depressed affect , cesd somatic / vegetative , cesd interpersonal , bsi global severity , animal naming , and rbans immediate memory were excluded ) only the cesd - lack of positive affect ( t = 3.19 , p = 0.002 ) , the rbans visuospatial / constructional index ( t = 2.63 , p = 0.01 ) , and the rbans delayed memory index ( t = 8.65 , p < 0.001 ) remained significant . the regression equations for the diagnostic groups differed from the predictors for the overall group . for the non - amci group the overall model was nonsignificant ( likely due to only 9 participants having all variables complete ) . for the non - ad dementia group the rbans delayed memory index was the only significant predictor of am ( t = 2.32 , p = 0.028 ) , but for the few amci patients with all predictors complete the delayed memory was not significant ( t = 2.22 , p = 0.053 ) . perhaps most salient was the radically different associations between am and the clinical correlates for the ad group . here , only the iadl - patient ( t = 2.15 , p = 0.035 ) and cesd lack of positive affect ( t = 2.32 , p = 0.024 ) predicted am . the zero - order correlations that drove the regression equations for ab are shown in table 4 . the regression equations for the overall sample were less plagued by small sample size problems than the two mci groups . the clinical correlates of probability of falling , poma , and the bbs were excluded , however , due to multicollinearity . the remaining predictors were all significant : faq - caregiver ( t = 4.77 , p < 0.001 ) , the abc scale ( t = 6.61 , p < 0.01 ) , and fall history in last 6 months ( coded yes / no , t = 8.01 , p < 0.001 ) and together accounted for a large proportion of variance in ab ( r = 0.757 , p < 0.001 ) . when compared across the diagnostic groups , the two regression equations for the mci groups were not statistically significant , likely due to small sample sizes . for both dementia groups the abc scale was a significant predictor of ab ( ad group t = 4.61 , p = 0.038 , non - ad t = 2.34 , p = 0.014 ) but , in addition , for the non - ad group the fall history in last 6 months was significant ( t = 3.81 , p = 0.001 ) .", "these data support the hypothesis that awareness for different domains , specifically awareness of function , memory , and balance , would differentially relate to clinical correlates . this is in keeping with early work on awareness demonstrating differential clinical correlates for specific awareness domains [ 1215 ] and provides support for the assertion by markova and colleagues that awareness must be conceptualized as specific to the domain being measured , and that research on one domain can not be generalized to another domain . in addition to finding differential patterns of clinical correlates across domains of awareness , these data suggest that diagnostic group is also an important consideration in the clinical correlates of awareness . this was most evident in the clinical correlates for the ad group versus the non - ad and amci groups for awareness of memory . here , the relationship between specific symptoms of depression and awareness of memory was only evident for the ad group . in contrast , the clinical correlates for the other groups remain restricted to measures of memory . regarding caution in cross - domain generalization is not sufficient , and diagnostic grouping is another important consideration , at least for some domains of awareness . awareness of function was lower for the groups diagnosed with dementia than those with mci whereas awareness of memory was lower for the group with ad dementia and the group with amci , often considered a precursor to ad , than for the non - ad dementia or non - amci groups . our data suggest that awareness of specific domains was orthogonal : awareness of function was not associated with awareness of memory or awareness of balance . this was in contrast to the findings by ott and colleagues who found moderate correlations between awareness of memory and awareness of function . our method for measuring awareness of function was similar to that used by ott and colleagues ( namely , patient / caregiver discrepancy ) , but we used a discrepancy between performance and self - report to assess memory and balance awareness , which may account for these inconsistent findings . evidence for the modality specific nature of awareness is provided by the differential patterns of clinical correlates depending on domain measured . we found that the relation between caregiver burden and distress depended on the modality of awareness measured : reduced awareness of function was associated with increased caregiver reports of burden , which is consistent with findings from previous research [ 10 , 11 , 14 ] . balance awareness was the only awareness measure associated with physical variables such as past history of falls and self - reported balance confidence . the relation between balance awareness and falls is consistent with previous research demonstrating a strong relationship between proprioception and balance or falls . balance awareness was not related to any measure of neuropsychological functioning , despite previously reported relationships between risk of falls and measures of executive function . although none of the domains of awareness were associated with measures of executive function , awareness of memory was associated with neuropsychological variables of the delayed memory index and the visuospatial / constructional indices from the rbans . the associations with neuropsychological variables differed , however , when the diagnostic groups were considered separately . interestingly , awareness of memory was not associated with the delayed memory scores for the ad group . a floor effect in the delayed memory score appears to have created problems with heteroscedasticity in the bivariate memory awareness relationship , which may have attenuated any associations . the possible floor effect in memory measures did not , however , impact the association between depressive symptoms and awareness of memory , only for the ad group . the findings of differential clinical correlates for awareness of memory based on diagnostic group may speak to some of the most contradictory findings regarding correlates of awareness . neuropsychological function is inconsistently related to awareness [ 1 , 12 , 19 , 20 , 27 , 29 ] , and the relationship between awareness in dementia and depression is complicated , with clinical lore and empirical data supporting the notion that increased awareness is associated with more symptoms of depressed mood [ 18 , 25 ] , but increased awareness and depression may only be related to subclinical ( or dysthymia ) rather than major depression . our data suggest that in addition to modality of awareness being considered when measuring associations of neuropsychological and depressive symptoms with awareness , diagnostic group is an additional important consideration . patients with dementia due to ad appear to have differential clinical correlates for awareness of memory versus patients with non - ad dementia , for example . although the prediction of differential clinical correlates for the different domains of awareness was supported , some of our predictions regarding these clinical correlates were contrary to previous research . in zero - order associations , severity was associated with awareness of function , but with no other domain of awareness . moreover , severity did not account for sufficient unique variance in awareness of function and was , therefore , not a significant predictor . this finding is in contrast to the cumulative cross - sectional data demonstrating an association between severity of cognitive impairment and awareness ( see for a thorough review ) and is contrary to the more compelling longitudinal data demonstrating decreasing awareness with increasing cognitive impairment [ 16 , 18 ] . these contrasting findings likely speak to the orthogonal and domain - specific nature of the construct of awareness . aalten and colleagues ' and mcdaniel and colleagues ' prospective studies measured awareness by clinician ratings based on an interview with patient and caregiver regarding the patient 's history of cognitive deficits and their impact on function . finally , all measures of awareness were associated with some measure of independence in daily function , particularly instrumental activities of daily living which is evidence against modality specificity . assessment of functional abilities as a clinical correlate for measures of awareness is not often reported in the literature , but the few studies that do exist suggest that decreased awareness is associated with increased functional limitations , which is consistent with our data . despite adding to the converging research on the modality - specific nature of awareness [ 4 , 810 ] , these data are limited by the inconsistency in the measurement methods used for each modality of awareness . measurement of awareness of function was based on caregiver / patient discrepancy , whereas awareness of memory and of balance was based on discrepancy between self - report and objective measures of performance . if awareness is a true construct , it should not be highly dependent on how it is measured . if , for example , awareness of function differs greatly when measured with caregiver / patient discrepancy versus patient / observation discrepancy , then this would not be a construct at all and would be considered an artifact of measurement . if awareness is an artifact of measurement , future research measuring awareness of different modalities of awareness with different methods for measuring awareness will find markedly different clinical correlates than those presented here . another more problematic limitation of these data is the fact that this sample is derived from a specialty clinic . specialty clinic patients have been postulated to have higher awareness than the general dementia population due to the referral process for specialty clinics . it is unclear how having higher awareness may have impacted the differential patterns of clinical correlates for these multiple domains of awareness . although replication is required , these data demonstrate differential patterns of clinical correlates for awareness of function and memory . in addition , this study provides a novel contribution by describing the clinical correlates for awareness of balance . these data provide evidence for modality specific relations between awareness and clinical correlates in a database with a wide range of standardized measures of clinical correlates including severity , function , neuropsychiatric symptoms , depression , caregiver burden and distress , and a comprehensive assessment of neuropsychological status . differing patterns of clinical correlates for awareness of function , awareness of memory , and awareness of balance provide support for the modality specific uniqueness of awareness measures for each of these domains . data demonstrating different patterns of awareness based on diagnostic group ( namely , amci , non - amci , ad , and non - ad dementia diagnoses ) provides further evidence for the modality specific nature of awareness . modality specificity , if replicated in different populations , for example , stroke patients , could have implications for rehabilitation . these data would suggest that rehabilitation needs to be targeted to a domain of awareness since awareness is not a unitary construct . future research is needed on the clinical course and implications for day - to - day care associated with impairments in specific modalities of awareness for persons with dementia ." ]

[ "severe skin and soft tissue infections of the head and neck are rare conditions that may emerge secondarily to oropharyngeal infections . anaerobic bacteria are often involved and may contribute to extensive inflammation , necrosis , and abscess formation . secondary focal complications as bacterial invasion of vasculature , venous or arterial septic embolisation to the brain , spine or thorax may appear . lemierre 's syndrome ( ls ) is a manifestation with anaerobic aetiology and septic thrombophlebitis of the internal jugular vein . cervicocranial necrotizing fasciitis ( cnf ) is a more superficial infection , and descending necrotizing mediastinitis ( dnm ) is a deep manifestation of this group of diseases . broad - spectrum antibiotics are the basis of treatment , and early surgery is often necessary , especially in nf and dnm . the role of adjuvant treatment with hyperbaric oxygen ( hbot ) in these conditions is controversial . especially for infections with anaerobic microbes , other than in knowledge of the possible benefit of adjuvant treatment is important for this group of patients . here we present three cases with definite or probable involvement of anaerobic bacteria , where hbo was used with a favourable outcome .", "a 67-year - old man in previously good condition , experienced a sore throat and dysphagia for 5 days . on admission to hospital temperature was 38,1c , heart rate ( hr ) 125/min , blood pressure ( bp ) 110/59 mm hg , respiratory rate ( rr ) 30/min , and sa02 87% with 12 l 02/min supplement via a nonrebreather mask . on clinical examination the neck was asymmetric with an enlarged mass on the left side , and crepitus was felt by palpation . a ct - scan demonstrated soft tissue swelling , subcutaneous gas ( figure 2 ) , and a muscle abscess in the neck . antibiotic treatment was initiated , and he had to undergo immediate surgery with drainage of the abscess . mixed anaerobic microbes were identified ( table 1 ) . due to the foci of infection , gas - production in the tissue and positive cultures for anaerobic bacteria , it was decided to start with hyperbaric oxygen treatment ( hbot ) for 90 min sequences at 3 atmosphere absolute ( ata ) . hbot at 3 ata was chosen based on the recommendation for treatment of clostridial myonecrosis from undersea and hyperbaric medical society ( uhms ) . a total of 5 hbot were performed in the next 2.5 days , the first starting a few hours after the initial surgery . already after 3 hbots the surgeon reported a halt of the ongoing necrotizing infection in the area . after 5 hbots the patients condition was reported to be under control and stabilized , and hbot was discontinued . during hbo - treatment the sequential organ failure assessment ( sofa ) score decreased from 12 to 5 , and vasopressor was ceased ( figure 1 ) . although the condition improved , another ct - scan of the neck and chest demonstrated thrombosis of the left jugular vein and an additional abscess in the upper mediastinum . after 27 days in the icu , the patient was transferred to the medical ward , were he stayed another 36 days before he was discharged from hospital to home . changes in c - reactive protein ( , mg / l ) , procalcitonin ( , g / l * 100 ) and sequential organ failure assessment -score * 10 ( ) during the first twelve days in hospital . the hyperbaric oxygen treatment period is marked . crp , c - reactive protein ; pct , procalcitonin ; sofa , sequential organ failure assessment ; hbo , hyperbaric oxygen . \n changes in c - reactive protein ( , mg / l ) , procalcitonin ( , g / l * 100 ) and sequential organ failure assessment -score * 10 ( ) during the first twelve days in hospital . the hyperbaric oxygen treatment period is marked . crp , c - reactive protein ; pct , procalcitonin ; sofa , sequential organ failure assessment ; hbo , hyperbaric oxygen . \n figure 2computed tomography scan of thorax , showing loculaments of air in the tissue of the mediastinum ( white arrows ) in patient # 1 . \n computed tomography scan of thorax , showing loculaments of air in the tissue of the mediastinum ( white arrows ) in patient # 1 . \n table 1clinical data of patient # 1 and # 2.localizationdetection methodmicrobepatient # 1blood cultureculture / v3-v4 sequencingcampylobacter species ( rectus / showae)anaerobic blood culturemicroscopygram positive coccusneckculturepeptostreptococcus anaerobius , propionibacterium acnesmediastinumv1-v3 , group specific primers*parvimonas spp . , treponema denticola , prevotella dentalis , prevotella biviamediastinumv3 v4 sequencing*porphyromonas gingivalis , bacteriodes species ( parabecteriodes goldsteinii)patient # 2tonsilsmicroscopyfusiform gram negative rodsculturehaemophilus parainfluenzae , streptococcus viridans \n aggregatibacter aphrophilus , group b streptococcus , mediastinum , tonsilsculturestreptococcus milleri , prevotella speciesmediastinumculturepeptostreptococcus species*used ripseq software \n", "a healthy 53 year old man with psoriatic disease experienced 6 days of sore throat . due to sudden onset of chest pain a coronary event was suspected . on admittance to hospital he was in reduced general state with a temperature of 37 , 3c , hr 90/min , a ct - scan of neck and chest showed inflammation of the upper and lower mediastinum , involving the pericardium , and gas was seen in deep tissue layers . figure 3computed tomography scan of thorax , showing loculaments of air in the tissue of the mediastinum ( black arrow ) in patient # 2 . \n computed tomography scan of thorax , showing loculaments of air in the tissue of the mediastinum ( black arrow ) in patient # 2 . it was decided to treat the surgical wound with vacuum assisted closure ( vac ) , and initially not by hbot . however , over the next 5 days his condition did not improve , a ct - scan demonstrated bilateral empyema , significant inflammation in soft tissue of the neck and mediastinum , and gas surrounding the heart . due to the foci of infection , gas - production in the tissue and identification of anaerobic pathogens , he underwent a total of 5 hbo - treatments the next 3 days , as described in case 1 . upon hbot , the patient improved , vasopressors were ceased , and crp decreased from 285 to 116 mg / l ( figure 4 ) . four days after the last hbo - treatment his sternum was closed . after a total of 21 days in icu he was discharged to the ear - nose - and throat ward ( ent ) . changes in c - reactive protein ( , mg / l ) , procalcitonin ( , g / l * 100 ) and and sequential organ failure assessment -score * 10 ( ) during the first 16 days in hospital . the hyperbaric oxygen treatment period is marked . hbo , hyperbaric oxygen ; crp , c - reactive protein ; pct , procalcitonin ; sofa , sequential organ failure assessment . \n changes in c - reactive protein ( , mg / l ) , procalcitonin ( , g / l * 100 ) and and sequential organ failure assessment -score * 10 ( ) during the first 16 days in hospital . the hyperbaric oxygen treatment period is marked . hbo , hyperbaric oxygen ; crp , c - reactive protein ; pct , procalcitonin ; sofa , sequential organ failure assessment .", "a previously healthy woman , age 22 , had a history of 6 days with progressive dysphagia . she was admitted to the local hospital due to increasing systemic signs of infection , accompanied by tenderness of the neck and chest pain . she received treatment with antibiotics for one day , before she was transferred to the regional hospital . distinct tenderness on the left side of the neck was found , as well as discrete oedema . on inspection of the oropharynx , slight elevation of the left side of the lateral pharyngeal wall was seen . laboratory results are given in figure 5 . a new ct - scan and an mri confirmed the findings of inflammatory changes in the neck as well as an mediastinal abscess , together with thromboses of the left jugular and subclavian veins . the abscess was not suited for surgical drainage due to difficult access ; small volume and density measured by ct . she was treated with antibiotics and lmhw in the infectious diseases ward . in an attempt to reduce further progression of inflammation and pus formation , hbot was started ( 3 ata , 90 min ) whereby the patient 's condition improved shortly after this treatment was introduced ( figure 5 ) . three days after discontinuation of hbot she was transferred to her local hospital for further conservative measures . after two weeks she was discharged from the local hospital , where treatment was continued with antibiotics for another 2 weeks and anticoagulation for 3 months . changes in c - reactive protein ( , mg / l ) and , sequential organ failure assessment -score * 10 ( ) during the first 13 days in hospital . the hyperbaric oxygen treatment period is marked . hbo , hyperbaric oxygen ; crp , c - reactive protein ; sofa , sequential organ failure assessment . \n changes in c - reactive protein ( , mg / l ) and , sequential organ failure assessment -score * 10 ( ) during the first 13 days in hospital . the hyperbaric oxygen treatment period is marked . hbo , hyperbaric oxygen ; crp , c - reactive protein ; sofa , sequential organ failure assessment .", "in each of these three cases we diagnosed the patient with an extensive soft - tissue infection of the neck and mediastinum . patient # 1 and # 3 met the criteria for lemierre 's syndrome , and patient # 2 had findings consistent with dnm . in patient # 1 and # 2 several bacteria were identified with an oropharyngeal origin . both anaerobic and aerobic bacteria were probably involved in the disease of these two patients . anaerobic involvement was probable also the case in patient # 3 , as crepitations in the skin were found under clinical examination . the contribution of hbot to the recovery of each patient will be discussed in the following . descending necrotizing infections of the head and neck are rare and the case fatality rate is high . severe infections of the head and neck often start with symptoms from the source of infection . in lemierre 's syndrome sore throat and neck pain the origin is often a pharyngotonsillitis or a peritonsillar abscess . in cnf , dysphagia and a sore throat a dental infection is often the primary source of infection in dnm , pharyngeal infection is most often the primary source . in our three cases , all presented with a history of sore throat and dysphagia . the two patients with lemierre 's syndrome both had oropharyngeal infections with downward spread of infection to the mediastinum . in lemierre 's syndrome the spread is usually metastatic from the thrombophlebitis of the affected vein . in dnm the spread is probably facilitated by gravity , breathing and negative intrathoracic pressure . the systemic effects predominate when the mediastinum becomes more involved ; capillary leak , possible respiratory distress syndrome ( ards ) and empyema . the necrotizing infections described herein are typically polymicrobial , and anaerobic microbes normally harboured in the oral cavity are usually involved . all the tested bacteria were sensitive to penicillin g and are considered sensitive to the initial empiric therapy . however , the sub - optimal effect of antibiotics observed was most likely caused by local factors as impaired perfusion , oxygen depletion , impaired immunofunction or bacterial community mediated antibiotic tolerance mechanisms . strictly anaerobic microbes are easily killed during specimen transport and handling if anaerobic conditions are not maintained . , often considered the main bacteria causing lemierre 's syndrome , are extremely sensitive to o2 and can be missed by traditional culture methods . the usefulness of alternative techniques is illustrated in case 1 , where 16srdna detection identified in total 6 species that were not identified by conventional culture . 16srdna sequencing in mixed infections gives mixed chromatograms where overlying sequences make it difficult to identify which nucleic acid belong to which microbe . this was overcome by using the newly developed software ripseq that identified 2 microbes ( porphyromonas gingivalis and bacteroides spp . ) . the 16srdna sequencing , in this study targeted either or both of the variable gene regions v1-v3 and v3-v4 . using group specific primers and ripseq we were able to identify an additional 4 microbes . such detection methods based on genus / species specific nucleic acids are particularly useful in infections caused by fastidious and oxygen sensitive bacteria . earlier only infections caused by a single bacterial species could be detected by 16 rdna sequencing , but by using group specific primers and rip seq software this can be accomplished also for polymicrobial infections , even after antimicrobial therapy is started , as illustrated in this case report . patient # 1 and # 2 were treated in a multiplace - chamber due their need of intensive care and respirator ( haux - quadro 2500 - 2200 ) . in patient # 1 , an improvement in the clinical condition was objectively observed after three hbots . he received two additional treatments , and his clinical condition further improved , objectively observed by marked reduction of the sofa - score ( figure 1 ) . however , his condition worsened a few days later , and an abscess in the mediastinum was found and removed by drainage . one might argue a need for additional hbot in this patient , but this was not done . however , his clinical condition worsened and it was not until the start of hbot at day 5 one was able to get control over his infection and his condition stabilized . this patient was treated in a monoplace - chamber ( baramed hyperbaric chambers , etc ) . the use of hbot in conjunction with surgical debridement , antibiotic therapy and maximal critical - care therapy for severe soft tissue infections is widely accepted , but the efficacy of hbo remains unproven . in soft tissue infections , an area of hypoxia develops . the hypoxia impairs phagocytosis , and the drop in ph creates a milieu for growth of anaerobic organisms . gas is frequently seen in crepitant necrotizing infections , as described in our three cases . hbot provides oxygenation to otherwise ischemic areas , and reduces the impact of hypoxia on leukocyte function . hbot of infections also occurs via hbo acting as a bactericide or as a bacteristatic agent to some microorganisms , and through an additive and/or synergistic effect on some antimicrobial drugs . in patient # 1 the surgeon reported vital tissue only in the affected area , shortly after start of hbot which may illustrate its therapeutic potential . in all the cases , a clinical improvement was seen after the start of hbot , but the specific role of hbot in this improvement is difficult to estimate .", "the necrotizing infections described herein are typically polymicrobial , and anaerobic microbes normally harboured in the oral cavity are usually involved . all the tested bacteria were sensitive to penicillin g and are considered sensitive to the initial empiric therapy . however , the sub - optimal effect of antibiotics observed was most likely caused by local factors as impaired perfusion , oxygen depletion , impaired immunofunction or bacterial community mediated antibiotic tolerance mechanisms . strictly anaerobic microbes are easily killed during specimen transport and handling if anaerobic conditions are not maintained . , often considered the main bacteria causing lemierre 's syndrome , are extremely sensitive to o2 and can be missed by traditional culture methods . the usefulness of alternative techniques is illustrated in case 1 , where 16srdna detection identified in total 6 species that were not identified by conventional culture . 16srdna sequencing in mixed infections gives mixed chromatograms where overlying sequences make it difficult to identify which nucleic acid belong to which microbe . this was overcome by using the newly developed software ripseq that identified 2 microbes ( porphyromonas gingivalis and bacteroides spp . ) . the 16srdna sequencing , in this study targeted either or both of the variable gene regions v1-v3 and v3-v4 . using group specific primers and ripseq we were able to identify an additional 4 microbes . such detection methods based on genus / species specific nucleic acids are particularly useful in infections caused by fastidious and oxygen sensitive bacteria . earlier only infections caused by a single bacterial species could be detected by 16 rdna sequencing , but by using group specific primers and rip seq software this can be accomplished also for polymicrobial infections , even after antimicrobial therapy is started , as illustrated in this case report .", "patient # 1 and # 2 were treated in a multiplace - chamber due their need of intensive care and respirator ( haux - quadro 2500 - 2200 ) . in patient # 1 , an improvement in the clinical condition was objectively observed after three hbots . he received two additional treatments , and his clinical condition further improved , objectively observed by marked reduction of the sofa - score ( figure 1 ) . however , his condition worsened a few days later , and an abscess in the mediastinum was found and removed by drainage . one might argue a need for additional hbot in this patient , but this was not done . however , his clinical condition worsened and it was not until the start of hbot at day 5 one was able to get control over his infection and his condition stabilized . this patient was treated in a monoplace - chamber ( baramed hyperbaric chambers , etc ) . the use of hbot in conjunction with surgical debridement , antibiotic therapy and maximal critical - care therapy for severe soft tissue infections is widely accepted , but the efficacy of hbo remains unproven . in soft tissue infections , an area of hypoxia develops . the hypoxia impairs phagocytosis , and the drop in ph creates a milieu for growth of anaerobic organisms . gas is frequently seen in crepitant necrotizing infections , as described in our three cases . hbot provides oxygenation to otherwise ischemic areas , and reduces the impact of hypoxia on leukocyte function . hbot of infections also occurs via hbo acting as a bactericide or as a bacteristatic agent to some microorganisms , and through an additive and/or synergistic effect on some antimicrobial drugs . in patient # 1 the surgeon reported vital tissue only in the affected area , shortly after start of hbot which may illustrate its therapeutic potential . in all the cases , a clinical improvement was seen after the start of hbot , but the specific role of hbot in this improvement is difficult to estimate .", "data on hbot of such infections are scarce and not conclusive , but somewhat in support of this . recent availability of hbot with intensive care facilities at our hospital has led to three hbo treated cases all demonstrating a significant clinical improvement . we also show that hbot may be used on the basis of only strong clinical suspicion of anaerobic infection . the cases demonstrate that use of polymerase chain reaction is especially useful in the diagnostics of anaerobic infections . when hbot is available , it should be considered as adjunctive treatment in extensive infections with anaerobes , but more studies are needed to evaluate the effect ." ]

[ "the binding of il-6 to its receptor induces the activation of multiple signal transduction pathways such as jak / stats ( janus tyrosine kinase / signal transducers and activators of transcription ) pathway , ras / erk ( extracellular signal - regulated kinase ) pathway , and pi 3-k ( phosphotidylinositol 3-kinase)/akt pathway via gp130 tyrosine phosphorylation . the roles of jak / stats pathway and ras / erk pathway in the biological effects of il-6 have been extensively investigated . however , what role pi 3-k / akt plays in il-6 signaling is less clear . akt is a serine ( ser)/threonine ( thr ) protein kinase which resides within the cytosol in a catalytically inactive state in quiescent or serum - starved cells . after stimulation of cells with growth factors and cytokines , akt is catalytically activated by phosphorylation at thr308 and ser473 . activated akt in turn phosphorylates downstream target molecules and induces the expression of anti - apoptosis proteins , which promote induction of its anti - apoptosis effect . recently , growing evidence suggests the involvement of pi 3-k / akt in il-6-dependent survival and proliferative responses in several types of cells [ 3 - 6 ] . still , whether pi 3-k / akt plays the same role in il-6-dependent growth of 7td1 mouse - mouse b cell hybridoma is not known . in our previous work , we showed that erk cascade but not stat3 contributed to il-6-dependent growth of 7td1 cells . here we report that il-6 triggers activation of pi3-k / akt signaling in 7td1 cells , and that il-6-induced pi 3-k / akt activation is essential for the optimal growth of 7td1 cells .", "-mercaptoethanol and recombinant human il-6 ( 10u / mg ) were added to the medium at final concentration of 5 10mol / l and 5 ng / ml , respectively . wortmannin ( sigma ) was dissolved in dmso to 2.5 mm and stored at -20c . dmso was added to control cells to keep concentrations of dmso ( < 0.1% ) equal in all samples . the cells were pretreated with wortmannin for 30 min at 37c before il-6 was added to the medium . the cells were seeded into 96-well plate and cultured in the presence of different dose of il-6 for 72 h. afterwards , 10 l mtt ( sigma , 5 mg / ml ) was added to each well , 4 h later , an equal volume of 10%sds-10 mm hcl was added to dissolve the blue crystals of formazan . the samples were measured at od 570 nm by an elisa reader ( dynatech laboratories , inc . u.s.a . ) . after protein determination , total cell lysates ( 5 10cell / sample ) were boiled in 2 reducing sds loading buffer of equal volume for 10 min . after electrophoresis , proteins were transferred to a 0.45 3 m pore - size nitrocellulose membrane at 40 v for 2 h. non - specific binding sites on the nitrocellulose membrane were blocked by incubation in blocking buffer ( 5% w / v , non - fat dried milk ) for 1 h at 37c . the blots were washed once with tris - buffered saline ( 10 mm tris / hcl ph 7.5 , 150 mm nacl ) and incubated with the primary antibody for 1 h at 37c or overnight at 4c . after the removal of excess primary antibody with three washes , the blots were incubated with a secondary antibody ( goat anti - mouse or goat anti - rabbit antibodies conjugated with horseradish peroxidase ) . the membrane was developed with enhanced chemiluminescence reagent and exposed to hyperfilm - ecl(amersham life science corp . ) for detection . akt and phospho - akt ( ser473 ) antibodies were products of new england biolabs ( beverly , ma , u.s.a . ) . anti-(human xiap ) antibody was a product of medical and biological laboratories ( naka , nagoya , japan ) . anti - bcl-2 and anti - caspase-3 antibodies were obtained from santa cruz biotechnology ( santa cruz , ca , u.s.a . ) .", "-mercaptoethanol and recombinant human il-6 ( 10u / mg ) were added to the medium at final concentration of 5 10mol / l and 5 ng / ml , respectively . wortmannin ( sigma ) was dissolved in dmso to 2.5 mm and stored at -20c . dmso was added to control cells to keep concentrations of dmso ( < 0.1% ) equal in all samples . the cells were pretreated with wortmannin for 30 min at 37c before il-6 was added to the medium .", "the cells were seeded into 96-well plate and cultured in the presence of different dose of il-6 for 72 h. afterwards , 10 l mtt ( sigma , 5 mg / ml ) was added to each well , 4 h later , an equal volume of 10%sds-10 mm hcl was added to dissolve the blue crystals of formazan . the samples were measured at od 570 nm by an elisa reader ( dynatech laboratories , inc . u.s.a . ) .", "after protein determination , total cell lysates ( 5 10cell / sample ) were boiled in 2 reducing sds loading buffer of equal volume for 10 min . after electrophoresis , proteins were transferred to a 0.45 3 m pore - size nitrocellulose membrane at 40 v for 2 h. non - specific binding sites on the nitrocellulose membrane were blocked by incubation in blocking buffer ( 5% w / v , non - fat dried milk ) for 1 h at 37c . the blots were washed once with tris - buffered saline ( 10 mm tris / hcl ph 7.5 , 150 mm nacl ) and incubated with the primary antibody for 1 h at 37c or overnight at 4c . after the removal of excess primary antibody with three washes , the blots were incubated with a secondary antibody ( goat anti - mouse or goat anti - rabbit antibodies conjugated with horseradish peroxidase ) . the membrane was developed with enhanced chemiluminescence reagent and exposed to hyperfilm - ecl(amersham life science corp . ) for detection . akt and phospho - akt ( ser473 ) antibodies were products of new england biolabs ( beverly , ma , u.s.a . ) . anti-(human xiap ) antibody was a product of medical and biological laboratories ( naka , nagoya , japan ) . anti - bcl-2 and anti - caspase-3 antibodies were obtained from santa cruz biotechnology ( santa cruz , ca , u.s.a . ) .", "il-6 induced phosphorylation ( ser473 ) of akt , a downstream effector of pi 3-k , in 7td1 cells . this activation by il-6 occurred as early as 5 min , and was dependent on the dose of il-6 . il-6 stimulated phosphorylation of akt in a dose- and time - dependent manner in 7td1 cells . 7td1 cells were starved in il-6-free medium for 6 h. then the cells were cultured in the presence of different dose of il-6 for 5 min or in the presence of 1 ng / ml il-6 for 0 , 5 , 10 , 30 , 60 min respectively . after the cells were collected and washed , whole - cell extracts were prepared and subjected to western - blotting assay . this figure is representative of 3 separate experiments . to investigate what role pi 3k / akt plays in the signal transduction of il-6 in 7td1 hybridoma cells , we determined the effects of wortmannin , a pi 3-k specific inhibitor at 10100 nmol / l , on il-6-induced phosphorylation of akt and il-6-dependent growth of 7td1 cells . it was found that wortmannin significantly antagonized il-6-induced phosphorylation of akt and il-6-dependent growth of 7td1 cells and the inhibitory effects of wortmannin were dependent on its concentration . these data confirm that activation of akt is mediated by a pi 3-k - dependent mechanism and suggest that il-6-induced pi 3-k / akt activation is essential for the optimal growth of 7td1 cells ( fig . effects of wortmannin on il-6-induced phosphorylation of akt ( a ) and il-6-dependent growth of 7td1 cells ( b ) . 7td1 cells were starved in il-6-free medium for 6 h. then the cells were pretreated with wortmannin or dmso of equal volume for 30 min at 37c before il-6 was added into the medium . ( after the cells were collected and washed , whole - cell extracts were prepared and subjected to western - blotting assay . ( b ) the cells were seeded into 96-well plate ( 2 10cells per well ) and cultured in the presence of different dose of il-6 for 72 h. afterwards , mtt assay was performed to determine the effect of wortmannin on il-6-dependent growth of 7td1 cells . the preceding experiments suggest that il-6-induced pi 3-k / akt activation is essential for the optimal growth of 7td1 cells . recent evidence has indicated that proteins of the inhibitor of apoptosis ( iap ) family , whose expression might be under the regulation of nf-b , can block apoptotic events by directly binding and inhibiting selected caspases . a potent mammalian iap is x - linked iap ( xiap ) , for which the mechanism of action involves the direct binding and inhibition of caspase-3 and caspase-7 , two key effector proteases of apoptosis . it is reported that the level of bcl-2 , but not bcl - xl and mcl-1 , decreased after il-6 deprivation . to examine the effects of il-6-induced pi3-k / akt activation on these apoptosis - related proteins , we further studied il-6-induced expression of bcl-2 as well as xiap and caspase-3 in 7td1 cells by western - blotting assay with bcl-2 , xiap , and caspase-3 antibodies , with or without wortmannin . untreated 7td1 cells displayed significant levels of these apoptosis - related gene products ( fig . 3 ) . il-6 significantly up - regulated the levels of xiap and bcl-2 but had little effect on the level of caspase-3 . . taken together , these data suggest that il-6 might induce up - regulation of xiap through pi 3-k / akt activation . effects of il-6 and wortmannin on the expression of apoptosis - related proteins in 7td1 cells . ( a ) 7td1 cells were starved in il-6-free medium for 6 h. then the cells were cultured in the presence of 1 ng / ml il-6 for various periods as indicated . at the end of the incubation period , whole - cell extracts were prepared and subjected to western - blotting assay . ( b ) 7td1 cells were starved in il-6-free medium for 6 h. then the cells were pretreated with wortmannin or dmso of equal volume for 30 min at 37c before il-6 was added into the medium . the cells were cultured for 1 h in the presence of il-6 . after the cells were collected and washed , whole - cell extracts were prepared and subjected to western - blotting assay .", "il-6 induced phosphorylation ( ser473 ) of akt , a downstream effector of pi 3-k , in 7td1 cells . this activation by il-6 occurred as early as 5 min , and was dependent on the dose of il-6 . il-6 stimulated phosphorylation of akt in a dose- and time - dependent manner in 7td1 cells . 7td1 cells were starved in il-6-free medium for 6 h. then the cells were cultured in the presence of different dose of il-6 for 5 min or in the presence of 1 ng / ml il-6 for 0 , 5 , 10 , 30 , 60 min respectively . after the cells were collected and washed , whole - cell extracts were prepared and subjected to western - blotting assay .", "to investigate what role pi 3k / akt plays in the signal transduction of il-6 in 7td1 hybridoma cells , we determined the effects of wortmannin , a pi 3-k specific inhibitor at 10100 nmol / l , on il-6-induced phosphorylation of akt and il-6-dependent growth of 7td1 cells . it was found that wortmannin significantly antagonized il-6-induced phosphorylation of akt and il-6-dependent growth of 7td1 cells and the inhibitory effects of wortmannin were dependent on its concentration . these data confirm that activation of akt is mediated by a pi 3-k - dependent mechanism and suggest that il-6-induced pi 3-k / akt activation is essential for the optimal growth of 7td1 cells ( fig . effects of wortmannin on il-6-induced phosphorylation of akt ( a ) and il-6-dependent growth of 7td1 cells ( b ) . 7td1 cells were starved in il-6-free medium for 6 h. then the cells were pretreated with wortmannin or dmso of equal volume for 30 min at 37c before il-6 was added into the medium . ( after the cells were collected and washed , whole - cell extracts were prepared and subjected to western - blotting assay . ( b ) the cells were seeded into 96-well plate ( 2 10cells per well ) and cultured in the presence of different dose of il-6 for 72 h. afterwards , mtt assay was performed to determine the effect of wortmannin on il-6-dependent growth of 7td1 cells .", "the preceding experiments suggest that il-6-induced pi 3-k / akt activation is essential for the optimal growth of 7td1 cells . recent evidence has indicated that proteins of the inhibitor of apoptosis ( iap ) family , whose expression might be under the regulation of nf-b , can block apoptotic events by directly binding and inhibiting selected caspases . a potent mammalian iap is x - linked iap ( xiap ) , for which the mechanism of action involves the direct binding and inhibition of caspase-3 and caspase-7 , two key effector proteases of apoptosis . it is reported that the level of bcl-2 , but not bcl - xl and mcl-1 , decreased after il-6 deprivation . to examine the effects of il-6-induced pi3-k / akt activation on these apoptosis - related proteins , we further studied il-6-induced expression of bcl-2 as well as xiap and caspase-3 in 7td1 cells by western - blotting assay with bcl-2 , xiap , and caspase-3 antibodies , with or without wortmannin . untreated 7td1 cells displayed significant levels of these apoptosis - related gene products ( fig . 3 ) . il-6 significantly up - regulated the levels of xiap and bcl-2 but had little effect on the level of caspase-3 . . taken together , these data suggest that il-6 might induce up - regulation of xiap through pi 3-k / akt activation . effects of il-6 and wortmannin on the expression of apoptosis - related proteins in 7td1 cells . ( a ) 7td1 cells were starved in il-6-free medium for 6 h. then the cells were cultured in the presence of 1 ng / ml il-6 for various periods as indicated . at the end of the incubation period , ( b ) 7td1 cells were starved in il-6-free medium for 6 h. then the cells were pretreated with wortmannin or dmso of equal volume for 30 min at 37c before il-6 was added into the medium . the cells were cultured for 1 h in the presence of il-6 . after the cells were collected and washed , whole - cell extracts were prepared and subjected to western - blotting assay .", "il-6 inhibits physiological cell death and allows expansion of populations of serum - stimulated cells . how il-6 can promote the growth of 7td1 cells remains elusive . in our previous work , we showed that erk cascade but not stat3 contributed to il-6-dependent growth of 7td1 cells . however , activation of erk cascade seems not to be sufficient since mek inhibitor pd098059 pretreatment resulted in partial blockade of il-6-induced growth of 7td1 cells although il-6-induced activity of erk cascade can be completely blocked by pd098059 of the same concentration . in this work , we show that il-6-induced pi 3-k / akt activation is also essential for the optimal growth of 7td1 cells . taken together , our data suggest that il-6 promotes the growth of 7td1 cells via activation of multiple signal transduction pathways including erk cascade and pi 3-k / akt pathway . recently , growing evidence suggests the involvement of pi 3-k / akt in il-6-dependent survival and proliferative responses in several types of cells [ 3 - 6 ] . our data are consistent with these findings , further confirming the important roles of pi 3-k / akt in il-6 signaling . furthermore , we found that xiap , but not bcl-2 , might be a downstream target molecule of akt since both constitutive and il-6-induced expression of xiap , but not bcl-2 , in 7td1 cells was inhibited by wortmannin . recent evidence has indicated that the expression of xiap might be under the regulation of nf-b . pi 3-k / akt pathway is thought to be involved in the full activation of nf-b through phosphorylation of the rel proteins . this is the first report that xiap is involved in il-6-mediated anti - apoptosis mechanism .", "" ]

[ "endoscopic ultrasound ( eus)-guided tissue acquisition is the diagnostic procedure of choice in many diseases of the gastrointestinal tract and adjacent structures . this procedure is well known for its high accuracy and low complication rate ; however , its outcome closely relies on several factors . the location and characteristics of the lesion , endosonographer 's experience , needle size and type , sampling technique , sample preparation , presence of a cytopathologist for rapid on - site examination ( rose ) , and cytologist 's expertise are considered some of the important factors.1,2 issues related to needle selection will be discussed here .", "currently , there are three different sizes of commercially available eus fine - needle aspiration ( eus - fna ) needles : 19 , 22 , and 25 gauge ( g ) . the size of the needle should be chosen consciously because it can directly affect the quality of the procured sample . generally speaking , larger needles may render bigger tissue for diagnosis ; however , samples tend to be bloodier , which might hinder the cytologic interpretation . as a 19 g conventional needle is stiff and has limitation in the transduodenal approach , a new flexible 19 g nitinol needle ( expect 19 g flex ; boston scientific , natick , ma , usa ) has been introduced.3 recently , a new side - port needle has been developed by olympus ( tokyo , japan ) , and it is expected to allow better cellular acquisition.4 the spring - loaded 19 g biopsy needle trucut ( cook medical , winston - salem , nc , usa ) has been designed for the procurement of tissue core samples;5 however , it is not feasible to use with the transduodenal approach and has been reported to result in technical failures . the newly developed procore needle ( cook medical ) , which incorporates reverse bevel technology , has various available sizes and enables the transduodenal approach.6", "currently , there are three different sizes of commercially available eus fine - needle aspiration ( eus - fna ) needles : 19 , 22 , and 25 gauge ( g ) . the size of the needle should be chosen consciously because it can directly affect the quality of the procured sample . generally speaking , larger needles may render bigger tissue for diagnosis ; however , samples tend to be bloodier , which might hinder the cytologic interpretation . as a 19 g conventional needle is stiff and has limitation in the transduodenal approach , a new flexible 19 g nitinol needle ( expect 19 g flex ; boston scientific , natick , ma , usa ) has been introduced.3 recently , a new side - port needle has been developed by olympus ( tokyo , japan ) , and it is expected to allow better cellular acquisition.4", "the spring - loaded 19 g biopsy needle trucut ( cook medical , winston - salem , nc , usa ) has been designed for the procurement of tissue core samples;5 however , it is not feasible to use with the transduodenal approach and has been reported to result in technical failures . the newly developed procore needle ( cook medical ) , which incorporates reverse bevel technology , has various available sizes and enables the transduodenal approach.6", "the advantage of eus - guided tissue acquisition is its high accuracy and safety . according to a meta - analysis , the pooled diagnostic sensitivity and specificity of eus - fna in the diagnosis of solid pancreatic masses were 86.8% ( 95% confidence interval [ ci ] , 85.5 to 87.9 ) and 95.8% ( 95% ci , 94.6 to 96.7 ) , respectively.7 however , there is no consensus on the number of passes to achieve the highest diagnostic accuracy . increased number of passes may yield a higher diagnostic accuracy with a theoretically higher complication rate . the average numbers of passes to obtain an adequate diagnostic sample for a solid lesion are known to be five to seven passes for the conventional fna needle . however , the mean number of passes required for diagnosis with the new olympus 22 g side - port needle was only 1.7 in a prospective multicenter study ; however , the number of enrolled cases in that study was small.8 the procore needle seems to be able to obtain enough tissue for diagnosis with only a few passes . when single and multiple ( two to four ) passes of the 25 g procore needle were compared in the diagnosis of solid pancreatic lesions , the sensitivity , specificity , and accuracy were 85% vs. 96% , 100% vs. 100% , and 86% vs. 96% , respectively.9 in a prospective study , the diagnostic accuracy of eus - guided trucut needle core biopsy was 61% , with a mean value of 1.4 needle passes.10 the transduodenal approach was possible only in 40% of the patients . when subgroup analysis was done on technically successful cases only , the diagnostic accuracy was 87.5% . in a multicenter , pooled , cohort study , the overall diagnostic accuracy of the 19 g procore needle was 85%.6 during transduodenal procedures , sampling was done in 94% ; however , there were some technical difficulties . the combination of eus - fna / fine - needle biopsy ( fnb ) techniques revealed the highest diagnostic accuracy of 91% compared with 77% for eus - fna alone and 73% for eus - fnb alone ( p=0.008).11 another study showed an 84% diagnostic accuracy with eus - guided trucut needle biopsy and suggested the additional use of eus - fna as a rescue diagnostic tool.12 eus - fnb is useful in obtaining core tissue with a few passes . rose is critical for the high diagnostic accuracy of eus - fna;13 however , if an endosonographer can obtain visible tissue core with an fnb needle , the outcome may not be dependent on rose , which is not always readily available for many institutions . aspiration of core tissue with preserved architecture is beneficial for the diagnosis of some specific diseases such as submucosal masses,14 lymphomas,15 and autoimmune pancreatitis.16 as molecular profiling and personalized oncologic therapy are becoming important concepts nowadays , a histologic core biopsy sample is necessary for ancillary testing.17 tissue core can be obtained with a conventional aspiration needle or a specialized fnb needle . a study reported that satisfactory histologic specimens were procured in 94.7% and tissue acquisition for cytological assessment was successful in 100% , including the transduodenal route , when an expect 19 g flex aspiration needle was used.3 the high tissue acquisition rate is partially because of the high elasticity of the needle , which facilitates the transduodenal pass . small pancreatic lesions ( < 2 cm ) and nueroendocrine tumors are related to a higher complication rate ; however , no definite relation was proven with patient 's age , location of lesion , needle size , and number of needle passes.18 the type of needle does not seem to pose a big difference in the complication rate .", "many studies reported that there was no significant difference in diagnostic outcome and needle size . a study reported that the diagnostic accuracy of the 19 g needle for solid pancreatic and peripancreatic masses was 86.7% and that of the 22 g needle was 78.9% ( p=0.268).19 a 19 g aspiration needle could render a higher amount of tissue ; however , technical failure was more frequent when the mass was located in the head of the pancreas . when technical failures were excluded , the diagnostic accuracy of the 19 g needle was 94.5% . it can be easily bent in a perpendicular direction and also has a wider puncture range . therefore , the 25 g needle is better for targeting pancreatic head and uncinate lesions through the transduodenal route . the obtained sample size may be smaller , but it might result in minimal blood contamination . in a prospective , randomized trial comparing 22 and 25 g needles for solid pancreatic masses , the tissue samples provided positive diagnosis in 87.5% in the 22 g group and 95.5% in the 25 g group ( p=0.18).20 according to a meta - analysis , the pooled sensitivity of the 22 and 25 g needles was 0.85 ( 95% ci , 0.82 to 0.88 ) and 0.93 ( 95% ci , 0.91 to 0.96 ) , respectively . the pooled specificity of the 22 and 25 g needle was 1 ( 95% ci , 0.98 to 1.00 ) and 0.97 ( 95% ci , 0.93 to 0.99 ) , respectively . the 25 g needle showed a higher sensitivity ( p=0.0003 ) but comparable specificity to ( p=0.97 ) the 22 g needle.21 another study showed that the overall accuracy of the 25 and 22 g eus - fna needles and the 19 g trucut needle was 91.7% , 79.7% , and 54.1% , respectively , in the diagnosis of solid pancreatic masses.22 for head and uncinate lesions , the 25 g fna needle was technically more successful and had significantly superior overall diagnostic accuracy than the other needles . a study compared same - sized fna and fnb needles for the diagnosis of solid pancreatic neoplasms and reported a striking result.23 when five passes of the 22 g echotip ultra needle and two passes of the 22 g echotip procore needle were performed for same lesion alternately for 32 cases , the ability to achieve a diagnosis was 93.8% for fna and 28.1% for fnb . during the fnb procedure , when the echoendoscope was positioned within the duodenum , fnb could not be performed because of technical reasons . the authors did not explain the details of tissue processing failures but noted that the \" procore needle failed to obtain enough tissue to survive processing as a regular core biopsy for histology ( tissue attrition during processing ) . \" however , a previous randomized trial that compared a 22 g fna needle ( expect ; boston scientific ) and a 22 g fnb needle ( echotip procore ; cook endoscopy , bloomington , in , usa ) for solid pancreatic masses reported different results.24 the diagnostic sufficiency was 100% and 89.3% ( p=0.24 ) for the fna and fnb needle , respectively . the 22 g biopsy needle procured both cytologic and histologic specimen ( 89.3% and 80% , respectively ) , with a 3.6% technical failure rate . according to a meta - analysis , needle size confers only a limited effect on the overall outcomes in eus - fna for solid pancreatic masses.25 a study compared 22 g eus - fna without rose and 19 g trucut biopsy.26 the overall accuracy was 76% for both procedures , whereas the combination of the two procedures rendered a 95% diagnostic accuracy . thus , eus - fnb showed a similar diagnostic accuracy to eus - fna without rose , with fewer passes . the authors reported that they can obtain a positive report with eus - fnb when eus - fna was negative in cases of gastrointestinal stromal tumors , pancreatic adenocarcinoma , lung cancer , metastatic mediastinal node , retroperitoneal lymphoma , and mediastinal lymphoma.26", "usually , a cytological sample is enough to establish a diagnosis ; however , histologic assessment may be useful in some cases such as pancreatic tumors other than pancreatic adenocarcinoma , tumors surrounded by chronic pancreatitis , submucosal and intramural gastrointestinal tumors , and for the biopsy of lesions or lymph nodes in which lymphoma is suspected.17 certain diseases such as autoimmune pancreatitis , well - differentiated adenocarcinoma , and highly desmoplastic pancreatic neoplasm may also require tissue core samples for a definitive diagnosis . histological samples can often be obtained with a standard fna needle , and addition of cell block examination can provide good information that is comparable to an fnb sample.27 therefore , eus - fnb can be a recommendable supplementary technique when additional tissue and histologic section are necessary for an accurate diagnosis and if molecular characterization of tumors is required.8,17 the stiffness of the needle is a large obstacle to overcome in harvesting core tissues with the transduodenal approach .", "the needle size and type can be some of the factors that influence the diagnostic yield of eus - guided tissue acquisition . there are no convincing data showing any significant advantage between the three commonly used fna needle sizes . the smaller 25 g needle , which yields at least comparable results to the 22 and 19 g needles , may be easier to maneuver . large - bore needles can procure more tissue ; however , the sample tends to be bloodier and technical failure may occur . the yield of an fnb needle is higher with fewer passes and ancillary testing is usually possible . needle selection is a complex process and should be made on the basis of many aspects , such as the location and physical characteristics of the lesion , availability of rose , and clinical needs considering the suspected diagnosis.29" ]

[ "in this review , pubmed and sciencedirect databases were used to identify relevant articles published until the 3rd of april 2013 ( date of search ) . the search was conducted using the electronic library of king saud bin abdul aziz university for health sciences , riyadh , saudi arabia . pubmed search identified 3 groups of articles as follows : disease of interest ( keyword : autism ) , geographical location ( keywords : saudi , uae , oman , kuwait , qatar , and bahrain ) , and epidemiological terms ( keywords : epidemiology , prognosis , diagnosis , pattern , odds , risk , incidence , prevalence , impact , trends , and biomarker ) . finally , the boolean operator and combined the results for each group of articles , a total of 22 articles met the inclusion criteria . epidemiology of autism and each of the gcc countries individually , which yielded a total of 79 results . the titles of the final list consisting of 101 results were reviewed , 85 articles were excluded because they were not related to epidemiology of autism , and the abstracts of the remaining 16 articles were obtained . after reviewing the 16 abstracts , 6 more articles were eliminated : reviews ( n=3 ) , 2 were qualitative studies and abstract / full text of the sixth was irretrievable . a search was conducted for the full text of the remaining 10 articles , of which 8 were located and 2 were not . the first was an article published as a brief communication,16 and the second is an article published during the writing up of this review.17 literature search flowchart .", "studies were identified from 3 gcc countries only ; oman , saudi arabia , and uae . the 10 included articles , 3 were prevalence studies , and the rest discussed potential risk factors or biomarkers for autism in patients from gcc countries . prevalence studies were conducted in uae,18 saudi arabia,19 oman,20 and bahrain.17 the prevalence of asd was 1.4 per 10,000 in oman , and 29 per 10,000 for pdd in uae , and 4.3 per 10,000 in bahrain.17,18,20 the saudi study documented patients characteristics and reasons for referral for group of saudi autistic patients.19 male gender and history of developmental delay were significantly associated with autism prevalence in all 3 studies . consanguinity was present in 28.6% of saudi patients , and behavioral problems such as hyperactivity or aggression were evident in 45% of patients ( table 1).19 summary of epidemiological studies on autism / autism spectrum disorder in the gulf cooperation countries . the included studies were conducted in saudi arabia , oman , or bahrain , and all employed the case - control study design . sample size varied between these studies from 52 to 204 patients ; and the risk factors investigated were : suboptimal breastfeeding,21 lead exposure,22 serum osteopontin,23 maternal and paternal age , cesarian section , and prenatal complications . delayed initiation of breastfeeding and no colostrum intake was associated with increased risk of asd . exclusive and prolonged breastfeeding ( up to 24 months or more ) markedly reduced the risk of developing asd.21 higher blood levels of lead22 and osteopontin23 were found in autism patients . occurrence of autistic disorder was correlated with maternal ( or 1.83 ) and paternal ( or 2.08 ) age above 30 years at time of birth . the disease was also more common among children of mothers who delivered with a cesarian section or had antenatal complications16,17 ( table 1 ) . lipid peroxidation,24 glutathione peroxidase,25 superoxide dismutase , sodium - potassium adenosine triphosphatase,21 lactate , saturated fatty acids,26 and homocysteine26 levels were significantly higher among autistic patients . inversely , levels of vitamin e,24 glutathione,24 folate , vitamin b12,27 and some polyunsaturated acids were much lower in autistic patients . serum osteopontin levels were higher among autistic patients,25 and levels were positively related to the severity of autism ( table 1 ) .", "prevalence studies were conducted in uae,18 saudi arabia,19 oman,20 and bahrain.17 the prevalence of asd was 1.4 per 10,000 in oman , and 29 per 10,000 for pdd in uae , and 4.3 per 10,000 in bahrain.17,18,20 the saudi study documented patients characteristics and reasons for referral for group of saudi autistic patients.19 male gender and history of developmental delay were significantly associated with autism prevalence in all 3 studies . consanguinity was present in 28.6% of saudi patients , and behavioral problems such as hyperactivity or aggression were evident in 45% of patients ( table 1).19 summary of epidemiological studies on autism / autism spectrum disorder in the gulf cooperation countries .", "the included studies were conducted in saudi arabia , oman , or bahrain , and all employed the case - control study design . sample size varied between these studies from 52 to 204 patients ; and the risk factors investigated were : suboptimal breastfeeding,21 lead exposure,22 serum osteopontin,23 maternal and paternal age , cesarian section , and prenatal complications . delayed initiation of breastfeeding and no colostrum intake was associated with increased risk of asd . exclusive and prolonged breastfeeding ( up to 24 months or more ) markedly reduced the risk of developing asd.21 higher blood levels of lead22 and osteopontin23 were found in autism patients . occurrence of autistic disorder was correlated with maternal ( or 1.83 ) and paternal ( or 2.08 ) age above 30 years at time of birth . the disease was also more common among children of mothers who delivered with a cesarian section or had antenatal complications16,17 ( table 1 ) . lipid peroxidation,24 glutathione peroxidase,25 superoxide dismutase , sodium - potassium adenosine triphosphatase,21 lactate , saturated fatty acids,26 and homocysteine26 levels were significantly higher among autistic patients . inversely , levels of vitamin e,24 glutathione,24 folate , vitamin b12,27 and some polyunsaturated acids were much lower in autistic patients . serum osteopontin levels were higher among autistic patients,25 and levels were positively related to the severity of autism ( table 1 ) .", "the prevalence of asd and pdd was highly variable between included studies.18,20 the difference between both rates could be attributed , in part , to setting , method of assessment , and age of participants . the omani study20 included a larger sample with wide age range to determine prevalence of formally diagnosed asd from medical records . conversely , the emirati study18 screened a sample of preschool children for undiagnosed pdd , and the case definition for pdd is more inclusive than asd . for example , studies in europe recorded a prevalence that ranged from 1.9 up to 72.6 per 10,000 , and the range has been wider ( 2.8 - 94 per 10,000 ) in china.1 prevalence is also affected by accessibility to a specialized autism care center and source of case identification ( mainly families ) . a low prevalence rate is expected in areas with no facilities or centers for case reporting . over time , healthcare professionals and families have learned more about the disorder , and the increased awareness resulted in more comprehensive diagnostic criteria . this emphasizes the need to establish a reliable autism - screening tool that can be applied in community - based studies to produce more precise prevalence in gcc countries . collaborative efforts should target increasing awareness of the community toward asd to encourage early consultation and diagnosis . also , availability and accessibility to diagnosis and treatment centers should be assessed in light of the burden of this disorder . the male to female ratio in gcc countries was consistent with studies from elsewhere showing male predilection,1 and there is no evidence to date that explains this finding.12 one possible reason is that female children are more able to mask their behavioral difficulties than males.19 moreover , culture in developing countries may be a contributing factor , as some families may pay more attention to the development of male children compared with females . as the burden of reporting cases falls on parents ; there could be a lack of detection or lack of willingness to report certain behavior exhibited by a female child . this cultural perception could explain the older age for females at autism diagnosis in saudi arabia.19 either way ; more research is needed to explain other reasons behind this significant gender difference . still , with consanguinity rates in saudi arabia that range from 34 - 80% , depending on rural , or urban setting , this risk factor deserves further investigation.19,28 lead toxicity has been associated with autism,22 which is in agreement with other research.29 however , the nature of environmental exposure that might have contributed to lead toxicity was not clarified in the study . a strong dose - response protective effect of breastfeeding21 is in agreement with other studies,30,31 but potential for recall bias remains high as data collection depends on parents memory and reporting . findings for various biomarkers were comparable with studies carried out elsewhere.29,32 - 35 still , more research is needed to clarify applicability of these biomarkers for early screening or monitoring of autistic patients . first , is the sample size , as numbers of cases and controls used were small and can not be considered representative . also , the recruitment of cases and controls was from specialized clinics / tertiary care institutions , which might be problematic when extrapolating results to community autistic children in gcc countries . second , is that cases were recruited from pediatric wards , and none come from psychiatric clinics . the diagnosis of autism must include more comprehensive behavioral / psychological considerations to form a full picture about the disorder . the current study s limitations were the small number of studies identified and absence of studies from 3 gcc countries , which precluded comparing prevalence of autism across countries . generally , there is an evident lack of research into risk factors affecting the etiology of autism in gcc countries . consanguinity , multiparity , and closely - spaced pregnancies are common in the gcc region , and provide an exceptional opportunity to learn more about genetic determinants of the disease . also , dietary habits should be looked into as they could help in i ) investigating the risk and prognostic factors of the disease and , ii ) assisting families by identifying high - risk foods that could affect their children . more focus should be given to children in psychiatric wards to identify autistic symptoms among them . in conclusion , population - based studies should focus on quantifying the burden of asd in gcc countries . knowing the burden and extent of disease could help design screening tools that are applicable , culturally acceptable , and cost - effective to identify individuals who can benefit the most from early diagnosis and intervention . furthermore , raising asd awareness among parents , preschool / elementary school teachers are invaluable in helping autistic children cope with different challenges .", "generally , there is an evident lack of research into risk factors affecting the etiology of autism in gcc countries . consanguinity , multiparity , and closely - spaced pregnancies are common in the gcc region , and provide an exceptional opportunity to learn more about genetic determinants of the disease . also , dietary habits should be looked into as they could help in i ) investigating the risk and prognostic factors of the disease and , ii ) assisting families by identifying high - risk foods that could affect their children . more focus should be given to children in psychiatric wards to identify autistic symptoms among them . in conclusion , population - based studies should focus on quantifying the burden of asd in gcc countries . knowing the burden and extent of disease could help design screening tools that are applicable , culturally acceptable , and cost - effective to identify individuals who can benefit the most from early diagnosis and intervention . furthermore , raising asd awareness among parents , preschool / elementary school teachers are invaluable in helping autistic children cope with different challenges ." ]

[ "as the cervical spine degenerates with age , there is increased risk of undesirable conditions such as displacement or degeneration of intervertebral disc , slackness of annulus fibrosis , osteophytosis of vertebral body and instability . degenerative cervical disc may cause posterior neck pain , radiating pain on arm or shoulder , or cervical myelopathy . anterior cervical discectomy and fusion ( acdf ) is a safe and standard operation for the treatment of degenerative cervical disc disease concerned with radiculopathy or myelopathy29 ) . the main purposes of intervertebral cage are biomechanical support , restoration of disc height , maintaining of cervical lordosis and ideal osteointegration4,17,19 ) . tricortical iliac crest autobone graft results in numerous complications including breaking of bone graft , collapsing , pseudoarthrosis , subsidence , angular deformation , protrusion of bone block , pain or bleeding of donor site and infection22,30,31 ) . the most frequently donor site related complication is pain , and infection of harvest site could be a nettlesome problem23 ) . to solve these problems , various types of artificial cages providing immediate firmness without a plate system a standard cage alone for acdf is an effective method to treat degenerative cervical disease23 ) . short term clinical follow up data has been published less than 18 months after acdf with the polyetheretherketone ( peek ) cage . in the current study , we present a retrospective long term(mean period : 36 months ) study of thirty consecutive patients after acdf with solis cage with iliac autobone graft .", "we collected information from charts of patients who visited our neurosurgical department from march 2006 to july 2008 , retrospectively . only patients with single level acdf without anterior cervical plate were eligible for the study , and thirty patients were selected ( male : 20 patients and female : 10 patients ) . the mean age was 47.67.1 years ( range from 28 to 63 years old ) . the patients who complained of radiculopathy were 21 , myelopathy were 2 and myeloradiculopathy were 7 patients . mean follow - up period was 36.48.1 months ( ranged from 23 to 49 months ) . a right side skin incision was done in all cases ; fluoroscopy was used to check the target level . complete removal of the disc , lateral decompression and end plate flattening for maximal contact with cage was performed . after selection of ideal trial size by using intraoperative fluoroscopy , harvested cancellous bone from the iliac crest filled in the hollow space of the cage . finally , we checked that the radiopaque titanium spike was in an adequate location by fluoroscopy . we used the japanese orthopedic association ( joa ) score for evaluation of myelopathy and visual analogue scale ( vas ) for radiating pain to estimate postoperative clinical outcome . we assessed degree of pain relief between preoperative and postoperative ( last follow - up ) status by using two scoring systems . three parameters were used to evaluate radiologic outcome : anterior disc height ( adh ) , interbody height ( ih ) and segmental interbody angle ( sia ) ( fig . they were checked by plain x - ray on true lateral standing and classified into flexion , extension and neutral position view and 3d ct scan every 6 months after the surgery . fusion was defined according to trabecular bony formation across interfaces between cage and endplates and bony bridge formation between endplates . fusion was classified into 3 classifications : grade i , bridging bone partially filling the cage ; grade ii , bridging bone filling the cage ; and grade iii , bridging bone within and around the cage26 ) .", "we collected information from charts of patients who visited our neurosurgical department from march 2006 to july 2008 , retrospectively . only patients with single level acdf without anterior cervical plate were eligible for the study , and thirty patients were selected ( male : 20 patients and female : 10 patients ) . the mean age was 47.67.1 years ( range from 28 to 63 years old ) . the patients who complained of radiculopathy were 21 , myelopathy were 2 and myeloradiculopathy were 7 patients . mean follow - up period was 36.48.1 months ( ranged from 23 to 49 months ) .", "a right side skin incision was done in all cases ; fluoroscopy was used to check the target level . complete removal of the disc , lateral decompression and end plate flattening for maximal contact with cage was performed . after selection of ideal trial size by using intraoperative fluoroscopy , harvested cancellous bone from the iliac crest filled in the hollow space of the cage . finally , we checked that the radiopaque titanium spike was in an adequate location by fluoroscopy .", "we used the japanese orthopedic association ( joa ) score for evaluation of myelopathy and visual analogue scale ( vas ) for radiating pain to estimate postoperative clinical outcome . we assessed degree of pain relief between preoperative and postoperative ( last follow - up ) status by using two scoring systems . three parameters were used to evaluate radiologic outcome : anterior disc height ( adh ) , interbody height ( ih ) and segmental interbody angle ( sia ) ( fig . they were checked by plain x - ray on true lateral standing and classified into flexion , extension and neutral position view and 3d ct scan every 6 months after the surgery . fusion was defined according to trabecular bony formation across interfaces between cage and endplates and bony bridge formation between endplates . fusion was classified into 3 classifications : grade i , bridging bone partially filling the cage ; grade ii , bridging bone filling the cage ; and grade iii , bridging bone within and around the cage26 ) .", "we compared vas for neck and arm between preoperative and last follow - up status , additionally , joa score was also used . the mean vas for neck at the last exam was 2.50.8 and for arm was 3.21.1 ( p - value < 0.05 ) . in joa scoring assessment for 9 patients who were suffered from myelopathy , score improved from 11.12.9 at preoperative status to 14.52.6 at last exam(p - value < 0.05 ) . among 30 cases , 22 patients were performed 3 dimensional ct scan ( 3d ct ) at last follow - up and remainders were checked by cervical dynamic plain x - ray . radiological fusion rate was accomplished by 100% in selected group after 36 months after the surgery . grade i fusion were found in 1 case , grade ii were in 3 cases and grade iii were in 18 cases on 3 dct scan . on plain x - ray , grade i fusion was no case , grade ii were 1 cases and grade iii were 7 cases ( fig . the mean adh was 6.271.47 mm before the surgery and improved to 10.631.32 mm after the surgery ( p - value < 0.05 ) . some degree of subsidence occurred at the last follow - up and final adh was 8.321.08mm(p - value < 0.05 ) . in same way , ih improved from 36.73.35 mm to 41.24.23mm(p - value < 0.05 ) and slightly decreased to 38.73.75 mm at the last exam(p - value < 0.05 ) ; however , we still achieved an increase of ih . the mean preoperative sia was -3.353.44 and postoperative sia was -6.853.01 ( p - value < 0.05 ) . at the final exam , sia was -3.213.61 , not statistically different between postoperative sia and final exam sia ( p - value=0.813 ) . we had no complications concerned with the surgery itself except one case of osteomyelitis . during the follow - up period the superficial osteomyelitis of iliac bone donor site developed in 1 patient and a culture study of the infection site confirmed methicillin resistant staphylococcus aureus ( mrsa ) infection . we performed local debridement and irrigation and treated with vancomycin intravenous treatment for 10 days .", "we compared vas for neck and arm between preoperative and last follow - up status , additionally , joa score was also used . the mean vas for neck at the last exam was 2.50.8 and for arm was 3.21.1 ( p - value < 0.05 ) . in joa scoring assessment for 9 patients who were suffered from myelopathy , score improved from 11.12.9 at preoperative status to 14.52.6 at last exam(p - value < 0.05 ) .", "among 30 cases , 22 patients were performed 3 dimensional ct scan ( 3d ct ) at last follow - up and remainders were checked by cervical dynamic plain x - ray . radiological fusion rate was accomplished by 100% in selected group after 36 months after the surgery . grade i fusion were found in 1 case , grade ii were in 3 cases and grade iii were in 18 cases on 3 dct scan . on plain x - ray , grade i fusion was no case , grade ii were 1 cases and grade iii were 7 cases ( fig . the mean adh was 6.271.47 mm before the surgery and improved to 10.631.32 mm after the surgery ( p - value < 0.05 ) . some degree of subsidence occurred at the last follow - up and final adh was 8.321.08mm(p - value < 0.05 ) . in same way , ih improved from 36.73.35 mm to 41.24.23mm(p - value < 0.05 ) and slightly decreased to 38.73.75 mm at the last exam(p - value < 0.05 ) ; however , we still achieved an increase of ih . the mean preoperative sia was -3.353.44 and postoperative sia was -6.853.01 ( p - value < 0.05 ) . at the final exam , sia was -3.213.61 , not statistically different between postoperative sia and final exam sia ( p - value=0.813 ) .", "we had no complications concerned with the surgery itself except one case of osteomyelitis . during the follow - up period the superficial osteomyelitis of iliac bone donor site developed in 1 patient and a culture study of the infection site confirmed methicillin resistant staphylococcus aureus ( mrsa ) infection . we performed local debridement and irrigation and treated with vancomycin intravenous treatment for 10 days .", "acdf has been performed for treatment of cervical degenerative disease and applied to infectious disease , cervical trauma and tumorous condition10 ) . clinically , acdf with cage system began to be used regularly after clinical success of prospective research year 200013 ) . single level acdf with autograft shows over 95% of fusion rate and approximately 80% of neurologic improvement15,24,25 ) . some reports postulated there was no need for fusion after cervical discectomy and fusion should be considered only when instability occurs32 ) . the limitation of a cage - alone procedure is weak initial mechanical stability and subsidence to endplate . a cervical anterior plate and screw system provides reduction of kyphotic angulation , prevention of implant migration , and increases fusion rate and durable fixation . there may be , however , dysphasia due to plate and loosening , breakage of screw , plate migration and stress shield3,5,15 ) . innovative development of surgical instrument have reduced complications of the anterior plate system . however , complications are still reported even though dynamic plate or self locking screw is suggested27 ) . the peek cages are biologically inactive which means they do not induce a corrosive reaction and provide high versatility and good mechanical properties while causing minimal artifacts on mri and ct8,9 ) . furthermore , excellent radiolucency gives information that surgeon can use to adjust the cage at an optimal location during operation , and bone fusion can be readily evaluated by plain x - ray11,34 ) . titanium spikes on upper and bottom can make easy to anchor the vertebral body and provide immediate fixation , therefore cage migration is prevented . elastic modulus is defined as the capacity of returning to its initial shape when load is removed . lower elastic modulus shows a more natural characteristic with respect of bone material and lead to reduction of stress shield and increase bony fusion rate33 ) . among several cervical implants , high elastic mismatch between cage and bone can affect bone growth , promoting cortical thinning and subsidence in the case of metallic cages18,34 ) . generally , it is acceptable that bone fusion is achieved around 3 to 6 months after the surgery when using the peek cage . cho et al . reported 100% of bone fusion in forty cases was achieved by using peek cage comparing 93.1% of bone fusion when using iliac tricortical bonegraft9 ) . in this study , we achieved 100% of fusion rate . only cancellous bone from the iliac crest might be great role of increase fusion rate and small size of patient group might be another cause . the frequency of harvest autograft has decreased gradually , because of the relatively high rate of complications18 ) . complications of tricortical iliac bone graft are various such as displacement bone graft , pseudoarthrosis , hematoma , pain , nerve injury and infection of donor site20 ) . the incidence of related complications has been reported to be as high as 20% to 50%1,28 ) . moreover , the low stabilization support of iliac crest grafts requires instrumentation with anterior plate34 ) . to reduce complications related with donor site , many types of material have been studied to substitute autologous bone , but none of these have showed advantage over autologous bone6,16 ) . many complications related with iliac bone graft have been reduced with the use of cage system23 ) . in our patient group , the wound incision on the donor site was performed minimally and harvested only small amount of cancellous bone to minimize related complications . numerous materials have been tried to substitute for autologous bone graft to reduce donor site related complications . the ultimate material could provide immediate structural support and osteogenic intergration23 ) . since introduction of the cervical cage , numerous types of cage have been designed ; however subsidence of cage was reported frequently . ha et al . studied subsidence in standalone solis cage and found 8.1% of cages had subsidence greater than 3mm12 ) . noted that a decrease of disc height after operation did not affect clinical outcome20 ) . lee et al . found that subsidence occurred on radiologic evaluation at last follow - up when they used dmb rather than autologous bone graft23 ) . however , our data shows that at 36 months follow - up ih is still maintained compared to preoperative ih which implies autologous bone graft helps earlier bone fusion than dbm . symptomatic adjacent segment problems occur at rate of 2.9% per year during ten years after acdf with autologous bone graft , the risk was lower in multilevel acdf than in single level , and the fusion rate declines as the number of involved levels increase11,14 ) . in our study , we could not find degeneration of adjacent levels , but we concluded that this is due to small size of patient group . in current study , the complications of acdf with the peek cage did not include breaking , pseudoarthrosis , kyphotic angulation , protrusion of cage itself , and severe subsidence . however , one patient suffered from infection of donor site . local heating and pus discharge occurred at right iliac crest where cancellous bone was harvested and culture study performed . methicillin - resistant staphylococcus aureus ( mrsa ) was detected and vancomycin was prescribed for a week . to establish a role of the peek cage in acdf the authors searched many articles to find a long term follow - up study for clinical outcome after acdf with peek cage longer than 36 months but we believe that this study is the first report for long term follow - up .", "acdf with the solis cage provides favorable clinical outcomes and radiologic fusion rates comparing with other classical or alternative cervical fusion methods . it does not cause plate relating complication and radiologic opacity of cage spike enable to locate a cage at optimal location by using fluoroscope . there have been several reports that describe the efficacy of acdf with peek cage for short term follow - up , but long term(more than 24 months ) follow - up studies are rare . we present here a long term follow - up study for acdf with peek cage and its clinical efficacy is favorable ." ]

[ "the main attributes of biological identity are sex , age , stature , and ethnic background of the individual , which are also called the big four in forensic context . human identification is of paramount importance , for both legal as well as humanitarian purpose . albeit there have been tremendous advancements in forensic medicine , this remains a practical problem . the use of dental identification has long been considered a reliable method , especially when other methods ( fingerprints ) fail because body conditions are not available , and over time , forensic odontology has emerged as a complete branch . teeth can survive and remain virtually unaffected long after other soft tissue and skeletal tissues have been destroyed . the recognition of teeth as a tissue that withstands great variation in environment ( temperature upto 1600 c , humidity , and ph ) has lead to its application in personal identification . it has been observed in past time that dental tissues have witnessed its importance worldwide where it has contributed enormously in identification of victims in disaster , 80% of non - thai in tsunami in thailand and 20% in 26/11 incidence where 12 coordinated shooting and bombing attacks were carried by terrorists in mumbai , india 's most populous city on 26 november , 2010 were identified using teeth . other than this , it has been reported that renowned people like adolf hitler and indian prime minister rajiv gandhi were identified using tooth . several parameters have been proposed for sex determination to identify an individual from teeth , but none of them have proved its reliability . recently , dna analysis in forensic have gained attraction , but it is expensive and time - consuming . this prompted us to look for other methods of dental identification , which will be cost - effective yet reliable . tooth pulp is encased in a hard tissue casting , where it may be protected from detrimental effects of impact , trauma , and heat . developed a technique using pulpal tissue stained with quinacrine mustard , specific for y chromosome to determine sex of an individual . in literature , there is scarcity of relevant studies that analyzed the effect of caries on viability of pulpal tissue in sex determination . so , keeping in mind this fact , present study was conducted to analyze the effect of caries on pulpal tissue stained with quinacrine hydrochloride with the application of fluorescent microscope .", "this study was carried out in the department of oral pathology and microbiology , swami devi dyal hospital and dental college barwala , panchkula . the study protocol was approved by the ethical committee of college before commencement of the procedure . fifty maxillary and mandibular permanent teeth that were indicated for extraction for periodontal and endodontic reasons were included in the study . study sample consisted of 25 male and 25 female teeth , which were further categorized into 5 groups of 10 each ( 10 from males and 10 from females ) based on the extent of caries progression . group a includes freshly extracted tooth specimens with no caries , group b consisted of tooth specimens with caries in enamel , group c comprised of tooth specimens with caries less than half way of dentin , group d consisted of freshly extracted teeth with caries more than half way of dentin , and group e includes freshly extracted tooth specimen with caries involving pulp . the teeth were examined radiographically and clinically for analyzing the various stages of caries progression [ figure 1 ] . ( a ) sound teeth , ( b ) enamel , ( c ) less than half way of dentin , ( d ) more than half way of dentin , ( e ) pulp modeling wax was folded and made into a block . the tooth was embedded on the modeling block . to remove the pulp , the crown it was adequately washed in normal saline to remove any calcified bone or dentine particles . the pulp tissue was then transferred to the dry and clean conical centrifuge tubes containing 5 ml of fixative ( 3 methanol:1 glacial acetic acid ) and left as such for about half an hour to 2 hours for the fixation of the pulp cells . it was then crushed with the glass rod sufficiently to isolate the pulp cells . a suspension five ml of fresh fixative was then added to re - suspend the pellet , and the process was repeated thrice till a clear suspension of the pulp cells was obtained . thin smears were prepared on chilled microscope slides of 1 mm thickness by the air - drying method i.e. , by dropping 2 - 3 drops of the above suspension on the slide from a distance of inches to get a homogenous population of cells . the slide was mounted in buffer of ph 5.5 and was observed under leica dmr fluorescent microscope ( oil immersion in dark field at 40 ) by bv exciting method ( emitting a blue - violet color , mainly at 4.047a0 and 4.038a0 ) . only those cells which contained the characteristic y chromatin i.e. , a brightly fluorescent spot attached to the nuclear membrane were counted as positive cells while those which did not show any such fluorescent spot were labeled as negative . results obtained were subjected to statistical analysis by using independent t - test using spss ( version 9.0 ) software .", "the tooth was embedded on the modeling block . to remove the pulp , the crown it was adequately washed in normal saline to remove any calcified bone or dentine particles . the pulp tissue was then transferred to the dry and clean conical centrifuge tubes containing 5 ml of fixative ( 3 methanol:1 glacial acetic acid ) and left as such for about half an hour to 2 hours for the fixation of the pulp cells . it was then crushed with the glass rod sufficiently to isolate the pulp cells . a suspension five ml of fresh fixative was then added to re - suspend the pellet , and the process was repeated thrice till a clear suspension of the pulp cells was obtained . thin smears were prepared on chilled microscope slides of 1 mm thickness by the air - drying method i.e. , by dropping 2 - 3 drops of the above suspension on the slide from a distance of inches to get a homogenous population of cells . the slide was mounted in buffer of ph 5.5 and was observed under leica dmr fluorescent microscope ( oil immersion in dark field at 40 ) by bv exciting method ( emitting a blue - violet color , mainly at 4.047a0 and 4.038a0 ) . only those cells which contained the characteristic y chromatin i.e. , a brightly fluorescent spot attached to the nuclear membrane were counted as positive cells while those which did not show any such fluorescent spot were labeled as negative . results obtained were subjected to statistical analysis by using independent t - test using spss ( version 9.0 ) software .", "this study was done to evaluate the use of the fluorescent body test as a diagnostic test for sex determination . table 1 showed sensitivity , specificity , positive predictive value , negative predictive value , and efficiency of each of the five groups . the values obtained were highest for sound teeth with caries in enamel and value decreases with the progression of the caries . table 2 depicted that fluorescent bodies were found to be more in sound teeth in males as the caries increase , the mean percentage of fluorescent bodies observed decreases in males . we also observed the fluorescent spots in females , and the value of the spot increases in female as the caries progresses , thereby giving false positive results in females [ figure 3 ] . the p value were found to be significant for sound teeth and teeth with caries in enamel and involving less than half the way of dentin , whereas it was non - significant for teeth involved with further caries involvement . diagnostic utility of fluorescent body in identifying gender percentage of fluorescent bodies ( in % ) in different groups fluorescent photomicrograph showing bright fluorescent cell in males representing y chromosome fluorescent photomicrograph representing faint fluorescence in females", "despite the fact that tremendous research work is carried out to determine a reliable method , but none have proven its efficacy . the most reliable means of identification include fingerprints , dental comparisons , and biologic methods such as dna profiling . in some cases , however , fingerprints are not available from the deceased , or ante - mortem prints can not be obtained . sex determination from skull is highly unreliable although number of workers have described differences in the size of male and female teeth , such measurements seem unlikely to be used to determine the sex of an individual . so , a technique has been developed , which may offer a solution whenever soft tissue remains can be recovered . casperson et al . showed that chromosome stained with quinacrine mustard fluoresced differentially along their length when viewed in ultraviolet light and the human y chromosome fluoresced more brightly than other chromosomes . he suggested that alkylating agents like quinacrine acts on the dna portion rich in guanine and accumulate there . this technique has been used in forensic science for sex determination from dried blood stains , saliva , and hair . thus , it might be applicable to sex determination from tooth pulp some time after death , because the teeth are a stable part of the skeleton and the pulp tissue is well - protected . seno and ishizu carried out the detection of y chromosome in the nuclei of dental pulp . they found that f- body positive rate in the nucleated cells of male dental pulp was over 30% , even with the male teeth as old as 5 months , after the extraction . with female teeth , typical f - body can not be detected , and f - body like spot has been observed in 0.4% of cells , indicating that there can be no error in the identification of male tooth from that of female one , even such an f - body like spot is taken as an f - body itself . present study revealed that in males , 60 - 75% fluorescent y bodies [ figure 2 ] were observed in sound teeth ( mean 69.4% bodies ) , 59 - 70% bodies in tooth with caries in enamel ( mean 64.2% bodies ) , 19 - 53% in teeth with caries in half way of dentin ( mean 39.8% bodies ) , teeth with caries involving more than half way of dentin and involving pulp showed 13 - 29% , 1 - 19% ( mean 21.8% , 6.37% bodies ) off bodies respectively as shown in table 2 . seno and ishizu showed a range of 56 - 72% fluorescent y bodies in freshly extracted sound teeth , which are in accordance to sound teeth in this study . pseudo y body in the present study [ figure 4 ] in females were found to be in the range of 0 - 12% ( mean 5.2% ) , 0 - 12% ( mean 5.2% ) , 14 - 22% ( mean 17.8)% , 12 - 22 ( mean 16.8% ) , and 7 - 15% ( mean 11.6% ) for sound teeth , teeth with caries in enamel , caries in half way of dentin , caries involving more than half way of dentin caries , and caries involving pulp , respectively , as shown in table 2 . fluorescent photomicrograph representing artifacts or pseudo f - bodies in females discrepancy between various studies could be attributed to random inclusion of carious and non - carious teeth . so , the present study considered the effect of caries on fluorescent body test as literature ( when searched via pubmed and medline ) revealed lack of studies analyzing this fact . from present study , it can be inferred that as the caries progresses from enamel to dentin and further to pulp tissue , the sensitivity and specificity of determining y chromosome decreases [ table 1 ] . when the caries have involved only enamel or half the way of dentin , it has shown significant difference in fluorescent body test determining males and females , unlike when it involved more than half way of dentin and pulp where the difference is non - significant [ table 2 ] . the decrease in y body could be attributed to the fact that cariogenic bacteria alter the microenvironment of pulp , resulting in alteration in fluorescent staining . as the caries progresses , the inflammatory processes in the pulp are initiated , as the inflammation progresses the internal architecture of the cell is lost , and is also characterized by necrotic poorly stained cellular debris . many workers attributed the appearance of fluorescent bodies in females to artifacts , whereas others ascribed it to the presence of fluorescent debris . it was necessary to smear pulp cells thinly to prevent masking the fluorescent y chromosomes by fluorescent debris .", "sex determination by fluorescent staining of the y chromosome is a reliable technique in teeth with healthy pulp tissue or caries with enamel or upto half way of dentin ." ]

[ "it is a relatively rare odontogenic lesion which exists either as a cystic or a solid variant and is characterised by varied clinical , radiographical and biological features . the central ccot appears as a unilocular or multilocular destructive radiolucent lesion containing irregular calcifications . various terminologies used for ccot include calcifying odontogenic cyst , gorlin cyst , calcifying ghost cell odontogenic tumour and epithelial odontogenic ghost cell tumour , keratinizing calcifying odontogenic tumour . in 2005 , the world health organization classification of head and neck tumors reclassified ccot as an odontogenic tumor and gave it the name of calcifying cystic odontogenic tumor . is a developmental cyst of odontogenic origin and constitutes about 0.37% to 2% of all odontogenic tumours . ccot are cysts of primordial origin and not associated with crown of any impacted tooth . ccot may occur as a central lesion or as a peripheral lesion ( although rare ) .", "a comprehensive review of the available literature relating to malignant transformation of ccot was undertaken using medline , pubmed , google scholar and scopus in all languages . we used the following keywords for searching : calcifying cystic odontogenic tumour , malignancy and ghost cell odontogencic carcinoma from 20032013 . we also used the related articles feature of pubmed to identify further references of interest within the primary search . these articles were obtained , and from their references lists , pertinent secondary references were also identified and acquired .", "ghost cell odontogenic carcinoma ( gcoc ) is a rare tumour which is a malignant counterpart of ccot . ghost cell odontogenic carcinoma may arise as a denovo tumour or from previously existing ccot . one third cases of ghost cell odontogenic carcinoma are reported to be derived from a preexisting ccot and malignant transformation may take several years . however some of the ghost cell carcinoma may develop without history of ccot [ 1214 ] . recurrent ccot and gcoc are more common in the maxilla [ 8 , 15 ] . painful swelling with local paraesthesia is the most common symptom of ghost cell odontogenic carcinoma . some authors reported of infiltrative growth , root resorption and tooth displacements in cases of gcoc [ 16 , 17 ] . ct scan demonstrated bone expansion and bone destruction with irregularly shaped calcified inside the lesion . magnetic resonance images showed a mass with high signal intensity . li et al . reported an ameloblastoma - like epithelia with prominent features being presence of lots of ghost cells , dysplastic uncalcified dentin or osteodentin . increased nuclear / cytoplasmic ratio with 12 nucleoloi and atypical mitotic figures were also reported . according to motsugi et al . , tumour cells densely proliferates the epithelial component and the nucleus of tumour cells were enlarged and variable in size . immunohistochemical analysis of gcoc by motossugi et al . revealed that 70% of tumour cells were reactive for p53 and ki-67 index was 4% to28% . expression of ki-67 , mmp-9 and timp-1 was stronger in gcoc when compared to ccot . mmp-9 in stroma is associated with invasive ability of ccot and gcoc and ki-67 is associated with increased cellular proliferation . according to gomes et al . , there is a variable expression of syndecan-1 in stellate reticulum , stromal cells and basal cells of ccot and gcoc and might be associated with the biology of these tumors . a total of 8 cases have been reported in the literature from 2003 - 2013 where ghost cell odontogenic carcinoma has probably developed from ccot . these cases are enlisted in table 1 , [ 8 , 13 , 14 , 1618 , 21 , 22 ] . of the 29 patients diagnosed , 5 died of local recurrence and metastasis to brain and lung has been reported . the most commonly employed treatment was surgery with wide excision . in some cases radiotherapy and", "after reviewing the literature we conclude that recurrent and long standing case of ccot can undergo malignant transformation . gcoc , the malignant form of ccot can metastasize and can even lead to deaths . so it is mandatory to follow up the patients with ccot for possible eventual development of malignant counterparts .", "" ]

[ "an adrenal incidentaloma is an adrenal mass , larger than 1 cm in diameter , detected on imaging studies performed for other indications than adrenal disease [ 1 , 2 ] . the increasing use of computed tomography ( ct ) scans and magnetic resonance imaging ( mri ) causes a marked increase in incidence of adrenal incidentalomas . in approximately 6% of all autopsies and 4% of all abdominal ct scans an incidentaloma of the adrenal gland is discovered [ 4 , 5 ] . the incidence of adrenal incidentaloma increases with age to an incidence of 10% in patients over 70 years old . adrenal incidentalomas are characterized by size , growth , imaging characteristics , and functional status . although rare , the normal function of the adrenal gland can be disrupted by adrenal incidentalomas . in most cases adrenal incidentalomas will be a small , nonhormonal active cortical adenoma , a benign impediment ( 80% ) . some adrenal incidentalomas cause hormonal hypersecretion ( 15% ) or appear to be a primary or secondary malignancy ( < 5% ) [ 6 , 7 ] . adrenal incidentalomas can cause disease by hypersecretion of hormones . conditions due to hormonal activity of adrenal incidentaloma include hypercortisolism , ( cushing 's syndrome ) , catecholamine excess ( pheochromocytoma ) , or hyperaldosteronism ( conn 's syndrome ) . subclinical autonomous cortisol hypersecretion is the most frequent hormonal abnormality in patients with adrenal incidentalomas . some of these patients eventually develop overt clinical cushing 's syndrome . adrenal cortical adenomas with or without hormonal overproduction vascular lesions of the adrenal are suggestive of a medullary derived pheochromocytoma , but confirmation of a pheochromocytoma by serum or urine measurement of metanephrines is required to diagnose pheochromocytoma . not only will the radiologist appoint this finding in the radiology report , the radiologist will often also add a recommendation for the next diagnostic procedure . this retrospective study aims to get a clear view on the detection rate of adrenal incidentalomas on abdominal ct scans in our hospital , and the subsequent diagnostic procedures used after detection of this incidental finding .", "this retrospective study was designed to investigate the detection rate of adrenal incidentalomas on abdominal ct scans . for inclusion in this investigation , an adrenal incidentaloma was defined as an adrenal mass , greater than 1 cm in diameter , initially discovered by diagnostic imaging for a clinical condition not related to , or suspicious for , adrenal disease . two investigators learned from an expert radiologist to examine ct scans of the abdomen for primarily the adrenal gland . each investigator independently evaluated 180 ct scans out of 360 ct scans , of many patients , that were indicated for diagnostics of hepatic , pancreatic , or renal pathology between 2005 and 2007 . age , gender , indication for ct scan , and abnormalities in size or morphology , were noted . at the time of examining the adrenal glands , the investigators were not aware of the content of ct scans ' radiology report or indication for ct scan . only after their own judgement about size and aspect of the adrenal glands , indication for ct scan and the radiology report an expert abdominal radiologist ( over 45,000 abdominal ct scans examined ) reviewed the ct scans marked by the investigators with abnormal adrenal glands in size or morphology and results were compared . if an adrenal incidentaloma was mentioned in the original radiology report , the patients ' record was reviewed to determine whether additional investigations , for example , hormonal studies , additional imaging , or interventional diagnostic studies , were performed after the ct . an interobserver test was performed to evaluate the resemblance of the way of evaluation between the investigators and expert radiologist . the ct scans performed for suspected hepatic , pancreatic , or renal pathology of 75 new patients , between 2007 and 2008 , were evaluated for this purpose . the interobserver variability was calculated with the friedman test , a non - parametric test for coupled observations , with independent observers .", "of the 360 patients studied , 206 ( 57% ) were men and 154 ( 43% ) were women . of the total of 360 patients , 4 patients were excluded because suspected adrenal pathology was also an indication for imaging in these patients . in the remaining 356 ct scans evaluated , the investigators discovered independently a total of 44 ( 12% ) abnormal adrenal glands in 42 patients ( 2 bilateral adrenal incidentalomas ) . each radiology report was checked for adrenal incidentalomas which were already noted . in 25 ( 7% ) of 356 patients an adrenal mass the expert radiologist reassessed the ct scans of 42 patients ; the radiologist discovered 17 patients with an adrenal incidentaloma . two patients had bilateral incidentalomas , giving a total of 19 adrenal incidentalomas not noted previously ( figure 1 ) . the total number of adrenal incidentalomas was 44/356 ( 12% ) in 42 patients . \n figure 3 shows an enlarged right adrenal not mentioned in the initial radiology report . in 64 of 356 ( 18% ) patients , a malignancy was the indication for imaging . patients with an adrenal incidentaloma were more likely to have a malignancy as indication for ct scan , 20/42 ( 48% ) . the 25 patients that had an adrenal incidentaloma mentioned in the initial radiology report were checked for additional diagnostic procedures performed . in 3/25 patients a follow - up ct scan none of these patients showed hormonal overproduction caused by the adrenal lesion . in 2 patients ( 8% ) a second ct scan was performed to exclude increase in adrenal size ; there was no growth of the adrenal lesion shown . one patient who underwent a hemihepatectomy had a simultaneous resection of the right adrenal incidentaloma . the interobserver variation was calculated using a friedman analysis test to exclude or to demonstrate a significant difference in perception between different readers . the friedman test showed that there was no statistically significant difference in perception between the investigators and the radiologist ( p = .867 ) .", "the detection of adrenal incidentalomas in this study was 7% and the actual incidence of adrenal abnormalities was 12% after focused assessment of ct scans . this is high compared to other studies and can be explained by the relatively large group of patients who underwent imaging examination because of a malignancy [ 7 , 11 ] . however , because of the absence of histological examination of the enlarged adrenal glands , it can not simply be concluded that these patients had metastases in the adrenal gland . the incidence of adrenal incidentalomas in the literature varies from 0.5% to 15% and depends mainly on the age of the investigated group [ 11 , 12 ] . only 6 of 25 ( 24% ) patients with an adrenal incidentaloma were further investigated with hormonal workup or imaging . one reason for the lack of additional diagnostic testing and treatment after detection of an adrenal incidentaloma is the lack of a clear evidence based guideline . also unfamiliarity with adrenal incidentalomas by the physician who has requested the ct scan will cause lack of additional screening . another reason for the lack of additional diagnostic testing of adrenal incidentalomas is the apparent lack of direct clinical consequences [ 13 , 14 ] . undetected hormonal hypersecretion will probably reveal itself in time and the chance of an adrenal carcinoma is low with 0.72/million / year [ 10 , 13 ] . because of this low risk of malignancy and because of the limited impact of hormonal overproduction in an asymptomatic patient , it is not clear whether a guideline for diagnosis and treatment of adrenal incidentaloma is necessary . such a guideline may cause an increase in diagnostic procedures with additional burden and uncertainty for the patient . a comprehensive cost - effectiveness study showed however that hormonal analysis of an adrenal incidentaloma is cost effective . the cost effectiveness of additional imaging of the adrenal gland is less clear in this study . in addition , the radiation dose to the patient becomes more important and therefore complementary imaging with an mri scan has its advantage . the optimal strategy for screening and followup of an adrenal incidentaloma is still under discussion . the guideline of the nih ( 2002 ) seems to be the best alternative in this debate , but the nih already recognized that the guideline is not based on hard evidence . ( table 1 ) protocols on the diagnostic procedures of adrenal incidentalomas are described in several other publications as well , without describing additional prospective data on the clinical results of these protocols [ 9 , 10 , 1518 ] . there are currently no prospective studies that have examined the effects of an additional diagnostic procedure for adrenal incidentalomas . following this study a guideline for additional screening and followup was made ( figure 2 ) . in each radiology report a recommendation will be added for every patient with an adrenal incidentaloma and the referring physician is pointed to a webpage with a brief summary about adrenal incidentalomas . this website also contains the brochure with information for patients , which can be printed . in conclusion , it is not always noted by the radiologist and focused assessment of abdominal cts increased the detection rate of this abnormality form 7% to 12% . when detected and mentioned in the radiologist 's report , only a small percentage of patients receives additional hormonal or imaging investigations to determine the nature of the incidentaloma ." ]

[ "top down mass spectrometry \n describes an analytical process for \n the identification and characterization of whole proteins . the canonical top down experiment consists of a \n precursor scan to obtain the intact mass of the proteoform(s ) under study and a tandem mass spectrum ( ms / ms ) \n obtained using ion fragmentation techniques such as ecd , etd , hcd , cid , or uvpd . the defining characteristic of a top down experiment \n is that the precursor ion is an intact proteoform , not the typical small peptides ( less than 3 kda ) produced \n from intentional enzymatic digestion prior to mass spectrometry ( ms ) . \n thus , the mass of the precursor ion should represent a native proteoform \n present in the sample , with its fragment ion masses providing extensive \n characterization and verification of the primary structure . as larger \n proteins are targeted , experiments tend toward acquisition logic involving \n spectral averaging for both the precursor and fragment ions to improve \n the data quality . these combined data are then analyzed to infer the \n neutral masses of all intact and fragment ion species observed . for \n proteins analyzed by electrospray ionization , this analysis to infer \n mass ( aim ) uses either isotopic spacings for direct charge state assignment and/or deconvolution of protein charge states . historically , top down mass spectrometry has targeted the \n in - depth \n characterization of a small number of proteoforms ; however , the past 5 years has seen a gradual transition to while the \n number of proteins able to be identified has risen into the thousands , \n the extent of characterization of each individual proteoform varies \n and currently there is no scoring framework that captures this aspect \n of top down proteomics . in certain cases , a protein ( arising from \n a specific gene ) may be identified confidently with no inference problem \n whatsoever , yet may be only partially characterized as shown in figure 1 . in figure 1b , two equivalent \n proteoforms , one with a post - translational modification ( ptm ) in the \n first position and the other with the ptm in the second , will each \n have the same number of matching fragment ions . scoring systems based \n only on matching ions will report equal scores for these two proteoforms . \n this example illustrates how a proteoform can be clearly identified \n ( i.e. , the evidence supporting the identification of either of the \n two positional isomers is strong ) , yet not fully characterized . this \n problem of ptm site localization is encountered in bottom up , and \n has been dealt with in various ways . in targeted top down \n ms generating just a few spectra , manual reanalysis of data , or curation \n of the primary literature , can be used to select one protein form \n over another highly related one . in such cases , expert decisions are \n made to distinguish proteoforms with similar primary structures taking \n into account cleavage propensity of pairs of amino acids , complementary \n ion pairs , sequence tags , and mass errors of precursor and fragment \n ions . incomplete fragmentation may or may not lead to partial characterization \n of a protein molecule . in panel ( a ) , the matched fragment ions uniquely \n determine the location of the post - translational modifications ( ptms ) . \n in panel ( b ) , incomplete fragmentation in the middle of the protein \n backbone does not yield a definitive ptm localization . in this particular \n example , the ptm could be located at either of two amino acids , resulting \n in an identified , but partially characterized proteoform . the c - score \n framework was developed to handle such cases , routinely encountered \n in top down proteomics . n - terminal fragment ions are colored red , \n while c - terminal fragment ions are shown in blue . the numbers below \n the fragment ions indicate how many ptms are reported on by each ion . with the shift to high - throughput , \n fully automated data collection , \n we now seek a framework for scoring of protein identification and \n proteoform characterization that builds in domain knowledge to achieve \n the quality of manual analysis without requiring it . all of the mathematical \n symbols used below are aggregated into table 1 . fundamentally , the problem of identifying which proteoform is most \n consistent with an experiment combines both aspects of protein identification \n ( which gene ) and characterization ( which proteoform ) . in practice , \n the problem is one of testing a series of hypotheses about which proteoform \n was present in the mass spectrometer , and then picking the each candidate proteoform ( not simply its \n protein sequence ) constitutes a hypothesis , but since candidate proteoforms \n does not represent all possible hypotheses to be tested , a scoring \n system must allow for the possibility that the best scoring proteoform \n is near the correct answer , but not exactly correct . further , it is \n frequently the case that the observed data can not conclusively differentiate \n between two or more related proteoforms ( as in figure 1b ) , or the case where multiple proteoforms were actually fragmented \n together . typically , the way a proteoform score is used experimentally \n is not too dissimilar the use of scores in annotating novel nucleotide \n sequences with blast . for a given search , a minimum cutoff threshold \n is picked by the operator ( a priori ) , and for each query the answer \n accepted as correct must be both the highest scoring result and greater \n than the cutoff threshold . the problem of inferring \n which proteoform , from the articulated \n prior list of proteoforms in a database , was observed \n within the mass spectrometer is well - suited to a bayesian approach \n ( figure 2 ) . in this case , bayes law can be \n rearticulated as follows:1where ( 1 ) pr(proteoformi|datams / ms ) is read as the probability of the ith proteoform given the ms / ms data , and is known as the posterior probability of proteoform i given \n the observed data ; ( 2 ) pr(proteoformi ) \n is known as the prior probability of proteoform i ; ( 3 ) pr(datams / ms|proteoformi ) is read as the probability of the data given proteoform i , and is known as the likelihood of the \n data given proteoform i ; ( 4 ) pr(datams / ms ) is known as the probability of the data . by convention , \n this can be taken as the sum of all prior probabilities multiplied \n by their likelihoods across all hypotheses . notice that this term scales the posterior probability to be the \n fraction of the total of the numerators over all proteoforms interrogated . \n thus , a multiple testing correction across the database search is \n integral in this approach . this differs from controlling for the overall \n false discovery rate of an experiment which can , for example , be handled \n posthoc with a search against a scrambled sequence database in a manner \n analogous to that used in earlier work . problem \n of assigning which proteoform was present in the mass spectrometer \n during automated data collection can be envisioned as sorting a list \n of candidate proteoforms based on the observed ms data and a mathematical \n model of the process by which the observations were collected . bayes \n law provides a useful foundation for building these models . in practice , \n it is not required that the list of candidate proteoforms be explicitly \n articulated prior to the analysis . it is sufficient that all candidate \n forms can be calculated for an explicitly stated set . for example , \n listing base protein sequences and the ptms to be considered on these \n sequences defines a list of proteoforms , even if the list is never \n explicitly written . to be precise , we will \n define the following variables to restate \n bayes law from eq 1 . let mo = observed precursor mass , mi = mass of the ith of n observed fragment ions , so { mi}i = 1n is the set of all n observed fragment ions , and q = the qth of k candidate \n proteoforms in the database . the posterior probability of hypothesis \n q , as per eq 1 , can be restated aswhere pr(q ) is the prior \n since the probability of \n the data is , by convention , known , two \n values are needed to calculate the \n posterior probability for each hypothesis : the prior probability and \n the likelihood for the data . in many applications , the prior probabilities \n can be taken to be all hypotheses are equally probable \n ( i.e. , uniform prior probabilities ) . if there are k competing hypotheses , that is , k proteoforms in the candidate list , then each proteoform \n has a prior probability of 1/k , but this does not \n need to be the case . it is possible that one would want to assign \n proteoforms of proteins that contain experimentally demonstrated ptms \n ( or transcripts informed by rna - seq ) higher prior probabilities than \n proteoforms that contain chemically possible , but otherwise rarely \n observed modifications . for example , if there are two proteoforms \n that differ only in the location of a ptm such as in figure 1b , and one of the ptms was known to occur , while \n the other had never been reported , and the set of observed fragment \n ions failed to differentiate the two forms , then the known form should \n be considered the most probable form to have been observed . this degree \n of differentiation can be achieved with such a scoring system by first \n setting and then improving the prior probabilities with continued \n experimentation . prior probabilities are , by definition , based on \n information known prior to data collection and are in practice always \n somewhat arbitrary in their determination . in sharp contrast , the \n likelihood of the data given the proteoform is calculated under an \n explicit mathematical model of the processes used to generate top \n down ms data ; calculation of this likelihood requires generative models . generate the probability of the \n observed data , given the proteoform in question . therefore , they take \n as input the proteoform , and as much knowledge of the measurement \n process as can be encoded in the model - creation process . for example , \n a generative model could include the propensity of individual pairs \n of amino acids to dissociate during fragmentation ( e.g. , x - p cleavage \n in ecd and etd is not possible , yet dp \n bonds are preferentially cleaved in threshold dissociation ) , or the model could include a function for \n the difference between the observed and theoretical intact mass . the \n more knowledge of the measurement process the generative model includes , \n the better , but since the task is to rank order the list of candidate \n proteoforms ( figure 2 ) , some details can be \n safely excluded from the generative model if they do not shift the \n proteoform rankings . for example , during \n manual data interrogation of an error - tolerant , top down search result , \n many researchers prefer the observed intact mass to match the theoretical , \n but allow for the possibility that the masses may not match because \n the best proteoform in the database is not the correct one . any scoring \n system that does not include the closeness of the observed ms1 to \n the theoretical ms1 is ignoring a valuable observation . next , this \n bayesian framework explicitly states the process in the form of two \n generative models ; one for the precursor mass , and the other for the \n fragment ion masses . since the models are clearly articulated , they \n can be defended , rejected , or modified based on community discourse . \n in practice , this means that the process model can be modified and \n updated to reflect new understanding of the measurement process , or \n to reflect changes to the process used . for example , an automated \n data analysis system can use the same scoring mechanism , but employ \n different parameter sets that reflect experimental differences . experiments \n that use cid or hcd will employ different parameter sets in the generative \n models used for scoring than the same top down experiment employing \n ecd / etd or uvpd for protein ion fragmentation . it should be noted that the calculation of scores in this system \n differs from bayesian approaches commonly seen in biological sequence \n analysis . in those applications , the \n generative models usually have unknown parameters that need to be \n estimated from the sequence data , which is usually taken as being \n perfectly known . the application here is more like that of edwards \n where the process is considered known . as will be seen , our generative models have no unknown parameters ; \n instead all values are taken from our knowledge of mass spectrometry , \n or from prior studies that focused on determining the needed value . \n thus , instead of inferring values from the data collected for the \n study in question , we have a framework for applying knowledge gained \n in analytic chemistry to the problem of protein inference . currently , \n prosightpc and prosight ptm report an expectation , or \n e - value , for each proteoform . this score is calculated by multiplying \n the probability of getting at least the observed number of matching \n fragment ion due to chance by the number of proteoforms interrogated . \n for this calculation , the probability of getting at least a given \n number of matching fragment ions is determined using poisson - based \n model . here we describe the implementation \n of this bayesian approach to scoring , and compare one set of generative \n models to the prosight ptm expectation value used within prosightptm \n and prosightpc . we show that our implementation , with its current generative models , \n provides an improvement over the existing scoring system as measured \n by area under the curve ( auc ) on the resulting roc chart ( auc of 0.99 versus 0.78 for a complex human \n example and auc 0.85 versus 0.80 in pseudomonas ) .", "the \n observed data in a canonical ms / ms experiment includes ( a ) the neutral \n precursor mass , which gives the total molecular weight of the proteoform \n under study , and ( b ) a set of neutral fragment ion masses , that is , \n masses of the products resulting from fragmentation of the proteoform . \n also required is a database of possible proteoforms , each of which \n serves as a hypothesis that could potentially explain \n the observed ms / ms data . the database of possible proteoforms was \n generated by combinatorial expansion of all potential proteoforms \n using the known modification information in the uniprot knowledgebase . since the observed data mo and each fragment ion , mi , are independently conditioned on q , we could take unfortunately , this \n approach suffers \n from two limitations . first the magnitude of i = 1n pr(mi|q ) scales with n. larger lists of ms2 fragment ions lower the calculated \n value of the ms2 likelihood , relative to lists with few fragment ions , \n which makes it impossible to directly compare scores between separate \n queries with differing numbers of ms2 fragment ions . this can be mitigated \n by weighting by the geometric mean of the number of ms2 fragment ions ; \n 1/n . second , this approach weighs the ms1 data as \n simply a single additional matching fragment ion . to avoid this , we \n introduce two scaling functions , f and g , to map the ranges of the individual generative model to a normalized \n range ; for the precursor \n generative model , the function f is simply the identity \n function . for the fragment ion generative \n model , we define g by its logarithm base , which is \n simply a linear function on the logarithm base 10 of the fragment \n probability ; g sets the logarithm base 10 of the \n minimum possible fragment probability to the logarithm base 10 of \n the minimum possible precursor probability and likewise for the maxima . \n if min1 is the minimum precursor probability , max1 is the maximum precursor probability , min2 is the minimum \n fragment probability , and max2 is the maximum fragment \n probability , then under an assumption \n of uniform prior , and given the likelihood functions from above , we \n have2equation 2 therefore \n reduces the posterior probability of a hypothesis to the data likelihood \n computation , with a normalization factor equal to the sum of the likelihoods \n under all possible hypotheses . since we have assumed \n that the given database of proteoforms is an exhaustive set of hypotheses , \n these generative models must allow for the possibility of observing \n related proteoforms that are not present in the database . the c - score system requires two generative \n models ; one for the precursor mass mo and \n the other for the set of observed fragment ion masses , { mi}. these models fully prescribe how \n to compute the likelihood terms on the right - hand side of eq 2 . note that the particular form of eq 2 implies that all the likelihood ( probability ) terms need \n only be computed up to a constant factor . this constant factor cancels \n between the numerator and denominator of the rhs of eq 2 . the probability pr(mo|j ) of an arbitrary protein sequence j ( of theoretical mass mj ) producing the observed precursor mass mo can be modeled as a function of m , the difference between the mo and mj . we create the \n probability distribution pr(mo|j ) such that masses within m of mj have the highest \n probability , and this probability reduces as a truncated gaussian \n function with = 1 , = 30 da , and a minimum value of \n 1 10 . notice that we only need to specify \n pr(mo|j ) to a constant factor ( i.e. , we only need to specify a non - negative \n function f ( mo , j ) proportional to the probability ) , and the \n normalization factor ( 1/0max(mo)f(mo,j)dmo ) that converts it to a probability \n density function is assumed implicitly . to specify the probability \n distribution pr(mi|j ) , we \n need an ms2 generative model based on our knowledge of the measurement \n process during tandem mass spectrometry . we note that each fragmentation \n event involves cleavage of the intact proteoform at one bond on the protein backbone , resulting in exactly two fragments ( although both may not be observed in the spectrometer ) . \n the fragmentation propensity depends on the pair of adjacent amino \n acids flanking the cleavage site . the generative model we choose is \n based on this observation , and uses the following basic ideas : ( 1 ) each theoretically possible fragment ion mass defines a region \n of width 2m ( m m , m + m ) called a permissible region . an observed mass mi within \n a permissible region has a probability proportional to the cleavage \n propensity of gas phase protein ions at that permissible region . ( 2 ) an observed fragment ion mass mi outside of any \n permissible region has a small , constant probability . these \n ideas are captured in the probability distribution function \n of figure 3 . in principal , for any given j , the probability distribution pr(mi|j ) is constructed by assigning a height to every point in the \n range ( 0 , mj ) , where mj is the theoretical precursor \n mass . in practice , ms2 mass lists can contain unexpected ions with \n mass values greater than mj , and so an arbitrarily large mass of 4 million daltons is \n taken in place of mj . \n ( the value of 4 million daltons was selected as it is safely above \n the mass of the largest protein known , titin at 3.9 mda , and allows \n for a modified form of titin to be present . in practice , this value \n is effectively infinity . ) the assigned heights across the entire range \n are divided by the total area under the curve , thus defining a probability \n density function . the heights are assigned as follows : step \n 1 : determine all theoretical fragment ions that j can give rise to , noting their mass and \n the n- and c - terminal flanking amino acids at each cleavage site . step 2 : for each theoretical fragment ion , calculate a weight , \n , proportional to the product of the cleavage frequencies for \n both flanking amino acids as previously determined for the appropriate \n fragmentation method . thus , if \n and are the two flanking amino acids , and f and f are their \n respective cleavage frequencies , we set = ff. the permissible \n region associated with a theoretical fragment ion mass , m , is assigned a consistent height equal to the weight computed \n for the corresponding theoretical fragment ion . step 3 : any \n point in the range ( 0 , mj ) but outside of all permissible regions is assigned \n a height of noise , which is a constant . ms2 generative model for fragment ions observed \n in tandem mass \n spectrometry ( ms / ms ) . for instruments capable of ms / ms with accurate \n mass , thin ( e.g. , low part - per - million wide ) permissible regions occur \n with a search - defined width around each theoretical fragment ion mass . \n the \n heights of these regions are scaled by the propensity of the cleavage \n events required to form the theoretical ion . different fragmentation \n methods require different weights , for example ecd has different fragmentation \n propensities than cid . a very low probability , the weight \n for chemical or electronic noise , is assigned to any observed \n mass that does not match one of the theoretical masses . we noted above that the probability density function \n is obtained \n by dividing the above - mentioned height function by \n the sum of the area under the curve , which is different for different \n j . this total area , denoted by tj , is computed as follows : \n the kth permissible region has a height equal to \n k and a width equal to 2m . regions outside of permissible regions have a height of \n noise and a total width of p \n 2(len 1)m , where len is the length of the \n protein sequence . the resulting probability density function is3 the expressions on the right - hand side specify a probability density while the expression on the left - hand side is a \n probability mass , which , strictly speaking , should \n be equated to the probability density over a very small mass interval , \n . however , such a correction can be safely ignored here because \n the probability mass pr(mi|q ) is used only in the context \n of eq 2 , with equal powers of in numerator \n and denominator . using eqs 2 and 3 , \n it is now possible to calculate a posterior probability pr(q|mo,{mi } ) for every sequence q in the database . this posterior probability \n is proportional to the likelihood pr(mo,{mi}|q ) since we assume uniform priors ( eq 2 ) . therefore , our search for the maximum a posteriori hypothesis \n q is equivalent to a maximum likelihood \n estimation ( mle ) search , that is , we report the q that maximizes pr(mo,{mi}|q ) . we report the \n best hypothesis q along with its \n phred - like characterization \n score , which can be written \n as c = 10log10(1 pr(q|mo,{mi } ) ) . this final c - score transformation \n scales the posterior probability of q to the familiar range used in many other bioinformatic applications . \n c - scores span the standard phred - like score range of 0 to > 500 . \n practical \n ranges of the c - score are evaluated with specific examples and reported \n in the main text below . therefore , a c - score of 40 is sufficient to \n judge a proteoform as extensively or fully characterized , while proteoforms \n with c - scores between 3 and 40 are identified , but only partially \n characterized . a c - score below 3 indicates insufficient evidence for \n either identification or characterization . note also that since the \n c - score represents a nonlinear transformation of the posterior probability , \n which is itself normalized by pr(datams / ms ) , there is a \n functional relationship between the highest score in a search , and \n the second highest score ( supporting information figure 1 ) . the \n typical usage of a \n score such as the c - score is in high throughput data processing . an \n operator picks a threshold level of the score and then asserts that \n any query scoring above the threshold identifies the target data . \n this is done routinely in annotating dna sequences with tools such \n as blast . to test the utility of a new scoring model , a set of data \n where the correct answer can be considered known is needed ; this forms \n the ground truth of the analysis . when the new scoring \n system gives the known true answer both as the highest score , and \n the scoring above the operator - defined threshold , the system is said \n to have delivered a true positive . likewise , when \n the best proteoform scoring above threshold is not the known correct \n answer , it is scored as a false positive , and so on for both true \n and false negatives . sensitivity is the proportion \n of positives which are actually classified as such for a given threshold . \n likewise , specificity is the proportion of negatives \n that are correctly identified as such . for any given arbitrary \n threshold of a score , a specificity and sensitivity can be calculated \n from a known data set . by iterating over a number of thresholds , and \n plotting the resulting sensitivity against its corresponding specificity \n ( or by convention , against 1-specificity ) a receiver operating \n characteristic curve this curve is known to \n be indicative of the utility of the classifier . by repeating this \n iterative analysis of with multiple scoring systems , the relative \n utility of the systems so , to compare the \n new c - score with the existing prosight e - value , test input data sets \n with known correct answers are needed . these data sets are searched \n against the appropriate proteoform database and , for each proteoform \n returned , the e - value and c - score is calculated . next , an arbitrary \n list of threshold values is generated for each score , and for each \n threshold value in this list , a list of identified proteoforms is \n generated . the identified proteoform is taken as the form that is \n both above the threshold score , and to be the highest scoring proteoform . \n it is therefore possible for a search not to return a proteoform , \n if no proteoform scores above the cutoff threshold . when searching \n a test data set with known correct answers , it is possible to classify \n the search results as either a true positive , true negative , false \n positive , or false negative . from these classifications , these specificity \n and sensitivity couplets then become points on the roc chart curve \n for a given score . the human data files used in this analysis \n were acquired in the course other studies published previously . briefly , mitochondrial membrane proteins were isolated from hela \n s3 cells and separated using a gelfree 8100 fractionation system ( expedeon ) \n as described previously . for the analysis at \n hand , 295 top down experiments from a nanolc - velos orbitrap elite \n ms analysis of a gelfree fraction containing 1520 \n kda proteins were selected for intensive manual interrogation to provide \n a set of highly curated known positives to test parameter \n sets within the generative models used in development of the c - score \n framework . pseudomonas aeruginosa were \n grown on rich media to mid - log phase , were isolated by centrifugation , \n lysed , separated with gelfree , and analyzed with mass spectrometry \n using the methods referenced above . for the secondary data set , a descriptive analysis of intact \n and tandem mass spectral data was performed using rawmeat 2.1 ( http://vastsci.com/rawmeat/ , vast scientific ) . using these \n data , related ms2 scans were merged and individual prosight upload \n format ( puf ) files were created for each \n data set . a combination of qualbrowser and prosightpc 3.0 ( both thermofisher , \n san jose , ca ) was used , and all potential precursors predicted to \n have been in the ms1 isolation window were added as potential proteoforms \n for the experiments . both ms1 and ms2 data were deisotoped using the \n xtract algorithm embedded within prosightpc 3.0 , generating 623 single \n experiment puf files . ( containing 460 000 \n forms ) and homo_sapiens_2012_02_top_down_complex ( containing \n just over 10 million forms ) which are prosight warehouses ( .pwf files ) \n for human proteins built against uniprot release 2012_02 , available \n for download ( ftp://prosightftp:gsx1gon@prosightpc.northwestern.edu/2012_02/eukaryotes/homo%20sapiens/ ) . experiments with single proteoforms were \n selected and verified by at least two group members trained in top \n down proteomics data analysis , to be considered as true answers , and \n while subjective each met the following two criteria : the most abundant \n fragment ions must be accounted for , and the intact mass difference \n between theoretical and experimental must be small ( < 10 ppm ) or \n must be explainable ( 1 da errors from deisotoping , a previously \n unknown or unannotated post - translational modification , oxidation , \n etc . ) . this will typically involve the assignment of > 50% of fragment \n ions appearing at a signal - to - noise of 10:1 or higher . however , we \n note that both experimental conditions ( e.g. , overfragmentation , generating \n internal ions ) and the selection of data processing parameters will \n affect the quality of data and thus the fraction of ions matched for \n each experiment . if evidence was not sufficient to uniquely \n identify one proteoform for an experiment ( arising either from poor \n data quality or from multiple proteins being fragmented simultaneously ) , \n the experiment was excluded from further study here . using these heuristics , \n 295 puf files where only one proteoform was present were selected \n for use here . these files are described in supporting \n information table 1 and provided in supporting \n information data set 1 . to facilitate a comparison of c - scores \n and e - values , a custom c # this application takes , as input , a collection of puf files , the list \n of manually validated correct answers , and the c - score version number \n ( with a specific parameter set ) to use . the c - score version allows \n various iterations of generative models to be tested against the e - value \n and each other . the output from the application is an excel spreadsheet \n containing a correct score and actual score for both the e - value and \n the c - score . during execution , this application runs prosightpc absolute mass and biomarker searches on each \n puf file to compile actual search scores . the correct scores are then \n calculated using the list of correct answers ( supporting information table 1 ) . the c - score will be available \n for testing within the proteoform characterization tool , hosted by the consortium for top down proteomics \n ( http://www.topdownproteomics.org ) . to \n compare the e - value to the c - score , we \n chose as our first input a set of 295 puf files ( described above ) \n and a c - score version of 1.0 . the list of correct proteoforms for \n each of the 295 targets was provided as a csv file . the custom console \n application was then used to generate an excel spreadsheet that was \n further analyzed . two roc curves ( one for each score ) were plotted \n on the same chart by checking , for each target , whether the top scoring \n proteoform was the correct proteoform ( figure 4 ) . subsequently , additional roc curves were generated , where a target \n was counted as incorrect if the correct proteoform merely tied for \n the best score , but other proteoforms also shared the same score value . \n we also calculated the area under each curve as a quantitative measure \n of difference . two additional roc curves where generated as before \n but the correct answer would only be considered a true positive if \n it uniquely had the best score . thus , for these curves , if the correct \n proteoform failed to out - score all other proteoforms in the database \n it was not considered a true positive . this process was repeated for \n 136 proteoforms from pseudomonas aeruginosa ( data are provided in supporting information data set 2 ) . ( a ) receiver operating characteristic curves comparing \n c - scores \n and e - values on the 295 experiments in the manually curated test data \n set . the area under the curve for the blue c - score is 0.99 compared \n to 0.78 for the orange e - value . notice the large difference in sensitivity \n of the e - value in the low fpr region , between when ties for the best \n score are considered as acceptable for identification or not . although \n present in c - scores , the problem is much less pronounced , and at a \n much higher sensitivity . ( b ) histogram of the 295 c - scores obtained \n from searching the human database ( forward ) compared to the c - scores \n obtained from searching the same experimental data against a scrambled \n decoy database . of the decoy hits , only 7% had a c - score above 40 , \n likewise 42% of the forward c - scores are above this value .", "the c - score \n was substantially better than the e - value at identifying \n and characterizing the correct proteoform from the data set of 295 \n human test cases , as well as the 136 pseudomonas test \n cases . figure 4 shows a receiver operating \n characteristic ( roc ) curve for both scores on the human data , and \n the area under the curve for the c - score was 0.99 compared to only \n 0.78 for the e - value . for the pseudomonas test cases , \n the c - score also outperformed the e - value with aucs of 0.85 to 0.80 , \n respectively . clearly , the c - score ( with the v1.0 parameter \n set ) dominates the \n e - value for all levels of specificity and sensitivity . since the e - value \n is simply a nonlinear transformation of the number of matching fragment \n ions , it seems reasonable to assert that this improvement comes from \n the new score s ability to include additional factors such \n as known fragmentation propensities and ms1 mass differences both \n of which are known to be relevant in characterizing proteoforms . these \n and other such factors are not considered by the current e - value , \n nor is the score easily extended to consider such factors . when \n the data are sufficient to completely characterize a proteoform , \n the c - score is often well above 40 , indicating hyperconfidence in \n the characterization power of the underlying data ( figure 5a ) . however , a major limitation of the e - value occurs \n when many proteoforms share the same ( seemingly confident ) score . \n this can be seen in figure 4 as the vertical \n distance between the two e - value lines in the specificity range of \n 0.81.0 ( fpr 0.00.2 ) . figure 5b and c shows two example cases where there is equal evidence for \n two distinct proteoforms , one with an n - terminal acetylation and the \n other with the acetylation localized to k7 . in this example , these \n two proteoforms share a confident e - value of 7 10 ; however , their c - scores are tied , yet at a much less confident \n value of 3 . using the data from these two manually annotated sample \n sets , and with the understanding of the c - score model , we assert three \n operating ranges for the c - score : c - score > 40 proteoform \n is both identified and fully characterized ; 3 c - score \n 40 proteoform is identified , but only partially characterized ; \n c - score < 3 proteoform is neither identified nor characterized . ( a ) a \n result with a very high c - score of 525 , indicating a fully \n characterized proteoform of protein cytochrome b - c1 , o14957 . ( b , c ) two proteoforms with equivalent e - values \n and c - scores for 10 kda heat shock protein , p61604 . these data show \n the complementarity between the e - value ( scores protein identification \n well ) and the c - score ( reflects confidence in characterization of \n related proteoforms on a phred - like score from 0 to > 500 ) . to achieve separation between \n the two proteoforms in figure 5b and c , future \n iterations of the c - score will allow \n for differential probabilities for n - terminal acetylation and internal \n acetylation . n - terminally acetylated , so one may posit that , in the absence of evidence to the contrary , \n n - terminal acetylation is more likely than internal acetylation . the \n c - score model can incorporate this bias and many similar issues that \n provide biochemical and biological context . to achieve even more specificity \n and sensitivity in the c - score framework , one may use a proteomic \n database , such as gpmdb , to use peptide - level information linked to \n the specific gene product to inform these differential probabilities \n in top down proteomics experiments . in \n the case of uniprot entry p61604 , gpmdb reports that n - terminal \n acetylation was observed in 69/69 studies , making the proteoform reported \n in figure 5b a much more likely than the proteoform \n reported in figure 5c . the characterization \n of high - throughput lc ms / ms experiments , \n where hundreds of ms / ms targets are automatically generated for each \n lc run , forms the foundation of high throughput top down proteomics . \n our probabilistic formulation leverages the knowledge of fragmentation \n propensities and may be further extended to incorporate other types \n of prior information to improve the scoring ( vide supra ) . to characterize \n unknown ptms ( e.g. , a previously unknown methylation ) , we can extend \n our c - score model to give a higher probability to common ptm mass \n shifts ( i.e. , 42.0105 da for acetylation , 79.966 da for phosphorylation , \n etc . ) , thereby boosting the data likelihood . this will be particularly \n useful in complex eukaryotic proteomes where the inclusion of all \n theoretically possible proteoforms in the database ( even at search \n run time ) is computationally prohibitive . this framework provides \n a great deal of flexibility for having \n an appropriate scoring systems for a given experimental procedure . \n our current assumption of uniform priors on candidate proteins makes \n our procedure a maximum likelihood ( ml ) inference , but the framework \n can be readily extended to allow for nonuniform priors without additional \n overhead . nonuniform priors may be useful when researchers have a \n priori belief that some protein forms ( e.g. , particular combinations \n of ptms or splice variant ) are more likely to be present in the sample \n ( e.g. , from rna - seq data ) . further , the score remains robust when \n used with instruments with decreasing mass accuracy . supporting information figure 2 shows the roc chart resulting \n from rerunning the analysis on the human test data set with increasing \n mass tolerances . as tolerance increases , the discriminative power \n of the score decreases as more fragment ions will match by chance .", "in sum , we have shown a promising scoring system for protein identification \n and proteoform scoring to better capture the information content in \n high - resolution top down proteomics . the c - score model lays forth \n a path to increase the sophistication of protein identification and \n characterization platforms to extract maximum value from ms - based \n proteomics in automated fashion . the conceptual and demonstrable advances \n outlined above provide a deterministic process to advance the utility \n of proteomics for nonexperts . non - bioinformaticists / non - proteomicists \n to advance protein - based science based on proper description of the \n fully articulated primary structure for whole proteoforms . when coupled \n with high value experimentation , we posit that the faithful and more \n efficient conversion of data streams into knowledge will significantly \n advance major breakthroughs in mechanistic biology and on the front \n lines of disease research including improved discovery and validation \n of protein - based biomarkers ." ]

[ "chest physiotherapy is routinely employed as a prophylactic measure prior to major surgery and postoperatively to prevent respiratory complications such as atelectasis and pneumonia.1 at present , only limited evidence is available for some of the physiotherapeutic techniques used in patients with copd.2,3 physiotherapy treatment enhances sputum evacuation4 and can be applied as a single technique but usually a combination of techniques is applied to patients with copd . intrapulmonary percussive ventilation ( ipv ) is a ventilatory technique that uses a device to deliver small bursts of high - flow air into the lungs at high rates , superimposed upon the spontaneous breathing pattern . this causes airway pressures to oscillate between 5 and 35 cm h2o and the airway walls to vibrate in synchrony with these oscillations . a unique sliding venturi , called a phasitron , which is powered by compressed gas at 0.6 to 6 bar , generates these oscillations in the range of 80 to 650 cycles per minute.5 although several studies have addressed the physiological effects of ipv when used in copd patients , there is need for confirmation of its clinical effectiveness . previously , the effects of ipv in copd patients were assessed using lung function parameters , arterial blood gases , and duration of hospitalization . recently developed assessment techniques may give new insights into the effectiveness of airway clearance techniques . one promising new technique is computational fluid dynamics applied to the three - dimensional ( 3d ) images made by ct scanning ; this technique allows evaluation of flow and resistance of separate parts of the lung.6,7 in the present study , this novel imaging was used , in addition to more conventional outcome parameters , to visualize the effects of a single ipv treatment in copd patients .", "five moderate to severe copd patients ( three females and two males ) with global initiative for chronic obstructive lung disease stages 3 to 4 , who were hospitalized for an acute exacerbation , were included in this study . tests were performed before and after ipv treatment in a specific order to minimize the influence on other tests . for pre - treatment tests , the sequence was set as follows : forced oscillation technique ( fot ) in upright sitting and supine positions , conventional lung function measurements ( including spirometry and body plethysmography measurements ) , in- and expiratory muscle strength , diffusion capacity , arterial blood gases sampling , and finally a 3d low - dose ct scan was taken within 1 hour prior to the ipv treatment . patients were asked to score their dyspnea on a borg dyspnea scale before and after the treatment .", "no significant changes were evident in the spirometric or body plethysmographic indices due to ipv treatment . respiratory muscle strength after a single session tended to decrease , but the changes in inspiratory and expiratory muscle strength were not significantly different . we observed a small but nonsignificant change in the dlco / va ( diffusion capacity of carbon monoxide ) : corrected for alveolar volume ratio ( p = 0.066 ) . four out of five patients coughed up one or more flumes during the ipv treatment . all patients reported that they subjectively felt better after the treatment ( the change in borg dyspnea score , however , was not significant : p = 0.083 ) . arterial saturation tended to increase after a single ipv session but the changes were not statistically significant ( sao2 at baseline and post - ipv treatment : 95% 3% and 96% 1% , respectively ; p = 0.066 ) . 3d airway reconstructions based on the computed tomography ( ct ) images were made for each patient . for example , some peripheral airways that were blocked before the treatment ( possibly due to mucus plugging ) were reopened after the treatment . some airway branches were opened up after ipv and other airways were closed after a single ipv session ( figure 2 ) . the resistance measurements by body plethysmography and fot both showed a tendency toward an increase in airway resistance . the increase , however , was not statistically significant ( p = 0.109 and p = 0.080 alveolar volume for body plethysmography and fot , respectively ) . computational fluid dynamics ( cfd ) were used to calculate the local resistances for the different branches in the airways . specific airway resistance , calculated for the local changes in airway resistance , showed changes after the ipv treatment ; however , none of the changes were statistically significant . although the 3d computer models showed no changes in the overall airway resistance , local changes were observed , as indicated in figure 2 . branches with airway blockage in the preintervention scan were reopened in the post scan . in these branches , airway resistance seemed to decrease , possibly due to movement of mucus ; however , this is yet to be confirmed by the use of a control group . table 2 gives an overview of the airway changes observed in the different patients after a single ipv session . although data shown here are not compared with the data of a control group , 3d ct imaging has the potential to evaluate the displacement of mucus plugs and removal of mucus plugs in some copd patients after an ipv treatment . although we saw changes , the use of a control group is needed to confirm our findings . our study focused on the visualization of the short - term effects of a single ipv treatment . we used functional imaging to demonstrate that the airway geometry was changed by the ipv session whereas lung function parameters did not show any significant differences . the sample size in the present study is small ; more patients are needed to verify these findings . the accuracy of ct imaging has been confirmed for the assessment of the bronchodilator response in asthmatic patients8 and for the particle deposition of an aerosol in the lung.9 the usefulness of 3d imaging and cfd processing has also been shown in the assessment of changes in upper airways 10 and small airways.11 for example , cfd can detect changes in airway resistance in patients with asthma.8 one of the main advantages of the cfd method is that this technique allows investigators to make specific models of the patient s airways for use in analyses.12 in our study , we demonstrated that the effect of a single ipv treatment could be evaluated using functional imaging .", "despite its small sample size , this study demonstrated that local treatment effects could be visualized with 3d imaging of the airways . the resulting models allow a calculation of the change in airway volume and change in airway resistance . the technique can be used for comparison with traditional outcome parameters , which opens up perspectives for evaluation of physiotherapeutic drainage techniques , and may allow standardization and validation of different airway clearance techniques . further research should focus on the relationship between mucus displacement and local changes in airway flow and resistance ." ]

[ "gastrointestinal stromal tumors ( gists ) are the most common mesenchymal neoplasms of the gastrointestinal tract , with a mean annual incidence of 1015 cases per million people , affecting mainly older individuals at a median age of 5565 years [ 14 ] . radical surgery is the treatment of choice in primary resectable gists , but almost all gists are associated with a risk of recurrence , and approximately 4050 % of patients with potentially curative resections develop recurrent or metastatic disease [ 5 , 6 ] . radiotherapy has restricted efficacy in the management of gists , principally because the tumor location is surrounded by dose - limiting vital organs . the prognosis of patients with inoperable or metastatic gists was poor until the beginning of the 21st century , when significant progress in understanding the molecular pathogenesis of gists resulted in development of a treatment that has become a model of targeted therapy in oncology . the introduction of imatinib mesylate ( gleevec or glivec ; novartis ) , a small - molecule selective inhibitor of receptor tyrosine kinases , has revolutionized the treatment of gists , both in the adjuvant setting and in advanced ( i.e. , inoperable and/or metastatic ) cases . on the basis of recently published results of a clinical trial comparing 12 and 36 months of adjuvant imatinib therapy , demonstrating clinical benefit of longer imatinib treatment in terms of delaying recurrences and improving overall survival ( os ) , both the us food and drug administration ( fda ) and the european medicines agency ( ema ) have updated their recommendations and approved 36 months of imatinib treatment in patients with v - kit hardy - zuckerman 4 feline sarcoma viral oncogene homolog ( kit)-positive gists ( also known as cd117-positive gists ) at high risk of recurrence after surgical resection of the primary tumor .", "gists may originate anywhere in the gastrointestinal tract most frequently in the stomach , followed by the small intestine . they comprise a heterogeneous group of tumors ranging from small lesions with clinically benign behavior to highly aggressive malignant tumors [ 810 ] . metastases develop mainly in the liver or intraperitoneally and may even occur more than 10 years after surgery on the primary lesion , necessitating long - term follow - up of gist patients [ 9 , 11 ] . gists are believed to arise from progenitors related to the interstitial cells of cajal , which are the pacemakers for peristalsis [ 1214 ] . approximately 8595 % of gists express kit , which is currently used for routine immunohistochemical diagnosis . other well - established immunohistochemical markers used for differential diagnosis include dog1 [ discovered on gist-1 ; encoded by the ano1 ( anoctamin 1 , calcium activated chloride channel ) gene ] , cd34 ( a hematopoietic progenitor stem - cell antigen ) , smooth muscle actin , s100 protein , and desmin ( a muscle cell marker ) [ 1621 ] . characteristic genomic alterations in both benign and malignant gists mainly involve chromosomal losses of 1p , 14q , and 22q . additional cytogenetic abnormalities present in metastatic gists involve losses of chromosomes 13q , 15q , and 18 , and partial deletions of 11p and 9p [ including tumor suppressor genes cdkn2a ( cyclin - dependent kinase inhibitor 2a ) and cdkn2b ] , as well as gains of 5p , 8q , and 17q [ 2228 ] . approximately 7580 % of sporadic gists harbor kit - activating mutations , and another 513 % of sporadic gists carry platelet - derived growth factor receptor , alpha polypeptide ( pdgfra)-activating mutations [ 29 , 30 ] . about two thirds of all mutations in gists occur at the 5 end of kit exon 11 . less common primary mutation sites in kit include the 3 end of exons 11 and 9 . the most frequently mutated region in pdgfra is exon 18 , typically exhibiting the p.d842v substitution . approximately 1015 % of gists do not present detectable mutations in kit or pdgfra [ 2940 ] . kit / pdgfra wild - type gists arise mainly from the stomach and are characterized by distinct clinical and pathological features , including predominant incidence in young female patients , epithelioid morphology , frequent lymphovascular invasion and lymph node metastases , and unpredictable clinical behavior . wild - type gists carry inactivating mutations in genes coding for mitochondrial succinate dehydrogenase ( sdh ) complex ii subunits a , b , c , and d , which are components of the krebs cycle and the respiratory chain . additionally , this subgroup of gists express insulin - like growth factor 1 receptor ( igf1r ) . wild - type gists are commonly associated with carney s triad , carney - stratakis syndrome , or neurofibromatosis type 1 [ 4151 ] . table 1 summarizes the most important molecular features of gists in terms of kit and pdgfra mutational status.table 1molecular classification of gastrointestinal stromal tumors ( gists ) according to v - kit hardy - zuckerman 4 feline sarcoma viral oncogene homolog ( kit ) and platelet - derived growth factor receptor , alpha polypeptide ( pdgfra ) mutational statusgenotypefeatureskit mutations ( 7580 % of sporadic gists ) exon 11most common mutation in sporadic gists ( 6570 % ) ; present in tumors localized at all gastrointestinal sites ; best response to imatinib ; also reported in familial gists exon 9more common in gists originating from the small bowel / colon ; intermediate / dose - dependent response to imatinib in advanced gists exon 13present in tumors localized at all gastrointestinal sites ; observed clinical responses to imatinib ; reported in familial gists ; more often as secondary mutations in imatinib - resistant tumors exon 17present in tumors localized at all gastrointestinal sites ; observed clinical responses to imatinib ( except for p.d816v ) ; reported in familial gists ; more often as secondary mutations in imatinib - resistant tumorspdgfra mutations ( 513 % of sporadic gists ) exon 12present in tumors localized at all gastrointestinal sites ; observed clinical responses to imatinib exon 14only a few cases described in the literature ; more common in gists originating from the stomach exon 18more common in gists originating from the stomach , usually with epithelioid morphology ; often related to indolent clinical behavior ; p.d842v is the most common and is resistant to imatinib ; other exon 18 mutations are sensitive to imatinibkit / pdgfra wild typefrequent in pediatric gists ; poor response to imatinib ; typical for gists related to neurofibromatosis type 1 , carney s triad ( gastric gist + pulmonary chondroma paraganglioma ) , or carney - stratakis syndrome ( gist + paraganglioma , characterized by mutations in genes encoding sdh subunits sdha , sdhb , sdhc , sdhd ) , and/or igf1r expressionigf1r insulin - like growth factor 1 receptor , sdh succinate dehydrogenase molecular classification of gastrointestinal stromal tumors ( gists ) according to v - kit hardy - zuckerman 4 feline sarcoma viral oncogene homolog ( kit ) and platelet - derived growth factor receptor , alpha polypeptide ( pdgfra ) mutational status igf1r insulin - like growth factor 1 receptor , sdh succinate dehydrogenase", "imatinib mesylate was initially developed for the treatment of chronic myelogenous leukemia , to specifically inhibit the tyrosine kinase activity of breakpoint cluster region c - abl oncogene 1 , non - receptor tyrosine kinase ( bcr abl ) fusion oncoprotein . however , in preclinical studies , it was demonstrated that imatinib also inhibited the activity of kit , pdgfra / b , abl1 , and abl2 ( also known as arg ) tyrosine kinases [ 53 , 54 ] , which encouraged examination of imatinib therapy for other neoplasms driven by constitutive receptor tyrosine kinase activation . the first report describing imatinib treatment in a gist patient with multiple metastatic lesions demonstrated a dramatic response to this therapy . as early as 2002 , imatinib was registered for treatment of advanced gists ( i.e. in metastatic and/or recurrent and/or inoperable disease ) . the results of several clinical trials confirmed the high efficacy of imatinib in the treatment of gists in the majority of patients with inoperable / metastatic disease [ 5660 ] , prolonging median survival from 1019 months ( historical data ) to approximately 5 years . two large , parallel , very similar international studies comparing a standard imatinib dose of 400 mg daily with a high dose of 800 mg daily demonstrated a similar response rate and os with the two imatinib doses but better progression - free survival ( pfs ) in the high - dose treatment arm [ 6062 ] . moreover , data from these trials have shown that the response of gists with kit exon 9 mutations depends on the dose of the drug , and that these patients benefit from a higher dose ( 800 mg daily ) of imatinib , demonstrating significantly longer pfs ( 18 months ) than patients receiving a standard dose of 400 mg daily ( 6 months ) . unfortunately the spectacular activity of imatinib is time limited , and secondary resistance develops in the majority of patients [ 11 , 61 ] .", "although the treatment of choice in primary resectable localized gists is radical resection with negative margins , almost half of the patients ultimately develop recurrent or metastatic disease after potentially curative surgery . therefore , the idea of adjuvant therapy with imatinib after primary resection has been evoked to delay or prevent relapse and to prolong patients survival . the role of imatinib therapy in the adjuvant setting has been evaluated in several phase ii and iii clinical trials , namely acosog z9000 and z9001 ( conducted by the american college of surgeons oncology group ) , ssgxviii / aio [ 7 , 65 ] ( conducted by the scandinavian sarcoma group and the sarcoma group of the arbeitsgemeinschaft internistische onkologie xviii ) , rtog s0132 ( conducted by the radiation therapy oncology group ) , and eortc 62024 ( conducted by the european organization for research and treatment of cancer ) . table 2 presents the most important clinical trials of adjuvant imatinib in gists . data from the phase iii acosog z9001 trial evaluating 1 year of adjuvant therapy with imatinib 400 mg daily versus placebo in patients after microscopically radical ( r0 ) resection of gists at least 3 cm in diameter showed a significant reduction in the risk of recurrence from 17 to 2 % at 1 year ( during 20 months of follow - up ) [ p = 0.0001 ] , with a hazard ratio ( hr ) of 0.35 . although the treatment was well tolerated , no significant impact on os was demonstrated , thus implying that adjuvant imatinib delays rather than prevents relapse . the eligibility criteria for this trial were clearly inadequate because more than 40 % of patients had tumors between 3 and 6 cm in size , which in the majority were at low risk of relapse and did not require adjuvant therapy after surgery . nevertheless , in 2008 , imatinib was approved for use in adjuvant therapy after resection of primary gists in patients at significant risk of relapse . importantly , the initial approval lacked definite guidance concerning the optimal duration of treatment and risk assessment criteria.table 2the most important clinical trials of adjuvant therapy with imatinib in gastrointestinal stromal tumors ( gists)studystudy designno . 2009 one arm , open , multicenter ; imatinib 400 mg daily for 1 year107primary gist kit - positive after radical resection ; high risk of relapse : tumor size 10 cm or tumor rupture or < 5 intraperitoneal metastasesos at median follow - up of 4 years ; 1-year os : 99 % ; 2-year os : 97 % ; 3-year os : 97 % rfs at median follow - up of 4 years ; 1-year rfs : 94 % ; 2-year rfs : 73 % ; 3-year rfs : 61 % kang et al . 2009 one arm , open , multicenter , prospective ; imatinib 400 mg daily for 2 years47primary gist with exon 11 kit mutation after radical resection ; high risk of relapse : tumor size 10 cm or mitotic index 10/50 hpfs or tumor size 5 cm and mitotic index 5/50 hpfsrfs at median follow - up of 26.9 months ; 1-year rfs : 97.7 % ; 2-year rfs : 92.7 % li et al . 2011 open , non - randomized , prospective , one center ; imatinib 400 mg daily for 3 years versus observation56 ( imatinib ) , 49 ( observation)primary gist kit - positive after resection ; intermediate or high risk of recurrence ( nih classification ) : tumor size > 5 cm and/or mitotic index > 5/50 hpfssignificantly better rfs in the imatinib arm as compared with observation at median follow - up of 45 months ( hr 0.188 , 95 % ci 0.0850.417 ; p < 0.001 ) ; 1-year rfs : 100 versus 90 % ; 2-year rfs : 96 versus 57 % ; 3-year rfs : 89 versus 48 % significantly decreased risk of death due to gist with adjuvant imatinib therapy in comparison with observation at median follow - up of 45 months ( hr 0.254 , 95 % ci 0.0700.931 ; p = 0.025)jiang et al . 2011 non - randomized , one center , prospective ; imatinib 400 mg daily for 5 years versus observation35 ( imatinib ) , 55 ( observation)primary gist kit - positive after r0 resection ; high risk of relapse ( modified nih classification)significantly better rfs with imatinib as compared with observation at median follow - up of 44.0 months ( hr 0.122 , 95 % ci 0.0410.363 ; p < 0.001 ) ; 1-year rfs : 100 versus 70.9 % ; 2-year rfs : 88.0 versus 37.8 % ; 3-year rfs : 88.0 versus 27.5 % acosog z9001 , dematteo et al . 2009 [ 76 , 86]double - blind , placebo - controlled , randomized , multicenter ; imatinib 400 mg daily versus placebo for 1 year359 ( imatinib ) , 354 ( placebo)primary gist kit - positive after radical resection ; tumor size 3 cm ; low , intermediate , or high risk of relapsesignificant improvement in 1-year rfs in the imatinib arm ( 98 % ) as compared with placebo ( 83 % ) ; median follow - up time 19.7 months ; hr 0.35 ; p < 0.0001lack of statistically significant difference in 1-year os between study arms ( hr 0.66 ; p = 0.47)ssgxviii / aio , joensuu et al . 2012 [ 7 , 65]two arms , open , randomized , multicenter , prospective ; imatinib 400 mg daily for 1 versus 3 years200 ( 1 year ) , 200 ( 3 years)primary gist kit - positive after radical resection ; high risk of relapse ( modified nih classification ) : tumor size > 10 cm or mitotic index > 10/50 hpfs or mitotic index > 5/50 and tumor size > 5 cm or tumor rupturesignificant improvement in rfs with 3-year imatinib therapy as compared with 1-year therapy at median follow - up of 54 months ( hr 0.46 , 95 % ci 0.320.65 ; p < 0.0001 ) ; 5-year rfs : 65.6 versus 47.9 % significant improvement in os with 3-year imatinib therapy as compared with 1-year therapy at median follow - up of 54 months ( hr 0.45 , 95 % ci 0.220.89 ; p = 0.019 ) ; 5-year os : 92.0 versus 81.7 % eortc 62024 , hohenberger at al . 2012 two arms , open , randomized , multicenter , prospective ; imatinib 400 mg daily for 2 years versus observation906primary gist kit - positive after radical resection ; intermediate or high risk of relapse ( nih classification ) : tumor size > 5 cm and/or mitotic index > 5/50 hpfstime to imatinib failure at relapse ( changed from os)rfs , os , safety : results are expected in 2013acosog american college of surgeons oncology group , aio arbeitsgemeinschaft internistische onkologie , ci confidence interval , eortc european organization for research and treatment of cancer , hpfs high - powered fields , hr hazard ratio , kit v - kit hardy - zuckerman 4 feline sarcoma viral oncogene homolog , nih national institutes of health , os overall survival , r0 microscopically radical resection of the tumor , rfs recurrence - free survival , ssg scandinavian sarcoma groupstudies evaluating adjuvant therapy with imatinib for at least 3 years the most important clinical trials of adjuvant therapy with imatinib in gastrointestinal stromal tumors ( gists ) acosog american college of surgeons oncology group , aio arbeitsgemeinschaft internistische onkologie , ci confidence interval , eortc european organization for research and treatment of cancer , hpfs high - powered fields , hr hazard ratio , kit v - kit hardy - zuckerman 4 feline sarcoma viral oncogene homolog , nih national institutes of health , os overall survival , r0 microscopically radical resection of the tumor , rfs recurrence - free survival , ssg scandinavian sarcoma group studies evaluating adjuvant therapy with imatinib for at least 3 years only recent updates of the european society for medical oncology ( esmo ) and national comprehensive cancer network ( nccn ) guidelines have included the recommendation for 36 months of adjuvant imatinib therapy in adult patients with kit - positive gists at high risk of relapse . however , the optimal duration of imatinib therapy is still unknown . the latest fda and ema approvals for imatinib were based on the results of the ssgxviii / aio trial , which demonstrated that prolonged treatment extends both recurrence - free survival ( rfs ) and os . data from the ssgxviii / aio trial , comparing 12 and 36 months of adjuvant imatinib treatment after resection of gists in patients with a high risk of recurrence , were first presented in 2011 at the 47th annual meeting of the american society of clinical oncology . in the 36-month treatment arm , a significant improvement was observed in terms of both rfs ( 5-year rfs : 65.6 vs. 47.9 % ; p < 0.0001 ) and os ( 5-year os : 92.0 vs. 81.7 % ; p = 0.01 ; hr 0.45 ) . the study demonstrated that prolonged imatinib treatment was generally well tolerated , and the most common adverse events included anemia , leukopenia , periorbital edema , fatigue , nausea , diarrhea , muscle cramps , and elevated blood lactate dehydrogenase levels . more patients discontinued imatinib therapy in the 36-month treatment arm than in the 12-month arm , for reasons other than gist recurrence ( 25.8 vs. 12.6 % ; p < ", "evaluation of the risk factors for recurrence after primary surgery is essential for reliable prognosis , scheduling of follow - up , and identification of patients who may potentially benefit from adjuvant therapy . the main criteria taken into account in a few existing risk stratification systems include the tumor site , size , mitotic index , and tumor rupture ; however , the uniform risk criteria remain difficult to determine . the national institutes of health ( nih ) consensus criteria formulated in 2001 provided the first evidence - based categorization and a practical scheme for risk assessment in the clinical course of this disease . this risk classification was based on the tumor size and mitotic rate [ evaluated per 50 high - powered fields ( hpfs ) ] as the most reliable prognostic factors . this scheme was complemented in 2006 by miettinen and lasota from the armed forces institute of pathology ( afip ) , who recognized the significance of the tumor location as an independent prognostic factor in gists . they created a new risk assessment scheme ( recommended by the nccn and commonly used ) which reflected better prognosis of gastric gists compared with intestinal gists of the same mitotic index and size [ 21 , 6770 ] ( table 3 and fig . 1 ) . the same prognostic factors were taken into account in the nomogram created by gold et al . , which seems to vaguely outperform the nih and nccn afip criteria . moreover , it has been demonstrated that tumor rupture ( either spontaneous or iatrogenic ) is an important risk factor , which strongly correlates with the risk of recurrence in gists [ 72 , 73 ] . this observation has led to the development of modified nih criteria and novel non - linear risk stratification systems , including prognostic contour maps and heat maps , constructed on the basis of the tumor size , site , mitotic index , and incidence of tumor rupture [ 7375 ] . these features may provide even more accurate estimation of the risk of recurrence and are appropriate for individualizing risk stratification for adjuvant therapy in gists . subgroup analysis of the acosog z9001 trial confirmed that the major clinical benefit of adjuvant therapy was limited to the group of patients at high risk of relapse according to the nccn afip criteria ( an improvement in 2-year rfs from 41 to 77 % ; p < 0.0001 ) .table 3national comprehensive cancer network ( nccn)armed forces institute of pathology ( afip ) risk criteria after resection of primary gastrointestinal stromal tumors ( gists ) , according to miettinen and lasota tumor parametersprimary tumor location and risk of recurrencesizemitotic indexstomachduodenumsmall intestinerectum2 cm5/50 hpfs0 % 0 % 0 % 0 % > 2 cm , 5 cmvery low ( 1.9 % ) low ( 8.3 % ) low ( 4.3 % ) low ( 8.5 % ) > 5 cm , 10 cmlow ( 3.6 % ) high ( 34 % ) intermediate ( 24 % ) high ( 57 % ) > 10 cmintermediate ( 12 % ) high ( 52 % ) 2 cm>5/50 hpfsinsufficient datainsufficient datahigh ( 50 % ) high ( 5271 % ) > 2 cm , 5 cmintermediate ( 16 % ) high ( 5086 % ) high ( 7390 % ) > 5 cm , 10 cmhigh ( 5586 % ) > 10 cmhpfs high - powered fieldsfig . 1recurrence - free survival in small - bowel gastrointestinal stromal tumors ( gists ) , according to national comprehensive cancer network ( nccn)armed forces institute of pathology ( afip ) risk categories ( based on the authors own data from 659 primary gists after radical resection , presented during the european society of surgical oncology conference ) national comprehensive cancer network ( nccn)armed forces institute of pathology ( afip ) risk criteria after resection of primary gastrointestinal stromal tumors ( gists ) , according to miettinen and lasota hpfs high - powered fields recurrence - free survival in small - bowel gastrointestinal stromal tumors ( gists ) , according to national comprehensive cancer network ( nccn)armed forces institute of pathology ( afip ) risk categories ( based on the authors own data from 659 primary gists after radical resection , presented during the european society of surgical oncology conference ) in addition to clinicopathological factors , molecular features may also present added value to risk stratification of gists . several studies have demonstrated better prognosis for patients harboring kit exon 11 point mutations or insertions , as well as pdgfra exon 18 mutations . on the other hand , tumors carrying kit exon 11 deletions ( especially involving codons 557 or 558 ) and kit exon it has also been proposed that genomic complexity , defined by a genomic index determined by array comparative genomic hybridization , may serve as a useful adjunct to the current risk stratification systems , which are often uninformative in the case of intermediate - risk patients [ 84 , 85 ] . it is worth noting that the updated fda and ema approvals for 36 months of imatinib treatment apply to patients who specifically meet the inclusion criteria determined in the ssgxviii / aio trial [ 7 , 65 ] . in that trial , patients were eligible for the trial if they had kit - positive gists and demonstrated at least one of the following features : longest tumor diameter > 10 cm , mitotic index > 10/50 hpfs , longest tumor diameter > 5 cm and mitotic index > 5/50 hpfs , or tumor rupture prior to or at the time of surgery . this classification represents a modified nih risk - stratification system , complemented with tumor rupture as an independent prognostic factor . gastric gists constituted approximately half of the cases in both the 12- and 36-month arms , followed by small - intestine gists ( 37 and 31 % of cases , respectively ) , and gists located in the colon or rectum constituted 8 and 10 % of cases , respectively . in 7 % of patients in each arm ,", "the results of the ssgxviii / aio trial demonstrated that mutational analysis of gists may have predictive value for the clinical response to adjuvant imatinib therapy , similar to data observed in the metastatic setting . from the molecular point of view , resistance to imatinib has its origins in kit / pdgfra mutational status . data reported by joensuu and colleagues showed that patients with kit exon 11 mutations benefit the most from prolonged adjuvant treatment . similar data were shown for patients treated in the acosog z9001 trial ; the 2-year rfs rate was 91 % for patients treated with adjuvant imatinib harboring kit exon 11 mutations , as compared with 65 % in a group of patients with the same genotype receiving placebo ( p < 0.0001 ) . on the other hand , primary imatinib resistance in the adjuvant setting has been demonstrated especially in cases carrying a pdgfra exon 18 p.d842v mutation , presumably because of the structural alterations at the imatinib binding site . this mutation is detected in approximately 10 % of operable gists [ 75 , 87 ] , especially in tumors originating from the stomach ( exceeding 20 % of cases in this location ) . adjuvant imatinib should not be recommended in cases of gists harboring a pdgfra exon 18 p.d842v mutation . in the acosog z9001 trial , interestingly , it has been demonstrated that patients with advanced gists harboring mutations in kit exon 9 may benefit from an imatinib dose increase to 800 mg daily . this indicates that patients with this mutation may be underdosed when receiving 400 mg of imatinib daily , but it has never been examined in any clinical trial in the adjuvant setting . in wild - type gists , the tumor size and mitotic index poorly predict clinical outcome ; therefore , current risk stratification systems seem to be inapplicable in this subgroup of patients [ 50 , 51 ] . moreover , wild - type gists present a limited response to imatinib treatment , in comparison with gists carrying imatinib - sensitive mutations . adjuvant imatinib efficacy in kit exon 9 mutants and wild - type gists warrants further study ; however , the numbers of patients in these subgroups are usually small , and so statistical significance is difficult to reach when these categories are analyzed . nevertheless , kit and pdgfra genotyping in gists should be performed routinely in the adjuvant setting , since it may help to tailor the treatment to patients who are more likely to respond to imatinib therapy , or to exclude patients with imatinib - resistance mutations [ 86 , 88 ] . in the ssgxviii / aio trial , patients were monitored for their response to imatinib with contrast - enhanced computed tomography or magnetic resonance imaging at 6-month intervals for the first 7 years and annually thereafter . an initial staging examination was performed within 28 days before the introduction of imatinib treatment . blood biochemistry and cell counts were performed at 1- to 3-month intervals in the course of the treatment . gist relapse is usually observed at the highest frequency within the first 2 years after completion of adjuvant treatment ; therefore , regular imaging in this period is especially important for early detection of recurrence [ 64 , 76 ] . the majority of patients who develop gist recurrence after completion of adjuvant imatinib respond to an imatinib rechallenge regardless of the prior treatment duration . on the basis of the clinical behavior of advanced gists , it may be anticipated that in patients who relapse during adjuvant treatment or within the first few weeks after completion of adjuvant treatment , an increased dose of imatinib or introduction of another tyrosine kinase inhibitor , such as sunitinib , may be beneficial because these cases are probably primarily imatinib resistant . generally , only a few patients in the ssgxviii / aio trial developed gist recurrence during imatinib treatment ( 2 % of patients in the 12-month arm and 6 % of patients in the 36-month arm ) . this suggests that acquired resistance to adjuvant imatinib ( related mainly to occurrence of secondary kit / pdgfra mutations ) is infrequent in this patient population [ 7 , 65 ] . we still do not know if adjuvant imatinib therapy can cure a patient by preventing relapse or can only delay it . in the metastatic setting , interruption of imatinib therapy has been associated with disease relapse at a median of 6 months after stopping imatinib after 1 , 3 , or 5 years of treatment [ 89 , 90 ] . the significant improvement in os associated with 3 years versus 1 year of adjuvant imatinib in the ssgxviii / aio trial [ 7 , 65 ] was based on the limited number of deaths that occurred at median follow - up of 54 months , and so longer follow - up is needed to confirm the os advantage related to 3-year adjuvant imatinib therapy .", "there are still several unresolved issues concerning future use of adjuvant imatinib in gists . in the coming years , adjuvant imatinib treatment for at least 3 years will be standard therapy in high - risk gist patients harboring sensitive mutations . in intermediate - risk patients , adjuvant imatinib should be considered , provided there is better characterization of individual prognostic features . the role of adjuvant imatinib therapy in patients with wild - type gists or kit exon 9 mutations should be better defined , and the appropriate initial dose of imatinib400 or 800 mg daily in patients with kit exon 9 mutants must be established . the optimal duration of adjuvant imatinib therapy beyond 3 years requires further investigation and should preferably be determined on the basis of randomized controlled trials . furthermore , the optimal follow - up schedule after discontinuation of the therapy is not well established . the only issue that seems to be incontestable in the immediate future is the necessity for genotyping of every primary gist considered for adjuvant therapy .", "despite the striking efficacy of imatinib , recurrent or metastatic gist is still not a curable disease . this implies that prevention of disease recurrence following surgical resection of the primary tumor is the key to further improvement of the clinical outcomes of patients affected by gists . three years of adjuvant imatinib treatment , as opposed to 1 year of treatment , significantly reduced the risk of recurrence and improved os in patients with kit - positive gists at high risk of recurrence after surgery . currently , 3 years of adjuvant treatment for patients at high risk of recurrence may be considered as a standard of care . however , it is not clear whether patients who are classified as intermediate risk should be treated with adjuvant imatinib . results from several phase ii studies support the idea that at least 2 years of adjuvant imatinib treatment is beneficial for intermediate - risk gists ( especially those harboring kit exon 11 mutations ) and may be considered in this subgroup of patients [ 9297 ] . on the other hand , patients with very low - risk or low - risk tumors are likely to be cured by surgery alone and should not receive adjuvant imatinib . beyond risk assessment for proper selection of patients for adjuvant imatinib therapy it may help to tailor the treatment to patients carrying more sensitive mutations , such as kit exon 11 mutations , or to exclude patients with imatinib - resistance mutations , such as a pdgfra p.d842v mutation . thus , kit and pdgfra genotyping of patients with gists is obligatory in the adjuvant setting [ 86 , 88 ] ." ]

[ "while the physical disability aspect of multiple sclerosis ( ms ) , the most common demyelinating disease of the central nervous system in young adults , is of great importance , it is now well recognized that it does not reflect all of the facets that patients consider important in their life . fatigue , depression , and physical disability are only one aspect of a person 's experience with ms ; it is well documented that cognitive , emotional , and psychological functions contribute to their quality of life ( qol ) . the qol measurements are being considered increasingly important with regard to evaluating disease progression , treatment and the management of care provided to ms patients [ 2 , 3 ] . the us food and drug administration ( fda ) and the european medicines agency encourage the use of qol assessment in patients with chronic illnesses [ 4 , 5 ] , and several groups have published detailed recommendations for qol assessment [ 6 , 7 ] . in ms research , 118 studies that have reported qol as an outcome were performed with ms patients in the clinical trials registry ( clinicaltrials.gov , december 31 , 2012 ) . despite the acknowledged need to consider qol issues , qol assessment may be considered to be an unfulfilled promise [ 911 ] . therefore , these issues should be explored and understood to promote both the use and usefulness of measuring qol in ms clinical practice . here , we explore the difficulties for clinicians to choose and determine the most appropriate qol measure , to be convinced by the clinical utility of the qol assessment implementation in clinical practice and to interpret qol scores .", "qol is commonly assessed using self - reported questionnaires . to fully understand and explore the effectiveness of any intervention for the management of ms , it is important to have robust , valid , reliable , and universally applied measures . generic instruments are generally used to compare qol across different populations , while disease - specific instruments focus on particular health problems and are more sensitive for detecting and quantifying small changes . in ms clinical practice , ms - specific questionnaires are more appropriate due to a better ability to discern qol differences in patients than the 36-item short form . a large number of disease - specific qol instruments have been validated for use in ms patients . the most popular questionnaires are the multiple sclerosis quality of life questionnaire ( msqol54 ) , the functional assessment of multiple sclerosis questionnaire ( fams ) , the hamburg quality of life questionnaire in multiple sclerosis ( haquams ) , the quality of life index - multiple sclerosis ( qli - ms ) , the multiple sclerosis quality of life index ( msqli ) , the leeds multiple sclerosis quality of life scale , the ms impact scale ( msis-29 ) , the disability and impact profile ( dip ) , the extension of quality - adjusted time without symptoms of disease and toxicity of treatment , and more recently , the multiple sclerosis international quality of life questionnaire . while some reviews tried to describe the different questionnaires as designed specifically for ms patients [ 2 , 25 , 26 ] , a clinician contemplating these various rules and instruments may be overwhelmed by their level of complexity . the multiplicity of scales used requires describing their psychometrics and the theoretical and conceptual foundations . clinicians should be provided better guidance and training that includes evidence of the respective contributions of the various available instruments , the degree to which the tools measure what they claim to measure , and their respective strengths and shortcomings . high - level requirements for development and metric validation of qol measures , especially among the most recent instruments , are now well acknowledged [ 28 , 29 ] . briefly , we can mention some limitations about the process of validating the qol questionnaires that may compromise the robustness of the instrument . first , one important issue concerns the conceptual problems related to the definition of qol . the researchers should have well - validated questionnaires based on a clear conceptual basis for qol . one major challenge to explaining the content of the qol dimensions to be measured is to ensure that the subjects ' perceptions are accurately taken into account . interviews with patients are commonly considered as the best method to capture the patient 's perceptions [ 30 , 31 ] and provide the content of the questionnaire . few ms - specific qol questionnaires were exclusively based on the patient 's point of view . second , the responsiveness or sensitivity to change , defined as the ability to detect a meaningful change , is a core psychometric property of a measuring instrument . given the availability of many qol instruments , little research has been conducted to test the responsiveness of the qol tools in ms . the haquams showed satisfactory responsiveness to change , the msis-29 , msqol-54 , and fams moderately detected change in health status [ 33 , 34 ] . also , clinicians should prefer the use of the haquams to detect health changes over time of ms patients . future studies should provide comparisons with responsiveness indices using a direct head - to - head comparison to make the situations in which they were tested comparably . finally , another point that should be mentioned is related to the number of available languages of the questionnaire . the msqol54 [ 15 , 3537 ] and the musiqol [ 24 , 3841 ] these questionnaires were developed simultaneously in a number of countries and thus represent a major strength . environmental barriers have been described to explain why qol measures have not been routinely implemented in clinical practice . time and resource are both constraints on clinicians whose main role is providing patient care . a great asset of the qol questionnaire is its acceptability , which concerns the ergonomics of the questionnaire , such as the length of the questionnaire , the paper or electronic format , and the concept of computer adaptive testing . some authors have suggested that questionnaires intended for use in clinical populations should be as brief as possible because of the nonadaptability with a clinical evaluation and the difficulties of the concentration and perception faced by patients with a cognitive dysfunction [ 8 , 30 ] , such as ms patients . it is common to accept that the average time of completion of a questionnaire should not exceed 10 minutes to be fully compatible with clinical practice . providing shorter questionnaires in ms qol measures , as is already done in other chronic diseases , may contribute both appropriate and useful for use in clinical practice . a potential opportunity for questionnaire development exists in the growing use of electronic records and e - health research . to our knowledge , there are not any studies that evaluate the feasibility of e - form qol questionnaires in ms patients . however , it is not certain that e - form questionnaires would allow for obtaining qol data in an efficient real - time manner because of the logistics feasibility and the lack of computer stations and hand - held devices . while most qol questionnaires are initially fixed in content and length , future challenges now focus on the concept of computer adaptive testing . the number of items can be reduced substantially by use of item - response theory and computer adaptive testing to target questions through an iterative process in which responses determine which items are subsequently presented . this approach requires development and validation of algorithms in addition to development and validation of the original questionnaire . today , the neurology quality - of - life measurement initiative is a standardized approach based on extant items used for measuring qol across common neurologic conditions , including multiple sclerosis , for both adults and children [ 47 , 48 ] .", "the next challenge is to develop credible strategies for integrating qol data in clinical practice . to enhance the use of qol measures in clinical decision making , improving knowledge about the determinants of qol changes and the potential predictive role of qol on disability may reinforce the conviction of clinicians to use these measures in their ms clinical practice . in the same way , demonstrating that qol feedback should improve health status of ms patients may confirm the relevance of including qol in clinical practice . clinicians can use qol assessments to check whether interventions have been as effective from the patient 's point of view as from the clinician 's , and to determine whether further action is required . knowledge of which factors are determinants of qol in patients with ms would assist clinicians in choosing the most appropriate interventions . several determinants of qol have been identified with varying strengths of association and include both disease - related variables ( disability status [ 49 , 50 ] , disease duration [ 50 , 51 ] , fatigue [ 52 , 53 ] , depression [ 49 , 54 ] ) , cognition , sociodemographic variables ( age and sex [ 55 , 56 ] , level of education , and marital status ) . a number of these factors might be amenable to treatment intervention , which might be expected to improve qol : fatigue , depression , and cognition . predictive factors of long - term disability in patients with ms were also previously reported [ 60 , 61 ] : sociodemographic variables [ 62 , 63 ] , initial edss score or initial change in edss score [ 61 , 64 ] , number or types of relapses [ 61 , 62 ] , nature of the initial symptoms , and mri findings . the weight of these factors is poorly understood and does not explain the entire change of disability that is observed . in contrast to domains such as heart disease and cancer , few studies have examined the predictive value of qol on disability in patients with ms . longitudinal studies have described whether the qol level , in addition to conventional clinical and sociodemographic factors , provides prognostic information about the evolution of disability in patients with ms [ 6770 ] . these studies have found that scores of mental health qol [ 67 , 69 ] , scores of physical - like dimensions [ 68 , 69 , 71 ] , and the score of global qol are independent predictors of disability as assessed using the edss score . there must be at least one plausible mechanism responsible for the link between poor qol and progression in disability . qol could be a more subtle measure of early disability that is not detected by the edss scale . the identification of early predictors of the long - term evolution of disability status may be useful to identify both high - risk patients who require early and more aggressive therapies and low - risk patients who could avoid lifelong , expensive , and potentially troublesome treatments . thus , this identification procedure may favor a more homogeneous selection of patients for clinical therapeutic trials . patient - reported baseline qol levels provide additional prognostic information on ms disability beyond traditional clinical or sociodemographic factors . these findings provide strong support for the integration of qol into clinical practice , in addition to other standard assessments , and reinforce the importance of incorporating a patient 's evaluation of their own qol level during patient monitoring and the assessment of treatment effects . future studies should provide data from longer follow - up times and will likely highlight other robust findings . the impact of qol assessment on health status and other health - related outcomes of patients has already been accomplished in oncology [ 7375 ] . to our knowledge , there are no studies that have explored the effect of assessing qol in ms care management . this effect is defined by the negative expectations that derive from a clinical encounter and lead to poor health outcomes and therapy adherence . this theme constitutes an important avenue of ms research in clinical settings for the coming years .", "in some specific situations , clinicians can be perplexed when interpreting qol scores : ( 1 ) what does a qol score mean in the absence of normative / reference values ? ( 3 ) what is the meaning of qol scores for an individual with cognitive impairment ? the practical and clinical interpretations of qol data in a given disorder are difficult unless these data are presented with a reference system . one of the difficulties encountered when interpreting a qol score for clinicians is the lack of norms values . sf36 , a generic instrument , is commonly used because normative data from healthy adults and individuals with a variety of illnesses are available . to our knowledge , no norms were provided for any ms - specific questionnaire . at this time , the qol scores of the reference population described in the validation publication are implicitly used as norms . it is rare to have scores according to sex , gender , and clinical form . additionally , it becomes imperative to produce norms for the most popular ms - specific instruments . another concern expressed by clinicians is the interpretation of qol measures in longitudinal studies because qol , self - reported by the patient , might be influenced by psychological phenomena such as adaptation to illness . adaptation to illness is a potential explanation in cases where , for example , the qol of an individual who has experienced a serious health event or chronic condition is similar to the qol of a healthy individual . most people with a long - term chronic condition such as ms do not say that physical disability is their primary concern but mention involvement in everyday activities and psychological and emotional well - being . an important mediator of this adaptation process is response shift ( rs ) which involves changing internal standards , values , and the conceptualization of qol [ 78 , 79 ] . rs can be divided into ( 1 ) reconceptualization ( i.e. , a redefinition of qol ) , ( 2 ) reprioritization ( i.e. , a change in the importance attributed to component domains constituting qol ) , and ( 3 ) recalibration ( i.e. , a change in a patient 's internal standards of measurements ) . true change may be over- or underestimated when rs is present , leading to biased estimates of the magnitude of change . a recent meta - analysis revealed a substantial body of literature on rs phenomena and concluded that rs was common and significant in qol measurement . some studies have already investigated this phenomenon in ms populations using the most established methods : the then - test , structural equation modeling ( sem ) , latent trajectory analysis of residuals , recursive partitioning tree analysis as a data mining method , and , more recently , the random forest method . . it would be premature to conclude which method is best for detecting rs in ms patients . future explorations should be performed to compare the capacity of these methods for detecting rs and the degree of convergence of the isolated phenomena . however , the rs does not necessarily invalidate qol measures when it appears under the reprioritization component . change in values may simply represent a mechanism by which people gain true changes in qol . determining how to integrate the rs in the interpretation of qol scores in ms clinical practice is now the next challenge . prior studies of the relationship between cognitive impairment and qol have been contradictory , highlighting either negligible [ 8790 ] or strong links [ 51 , 91 , 92 ] between cognitive disturbances and qol alterations . the use of self - reported outcomes in subjects with cognitive dysfunction is of particular concern . the extent to which ms patients with cognitive dysfunction can validly self - report their qol is a crucial issue that has only partially been examined . while some authors argue that cognitively impaired individuals are unable to produce valid qol measures [ 94 , 95 ] , others reported empirical evidence suggesting that individuals with a moderate degree of cognitive impairment can perform reliable qol assessments [ 92 , 96 ] . two recent papers reported data providing strong arguments to support the conclusion that ms patients with executive dysfunction , as determined by the stroop test , and memory dysfunction , as determined by the grober and buschke test , are reliable and consistent when answering a well - validated ms - specific qol questionnaire , the musiqol [ 24 , 38 ] . these studies provided new evidence about the suitability for using self - reported qol data in these specific populations . the assessment of qol using the musiqol questionnaire could be more widely used without concern over the adequacy of this approach for cognitively impaired patients . however , it has to be acknowledged that a single test of cognitive functioning will never be entirely appropriate . an interdisciplinary approach would be most effective in addressing this deficit [ 1 , 12 ] . future studies should provide similar results according to other definitions of cognitive dysfunction that integrate combinations of different composites ( i.e. , memory , attention , and concentration ) and other qol questionnaires .", "using qol measures may provide clinicians with information regarding the general health status of their ms patients who might otherwise go unrecognized . neurologists should consider qol measures in the same way as routine objective measures such as symptomatic evaluation scales , laboratory tests , and radiographs to manage the care of ms patients . in this paper , we discussed several avenues to convince clinicians of the clinical relevance and accuracy of qol instruments and ultimately to enhance the use of qol measures in clinical practice for ms patients ." ]

[ "obestatin is a 23-amino acid peptide derived from proghrelin , a common prohormone for ghrelin and obestatin . obestatin , like ghrelin , was originally extracted from rat stomach , and the stomach seems to be a major source of circulating obestatin . secretion of obestatin is pulsatile , and plasma obestatin level exhibits an ultradian pulsatility with a frequency slightly lower than octanoylated ghrelin and growth hormone . synthesis and release of ghrelin in the stomach is related to gastric condition . in patients with helicobacter pylori - evoked antral gastritis , plasma concentration of ghrelin and gastric expression of mrna for ghrelin are increased ; whereas in the next stage of helicobacter pylori infection , in chronic atrophic gastritis , level of ghrelin is reduced . previous studies have shown that administration of ghrelin protects various organs such as the heart , kidney and brain against ischemic injury and attenuates sepsis - induced lung injury and mortality . moreover , ghrelin affects the bone metabolism , stimulating osteogenesis and improving the repair of bone defects . in the gut , pretreatment with ghrelin reduces gastric mucosal damage induced by noxious agents [ 1113 ] and inhibits the development of acute experimental pancreatitis . moreover , apart from its protective effect , ghrelin accelerates the healing of gastric ulcers and exhibits a therapeutic effect in the course of acute pancreatitis and colonic inflammation . obestatin promotes survival of pancreatic islets , and pretreatment with obestatin inhibits the development of cerulein - induced acute pancreatitis . tumor necrosis factor- ( tnf- ) and interleukin-1 ( il-1 ) are cytokines involved in systemic inflammation and are members of a group of cytokines that stimulate acute phase reaction . tnf- and il-1 are produced mainly by macrophages , but a broad variety of other cell types is also involved in their production . therefore , the aim of our present investigation was to examine whether obestatin administration exhibits any effect on the healing of chronic gastric ulcers and whether obestatin affects mucosal expression of pro - inflammatory cytokines .", "studies were performed on 80 male wistar rats weighing 180200 g and divided randomly into 8 groups . experiments were conducted following the experimental protocol approved by the local commission of ethics for the care and use of laboratory animals . animals were housed in cages with wire mesh bottoms , in normal room temperature ( 221c ) and a 12-h light - dark cycle . after fasting for 16 h , rats were anesthetized with pentobarbital ( 30 mg / kg i.p . , vetbutal , biowet , puawy , poland ) and chronic gastric ulcers were induced using our modification of a method originally described by okabe et al . briefly , a plastic tube of 4.2 mm inner diameter was applied tightly to the serosal surface of the anterior wall of the distal portion of the stomach , proximal to the pylorus . about 70 l of 100% acetic acid was applied through this tube for 20 s. after removal of the acetic acid , the abdomen was closed by sutures . this method was found to result in the formation of chronic ulceration of mucosa and submucosa within the area of acetic acid application . all rats were fasted with unlimited access to water at day 0 and then had free access to food and water . after induction of ulcers or sham operation , rats were treated with saline ( 0.9% solution of nacl ) or obestatin given intraperitoneally twice a day for 6 days ( the first injection at the day of ulcer induction , the last injection 1 h before the end of experiment ) . obestatin was administered at the dose of 4 , 8 or 16 nmol / kg / dose . rat obestatin was synthesized at the yanaihara institute by a solid phase methodology with fmoc strategy using an automated peptide synthesizer ( applied biosystem 9030 pioneer , foster , ca , usa ) . six days after induction of chronic gastric ulcers , rats were anesthetized again with pentobarbital and the abdomen was opened by a midline incision . the stomach was exposed and the gastric mucosal blood flow was measured using laser doppler flowmeter ( periflux 4001 master monitor , perimed ab , jrflla , sweden ) . blood flow was measured in 5 areas of gastric mucosa and mean value of 5 recordings was presented as percent of mucosal blood flow recorded in saline - treated control rats without induction of ulcers . after measurement of mucosal blood flow the area of ulcerated mucosa was measured using a computerized planimeter ( morphomat , carl zeiss , berlin , germany ) as described previously . expression of mrna for interleukin-1 and tnf- was determined using reverse transcriptase - polymerase chain reaction ( rt - pcr ) as described previously . samples of gastric mucosa were snap frozen in liquid nitrogen and stored at 80c until rna extraction . the interleukin-1 primer sequences were : sense , gctacctatgtcttgcccgt , and antisense , gaccattgctgtttcctagg ; the expected length of the product was 543 bp . the tnf- primer sequences were : sense , tactgaacttcggggtgattggtcc , and antisense , cagccttgtcccttgaagagaacc ; the expected length of the product was 295 bp . the -actin primer sequences were : sense , ttgtaaccaactgggacgatatgg , and antisense , gatcttgatcttcatggtgctagg ; the expected length of the product was 764 bp . polymerase chain reaction products were detected by electrophoresis on a 1.5% agarose gel containing ethidium bromide . location of predicted products was confirmed by using 100-bp ladder ( takara , shiga , japan ) as a standard size marker . the intensity of pcr products was measured using a video image analysis system ( kodak digital science ) . the signal for investigated mrna was standardized against that of the -actin mrna from each sample and the results were expressed as analyzed mrna / b - actin mrna ratio as described earlier . dna synthesis in gastric mucosa was determined by measurement of [ h]thymidine incorporation ( [ 6 - 3h]-thymidine , 2030 ci / mmol , institute for research , production and application of radioisotopes , prague , czech republic ) into mucosal dna as described previously . the incorporation of labeled thymidine into dna was determined by counting 0.5 ml dna - containing supernatant in a liquid scintillation system . dna synthesis was expressed as disintegrations of tritium per minute per g dna ( dpm/g dna ) . statistical analysis was carried out by one - way analysis of variance ( anova ) followed by the tukey multiple comparison test using graphpadprism ( graphpad software , san diego , ca , usa ) .", "studies were performed on 80 male wistar rats weighing 180200 g and divided randomly into 8 groups . experiments were conducted following the experimental protocol approved by the local commission of ethics for the care and use of laboratory animals . animals were housed in cages with wire mesh bottoms , in normal room temperature ( 221c ) and a 12-h light - dark cycle . after fasting for 16 h , rats were anesthetized with pentobarbital ( 30 mg / kg i.p . , vetbutal , biowet , puawy , poland ) and chronic gastric ulcers were induced using our modification of a method originally described by okabe et al . briefly , a plastic tube of 4.2 mm inner diameter was applied tightly to the serosal surface of the anterior wall of the distal portion of the stomach , proximal to the pylorus . about 70 l of 100% acetic acid was applied through this tube for 20 s. after removal of the acetic acid , the abdomen was closed by sutures . this method was found to result in the formation of chronic ulceration of mucosa and submucosa within the area of acetic acid application . all rats were fasted with unlimited access to water at day 0 and then had free access to food and water . after induction of ulcers or sham operation , rats were treated with saline ( 0.9% solution of nacl ) or obestatin given intraperitoneally twice a day for 6 days ( the first injection at the day of ulcer induction , the last injection 1 h before the end of experiment ) . obestatin was administered at the dose of 4 , 8 or 16 nmol / kg / dose . rat obestatin was synthesized at the yanaihara institute by a solid phase methodology with fmoc strategy using an automated peptide synthesizer ( applied biosystem 9030 pioneer , foster , ca , usa ) .", "six days after induction of chronic gastric ulcers , rats were anesthetized again with pentobarbital and the abdomen was opened by a midline incision . the stomach was exposed and the gastric mucosal blood flow was measured using laser doppler flowmeter ( periflux 4001 master monitor , perimed ab , jrflla , sweden ) . blood flow was measured in 5 areas of gastric mucosa and mean value of 5 recordings was presented as percent of mucosal blood flow recorded in saline - treated control rats without induction of ulcers . after measurement of mucosal blood flow the area of ulcerated mucosa was measured using a computerized planimeter ( morphomat , carl zeiss , berlin , germany ) as described previously .", "expression of mrna for interleukin-1 and tnf- was determined using reverse transcriptase - polymerase chain reaction ( rt - pcr ) as described previously . samples of gastric mucosa were snap frozen in liquid nitrogen and stored at 80c until rna extraction . the interleukin-1 primer sequences were : sense , gctacctatgtcttgcccgt , and antisense , gaccattgctgtttcctagg ; the expected length of the product was 543 bp . the tnf- primer sequences were : sense , tactgaacttcggggtgattggtcc , and antisense , cagccttgtcccttgaagagaacc ; the expected length of the product was 295 bp . the -actin primer sequences were : sense , ttgtaaccaactgggacgatatgg , and antisense , gatcttgatcttcatggtgctagg ; the expected length of the product was 764 bp . polymerase chain reaction products were detected by electrophoresis on a 1.5% agarose gel containing ethidium bromide . location of predicted products was confirmed by using 100-bp ladder ( takara , shiga , japan ) as a standard size marker . the intensity of pcr products was measured using a video image analysis system ( kodak digital science ) . the signal for investigated mrna was standardized against that of the -actin mrna from each sample and the results were expressed as analyzed mrna / b - actin mrna ratio as described earlier . dna synthesis in gastric mucosa was determined by measurement of [ h]thymidine incorporation ( [ 6 - 3h]-thymidine , 2030 ci / mmol , institute for research , production and application of radioisotopes , prague , czech republic ) into mucosal dna as described previously . the incorporation of labeled thymidine into dna was determined by counting 0.5 ml dna - containing supernatant in a liquid scintillation system . dna synthesis was expressed as disintegrations of tritium per minute per g dna ( dpm/g dna ) .", "results were expressed as mean sem . statistical analysis was carried out by one - way analysis of variance ( anova ) followed by the tukey multiple comparison test using graphpadprism ( graphpad software , san diego , ca , usa ) .", "figure 1 shows the influence of obestatin administration on the healing of chronic gastric ulcers . in saline- or obestatin - treated rats without induction of ulcer , treatment with obestatin given at the dose of 4 , 8 and 16 nmol / kg / dose reduced ulcer area by 12% , 29% and 27% , respectively . effect of obestatin given at the doses of 8 and 16 nmol / kg / dose was statistically significant . in rats without induction of ulcers , administration of obestatin failed to affect gastric mucosal blood flow ( figure 2 ) . induction of ulcers significantly increased gastric mucosal blood flow by 23% and this effect was additionally enhanced by treatment with obestatin . obestatin given at the dose of 8 and 16 nmol / kg / dose exhibited similar and statistically significant effect on gastric mucosal blood flow in rats with ulcers ; whereas effect of obestatin given at the dose of 4 nmol / kg was statistically insignificant . in control saline - treated animals , gastric mucosal dna synthesis reached a value of 75.22.8 dpm/g dna ( figure 3 ) . administration of obestatin failed to affect dna synthesis in gastric mucosa in rats without induction of ulcers . in saline - treated rats with ulcers , gastric mucosal dna synthesis was reduced by 42% . treatment with obestatin partly reversed the ulcer - evoked reduction in dna synthesis in gastric mucosa . this effect was statistically significant after obestatin was administered at the dose of 8 or 16 nmol / kg / dose . in rats with intact gastric mucosa , administration of obestatin at the dose of 8 nmol / kg / dose was without effect on mucosal expression of mrna for pro - inflammatory il-1 in the stomach ( figure 4 ) . administration of obestatin at the dose of 8 nmol / kg / dose partly , but significantly , reversed the ulcer - evoked increase in mucosal expression of mrna for interleukin-1. administration of obestatin at the dose of 8 nmol / kg / dose was without effect on the ratio of mrna for tnf- to mrna for -actin in gastric mucosa in rats without induction of ulcers ( figure 5 ) . treatment with obestatin at the dose 8 nmol / kg / dose reduced the ulcer - evoked increase in expression of tnf- mrna by 61% , but this value was still higher than that observed in control rats with intact mucosa .", "our present study has shown for the first time that obestatin exhibits therapeutic effect in the course of chronic gastric ulcers . this effect was related to a decrease in local inflammatory process , improvement of mucosal blood flow and enhancement of mucosal cell proliferation , leading to acceleration of gastric ulcer healing . direct mechanism of obestatin s therapeutic effect is not clear because the cellular target of this peptide is uncertain . initially , zhang et al reported that obestatin binds and activates the orphan g protein - coupled receptor gpr39 . on the other hand , numerous researchers have obtained opposite results . chartrel et al . found no specific binding of i - obestatin to grp39 receptor , and they observed no effects of obestatin on gpr39-transfected cells in various functional assays , using the same experimental conditions as zhang et al . similar negative results were also observed by lauwers et al . and holst . facing the problem of inconsistent result , zhang et al . have performed a new , precise study , investigating target cells for obestatin based on induction of an early - response gene c - fos in different tissues . after administration of obestatin , c - fos staining was found in the nuclei of gastric and intestinal mucosa , white adipose tissues , hepatic cords , and kidney tubules . binding studies , using jejunum homogenates and recombinant gpr39 , revealed obestatin - specific displacement curves . furthermore , zhang et al . demonstrated that treatment with obestatin induces c - fos expression in gastric mucosa of wild - type , but not gpr39 null , mice , indicating a mediating role of this receptor in obestatin actions . finally , zhang et al . concluded that obestatin is a metabolic hormone capable of binding to gpr39 receptor to regulate the functions of diverse gastrointestinal and adipose tissues . however , future studies are needed to confirm results obtained by zhang et al . , as well as to investigate physiological and pathophysiological role of obestatin . circulation and perfusion of organs is a basic physiological process necessary to sustain oxygenation and nutrition at a cellular level . microvascular impairment of the abdominal organs has been implicated in the pathogenesis of a variety of disorders , including peptic ulcer disease and inflammatory bowel disease . blood flow plays an important role in protection of normal gastric mucosa and in the healing of damaged mucosa . low mucosal blood flow predisposes to injury , whereas high blood flow protects against injurious agents . . development of peptic ulcer is associated with damage to blood vessels and reduction in mucosal blood flow . during ulcer healing mucosal blood flow returns to normal level . these data are in agreement with results of our present study and indicates the role of blood flow in the therapeutic effect of obestatin in the course of chronic gastric ulcer . treatment with obestatin has increased mucosal blood flow in the stomach ; this effect has been associated with reduction in gastric ulcer area . this obestatin - evoked influence on gastric blood flow seems to be an indirect effect because administration of obestatin has failed to affect gastric blood flow in animals with intact gastric mucosa . healing of gastric ulcers needs cell proliferation ; this process is required for complete regeneration of damaged mucosa . dna synthesis precedes cell division and the rate of mucosal dna synthesis is an index of mucosal cell proliferation . in our present study , obestatin failed to affect dna synthesis in gastric mucosa in rats without ulcers , but significantly reversed the ulcer - evoked reduction in this parameter . these findings indicate that the obestatin - evoked acceleration of gastric ulcer healing involves promotion of mucosal cell proliferation , but it seems to be the secondary , indirect effect . our present study has shown that induction of ulcers increases mucosal expression of mrna for il-1 and tnf-. both of these factors are cytokines involved in local and systemic inflammation , and act synergistically . they are inducers of endothelial adhesion molecules , which are essential for the adhesion of leukocytes to the endothelial surface prior to their migration into the tissues . il-1 and tnf- play a crucial role in the stimulation of acute phase reaction . these data , together with our observation that treatment with obestatin reverses the ulcer - induced increase in mucosal expression of mrna for il-1 and tnf- ,", "our study has demonstrated that treatment with obestatin accelerates healing of chronic gastric ulcers and this effect is related to improvement of mucosal blood flow , increase in mucosal cell proliferation and reduction in local expression of pro - inflammatory cytokines ." ]

[ "this report describes the design , implementation , and feasibility of the interstitial cystitis : elucidation of psychophysiologic and autonomic characteristics ( icepac ) study . interstitial cystitis / bladder pain syndrome ( ic / bps ) causes severe bladder pain and afflicts about 2.5% of the population.1 the authors hypothesized abnormality of bladder perception at the central and/or peripheral nervous system levels . typical symptoms and findings support this hypothesis ( table 1 ) , and suggest ic / bps is better conceptualized as either a chronic pain disorder , one involving autonomic nervous system dysfunction , or a combination of both . classification as a chronic pain disorder may imply aberrant afferent ( sensory ) processing , whereas autonomic nervous system disorders are more often conceptualized as reflecting a primary efferent disturbance ( table 1 ) . if ic / bps reflects a nervous system disorder , the large number of comorbid diagnoses associated with ic / bps2 suggests a widespread abnormality , either in a large portion of peripheral nerves or in a single location of the central nervous system responsible for end - organ input , control , or both . a number of ic / bps comorbid psychiatric , chronic pain , and autonomic disorders have been described previously.3,4 examination of the interstitial cystitis database suggests significant overlap of ic / bps with other pain areas , including lower back , pelvic , and abdominal pain in 60%80% of subjects.5 the presence of headache , abdominal pain , tachycardia , panic attacks , dry eyes and mouth , heat intolerance , and cold - sensitive fingers and toes suggests increased sympathetic activity in ic / bps.3,6,7 studies investigating autonomic function in ic / bps identified the presence of abnormal vasomotor tone,810 increased bladder sympathetic neuron density,6,11 and increased urine norepinephrine excretion.12 stress response is partially explored in chronic pain disorders like ic / bps . prior provocative testing was restricted to physical stressors , though the stress response system behaves differently when activated by physical or psychosocial stressors.13 moreover , disease activity at testing is generally not reported , further complicating interpretation . in feline ic / bps , sympathetic outflow increases1416 while the hypothalamic pituitary adrenal axis does not respond to external threat.17 sympathetic nervous system outflow may become exaggerated since adrenocortical hormone activity normally restrains sympathetic nervous system outflow.3,18 adrenocorticotropic hormone concentrations appear to decline during the stress of an ic / bps flare in women3 and in men with chronic pelvic pain syndrome.19 lutgendorf et al15 found that although mean urinary or salivary cortisol did not differ between women with ic / bps and controls , subjects with higher morning cortisol had significantly less pain and urgency and those with higher urinary free cortisol reported less overall symptomatology ( p<0.05 ) . thus , information to date suggests correlation between lower circulating cortisol concentration , higher sympathetic nervous system outflow , and higher pain levels . the study aims to define autonomic , psychological , and other ic / bps comorbid disorders , evaluate associated changes in autonomic and sensory nervous system structure and function , and characterize stress response physiology . this paper describes the study design and feasibility in a population that is difficult to research in adequate number.20", "developed initially by a core group of investigators , the protocols utilized in icepac evolved in the first year of the study through the guidance of an advisory board with expertise in each of the fields encompassed in this complex interdisciplinary effort . the board meets annually to review study progress , advise the investigators , and serves as the data safety and monitoring board . icepac plans to enroll 228 women aged 1880 years : 76 ic / bps subjects , 76 mpp subjects , 38 family member subjects ( female siblings / parents / children of ic / bps patients ) , and 38 healthy controls . the mpp group was selected to determine if findings are specific to ic / bps or occur with other pelvic pain syndromes . ic / bps was defined by at least 6 months of urgency , frequency , and bladder pain clearly linked to bladder filling and emptying . mpp was defined by at least 3 months of chronic pelvic pain unrelated to bladder state and a minimum of two of five pelvic floor tender points scoring > 4/10 on a numeric rating scale ( nrs ) when examined applying 2 kg pressure with the index finger . the differing pain durations for subjects to be classified as ic / bps or mpp , though not optimally comparable , are required for two reasons : 1 ) these durations reflect the current definitions found in the literature , and 2 ) subjects with mpp often become diagnosed and treated , effectively reducing pain burden , before 6 months have elapsed leading to recruitment difficulties if mpp inclusion requires 6 months of recent pain . family members of ic / bps subjects are excluded if they have any history of ic / bps , mpp , or chronic pelvic pain as they would then be indistinguishable from subjects with pelvic pain . healthy controls must have no history , symptoms or signs of fibromyalgia , chronic fatigue syndrome , ic / bps , mpp , chronic pelvic pain , migraine headache , or any other putative ic / bps comorbid disorders and be age matched to within 3 years of an ic / bps subject . general exclusion criteria include : attempted , recent , or existing pregnancy , recurrent urinary tract infections in the last 12 months , pelvic or bladder neoplasm , major organ impairment , uncontrolled illness or unstable medical disorder , central or peripheral nervous system disorder associated with its own confounding autonomic and neurologic findings , drug / medical device or noninvasive treatment initiation ( eg , bladder instillation , pelvic floor therapy ) within 30 days , major surgical intervention ( eg , cystoplasty , sacral neuromodulation therapy ) within 120 days , use of hormones ( except insulin , thyroid replacement , or oral contraceptives ) , opioid medications or allergy to bupivacaine , inability to stop all autonomic and gastrointestinal motility modifying agents prior to testing , any condition impairing ability to consent and comply with study procedures , or math / speech / needle phobia . all subjects sign an informed consent prior to undergoing any study procedures in accordance with the institutional review board of university hospitals case medical center in cleveland , oh , usa . the study administration is handled by the principal investigator ( pi ) , co - pi , and project manager . five satellite locations are used to screen and refer patients . to further increase recruitment , subcontracts were developed with summa health systems ( akron , oh , usa ) and the university of toledo medical center ( toledo , oh , usa ) to allow recruitment from other hospital systems located in the region . with a diverse group of investigators performing the screening visit , it was necessary to standardize the examination to eliminate procedural bias . a total of four independent screening examinations were performed with each investigator ; the first two conducted by the icepac study pi while the trained investigator observed . after observing two examinations , this process took place on four different days and with four different patients to establish examiner consistency . additional rigor is brought to subject selection by requiring a structured screening examination , even if the referral came from a study investigator trained to perform the visit . a customized filemaker pro ( filemaker , inc . , santa clara , ca , usa ) , password protected database ( figure 1 ) resides on an encrypted network at the medical center . research assistants ( ra ) perform real - time entry of all registration , visit , and testing data that is internally validated and stored in the database . the icepac online survey system , developed specifically for this study , allows subjects to enter questionnaire responses into the database . the ra monitors responses in real time at a different terminal to validate subject response patterns , speed , and subject attention . data are stored in the icepac research database and the icepac online survey system is backed up daily . data stored within the two systems can be exported and analyzed using the desired analytic software package . completion is anticipated in early 2015 with enrollment through december 2012 depicted in figure 2 . subjects may contact icepac study staff or give permission for study staff to contact them and schedule a screening visit ( visit 0 ) . in the first year , a steady referral volume originated from a bimonthly interdisciplinary pelvic pain clinic , structured so that appropriate interested subjects could be consented , enrolled , and have their screening visit performed that day . mothers , sisters , and daughters accompanying study subjects to their visits are directly solicited . in addition to flyers at satellite clinics and postings in internal university / hospital communications , the study is listed on researchmatch.com and clinicaltrials.gov . investigators also guest lecture at regional ic support group meetings throughout northeast and central ohio . for example , initial inclusion criteria excluded mpp from the ic / bps group and excluded ic / bps from the mpp group to enable clean comparisons . the advisory board was concerned about recruitment and how realistic it might be to find patients with ic / bps who did not have mpp and recommended that the ic / bps group be allowed to have comorbid mpp , while keeping the mpp group clean ( without ic / bps ) . enrollment ( not completed subjects ) of the ic / bps group through december 2012 numbers 37 , of whom 25 also have mpp . had this change not been implemented , only twelve subjects would be enrolled while 25 would have been excluded . after informed consent , the initial standard medical evaluation includes a medical history , physical exam , pregnancy , and urine dipstick tests . physical evaluation includes height , weight , lying and standing blood pressure and heart rate , body temperature , and body mass index . an ra leads each visit to ensure direct , in - person contact between clinical and study personnel.21 once the above information is obtained , a study investigator reviews subject information and performs a routine physical examination of the head , eyes , ears , nose , throat , heart , lungs , extremities , and abdomen and assesses neurologic function . particular attention is paid to any neurologic findings ( eg , neuropathy , parkinsonian features ) that would require exclusion . . figures 3 and 4 show the locations of points examined for tenderness over the abdominal musculature , the inguinal ligaments , adductor muscles , and the pelvic floor musculature . the abdomen , inguinal region , and adductors are examined by applying 3 kg of force using an algometer ( model fdn-50 ; wagner instruments , greenwich , ct , usa ) . both the force associated with the first pain experience and a pain score ( nrs : 010 ) at 3 kg ( or the maximum tolerated force ) are recorded . pelvic floor muscle examination is done using 2 kg finger pressure where the study investigator standardizes the pressure applied by the digit with the algometer prior to starting the examination . the vulvodynia examination involves moving a lubricated cotton - tipped applicator back and forth inside the vagina ( reported as a pressure or pain sensation ) followed by a standard six - point assessment of the vulvar mucosa . the subject is oriented to the sensation of pin and cotton on the thigh and asked to determine whether similar contact on the vulva is experienced as pin or cotton and to rank any pain on an nrs of 010 . a diagnosis of vulvodynia requires three or more points ranked at a pain nrs of four or more . the fibromyalgia examination is conducted per american college of rheumatology criteria22 using 4 kg of pressure applied by the thumb standardized against the pressure algometer at standard sites . the fibromyalgia examination is conducted at visit 0 only for healthy controls as fibromyalgia is exclusionary for healthy controls and at visit 2 for ic / bps , mpp , and family members . the ra records the subject pain ratings and study investigator comments pertaining to the examination . based on history , examination , and referring physician records , subjects are grouped as ic / bps mpp , mpp alone , or healthy subject . if the subject qualifies for the study , the ra schedules additional study visits and the subject is sent home with a urine hat and 24-hour voiding diary to be completed before her next visit . study ineligibility may lead to one of two actions : 1 ) the subject may qualify at a later date ( ie , if subject had a recent procedure that requires a specific delay before enrollment ) , and will be contacted to return at the appropriate time ; or 2 ) subject will be excluded from the study indefinitely . subjects arrive with their completed 24-hour voiding diary having not voided in the prior hour . subjects use a portable computer to complete the psychological and ohio dysautonomia ( odysa ) questionnaires40 on the icepac online survey system while the ra monitors progress and validates responses . the questionnaires listed in table 2 are administered in random order to neutralize any questionnaire order effect with the exception of the odysa , which is given last due to its length . the odysa questionnaire was developed over the last several years to query for the presence of symptoms suggestive of comorbid disorders such as chronic fatigue syndrome , fibromyalgia , raynaud s syndrome , complex regional pain syndrome , migraine headache , irritable bowel syndrome , cyclic vomiting syndrome , functional dyspepsia , syncope , and orthostatic intolerance . subjects are informed that they are not required to answer all questions and may skip questions should they feel uncomfortable for any reason . the ra will verify missing questionnaire data with the subject to determine whether omission was intentional before proceeding forward with the study visit . visit 1 also includes a 20 ml bladder instillation of a 0.75% bupivacaine solution performed on ic / bps and mpp subjects only . the local anesthetic solution is prepared by the university hospitals research pharmacy ( university hospitals , cleveland , oh , usa ) and dropped off at the procedure location . since the intent of this procedure is to relate the change in bladder function to local anesthetic induced change in afferent processing , subjects undergo a baseline bladder ultrasound and uroflow ( flopoint elite ; verathon , bothell , wa , usa ) measurement so that pre- and post - procedure volumes can be matched as closely as possible for an apples to apples prior to receiving the bladder instillation , the investigator cleans the subject s urethra with three benzalkonium chloride swabsticks ( aplicare , inc . , meriden , ct , usa ) , and then inserts a lubricated 8f pediatric catheter ( c.r . , murray hill , nj , usa ) . the subject is asked to hold the solution in the bladder for a minimum of 60 minutes if possible . subjects are asked to give pain ratings pre- and post - instillation . while waiting to void , subjects are given water to drink and the odysa questionnaire to complete . after 60 minutes of holding the solution , bladder volume is determined via ultrasound for comparison to the baseline volume reading . if the volume is reduced compared to baseline , more water is given and the bladder is subjected to ultrasound again after a suitable period of time has elapsed . once the volume is approximately equal to that of the baseline recording ( 10% ) , a final uroflow is performed . subjects who received an instillation are given a 3-day voiding diary to return at the final study visit and reminded which medications must be stopped prior to their next visit . at this visit , the investigator reviews medications the subject will need to temporarily discontinue / halt prior to the autonomic testing study visit ( visit 2 ) . autonomic testing includes the cardiac responses to deep breathing and to the valsalva maneuver , the post - ganglionic quantitative sudomotor axon reflex test , and a tilt table test . ras complete all autonomic nervous system testing with a trained investigator required only during the tilt table test . the methods of the autonomic nervous system laboratory have been previously described23 and will be reiterated here in brief . the cardiac response to deep breathing is a fairly pure measure of pulmonary afferent stretch receptor and cardiac parasympathetic efferent activities.24 the subject takes six full breaths per minute for 1 minute while an electrocardiogram records heart rate . the difference between inspiration ( higher heart rate ) and expiration ( lower heart rate ) is averaged for the five best breaths and compared to age - based norms . the valsalva maneuver is performed by asking the subject to blow against a pressure gauge holding 40 mmhg for 15 seconds with an open glottis ( insured by a small leak in the connecting tubing ) while continuous blood pressure , measured by digital plethysmography ( nexfin monitor model 1 ; bmeye b.v . , amsterdam , the netherlands ) , and heart rate are recorded . measurements include the highest heart rate at the end of the pressure holding period ( phase ii ) reflecting cardiac sympathetic function , the lowest heart rate after release ( phase iv ) reflecting cardiac parasympathetic function , and maintenance of diastolic pressure throughout phase ii reflecting vasomotor sympathetic function . age - based norms are expressed as a ratio of the highest to lowest heart rates ( valsalva ratio ) . the tilt - table test requires the subject to remain inclined at 70 degrees for 30 minutes preceded and followed by baseline blood pressure and heart rate readings taken each minute for 510 minutes . the subject is asked every few minutes for any standard orthostatic symptoms such as lightheadedness , nausea , diaphoresis , blurred or darkening vision , and fatigue , ranked on a nrs from 010 . tilt results are interpreted as either normal , showing orthostatic hypotension ( > 20 mmhg systolic or > 10 mmhg diastolic blood pressure drop in the first 3 minutes of tilt ) , postural tachycardia syndrome ( > 30 beats per minute ( bpm ) rise in heart rate in the first 10 minutes of tilt in the presence of orthostatic symptoms and in the absence of a drop in blood pressure ) , or reflex syncope ( an abrupt drop in pressure usually accompanied by a drop in heart rate that would have led to loss of consciousness had the subject not been reclined ) . the heart rate record is also analyzed for heart rate variability . during the tilt test , the gastric electrical activity ( polygram net analysis package ; medtronic , minneapolis , mn , usa ) is recorded for 10 minutes with the patient in the supine position and then during the 30 minutes of head - up tilt . the quantitative sudomotor axon reflex test provides a specific measure of cholinergic sympathetic efferent small fiber function . in brief , a battery sourced current is driven for 5 minutes across a 10% solution of acetylcholine located in the outer chamber of a dual - chambered capsule applied to the skin . sweat rate is detected through the change in humidity in the inner chamber of the same capsule . since each sudomotor nerve innervates multiple sweat glands , the axon stimulated by the acetylcholine iontophoresis signals the other sweat glands and results in sweat output into the inner chamber.25 the remainder of visit 2 is performed in a standard examination room . a water load test26 is administered , which consists of recording the maximal volume of water a subject can consume in 5 minutes with comparison to normal values . subjects classified as ic / bps , mpp , or family members then undergo a fibromyalgia examination based on the 1990 american college of rheumatology22 criteria , checking the 18 standard tender points applying 4 kg of pressure with the thumb , calibrated using an algometer every fourth point . an examination of the extremities ( small fiber score ) looking for generalized small ( and large ) fiber peripheral nerve dysfunction is performed assessing pin , temperature , vibration sensation , superficial and deep allodynia , distal muscle strength , and reflexes ( figure 5 ) . a pelvic neurologic examination27 is performed to evaluate dermatomes t12 , l1 , l2 , s1 , s2 , s3 , s4 , and s5 for pin prick and vibration sensations . subjects are compensated for their time and offered participation in other icepac substudies such as the trier social stress test study28 or an icepac sleep study investigating sleep disorders in women with ic / bps .", "icepac plans to enroll 228 women aged 1880 years : 76 ic / bps subjects , 76 mpp subjects , 38 family member subjects ( female siblings / parents / children of ic / bps patients ) , and 38 healthy controls . the mpp group was selected to determine if findings are specific to ic / bps or occur with other pelvic pain syndromes . ic / bps was defined by at least 6 months of urgency , frequency , and bladder pain clearly linked to bladder filling and emptying . mpp was defined by at least 3 months of chronic pelvic pain unrelated to bladder state and a minimum of two of five pelvic floor tender points scoring > 4/10 on a numeric rating scale ( nrs ) when examined applying 2 kg pressure with the index finger . the differing pain durations for subjects to be classified as ic / bps or mpp , though not optimally comparable , are required for two reasons : 1 ) these durations reflect the current definitions found in the literature , and 2 ) subjects with mpp often become diagnosed and treated , effectively reducing pain burden , before 6 months have elapsed leading to recruitment difficulties if mpp inclusion requires 6 months of recent pain . family members of ic / bps subjects are excluded if they have any history of ic / bps , mpp , or chronic pelvic pain as they would then be indistinguishable from subjects with pelvic pain . healthy controls must have no history , symptoms or signs of fibromyalgia , chronic fatigue syndrome , ic / bps , mpp , chronic pelvic pain , migraine headache , or any other putative ic / bps comorbid disorders and be age matched to within 3 years of an ic / bps subject . general exclusion criteria include : attempted , recent , or existing pregnancy , recurrent urinary tract infections in the last 12 months , pelvic or bladder neoplasm , major organ impairment , uncontrolled illness or unstable medical disorder , central or peripheral nervous system disorder associated with its own confounding autonomic and neurologic findings , drug / medical device or noninvasive treatment initiation ( eg , bladder instillation , pelvic floor therapy ) within 30 days , major surgical intervention ( eg , cystoplasty , sacral neuromodulation therapy ) within 120 days , use of hormones ( except insulin , thyroid replacement , or oral contraceptives ) , opioid medications or allergy to bupivacaine , inability to stop all autonomic and gastrointestinal motility modifying agents prior to testing , any condition impairing ability to consent and comply with study procedures , or math / speech / needle phobia . all subjects sign an informed consent prior to undergoing any study procedures in accordance with the institutional review board of university hospitals case medical center in cleveland , oh , usa .", "the study administration is handled by the principal investigator ( pi ) , co - pi , and project manager . five satellite locations are used to screen and refer patients . to further increase recruitment , subcontracts were developed with summa health systems ( akron , oh , usa ) and the university of toledo medical center ( toledo , oh , usa ) to allow recruitment from other hospital systems located in the region . with a diverse group of investigators performing the screening visit , it was necessary to standardize the examination to eliminate procedural bias . a total of four independent screening examinations were performed with each investigator ; the first two conducted by the icepac study pi while the trained investigator observed . after observing this process took place on four different days and with four different patients to establish examiner consistency . additional rigor is brought to subject selection by requiring a structured screening examination , even if the referral came from a study investigator trained to perform the visit .", "ca , usa ) , password protected database ( figure 1 ) resides on an encrypted network at the medical center . research assistants ( ra ) perform real - time entry of all registration , visit , and testing data that is internally validated and stored in the database . the icepac online survey system , developed specifically for this study , allows subjects to enter questionnaire responses into the database . the ra monitors responses in real time at a different terminal to validate subject response patterns , speed , and subject attention . data are stored in the icepac research database and the icepac online survey system is backed up daily . data stored within the two systems can be exported and analyzed using the desired analytic software package .", "completion is anticipated in early 2015 with enrollment through december 2012 depicted in figure 2 . subjects may contact icepac study staff or give permission for study staff to contact them and schedule a screening visit ( visit 0 ) . in the first year , a steady referral volume originated from a bimonthly interdisciplinary pelvic pain clinic , structured so that appropriate interested subjects could be consented , enrolled , and have their screening visit performed that day . mothers , sisters , and daughters accompanying study subjects to their visits are directly solicited . in addition to flyers at satellite clinics and postings in internal university / hospital communications , the study is listed on researchmatch.com and clinicaltrials.gov . investigators also guest lecture at regional ic support group meetings throughout northeast and central ohio . for example , initial inclusion criteria excluded mpp from the ic / bps group and excluded ic / bps from the mpp group to enable clean comparisons . the advisory board was concerned about recruitment and how realistic it might be to find patients with ic / bps who did not have mpp and recommended that the ic / bps group be allowed to have comorbid mpp , while keeping the mpp group clean ( without ic / bps ) . enrollment ( not completed subjects ) of the ic / bps group through december 2012 numbers 37 , of whom 25 also have mpp . had this change not been implemented , only twelve subjects would be enrolled while 25 would have been excluded .", "after informed consent , the initial standard medical evaluation includes a medical history , physical exam , pregnancy , and urine dipstick tests . physical evaluation includes height , weight , lying and standing blood pressure and heart rate , body temperature , and body mass index . an ra leads each visit to ensure direct , in - person contact between clinical and study personnel.21 once the above information is obtained , a study investigator reviews subject information and performs a routine physical examination of the head , eyes , ears , nose , throat , heart , lungs , extremities , and abdomen and assesses neurologic function . particular attention is paid to any neurologic findings ( eg , neuropathy , parkinsonian features ) that would require exclusion . . figures 3 and 4 show the locations of points examined for tenderness over the abdominal musculature , the inguinal ligaments , adductor muscles , and the pelvic floor musculature . the abdomen , inguinal region , and adductors are examined by applying 3 kg of force using an algometer ( model fdn-50 ; wagner instruments , greenwich , ct , usa ) . both the force associated with the first pain experience and a pain score ( nrs : 010 ) at 3 kg ( or the maximum tolerated force ) are recorded . pelvic floor muscle examination is done using 2 kg finger pressure where the study investigator standardizes the pressure applied by the digit with the algometer prior to starting the examination . the vulvodynia examination involves moving a lubricated cotton - tipped applicator back and forth inside the vagina ( reported as a pressure or pain sensation ) followed by a standard six - point assessment of the vulvar mucosa . the subject is oriented to the sensation of pin and cotton on the thigh and asked to determine whether similar contact on the vulva is experienced as pin or cotton and to rank any pain on an nrs of 010 . a diagnosis of vulvodynia requires three or more points ranked at a pain nrs of four or more . the fibromyalgia examination is conducted per american college of rheumatology criteria22 using 4 kg of pressure applied by the thumb standardized against the pressure algometer at standard sites . the fibromyalgia examination is conducted at visit 0 only for healthy controls as fibromyalgia is exclusionary for healthy controls and at visit 2 for ic / bps , mpp , and family members . the ra records the subject pain ratings and study investigator comments pertaining to the examination . based on history , examination , and referring physician records , subjects are grouped as ic / bps mpp , mpp alone , or healthy subject . if the subject qualifies for the study , the ra schedules additional study visits and the subject is sent home with a urine hat and 24-hour voiding diary to be completed before her next visit . study ineligibility may lead to one of two actions : 1 ) the subject may qualify at a later date ( ie , if subject had a recent procedure that requires a specific delay before enrollment ) , and will be contacted to return at the appropriate time ; or 2 ) subject will be excluded from the study indefinitely . subjects arrive with their completed 24-hour voiding diary having not voided in the prior hour . subjects use a portable computer to complete the psychological and ohio dysautonomia ( odysa ) questionnaires40 on the icepac online survey system while the ra monitors progress and validates responses . the questionnaires listed in table 2 are administered in random order to neutralize any questionnaire order effect with the exception of the odysa , which is given last due to its length . the odysa questionnaire was developed over the last several years to query for the presence of symptoms suggestive of comorbid disorders such as chronic fatigue syndrome , fibromyalgia , raynaud s syndrome , complex regional pain syndrome , migraine headache , irritable bowel syndrome , cyclic vomiting syndrome , functional dyspepsia , syncope , and orthostatic intolerance . subjects are informed that they are not required to answer all questions and may skip questions should they feel uncomfortable for any reason . the ra will verify missing questionnaire data with the subject to determine whether omission was intentional before proceeding forward with the study visit . visit 1 also includes a 20 ml bladder instillation of a 0.75% bupivacaine solution performed on ic / bps and mpp subjects only . the local anesthetic solution is prepared by the university hospitals research pharmacy ( university hospitals , cleveland , oh , usa ) and dropped off at the procedure location . since the intent of this procedure is to relate the change in bladder function to local anesthetic induced change in afferent processing , subjects undergo a baseline bladder ultrasound and uroflow ( flopoint elite ; verathon , bothell , wa , usa ) measurement so that pre- and post - procedure volumes can be matched as closely as possible for an apples to apples comparison of detrusor and sphincter functions . prior to receiving the bladder instillation , the investigator cleans the subject s urethra with three benzalkonium chloride swabsticks ( aplicare , inc . , meriden , ct , usa ) , and then inserts a lubricated 8f pediatric catheter ( c.r . the subject is asked to hold the solution in the bladder for a minimum of 60 minutes if possible . subjects are asked to give pain ratings pre- and post - instillation . while waiting to void , subjects are given water to drink and the odysa questionnaire to complete . after 60 minutes of holding the solution , bladder volume is determined via ultrasound for comparison to the baseline volume reading . if the volume is reduced compared to baseline , more water is given and the bladder is subjected to ultrasound again after a suitable period of time has elapsed . once the volume is approximately equal to that of the baseline recording ( 10% ) , a final uroflow is performed . subjects who received an instillation are given a 3-day voiding diary to return at the final study visit and reminded which medications must be stopped prior to their next visit . at this visit , the investigator reviews medications the subject will need to temporarily discontinue / halt prior to the autonomic testing study visit ( visit 2 ) . autonomic testing includes the cardiac responses to deep breathing and to the valsalva maneuver , the post - ganglionic quantitative sudomotor axon reflex test , and a tilt table test . ras complete all autonomic nervous system testing with a trained investigator required only during the tilt table test . the methods of the autonomic nervous system laboratory have been previously described23 and will be reiterated here in brief . the cardiac response to deep breathing is a fairly pure measure of pulmonary afferent stretch receptor and cardiac parasympathetic efferent activities.24 the subject takes six full breaths per minute for 1 minute while an electrocardiogram records heart rate . the difference between inspiration ( higher heart rate ) and expiration ( lower heart rate ) is averaged for the five best breaths and compared to age - based norms . the valsalva maneuver is performed by asking the subject to blow against a pressure gauge holding 40 mmhg for 15 seconds with an open glottis ( insured by a small leak in the connecting tubing ) while continuous blood pressure , measured by digital plethysmography ( nexfin monitor model 1 ; bmeye b.v . measurements include the highest heart rate at the end of the pressure holding period ( phase ii ) reflecting cardiac sympathetic function , the lowest heart rate after release ( phase iv ) reflecting cardiac parasympathetic function , and maintenance of diastolic pressure throughout phase ii reflecting vasomotor sympathetic function . age - based norms are expressed as a ratio of the highest to lowest heart rates ( valsalva ratio ) . the tilt - table test requires the subject to remain inclined at 70 degrees for 30 minutes preceded and followed by baseline blood pressure and heart rate readings taken each minute for 510 minutes . the subject is asked every few minutes for any standard orthostatic symptoms such as lightheadedness , nausea , diaphoresis , blurred or darkening vision , and fatigue , ranked on a nrs from 010 . tilt results are interpreted as either normal , showing orthostatic hypotension ( > 20 mmhg systolic or > 10 mmhg diastolic blood pressure drop in the first 3 minutes of tilt ) , postural tachycardia syndrome ( > 30 beats per minute ( bpm ) rise in heart rate in the first 10 minutes of tilt in the presence of orthostatic symptoms and in the absence of a drop in blood pressure ) , or reflex syncope ( an abrupt drop in pressure usually accompanied by a drop in heart rate that would have led to loss of consciousness had the subject not been reclined ) . the heart rate record is also analyzed for heart rate variability . during the tilt test , the gastric electrical activity ( polygram net analysis package ; medtronic , minneapolis , mn , usa ) is recorded for 10 minutes with the patient in the supine position and then during the 30 minutes of head - up tilt . the quantitative sudomotor axon reflex test provides a specific measure of cholinergic sympathetic efferent small fiber function . in brief , a battery sourced current is driven for 5 minutes across a 10% solution of acetylcholine located in the outer chamber of a dual - chambered capsule applied to the skin . sweat rate is detected through the change in humidity in the inner chamber of the same capsule . since each sudomotor nerve innervates multiple sweat glands , the axon stimulated by the acetylcholine iontophoresis signals the other sweat glands and results in sweat output into the inner chamber.25 the remainder of visit 2 is performed in a standard examination room . a water load test26 is administered , which consists of recording the maximal volume of water a subject can consume in 5 minutes with comparison to normal values . subjects classified as ic / bps , mpp , or family members then undergo a fibromyalgia examination based on the 1990 american college of rheumatology22 criteria , checking the 18 standard tender points applying 4 kg of pressure with the thumb , calibrated using an algometer every fourth point . an examination of the extremities ( small fiber score ) looking for generalized small ( and large ) fiber peripheral nerve dysfunction is performed assessing pin , temperature , vibration sensation , superficial and deep allodynia , distal muscle strength , and reflexes ( figure 5 ) . a pelvic neurologic examination27 is performed to evaluate dermatomes t12 , l1 , l2 , s1 , s2 , s3 , s4 , and s5 for pin prick and vibration sensations . subjects are compensated for their time and offered participation in other icepac substudies such as the trier social stress test study28 or an icepac sleep study investigating sleep disorders in women with ic / bps .", "after informed consent , the initial standard medical evaluation includes a medical history , physical exam , pregnancy , and urine dipstick tests . physical evaluation includes height , weight , lying and standing blood pressure and heart rate , body temperature , and body mass index . an ra leads each visit to ensure direct , in - person contact between clinical and study personnel.21 once the above information is obtained , a study investigator reviews subject information and performs a routine physical examination of the head , eyes , ears , nose , throat , heart , lungs , extremities , and abdomen and assesses neurologic function . particular attention is paid to any neurologic findings ( eg , neuropathy , parkinsonian features ) that would require exclusion . . figures 3 and 4 show the locations of points examined for tenderness over the abdominal musculature , the inguinal ligaments , adductor muscles , and the pelvic floor musculature . the abdomen , inguinal region , and adductors are examined by applying 3 kg of force using an algometer ( model fdn-50 ; wagner instruments , greenwich , ct , usa ) . both the force associated with the first pain experience and a pain score ( nrs : 010 ) at 3 kg ( or the maximum tolerated force ) are recorded . pelvic floor muscle examination is done using 2 kg finger pressure where the study investigator standardizes the pressure applied by the digit with the algometer prior to starting the examination . the vulvodynia examination involves moving a lubricated cotton - tipped applicator back and forth inside the vagina ( reported as a pressure or pain sensation ) followed by a standard six - point assessment of the vulvar mucosa . the subject is oriented to the sensation of pin and cotton on the thigh and asked to determine whether similar contact on the vulva is experienced as pin or cotton and to rank any pain on an nrs of 010 . a diagnosis of vulvodynia requires three or more points ranked at a pain nrs of four or more . the fibromyalgia examination is conducted per american college of rheumatology criteria22 using 4 kg of pressure applied by the thumb standardized against the pressure algometer at standard sites . the fibromyalgia examination is conducted at visit 0 only for healthy controls as fibromyalgia is exclusionary for healthy controls and at visit 2 for ic / bps , mpp , and family members . the ra records the subject pain ratings and study investigator comments pertaining to the examination . based on history , examination , and referring physician records , subjects are grouped as ic / bps mpp , mpp alone , or healthy subject . if the subject qualifies for the study , the ra schedules additional study visits and the subject is sent home with a urine hat and 24-hour voiding diary to be completed before her next visit . study ineligibility may lead to one of two actions : 1 ) the subject may qualify at a later date ( ie , if subject had a recent procedure that requires a specific delay before enrollment ) , and will be contacted to return at the appropriate time ; or 2 ) subject will be excluded from the study indefinitely .", "subjects arrive with their completed 24-hour voiding diary having not voided in the prior hour . subjects use a portable computer to complete the psychological and ohio dysautonomia ( odysa ) questionnaires40 on the icepac online survey system while the ra monitors progress and validates responses . the questionnaires listed in table 2 are administered in random order to neutralize any questionnaire order effect with the exception of the odysa , which is given last due to its length . the odysa questionnaire was developed over the last several years to query for the presence of symptoms suggestive of comorbid disorders such as chronic fatigue syndrome , fibromyalgia , raynaud s syndrome , complex regional pain syndrome , migraine headache , irritable bowel syndrome , cyclic vomiting syndrome , functional dyspepsia , syncope , and orthostatic intolerance . subjects are informed that they are not required to answer all questions and may skip questions should they feel uncomfortable for any reason . the ra will verify missing questionnaire data with the subject to determine whether omission was intentional before proceeding forward with the study visit . visit 1 also includes a 20 ml bladder instillation of a 0.75% bupivacaine solution performed on ic / bps and mpp subjects only . the local anesthetic solution is prepared by the university hospitals research pharmacy ( university hospitals , cleveland , oh , usa ) and dropped off at the procedure location . since the intent of this procedure is to relate the change in bladder function to local anesthetic induced change in afferent processing , subjects undergo a baseline bladder ultrasound and uroflow ( flopoint elite ; verathon , bothell , wa , usa ) measurement so that pre- and post - procedure volumes can be matched as closely as possible for an apples to apples comparison of detrusor and sphincter functions . prior to receiving the bladder instillation , the investigator cleans the subject s urethra with three benzalkonium chloride swabsticks ( aplicare , inc . , meriden , ct , usa ) , and then inserts a lubricated 8f pediatric catheter ( c.r . , murray hill , nj , usa ) . the subject is asked to hold the solution in the bladder for a minimum of 60 minutes if possible . subjects are asked to give pain ratings pre- and post - instillation . while waiting to void , subjects are given water to drink and the odysa questionnaire to complete . after 60 minutes of holding the solution , bladder volume is determined via ultrasound for comparison to the baseline volume reading . if the volume is reduced compared to baseline , more water is given and the bladder is subjected to ultrasound again after a suitable period of time has elapsed . once the volume is approximately equal to that of the baseline recording ( 10% ) , a final uroflow is performed . subjects who received an instillation are given a 3-day voiding diary to return at the final study visit and reminded which medications must be stopped prior to their next visit . at this visit , the investigator reviews medications the subject will need to temporarily discontinue / halt prior to the autonomic testing study visit ( visit 2 ) .", "autonomic testing includes the cardiac responses to deep breathing and to the valsalva maneuver , the post - ganglionic quantitative sudomotor axon reflex test , and a tilt table test . ras complete all autonomic nervous system testing with a trained investigator required only during the tilt table test . the methods of the autonomic nervous system laboratory have been previously described23 and will be reiterated here in brief . the cardiac response to deep breathing is a fairly pure measure of pulmonary afferent stretch receptor and cardiac parasympathetic efferent activities.24 the subject takes six full breaths per minute for 1 minute while an electrocardiogram records heart rate . the difference between inspiration ( higher heart rate ) and expiration ( lower heart rate ) is averaged for the five best breaths and compared to age - based norms . the valsalva maneuver is performed by asking the subject to blow against a pressure gauge holding 40 mmhg for 15 seconds with an open glottis ( insured by a small leak in the connecting tubing ) while continuous blood pressure , measured by digital plethysmography ( nexfin monitor model 1 ; bmeye b.v . , measurements include the highest heart rate at the end of the pressure holding period ( phase ii ) reflecting cardiac sympathetic function , the lowest heart rate after release ( phase iv ) reflecting cardiac parasympathetic function , and maintenance of diastolic pressure throughout phase ii reflecting vasomotor sympathetic function . age - based norms are expressed as a ratio of the highest to lowest heart rates ( valsalva ratio ) . the tilt - table test requires the subject to remain inclined at 70 degrees for 30 minutes preceded and followed by baseline blood pressure and heart rate readings taken each minute for 510 minutes . the subject is asked every few minutes for any standard orthostatic symptoms such as lightheadedness , nausea , diaphoresis , blurred or darkening vision , and fatigue , ranked on a nrs from 010 . tilt results are interpreted as either normal , showing orthostatic hypotension ( > 20 mmhg systolic or > 10 mmhg diastolic blood pressure drop in the first 3 minutes of tilt ) , postural tachycardia syndrome ( > 30 beats per minute ( bpm ) rise in heart rate in the first 10 minutes of tilt in the presence of orthostatic symptoms and in the absence of a drop in blood pressure ) , or reflex syncope ( an abrupt drop in pressure usually accompanied by a drop in heart rate that would have led to loss of consciousness had the subject not been reclined ) . the heart rate record is also analyzed for heart rate variability . during the tilt test , the gastric electrical activity ( polygram net analysis package ; medtronic , minneapolis , mn , usa ) is recorded for 10 minutes with the patient in the supine position and then during the 30 minutes of head - up tilt . the quantitative sudomotor axon reflex test provides a specific measure of cholinergic sympathetic efferent small fiber function . in brief , a battery sourced current is driven for 5 minutes across a 10% solution of acetylcholine located in the outer chamber of a dual - chambered capsule applied to the skin . sweat rate is detected through the change in humidity in the inner chamber of the same capsule . since each sudomotor nerve innervates multiple sweat glands , the axon stimulated by the acetylcholine iontophoresis signals the other sweat glands and results in sweat output into the inner chamber.25 the remainder of visit 2 is performed in a standard examination room . a water load test26 is administered , which consists of recording the maximal volume of water a subject can consume in 5 minutes with comparison to normal values . subjects classified as ic / bps , mpp , or family members then undergo a fibromyalgia examination based on the 1990 american college of rheumatology22 criteria , checking the 18 standard tender points applying 4 kg of pressure with the thumb , calibrated using an algometer every fourth point . an examination of the extremities ( small fiber score ) looking for generalized small ( and large ) fiber peripheral nerve dysfunction is performed assessing pin , temperature , vibration sensation , superficial and deep allodynia , distal muscle strength , and reflexes ( figure 5 ) . a pelvic neurologic examination27 is performed to evaluate dermatomes t12 , l1 , l2 , s1 , s2 , s3 , s4 , and s5 for pin prick and vibration sensations . subjects are compensated for their time and offered participation in other icepac substudies such as the trier social stress test study28 or an icepac sleep study investigating sleep disorders in women with ic / bps .", "as of december 2012 , data collection has been completed for 25 healthy controls , 33 ic / bps mpp , eight mpp , and three family members . initially , the pi and co - pi were the main source of referrals , but this pattern was not sustainable once clinic populations were exhausted . efforts at maintaining contact with investigators to encourage referrals have led to gradual referral growth across a broader group of referrers . study investigators are kept up - to - date on study progress through an icepac investigator newsletter , which also serves as a reminder to refer . to date , the only adverse events have been associated with the bupivacaine instillation procedure . as a result , the investigators , guided by the icepac data safety monitoring board adopted a smaller , pediatric hydrophilic catheter and , since then , no further adverse events of any type have been reported . studies involving chronic pain disorders such as ic / bps pose two very specific challenges . first , in the current era , most successful clinical translational studies on disorders involving chronic pain are interdisciplinary in design , requiring significant education , cross - training , and front - end work for the team to be successful . md , usa ) is currently funding much of the work on ic / bps through the multidisciplinary approach to the study of chronic pelvic pain ( mapp ) multisite network . second , these populations have been difficult to recruit in large numbers.20 the purpose here is to present an approach to both of these challenges for the benefit of others who are performing related studies and spell out which strategies were and were not successful . the original proposal arose from a collaboration funded by the interstitial cystitis association of america between dr buffington and dr chelimsky on the familial characteristics of ic / bps and an interdisciplinary team seeing pelvic pain patients together in a clinic setting , with a set of questions regarding these patients . disagreements on methods ( eg , the best way to examine the pelvic floor musculature ) were incorporated as questions to be answered by the grant . thus , this study is noteworthy for its true interdisciplinary nature , from conception to implementation , and there was strong investment in the grant by the research team . although such a process takes longer , the authors believe the design quality was higher , and the scientific questions posed were more clinically relevant . the board reflects the interdisciplinary composition nature of the research team and is comprised of a psychophysiologist with expertise in heart rate variability and stress responses , a pelvic pain neurologist , an urologist , a gynecologist specializing in pelvic pain and detailed vulvar examinations , a psychiatrist , and a sleep specialist . the board provided refinements to the study and helped validate that the project was capable of addressing important questions with an adequately sophisticated design . a simple issue pertained to the practicality of scheduling meetings for 20 busy surgeons and clinicians . this was initially addressed by scheduling monthly conference calls at an optimal time with topical discussions that were highly relevant and intellectually stimulating . an investigator newsletter was implemented as a means of maintaining investigator engagement and transparent communication . the collaboration of disciplines that usually do not understand each other s technical terms required significant education , with an initially steep learning curve . cross - disciplinary training for standardization of pelvic floor , neurologic , and urologic examinations conducted during study visits was completed by each investigator . this was a highly rewarding process for investigators from varied disciplines , resulting in novel questions on each area driven by an entirely fresh perspective . another set of challenges arose from sheer study size . a protocol comprised of multiple investigators from different departments and medical centers required multiple revisions in order to obtain institutional review board approval . urologists and gynecologists have different views on methodology and the relative importance of different portions of the examinations . it took several months of re - evaluations and standardization to obtain a final protocol , a feat not possible without the guidance and expertise of the icepac study advisory board members . the number of investigators , of whom consensus was required , slowed attempts to modify the study . exploration of new ideas or protocol modifications , such as assessment of sleep pattern and sleep disorder causality or measurement of stress and tight junction related cytokines in serum in subjects undergoing the trier social stress test , require more discussion and take longer to implement . as a result , however , the design is more likely to be embraced by specialists in diverse areas of medicine ( eg , urologists , gynecologists ) . the number of physicians trained to perform study visits ( which was the only way to recruit the large number of subjects proposed ) required particular attention to investigator training ( described in methods ) and protocol standardization . to this end , attention was paid to protocol scripts , and most of these were designed to be read and controlled by the ra rather than the investigator , which minimizes protocol variability . for example , semi - quantitative tuning forks29 ( us neurologicals llc , poulsbo , wa , usa ) for the assessment of vibration sensation were introduced , the temperature of the hot water stimulus was standardized to 115f , and a digital algometer ( model fdix 10 ; wagner instruments ) to standardize the force used to assess pin sensation to 0.55 n ( about 2 oz ) were implemented as part of standard operating procedure . selection of the psychological questionnaires required great care , ensuring that appropriate psychological constructs were evaluated while simultaneously limiting the time requirement burden on subjects and reducing the impact on statistical power of the number of variables employed . after extensive discussion and consideration of alternatives , the advisory board ultimately supported the selection of psychological proposed instruments . the psychological questionnaire set includes 313 questions and the odysa either 158 or 330 questions , depending on the subject s symptomatic history . though all subjects have completed the question set to date , a small number of subjects have expressed concern about questionnaire time burden . breaks are offered in the process and no time constraints are placed on subjects to complete the questionnaires . the database had to be accessible by subjects for entry but not for look - up , and specific layouts needed to remain inaccessible to some team members while accessible to others ( eg , demographic and diagnostic information needed to be blinded to the investigator to eliminate bias ) . using the filemaker server and database platform in cooperation with university hospitals information technology and solutions allowed the authors to design a database with all of these features , which may well be useful for other similar studies in the future . this level of sophistication though required the fulltime effort of a data manager for 3 years . as with all studies on pelvic pain , recruitment presents a challenge . in an effort to maintain study awareness , the pi , co - pi , and project manager visited each of the investigators to encourage active participation . investigators are invited to annual advisory board meetings to encourage a shared sense of academic participation and monthly phone conferences were conducted . advertisements were placed on several research subject recruitment websites and patient support organizations ( as outlined in the methods section ) . recruitment returns from the effort at the subject level far exceeded those from efforts at the investigator and provider level . recurrent communication with eight interested providers and potential collaborators from neighboring institutions resulted in few referrals . in contrast , promoting icepac study information to patient support groups , both regional and national , resulted in higher enrollment than referrals alone . the study utilizes the autonomic laboratory and clinic rooms for subject examinations that are also employed by patients for neurology and urology clinics . coordinating open times requires negotiation and reminders to hospital administration of the importance of the study in fostering clinical referrals . however , every effort is made to maintain an excellent working relationship with clinic staff and faculty , which results in excellent cooperation . when hospital staff turnover occurs , renewed educational efforts help replacement staff get up to speed on the study . icepac has been designed to allow careful phenotyping of subjects , which affords the novel identification of potentially important patient subgroups . the study is exploratory in nature , collecting a broad and comprehensive array of data , and its conclusions should generate specific , testable hypotheses that form the basis for future studies . moreover , icepac can be seen as a template for the study of other complex pain phenomena , such as gastrointestinal and other visceral and nonvisceral referred pain .", "as of december 2012 , data collection has been completed for 25 healthy controls , 33 ic / bps mpp , eight mpp , and three family members . initially , the pi and co - pi were the main source of referrals , but this pattern was not sustainable once clinic populations were exhausted . efforts at maintaining contact with investigators to encourage referrals have led to gradual referral growth across a broader group of referrers . study investigators are kept up - to - date on study progress through an icepac investigator newsletter , which also serves as a reminder to refer .", "to date , the only adverse events have been associated with the bupivacaine instillation procedure . as a result , the investigators , guided by the icepac data safety monitoring board adopted a smaller , pediatric hydrophilic catheter and , since then , no further adverse events of any type have been reported .", "studies involving chronic pain disorders such as ic / bps pose two very specific challenges . first , in the current era , most successful clinical translational studies on disorders involving chronic pain are interdisciplinary in design , requiring significant education , cross - training , and front - end work for the team to be successful . in fact , the national institutes of health ( bethesda , md , usa ) is currently funding much of the work on ic / bps through the multidisciplinary approach to the study of chronic pelvic pain ( mapp ) multisite network . second , these populations have been difficult to recruit in large numbers.20 the purpose here is to present an approach to both of these challenges for the benefit of others who are performing related studies and spell out which strategies were and were not successful . the original proposal arose from a collaboration funded by the interstitial cystitis association of america between dr buffington and dr chelimsky on the familial characteristics of ic / bps and an interdisciplinary team seeing pelvic pain patients together in a clinic setting , with a set of questions regarding these patients . disagreements on methods ( eg , the best way to examine the pelvic floor musculature ) were incorporated as questions to be answered by the grant . thus , this study is noteworthy for its true interdisciplinary nature , from conception to implementation , and there was strong investment in the grant by the research team . although such a process takes longer , the authors believe the design quality was higher , and the scientific questions posed were more clinically relevant . the board reflects the interdisciplinary composition nature of the research team and is comprised of a psychophysiologist with expertise in heart rate variability and stress responses , a pelvic pain neurologist , an urologist , a gynecologist specializing in pelvic pain and detailed vulvar examinations , a psychiatrist , and a sleep specialist . the board provided refinements to the study and helped validate that the project was capable of addressing important questions with an adequately sophisticated design . a simple issue pertained to the practicality of scheduling meetings for 20 busy surgeons and clinicians . this was initially addressed by scheduling monthly conference calls at an optimal time with topical discussions that were highly relevant and intellectually stimulating . an investigator newsletter was implemented as a means of maintaining investigator engagement and transparent communication . the collaboration of disciplines that usually do not understand each other s technical terms required significant education , with an initially steep learning curve . cross - disciplinary training for standardization of pelvic floor , neurologic , and urologic examinations conducted during study visits was completed by each investigator . this was a highly rewarding process for investigators from varied disciplines , resulting in novel questions on each area driven by an entirely fresh perspective . another set of challenges arose from sheer study size . a protocol comprised of multiple investigators from different departments and medical centers required multiple revisions in order to obtain institutional review board approval . urologists and gynecologists have different views on methodology and the relative importance of different portions of the examinations . it took several months of re - evaluations and standardization to obtain a final protocol , a feat not possible without the guidance and expertise of the icepac study advisory board members . the number of investigators , of whom consensus was required , slowed attempts to modify the study . exploration of new ideas or protocol modifications , such as assessment of sleep pattern and sleep disorder causality or measurement of stress and tight junction related cytokines in serum in subjects undergoing the trier social stress test , require more discussion and take longer to implement . as a result , however , the design is more likely to be embraced by specialists in diverse areas of medicine ( eg , urologists , gynecologists ) . the number of physicians trained to perform study visits ( which was the only way to recruit the large number of subjects proposed ) required particular attention to investigator training ( described in methods ) and protocol standardization . to this end , attention was paid to protocol scripts , and most of these were designed to be read and controlled by the ra rather than the investigator , which minimizes protocol variability . for example , semi - quantitative tuning forks29 ( us neurologicals llc , poulsbo , wa , usa ) for the assessment of vibration sensation were introduced , the temperature of the hot water stimulus was standardized to 115f , and a digital algometer ( model fdix 10 ; wagner instruments ) to standardize the force used to assess pin sensation to 0.55 n ( about 2 oz ) were implemented as part of standard operating procedure . selection of the psychological questionnaires required great care , ensuring that appropriate psychological constructs were evaluated while simultaneously limiting the time requirement burden on subjects and reducing the impact on statistical power of the number of variables employed . after extensive discussion and consideration of alternatives , the advisory board ultimately supported the selection of psychological proposed instruments . the psychological questionnaire set includes 313 questions and the odysa either 158 or 330 questions , depending on the subject s symptomatic history . though all subjects have completed the question set to date , a small number of subjects have expressed concern about questionnaire time burden . breaks are offered in the process and no time constraints are placed on subjects to complete the questionnaires . the database presented some informatics challenges . with current privacy regulations and concerns , the database had to be accessible by subjects for entry but not for look - up , and specific layouts needed to remain inaccessible to some team members while accessible to others ( eg , demographic and diagnostic information needed to be blinded to the investigator to eliminate bias ) . using the filemaker server and database platform in cooperation with university hospitals information technology and solutions allowed the authors to design a database with all of these features , which may well be useful for other similar studies in the future . this level of sophistication though required the fulltime effort of a data manager for 3 years . as with all studies on pelvic pain , recruitment presents a challenge . in an effort to maintain study awareness , the pi , co - pi , and project manager visited each of the investigators to encourage active participation investigators are invited to annual advisory board meetings to encourage a shared sense of academic participation and monthly phone conferences were conducted . advertisements were placed on several research subject recruitment websites and patient support organizations ( as outlined in the methods section ) . recruitment returns from the effort at the subject level far exceeded those from efforts at the investigator and provider level . recurrent communication with eight interested providers and potential collaborators from neighboring institutions resulted in few referrals . in contrast , promoting icepac study information to patient support groups , both regional and national , resulted in higher enrollment than referrals alone . the study utilizes the autonomic laboratory and clinic rooms for subject examinations that are also employed by patients for neurology and urology clinics . coordinating open times requires negotiation and reminders to hospital administration of the importance of the study in fostering clinical referrals . however , every effort is made to maintain an excellent working relationship with clinic staff and faculty , which results in excellent cooperation . when hospital staff turnover occurs , renewed educational efforts help replacement staff get up to speed on the study . icepac has been designed to allow careful phenotyping of subjects , which affords the novel identification of potentially important patient subgroups . the study is exploratory in nature , collecting a broad and comprehensive array of data , and its conclusions should generate specific , testable hypotheses that form the basis for future studies . moreover , icepac can be seen as a template for the study of other complex pain phenomena , such as gastrointestinal and other visceral and nonvisceral referred pain .", "the icepac study represents a comprehensive , interdisciplinary approach to understanding the autonomic and psychophysiologic characteristics of ic / bps . the study has proven feasible to date , although it is too early to report findings . the major obstacles have been by - products of the different perspectives and areas of expertise that a diverse group of investigators has brought , which , interestingly has also been one of the study s greatest strengths . that is , as perspectives have been shared and a common approach has been forged , each specialty has benefited by the input of the others . the investigators are hopeful that the findings of the icepac study will reflect the strength of this collaborative process ." ]

[ "noise in schools deserves special attention , as appropriate learning situations depend on good acoustic conditions . established by the brazilian association of technical standards ( abnt ) , the standard nbr 10152 recommends that noise levels in schools should not exceed 50 db sound pressure level ( spl ) and remain below that of the human voice , which is 60 db ( spl ) at normal intensity1 . in the school environment , children are exposed to several types of noise , such as external noise , environmental noise , and noise generated in the classroom . previous studies have shown that in children , noise impairs the academic performance related to memory , motivation , and reading ability2 . thus , in this environment , students can develop difficulties in writing , reading , and maintaining attention and concentration , which can result in disciplinary problems2 . the presence of noise in the communication process often causes difficulties in speech perception and high levels of stress , even in people with normal hearing3 . researchers have demonstrated that children are the most affected by background noise both in speech perception and in auditory comprehension4 . with this knowledge of the effects of noise on the learning process , it becomes necessary to measure the noise levels in the school environment in order to investigate the factors that may interfere with this process and propose educational and/or environmental modifications to minimize these adverse effects5 . high levels of background noise are common in the natural environment of children , and are a major contributing factor to learning problems . a study developed in kindergartens and schools demonstrated that children 's voices produce considerable noise levels . over an 8-hour period , the authors recorded average noise levels of 80.1 db ( a ) near the teacher 's ear and 70.87 db ( a ) in the classroom . the maximum noise level near the teacher 's ear was 112.55 db ( a ) and that in the classroom was 103.77 db ( a)7 . thus , the aim of this study was to evaluate the spl to which students are exposed in a municipal preschool .", "this study was conducted in a municipal preschool located in a suburb of the city of marlia , whose population is of low socioeconomic status . the project was first presented to the municipal secretary of education , and after receiving approval , it was carried out at the school that had agreed to the study . are 4 classrooms , the principal 's office , library , toilets and bathroons and courtyard ; there is a covered court and a cafeteria on the second block . the classrooms are constructed from concrete blocks , have ceramic - tiled floors , padded ceilings , iron doors that open to the outside , and wooden doors that open to the inner courtyard ; 2 rooms face the street and the other 2 face the park . the cafeteria walls are made of concrete blocks ; it has a plastic ceiling with acoustic treatment and a ceramic - tiled floor . the school furniture consists of iron cabinets , tables , and chairs with iron legs , and these do not occupy a fixed position in the school . the spl measurement was performed on 4 different days over a period of 8 hours per day , totaling 1920 minutes . the measurement was carried out in 2 classes that attended school in the integral period . on the first 2 days , we followed up the activities of 26 children who were 5 years of age ( preschool ii ) , and on the other 2 days , we followed 28 children who were 4 years old ( preschool i ) . an audiologist performed the measurements using an audio dosimeter , monitoring the children 's activities at school . these activities were held in different parts of the school , and most took place outdoors ( court and park ) . the equipment used for this study was an sv 102 svantek audio dosimeter ; the device was calibrated and checked before the beginning of each measurement according to the technical specification . a and with a slow response in order to monitor low levels and continuous sounds in the environment studied according to the recommendations of regulatory standard-15 ( nr-15)8 and the fundacentro standard of occupational hygiene ( nho-01)9 . measurements were obtained for the following parameters : maximum ( lmax ) , minimum ( lmin ) and equivalent noise level ( leq ) . the equipment was programmed to operate at nps intervals ( spl ) between 40 and 140 db . for the offsetting , we used the values proposed in the nr-15 and nho-018 \n 9 . in brazil , 2 standards deal with the measurement of noise and its harmful effects ; they were created to establish the criteria for occupational noise exposure . 1 the limit of tolerance for continuous or intermittent noise , and the other is the nho-01 , which provides criteria for the assessment of personal exposure to noise that are more accurate but does not have legal authority9 . neither standard specifies changes in measurement parameters and analysis based on an open or enclosed environment . one difference between the 2 standards is the recommended rate of duplicity : the nr-15 states that it is equal to 5 db , while the nho-01 states that it is equal to 3 db . we used these 2 standards in this study , articulated with that advocated in the abnt standard nbr 101521 . the results were analyzed using descriptive statistics based on the spl measurement parameters : lmax , lmin and leq . complementary analysis was performed to compare the measured values ( as related to both the nho-01 and nr-15 ) for preschool i and ii ; the mann whitney test was used , the significance level was 5% ( p < 0.05 ) , and the confidence interval was constructed with 95% statistical confidence .", "there were differences in the spls measured according to the 2 standards . the noise intensity measured at the school ranged between 40.6 db ( a ) and 105.8 db ( a ) on the nr-15 and between 40.6 db ( a ) and 116.6 db ( a ) on the nho-01 ( table 1 ) . \n legend : max - maximum ; min - minimum ; leq - equivalent noise level . when we analyzed table 1 , it showed that according to the nr-15 , leq was 73.9 db ( a ) and 75.5 db ( a ) in preschool i , and 76.1 db ( a ) and 82.1 db ( a ) in preschool ii . in this sample , the band intensity of a higher recurrence of spl was 5355 db ( a ) and 6580 db ( a ) in preschool i and 5357 db ( a ) and 7185 db ( a ) in preschool ii ( figure 1 ) ; the mann whitney test used to compare the standards determined that there were no statistically significant differences ( nr-15 , p = 0.427 ; nho-01 , p = 0.186 ) . this suggests that despite the older children producing a higher spl than the younger children , quantitative analysis determined that this difference was not significant . \n the frequency spectrum of the spl measured in the octave bands was concentrated in the frequency range between 500 hz and 4000 hz ( figure 2 ) . \n distribution of the sound pressure level measured at preschool i and ii according to frequency spectrum ( octave bands ) . the activities performed by preschool i ( chart 1 ) were related to the spl measurement ( figure 3 ) during the 8-hour period . the spl varied according to the activity : painting and writing were quieter activities and free activities and games were noisiest ; these activities were carried out in the classroom . the only time the spl was within the standards was during the childres nap time . \n", "the results demonstrated that most of the time , the noise level at school is higher than that recommended by the abnt and the world health organization1 \n 10 . a study conducted in a school showed that the noise levels measured in the classrooms and the school yard were the same as that caused by heavy traffic , race cars , and subway trains , ranging from 80 db to 110 db10 , and this shows that the measurements obtained in this study are not appropriate for the school environment , the physical and mental health of children in this learning phase , and for other school professionals11 . in this study , the average spl , determined from 4 days ' measurement , was 73.9 db ( a ) and 75.5 db ( a ) in preschool i and 76.1 db ( a ) and 82.1 db ( a ) in preschool ii ; these results are similar to those found in the literature . in other studies involving schools , the spls in classrooms ranged 4975 db ( a ) , 59.571.3 db ( a ) , 5987 db ( a ) , and 71.196.2 db ( a)12 \n 13 \n 14 \n 15 . in daycare centers and schools , children 's voices produce considerable levels of noise ; the equivalent noise levels ( leq ) measured over 8 hours were 80.1 db ( a ) near the teachers ' ears and 70.87 db ( a ) in the classroom . the lmax was 112.55 db ( a ) near the teachers ' ears and 103.77 db ( a ) in the classroom7 . a study that measured the influence of external noise in an empty classroom obtained a leq of 56.2 db ( a ) when there was activity in only one classroom in the school and 63.3 db ( a ) when activity was carried out in another 3 classrooms16 . this difference in spls observed in the literature can be explained by the influence of different factors , such as equipment position , the number of children in the classroom and/or activity , type of activity performed , the environment acoustic characteristics , and school location . the noise levels in schools should not exceed 50 db ( spl ) , remaining below the human voice , which is 60 db ( spl ) at normal intensity1 . measurements in the classroom demonstrated that excessive noise is a more relevant issue than the poor acoustics of the room , and the levels of environmental noise are almost always higher than the 35 db ( a ) recommended by the abnt , even in empty rooms1 . the spl measured at the school in octave band was concentrated in the frequency range between 500 hz and 4000 hz , the frequencies that favor speech perception . this finding suggests the interference of spl in the understanding of speech due to the signal - to - noise ratio . several studies have indicated that the contribution to the intelligibility of speech is specific to certain frequency bands , and speech sounds consist of low and high frequencies that vary continuously in intensity17 . for sounds below 500 hz , there is a concentration of 60% of the energy ; however , only 5% contributes to speech intelligibility . at frequencies of 5001000 hz , the energy and intelligibility are around 35% , and finally , at frequencies above 1000 hz , only 5% of the acoustic energy is responsible for 60% of the intelligibility and information18 . research has shown that children are the most affected by background noise , either in speech perception or in listening4 . regarding the recommendations for noise in schools , we observe that concern has increased because noise from internal sources ( conversations , furniture , and equipment ) and external sources ( traffic , movement of people , and proximity to urban centers ) has increased . thus , the teaching learning process suffers interference , as the environment does not favor concentration and understanding of speech19 . in this study , the spls in the classroom reached values above 80 db ( a ) according to the activity performed , where painting and writing were the quietest activities . during free activities periods and games that took place on the covered court and playground , the spl exceeded 90 db ( a ) , and these were the noisiest activities in this sample . these findings contradict the recommendations endorsing the classroom - tolerated limit of 4050 db1 . in the literature , studies have reported that the spl depended on the activity performed in the classroom12 \n 20 \n 21 . in elementary schools , the noise levels measured were 44 db ( a ) when the children were silent , 56 db ( a ) when they were carrying out some activity in silence ( silent reading ) , 65 db ( a ) when they were carrying out individual work in a noisy environment ( conversation ) , and 7077 db ( a ) when group work was being done20 \n 21 . students ' activities are a dominant source of noise in the classroom , even when they are quiet and well behaved . in this environment , any activity can increase the noise level by 510 db ( a)19 . a recent study measured noise during recess , demonstrating that the noise was excessive during both periods ( morning and afternoon ) , reaching maximum values of 88.7 db ( a ) in the morning and 102 db ( a ) in the afternoon15 . the authors stated that these peaks are caused by the objects falling or being used , furniture being moved , or students shouting . the peaks interrupted the teacher 's activity and the student group lost its focus19 . in this study , the children of preschool ii , aged between 5 and 6 years , produced a higher level of noise than the younger children did . it has been reported that kindergarten rooms frequented by children aged 5 years were noisier than rooms frequented by high school students22 . we used 2 different standards ( nr-15 and nho-01 ) to analyze the results and observed differences in the measurements obtained , and these differences were justified by the parameters used , for example , the duplicity rate of the dose . it is worth mentioning that the rules that deal with noise measurement and its harmful effects were created to establish criteria for occupational noise exposure . however , as there are no specific rules in brazil for noise measurement in schools , we decided to use these standards1 . the criteria established by the nho-01 are based on modern concepts and scientific and technical parameters , follow current international trends , but without the commitment of equivalence with the legal criteria . thus , the results obtained and their interpretation when applying this standard may differ from those compared against the nr-15 . when we consider the high spls found in schools and their negative impact in this environment , it is essential to implement actions that aim to minimize this disadvantage . it is important to remember that a good acoustic design ensures efficient distribution of the desirable sounds , as well as the exclusion of unwanted noise ( noise from the roof , floor , ceiling , and walls)23 . the high level of noise in the school environment was reported as a disturbing finding in a study because it impairs the academic activities of students . this problem goes beyond the perception of the discomfort caused by noise : it demands reflection about the physical layout of the school environment , classroom acoustics , and student and staff awareness of the noise generated at school24 . researchers have stated that noise should be considered a risk factor in the school environment . once the acceptable noise levels for classrooms are exceeded , it is necessary to reduce them within the legal and medical scope . smaller classes built with acoustic materials and suitable furniture could be examples of immediate actions14 . changes in students ' attitudes , such as behavior in the classroom , will affect the noise level . a reduced noise level combined with treatment for the acoustic environment would produce a significant beneficial effect19 .", "the spls measured at the school were higher and exceeded the maximum permitted level according to the reference standards . therefore , the implementation of actions that aim to minimize the negative impact of noise in this environment thus becomes essential ." ]

[ "chronic periodontitis is an inflammatory disease initiated by microbial pathogens that elicit a host immune response with subsequent loss of connective tissue attachment and supporting alveolar bone . although bacteria are the causal agents of periodontitis , individual susceptibility to disease may be influenced by systemic factors . recently , estrogen deficiency has received increasing attention in relation to susceptibility to chronic periodontitis in postmenopausal women . the production of estrogens changes drastically at menopause , leading to osteoporosis in skeletal bones , characterized by the loss of bone mass and reduction of bone density , and with a consequent increase in bone fragility and susceptibility to fracture . total skeletal mass reduction in postmenopausal women may include jawbones , particularly the mandible [ 69 ] . a number of studies have shown that bone changes in osteoporosis are associated with loss of periodontal attachment , loss of teeth , and height of residual ridge [ 1015 ] . based on these findings , it has been hypothesized that osteoporosis may be a risk factor for the progression of periodontitis . both osteoporosis and periodontitis , in fact , are bone resorptive diseases sharing common etiologic agents / risk factor ( e.g. , sex , cigarette smoking , alcohol consumption , systemic diseases , heredity ) that may either affect or modulate the process of both diseases . in the past decade hrt was recognized as an effective treatment of menopausal signs and symptoms [ 1619 ] . this therapy leads to a reduction of bone mass loss , and therefore has a significant role in the primary and secondary prevention of postmenopausal osteoporosis [ 2022 ] . it has also been suggested that hrt may be beneficial in optimizing periodontal status in postmenopausal women . some clinical studies showed that hrt had a positive effect on alveolar bone density and tooth retention [ 11,2529 ] . similarly , estrogen administration in rats was found to prevent alveolar bone loss resulting from an estrogen - deficient state . periodontal health in postmenopausal women taking hrt , however , has been addressed only in a limited number of studies . it has been reported that women treated with hrt exhibited lower gingival bleeding than estrogen deficient women , but conflicting results were found when the effects of hrt on attachment level and pocket depth were determined . the aims of this cross - sectional study were to assess the periodontal status of a group of postmenopausal women receiving hrt , and to evaluate the association between hrt and clinical measures of periodontal disease including attachment level , pocket depth and gingival bleeding .", "a total of 91 caucasian postmenopausal women , being at least 5 years past their last menstrual period ( age range 50 to 62 years ; mean agesd : 55.123.81 ) , volunteered to participate in this clinical study . the women enrolled in the study were selected from a pool of 195 subjects attending the obstetrics and gynecology unit of the university of palermo medical center ( palermo , italy ) on the basis of the following criteria : being dentate with at least 9 natural teeth in the posterior sites ( with the exclusion of third molars ) ; having no history of early menopause ( ie , occurring before age 45 years ) ; having no cancer or active or chronic parathyroid diseases ; and having no pharmacological history of steroidal or non - steroidal anti - inflammatory drug use or use of immunosuppressants . subjects who were current smokers and those who had a surgically- or chemically - induced menopause no woman included in the study had received periodontal therapy and/or used antimicrobial mouthrinses in the preceding 6 months . screening and selection of volunteers were carried out by a single investigator who explained the study and obtained witnessed and signed consent to participate . the study was performed between october 2005 and september 2008 at the department of oral sciences , university of palermo . the study design was approved by the local ethics committee and was found to conform to the requirements of the declaration of helsinki as adopted by the 18th world medical assembly in 1964 and subsequently revised . women who reported current hrt supplementation ( n=52 ) for at least 5 years were assigned to the hrt + group . the control group ( hrt ) ( n=39 ) consisted of the remaining women . the mean age for both groups was similar , 55.673.36 ( range 5062 years ) for hrt+ group , and 54.384.26 ( range 5062 years ) for the control group . the following oral health variables were measured : plaque index ( pi ) , recorded on 4 sites in each tooth ( mesiobuccal , mid - buccal , distobuccal , mid - lingual ) ; bleeding on probing ( bop ) , recorded on 4 sites in each tooth ( mesiobuccal , mid - buccal , distobuccal , mid - lingual ) ; probing depth ( pd ) and clinical attachment level ( cal ) recorded on 6 sites in each tooth ( mesiobuccal , mid - buccal , distobuccal , mesiolingual , mid - lingual and distolingual ) . pd was measured from the free gingival margin ( mg ) to the base of the pocket . for cal assessment , according to ramfjord s technique , probing depth from the free gingival margin to the base of the pocket was measured ; the distance from the gingival margin and the cemento - enamel junction ( cej ) was also recorded . the following considerations were observed when measuring cal : 1 ) calculus that obscured the cej or interfered with the correct placement of the probe was removed with a curette ; 2 ) when the margin of restoration was apical to the cej , the position of cej was estimated using adjacent landmarks and dental anatomy ; 3 ) when the cej could not be estimated , the examiner excluded the site ; 4 ) when the natural tooth was missing , the site was excluded ; 5 ) partially erupted teeth and root tips were excluded . assuming a=0.05 , the present design ensured a 93.6% chance of detecting a difference of 0.5 at a standard deviation of 0.67 . the data were analyzed for normality of distribution through the use of the kolmogorov - smirnov test . since the data were normally distributed , an unpaired t - test was performed to determine differences in pi , pd and cal between the hrt+ group and the hrt ( control ) group . analysis of covariance ( ancova ) was performed to further assess differences in bop while adjusting for relationship detected by the initial analyses .", "a total of 91 caucasian postmenopausal women , being at least 5 years past their last menstrual period ( age range 50 to 62 years ; mean agesd : 55.123.81 ) , volunteered to participate in this clinical study . the women enrolled in the study were selected from a pool of 195 subjects attending the obstetrics and gynecology unit of the university of palermo medical center ( palermo , italy ) on the basis of the following criteria : being dentate with at least 9 natural teeth in the posterior sites ( with the exclusion of third molars ) ; having no history of early menopause ( ie , occurring before age 45 years ) ; having no cancer or active or chronic parathyroid diseases ; and having no pharmacological history of steroidal or non - steroidal anti - inflammatory drug use or use of immunosuppressants . subjects who were current smokers and those who had a surgically- or chemically - induced menopause no woman included in the study had received periodontal therapy and/or used antimicrobial mouthrinses in the preceding 6 months . screening and selection of volunteers were carried out by a single investigator who explained the study and obtained witnessed and signed consent to participate . the study was performed between october 2005 and september 2008 at the department of oral sciences , university of palermo . the study design was approved by the local ethics committee and was found to conform to the requirements of the declaration of helsinki as adopted by the 18th world medical assembly in 1964 and subsequently revised . women who reported current hrt supplementation ( n=52 ) for at least 5 years were assigned to the hrt + group . the control group ( hrt ) ( n=39 ) consisted of the remaining women . the mean age for both groups was similar , 55.673.36 ( range 5062 years ) for hrt+ group , and 54.384.26 ( range 5062 years ) for the control group .", "the following oral health variables were measured : plaque index ( pi ) , recorded on 4 sites in each tooth ( mesiobuccal , mid - buccal , distobuccal , mid - lingual ) ; bleeding on probing ( bop ) , recorded on 4 sites in each tooth ( mesiobuccal , mid - buccal , distobuccal , mid - lingual ) ; probing depth ( pd ) and clinical attachment level ( cal ) recorded on 6 sites in each tooth ( mesiobuccal , mid - buccal , distobuccal , mesiolingual , mid - lingual and distolingual ) . pd was measured from the free gingival margin ( mg ) to the base of the pocket . for cal assessment , according to ramfjord s technique , probing depth from the free gingival margin to the base of the pocket was measured ; the distance from the gingival margin and the cemento - enamel junction ( cej ) was also recorded . the following considerations were observed when measuring cal : 1 ) calculus that obscured the cej or interfered with the correct placement of the probe was removed with a curette ; 2 ) when the margin of restoration was apical to the cej , the position of cej was estimated using adjacent landmarks and dental anatomy ; 3 ) when the cej could not be estimated , the examiner excluded the site ; 4 ) when the natural tooth was missing , the site was excluded ; 5 ) partially erupted teeth and root tips were excluded .", "assuming a=0.05 , the present design ensured a 93.6% chance of detecting a difference of 0.5 at a standard deviation of 0.67 . the data were analyzed for normality of distribution through the use of the kolmogorov - smirnov test . since the data were normally distributed , an unpaired t - test was performed to determine differences in pi , pd and cal between the hrt+ group and the hrt ( control ) group . analysis of covariance ( ancova ) was performed to further assess differences in bop while adjusting for relationship detected by the initial analyses .", "mean pi , pd and cal for both hrt+ and hrt groups are shown in table 1 . mean pi were significantly lower in hrt+ women than in hrt women ( p<0.0001 ) . conversely , no significant differences were found for pd and cal between groups ( p=0.8067 and p=0.1627 , respectively ) . the percentage of gingival sites with positive bop was significantly lower in the hrt+ group compared to the control group ( 34.85% vs. 65.15% ; p=0.0007 ) ( table 1 ) . plaque accumulation was tested in ancova as a possible explanatory variable for the differences observed in gingival bleeding . the ancova showed that this covariate was significantly different between groups ( p<0.0001 ) ( data not shown ) . after the effect adjustments , no significant differences in gingival bleeding were found between hrt+ and hrt women ( p=0.4677 ) ( data not shown ) . no significant differences in women who smoked and those who used oral contraceptives were detected between hrt+ and hrt subjects ( p=0.9999 and p=0.0845 , respectively ) ( data not shown ) .", "the physiological changes associated with menopause can cause some women to experience uncomfortable symptoms such as hot flashes and night sweats , vaginal dryness and dyspareunia , disturbed sleep and irritability / depression . moreover , estrogen deficiency arising from menopause , in association with age - related factors , has been shown to increase the risk of developing cardiovascular disease , including coronary heart disease and stroke , colorectal cancer and osteoporosis . until recently , hrt was considered the single most effective treatment of menopausal symptoms and its use after the publication of the women s health initiative ( whi ) findings in 2002 and 2004 , the use of hrt at menopause has become a matter of debate and its utility has been questioned . recent analyses of the whi data and other randomized controlled trials , however , have suggested that the potential risks involved in taking hrt ( increased risk of breast cancer , cardiovascular outcomes and stroke ) may largely depend on the estrogen and progesterone / progestin formulation , dosage , mode of administration , patient s age , associated diseases , and duration of treatment [ 1618,4246 ] . therefore , based on the current evidence , the intention , dose and regimen of hrt need to be individualized , based on the principle of choosing the lowest appropriate dose in relation to the severity of symptoms and age at onset of menopause . for early postmenopausal women , hrt may be the most effective treatment available for vasomotor and urinary / genital symptoms , and may be still considered a good therapeutic choice to prevent osteoporosis and cardiovascular risk [ 1618,20,46,47 ] . moreover , the current evidence supports the use of hrt in women at the beginning of menopause and suffering from heard - to - bear vasomotor symptoms and disturbed sleep . in past years , various studies have been conducted to evaluate the effect of hrt in modifying the periodontal conditions in postmenopausal women due to a possible connection between osteoporosis and the progression or severity of periodontitis [ 2325,27,32,33 ] . hrt was associated with a reduction of alveolar bone loss , but a number of studies failed to find an inverse correlation between alveolar bone density and severity of periodontal disease [ 4851 ] . furthermore , some authors failed to demonstrate any beneficial effect of hrt on alveolar bone density / height . it has been suggested that estrogen may have an inhibitory effect on gingival inflammation by inhibiting mediators ( il-1 , tnf- , il-6 , il-1 , il-8 ) and cellular mechanism of inflammation ( pmn recruitment , lymphocyte activation ) [ 5457 ] . similarly , estrogen supplementation may modulate the rate of breakdown of periodontal tissue through a mechanism involving down - regulation of matrix metalloproteinases ( mmp-8 and mmp-13 ) and cytokines involved in bone resorption [ 4,5759 ] . conflicting results exist on the effects of hrt on probing pocket depth and attachment level . furthermore , the risk of tooth loss was found to be lower in women who used hrt than those who did not . tooth loss , however , could not be used as a surrogate evaluation for periodontal disease , since reasons for tooth loss could include caries or trauma . moreover , the extent of periodontal destruction around the remaining teeth was not taken into account in this analysis . the aim of this study was to evaluate the periodontal status of postmenopausal women and to determine the effect of hrt on standard clinical measurements of periodontal disease . in the present study , hrt+ women had lower inflammatory gingival scores than hrt women , as indicated by the lower percentage of bleeding sites ( p=0.0007 ) . the level of supragingival plaque accumulation was found to be significantly lower in hrt+ women than in hrt women ( p<0.0001 ) . to account for factors that are known to be associated with gingivitis , it was of great importance to adjust for the difference in plaque level in the final analysis between groups . the findings of initial statistical analysis were not confirmed after correcting for plaque accumulation by those women on hrt having less gingival bleeding ( ancova , p=0.4677 ) . women taking hrt had fewer bleeding sites than did hrt women , but this finding may be related to the lower level of supragingival plaque than to the effect of hrt . these results are in contrast with previous reports linking the use of hrt with the reduction of bleeding sites . in those studies , the percent of gingival sites with bleeding was significantly lower in hrt+ women compared to hrt women , despite the levels of plaque accumulation . cal is an important measure of periodontitis progression because of its relationship with alveolar bone loss . due to the known beneficial effects of hrt on osteoporosis , it may be expected to significantly lower values for cal in the hrt+ group . ronderos et al . found the mean cal differences observed between postmenopausal females who reported the use of estrogen supplementation for more than 5 years and those who never used estrogens were significant , although quite small ( 1.74 vs. 1.56 ) . other previous studies reported lower values of cal in women using hrt , but the difference found between hrt+ and hrt patients was not significant . in the present study , no significant difference was detected in the mean pd between the 2 groups of women . this finding is in agreement with previous studies , with the exception of the study by lopez marcos et al . , who evaluated the differences in pd values between hrt+ and hrt groups at the beginning of the therapy and then revaluated over 6 months to 1 year after the beginning of the hrt . lopez marcos et al . reported the pd variable for patients not receiving hrt evolved to worse stages , whereas patients receiving hrt showed a significant improvement in pd . it must be noted , however , that these results can not be compared with those of the present study because of the different study designs . moreover , in the study of lopez marcos et al . , cal was not assessed and other clinical measures of periodontitis ( dental pain of periodontal origin , gingival recessions ) did not show significant improvement in the hrt+ group . thus , the decrease of pd values in patients receiving hrt could be related to the reduction of gingival inflammation due to the estrogen action rather than to an effective gain of attachment .", "the findings of the present study indicate that , in postmenopausal women , long - term hrt was not associated with significant effects on periodontal status and clinical measures of periodontitis , thus suggesting that hrt may not confer protection against periodontitis . periodontitis may be primarily related to the presence of plaque and to a lesser extent to hormonal changes such as estrogen deficiency . however , the possibility exists that the decreased estrogen levels associated with the postmenopausal period may contribute to the progression of periodontal disease by affecting the oral bone mass [ 3,1012,15,23,28,50 ] . thus , postmenopausal women with periodontal disease should undergo periodical screening examinations in order to detect changes in their periodontal status and support them with periodontal treatment ." ]

[ "pars plana vitrectomy ( ppv ) is a proven and basically safe procedure with a low incidence of complications [ 1 , 2 ] . however , serious adverse events can and do occur , the most serious complications being endophthalmitis , hemorrhages and nonarteritic anterior ischemic optic neuropathy ( naion ) , a potentially blinding condition . an investigation in a random sample of 5% of the american medicare beneficiaries over a period of 12 years ( 19942005 ) yielded an incidence of approximately 7% for postprocedural blindness after ppv without an appreciable trend over time . whereas endophthalmitis is widely considered and investigated in the literature concerning post - ppv complications [ 1 , 2 , 3 ] , the incidence of postprocedural loss of vision due to naion appears to be somewhat underreported . following the concept of vascular occlusion as a key factor in sudden blindness , the conventional mainstay for the treatment of postsurgical loss of vision is the systemic administration of corticosteroids and anticoagulants , e.g. acetylsalicylic acid [ 6 , 7 , 8 ] . however , there is no generally accepted , well - proven treatment for naion currently . in the past decade , a number of novel protein - based direct thrombin inhibitors became available for the treatment of diseases associated with undesired blood clotting . one of those agents is dabigatran etexilate , presently approved for the prophylaxis of venous thrombosis after hip or knee arthroplasty and stroke in patients with atrial fibrillation . after all conventional methods of reversing the visual loss in our patient had failed , we resorted to a therapeutic trial of dabigatran etexilate , and the results are reported here .", "a 46-year - old caucasian female underwent ppv of the right eye with endolaser treatment and c2f6 ( hexafluoroethane ) gas tamponade as per the current guidelines for retinal detachment . after the procedure , the vision of the treated eye was practically lost , and the patient was only able to distinguish hand movements . the afferent pupillary defect ( apd ) was positive , and perimetry revealed a severe loss of the visual field ( fig . the administration of a conventional therapeutic regimen [ consisting of prednisolone ( 100 mg / day for 3 days , 80 mg / day for 3 days , 60 mg / day for 3 days , 40 mg / day for 3 days , and 20 mg / day for 3 days ) and acetylsalicylic acid ( 100 mg ) ] improved visual acuity only marginally to logmar 1,4 ( fig . 3 ) with positive apd . since pronounced corticosteroid side effects ( sleeplessness , facial edema , restlessness , sweating and tachycardia ) burdened the patient and the treatment showed practically no effect , we decided to try to improve her vision with the administration of dabigatran etexilate ( 2 110 mg ) , a novel direct thrombin inhibitor , 24 days after the initiation of the prednisolone / acetylsalicylic acid treatment . promptly after the first administration , visual acuity improved to logmar 1,0 and continued to improve to logmar 0,4 ( fig . perimetry done 26 days afterwards showed a marked improvement in central sensitivity from 7 to 25 and 21 db , respectively ; the nasal part of the visual field also showed an increase in sensitivity ( fig .", "strictly speaking , the diagnosis of naion requires the exclusion of arteritic alterations , usually by temporal artery biopsy . however , a sudden loss of vision after ocular surgery without signs of retinal detachment or other intraocular alterations strongly suggest ischemic neuropathy , and tentative diagnosis and treatment are warranted . since naion is not a disease as such but rather the common endpoint of a large number of local and systemic conditions , there is no established standard therapy . however , systemic corticosteroids in combination with anticoagulation to reduce swelling and improve venous blood flow are basically accepted modalities . when this approach failed in the present case , we resorted to the off - label administration of a novel direct thrombin inhibitor , resulting in a dramatic recovery of visual function . naion is known to show spontaneous remission in approximately 40% of the cases , but this assumption notwithstanding , improvement of blood flow is an accepted measure whose indication to preserve or restore vision is undisputed . therefore , the striking improvement of vision after the administration of dabigatran etexilate in the present case may warrant a systematic clinical trial of a combination of corticosteroids and dabigatran etexilate in comparison with ( for instance ) warfarin as is common practice under different indications for anticoagulation [ 12 , 13 , 14 ] . however , when ophthalmologists consider the administration of dabigatran etexilate for naion , certain peculiarities and disadvantages of the drug ( such as the lack of an antidote [ 12 , 15 ] ) need to be borne in mind to avoid potential hazards .", "" ]

[ "cigarette smoking is the most important preventable cause of mortality all over the world . also , it is responsible for many non - communicable diseases such as cancers and cardiovascular diseases . moreover , cigarette smoking is the cause of half of the death of those who smoke for a long time . in the year 2000 , about 5 million adults died as a result of cigarette consumption ( about 12% of total deaths in the year 2000 ) . it is estimated that this rate reaches 8.3 million per year by the year 2030 , which 70% of these deaths will occur in developing countries . according to the who estimation , there are about 1.3 billion smokers worldwide that comprise one third of the world population over the age of 15 years . if this pattern of smoking remains unchanged , this rate will reach 2 billion by the year 2030 . meysamie a and colleagues reported that prevalence of cigarette smoking is 23.4% and 1.4% in iranian males and females , respectively . teachers and other groups like clergymen who can be role models , play an important role in persuasion or prevention of cigarette smoking among the youth . also , as students will enter the society and play key roles such as physicians , engineers , and teachers and so on ; studying their smoking behaviors is very important . therefore , students are also role model for the younger , as well as being a representative of youth in the population . the rate and tendency toward smoking among students has increased as shown by several studies . for example , a national survey in the us demonstrated that during a 5-year period , the rate of smoking among students increased from 22% to 29% . also , a study in iran found similar results showing that 5% of the female students in medical schools who were non - smokers in their first year of study became cigarette users in their seventh year of education . these rates among male students were 2% in the first and dramatically increased to 34% in the seventh year . heydari et al . also showed that prevalence of smoking was significantly higher in students in their last year of study compared with whom in the first year . in addition , several studies have demonstrated that prevalence of smoking was higher among students who had smoker teachers compared to those who had non - smoker . these imply the importance of study of prevalence of smoking in these groups and also their knowledge , attitude and practice on the matter . since the clergymen in any religion are one of the most influential groups in the society , study of their smoking habits has been of interest and several studies looked at the prevalence of smoking in this group . for example , a study on buddhist monks demonstrated that prevalence of daily smoking was 12% , which was lower than general population . this study also showed that buddhist monks with no history of smoking had a better knowledge and attitude towards the hazards of smoking . however , there is no study about smoking status of clergymen in islamic countries including iran . the aim of this study is to estimate and compare the prevalence of smoking in 3 groups of male teachers , clergymen and university students and also their knowledge , attitude and prediction of future smoking . this is the first study in iran , which compares not only the prevalence of smoking but also evaluates knowledge , attitude and their future prediction of smoking and investigates inter - relationship in these 3 groups .", "university students , clergymen and teachers were studied in tehran , iran during 2009 . in this cross sectional study , the knowledge , attitude towards tobacco consumption and their prediction of smoking in the next 5 years of participants were asked by questionnaire . since the understudy clergymen were all males , only males first , tehran islamic religious school and shahid beheshti university were randomly selected from the corresponding lists . then , four medical and randomly four non medical faculties from the shahid beheshti university were selected . one class per grade ( from grade 1 to 4 ) was also randomly selected in these faculties . besides , in tehran islamic religious school one class per grade ( from grade 1 to 5 ) was also selected randomly . the students and clergymen were all 18 - 25 years old . in each class , after explaining the aim of the study and also the confidentiality , all the students were invited to participate in the study . male teachers ( 20 - 29 years ) who thought boys in middle schools in tehran were also randomly selected . first , from the list of districts provided by the ministry of education and training 5 districts randomly selected . third , in each school , on average , about 10 teachers were randomly selected . for calculation of the required number of subjects in each of 3 groups , the formula for sample size calculation for proportion was used . considering p = 50% , = 0.05 and precision of 0.05 , a minimum sample size of 385 was computed for each group . a total of 1,271 university students were enrolled ( 765 medical and 506 non - medical ) . also , 549 clergymen and 551 teachers were randomly studied . therefore , in all 3 groups , we examined a larger population than the calculated required number , which generally can increase the power and precision of the analysis . to examine knowledge and smoking status of the study subjects , a self - report questionnaire was adapted from the standard questionnaire of the global adult tobacco survey . this questionnaire evaluates age of smoking initiation , place of birth , history of smoking ( one with consumption of at least 100 cigarettes was defined as a smoker person ) , smoking status at present , also knowledge about tobacco consumption ( including 4 general knowledge multiple choice questions with 4 options ) , attitude towards tobacco consumption ( 4 multiple choice questions with 5 options ) and contains one question about the probability of tobacco consumption in the next 5 years , which is presented in details by heydari et al . considering the subjects total scores of knowledge and attitude , the answers were categorized into 2 groups of poor / inappropriate ( no correct answer ) and moderate or good / appropriate ( at least one correct answer ) . the answer to the question about probability of smoking in the next 5 years was divided into 2 groups of yes or no . data was entered and analyzed using spss ( 11.5 ) and stata ( 11.0 ) . chi - squared test and logistic regression were used for comparison of smoking status , knowledge , attitude , and probability of smoking in the next 5 years among the 3 groups .", "in this study , 1,271 students , 549 clergymen , and 551 teachers were interviewed in tehran during 2009 . as table 1 shows , 395 ( 31.1% ) of students , ( 95% ci : 28.5%-33.6% ) had a history of smoking more than 100 cigarettes . this rate was 21.9% ( 95% ci : 18.3 - 25.3% ) among clergymen and 27.2% ( 95% ci : 23.4%-30.9% ) among teachers . as presented in this table , the highest prevalence was seen among students and the lowest among clergymen ( p < 0.0001 ) . logistic regression showed that prevalence of smoking was significantly higher among students and teachers than clergymen ( p < 0.0001 and p = 0.04 ) . however , the 3.9% difference in prevalence of smoking between students and teachers was not found significant ( p = 0.09 ) . also , among the 3 groups , there was borderline difference in age of smoking initiation ( p = 0.06 ) . neither , such difference was detected in terms of successful quit attempts , occasional smoking and daily cigarette consumption ( p = 0.99 ) . no significant difference was found in the amount of daily smoking ( less than 10 cigarettes , 11 - 20 cigarettes and more than 20 cigarettes ) between the 3 groups ( p = 0.64 ) . smoking status of male students , teachers and clergymen in tehran there was a significant difference between the understudy groups in terms of their knowledge , attitude and probability of smoking in the next 5 years ( p < 0.0001 ) as presented in table 2 . also , table 2 shows , 61.9% ( 787 ) of students had poor knowledge ; whereas , this rate was 38.8% ( 213 ) among clergymen and 42.1% ( 232 ) among teachers . inappropriate attitude ( tendency ) towards smoking was observed in 23.1% ( 294 ) of students , 10.2% ( 56 ) of clergymen and 12.7% ( 70 ) of teachers . in addition , 11.9% ( 151 ) of students , 5.8% ( 32 ) of clergymen and 7.3% ( 40 ) of teachers predicted that they will smoke cigarette in the next 5 years . it worth mentioning that the knowledge , attitude , and probability of smoking in the next 5 years of two groups of medical and non - medical students were not statistically significant ( p = 0.29 ; p = 0.28 ; p = 0.30 ; data not shown ) , respectively . this was the reason that we combined these two groups of the students for comparisons between 3 groups . knowledge , attitude and prediction of smoking in the next 5 years among male students , teachers and clergymen in tehran table 3 shows the odds ratio of smoking initiation in the understudy groups based on their level of knowledge , and attitude . odds ratio of smoking cigarette was not significant in students with poor knowledge ( or = 1.2 ; 95% ci : 0.9 - 1.6 ) . whereas , odds ratio of smoking cigarette in clergymen ( or = 3.1 ; 95% ci : 2.0 - 4.6 ) and teachers ( or = 2.7 ; 95% ci : 1.9 - 4.0 ) with poor knowledge was significantly higher than those with moderate or good level of knowledge . also , in all 3 groups , the odds ratio of smoking cigarette was higher among those with inappropriate attitude compared to those with appropriate attitude towards smoking . this chance was significantly more in clergymen than teachers and was the lowest amongst students ( p = 0.01 ; table 3 ) . likelihood of smoking in the next 5 years of male students , teachers and clergymen based on their knowledge and attitude in tehran in addition , when examining the effect of current smoking status on the likelihood of smoking cigarette in the next 5 years , the corresponding odds ratios for students , clergymen and teachers were 1.4 , ( 95% ci : 0.98 - 2.0 ) , 4.0 ( 95% ci : 1.9 - 8.2 ) and 2.9 ( 95% ci : 1.5 - 5.6 ) respectively , which were significantly different ( p = 0.0001 ) . the results of study of association between knowledge , attitude and prediction of smoking in the next 5 in three groups are presented in table 4 . as shown in this table , 25.9% ( 204 ) of students with poor level of knowledge had also inappropriate attitude towards smoking cigarette ; whereas , only 15% ( 32 ) of clergymen and 17.2% ( 40 ) of teachers with poor knowledge had this attitude ( p < 0.0001 ) . also , 7.8% ( 61 ) of students with poor knowledge predicted that they may smoke cigarette in the next 5 years , where these rates were 3.8% ( 8) and 4.3% ( 10 ) among clergymen and teachers , respectively ( p in addition , it was found that 20.4% ( 60 ) of students with inappropriate attitude predicted that they may smoke cigarette in the next 5 years however these were 28.6% ( 16 ) and 28.6% ( 20 ) in clergymen and teachers ( p = 0.008 ) . these finding revealed that although frequency of inappropriate attitude was higher among students , the chance of smoking in the next 5 years in this group was lower than clergymen and teachers . as it is stated the age rage of the students and clergymen were 18 to 25 years and of the teachers 20 to 29 years . when significant test was carried on grade ( as a representative of age ) of students and clergymen it was not significant ( p = 0.37 ) . also , given the rage of age ( 20 to 29 years ) , the mean age of teachers is not generally far from the other 2 groups to alter the findings .", "the results of this study showed that prevalence of smoking was higher among students ( 31.1% ) and teachers ( 27.2% ) in comparison with clergymen ( 21.0% ) and other males in general population ( 23.4% ) . although , the lowest consumption was seen among clergymen , it was not significantly lower than general population ( p = 0.40 ) . also , level of knowledge , attitude and prediction of smoking cigarette in the next 5 years were more favorable in teachers and clergymen . although , whenever the range of age extended or the females are enrolled the findings could be different . in general , limited studies have compared smoking status in different groups in a community , although there are many researches focusing on a specific group of people . they evaluated 280 medical students in isfahan university of medical sciences and found that prevalence of smoking was 34% among male students who were in last year of their training . another study conducted in saudi arabia showed a relatively similar prevalence of smoking among students of different majors . in this study , which was conducted on 202 medical and 300 non - medical students , they demonstrated that the rate of smoking was 27.8% and 39.5% among medical and non - medical students , respectively . frisch et al . in malaysia examined the pattern of smoking , level of knowledge and attitude of 146 medical and nursing students towards smoking and found that only 11% of male students and none of the female students smoked which is much lower than ours . the level of knowledge and attitude were significantly lower in students compared with other groups in our study . however , other studies conducted in different countries demonstrated that level of knowledge and attitude of medical students towards smoking were more appropriate . a study conducted in the united kingdom on 181 dental students showed that more than 90% of dental students had moderate or good knowledge and more than 80% had an appropriate attitude towards smoking pizzo et al . in a study aiming to examine prevalence of smoking among dental students and their knowledge and attitude towards quitting showed that of 220 students 65% of students had appropriate knowledge and 87% had appropriate attitude towards smoking cessation activities . although in their study , the level of knowledge and attitude of dental students were higher than our students , no significant difference was observed between prevalence of smoking . this indicates that appropriate knowledge and attitude alone can not result in a proper behavior and other confounding factors like socioeconomic and family issues should also be taken into account . , in the netherlands examined knowledge , attitude and rate of smoking in 3 groups of medical students ( 725 subjects ) , residents ( 126 subjects ) and psychology counselors ( 236 subjects ) and found that prevalence of smoking among medical students and residents was lower than the general population ; whereas , prevalence of smoking among counselors was not different from general population . they also found that counselors had poorer knowledge and more inappropriate attitude towards smoking compared to the other 2 groups . the results of glantz study on prevalence of smoking in comparison with general population were in contrast with ours , however he found similar association between knowledge , attitude and prevalence of smoking cigarette with our study . limited studies have been conducted on the smoking status among clergymen of other religions and those available have been mostly performed on buddhist monks . a study conducted on 318 buddhist monks in cambodia showed that 44% were smokers ; whereas , prevalence of smoking in cambodian general population was 65% . in addition , most monks had a poor knowledge about hazards of smoking but as the result of social stigma , prevalence of smoking among them was lower than the general population . another study conducted on buddhist monks in laos showed that prevalence of smoking among them was about 12% , which is much lower than the neighboring countries like cambodia . this study also demonstrated that lao monks had a good knowledge about hazards of smoking . the results of these 2 studies were in accord with those of ours demonstrating that islamic clergymen and buddhist monks both had a lower prevalence of smoking than general population and also had an appropriate level of knowledge in this respect . in general , the majority of studies performed on teachers only studied the prevalence of smoking . our study findings regarding high prevalence of smoking among teachers were in agreement with the findings of talay et al . , in turkey , and sorensen et al . in india . on the contrary , a study in bahrain on 1,140 teachers demonstrated that only 8.7% of bahraini teachers smoked , which was lower than their general population . they also reported that these teachers had acceptable level of knowledge about hazards of smoking . the results of this study revealed that clergymen and teachers with poor knowledge had lower chance for becoming a smoker . in all 3 groups , the odds ratio of smoking in those with inappropriate attitude was significantly different from those with appropriate attitude . however , this chance was not significantly different in clergymen than teachers . also , it was found that smoking status had no significant effect on the probability of smoking in the next 5 years among students . however , for clergymen and teachers , likelihood of smoking in the next 5 years among current smokers was significantly different from non - smokers . in a study on 5,112 teachers in malaysia it also showed that teachers attitude affected their smoking status , which is in concord with our study findings . another study conducted in bosnia on 273 physicians and nurses found a significant difference in their knowledge and attitude towards smoking . while , in each group , prevalence of smoking . also found a significant relationship between prevalence of smoking and level of knowledge and attitude in each group of medical students , psychologists and medical residents . preventing the initiation of smoking in the adolescents and decreasing the prevalence of smoking in adults are the most important methods for prevention of cancer and various diseases . these programs may include increased price of cigarettes , ban of smoking in public places , limiting cigarette advertisements , restricting tobacco advertising , and establishment of counseling and treatment centers for nicotine dependence . however , for implementation of such programs at the national level , a correct estimate of the prevalence of smoking in different social and occupational groups seems necessary . cigarette consumption has increased among the youth of various social levels in the recent years . this study also showed that prevalence of smoking was higher among male students ( which represents the youth in the community ) than general population . considering this increase , new strategies the strength of this study was looking at these 3 groups for the first time , having standard questionnaire , trained research staff and acceptable executive process . the weakness of the study was because the clergyman were male the other 2 groups were selected from males . also , limiting the information on grades of the students and clergymen and age rage of teachers and not recording exact age of participants was of the limitations of the study .", "this study showed that prevalence of smoking among male students and teachers was higher than general population and clergymen , who smoked equally . also , level of knowledge and attitude and prediction of future smoking in students were worse than teachers and clergymen , which is alarming ." ]

[ "the etiology and progression of various diseases are not necessarily influenced by biological factors only . for their understanding it is important to consider the complex interaction of physiological , psychological , behavioral , and social factors . the most accepted model of the disease is the biopsychosocial model , which distinguishes three groups of factors important for the development of a disease , such as biological , psychosocial and behavioral factors ( 1 ) . their interaction results in the susceptibility or resistance to disease , as well as in the appearance and/or progression of the disease . according to this model , the biological factors are the following : heritage , gender , age , exposure to toxins and injury . psychosocial factors are related to the way of interpretation and reaction to life events and stressors . behavioral factors reflect the lifestyle , including physical activity , and various habits such as alcohol drinking , cigarette smoking and drug use , as well as sexual behavior . the interaction of these three groups of factors in the etiology and progression of the disease takes place over an activation of a series of neuroendocrine and immune mechanisms . one of the components of this complex interaction may be the stress which is correlated to hereditary disposition for the disease manifestation . it is well known that stress is responsible for weakening the body defense mechanisms , especially the immune and endocrine systems . malignant disease bears a major impact on the patients mental status due to the gravity of such a condition . a newly discovered malignant disease , as well as coping with such a situation is especially stressful acute event for patients responding through a repetitive activation mechanism , including deregulation of the hypothalamic - pituitary - adrenal axis ( hpa ) that has an adverse health consequence . more specifically , the entire neuroendocrine response to stress is interconnected to the excessive release of various hormones such are the pituitary vasopressin and growth hormone , glucocorticoids , the thyroid hormones , and pancreatic glucagon ( 2 ) . obvious sign of the endocrine system deregulation as a response to stress , is the change in circadian rhythm of serum cortisol production . in healthy individuals the level of serum cortisol is usually the highest in the morning before waking up and gradually lowered during the day . however , about 70% of patients with newly diagnosed cancer shows flattened circadian cortisol profile , as well as consistently high levels or irregular fluctuations in serum cortisol ( 3 ) . the effect of stress onto immune and neuroendocrine system is mediated by a number of psychosocial factors . recently , it is observed that optimism is a psychosocial factor of particular importance in the response to stress ( 4 ) , having a direct positive impact on psychological and physical health ( 5 - 9 ) . it is associated with a lower incidence of depression and anxiety , better functioning of the cardiovascular system , slower progression of the disease , and improved survival of the malignant disease , as well ( 5 - 9 ) . in general , optimists tend to use active strategies aimed at coping with the stress , while pessimists use adverse coping strategies ( 10 ) . therefore , one may assume that optimism improves health condition by activating the immune system which allows better psychophysiological adaptation of the body ( 11 ) . results of the study investigating the influence of optimism onto the immune system have shown that optimists posses various indicators of cellular immunity ( increased proliferation of lymphocytes , enhanced local immune reactions ) ( 5 , 12 ) . therefore , it seams that the serum level of stress hormone cortisol is relatively lower in optimistic person in comparison to the pessimistic one due to the former more successful coping with the stress ( 13 ) , what probably contribute to a better functioning of the immune system . however , previous studies have not taken into account the impact of serum cortisol level to perceptive experience of optimism in persons coping with stressful situations caused by awareness of recently diagnosed malignant disease . the aim of this study is to investigate the correlation between the morning level of serum cortisol and perceptive experience of optimism in a selected group of patients with newly diagnosed cancer .", "the study was conducted on a cohort of patients with recently histologically verified diagnosis of malignant diseases of different organs and organic systems , which have responded to call for examination at the outpatient department of oncology , clinical university hospital mostar during the one - month period ( december 2014 ) the study included 60 patients with newly established diagnosis of cancer ( 30 males and 30 females ) in whom a malignant metastatic disease was found by different diagnostic methods . all participants agreed to participate in the study and signed a letter of informed consent . after confirmation of the diagnosis , patients were given a questionnaire consisting of socio - demographic questionnaire , and a scale for assessing optimism / pessimism . in all the morning cortisol level was measured and analyzed during the study all patients were treated with corticosteroid therapy and spironolactone . those suffering from chushing s or addison s disease , as well as those with incompletely or incorrectly fulfilled questionnaires were excluded from the study . we assumed that the awareness of newly diagnosed cancer is a possible stress inducer for the patient , and as such may increase the level of serum cortisol . at the same time , the assumption of that awareness may also well affect the perceptive experience of optimism/ pessimism in every individual patient . a sociodemographic questionnaire contained demographic and general information of gender and age , the level of education , marital status , employment and economic status was used . to test the level of optimism / pessimism the croatian version of scales of optimism and pessimism was applied containing 14 particles divided into two charts ( 15 ) . six particles contained the scale for optimism assessment , while 8 contained the scale for pessimism . each patient was asked to estimate the extent to which each particular statement was appropriate on a likert type scale of five degrees . the scale showed satisfactory reliability on a range from 0.74 to 0.77 for the scale of optimism and from 0.78 to 0.83 for the scale of pessimism . to determine the level of morning serum cortisol a fluorometric method utilizing delfia cortisol fluoroimunoessay was applied ( 16 ) , using lkb wallace 1230 arcus fluorometer measuring device . the measurement method was based on a competitive antigen - antibody reaction between cortisol highlighted by fluorescing europium and cortisol aimed at places of specific monoclonal antibodies derived from mice . the measured fluorescence was inversely proportional to the level of serum cortisol in the samples of subjects . in all patients serum cortisol level was measured in the morning , between 7 and 10 a.m. to determine if the level of morning serum cortisol have any influence on patient s subjective experience of optimism , respondents were divided into two subgroups . subjects whose result on the scale of optimism was greater than + 0.60 were allocated to a subgroup of highly optimistic ( m = 4.64 ; sd = 0.20 ) , while those whose result exceeded -0.60 were allocated to a subgroup of low - optimistic patients ( m = 3.38 ; sd = 0.30 ) . the same method was applied to test the differences in the level of morning serum cortisol between the two subgroups of pessimistic patients . those whose result on the scale of pessimism was greater than + 0.60 were assigned to the subgroup of highly pessimistic ( m = 3.67 ; sd = 0.23 ) , while those whose result exceeded -0.60 were assigned to the subgroup low - pessimistic patients ( m = 2.22 ; sd = 0.28 ) the mann - whitney u test was used for comparison of continuous variables due to the small sample size .", "a sociodemographic questionnaire contained demographic and general information of gender and age , the level of education , marital status , employment and economic status was used . to test the level of optimism / pessimism the croatian version of scales of optimism and pessimism was applied containing 14 particles divided into two charts ( 15 ) . six particles contained the scale for optimism assessment , while 8 contained the scale for pessimism . each patient was asked to estimate the extent to which each particular statement was appropriate on a likert type scale of five degrees . the scale showed satisfactory reliability on a range from 0.74 to 0.77 for the scale of optimism and from 0.78 to 0.83 for the scale of pessimism . to determine the level of morning serum cortisol a fluorometric method utilizing delfia cortisol fluoroimunoessay was applied ( 16 ) , using lkb wallace 1230 arcus fluorometer measuring device . the measurement method was based on a competitive antigen - antibody reaction between cortisol highlighted by fluorescing europium and cortisol aimed at places of specific monoclonal antibodies derived from mice . the measured fluorescence was inversely proportional to the level of serum cortisol in the samples of subjects . in all patients serum cortisol level was measured in the morning , between 7 and 10 a.m. to determine if the level of morning serum cortisol have any influence on patient s subjective experience of optimism , respondents were divided into two subgroups . subjects whose result on the scale of optimism was greater than + 0.60 were allocated to a subgroup of highly optimistic ( m = 4.64 ; sd = 0.20 ) , while those whose result exceeded -0.60 were allocated to a subgroup of low - optimistic patients ( m = 3.38 ; sd = 0.30 ) . the same method was applied to test the differences in the level of morning serum cortisol between the two subgroups of pessimistic patients . those whose result on the scale of pessimism was greater than + 0.60 were assigned to the subgroup of highly pessimistic ( m = 3.67 ; sd = 0.23 ) , while those whose result exceeded -0.60 were assigned to the subgroup low - pessimistic patients ( m = 2.22 ; sd = 0.28 ) .", "the mann - whitney u test was used for comparison of continuous variables due to the small sample size .", "the study group consisted of a sample of 60 patients , including 30 males and 30 females , aged 49 - 88 years ( m = 62.68 ; sd = 8.67 ) . in the entire sample , 20 ( 33.33% ) patients completed primary school , 25 ( 41.66% ) had a high school level of education , and 15 ( 25% ) were college or university educated . values of morning serum cortisol level were in the range between 5.80 and 698.50 ( mdn = 242.85 ; q1-q3 = 83.75 to 372.45 ) . there were within proper range in 36 patients ( 60.00% ) , were increased in one ( 1.66% ) , and decreased in 23 patients ( 38.33% ) . basic demographic data ( n = 60 ) level of morning serum cortisol the average value of morning serum cortisol level in the subgroup of optimistic patients was within the proper range ( mdn = 262.00 ; q1-q3 = 197.50 to 376.00 ) , as well as in the group of pessimistic ones ( mares = 217.10 ; q1-q3 = 74.00 to 330.40 ) . there was no statistically significant difference in the level of morning serum cortisol between optimistic and pessimistic subgroup of patients ( z = -0.89 ; p = 0.37 ) ( figure 1 ) . level of morning serum cortisol in subgroups of optimistic and pessimistic patients there was no statistically significant correlation between the level of morning serum cortisol and expressed optimism ( r = 0.09 ; p > 0.05 ) , as well as between the level of morning serum cortisol and expressed pessimism ( r = 0.12 ; p>0.05 ) ( figure 1 ) .", "the aim of this study was to determine the relationship between the level of morning serum cortisol and perceived experience of optimism / pessimism in selected group of patients with de novo diagnosed cancer treated at the university clinical hospital mostar during the one - month period . the expectation of good or bad events to happen in the future is the simplest definition of optimism or pessimism ( 17 ) . they are not clearly separated as a constant ( e.g. a person may be optimistic in terms of job promotion , but pessimistic about getting married ) . only a small number of persons show a systematic tendency to adhere onto one of the extremes of either optimism or pessimism . however , there are certain life events influencing a person to incline to a higher level of one of the perceived experience extremes . our findings point out to the fact that the majority of patients did not emotionally react to stressful awareness about the newly diagnosed cancer , since in most of them ( 60% ) the level of morning serum cortisol as an objective indicator of reaction to a stressful event , was not increased ( table 2 ) . results of previous studies have shown that increased levels of serum cortisol are associated with a reduced resistance to infection and deranged immune system what may well contribute to stressful reaction ( 18 , 19 ) . it is characterized by cytokines over secretion contributing to inflammatory processes ( 21 , 22 ) . such a reaction is also characterized by increased activity of adrenal gland secreting cortisol in large quantities which consequently enhances the secretion of cytokines . therefore , it is to expect that perceived expression of optimism affecting the immune response may reduce the stress . however , our results do not support this , since the increased values of morning serum cortisol , as a possible indicator of respond to a stressful event , were not observed in the majority of patients in our series . additionally , no statistically significant correlation between the level of morning serum cortisol and perceived expression of optimism / pessimism was recorded ( p>0.05 ) ( table 2 , figure 1 ) . hence , most patients in our series did not react to the stress event by changing their mood . the possible explanation of this could be the fact that the study was conducted on a sample of patients with de novo discovered cancer who had not previously been exposed to the treatment of malignant disease or had not a metastatic disease ( e.g. brain metastases may affect the behavior and psychological status ) . consequently , such patients had not been exhausted and frustrated by illness yet , and were just initially confronted with the awareness of newly discovered disease . therefore , the impact of past experience and the environment were excluded as possible stressors in such patients ( 23 ) . this group of patients had not been confronted by the extreme conditions of the prolonged disease that may well affected their mental status and provoke a stressful reaction ( 24 - 27 ) . our results partially support the affective model of correlation between stress and physiological changes ( 13 ) . according to this model , optimistic mood is beneficial for the body only when the attempt to cope with stressful situations results in positive outcome . on contrary , in a case of failure to meet expectations ( i.e. , solution to problem ) , optimism can lead to a negative effect having an impact on the overall condition of the body consequently . our results can also be regarded through the fact that containing the disease usually requires compliance between the perception of optimism and pessimism . results of previous studies dealing with the perception of optimism / pessimism in cancer patients show a greater perceived level of optimism before the start of chemotherapy and increased perceived level of pessimism after chemotherapy in most patients ( 28 , 29 ) . regarding the level of education , most of the sample consisted of patients with secondary school ( 41.66% ) , followed by those with primary school completed ( 33.33% ) . regarding the employment status , the vast majority of patients were those retired and unemployed ( 79.99% ) ( table 1 ) . accordingly , most of them were of lower socioeconomic status and level of education , and their access to medical information or knowledge about the modern possibilities of cancer treatment was notably limited , which may have well affected their perception of the experience of optimism / pessimism ( 20 ) . having that in mind , we would like to underline that our results considering the assessment of perceived experience of optimism / pessimism in regard to a stressful event were ambivalent and dichotomized . therefore , we can conclude that the perceived experience of optimism / pessimism was not necessarily affected by a stressful event , but was most likely related to personal character , as well as the patients level of education and socio - economic status . during the study certain methodological limitations became apparent primarily stemming from its retrospective character , relatively small number of patients and short period of research . only the patients with newly diagnosed cancers were analyzed what may also present a certain methodological limitation of the study . therefore , future research should take into consideration patients exposed to the consequences of malignant disease long duration having in mind the potential impact of therapeutic response to neuroendocrine changes caused by such a disease . the sample of patients of both genders was analyzed when assessing hormonal influence to perceived expression of optimism / pessimist . that may also present the study bias . methodologically , it would be more appropriate to analyze one gender only , bearing in mind that different sex hormones , as a test variables , may have different effects on the immune system function affecting physiological changes .", "the study results did not confirm the effect of psychological status and the influence of physiological reaction to stressful condition , neither the impact of the level of cortisol to the perceived experience of optimism in selected groups of patients with newly diagnosed cancer . the results concerned with the perceptive experience of optimism / pessimism assessment were not a consequence of stress reaction but they were more correlated to general personal characteristics , the level of education , and socio - economic status of patients . the results do not confirm the impact of morning serum cortisol level onto physiological reactions to stressful conditions and situations in selected group of patients with de novo carcinoma . for further study it would be necessary to conduct a prospective research on a larger sample during a longer period ." ]

[ "hyperthyroidism is commonly associated with atrial fibrillation ( af ) , particularly in the elderly . we hereby report a case of patient with primary hypothyroidism presenting with af and pericardial effusion which resolved with levothyroxine therapy .", "he complained of chest pain which was substernal , nonradiating , and throbbing in nature . he smoked 10 cigarettes per day for past 25 years , and denied use of alcohol , caffeine , or drugs . physical examination was unremarkable except for the irregular heart rate ( approximately 130 beats per min ) and muffled heart sounds on auscultation . electrocardiogram [ figure 1 ] confirmed af with rapid ventricular rate , which responded to initial treatment with metoprolol [ figure 2 ] . af with rapid ventricular rate normalization of af with metoprolol thyroid function tests revealed a sensitive thyroid stimulating hormone ( tsh ) concentration of 34.70 iu / ml ( normal : 0.40 - 4.70 iu / ml ) , and thyroxine ( t4 ) of 5.57 g / dl ( normal : 8 - 12 g / dl ) confirming primary hypothyroidism . transthoracic echocardiography showed normal left ventricular systolic function ( ejection fraction of 63% ) , decreased left ventricular diastolic compliance , and massive pericardial effusion ( posterior 17 mm , anterior 13 mm ) . right atrial and right ventricle showed 30% collapse during diastole , mild left ventricular hypertrophy was present with no regional wall motion abnormalities . patient was treated with levothyroxine which lead to resolution of symptoms and restoration of normal sinus rhythm . repeat echocardiography showed no collapse of right atrium and right ventricle during diastole ) and mild pericardial effusion ( 11 mm circumferential ) .", "the most common cardiovascular signs and symptoms of hypothyroidism include bradycardia , mild hypertension ( diastolic ) , narrow pulse pressure , cold intolerance , pericardial effusion , cardiomyopathy and fatigue . hypothyroidism is often associated with electrocardiographic changes like bradycardia , right bundle branch block , flat or inverted t wave , qrs prolongation , qt prolongation , and infrequently ventricular arrhythmia , torsades de pointes . treatment of hypothyroidism is well - documented to cause af due to inadvertent overdosing of levothyroxine . although atrial arrhythmias are common and ventricular ectopy is rare in patients with hyperthyroidism , it is rarely associated with hypothyroidism . af is seen in 5 - 15% patients of hyperthyroidism and may be the presenting feature . increased chronotrophic activity due to increased thyroid hormones and increased sympathetic tone are the proposed underlying mechanisms . the physiological chronotropic response and normal tension of the heart muscle in diastolic phase depend on the action of triiodothyronine in the heart cells and its stimulating influence on na - k atpase and ca atpase in endoplasmic reticulum . normal contractility is also related to triiodothyronine stimulated transcription of the myosin heavy - chain alpha gene and inhibition of the heavy - chain beta gene . moreover , triiodothyronine acts on the cardiac muscle affects the number of beta adrenergic receptors and their sensitivity to catecholamines . few case reports have demonstrated that hypothyroidism may cause a prolongation of the qt interval which predisposes the patient to ventricular irritability . the canadian registry of atrial fibrillation investigators reported that 1.5% of 726 patients with af had hypothyroidism over a period of 1.7 years . studies have also reported that up to 8% of patients with atrial fibrillation were hypothyroid . hypothyroidism is known to cause nodal defects , but the mechanism of af in hypothyroidism is not known . it is also not clear whether its presence is causally related or is a mere manifestation of an underlying unrecognized structural heart disease . however in our case , reversal of af with levothyroxine treatment negates underlying structural damage of the heart nans suggests causal relationship . previous case reports have shown association of af with hypothyroidism but pericardial effusion was absent in those cases . this is possibly the first reported case of af and pericardial effusion in a case of hypothyroidism . young patients with no evidence of organic heart disease may be started on a full replacement dose of thyroxine . older patients or those with known or suspected ischemic heart disease , should initially be given about 25% of the anticipated replacement dose , and the dose should be increased gradually at 6 - 8 week intervals .", "" ]

[ "graft versus host disease ( gvhd ) remains a major cause of morbidity and mortality post hematopoietic cell transplant ( hct ) . the pathophysiology of acute gvhd involves priming of immune response by pre - transplant conditioning leading to tissue damage and induction of cytokine release , t cell activation and co - stimulation , alloreactive t cell expansion , differentiation and trafficking and destruction of target tissues by effector t cells ( 1 ) . four theories have been postulated based on experimental studies including thymic damage and defective negative selection of t cells generated from marrow progenitors after hct , aberrant production of transforming growth factor - , auto - antibody production , and deficiency of t - regulatory cells ( 2 ) . the main mechanism of action of alkylator based conditioning regimens and ionizing radiation is induction of dna damage . this damage is repaired by the dna repair pathways ( 3 ) . we have recently demonstrated that single nucleotide polymorphisms ( snps ) in the base excision repair ( ber ) pathway are significantly associated with transplant related mortality post allogeneic transplant ( 4 ) . we further hypothesized that snps in the ber pathway can lead to altered repair ( after conditioning induced tissue damage ) and altered t cell function ( secondary to thymic damage ) and may be one of the pathways implicated in the pathophysiology of gvhd . the ber pathway was selected as it plays an important role in repairing damage caused by ionizing radiation and alkylating agents commonly used in conditioning regimens for hct . we analyzed 179 snps in 27 genes in the ber pathway in 470 recipients of allogeneic hct using alkylating agents and ionizing radiation based conditioning regimes for hematologic malignancies at university of minnesota , for association with acute and chronic gvhd .", "all consecutive patients who underwent an allogeneic hct from an hla - identical sibling donor , matched or mismatched unrelated donor ( urd ) or single umbilical cord blood ( ucb ) transplant for hematological malignancies from january 1 , 1998 to december 31 , 2007 were eligible ( n=587 ) . all patients received a conditioning regimen including an alkylating agent and/or ionizing radiation . this study was approved by the institutional review board at the university of minnesota and waiver of informed consent from individual patients was obtained for this study . demographic and transplant related information regarding all patients undergoing a hct is prospectively entered in the university of minnesota bone marrow transplant database . this included patient and donor age at transplant , patient and donor gender , type of donor ( related , urd or ucb ) , graft source ( bone marrow versus peripheral blood stem cell versus cord blood ) , race , patient s underlying disease , disease status at transplant , hla matching between donor and recipient , conditioning intensity ( myeloablative or reduced intensity ) , conditioning regimen used for transplant , gvhd prophylaxis , cytomegalovirus ( cmv ) serological status of recipient and donor prior to transplant , date of diagnosis and grade of acute gvhd , date of diagnosis and development of chronic gvhd , malignancy relapse and survival at time of last follow up . hla - matching status for urd transplants was categorized as well matched , partially matched or mismatched based on classification proposed by weisdorf et al ( 5 ) . hla - matching status for cord blood transplants was based on antigen level hla - a , b and allele level hla - drb1 typing . dna samples from patients were obtained from peripheral blood samples collected prior to undergoing hct . all patients with acute leukemia had no evidence of leukemic blasts at the time of obtaining blood for dna extraction . dna was extracted from buffy coat using either the puregene dna extraction method ( for samples collected prior to 2001 ) ( gentra systems , minneapolis , mn ) or the qiagen mini blood kit ( all samples collected during or after 2001 ) ( qiagen inc . , san jose , ca ) as per manufacturer recommendations . all dna samples were collected and stored at 4c in the molecular diagnostics laboratory at university of minnesota medical center , fairview prior to use in the study . we used data from environmental genome project ( 6,7 ) to identify and select linkage disequilibrium ( ld ) tagsnps that had a frequency of 5% in the caucasian population in 27 ber genes . if genes did not have tagsnps information in the environmental genome project , we used hapmap data for caucasian populations to identify tagsnps that had 5% frequency in caucasian populations using the genome variation server software ( http://gvs.gs.washington.edu/gvs/ ) . we then supplemented this list with non - synonymous snps that were identified to be functionally important using three software programs ; polyphen ( 8) , sift ( 9 ) and snp3d ( 10 ) . this approach allowed us to select 263 snps ( 210 tagsnps and 53 snps that may be functionally important ) in 27 genes with known function in the ber pathway . all dna samples were genotyped using the sequenom iplex system at the biomedical genomics center at university of minnesota . of these , 179 snps were successfully genotyped after assuring quality control by selecting only snps with call rates > 80% . high quality genotyping was also assured by only selecting samples with a concordance rate of 95% or greater ( using 61 pairs of blinded duplicates ) for further analysis . hence 179 snps and 470 samples were analyzed . among snps that were successfully genotyped ( n=179 ) 80% were tagsnps ( n=143 ) and 20% were functionally important snps ( n=36 ) . detailed description of number of snps genotyped within individual genes is given in table 1 .", "we used data from environmental genome project ( 6,7 ) to identify and select linkage disequilibrium ( ld ) tagsnps that had a frequency of 5% in the caucasian population in 27 ber genes . if genes did not have tagsnps information in the environmental genome project , we used hapmap data for caucasian populations to identify tagsnps that had 5% frequency in caucasian populations using the genome variation server software ( http://gvs.gs.washington.edu/gvs/ ) . we then supplemented this list with non - synonymous snps that were identified to be functionally important using three software programs ; polyphen ( 8) , sift ( 9 ) and snp3d ( 10 ) . this approach allowed us to select 263 snps ( 210 tagsnps and 53 snps that may be functionally important ) in 27 genes with known function in the ber pathway . all dna samples were genotyped using the sequenom iplex system at the biomedical genomics center at university of minnesota . of these , 179 snps were successfully genotyped after assuring quality control by selecting only snps with call rates > 80% . high quality genotyping was also assured by only selecting samples with a concordance rate of 95% or greater ( using 61 pairs of blinded duplicates ) for further analysis . hence 179 snps and 470 samples were analyzed . among snps that were successfully genotyped ( n=179 ) 80% were tagsnps ( n=143 ) and 20% were functionally important snps ( n=36 ) . detailed description of number of snps genotyped within individual genes is given in table 1 .", "all statistical analyses were performed using sas software version 9.1 ( sas institute , inc . , minor allele frequencies ( maf ) and hardy weinberg proportions of snps genotyped were estimated . linkage disequilibrium among snps in the rfc1 gene was estimated using haploview software ( 12 ) . assuming an additive model for the snps ( where each snp was treated as a continuous variable with the homozygous major , heterozygote and homozygous minor genotypes indicating 0 , 1 or 2 copies of the minor allele being present ) , the association between each of these snps and acute and chronic gvhd was evaluated using a proportional hazards model with death as the competing risk as described by fine and gray ( 13 ) after adjustment for clinical covariates . covariates included recipient age , race , donor type , diagnosis , disease status at transplant , gender mismatch , cmv serostatus of recipient and donor , stem cell source , conditioning regimen ( myeloablative or reduced intensity ) and gvhd prophylaxis . a p value 0.01 was considered to be significant to select a snp for multivariate analysis and individual snps that were significant were evaluated in a backward stepwise multiple regression model after adjustment for clinical covariates . one hundred and thirty five of 355 patients who were alive by day 100 developed chronic gvhd and were analyzed in a similar manner . grade ii - iv acute gvhd was evaluated as a time dependant covariate in the model for chronic gvhd .", "the majority underwent myeloablative hct from an hla - identical sibling donor ( n=231 ) , 72% of the cohort were 21 years at the time of transplant and 86% of the cohort were caucasian . acute leukemia ( acute myeloid leukemia and acute lymphoid leukemia ) ( 51% ) was the most frequent diagnosis . among 75 urd recipients , 27 ( 36% ) of recipients received a transplant from a well matched donor , 36 ( 48% ) from a partially matched donor and 10 ( 13% ) from a mismatched donor . insufficient data was available to categorize two patients . among 99 ucb recipients , hla - matching status for ucb transplants was based on antigen level hla - a , b and allele level hla - drb1 typing . of these , 47% were mismatched at a single locus ( 5/6 ) , 43% were mismatched at 2 loci ( 4/6 ) and 9% received a 6/6 matched transplant . the cumulative incidence of grade ii - iv acute gvhd was 40.6% ( 95% ci 35.8 - 45.4% ) and the cumulative incidence of chronic gvhd was 34% ( 95% ci 28.8 - 39.3% ) . the overall survival was 48.5% ( 95% ci 43.8 - 53.2% ) at three years and 44.4% ( 95% ci 39.4 - 49.5% ) at five years . univariate analysis was performed by entering each snp in a model adjusted for all clinical covariates . in univariate analysis , three snps located in rfc1 gene ( rs1057807 , rs4975003 and rs6844176 ) were significantly associated with grade ii - iv acute gvhd ( table 3a ) . however , all three snps were in strong linkage disequilibrium with each other ( r 0.88 ) as shown in figure 1 . in multivariate analysis ( table 4a ) , one snp ( rs6844176 ) remained independently associated with a higher risk of grade ii - iv acute gvhd ( rr 1.39 , 95% ci 1.14 - 1.70 , p=0.001 ) . the model was also evaluated for interactions between snp and significant clinical co - variates . the snp , rs6844176 , was significantly associated with higher risk of grade ii - iv acute gvhd in patients with relapse or primary induction failure at transplant ( p=0.03 ) , but not in those without relapse or primary induction failure ( p=0.15 ) . the cumulative incidence of grade ii - iv acute gvhd was 47% ( 95% ci 37 - 56.9% ) in 115 patients with homozygous minor genotype versus 42% ( 95% ci 34.9 - 49.1% ) in 219 patients with heterozygous genotype versus 32.3% ( 95% ci 24 - 40.7% ) in 133 patients with homozygous major genotype ( p = 0.06 ) ( figure 2 ) . the same three snps ( rs1057807 , rs4975003 and rs6844176 ) in rfc1 gene also showed similar but non significant association with grade iii - iv acute gvhd in univariate analysis ( all p 0.06 ) ( table 3b ) . as shown in table 4b , in multivariate analysis , the same snp ( rs6844176 ) showed a trend towards a higher risk of grade iii - iv acute gvhd ( p=0.09 ) . in univariate analysis , one snp ( rs1805410 ) , located in the parp1 gene was significantly associated with a higher risk of chronic gvhd with a relative risk of 1.81 ( 95% ci 1.29 - 2.54 , p=0.001 ) ( table 3c ) . other significant variables included year of transplant and prior grade ii - iv acute gvhd . the cumulative incidence of chronic gvhd was 50% ( 95% ci 20.8 - 79.2% ) in 12 patients with homozygous minor genotype versus 42.9% ( 95% ci 31.5 - 54.3% ) in 84 patients with heterozygous genotype versus 30.9 ( 95% ci 24.9- 36.9% ) in 259 patients with homozygous major genotype ( p=0.026 ) ( figure 3 ) .", "univariate analysis was performed by entering each snp in a model adjusted for all clinical covariates . in univariate analysis , three snps located in rfc1 gene ( rs1057807 , rs4975003 and rs6844176 ) were significantly associated with grade ii - iv acute gvhd ( table 3a ) . however , all three snps were in strong linkage disequilibrium with each other ( r 0.88 ) as shown in figure 1 . in multivariate analysis ( table 4a ) , one snp ( rs6844176 ) remained independently associated with a higher risk of grade ii - iv acute gvhd ( rr 1.39 , 95% ci 1.14 - 1.70 , p=0.001 ) . the model was also evaluated for interactions between snp and significant clinical co - variates . the snp , rs6844176 , was significantly associated with higher risk of grade ii - iv acute gvhd in patients with relapse or primary induction failure at transplant ( p=0.03 ) , but not in those without relapse or primary induction failure ( p=0.15 ) . the cumulative incidence of grade ii - iv acute gvhd was 47% ( 95% ci 37 - 56.9% ) in 115 patients with homozygous minor genotype versus 42% ( 95% ci 34.9 - 49.1% ) in 219 patients with heterozygous genotype versus 32.3% ( 95% ci 24 - 40.7% ) in 133 patients with homozygous major genotype ( p = 0.06 ) ( figure 2 ) . the same three snps ( rs1057807 , rs4975003 and rs6844176 ) in rfc1 gene also showed similar but non significant association with grade iii - iv acute gvhd in univariate analysis ( all p 0.06 ) ( table 3b ) . as shown in table 4b , in multivariate analysis , the same snp ( rs6844176 ) showed a trend towards a higher risk of grade iii - iv acute gvhd ( p=0.09 ) .", "in univariate analysis , one snp ( rs1805410 ) , located in the parp1 gene was significantly associated with a higher risk of chronic gvhd with a relative risk of 1.81 ( 95% ci 1.29 - 2.54 , p=0.001 ) ( table 3c ) . other significant variables included year of transplant and prior grade ii - iv acute gvhd . the cumulative incidence of chronic gvhd was 50% ( 95% ci 20.8 - 79.2% ) in 12 patients with homozygous minor genotype versus 42.9% ( 95% ci 31.5 - 54.3% ) in 84 patients with heterozygous genotype versus 30.9 ( 95% ci 24.9- 36.9% ) in 259 patients with homozygous major genotype ( p=0.026 ) ( figure 3 ) .", "the pathophysiology of the disease ( especially chronic gvhd ) remains to be fully defined . we found three snps in rfc1 genes to be significantly associated with grade ii - iv acute gvhd and one snp in the parp1 gene to be significantly associated with chronic gvhd . in our prior report ( association between genetic variants in the ber pathway and outcomes after hct , bbmt ) , we have identified three snps in tdg , lig3 and mutyh genes ( rs167715 , rs3135974 , rs3219463 ) to be associated with transplant related mortality ( trm ) in multiple regression analysis . these differ from the genetic variants identified in the current analysis , suggesting that the polymorphisms identified in the current analysis represent an association with occurrence of gvhd and not with mortality . further analysis of trm showed that the association between the 3 snps ( rs167715 , rs3135974 , rs3219463 ) and trm remained unchanged even after controlling for grade ii - iv acute gvhd as a time dependent co - variate ( data not shown ) , indicating that these snps affect trm through mechanisms independent of gvhd . base excision repair is the major dna repair pathway for repair of non - bulky damaged bases , abasic sites and single stranded breaks caused by ionizing radiation and alkylating agents ( 3 ) . the three snps associated with grade ii - iv acute gvhd were all located in rfc1 gene . though in multivariate analysis , only rs6844176 remained significantly associated with acute gvhd , all three snps ( rs6844176 , rs4975003 and rs1057807 ) were in strong ld , hence , it is likely that the snp with the strongest association may in fact be a surrogate for the other two snps strongly correlated and located in the region . the protein encoded by this gene is the large subunit of replication factor c , a dna - dependent atpase that is required for eukaryotic dna replication and repair . the protein acts as an activator of dna polymerases and promotes coordinated synthesis of both strands ( 14 ) . these snps showed a similar ( though not significant ) association with grade iii - iv acute gvhd , possibly due to limited sample size when evaluating grade iii - iv acute gvhd . parp1 ( poly [ adp - ribose ] polymerase 1 ) gene encodes an enzyme that works by modifying nuclear proteins by poly adp - ribosylation ( 15 ) . parp1 also binds with single strand breaks through its n - terminal zinc fingers and recruits xrcc1 , dna pol , and dna ligase iii in the short patch ber pathway ; and recruits xrcc1 , flap endonuclease 1 , and dna ligase i in long - patch ber pathway ( 16 ) . parp-1 overactivation in response to extensive dna damage results in necrosis ( 17 - 20 ) . in addition to inducing necrosis , parp-1 also has a profound modulatory effect on the inflammatory response . parp-1 can form stable complexes with transcription factors such as p53 and ap-2 ( 21,22 ) . parp-1 can also act as a coactivator of nf - kb ( 21 - 23 ) and , therefore , may be involved in the induction of tnf-. polymorphisms resulting in altered activity in this gene could modulate cellular necrosis and altered inflammatory response and hence be implicated in the pathogenesis of gvhd . these results also need to be confirmed in patients receiving non - alkylator based reduced intensity regimens where the observed higher risk associated with these snps should not be present . this analysis could not be performed in the current study as all conditioning regimens at our institution ( myeloablative as well as reduced intensity ) are alkylator based . several studies have evaluated the impact of polymorphisms involving minor histocompatibility antigens , cytokine genes and innate immunity genes towards gvhd . a recent study reported a higher risk of acute gvhd when donor and recipient were mismatched for homozygous deletion of ugt2b17 , a gene expressed in gvhd - affected tissues and giving rise to multiple histocompatibility antigens ( 24 ) . other minor histocomatibility antigens including hy , ha-1 , ha-2 and ha-3 have been evaluated in the etiology of both gvhd and disease relapse ( 25 - 35 ) . polymorphisms in donor and recipient genes for cytokines have been demonstrated to be risk factors for gvhd . tumor necrosis factor ( tnf)- , interleukin 10 ( il-10 ) , interferon- ( ifn ) variants have correlated with gvhd in some , but not all , studies ( 36 - 39 ) . genetic polymorphisms of proteins involved in innate immunity , such as nucleotide oligomerization domain 2 and keratin 18 receptors , have also been associated with gvhd ( 40 ) . these studies provide support to the hypothesis that tissue injury and resulting cytokine release are implicated in the pathogenesis of graft versus host disease . polymorphisms in dna repair pathways in conjunction with other pathways could also be implicated by impeding or accelerating repair of injured tissue and hence affecting gvhd . this study represents the first analysis of snps in ber dna repair pathway towards acute and chronic gvhd . if confirmed , they represent an important step towards understanding the pathophysiology of gvhd as well as identifying subgroups at high risk for gvhd towards whom novel prophylactic strategies could be targeted ." ]

[ "herbal plants have been used as medicines for thousands of years , and ; some specific plants have been used for particular ailments . medicinal plants are sources of raw materials for both traditional systems of medicine and modern medicine . these medicines are also in great demand in the developed world for primary health care because of their efficacy , safety and fewer lesser side effects . traditionally , herbs and herbal products have been considered to be nontoxic and have been used by the general public and traditional medicinal doctors worldwide to treat a range of ailments . however , the fact that something is natural does not necessarily make it safe or effective . the active ingredients of plant extracts are chemicals that are similar to those in purified medications , and they have the same potential to cause serious adverse effects . whilst the literature documents severe toxicity resulting from the use of herbs , on many occasions the potential toxicities of herbs and herbal products have not been recognized . pistacia integerrima j. l. stewart ex brandis ( pi ) is a species of pistachio tree , commonly called zebrawood , native to asia . it is one of the important plants of indian traditional medicine and belongs to the family anacardiaceae . the phytochemical constituents of pi have been reported to be tannins , essential oils and resins . the oil contains alpha - pinene ( 25% ) , camphene ( 27% ) , di - limonene ( 4% 5% ) , 1:8-cineol ( 10% ) , caprylic acid ( 15% ) , alpha - terpineol ( 20% ) and aromadendrene ( 4% 5% ) . the two triterpenic acids are ketocarboxylic and appear to be identical to the alpha and the beta acids [ 3 , 4 ] . pi is used for a variety of purposes in india , including timber , dye , and fodder ; it is also used as a herbal remedy for many ailments including coughing , asthma , fever , vomiting , diarrhea , loss of appetite , nose bleeds , snakebites , and gastrointestinal and liver disorders [ 5 - 8 ] . pi is reported to be useful as an anti- inflammatory , and an anti - diabetic agent and as a blood purifier [ 9 - 11 ] . galls excrescences are formed by insects on the leaves , petioles and branches of plants . these leaf galls are harvested and used to make kakad shringi ; a herbal medicine used to treat diarrhea in northern india .", "pi leaf galls were collected in the month of july from the nadaun block of the hamirpur district , himachal pradesh . ravindra pandey , department of natural products research , columbia institute of pharmacy , raipur , and a voucher specimen , i.e. , leaf galls , with voucher number 0342 , was deposited in the herbarium of the institute . the powdered material was soaked in methanol , distilled water , chloroform , ethyl acetate and n - hexane for one week and subjected to extraction until exhaustion of the plant material . male wistar rats with weights in the range of 160 200 g were used for the experiments , which were carried out according to a protocol approved by the institutional animal ethics committee , columbia institute of pharmacy , raipur , chhattisgarh , india ( 1321/ac/10/cpcsea , dated- 01/28/2010 ) . the animals were housed in polycarbonate cages in a room with a 12-hour day - night cycle , a temperature of 22 2c , and a humidity of 45% 64% . during the entire experimental period , animals were fed with a balanced commercial pellet diet ( ashirwad industries , mohali , india ) and were allowed ad libitum access to water and normal saline . the acute toxicity studies were conducted as per guideline 425 of the organization of economic and cooperation development ( oecd ) , where a dose limit of 2,000 mg / kg of body weight was used . animals were observed individually after dosing at least once during the first 30 minutes , periodically during the first 24 hours , with special attention given during the first 4 hours and daily thereafter , for a total of 14 days . individual body weights were recorded once a week as well as on the day the experiment ended . changes in skin , fur , eyes , mucous membranes secretions , excretions , and autonomic activity ( e.g. lacrimation , piloerection , pupil size , unusual respiratory pattern ) were recorded , as were changes in gait , posture , and response to handling , as well as the presence of clonic or tonic movements . the sub - acute toxicity studies were conducted as per the guideline 407 of the oecd ; this provides information on the possible health hazards likely to arise from repeated exposure over a relatively limited period of time . four groups of animals were selected , group 1 being the normal control and groups 2 , 3 and 4 being treated daily with pi at doses of 250 , 500 , and 1,000 mg / kg of body weight , respectively , for 28 days . all animals were monitored for toxic manifestations such as change in body weight and , mortality . after 28 days all surviving animals were fasted overnight , after which blood samples were collected for hematological and biochemical analyses . animals were sacrificed after blood collection , and internal organ were removed and preserved in 10% formalin for histological examination . the hematology parameters measured for the sub - acute toxicity study of pi were white blood cell count ( wbc ) , red blood cell count ( rbc ) , hemoglobin ( hb ) , hematocrit ( hct ) , mean corpuscular volume ( mcv ) , mean corpuscular hemoglobin ( mch ) , mean corpuscular hemoglobin concentration ( mchc ) , platelets ( plt ) and lymphocyte ( lymp ) . clinical biochemistry analysed to investigate the major toxic effects on tissues and specifically , the effects on the kidneys and the liver were performed on blood samples obtained from of all animals . biochemical parameters measured for the sub - acute toxicity study of pi were glucose , albumin , urea , total protein ( tp ) , serum glutamate oxaloacetate transaminase ( sgot ) and serum glutamate pyruvate transaminase ( sgpt ) . histological examinations were performed on the tissues , which had been preserved in 10% formalin solution . in this study , all data are expressed as means standard errors of the mean ( sems ) . the results were analyzed statistically through graph pad prism 6.0 by using the twoway analysis of variance ( anova ) , followed by the bonferroni post - test to calculate the level of significance . the number of animals was six ( n = 6 ) ; statistically significant difference in the outcomes , when compared to the control group , were indicated as follows : p < 0.05 , p < 0.01 , p < 0.001 .", "an investigation of acute toxicity is an initial step in the characterization of the biological effect of any substance and is necessary for conducting any biological experiment . no deaths or hazardous signs were recorded in the rats during the 14 days of observation after acute treatment by an oral route with pi at doses of 50 , 300 , and 2,000 mg / kg of body weight . in sub - acute toxicity investigation , no toxicity and no deaths were recorded during the 28 days of treatment by an oral route with pi in doses of 250 , 500 , and 1,000 mg / kg of body weight . no significant changes were observed in the body weights of the both control and the experimental groups of animals ( figs . the hematological profiles of the animals revealed no significant change in any of the clinical parameters ( tables 1,2 ) . the mchcs for the experimental animals of both sexes were higher than those for the control animals , but the values were within the normal range , demonstrating the methanolic extract of pi exhibited no toxicity . during the biochemical analyses , all the parameters were in the normal range , and no significant changes were noted when the values of the parameters for the different dose groups were compared with the values for the control group . slight variations were observed in parameters such as glucose ( glu ) , urea , sgpt , sgot in the 1,000 mg / kg of body weight dose group , but the values were in the normal range ( tables 3,4 ) . the organs were found to be devoid of any sign of toxicity , and no significant changes in any of the organ weights were observed ( tables 5,6 ) . the histopathological examination of the kidney , lungs and liver were normal in both the control and the treated groups .", "the research protocol was envisaged and designed to evaluate the toxicity profile of methanolic extract of pi with a main focus on observing the normal physiological conditions of experimental animals after treatment the with extract . thus , because of the advancement of research in this area , a wide range of parameters and experimental targets were studied to assess the overall profile of the pi extract to determine if any toxicity was present . the various hematological and biochemical parameters evaluated for the rats showed no abnormalities , and the values were within normal physiological limits and were comparable to the values in the vehicle - treated ( control ) animals . the pi extract is seen to have had no , toxic effect on any of the observed blood parameters , wbc , rbc , hb , hct , mch , mchc , plt and lymp , for the different dose levels . regardless of the doses of the pi extract the blood parameters were within the normal range . in ( fig . 2 ) , small differences in the levels of the biochemical parameters sgpt and sgot can be seen . higher doses of the pi extract , i.e. 500 and 1,000 mg / kg of body weight , both caused increase in the sgpt and the sgot levels , but these increases did not take the levels outside the normal range . histopathological evaluation showed no adverse effects of pi extract on the dissected organs ; swelling , atrophy , and hypertrophy were not observed . the results of the urine analysis showed no signs of toxicity in the urine ; the parameters being within the normal range ; creatinine , ph , color , quantity of urine . however , pus cells , sperms , bacteria , and ketone bodies were found , but rarely . no statistically significant differences were found in any of the parameters between the control and the treated groups with respect to various vital organs , and no visceral abnormalities were seen in any of the groups . all animals survived until the scheduled euthanasia and no significant gross pathological alterations were found in the internal organs .", "in summary , our acute and sub - acute toxicity studies of wistar rats revealed no toxicological symptoms or mortality at any of the dose levels of methanolic extract of pi used in this research . daily treatments with pi at intervals of 24 hours in doses of 250 , 500 , and 1,000 mg / kg of body weigh p.o . had no adverse effect on body weight . the various hematological and biochemical parameters evaluated in the rats showed no abnormalities , and the values were within the normal physiological limits and were comparable to the values for the vehicle - treated ( control ) animals . the methanolic extract of pi was found to be non - toxic based on the results of the oral acute and sub - acute toxicity tests performed on rats in this research . however , an evaluation of chronic toxicity is needed to determine the long - term safety of the extract . values are expressed as means sems ( number of animals , n = 6 ) ; and were significantly different at p < 0.05 , p < 0.01 , and p < 0.001 , when compared with the control group . sems , standard errors of the mean ; wbc , white blood cell ; rbc , red blood cell , hb , haemoglobin ; hct , hematocrit ; mcv , mean corpuscular volume ; mch , mean corpuscular haemoglobin ; mchc , mean corpuscular hemoglobin concentration ; plt , platelets ; lymp , lymphocyte . values are expressed as means sems ( number of animals , n = 6 ) ; and were significantly different at p < 0.05 , p < 0.01 , and p < 0.001 , when compared with the control group . sems , standard errors of the mean ; wbc , white blood cell ; rbc , red blood cell , hb , haemoglobin ; hct , hematocrit ; mcv , mean corpuscular volume ; mch , mean corpuscular haemoglobin ; mchc , mean corpuscular hemoglobin concentration ; plt , platelets ; lymp , lymphocyte . values were expressed as means sems ( n = 6 ) and were significantly different at p < 0.05 , p < 0.01 , and p < 0.001 , when compared with control group . sems , standard errors of the mean ; glu , glucose ; tp , total protein ; alb , albumin ; sgpt , serum glutamate oxaloacetate transaminase ; sgot , serum glutamate pyruvate transaminase . values were expressed as means sems ( n = 6 ) and were significantly different at p < 0.05 , p < 0.01 , and p < 0.001 , when compared with control group . sems , standard errors of the mean ; glu , glucose ; tp , total protein ; alb , albumin ; sgpt , serum glutamate oxaloacetate transaminase ; sgot , serum glutamate pyruvate transaminase . values were expressed as means sems ( n = 6 ) and were significantly different at p < 0.05 , values were expressed as means sems ( n = 6 ) and were significantly different at p < 0.05 , p < 0.01 , and p < 0.001 , when compared with control group . n = 6 ) and were ; significantly different at p < 0.05 , p < 0.01 , and p < 0.001 , when compared with the control group . values are expressed as means sems ( number of animals , n = 6 ) and were ; significantly different at p < 0.05 , p < 0.01 , and p < 0.001 , when compared with the control group ." ]

[ "pemphigus is an autoimmune blistering disease characterized by blisters and erosions on the skin or mucosal membranes or both . the two main types of pemphigus are pemphigus vulgaris ( pv ) and pemphigus foliaceus ( pf ) . in most countries , pv accounts for about 70% of all cases of pemphigus , presenting with skin or mucosal symptoms or both . pf , on the other hand , accounts for about 20% of cases in most countries , where there are not endemic forms of pf , and presents only with skin manifestations [ 1 - 3 ] . because pemphigus is an autoimmune disease , immunosuppressive agents have been employed to control and manage the disease . since the advent of systemic corticosteroids , the mortality associated with pemphigus has reduced from 90% to 10% and is now usually related to complications of treatment . steroids are still the mainstay of treatment , usually used at high doses initially to get the disease under control and then in conjunction with a steroid - sparing agent for maintenance . because of the side effects associated with long - term systemic corticosteroids such as hypertension , diabetes mellitus , osteoporosis , and ocular complications , a lot of the recent research in pemphigus has been directed at finding the optimal steroid - sparing agent . though many treatments have been tried in the management of pemphigus , often demonstrating clinical benefit in individual case reports and case series , the evidence supporting their use has not been confirmed in rcts . this is due to the rarity of the disease in most countries where rcts have been performed and difficulty in recruiting patients , resulting in underpowered studies . a recent cochrane review comparing treatments for pemphigus found significant heterogeneity amongst the rcts with respect to the study designs , primary outcome measures , and therapeutic end - points . such variation prevented the authors from performing direct comparisons and a meaningful meta - analysis . to solve this problem of variation between studies , a panel of international bullous experts convened on many occasions to form a consensus paper on the definitions of disease and therapeutic end - points for pemphigus . the goal of this consensus paper was to facilitate researchers and clinicians to design studies with similar study end - points so that even if an rct was underpowered , its data could be used in conjunction with other similar studies in a meta - analysis . it is hoped that in the coming years the rcts will incorporate the end - points and definitions from the consensus paper in their study designs so that meaningful comparisons and meta - analyses can be performed .", "this paper looks at the evidence from rcts that have assessed treatments for pemphigus . as mentioned above , systemic corticosteroids are employed as first - line treatment with lower doses used as maintenance . though higher doses ( 120 mg / day ) result in a more rapid control of disease than lower doses ( 60 mg / day ) , there is no evidence that the higher doses are beneficial in the long term . therefore , it is recommended that 1 mg / kg per day be the initial dose for managing pemphigus . steroid - sparing agents are introduced immediately if safe to do so ( for example , after normal results from a thiopurine s - methyltransferase [ tpmt ] test ) . once consolidation has been achieved in accordance with the consensus definitions for pemphigus ( that is , disease progression has been halted ) , a slow standardized tapering of corticosteroid is commenced over about a 4-month period , which we term the werth taper . steroid - sparing agents are employed to reduce the cumulative exposure and side effects associated with long - term steroid use . such agents include azathioprine , mycophenolate mofetil , intravenous immunoglobulin ( ivig ) , rituximab , cyclophosphamide , methotrexate , and cyclosporine . an rct comparing a combination of prednisolone plus azathioprine to prednisolone plus placebo in 56 patients with newly diagnosed pv found no statistically significant difference between the 2 groups after 1 year of treatment . the steroid - sparing effects of adjuvants were also demonstrated in another rct , which showed similar efficacy with azathioprine , mycophenolate mofetil ( mmf ) , and intravenous cyclophosphamide . the steroid - sparing effect was demonstrated only when all three agents were pooled together as one group . because of the similarities in efficacy and side effect profiles , clinicians often use azathioprine or mmf as first - line therapy . no study has been able to prove one to be more effective than the other [ 11 - 13 ] . though mmf is a steroid - sparing agent that is safe and effective , a recent rct was unable to demonstrate clinical benefit in adding it to steroids in terms of outcome at one year , but in subanalysis it had benefits at other time points . rcts to date have failed to show a beneficial effect of cyclosporine in the management of pemphigus . remission and relapse rates were similar in all three groups , and there was no clear benefit of using a combination treatment . in fact , they noticed more side effects in the combination groups compared with using steroids alone . a multicenter rct comparing various doses of ivig found patients treated with a higher dose of ivig had a better outcome . patients received one of three doses : 0 mg / kg per day ( placebo infusion ) , 200 mg / kg per day , or 400 mg / kg per day . there was a dose - response relationship with more patients benefiting from the higher dose and objectively this correlated with lower desmoglein ( dsg)-1 and dsg-3 autoantibody titers . the limitation of these studies was their short - term follow - up , so that relapse rates could be compared with other options . rituximab , an anti - cd20 monoclonal antibody , is effective in recalcitrant pemphigus and is typically prescribed for patients who are unable to taper steroids without flare of their disease or in patients who are still flaring despite combination therapy ( steroids + steroid - sparing agent ) . rituximab is associated with a reduction in autoantibodies ( dsg-1 and -3 ) and b cell depletion . the clinical benefits are noticed within 2 to 3 months of infusion and can last years . one study found that the combination of rituximab for 3-weeks and ivig for the fourth week followed by maintenance monthly rituximab and ivig results in rapid clinical resolution , steroid cessation , and prolonged remission . another study found similar response and relapse rates with rituximab alone . despite case reports suggesting a potential role for cyclophosphamide in pemphigus treatment , benefits have not been reproduced in rcts , not even for cyclophosphamide with pulses of dexamethasone randomized against prednisone with azathioprine . there are some issues with the design of this rct , with modifications of the cyclophosphamide treatment arm compared with the original protocol and timing of cyclophosphamide doses and cessation of treatment . in clinical practice , there is reservation from clinicians and patients using this medication given the potential long - term side effects of infertility , bladder cancer , and hemorrhagic cystitis , although these adverse effects have not been demonstrated in pemphigus rcts . nevertheless , the lack of level 1 evidence and the potential harmful side effects make cyclophosphamide a second- or third - line steroid - sparing agent . it is typically not considered unless alternative therapies have failed and should not be used on young patients unless they were not planning on having further children . hence , further evidence is required to attest to the benefit of this modality in treating pemphigus . although the long - term efficacy of many of the therapies in pemphigus has not been evaluated in studies , it has been noted that 60% of patients with severe pemphigus treated with rituximab were in long - term remission of 6 years . in comparison , the remission rates for patients managed in the ratnam 5-year study were 36% ( 4/11 ) with a dose of 120 mg / kg per day and 9% ( 1/11 ) with a starting dose of 60 mg / kg per day . rituximab has not been officially approved by the food and drug administration or european medicines agency for pemphigus , although there are reports of success with its off - label use . ivig is approved for relapsing and recalcitrant pemphigus by medicare and the blood bank / official funding agencies of various countries and has also been approved by the therapeutics goods administration in australia .", "systemic corticosteroids are the mainstay of treatment for pemphigus . much of the recent research has been assessing the efficacy of steroid - sparing agents , most commonly azathioprine , mmf , rituximab , methotrexate , ivig , and cyclophosphamide . although strong evidence in the form of rcts is lacking , it does not mean that these systemic treatments are ineffective . because of the rarity of the disease , studies are often underpowered and fail to demonstrate a statistically significant difference between the active and control groups . the evidence to date indicates that adding an adjuvant to steroids has a significant steroid - sparing effect , reducing the cumulative exposure to steroids . azathioprine and mmf are often considered first - line therapies for pv with good improvement . rituximab is beneficial in patients who have poorly controlled disease despite high - dose steroids or steroid - sparing agents ( or both ) or are contra - indicated for receiving steroids . ivig in short - term studies is effective for recalcitrant cases but its duration of treatment needs further investigation . as more studies incorporate the definitions of disease and therapeutic end - points of the recent consensus statement , it is hoped that valuable and meaningful meta - analyses will provide more definitive answers .", "" ]

[ "participants were recruited in the dominiek savio institute , a service center for people with physical disabilities in belgium . the dominiek savio institute offers ambulatory , semi - residential , and residential services to children and adults who need support in the domains of living , education , and work . participants of this study were included if they were diagnosed with a neurological condition resulting in a major physical disability ( e.g. , cerebral palsy , spina bifida , and traumatic brain injury ) . in order to achieve a homogenous sample , individuals with a medical condition that was progressive by nature ( e.g. , huntington s disease , neuromuscular diseases ) were excluded from participation . this resulted in a sample of 65 adults ( 31 male ; 34 female ) , representing the most common physical disabilities . most participants were diagnosed with cerebral palsy ( 80% ) followed by traumatic brain injury ( 15% ) and spina bifida ( 5% ) . a total of 48% of the sample was diagnosed with an intellectual disability ( iq - score lower than 70 ) . table 1demographic and background variables of the participants ( n = 65)percentage ( % ) age 21 - 3012 31 - 4029 41 - 5040 51 - 6019primary disability cerebral palsy80 spina bifida5 traumatic brain injury15secondary disability intellectual disability48 deafness / hearing impairment6 blindness / visual impairment8 speech / language impairment46 psychiatric impairment19 cognitive impairments ( e.g. , apraxia , ataxia , amnesia)12intelligence level > 7152 567025 465511 36459 21353 demographic and background variables of the participants ( n = 65 ) the supports intensity scale ( sis ) and the barthel index ( bi ) were administered according to the guidelines . both scales were scored by caregivers who were familiar with the person for at least 3 months . for the sis , individuals were rated by staff workers who held an academic degree and had sufficient knowledge of the concept of the bi was rated by the personal assistant ( pa ) of each participant . for the bi , raters were assisted by the first author ( e.g. , instruction ofunclear items , verifying that all items were scored ) .", "participants were recruited in the dominiek savio institute , a service center for people with physical disabilities in belgium . the dominiek savio institute offers ambulatory , semi - residential , and residential services to children and adults who need support in the domains of living , education , and work . participants of this study were included if they were diagnosed with a neurological condition resulting in a major physical disability ( e.g. , cerebral palsy , spina bifida , and traumatic brain injury ) . in order to achieve a homogenous sample , individuals with a medical condition that was progressive by nature ( e.g. , huntington s disease , neuromuscular diseases ) were excluded from participation . this resulted in a sample of 65 adults ( 31 male ; 34 female ) , representing the most common physical disabilities . most participants were diagnosed with cerebral palsy ( 80% ) followed by traumatic brain injury ( 15% ) and spina bifida ( 5% ) . a total of 48% of the sample was diagnosed with an intellectual disability ( iq - score lower than 70 ) . table 1demographic and background variables of the participants ( n = 65)percentage ( % ) age 21 - 3012 31 - 4029 41 - 5040 51 - 6019primary disability cerebral palsy80 spina bifida5 traumatic brain injury15secondary disability intellectual disability48 deafness / hearing impairment6 blindness / visual impairment8 speech / language impairment46 psychiatric impairment19 cognitive impairments ( e.g. , apraxia , ataxia , amnesia)12intelligence level > 7152 567025 465511 36459 21353 demographic and background variables of the participants ( n = 65 )", "the supports intensity scale ( sis ) and the barthel index ( bi ) were administered according to the guidelines . both scales were scored by caregivers who were familiar with the person for at least 3 months . for the sis , individuals were rated by staff workers who held an academic degree and had sufficient knowledge of the concept of support which is also recommended by the sis manual ( aaidd 2004 ) . the bi was rated by the personal assistant ( pa ) of each participant . for the bi , raters were assisted by the first author ( e.g. , instruction ofunclear items , verifying that all items were scored ) .", "evidence for the good psychometric properties of the instrument has been provided in both dutch and belgium samples ( buntinx 2006 ; claes et al . the sis is composed of three separate areas in which support may be needed : life activities ( 57 items ) , medical conditions ( 16 items ) and behavioral conditions ( 13 items ) . the domain of life activities is composed by 7 subscales : home living , community living , life - long learning , employment , health and safety , social activities , and protection and advocacy . for these subscales , ratings are made on a 5-points scale with regard to the frequency of support ( ranging from none to hourly ) , the daily support time needed ( ranging from none to 4 h or more ) and the type of support ( ranging from none to full physical assistance ) . additionally , ratings in the areas of medical and behavioral conditions are assessed on a 3-points scale , ranging from no support , some support and extensive support needed . by summing up all scores on the subscales , a total raw score is derived . a dutch validated version of bi was used in order to measure the practical skills of the individuals included in our sample . the bi is a widely used and accepted instrument in clinical and scientific research to assess a range of functional abilities in activities of daily living ( adl ) . the bi has been considered as the gold standard to measure adl - abilities ( dijkstra et al . a total of ten domains of adl are rated by a primary caregiver on a scale ranging from ( 0 ) fully dependent to ( 3 ) fully independent . these domains of adl include : bowel control , bladder control , personal hygiene , toilet use , feeding , transfer , mobility , dressing , stair climbing , and bathing . the total score ( ranging from 0 to 20 ) gives an indication of the care dependency of the person . the lower the scores , the more dependent the person is on care , and vice versa . the bi has been considered as a reliable and valid instrument to measure activities of daily living ( adl ) in people with neuromuscular and muscoskelatal disorders . 2006 ) internal consistency cronbach s alphas were calculated for both the sis subscales and the total sis scale to determine the internal consistency of the scales . a cronbach s alpha higher than .70 construct validity the measurement of construct validity is involved whenever a test is to be interpreted as a measure of some attribute or quality which is not operationally defined ( cronbach and meehl 1955 , p. 281).there are multiple validation procedures to determine the construct validity of a scale ( arvey 1992 ) . if correlations between subscales are in the moderate to high range ( .4 .9 ) , it is evidenced that the subscales measure the same overall construct ( thompson et al . 2002).the second manner to examine construct validity is to correlate the sis subscale scores with the total score of the barthel index ( bi ) . moreover , one would expect a significant correlation between the sis and bi because they measure two related but different constructs , namely support needs and adaptive skills respectively ( thompson et al . therefore , we hypothesized that the correlation between the sis subscales and the bi would be in the moderate range ( .4 to .6).a third procedure to determine the construct validity of the sis is to test whether there are expected differences among groups with different number of disabilities on total sis - scores . one would expect that persons with more disabilities have higher sis scores ( indicating higher support needs ) than persons with less disabilities . therefore , three groups were composed according to the number of disabilities : a group with one disability ( n = 20 ) , a group with two disabilities ( n = 30 ) and a group with three or more disabilities ( n = 14 ) . the group with one disability exclusively had a motor disability , whereas the other two groups had additional disabilities , such as a hearing , visual , speech / language , psychiatric or cognitive disabilities . a one - way analyses of variance ( anova ) was conducted to test our hypothesis that the sis total scores increased as the number of disabilities was higher .", "internal consistency cronbach s alphas were calculated for both the sis subscales and the total sis scale to determine the internal consistency of the scales . a cronbach s alpha higher than .70 construct validity the measurement of construct validity is involved whenever a test is to be interpreted as a measure of some attribute or quality which is not operationally defined ( cronbach and meehl 1955 , p. 281).there are multiple validation procedures to determine the construct validity of a scale ( arvey 1992 ) . if correlations between subscales are in the moderate to high range ( .4 .9 ) , it is evidenced that the subscales measure the same overall construct ( thompson et al . 2002).the second manner to examine construct validity is to correlate the sis subscale scores with the total score of the barthel index ( bi ) . moreover , one would expect a significant correlation between the sis and bi because they measure two related but different constructs , namely support needs and adaptive skills respectively ( thompson et al . therefore , we hypothesized that the correlation between the sis subscales and the bi would be in the moderate range ( .4 to .6).a third procedure to determine the construct validity of the sis is to test whether there are expected differences among groups with different number of disabilities on total sis - scores . one would expect that persons with more disabilities have higher sis scores ( indicating higher support needs ) than persons with less disabilities . therefore , three groups were composed according to the number of disabilities : a group with one disability ( n = 20 ) , a group with two disabilities ( n = 30 ) and a group with three or more disabilities ( n = 14 ) . the group with one disability exclusively had a motor disability , whereas the other two groups had additional disabilities , such as a hearing , visual , speech / language , psychiatric or cognitive disabilities . a one - way analyses of variance ( anova ) was conducted to test our hypothesis that the sis total scores increased as the number of disabilities was higher .", "internal consistency internal consistency coefficients were high and exceeded the criterion of .70 ( see table 2 ) : cronbach s alphas ranged from .71 for medical to .96 for life - long learning , and the cronbach alpha for the total sis was .98 . thus , internal consistency was evidenced for both the subscales and the total sis scale . \n table 2intercorrelations between sis subscales ( n = 65)sis subscalehlcllllemph&ssocmedbehhl.95cl.62**.95lll.47**.78**.96emp.46**.65**.71**.94h&s.59**.76**.82**.69**.94soc.44**.77**.72**.75**.76**.93med.74**.63**.52**.55**.58**.46**.71beh-.00-.02-.01-.01.16.05-.05.77**significant at p<.01;hl home living , cl community living , lll life - long learning , emp employment , h&s health & safety , soc social activities , med medical , beh behaviorcoefficients on the diagonal are the cronbach s alphas intercorrelations between sis subscales ( n = 65 ) * * significant at p<.01 ; hl home living , cl community living , lll life - long learning , emp employment , h&s health & safety , soc social activities , med medical , beh behavior coefficients on the diagonal are the cronbach s alphas construct validity first , to test the construct validity , the intercorrelations between the sis subscales were calculated . as can be seen in table 2 , construct validity was present in 7 out of 8 subscales , as shown by the statistically significant intercorrelations . however , the subscale behavior did not significantly correlate with the other subscales ( range .00.16 ) . that is , the highest significant correlation was found between life - long learning and health and safety ( .82 ) , whereas , home living and social activities revealed the lowest significant correlation ( .44 ) . thus , all sis subscales seemed to measure the same construct , namely support needs , with the exception of the behavior scale.second , sis subscale scores were correlated with the bi sum score ( table 3 ) . four of the eight correlations between the sis subscales and the bi exceeded the criterion of .35 , namely home living ( -.78 ) , community living ( -.41 ) , health and safety ( -.41 ) and medical ( -.70 ) . the other four sis subscales ( life - long learning , employment , social activities and behavior ) did not correlate higher than .35 with the bi . \n table 3correlations between sis subscales and the sum score of the bi ( n = 65)bihl-.78**cl-.41**lll-.26*emp-.29*h&s-.41**soc-.22med-.70**beh-.03 * significant at p < .05 ; * * significant at p < .01hl home living , cl community living , lll life - long learning , emp employment , h&s health & safety , soc social activities , med medical , beh behaviorbi barthel indexfinally , we tested whether subgroups with different number of disabilities had different total scores on the sis . our analysis revealed significant differences between groups in total sis scores , f(2,62 ) = 4.98 , p < 01 , = .14 . post - hoc comparisons with lsd indicated that the group with 1 disability ( m = 242.0 ; sd = 72.8 ) required less support compared with the group with 2 ( m = 291.1 ; sd = 86.3 ) and 3 or more disabilities ( m = 329.6 ; sd = 87.5 ) . although the mean sis score was higher for participants in the group of 3 or more disabilities compared to the participants with 2 disabilities , the difference was not statistically significant . these results indicate that the sis discriminates between subgroups with different number of disabilities , which could be regarded as an indicator for construct validity . correlations between sis subscales and the sum score of the bi ( n = 65 ) * significant at p < .05 ; * * significant at p < .01 hl home living , cl community living , lll life - long learning , emp employment , h&s health & safety , soc social activities , med medical , beh behavior", "the present study investigated the internal consistency and the construct validity of the sis in a sample of people with physical disabilities . the cronbach s alphas were comparable to the coefficients reported in previous research of thompson and colleagues ( 2002 ) and buntinx et al . ( 2008 ) including people with intellectual disabilities , albeit that the cronbach s alphas of sis medical and sis behavior were somewhat lower in the present study . a lower internal coefficient of the behavior scale ( .77 ) was found in the present study compared to research by thompson et al . ( 2008 ) ( .98 and .86 , respectively ) , both using samples of people with intellectual disabilities . in addition , the sis behavior subscale did not correlate significantly with other sis subscales . that is , most items of the behavior subscale refer to support needs of behaviors that are externalizing by nature ( e.g. , aggression and automutulation ) . in contrast , only two items ( maintenance of mental health treatments and prevention of other serious behavior problems ) are included that may capture more internalizing problems , such as depression and anxiety . it is possible that these externalizing behaviors are less relevant for people with physical disabilities . it is known from research that , in comparison to people without disabilities , individuals who are physically disabled have a higher risk to develop mood and anxiety disorders ( mccoll and friedland 1993 ) . therefore , if support needs in people with physical disabilities are assessed , instruments should encompass a broader range of behavioral issues , including behaviors that are more relevant for individuals with physical disabilities . in order to investigate the construct validity of the sis , past research reveals that people with physical disabilities often have limitations in practical skills , such as toileting , bathing , and mobility ( e.g. , andrn and grimby 2000 ; balandin and morgan 1997 ) . as balandin and morgan ( 1997 ) have suggested , these limitations may be accompanied by higher support needs in , for example , people with cerebral palsy . in accordance with this expectation , a moderate correlation was found between total sis scores and the bi . overall , these results indicate that participants had more support needs as they had more limitations in practical skills . however , further analyses of the data revealed that the construct validity was evident in only four subscales of the sis . as was expected , a strong correlation was found between sis home living and bi , as the former typically requires such practical skills , as dressing and toileting . it was , however , hypothesized that limitations in practical skills would be also linked to support requirements in a range of life domains , as was suggested by some previous studies of support needs of people with physical disabilities ( andrn and grimby 2000 ; balandin and morgan 1997 ) . for example , stronger correlations were expected between bi - scores and life - long learning , employment , and social activities . for instance , it is reasonable that people with physical disabilities may also need assistance ( in for example toileting or walking ) , while performing activities such as participating in educational activities ( life - long learning ) or participating in recreational activities ( social activities ) . in addition , the correlations between the bi and community living and health and safety exceeded the minimum criterion .35 . however , these correlations were still lower than the correlations reported in a study with people intellectual disabilities of harries and colleagues ( 2005 ) , who found higher correlations between these sis subscales and several subscales of the adaptive behavior scale ( abs ) and the inventory client and agency planning ( icap ) measuring practical skills ( abs self - sufficiency , icap motor skills and icap personal living skills ) . therefore , compared to previous research , this study reveals a weak relationship between limitations in practical skills and support needs in specific sis domains , and additionally , construct validity was evidenced in only four out of eight sis subscales . an explanation for the weak relationship between the bi and the sis subscales could be that the sis subscales might have underestimated the limitations of practical skills associated with physical disabilities . in the study of harries et al . ( 2005 ) , in which scores of the abs , icap and sis section subscales were combined in an explorative factor - analysis , it was found that the sis support need scale and these adaptive behavior scales had the same underlying construct . although initial analyses showed a strong association between sis subscales and the subscales of the abs and the icap , a three - factor solution showed that no sis subscales were present in the third factor , representing the practical dimension . the outcomes revealed that , considered in terms of the three adaptive behavior skill areas , the underlying construct related predominantly to the conceptual skills dimension the authors suggest that the raters used an individual s conceptual skills as a framework of reference when assessing support needs ( p. 402 ) . although harries and colleagues ( 2005 ) do not further explain this suggestion , it may be that the frame of reference is a bias in the sis itself . it might be that support needs , as measured by the sis , are based more on the limitations in conceptual skills ( e.g. , cognition and language ) rather than limitations in practical skills ( e.g. , mobility , bladder and bowel control ) . all subscales ( except the behavior subscale ) were intercorrelated in the moderate to high range , comparable to the outcome of buntinx et al . moreover , the sis was able to discriminate between groups who varied in the number of disabilities . specifically , the group of people with a physical disability and 2 or 3 or more additional impairments were rated as having higher support needs than people with only a physical disability . thus , the analysis of the construct validity reveals that the sis measured the overall construct of support needs in the current sample . however , in contrast to the expectation that the sis subscales would be related to the bi , this construct is only slightly based on limitations in practical skills first most of the participants in the sample were diagnosed with cerebral palsy and only a small proportion consisted of people with spina bifida and tbi . subgroups consisting of people with spina bifida and tbi were too small to conduct separate analyses . future research is needed to investigate whether these groups differ in the nature of support needs . for example , many people with spina bifida may need support related to bladder and bowel control and shunt - related problems ( oi et al . 1996 ) . in addition , people with tbi often need support in the behavioral domain ( soo et al . therefore , future research of the sis should take into account other settings , such as ambulatory and semi - residential services . however , people with cerebral palsy often experience a decline in functional status and health status at a young age ( hemsley et al . ( 2002 ) argue , support needs are proposed to be dynamic , which indicates that they change across settings , across situations , and over time ( p. 392 ) . for this reason , equally important , in order to consider the changing nature of support needs in people with a physical disability , research should also focus on longitudinal assessments on individuals . in summary , the present research was the first attempt to measure the psychometric properties of the sis in people with physical disabilities . although there are some indications that the sis may be useful assessing support needs in people with physical disabilities , the sis might not take sufficiently into account the limitations in practical skills of these people . for people with physical disabilities , future revisions of the sis should take into consideration limitations in practical skills in a variety of support domains as measured by the sis .", "first most of the participants in the sample were diagnosed with cerebral palsy and only a small proportion consisted of people with spina bifida and tbi . subgroups consisting of people with spina bifida and tbi were too small to conduct separate analyses . future research is needed to investigate whether these groups differ in the nature of support needs . for example , many people with spina bifida may need support related to bladder and bowel control and shunt - related problems ( oi et al . in addition , people with tbi often need support in the behavioral domain ( soo et al . 2007 ) , as they often exhibit externalizing behaviors ( ducharme 1999 ) . therefore , future research of the sis should take into account other settings , such as ambulatory and semi - residential services . however , people with cerebral palsy often experience a decline in functional status and health status at a young age ( hemsley et al . ( 2002 ) argue , support needs are proposed to be dynamic , which indicates that they change across settings , across situations , and over time ( p. 392 ) . for this reason , equally important , in order to consider the changing nature of support needs in people with a physical disability , research should also focus on longitudinal assessments on individuals . in summary , the present research was the first attempt to measure the psychometric properties of the sis in people with physical disabilities . although there are some indications that the sis may be useful assessing support needs in people with physical disabilities , the sis might not take sufficiently into account the limitations in practical skills of these people . for people with physical disabilities , future revisions of the sis should take into consideration limitations in practical skills in a variety of support domains as measured by the sis" ]

[ "first described in 1910 , purtscher s retinopathy is seen in severely traumatized patients and is characterized by sudden visual loss ( purtscher 1912 ) . the characteristic ophthalmoscopic findings are multiple areas scattered throughout the posterior pole of superficial retinal whitening , which appear as focal areas of retinal arteriolar occlusion on fluoresceinangiography ( grass 1997 ) . similar clinical findings have been reported in association with childbirth ( blodi et al 1990 ; shaikh et al 2003 ) , and have been termed purtschers - like retinopathy . the visual prognosis in purtschers - like retinopathy after childbirth is guarded , and to date , there is no definitive treatment . however , there are encouraging reports of visual recovery in patients with purtscher s retinopathy receiving high dose intravenous corticosteroid therapy ( atabay et al 2003 ) . we report a patient with purtschers - like retinopathy following childbirth who received a sub - tenon s capsule injection of triamcinolone with subsequent increase in visual acuity and decrease in retinal swelling .", "ten days after an emergent caesarian section for severe preeclampsia , rh immunization , and fetal anemia , a 24 year - old primigravida primiparus patient presented with complaints of decreased vision in both eyes , right greater than left . there were no other systemic abnormalities such as elevated liver enzymes , low platelets or other hematologic abnormalities . dilated fundus examination revealed bilateral purtschers - like retinopathy ( figures 1a , 1b ) , with widespread areas of macular ischemia and edema , as confirmed by optical coherence tomography ( figures 2a , 2b ) . of note are the superficial areas of high intensity signal , indicative of retinal ischemia . the central thickness in the right eye was 272 microns , and in the left 239 microns . a sub - tenon s injection of 0.5 cc of triamcinolone ( 40 mg / cc ) was given in the right eye on day 15 after delivery . at one week following the injection , her visual acuity was unchanged and her intraocular pressure was normal . she noted a marked improvement in the vision in her right eye . on examination a her acuity had improved to 20/60 in the right eye and 20/20 in the left , with normal intraocular pressures . her fundus examination showed marked improvement , with most of the superficial ischemic areas resolving . repeat optical coherence tomography in both eyes ( figures 3a , 3b ) demonstrated a reduction in the edema of the right eye by 30% from baseline , whereas the left , untreated eye showed a reduction in swelling of 14% . her visual acuity remained 20/60 in the right eye and 20/20 in the left eye .", "nearly a century ago otmar purtscher described a case of visual loss in a severely traumatized patient whose exam showed multiple superficial retinal hemorrhages and white patches throughout the posterior pole . since that time , similar findings have been associated with other conditions including compressive chest injuries , acute pancreatitis , fat embolism , retro - bulbar anesthesia , connective tissue diseases ( grass 1997 ) , and childbirth ( blodi et al 1990 ; shaikh et al 2003 ) . the pathogenesis of purtschers - like retinopathy post - partum is unknown , but may be related to arteriolar obstruction by complement induced leukoemboli produced during parturition ( blodi et al 1990 ) . similar clinical findings have been reported in the setting of amniotic fluid embolism . however , in the absence of a patent foramen ovale or pulmonary arteriovenous - shunts , it is unlikely that amniotic emboli are the direct cause of the observed retinal arteriolar obstructions . other investigators have theorized that subclinical amniotic fluid emboli may activate complement and induce granulocyte microemboli , which could occur on both sides of the pulmonary capillary bed . the visual recovery of postpartum patients with purtschers - like retinopathy is varied ( blodi et al 1990 ; shaikh et al 2003 ) . of the four patients described by blodi , three enjoyed significant improvement in central acuity , another case of purtscher - like retinopathy has been described in a patient with hellp syndrome during antepartum . generally purtscher - like retinopathy has a favorable prognosis but this case resulted in permanent loss of vision ( stewart et al 2007 ) . currently , there is no definitive treatment for postpartum purtschers - like retinopathy . in vivo , corticosteroids have been shown efficacious in inhibiting complement - induced granulocyte aggregation ( hammerschimidt et al 1979 ) . clinically , there are two reports of visual recovery after high dose , intravenous corticosteroid therapy in post - traumatic patients ( atabay et al 1993 ) . the case presented here is unique in that the patient had bilateral , asymmetric purtschers - like retinopathy post - partum , with quantitative oct improvement following unilateral local steroid therapy ." ]

[ "the study was performed at a farm in bursa , situated in northwest turkey , at 408 north latitude , 298 east longitude and an altitude 149 m above sea level \n during an 80-day period . this study was approved by the ethical committee at the university of uludag , bursa , turkey . eighteen saanen goats , ages 34 years , \n were used in this study . the live weight , body condition score and milk yields of the goats were determined as follows : mean standard errors ; 45.13 2.2 kg ; \n bcs , 3.72 0.3 arbitrary units ; and my , 1.50 kg / day . the goats were housed with their kids in a sheltered outdoor pen with straw bedding . all goats grazed on \n pasture between 9 am and 5 pm and had access to water ad libitum . the goats were also given alfalfa hay [ dry matter ( 89.42% ) , cp - crude protein \n ( 16.50% ) , ether extract ( 1.39% ) , ndf - neutral detergent fiber ( 58.85% ) , adf - acid detergent fiber ( 52.42% ) , adl - acid detergent lignin ( 11.40% ) , nfc - non - fibrous \n carbohydrates ( 14.62% ) , ash ( 8.64% ) , ca - calcium ( 1.35% ) and p - phosphorus ( 0.12% ) ] ad libitum in the morning and evening . on postpartum days 20 , \n 35 , 50 , 65 and 80 , venous blood samples were collected from the goats via jugular punctures into vacutainers ( venoject , terumo , leuven , belgium ) containing edta \n as an anticoagulant and tubes with no anticoagulant after a fasting time of 3 hr . within 30 min , the blood samples were centrifuged at 1,500 g \n for 10 min at 4c , and the serum and plasma were harvested and stored at 20c until the day of the analysis . two milk samples of 60 ml ( one at the morning milking and one at the evening milking ) were also individually collected in a plastic vial on \n the same days as the blood samples . the first collection occurred on day 20 post - parturition to avoid a collection of colostrum . the milk samples were kept at \n 4c until the milk quality and composition analyses were conducted . for hormonal analyses , the milk samples were vortexed ; aliquots ( 500 ml ) of \n whole milk were obtained ( into 1.5 ml eppendorf tubes , eppendorf , hamburg , germany ) and frozen at 20c until analysis . the milk samples were analyzed for their fat , lactose , protein , solids - non - fat ( snf ) , total solid ( ts ) , freezing point depression ( fpd ) , density , acidity , free \n fatty acids ( ffa ) , casein with infrared reflectance spectroscopy ( rev - milkoscan ft1 , foss electric , hillerd , denmark ) and scc using a somatic cell \n counter ( fts / fcm combi 400 , bentley , chaska , mn , u.s.a . ) within 24 hr . for microbial analyses , the raw milk samples were immediately diluted in sterile pbs ( 1 ml in 9 ml ) and then homogenized in a \n vortex mixer , and serial 10-fold dilutions were made for colony countings . aliquots of 0.1 ml of selected dilutions were plated for aerobic \n mesophilic colony counts using casein - peptone glucose yeast extract agar plates ( pca : plate count agar , 1.05463.0500 , merck , darmstadt , germany ) followed by \n incubation at 37c for 24 hr . a pair of plates containing de man - rogosa - sharpe medium ( mrs agar , \n 1.10660.0500 , merck ) was used . after inoculation , each plate was incubated in an anaerobic chamber using anaerogenic jars ( an0035a , oxoid , basingstoke , hants , \n u.k . ) with an anaerobic pack ( cn0020c , oxoid ) at 37c for 48 hr . plates containing 30300 colonies were selected , and representative colonies of each morphotype \n previously characterized as lactobacilli were enumerated . non - spore - former rods , gram - positive and catalase - negative isolates were regarded as lactobacilli and \n calculated for each sample . the milk samples were thawed overnight in the refrigerator and vortexed continuously to ensure sample uniformity . skim milk was prepared by centrifuging 500 \n ml of whole milk at 16,000 g at 4c for 5 min . milk and \n plasma adiponectin were measured using a commercially available goat - specific sandwich enzyme - linked immunosorbent assay ( elisa ) kit ( goat adiponectin elisa \n kit ; hangzhou eastbiopharm co. , ltd . , yile road , china ) in an automated microplate reader ( x808 , biotek el , winooski , vt , u.s.a . ) . a goat resistin \n sandwich elisa kit ( goat resistin elisa kit ; hangzhou eastbiopharm co. , ltd . ) was used to measure the resistin in the milk and plasma samples . the milk and \n plasma leptin levels were measured by sandwich elisa using a goat - specific elisa kit ( goat leptin elisa kit ; hangzhou eastbiopharm co. , ltd . ) . the plasma crp level was also measured using a commercially available goat - specific elisa kit ( hangzhou \n eastbiopharm co. , ltd . ) . serum total protein , cholesterol and total lipid concentrations were determined with commercial kits ( ref t528 - 480 ; ref c507 - 480 and \n t526 - 480 , respectively , teco diagnostics , anaheim , ca , u.s.a . ) following the manufacturer s instructions and using a spectrophotometer ( uv 1601 , shimadzu , \n kyoto , japan ) . the sensitivity , milk and serum intra - assay coefficients of the variation were 0.11 g / ml , 6% and 8% for \n adiponectin , 0.12 ng / ml , 5% and 6% for resistin , 0.27 ng / ml , 6.7% and 8% for leptin , and \n 0.26 g / ml , 4% for crp . changes at different time points were determined using repeated measures test for gaussian distributed variables \n and friedman test for non - gaussian distributed variables . the data are given as the means sem ( standard error of the mean ) . p values less \n than 0.05 were considered statistically significant in all tests , and p value with bonferroni correction was used for multiple comparisons \n ( *=0.01 ) .", "the study was performed at a farm in bursa , situated in northwest turkey , at 408 north latitude , 298 east longitude and an altitude 149 m above sea level \n during an 80-day period . this study was approved by the ethical committee at the university of uludag , bursa , turkey . eighteen saanen goats , ages 34 years , \n were used in this study . the live weight , body condition score and milk yields of the goats were determined as follows : mean standard errors ; 45.13 2.2 kg ; \n bcs , 3.72 0.3 arbitrary units ; and my , 1.50 kg / day . the goats were housed with their kids in a sheltered outdoor pen with straw bedding . all goats grazed on \n pasture between 9 am and 5 pm and had access to water ad libitum . the goats were also given alfalfa hay [ dry matter ( 89.42% ) , cp - crude protein \n ( 16.50% ) , ether extract ( 1.39% ) , ndf - neutral detergent fiber ( 58.85% ) , adf - acid detergent fiber ( 52.42% ) , adl - acid detergent lignin ( 11.40% ) , nfc - non - fibrous \n carbohydrates ( 14.62% ) , ash ( 8.64% ) , ca - calcium ( 1.35% ) and p - phosphorus ( 0.12% ) ] ad libitum in the morning and evening . on postpartum days 20 , \n 35 , 50 , 65 and 80 , venous blood samples were collected from the goats via jugular punctures into vacutainers ( venoject , terumo , leuven , belgium ) containing edta \n as an anticoagulant and tubes with no anticoagulant after a fasting time of 3 hr . within 30 min , the blood samples were centrifuged at 1,500 g \n for 10 min at 4c , and the serum and plasma were harvested and stored at 20c until the day of the analysis . two milk samples of 60 ml ( one at the morning milking and one at the evening milking ) were also individually collected in a plastic vial on \n the same days as the blood samples . the first collection occurred on day 20 post - parturition to avoid a collection of colostrum . the milk samples were kept at \n 4c until the milk quality and composition analyses were conducted . for hormonal analyses , the milk samples were vortexed ; aliquots ( 500 ml ) of \n whole milk were obtained ( into 1.5 ml eppendorf tubes , eppendorf , hamburg , germany ) and frozen at 20c until analysis .", "the milk samples were analyzed for their fat , lactose , protein , solids - non - fat ( snf ) , total solid ( ts ) , freezing point depression ( fpd ) , density , acidity , free \n fatty acids ( ffa ) , casein with infrared reflectance spectroscopy ( rev - milkoscan ft1 , foss electric , hillerd , denmark ) and scc using a somatic cell \n counter ( fts / fcm combi 400 , bentley , chaska , mn , u.s.a . ) within 24 hr . for microbial analyses , the raw milk samples were immediately diluted in sterile pbs ( 1 ml in 9 ml ) and then homogenized in a \n vortex mixer , and serial 10-fold dilutions were made for colony countings . aliquots of 0.1 ml of selected dilutions were plated for aerobic \n mesophilic colony counts using casein - peptone glucose yeast extract agar plates ( pca : plate count agar , 1.05463.0500 , merck , darmstadt , germany ) followed by \n incubation at 37c for 24 hr . a pair of plates containing de man - rogosa - sharpe medium ( mrs agar , \n 1.10660.0500 , merck ) was used . after inoculation , each plate was incubated in an anaerobic chamber using anaerogenic jars ( an0035a , oxoid , basingstoke , hants , \n u.k . ) with an anaerobic pack ( cn0020c , oxoid ) at 37c for 48 hr . plates containing 30300 colonies were selected , and representative colonies of each morphotype \n previously characterized as lactobacilli were enumerated . non - spore - former rods , gram - positive and catalase - negative isolates were regarded as lactobacilli and \n calculated for each sample .", "the milk samples were thawed overnight in the refrigerator and vortexed continuously to ensure sample uniformity . skim milk was prepared by centrifuging 500 \n ml of whole milk at 16,000 g at 4c for 5 min . milk and \n plasma adiponectin were measured using a commercially available goat - specific sandwich enzyme - linked immunosorbent assay ( elisa ) kit ( goat adiponectin elisa \n kit ; hangzhou eastbiopharm co. , ltd . , yile road , china ) in an automated microplate reader ( x808 , biotek el , winooski , vt , u.s.a . ) . a goat resistin \n sandwich elisa kit ( goat resistin elisa kit ; hangzhou eastbiopharm co. , ltd . ) was used to measure the resistin in the milk and plasma samples . the milk and \n plasma leptin levels were measured by sandwich elisa using a goat - specific elisa kit ( goat leptin elisa kit ; hangzhou eastbiopharm co. , ltd . ) . the plasma crp level was also measured using a commercially available goat - specific elisa kit ( hangzhou \n eastbiopharm co. , ltd . ) . serum total protein , cholesterol and total lipid concentrations were determined with commercial kits ( ref t528 - 480 ; ref c507 - 480 and \n t526 - 480 , respectively , teco diagnostics , anaheim , ca , u.s.a . ) following the manufacturer s instructions and using a spectrophotometer ( uv 1601 , shimadzu , \n kyoto , japan ) . the sensitivity , milk and serum intra - assay coefficients of the variation were 0.11 g / ml , 6% and 8% for \n adiponectin , 0.12 ng / ml , 5% and 6% for resistin , 0.27 ng / ml , 6.7% and 8% for leptin , and \n 0.26 g / ml , 4% for crp .", "changes at different time points were determined using repeated measures test for gaussian distributed variables \n and friedman test for non - gaussian distributed variables . the data are given as the means sem ( standard error of the mean ) . p values less \n than 0.05 were considered statistically significant in all tests , and p value with bonferroni correction was used for multiple comparisons \n ( *=0.01 ) .", "the milk and plasma concentrations of the adipokines , milk composition and quality characteristics of the lactating goats on days 20 , 35 , 50 , 65 and 80 \n postpartum are shown in table 1table 1.milk and plasma concentrations of adiponectin , leptin , resistin , crp , serum total protein , cholesterol and lipid concentrations , milk composition and \n quality parameter levels on lactating days 2080 of saanen goats ( n=18)20 day35 day50 day65 day80 daymilk parametersmilk adipokinesmilk adiponectin ( g / ml)2.4 0.23.2 0.43.6 0.23.7 0.23.9 0.2milk resistin ( ng / ml)5.2 0.45.4 0.55.9 0.45.8 0.26.5 0.4milk leptin ( ng / ml)7.6 0.511.0 0.89.0 0.38.6 0.28.6 0.3milk composition fat ( % ) 4.4 0.24.5 0.24.5 0.24.8 0.04.6 0.0protein ( % ) 3.4 0.03.3 0.13.5 0.13.6 0.13.7 0.1snf ( % ) 8.9 0.18.8 0.18.9 0.09.0 0.19.2 0.1ts ( % ) 13.3 0.213.1 0.213.4 0.213.9 0.413.2 0.2fpd ( c)0.5 0.00.5 0.00.5 0.00.5 0.00.5 0.0density ( kg / m)1,029.9 0.51,028.2 0.61,029.7 0.41,028.2 0.81,032.7 0.5acidity ( sh)6.1 0,16.5 0.16.4 0.16.4 0.26.4 0.1ffa ( meq / l)0.4 0.00.4 0.00.5 0.00.4 0.00.3 0.0casein ( % ) 2.6 0.02.6 0.02.7 0.02.8 0.02.9 0.0scc ( 10/ml)441.0 23.4303.7 16.5543.7 42.5686.7 47.7236.1 25.7total aerobic colony ( 10/ml)32 941 2.432 8.137 1.320 1.4lactobacillus ( 10/ml)1.1 0.21.3 0.41.5 0.80.22 0.10.13 0.05blood parametersplasma adiponectin ( g / ml)26.2 4.227.8 4.530.8 2.133.0 3.028.8 4.0plasma resistin ( ng / ml ) 32.9 5.230.7 4.932.7 5.529.8 5.233.6 6.0plasma leptin ( ng / ml)43.7 6.754.2 6.553.5 6.654.6 7.350.3 4.8plasma crp ( mg / l)2.4 0.32.5 0.32.5 0.22.6 0.32.7 0.4serum total protein ( g / l)57 2.060 2.165 2.463 2.258 1.1serum cholesterol ( mmol / l)1.8 0.01.6 0.01.3 0.11.4 0.01.2 0.0serum total lipid ( g / l)1.3 0.01.6 0.01.8 0.02.1 0.12.2 0.0a ) significantly ( p<0.01 ) different from the observed values for 20 post - partum lactation days . data are given as the mean standard error .. non - significant differences in milk and plasma resistin , crp , total protein , milk fat , lactose , ts , fpd , scc , the total aerobic colony count and \n lactobacilli were observed on days 20 , 35 , 50 , 65 and 80 postpartum ( table 1 ) . lactating goats had significantly \n higher milk adiponectin levels on days 50 ( p<0.003 ) , 65 ( p<0.002 ) and 80 ( p<0.002 ) postpartum than on \n day 20 ( table 1 ) . the milk leptin levels were lower on day 20 than on days 35 ( p<0.005 ) , 50 \n ( p<0.008 ) , 65 ( p<0.01 ) and 80 ( p<0.01 ; table 1 ) . the \n plasma adiponectin levels on days 50 , 65 and 80 were higher ( p<0.002 , p<0.001 and p<0.01 , \n respectively ) than those on day 20 ( table 1 ) . the plasma leptin levels were lower on day 20 than on days 35 \n ( p<0.01 ) , 50 ( p<0.01 ) , 65 ( p<0.01 ) and 80 ( p<0.01 ; table 1 ) . the serum cholesterol levels on day 20 were higher than those on days 35 ( p<0.01 ) , 50 , 65 and 80 \n ( p<0.000 ) , and the serum total lipid levels on day 20 were lower than those on days 35 ( p<0.000 ) , 50 , 65 and 80 \n ( p<0.000 ; table 1 ) . the percentage of milk protein was higher on days 65 \n ( p<0.01 ) and 80 ( p<0.000 ) than on day 20 ( table 1 ) . milk snf and density \n levels were higher on day 80 than on day 20 ( p<0.02 and p<0.000 ; table 1 ) . \n milk acidity levels were lower on day 20 than on days 35 ( p<0.001 ) , 50 ( p<0.005 ) , 65 ( p<0.000 ) and 80 \n ( p<0.000 ) postpartum ( table 1 ) . milk ffa level was lower on day 80 than on day 20 postpartum \n ( p<0.01 ; table 1 ) . the goats had a significantly lower milk casein level on day 20 than on days \n 50 ( p<0.01 ) , 65 ( p<0.000 ) and 80 ( p<0.000 ; table 1 ) . a ) significantly ( p<0.01 ) different from the observed values for 20 post - partum lactation days . a correlation analysis revealed a positive correlation between milk concentrations of adiponectin , leptin and resistin ( p<0.05 ; table 2table 2.interrelationships between milk adiponectin , leptin and resistin concentrations and the relationships of milk adiponectin , leptin and resistin with \n plasma levels and plasma crp , serum total protein , cholesterol and lipid concentrations in lactating goatsmilk adiponectinrmilk resistinrmilk leptinrplasma adiponectinrplasma resistinrplasma leptinrplasma crprserum total proteinrserum cholesterolrserum total lipidrmilk adiponectin-0.500.490.550.580.480.480.280.200.15milk resistin 0.50 - 0.490.540.590.490.480.370.080.17milk leptin0.490.49 - 0.640.680.630.590.160.230.14a ) p<0.05 , b ) p<0.01 . ) . there were also positive correlations between the milk and plasma concentrations of these three adipokines ( table 2 ) . milk adiponectin level positively correlated with plasma adiponectin , leptin and resistin levels ( p<0.05 ; table 2 ) . milk resistin level positively correlated with plasma adiponectin ( p<0.05 ) , leptin \n ( p<0.01 ) and resistin levels ( p<0.05 ; table 2 ) . milk leptin level also \n positively correlated with plasma adiponectin and resistin levels ( p<0.01 ; table 2 ) . there was \n also a positive correlation between plasma crp level and milk leptin and resistin ( p<0.05 ) concentrations and an inverse correlation between \n milk adiponectin and plasma crp concentrations ( table 2 ) . there was no correlation between milk concentrations of \n these adipokines and serum total protein , cholesterol and total lipid levels ( table 2 ) . a significant negative \n correlation was noted between milk adiponectin level and its scc ( p<0.05 ) , whereas no relationship was found between milk adiponectin level \n and its composition parameters ( table 3table 3 . the relationships of goat milk adiponectin , leptin and resistin concentrations with milk quality and compositionfatrlactoserproteinrsnfrtsrfpdrdensityracidityrffarcaseinrsccrtotal aerobic colonyrlactobacillusrmilk adiponectin0.220.270.330.020.240.010.030.050.160.360.470.140.07milk resistin 0.010.020.190.220.090.010.300.550.000.250.020.290.02milk leptin 0.210.100.170.380.070.000.380.300.240.130.330.290.01a ) p<0.05 . ) . non - significant correlations were observed between milk resistin and leptin concentrations and milk components , scc , total aerobic colony and \n lactobacillus count ( table 3 ) . a ) p<0.05 , b ) p<0.01 . the 20- , 35- , 50- , 65- and 35-day body weight and bcs of goats were 42.5 1.6 , 43.00 2.1 , 44.50 2.4 , 45.65 2.5 and 50.00 2.3 kg , and 3.31 0.1 , 3.57 \n 0.2 , 3.62 0.2 , 3.94 0.4 and 4.20 0.4 , respectively and not statistically different . non - significant correlations were observed between milk adipokine \n concentrations and body weights and bcs .", "this is the first report of the adiponectin and resistin concentrations in the milk of saanen goats . leptin gene expression in the mammary gland of alpine goats \n was reported by bonnet et al . . leptin concentrations were also previously reported in the milk of \n mixed - parity boer and boer crossbred meat - type goats by whitley et al . . in this study , we measured \n the leptin levels in lactating saanen goats and confirmed the presence of leptin in goat milk . our data indicate that goat milk and plasma adiponectin and leptin \n concentrations increased , whereas no changes were observed in the resistin levels during a lactation period of 2080 days . the observed increase in the milk \n adiponectin concentration during days 2080 of the lactation period has also been reported in humans by ilcol et al . , weyermann et al . , bronsky et al . and martin et al . in good accordance with previous reports on humans , the adiponectin concentration in goat milk correlated positively with plasma adiponectin levels . the significant \n association between milk and plasma adiponectin concentrations indicates that circulating adiponectin is likely to be the major source of milk adiponectin . the \n mammary gland is not a meaningful source of adiponectin , its expression being 0.05% that of adipose tissue . the \n concentrations of leptin in goat milk and plasma were lower on day 20 than on days 35 , 50 , 65 and 80 days . these results are similar to those reported in \n mixed - parity boer and boer crossbred meat - type goats . the presence of a significant association between milk and \n plasma leptin concentrations during days 20 to 80 of lactation indicates that circulating leptin may be the major source of milk leptin . the observed relationship \n between milk and plasma leptin concentrations during days 20 to 80 of lactation has also been reported in humans by ucar et al . and ilcol et al . . as the number of lactation days increased \n from 20 to 80 , non - significant differences were observed in the milk and plasma resistin concentrations of saanen goats . . demonstrated that milk resistin concentrations were highest in colostrum , decreased rapidly during \n postpartum days 414 and remained low during postpartum days 15180 . the positive correlation between these three adipokine concentrations in goat milk in the \n current study during days 20 to 80 of lactation is also in good accordance with a previous observation in cord blood , milk and blood [ 14 , 18 , 40 ] . however , an inverse relationship between the \n resistin concentrations and both the leptin and adiponectin concentrations in milk and plasma was observed in some previous studies on humans [ 28 , 29 ] . these differences between the results of the current study and those of ilcol \n et al . [ 28 , 29 ] may be due to changes in regulatory mechanisms \n and factors for circulating adiponectin , leptin and resistin concentrations in goats and humans . our results show that the circulatory concentrations of these \n three adipokines are interrelated in days 20 to 80 of the lactation period of saanen goats . it appears that the changes in the milk and plasma adiponectin \n concentrations coincide with changes in the plasma leptin and resistin concentrations . adiponectin , leptin and resistin hormones are secreted biologically active forms into milk and may transiently regulate the activities of \n various tissues until the endocrine system of the neonate begins to function . these bioactive milk peptides also play important roles , such as energy intake and \n systemic and local imflammatory status . [ 5 , 15 , 33 ] . at this point , another important focus of this study was a positive correlation between crp and these three adipokines . crp , a marker of systemic \n inflammation , was known as a stimulator of monocytes and macrophages [ 31 , 34 ] . there \n were a positive correlation between the crp and leptin and resistin concentrations in goat milk and an inverse correlation between crp and milk adiponectin , \n consistent with previous studies in humans [ 14 , 28 , 39 ] . it not only regulates t - cell proliferation and activation \n but also influences cytokine production from t lymphocytes [ 9 , 16 ] . furthermore , ble \n et al . demonstrated a direct crp - stimulatory activation of leptin , independent of il-6 or other \n proinflammatory cytokines in humans . the inverse relationship between crp and milk adiponectin in this study is in strong accordance with previous studies on \n humans that report that proinflammatory factors suppress the adiponectin production of adipocytes [ 21 , 25 , 26 , 34 , 42 ] . resistin , mononuclear cells and macrophages , other major sources of circulating resistin , have also been implicated in the inflammatory response of \n humans . in good accordance with recent studies on human milk [ 11 , 14 , 23 ] , we observed that plasma crp \n correlated positively with milk resistin . scc is recognized as a reliable indicator of animals udder health ( local inflammation ) and milk quality and changes in \n their milk composition . the milk somatic cells include leucocytes , neutrophils , macrophages , lymphocytes , erythrocytes and epithelial cells . moreover , a high scc \n is directly related to inverse effects on human health , including poor farm hygiene , antibiotic residues and the presence of pathogenic bacteria and toxins in \n milk [ 27 , 35 ] . the inverse relationship between adiponectin and scc or crp may be \n related to the fact that adiponectin gene expression is decreased by oxidative stress or a pro - inflammatory state . in this study , no relation was observed between \n these three adipokines and the total aerobic colony count , which represents the total amount of viable microorganisms that could grow aerobically on plate - count \n agar , and the lactobacillus count . lactobacilli , non - pathogen microorganisms , may possess potentially therapeutic properties , including anti - inflammatory and \n anti - cancer activities . protective anti - tumor and anti - cancer effects of some strains of these bacteria were demonstrated in mice . a recent study reported that there may be a relationship between lactobacilli and the health of bovine udders . in the current study , we did not find a relationship between lactobacilli and these milk adipokines . we also determined whether the milk levels of leptin , adiponectin and resistin are related to the milk composition of lactating goats . however , no correlation \n was observed between the milk concentrations of these major adipokines and milk composition . in conclusion , the current study is the first to show adiponectin and resistin concentrations in the milk of saanen goats during days 20 to 80 of the lactation \n period . the data from the current study show interrelationships between the milk concentrations of adiponectin , leptin and resistin and significant positive \n relationships between the milk and plasma concentrations of these three major adipokines during days 20 to 80 of the lactation period in goats . the concentrations \n of leptin and resistin in goat milk are also positively related to the plasma crp concentrations , whereas the milk adiponectin concentration is inversely related \n to the plasma crp concentration and milk ssc . the findings in this study indicate a possible role of these three adipokines in the inflammatory status of goat \n milk , but more in - depth analyses are necessary to determine the mechanism and to better define their function ." ]

[ "outcomes are time to 12-month remission and time to second treatment failure , both measured from date of first treatment failure due to inadequate seizure control or unacceptable adverse events . twelve - month remission is defined as time to 365 days of continuous seizure freedom . second treatment failure is defined as withdrawal of a treatment , or addition of a drug , which may be due to inadequate seizure control , unacceptable adverse events , or both . the methods for the sanad trial have been published elsewhere . in summary , patients were eligible for inclusion if , in the previous year , they had a history of at least 2 clinically definite unprovoked seizures and they were at least 5 years old . patients were recruited into sanad arm a if the recruiting clinician considered carbamazepine to be the optimal standard treatment option . patients were then allocated to start treatment with carbamazepine , gabapentin , lamotrigine , oxcarbazepine , or topiramate . patients were eligible for inclusion in arm b if the recruiting clinician regarded valproate the standard treatment option . one protocol was used for both arms a and b. our approach was similar to that published previously , and our list of potential prognostic factors included the following : sex , history of at least one febrile seizure ( associated with fever but without evidence of intracranial infection or defined cause ) , first - degree relative with epilepsy , age at first treatment failure , time on randomized ( first ) treatment , neurologic insult , total number of tonic - clonic seizures ever at first treatment failure , reason for first treatment failure ( inadequate seizure control or adverse effects ) , seizure type , epilepsy type , eeg result at entry into the sanad trial , and ct or mri result at entry into sanad . randomized drug was also considered as a prognostic factor to determine whether the outcomes were influenced by first drug . patients were classified as having neurologic insult if they had learning disabilities ( a history of requiring a remedial or additional teacher in more than 2 subjects , or who underwent a statement of their education needs , or attended a special school ) or neurologic deficit ( localizing neurologic signs resulting in functional impairment ) . eeg was classified as normal , not done , nonspecific abnormality , or epileptiform abnormality ( focal or generalized spikes or spike and slow - wave activity ) . epilepsy type was classified as focal , generalized , or unclassified with the unclassified category representing uncertainty between focal - onset and generalized - onset seizures . analyses , adjusted for multiple variables using cox proportional hazards modeling , determined variables associated with a greater likelihood of achieving the outcomes . variable centering was used to diminish multicollinearity : binary independent variables were coded + 1/2 and 1/2 rather than 1 and 0 ; categorical independent variables were dummy - coded as usual , but instead of coding each response as 1 and 0 , the values 1 1/m and 1/m were used , where m is the number of categories . parsimonious multivariable models were produced with variable selection via backward elimination with akaike information criterion . all continuous variables were investigated using log and fractional polynomial transformations ; selection was made via the akaike information criterion . continuous variable results are presented as post hoc defined categorical variables with categories chosen according to knot positions for a spline model fit to the data . schoenfeld residual plots and incorporation of time - dependent covariate effects were used to investigate the proportional hazards assumption of the cox model . kaplan - meier curves were produced to show the unadjusted time to 12-month remission and time to second treatment failure after a first treatment failure . the discriminatory power and predictive accuracy of the models were assessed , as a method of internal validation , by the c statistic . this measures the proportion of patient pairs in which the predictions and outcomes are concordant . to assess the effect of factors on the different reasons for second treatment failure , subgroup analyses were performed : factors that predict the failure outcome were considered for patients whose first treatment failed due to inadequate seizure control and for patients whose first treatment failed due to unacceptable adverse effects . the sanad trial received appropriate multicenter and local ethics and research committee approvals , and was managed according to the medical research council 's good clinical practice guidelines . patients gave informed written consent to inclusion and to long - term follow - up .", "outcomes are time to 12-month remission and time to second treatment failure , both measured from date of first treatment failure due to inadequate seizure control or unacceptable adverse events . twelve - month remission is defined as time to 365 days of continuous seizure freedom . second treatment failure is defined as withdrawal of a treatment , or addition of a drug , which may be due to inadequate seizure control , unacceptable adverse events , or both .", "the methods for the sanad trial have been published elsewhere . in summary , patients were eligible for inclusion if , in the previous year , they had a history of at least 2 clinically definite unprovoked seizures and they were at least 5 years old . patients were recruited into sanad arm a if the recruiting clinician considered carbamazepine to be the optimal standard treatment option . patients were then allocated to start treatment with carbamazepine , gabapentin , lamotrigine , oxcarbazepine , or topiramate . patients were eligible for inclusion in arm b if the recruiting clinician regarded valproate the standard treatment option .", "our approach was similar to that published previously , and our list of potential prognostic factors included the following : sex , history of at least one febrile seizure ( associated with fever but without evidence of intracranial infection or defined cause ) , first - degree relative with epilepsy , age at first treatment failure , time on randomized ( first ) treatment , neurologic insult , total number of tonic - clonic seizures ever at first treatment failure , reason for first treatment failure ( inadequate seizure control or adverse effects ) , seizure type , epilepsy type , eeg result at entry into the sanad trial , and ct or mri result at entry into sanad . randomized drug was also considered as a prognostic factor to determine whether the outcomes were influenced by first drug . patients were classified as having neurologic insult if they had learning disabilities ( a history of requiring a remedial or additional teacher in more than 2 subjects , or who underwent a statement of their education needs , or attended a special school ) or neurologic deficit ( localizing neurologic signs resulting in functional impairment ) . eeg was classified as normal , not done , nonspecific abnormality , or epileptiform abnormality ( focal or generalized spikes or spike and slow - wave activity ) . epilepsy type was classified as focal , generalized , or unclassified with the unclassified category representing uncertainty between focal - onset and generalized - onset seizures . analyses , adjusted for multiple variables using cox proportional hazards modeling , determined variables associated with a greater likelihood of achieving the outcomes . variable centering was used to diminish multicollinearity : binary independent variables were coded + 1/2 and 1/2 rather than 1 and 0 ; categorical independent variables were dummy - coded as usual , but instead of coding each response as 1 and 0 , the values 1 1/m and 1/m were used , where m is the number of categories . parsimonious multivariable models were produced with variable selection via backward elimination with akaike information criterion . all continuous variables were investigated using log and fractional polynomial transformations ; selection was made via the akaike information criterion . continuous variable results are presented as post hoc defined categorical variables with categories chosen according to knot positions for a spline model fit to the data . schoenfeld residual plots and incorporation of time - dependent covariate effects were used to investigate the proportional hazards assumption of the cox model . kaplan - meier curves were produced to show the unadjusted time to 12-month remission and time to second treatment failure after a first treatment failure . the discriminatory power and predictive accuracy of the models were assessed , as a method of internal validation , by the c statistic . this measures the proportion of patient pairs in which the predictions and outcomes are concordant . to assess the effect of factors on the different reasons for second treatment failure , subgroup analyses were performed : factors that predict the failure outcome were considered for patients whose first treatment failed due to inadequate seizure control and for patients whose first treatment failed due to unacceptable adverse effects .", "the sanad trial received appropriate multicenter and local ethics and research committee approvals , and was managed according to the medical research council 's good clinical practice guidelines . patients gave informed written consent to inclusion and to long - term follow - up .", "figure 1 shows the flow of the 2,627 patients recruited into arms a and b of the sanad trial . after a first treatment failure , 147 patients did not start another aed . these patients were included in the analysis of time to 12-month remission but excluded from the analysis of time to second treatment failure . of these patients , 130 had withdrawn from their randomized treatment because of unacceptable adverse events , and 17 had withdrawn because of inadequate seizure control . carbamazepine , gabapentin , lamotrigine , oxcarbazepine , and topiramate were randomized drugs in arm a. lamotrigine , topiramate , and valproate were randomized drugs in arm b. for this reason , the numbers randomized varied across the drugs . in addition , oxcarbazepine was only added to arm a midway through the trial , hence fewer patients were randomized to it . a total of 1,065 patients were included in the analysis of time to 12-month remission , of whom 535 had a 12-month remission . nine hundred twenty - eight patients were included in the analysis of time to second treatment failure , of whom 356 had a second treatment failure . characteristics of patients included in time to 12-month remission analysis are summarized in table 1 . patient characteristics for patients with a first treatment failure table e-1 ( on the neurology web site at neurology.org ) summarizes the treatments that patients were switched to after the first failure . after treatment failure on carbamazepine , oxcarbazepine , or valproate , the most likely treatment switch was to lamotrigine . in patients for whom gabapentin , lamotrigine , and topiramate failed , the kaplan - meier curve for time to 12-month remission after a first treatment failure for any reason can be seen in figure e-1 . approximately 30% of patients failing their first treatment achieved 12-month remission immediately after the first failure . at 5 years , overall , 70% of patients achieved a 12-month remission : 65% with a first failure due to inadequate seizure control and 80% with a first treatment failure due to unacceptable adverse events . results for the parsimonious multivariable model for time to 12-month remission after first treatment failure are summarized in table 2 ( see table e-2 for regression coefficients and standard errors . ) the c statistic for the model was 0.6 . this means that , for a random pair of patients , the probability of the patient who achieved 12-month remission first having the shorter predicted probability of achieving 12-month remission is 60% , which suggests low predictive utility . multivariable results for time to 12-month remission after first treatment failure initial aed was not significant univariately and was not included in the multivariable model . patients whose first treatment failed due to unacceptable adverse events were more likely to achieve 12-month remission after a first treatment failure than those whose treatment failed due to inadequate seizure control . twelve - month remission was more likely in men than in women , more likely in patients older than 45 years than those younger than 11 years , and more likely for patients with a shorter duration of treatment with the first aed . the occurrence of tonic - clonic seizures ( primary or secondary generalized ) on first aed was associated with a lower probability of subsequent 12-month remission . the combination of seizure types that patients had experienced on entry to the sanad trial was also of prognostic importance : 12-month remission was more likely in patients with generalized tonic - clonic seizures than in those with focal and secondary generalized seizures , while the latter were more likely to have a 12-month remission than those with focal seizures without secondary generalization . to illustrate the range of remission rates predicted by the multivariable model , figure 2 shows estimates of the proportion of patients achieving 12-month remission 1 and 3 years after first treatment failure . patients were assumed to be male , to have no neurologic insult , and to have spent 6 months on the randomized treatment at treatment failure . the other variables were altered according to categories of interest ( e.g. , age as 10 and 40 years ) . t - c : number of tonic - clonic seizures before first treatment failure ; reason : first treatment failure reason ( isc = inadequate seizure control ; uae = unacceptable adverse events ) ; s. type : seizure type ( scgtc = simple or complex partial with secondary generalized tonic - clonic seizures ; gen . t - c = generalized tonic - clonic seizures only ) ; ct / mri ( norm = normal result ; ab = abnormal result ) . the kaplan - meier curve for time to second treatment failure after a first for any reason can be seen in figure e-2 . of patients whose first treatment failed , approximately 20% had another treatment failure by 6 months and approximately 25% by 1 year . at 3 years , overall , approximately 40% had a second treatment failure , while 45% with a first failure due to inadequate seizure control and 30% with a treatment failure due to unacceptable adverse events had a second treatment failure by 3 years after a first treatment failure . the first is for time to second treatment failure irrespective of the reason for first treatment failure ( inadequate seizure control or adverse events ) . this model includes number of tonic - clonic seizures before first failure , ct / mri results , and reason for first failure . this means that , for a random pair of patients , the probability of the patient who had a second treatment first having the shorter predicted probability of second treatment failure is 60% , which suggests low predictive utility . once again multivariable results for time to second treatment failure after first treatment failure the second model is for patients with a first failure due to inadequate seizure control and the third for patients with a first failure due to adverse events . as might be anticipated , these models are quite different . the model including patients with a first failure due to inadequate seizure control includes age and ct / mri results , and has a c statistic of 0.6 , suggesting low predictive utility . the model including patients with a first failure due to adverse effects includes number of tonic - clonic seizures before first treatment failure and eeg , and has a c statistic of 0.6 , suggesting low predictive utility . risk estimates for stratified groups of patients whose first treatment failed due to unacceptable adverse events can be seen in table e-6 .", "the kaplan - meier curve for time to 12-month remission after a first treatment failure for any reason can be seen in figure e-1 . approximately 30% of patients failing their first treatment achieved 12-month remission immediately after the first failure . at 5 years , overall , 70% of patients achieved a 12-month remission : 65% with a first failure due to inadequate seizure control and 80% with a first treatment failure due to unacceptable adverse events . results for the parsimonious multivariable model for time to 12-month remission after first treatment failure are summarized in table 2 ( see table e-2 for regression coefficients and standard errors . ) the c statistic for the model was 0.6 . this means that , for a random pair of patients , the probability of the patient who achieved 12-month remission first having the shorter predicted probability of achieving 12-month remission is 60% , which suggests low predictive utility . multivariable results for time to 12-month remission after first treatment failure initial aed was not significant univariately and was not included in the multivariable model . patients whose first treatment failed due to unacceptable adverse events were more likely to achieve 12-month remission after a first treatment failure than those whose treatment failed due to inadequate seizure control . twelve - month remission was more likely in men than in women , more likely in patients older than 45 years than those younger than 11 years , and more likely for patients with a shorter duration of treatment with the first aed . the occurrence of tonic - clonic seizures ( primary or secondary generalized ) on first aed was associated with a lower probability of subsequent 12-month remission . the combination of seizure types that patients had experienced on entry to the sanad trial was also of prognostic importance : 12-month remission was more likely in patients with generalized tonic - clonic seizures than in those with focal and secondary generalized seizures , while the latter were more likely to have a 12-month remission than those with focal seizures without secondary generalization . to illustrate the range of remission rates predicted by the multivariable model , figure 2 shows estimates of the proportion of patients achieving 12-month remission 1 and 3 years after first treatment failure . patients were assumed to be male , to have no neurologic insult , and to have spent 6 months on the randomized treatment at treatment failure . the other variables were altered according to categories of interest ( e.g. , age as 10 and 40 years ) . t - c : number of tonic - clonic seizures before first treatment failure ; reason : first treatment failure reason ( isc = inadequate seizure control ; uae = unacceptable adverse events ) ; s. type : seizure type ( scgtc = simple or complex partial with secondary generalized tonic - clonic seizures ; gen . t - c = generalized tonic - clonic seizures only ) ; ct / mri ( norm = normal result ; ab = abnormal result ) .", "the kaplan - meier curve for time to second treatment failure after a first for any reason can be seen in figure e-2 . of patients whose first treatment failed , approximately 20% had another treatment failure by 6 months and approximately 25% by 1 year . at 3 years , overall , approximately 40% had a second treatment failure , while 45% with a first failure due to inadequate seizure control and 30% with a treatment failure due to unacceptable adverse events had a second treatment failure by 3 years after a first treatment failure . the first is for time to second treatment failure irrespective of the reason for first treatment failure ( inadequate seizure control or adverse events ) . this model includes number of tonic - clonic seizures before first failure , ct / mri results , and reason for first failure . this means that , for a random pair of patients , the probability of the patient who had a second treatment first having the shorter predicted probability of second treatment failure is 60% , which suggests low predictive utility . once again , type of initial aed was not significantly associated with the outcome . multivariable results for time to second treatment failure after first treatment failure the second model is for patients with a first failure due to inadequate seizure control and the third for patients with a first failure due to adverse events . as might be anticipated , these models are quite different . the model including patients with a first failure due to inadequate seizure control includes age and ct / mri results , and has a c statistic of 0.6 , suggesting low predictive utility . the model including patients with a first failure due to adverse effects includes number of tonic - clonic seizures before first treatment failure and eeg , and has a c statistic of 0.6 , suggesting low predictive utility . risk estimates for stratified groups of patients whose first treatment failed due to unacceptable adverse events can be seen in table e-6 .", "numerous factors contribute to the multivariable model for 12-month remission , highlighting the heterogeneity of epilepsy , but also highlighting the prognostic importance of information collected in routine clinical practice . the model is able to stratify patients , and the estimates for 12-month remission rates could be used in routine clinical practice to inform likely outcomes . the model published here has a number of similarities to the model for time to 12-month remission from randomization in sanad . unsurprisingly , reason for first treatment failure is of prognostic importance as is duration of first treatment . early treatment failure is more likely to be due to adverse effects , so duration of first treatment and reason for first treatment failure are likely to be correlated , but nonetheless , both factors were included in the multivariable model . while broad epilepsy type ( focal vs generalized ) was not included in the multivariable model , this was , in part , accounted for by seizure type , which was included . also , the occurrence of tonic - clonic seizures ( focal or generalized in onset ) on first treatment was prognostic as was age . the eeg result was not associated with 12-month remission , which is surprising because eeg abnormality was found to be associated with seizure recurrence risk in other studies . the most likely explanation is that the eeg data used were collected at entry into sanad . future studies assessing outcome after a first treatment failure need to undertake eegs at that time point to assess their prognostic importance . we also found that 12-month remission was more likely in men than in women , which was also established when the sanad arm a data were modeled for time to 12-month remission from initiating treatment ( randomization ) . this finding remains mostly unexplained because there was no significant difference in the way men and women were dosed , and it is unclear whether this finding represents differences in the way that men and women are managed , or whether this represents an underlying important biological difference between the sexes that influences drug response . a study in children also found sex to be significant ; the authors showed that discontinuation of aeds in seizure - free children was less likely to succeed if the patient was female , had an abnormal neurologic examination , seizure onset of less than 120 months , and had focal seizures . it is important to note that first aed was not included in the model , highlighting that clinical factors have a more important impact on outcome than choice of first drug . this should not be surprising because differences found among drugs have been small and drug development programs have retreated to finding noninferiority as opposed to superiority for new treatments . for time to second treatment failure after a first treatment failure , we have produced 3 models . the first examines time to a second treatment failure irrespective of the reason for a first treatment failure . the models assessing subgroups according to reason for first treatment failure give quite different results . the sanad trial was not designed to address the question considered here . although patients were followed up regardless of outcome , it is possible that data collection for the outcomes examined in this report may not have been as complete or accurate as for the primary outcomes in the trial . some have criticized the fact that sanad recruited a heterogeneous group of patients rather than specific seizure types or epilepsy syndromes ; however , the strength of this approach is illustrated in this report and in our previous reports modeling data from sanad . sanad was an unblinded trial , which could have influenced outcome assessment ; for example , decisions as to whether a treatment had failed , although examination of dosing data indicates that reasonable doses were tried before a decision was made that treatment had failed . while randomized controlled trials are the best methodology for assessing treatment effects , they might recruit a selected population , which might bias estimates of prognosis . participants were seen predominantly by neurologists experienced at identifying and classifying seizures , but a further challenge in outpatient - based studies of seizures and epilepsy is that seizures are reported to the clinician by the patient and it is possible that patients underreport the occurrence of seizures . validating patient reporting in an outpatient population with infrequent seizures is difficult and to date has not been done . the predictive ability of the models presented within this report is low , as illustrated by the low c statistics for each model . while there is increasing interest in stratified medicine and pharmacogenetics , it remains unknown as to whether genetic factors might account for some of the unexplained variability in our predictive models . in the future , they may help to improve the predictive accuracy of the models . the models presented here are the first to consider chance of remission and risk of second treatment failure after a first treatment failure . while we have presented a number of models that may inform patient counseling and treatment decisions , ideally these models require validation in other similar datasets , although few such datasets exist . in addition , the mechanisms by which the clinical factors identified in this report influence outcome remain poorly understood and require further assessment . this article presents the first report of prognostic modeling for time to 12-month remission and time to second treatment failure , both after a first treatment failure . our results highlight the heterogeneity of outcome in epilepsy and the complex interplay among the factors that influence it . patients with differing risks of 12 months of remission and treatment failure could be identified at the point in time when the initial aed treatment failed . results will improve outcome prediction for patients , and allow better stratification of patients , including the identification of patients more likely to have poor treatment outcome for whom more intensive follow - up may be required . similarly , the models may also aid in the identification of patients with poorer seizure control outcomes who might be eligible to participate in future trials of new treatments , for example surgical treatments such as deep brain stimulation , which might carry greater risk than drug treatment .", "", "", "this report presents independent research funded by the national institute for health research ( nihr ) under its programme grants for applied research programme ( grant rp - pg-0606 - 1062 ) . the views expressed are those of the author(s ) and not necessarily those of the nhs , the nihr , or the department of health .", "" ]

[ "varicella zoster virus ( vzv ) disease is one of the most frequent infectious complications after allogeneic hematopoietic stem cell transplantation ( allo - hsct ) ; during the first year , its incidence ranges from 13 to 55% ( 1 ) . although cutaneous herpes zoster is the most common clinical form of reactivation , allo - hsct recipients may present with fatal systemic dissemination ( 1,2 ) . among the various types of vzv infection , infections of the central nervous system ( cns ) , especially meningitis and encephalitis , are only rarely reported ; however , they represent severely life threatening conditions and may compromise the patient 's quality of life ( 3 ) . we herein report a case of post - transplant vzv meningitis and myelitis that developed after the cessation of immunosuppressant therapy , which was successfully treated with the intravenous administration of foscarnet .", "a 42-year - old chinese man with myelodysplastic syndrome ( mds , raeb-2 ) underwent cord blood transplantation ( cbt ) from a japanese donor in october 2011 . the conditioning regimen consisted of total - body irradiation ( tbi ) ( 12 gy ) , cyclophosphamide ( total dose , 120 mg / kg ) , and cytarabine ( total dose , 12 g / m ) . prophylaxis against graft - versus - host disease ( gvhd ) consisted of cyclosporine ( csa ) and a short course of methotrexate . acyclovir ( acv ) ( 1,000 mg / day , orally ) was administered from day -7 to 35 as prophylaxis against herpes virus . this was maintained at a reduced dose of 200 mg / day until day 213 . the patient 's serum immunoglobulin g ( igg ) levels remained within the normal limits , and his peripheral post - transplant leukocyte counts remained within the normal range . on day 241 after cbt , the patient presented with blisters on his face and on day 245 , a herpes zoster rash developed on his face , body , and extremities . the patient was clinically diagnosed with a systemic vzv infection and intravenous acv ( 5 mg / kg three times a day ) was promptly administered . the cutaneous lesions were reduced on the 8th day after the initiation of acv treatment , and the treatment was then switched to oral valaciclovir . however , the patient developed a high fever , paralysis of the lower extremities , ischuria , neck stiffness , and spinal automatism on the second day of valaciclovir treatment . the patient 's cerebrospinal fluid ( csf ) showed an increased number of mononuclear cells ( 77/l ) , an elevated protein level , and a normal glucose level . the enzyme immunoassay ( eia ) values in the patient 's csf and serum were 2.56 and 13.5 , respectively , for vzv - igg , and 5.32 and 3.90 for vzv - igm . vzv - dna was not detected in a polymerase chain reaction ( pcr ) . at 5.3 , the presentation of spinal automatism , paralysis of the lower extremities and ischuria led to a diagnosis of vzv meningitis , myelitis , and radiculitis . intravenous acv was resumed at an increased dose ( 10 mg / kg , three times a day ) , on the 12th day after the initial diagnosis of the vzv infection . magnetic resonance imaging ( mri ) of the thoracic vertebrae and the lumbosacral spinal cord on days 6 and 7 after the resumption of acv , respectively , revealed no evident abnormalities . seventeen days after the resumption of acv , a high mononuclear cell count ( 69/l ) was still present in the patient 's csf , and the patient 's paralysis and ischuria showed no improvement . acv was then switched to foscarnet ( 90 mg / kg , twice a day ) on day 20 after the initial diagnosis . after 12 days of foscarnet treatment , the patient showed a complete recovery from ischuria and was able to walk by himself . the patient 's csf showed a significantly decreased cell count , and foscarnet was discontinued after 51 days of treatment . on day 25 after the discontinuation of foscarnet therapy , the vzv - igm level in the patient 's csf dropped to negative value of 0.78 , whereas the vzv - igg level in the patient 's csf rose to 7.53 ; in contrast , the value at time of the patient 's diagnosis was 2.56 . the patient has been in complete remission without recurrent neurological symptoms for 3.5 years since transplantation .", "the long - term administration of acv after transplantation has been recommended to reduce the risk of vzv reactivation ( 1 ) . a large retrospective study showed that the prophylactic administration of acv for 1 year reduced the incidence of vzv disease , and that the incidence was further decreased by the continuation of prophylaxis in patients who remained on immunosuppressive drugs ( 4 - 7 ) . however , the cumulative incidence of vzv disease after the cessation of long - term acv is reported to be approximately 28.4% at 1 year ( 8) , suggesting that further studies are required to evaluate the optimal duration of low - dose acv prophylaxis . our patient had a normal peripheral blood lymphocyte count and serum immunoglobulin levels ; thus , we discontinued prophylaxis with low - dose acv after the cessation of csa , which may have been associated with the reactivation of vzv . furthermore , one report described the case of a patient without any known risk factors who developed vzv meningoencephalitis at 22 months after hsct following the cessation of immunosuppressants and prophylactic treatment with low - dose acv ( 9 ) . these rare experiences suggest that vzv meningitis is a complication that may occur in any allo - hsct recipient at any time after transplantation . the initial symptoms of vzv meningitis and myelitis in post - transplantation patients vary and may include dermatomal zoster before the onset . leveque et al . ( 10 ) reported two recipients who developed meningitis without skin manifestations . in contrast , fukuno et al . ( 11 ) described a bone marrow transplantation recipient in whom vzv meningoencephalitis occurred suddenly at 21 days after the completion of acv therapy for a localized cutaneous vzv infection . our patient 's disseminated skin lesions developed first , and his neurological symptoms became obvious as the skin rash disappeared after acv therapy . thus , cns infections should always be considered when cns symptoms emerge without skin lesions or develop after a cutaneous vzv infection . although we could not detect vzv dna in this patient 's csf , the patient 's csf was positive for anti - vzv igm and igg , which was helpful in establishing the diagnoses of vzv meningitis and myelitis . the detection of anti - vzv antibodies in the csf appears to have greater sensitivity in the diagnosis of vzv infections of the nervous system , than the detection of viral dna . reported that vzv - dna positivity and the detection of antibodies in the csf can dramatically change during the clinical course of a viral infection ( 12 ) . in this report , 0% and 61% of the csf samples that were collected within the first 7 days after the onset of rash were positive for anti - vzv antibodies and vzv dna , respectively however , after 7 days the rate of anti - vzv antibody - positive samples increased to 83% , while the rate of vzv dna - positive samples decreased to 25% . in our present case , csf sampling was performed on day 15 after the onset of rash , which was a relatively late time point . we hypothesize that the vzv dna in the csf decreased to an undetectable level while the csf became antibody - positive . thus , both assays are recommended in the assessment of csf samples in order to accurately diagnose vzv infections ( 13 ) . vaccination may help decrease the risk of reactivation . although the data on the safety and efficacy of live - attenuated varicella vaccines in allo - hsct recipients are limited ( 14,15 ) , no serious adverse events were reported in a previous study involving 110 adult allo - hsct patients ( 16 ) . thus , the guidelines recommend varicella vaccination at 2 or more years after transplantation in allo - hsct patients without active chronic gvhd or ongoing immunosuppressive therapy ( evidenced - based rating : ciii ) ( 17,18 ) . however , even at 2 years after hsct , 30 - 40% of the patients are considered to be ineligible for vaccination ( 19,20 ) . for these recipients , the continuation of acv treatment for an extended period of time may be necessary to decrease the incidence of serious vzv reactivation . intravenous acv ( 10 mg / kg , every 8 hours ) , is the recommended treatment for vzv infections of the cns ( 21 ) . however , acv activation is dependent on intracellular virus - encoded thymidine kinase ( tk ) , which implies that tk - deficient vzv strains are resistant to acv . described a case in which a patient with vzv encephalitis was successfully treated with the addition of foscarnet to acv ( 22 ) . the pharmacological action of foscarnet is tk - independent , which enables the elimination of acv - resistant vzv ( 23 ) . in our case , acv appeared to be insufficient for improving the patient 's neurological symptoms , and the patient was then successfully treated when acv was switched to foscarnet , suggesting that an acv - resistant vzv strain was involved in the patient 's meningitis . it is possible that the strain of vzv that caused the meningitis was the same strain as that which caused the cutaneous infection , and the present patient might have been a late responder to acv . however , several reports have shown that the interval between the initiation of acv treatment and clinical improvement ranged from 3 to 9 days in patients with zoster- or varicella - induced myelitis ( 24 - 27 ) . the paralysis and ischuria of the present patient showed no improvement during the 17 days in which he received a sufficient dose of intravenous acv , and the number of mononuclear cells in the patient 's csf showed a minimal decrease . we therefore hypothesized that the strain of vzv that was responsible for the patient 's meningitis was acv - resistant and that it was unlikely that the patient was a late responder to acv , and decided to switch the therapy to foscarnet . in conclusion , we described the case of a patient with vzv meningitis , radiculitis and myelitis after the cessation of immunosuppressant therapy and long - term acv prophylaxis . vzv cns infections may be severe life threatening events and have the potential to compromise a patient 's quality of life . thus , when initial acv therapy is found to be insufficient for the treatment of vzv infections in transplant recipients under long - term acv prophylaxis , physicians should immediately consider changing to second line therapies , such as foscarnet . further investigation is necessary to develop optimal prophylactic strategies and effective vaccination schedules may be needed to eradicate post - transplant vzv disease .", "" ]

[ "endothelial dysfunction is an early predictor of cardiovascular disease [ 13 ] , and might be the causal pathological mechanism of a variety of metabolic diseases , also referred to as the common soil hypothesis . endothelial function has been shown to be impaired in patients with coronary artery disease , type ii diabetes mellitus , hypertension , obesity , renal failure , and hypercholesterolemia [ 59 ] . it is conceivable that improvement of endothelial function will be an important target in the treatment of these conditions . therefore , availability of methodology that can be used to reliably assess the effects of ( pharmacological ) treatments on endothelial function is of critical importance . endothelial dysfunction is commonly described as the inability of the artery to sufficiently dilate in response to an appropriate endothelial stimulus . it can be assessed by measurement of the arterial pulse wave at a finger artery or by the measurement of flow - mediated dilation ( fmd ) of the brachial artery after occlusion of the blood flow . although the exact mechanisms causing fmd are not entirely known , the main mechanism inducing fmd is thought to be an increase in shear stress , leading to the release of nitric oxide from endothelial cells which causes blood vessel dilation . currently , fmd is assessed clinically in a noninvasive manner using high - resolution ultrasound of the brachial artery . the technique is widely used and has been shown to be a suitable tool to assess endothelial dysfunction . however , the method has several disadvantages : it is operator dependent , and as fmd is measured at one arm only , there are no possibilities to correct for potential measurement - induced changes in the systemic hemodynamics , such as those resulting from alterations in the autonomous nervous system tone . to overcome these problems , the endopat was developed . this device allows non - invasive measurement of vasoreactivity without the disadvantages of conventional ultrasound measurement . the endopat detects plethysmographic pressure changes in the finger tips caused by the arterial pulse and translates this to a peripheral arterial tone ( pat ) . endothelium - mediated changes in vascular tone after occlusion of the brachial artery are reflecting a downstream hyperemic response , which is a measure for arterial endothelial function . measurements on the contralateral arm are used to control for concurrent nonendothelium - dependent changes in vascular tone . in addition , the endopat provides a measure for arterial stiffness : the augmentation index ( ai ) . in theory , the endopat could be a useful device in clinical research as the test is easy to perform , not operator - dependent , and with comprehensive automatic analysis . in a group of 89 adult patients suffering from chest pain , peripheral arterial tone correlated positively with fmd . in the framingham study , a significant inverse relation was observed between endothelial function as determined by the endopat ( endoscore or reactive hyperemia index , rhi ) and multiple cardiovascular risk factors ( male sex , body mass index , total / hdl cholesterol , diabetes , smoking , and lipid - lowering treatment ) . the endoscore was reported to be significantly decreased in patients with coronary artery disease , hypertension , hyperlipidemia , diabetes , glucose intolerance , and tobacco users ( group sizes of 15 to 70 subjects ) [ 12 , 1418 ] . several endopat studies have demonstrated an improvement in endothelial function as a result of lifestyle modification ( smoking cessation , and dietary change ) [ 1922 ] or prolonged pharmacological intervention [ 23 , 24 ] . however , there is only limited information on the performance of the endopat for repeated measurements in a relatively short time frame . this information is pertinent as in many clinical ( pharmacology ) studies repeated measures are performed in populations consisting of 6 to 12 subjects . therefore , we performed a series of experiments to investigate the feasibility of the endopat to evaluate acute changes in endothelial function and arterial stiffness with repeated measurements and to assess the discriminating power of the endopat in different populations . first , we investigated the variability of endothelial function and arterial stiffness , as measured by the endopat , in patients with chronic kidney failure on three different days . endothelial function , as assessed by high - resolution ultrasound , is known to be severely impaired in this patient population , despite intensive treatment ( 3060% reduction ) [ 2528 ] . in addition , we measured endothelial function and arterial stiffness in patients with diabetes mellitus type 2 , another patient population with a strongly reduced endothelial reactivity as determined using conventional techniques ( 3035% reduction ) [ 2931 ] . finally , we investigated the capability of the device to detect changes in endothelial function induced by two acute and robust interventions ( smoking and glucose administration ) in healthy volunteers . cigarette smoking acutely impairs endothelial function in healthy volunteers by causing oxidative stress and reducing the production of nitric oxide due to the free radicals present in cigarette smoke [ 2 , 32 ] . also high blood glucose levels lead to an attenuated endothelial function , as has been demonstrated by plethysmography and high - resolution ultrasound [ 33 , 34 ] .", "the experiments were approved by the medical ethics committee of leiden university medical center ( lumc ) . endothelial function and arterial stiffness were assessed in 6 renal patients ( creatinine clearance between 30 and 70 ml / min ) and 16 patients with diabetes mellitus type 2 ( 8 using metformin and 8 using metformin plus sulfonylurea ) . intervention studies were performed in apparently healthy males and females , not using any medication . in all experiments , subjects were fasted for at least 3 hours before endopat measurements . reactive hyperemia index ( rhi ) , which is a measure for endothelial function , and augmentation index ( ai ) , which is a measure for arterial stiffness , were assessed using the endopat 2000 device ( itamar medical , israel ) . both measures were calculated using a computerised automated algorithm ( software version 3.1.2 ) provided with the device . briefly , the subjects were in supine position for a minimum of 20 minutes before measurements , in a quiet , temperature - controlled ( 2124c ) room with dimmed lights . the subjects were asked to remain as still as possible and silent during the entire measurement period . each recording consisted of 5 minutes of baseline measurement , 5 minutes of occlusion measurement , and 5 minutes postocclusion measurement ( hyperemic period ) . the occlusion pressure was at least 60 mmhg above the systolic blood pressure ( minimally 200 mmhg , and maximally 300 mmhg ) . endothelial function and arterial stiffness were investigated in six patients with chronic kidney failure ( subject characteristics in table 1 , glomerular filtration rate was estimated by calculation of creatinine clearance using a 24-hour urine collection ) . all measurements were performed in the morning . per subject , 3 measurements were performed , separated by one to two weeks . patients were allowed to use medication needed for their medical condition , except for corticosteroids and erythropoietic medication within one month before study participation . endothelial function and arterial stiffness were investigated in 16 patients with diabetes mellitus type 2 ( subject characteristics in table 2 ) . all subjects were on oral antidiabetics to control glucose metabolism : 8 subjects were using metformin , and 8 subjects were using metformin plus sulfonylurea . per subject , two endopat measurements were performed : one time during continuation of the antidiabetic therapy and one time after two weeks of therapy discontinuation , with the sequence randomized . patients were allowed to use medication needed for their medical condition , except for medication known to affect glucose homeostasis ( other than biguanides and sulphonylurea ) , anti - inflammatory drugs , nonselective beta blockers , oral anticoagulants , and systemic glucocorticoids or other immunosuppressive drugs . six nonsmoking female subjects ( mean age 23 3 years ) participated in the oral glucose intervention study part . after the baseline endopat measurement was performed , an oral glucose solution ( 75 g glucose in 300 ml ) was consumed within 4 minutes . at 30 minutes and 90 minutes after the oral glucose consumption six male cigarette smoking subjects ( mean age 32 10 years ) participated in this study part . subjects refrained from smoking until at least 2 hours before the start of the study . after a baseline measurement was performed , the participants smoked a cigarette ( tar 10 mg , nicotine 0.8 mg and carbon monoxide 10 mg ) within 4 minutes . at 30 minutes and 90 minutes after smoking unpaired t - tests were used to compare rhi and ai between healthy volunteers and patients and between diabetic patients using metformin only and patients using metformin plus sulfonylurea , while paired t - tests were used to compare rhi and ai between diabetic patients who continued their medication and patients who discontinued their medication . the intervention experiments were carried out in groups of 6 healthy volunteers ; a sample size based on the observed intraindividual variability in rhi and the level of impairment of endothelial function determined by conventional techniques ( high - resolution ultrasound , plethysmography ) in intervention studies as reported in literature . our experiments were powered such that a group size of 6 would have 80% power to detect a 25% change in baseline rhi using a 2-sided alpha of 5% . paired t - tests were used to compare the difference in rhi between baseline and the postintervention measurements , which was considered to be statistically significant when p value < 0.05 .", "to assess the performance of the endopat , we investigated the variability of endothelial function ( rhi ) and arterial stiffness ( ai ) in patients with chronic kidney failure on three different days , separated by one to two weeks . average rhi over three days was 2.9 1.4 ( table 3 ) . for most patients , the rhi values exceeded a value of 2 ( range : from 1.7 to 5.5 ) . official reference values for rhi are not available , but in general rhi values below 2 are categorized as endothelial dysfunction , whereas higher rhi values are considered normal or improved endothelial function ( itamar product information ) . the average intra - individual variability for the rhi was 13% ( ranging from 1% to 29% for individuals , data not shown ) . this is in line with the expectation , as normal arterial stiffness is defined by an ai between 30% and 10% , increased arterial stiffness by an ai between 10% and 10% , and abnormal arterial stiffness by an ai above 10% . the mean intra - individual coefficient of variation was 37% ( ranging from 13% to 67% , data not shown ) . these data indicate that whereas endothelial function is a relatively stable measure over a longer period of time , arterial stiffness as determined by the endopat is rather variable . next , we measured endothelial function and arterial stiffness in patients with diabetes mellitus type 2 , 8 subjects using metformin and 8 subjects using metformin plus sulfonylurea . endothelial function and arterial stiffness were determined during continuation of the antidiabetic therapy and after two weeks of therapy discontinuation . arterial stiffness , as determined by ai , was not different between patients using metformin or metformin plus sulfonylurea or between patients continuing and discontinuing antidiabetic medication ( table 4 : 5.9 9.4 versus 9.0 13.0 and 14.3 18.8 versus 16.3 16.0 , resp . ) . however , rhi was significantly higher in patients using a combination of metformin plus sulfonylurea , compared to patients using metformin only ( table 3 : 2.5 0.7 versus 1.8 0.3 in patients continuing therapy and 2.7 1.1 versus 1.8 0.4 in patients discontinuing therapy ; p = 0.02 and 0.04 resp . ) . the increasing effect of sulfonylurea treatment on rhi was independent on continuation or discontinuation of the use of antidiabetics . finally , we investigated the capability of the endopat to detect changes in endothelial function induced by two acute interventions in healthy volunteers . neither the oral glucose load nor the smoking intervention resulted in significant effects on endothelial function ( figure 1 ) . for the glucose intervention , the difference in rhi from baseline measurement was 0.08 0.50 ( 95% ci , confidence interval : from 0.44 to 0.60 ) for the 30 min assessment and 0.44 0.86 ( 95% ci : from 0.46 to 1.34 ) for the 90 min assessment . for the smoking intervention , the difference in rhi from baseline measurement was 0.49 0.92 ( 95% ci : from 0.47 to 1.46 ) for the 30 min assessment and 0.39 0.53 ( 95% ci : from 0.16 to 0.95 ) for the 90 min assessment . ai and rhi were compared between the investigated patient groups and the healthy volunteer group . as expected , ai was higher in renal patients compared to healthy subjects ( table 4 : 26.1 13.9 in patients versus 6.0 14.2 in healthy volunteers , p = 0.001 ) . ai was also higher in diabetic patients compared to healthy subjects , independent of type of oral antidiabetics ( metformin or metformin plus sulfonylurea ) or continuation or discontinuation of therapy ( table 4 : 5.9 9.4 , 9.0 13.0 , 14.3 18.8 , and 16.3 16.0 , resp . , in patients versus 6.0 14.2 in healthy volunteers , 0.01 < p < 0.05 ) . however , there was no difference in rhi between the renal patients and the healthy volunteers ( table 3 : 2.9 1.4 in patients versus 1.8 0.5 in healthy volunteers , p = 0.15 ) . furthermore , rhi values did not differ between diabetic patients using metformin and healthy volunteers ( table 3 : 1.8 0.3 in patients continuing therapy and 1.8 0.4 in patients discontinuing therapy versus 1.8 0.5 in healthy volunteers ) . rhi was significantly higher in diabetic patients using a combination of metformin plus sulfonylurea compared to healthy volunteers ( table 3 : 2.5 0.7 in patients continuing therapy and 2.7 1.1 in patients discontinuing therapy ; p = 0.04 and 0.01 resp . versus healthy volunteers ) .", "endothelial dysfunction is present in several systemic pathological conditions [ 59 ] , associated with considerable morbidity and mortality . as a consequence , endothelial dysfunction is expected to gain interest as potential target for ( pharmaceutical ) intervention within the coming years . currently , endothelial function is assessed mainly by high - resolution ultrasound of the brachial artery . however , this technique has important practical limitations : it is strongly operator - dependent , and it offers no correction for autonomous activation of the nervous system , as vascular dilation is only studied in one arm . to overcome these problems , the endopat was developed , allowing noninvasive measurement of endothelial function via assessment of reactive hyperemia . although in several studies the endopat appeared to be feasible to demonstrate improvement of endothelial function as a result of lifestyle modification or pharmacological intervention [ 1924 ] , the information in literature on the performance of the endopat in intervention trials is limited . therefore , we performed a series of experiments to investigate the feasibility of the endopat to evaluate acute changes in endothelial function with repeated measurements and to assess the discriminating power of the endopat for endothelial function and arterial stiffness in different populations . we assessed the variability of endothelial function ( by rhi ) and arterial stiffness ( by ai ) , as measured by the endopat , in patients with impaired renal function on three different days . next , we measured endothelial function and arterial stiffness in patients with diabetes mellitus type 2 . finally , we investigated the applicability and feasibility of the endopat to detect changes in endothelial function in healthy volunteers after interventions known to be associated with robust acute changes in endothelial function in an adequately powered experiment . generally , augmentation index , calculated from carotid , aortic , or radial artery pressure waves using conventional techniques , is a reliable and reproducible measure to define arterial stiffness . however , the influence of variables such as heart rate and vasomotor tone of the arterial system can affect the variability of the technique . we demonstrated that when using the endopat , the intra - individual variability in ai was substantial over a longer period of time ( cv : coefficient of variation , 37% ) . this indicates that arterial stiffness as determined by the endopat is also not a stable measure , which limits its usefulness to assess the effects of ( pharmacological ) interventions . arterial stiffness as measured by the endopat was higher in renally impaired patients with vascular disease compared to healthy subjects . this is in line with reports in literature in patient populations : compared to healthy volunteers , arterial stiffness is increased in a variety of pathological conditions , such as coronary artery disease , metabolic syndrome , and chronic kidney disease [ 3739 ] . compared with arterial stiffness , rhi proved to be a more stable measure ( cv 13% ) . surprisingly , endothelial function , as determined by reactive hyperemia index , was not impaired in the renal patient group . importantly , observed rhis in the patient population were scattered over a broad range , covering both endothelial dysfunction ( rhi < 2 ) and exceptionally good endothelial function ( rhi > 3 ) . given the fact that all subjects were renally impaired and treated for hypertension , it is very unlikely that 4 out of 6 patients had an ( exceptionally ) good endothelial function . obviously , all patients used medication with pertinent effects on endothelial function ( table 1 : statins , ace inhibitors , and calcium channel blockers ) , but literature data suggest that despite optimal ( cardiovascular ) therapy , a considerable increased risk for cardiovascular morbidity in this population still exists . importantly , although most chronic kidney disease patients use antihypertensive medication and other drugs that could affect endothelial function ( statins , potassium , and ace inhibitors ) , they still exhibit a significantly impaired endothelial function as demonstrated by laser doppler flowmetry ( 32% reduction ) . interestingly , gordon et al . reported that pulse contour analysis obtained by finger plethysmography , which is comparable with the endopat methodology , may not be suitable to measure endothelial function in subjects with extensive coronary artery disease , as no effect of administration of strong vasodilators ( salbutamol and nitroglycerin ) could be observed . we investigated whether the endopat could discriminate in vascular function between healthy volunteers and patients with diabetes mellitus type 2 . as expected , arterial stiffness was higher in diabetic patients compared to healthy subjects , irrespective of treatment with oral antidiabetics . however , endothelial function ( as measured by the endopat ) was not impaired in diabetic patients using metformin compared to healthy volunteers , neither during continuation of treatment nor after two weeks of treatment discontinuation . this is contrasting with literature , which demonstrates that endothelial function , measured using conventional techniques ( endothelium - dependent flow - mediated dilatation of the brachial artery , by ultrasound ) , is substantially impaired in diabetic patients ( reduction of endothelial function versus healthy controls or subjects with coronary artery disease without diabetes ranging from 27% to 43% ) [ 2931 ] . this discrepancy could not be explained by an effect of treatment with oral antidiabetics , as rhi was assessed both during treatment continuation and after a two - week period of treatment discontinuation . rhi was significantly increased in patients using a combination of metformin plus sulfonylurea , compared to healthy volunteers and to patients using metformin only . this stimulating effect of sulfonylurea treatment on rhi was still observed after two weeks of treatment discontinuation , implicating a long - lasting effect of sulfonylurea on endothelial function . this is remarkable as the general point of view is that the use of pancreatic -cell - specific sulfonylurea ( i.e. , glimepiride , as used by 6 out of 8 diabetic subjects in our study ) does not affect endothelial function [ 4345 ] . possibly , endothelial function as measured by the endopat ( rhi ) is a physiologically different process than endothelial function as measured by conventional techniques such as high - resolution ultrasound ( endothelium - dependent fmd ) . the exact nature of this difference is currently unknown , and should be investigated in detail before the endopat can be considered a useful tool in drug development or clinical practice . we evaluated the performance of the endopat to detect the effects of two different acute interventions on rhi in healthy subjects . the literature shows that fmd decreases by 4065% after smoking one cigarette , which is detected directly after smoking and lasts for 1 hour [ 2 , 32 , 46 , 47 ] . also hyperglycaemia , induced by the administration of a standardised oral glucose load , has been reported to acutely lead to a 2545% impairment of endothelial function , as assessed by fmd or forearm blood flow plethysmography [ 33 , 34 , 48 ] . however , we were unable to replicate these findings on endothelial function using the endopat , demonstrating that the device is currently not suitable to detect acute changes in endothelial function after different robust interventions . there could be several explanations for our findings . in the automated analysis , the endopat software uses a fixed time frame during the hyperemic response to calculate the rhi . inspection of the data and manual analysis of the rhi showed that the maximal hyperemic response does not always occur in the same time period after occlusion ( data not shown ) , an observation that is supported by literature . for example , the time course of fmd is strongly influenced by age : comparison of young and older subjects indicates that the time frame to reach maximal vasodilatation after occlusion is significantly prolonged in older subjects . this may be remedied by refinement of the endopat software to allow for interindividual differences in hyperemic time course . although inter - individual differences in hyperemic time course is a potentially confounding factor when using the automatic analysis , manual analysis of our data did not result in significantly different findings ( data not shown ) . there are some indications that endothelial function is subject to a circadian rhythm , with a lower reactive hyperemic response in the morning , but this is not unambiguously supported [ 5154 ] . in fact , the presumed circadian variability is probably more related to changes in physical activity , blood pressure and shear stress , and changes in plasma lipids . whatever the explanation may be , our experiments were performed within a short fixed time frame of maximally 2 hours , in a fasted condition and in complete rest , thereby reducing the influence of these confounding factors . as a consequence , it is unlikely that circadian variability has influenced our measurement outcomes . finally , it is possible that previous experiments using ultrasound or plethysmography to assess the acute effect of an intervention on endothelial function are flawed because measurements were performed ( in the majority of the cases ) in the vasculature of one arm only , and thus relatively uncontrolled for concomitant systemic hemodynamic changes . we are well aware that the group sizes of our intervention experiments were small and that no formal control groups were included . however , the experiments were sufficiently powered to detect intervention - induced changes in endothelial function at effect sizes that are reported in literature using fmd or forearm blood flow plethysmography . in conclusion , whereas the reactive hyperemia index ( a measure for endothelial function ) , as determined by the endopat , is rather stable over time , the augmentation index ( a measure for arterial stiffness ) showed substantial intra - individual variability , limiting its value for evaluation of ( pharmacological ) interventions . surprisingly , the endopat did not demonstrate differences in endothelial function between healthy volunteers and renally impaired patients with known vascular disease or diabetic patients . in the latter patient group , an unexplained improving effect of sulfonylurea on reactive hyperemia index was demonstrated by the endopat . this could indicate that endothelial function as measured using the endopat might be physiologically different from endothelial function as measured by conventional techniques . furthermore , the endopat was not useful to detect the effect of robust interventions on endothelial function while the experiments were adequately powered . taken together , our findings suggest that the endopat is at present not suitable to assess ( changes in ) endothelial function and arterial stiffness in populations with sizes that are commonly employed in clinical pharmacology studies ." ]

[ "the clustering of cardiovascular risk factors that includes central adiposity , hypertension , hyperglycemia , and high triglycerides ( tg ) with low high density lipoprotein cholesterol ( hdl - c ) levels is termed the metabolic syndrome ( ms ) . ms is known to strongly predict the long - term risk of diabetes and cardiovascular disease ( cvd ) . adipose tissue products are reported to affect systemic metabolism ; among these are adiponectin , leptin , plasminogen activator inhibitor-1 ( pai-1 ) , resistin , inflammatory cytokines , and angiotensinogen . adiponectin has recently attracted much attention with particular emphasis on the role of adiponectin in the regulation of insulin sensitivity and the development of insulin resistance . plasma levels of adiponectin have also been reported to be significantly reduced in obese humans . moreover , plasma adiponectin levels have been shown to be decreased in patients with type-2 diabetes mellitus ( t2 dm ) , cvd , hypertension , and ms.[69 ] adiponectin activates adenosine mono - phosphate activated protein kinase and peroxisome proliferator activated receptor- in the liver and skeletal muscle , thereby stimulating phosphorylation of acetyl - coa carboxylase , fatty acid oxidation , thus decreasing tissue triglyceride ( tg ) content in muscle and liver . the expression levels of adipor1/r2 are also decreased in obesity , which reduces adiponectin sensitivity and finally leads to insulin resistance , the so - called vicious cycle . adiponectin was demonstrated to strongly inhibit the expression of adhesion molecules , including intracellular adhesion molecule-1 , vascular cellular adhesion molecule-1 , and e - selectin . thus , various studies have highlighted the potential antidiabetic , antiatherosclerotic and anti - inflammatory properties of adiponectin . decreased levels of plasma adiponectin are associated with increased body mass index ( bmi ) , decreased insulin sensitivity , less favorable plasma lipid profiles , increased levels of inflammatory markers and increased risk for the development of cvd . therefore , adiponectin levels hold great promise for use in clinical application , serving as a potent indicator of underlying metabolic complications . plasma pai-1 levels are elevated in obesity and insulin resistance , are positively correlated with features of the ms , and predict future risk for type 2 diabetes and cvd . thus , pai-1 may contribute to the development of obesity and insulin resistance and may be a causal link between obesity and cvd.[1113 ] there are few studies which have evaluated adipokines in indian population.[1417 ] hence , we studied adiponectin and pai-1 levels and their correlation with various parameters in subjects with ms .", "this study was carried out at the department of endocrinology of a tertiary care center and details are provided in our previous publication in this journal . subjects with age 30 years and 50 years ( to exclude all postmenopausal women ) were screened for the presence of ms according to international diabetes federation ( idf ) criteria as follows : central obesity ( waist circumference males > 90 cm , females > 80 cm ) plus any two of the following : raised triglycerides ( > 150 mg / dl ) , reduced hdl - c ( < 40 mg / dl in men and < 50 mg / dl in women ) , raised blood pressure ( systolic 130 mm hg or diastolic 85 mm hg ) , raised fasting plasma glucose ( fpg ) ( 100 mg / dl ) . age- and sex - matched healthy subjects were screened for the absence of ms . only those cases with waist circumference below the idf criteria and absence of at least three of the four parameters a total of 50 drug - nave subjects with ms ( 25 males and 25 females ) and 24 controls ( 12 males and 12 females ) were included in the study . subjects with hepatic disease , renal disease , other endocrine diseases , alcoholism , infectious diseases or receiving any medications were excluded from the study . body fat measurement was done using inbody composition analyser - biospacer manufactured by m / s biodex medical systems inc . it measured waist hip ratio ( whr ) , body fat mass ( bfm ) , percent body fat ( pbf ) and basal metabolic rate ( bmr ) . fasting blood samples were drawn for the estimation of fpg , renal and hepatic parameters , a1c , lipid profile , highly sensitive c - reactive protein ( hscrp ) and fibrinogen . one aliquot of the sample was frozen at 80c for the measurement of plasma insulin , adiponectin and pai-1 . adiponectin was measured with avibion human adiponectin ( acrp30 ) elisa commercial kits supplied by orgenium laboratories business unit , finland , as per manufacturer 's instructions . it had an assay range of 0.18515 ng / ml and a sensitivity of < 0.3 ng / ml . intra - assay precision was 10% and inter - assay precision was 12% . pai-1 was measured with human pai-1 elisa ( ea-0207 ) supplied by signosis biosignal capture ( sunnyvale , ca , usa ) , as per manufacturer 's instructions . it had an assay range of 0.320 ng / ml and a sensitivity of < 0.79 ng / ml . intra - assay and inter - assay precision was 15% . the homa model was used to calculate insulin resistance and insulin insensitivity . the formulae are as follows : where fi = fasting insulin in iu / ml and g = fasting glucose in mmol / l . the study was approved by the ethics committee of army hospital ( research and referral ) , delhi cantt , and all subjects gave written informed consent . statistical analysis was carried out using epi info 3.5.3 ( cdc ; atlanta ; usa ) . if barlett 's chi - square test for equality of population variances was < 0.05 , then kruskal wallis test was applied .", "this study was carried out in 50 cases of ms and 24 normal healthy controls . basal characteristics of the cases and controls are shown in table 1 ( also given in our previous publication ) . there were 37 ( 74% ) cases with t2 dm and 13 ( 26% ) cases with impaired glucose tolerance . tg total cholesterol ( tc) low density lipoprotein ( ldl) and very low density lipoprotein ( vldl ) were significantly higher and hdl was significantly lower among cases than in controls . most of the cases ( 28.56% ) had four features of ms , followed by cases with all features ( 16.32% ) , and 6 ( 12% ) cases had three features of ms [ table 1 ] . basic characteristics of cases and controls subjects with ms had significantly lower adiponectin levels than controls ( 4.01 2.24 vs. 8.7 1.77 g / ml ; p < 0.0001 ) [ table 1 ] . there was no difference in adiponectin levels between sexes ( 5.23 3.12 vs. 5.71 2.65 g / ml ; p = 0.49 ) . adiponectin levels according to the number of metabolic abnormalities in univariate regression analysis , adiponectin was negatively associated with age , bmi , bfm and pbf , and positively associated with bmr . among the various parameters of ms , adiponectin was negatively associated with all parameters , except hdl - c with which it was positively associated . adiponectin showed strong negative association with inflammatory markers ( crp , fibrinogen ) and procoagulant marker ( pai-1 ) . adiponectin was positively associated with insulin secretion ( homa - s ) and negatively associated with insulin resistance ( homa - ir ) [ table 2 ] . univariate regression analysis of adipokines among all subjects multiple regression analysis showed that among the metabolic parameters , whr , fpg and tg maintained negative association with adiponectin even after adjustment for all metabolic variables . however , hdl and hypertension lost significance during multiple regression analysis [ table 3 ] . only bmi remained negatively associated with adiponectin when adjusted for anthropometric parameters , e.g. bmr , bfm , and percent body fat , in multiple regression analysis [ table 4 ] . bmr showed positive association when adjusted with bmi , but lost significance when bfm was added . similarly , pai-1 levels showed strong negative association with adiponectin [ figure 2 ] even after adjustment with other parameters like homa - ir , crp , and fibrinogen [ table 5 ] . multivariate regression analysis of adipokines with metabolic parameters among all subjects multivariate regression analysis of adipokines with anthropometric parameters among all subjects correlation between adiponectin and pai-1 among all subjects multivariate regression analysis of adipokines with other parameters among all subjects receiver operating characteristic ( roc ) curve analysis revealed best prediction value of adiponectin at 6.7 g / ml with a sensitivity of 83% , specificity of 86% , accuracy of 85% , positive predictive value of 74% , negative predictive value of 84% and positive and negative likelihood ratios of 5.95 and 0.19 , respectively ( roc 0.934 , se 0.0277 , 95% ci = 0.8790.988 ) . subjects with ms had significantly higher pai-1 levels than controls ( 53.85 16.45 vs. 17.35 4.45 ng / ml ; p < 0.0001 ) [ table 1 ] . there was no difference in pai-1 levels between sexes ( 8.59 4.42 vs. 8.21 4.44 ng / ml ; p = 0.71 ) . pai-1 according to the number of metabolic abnormalities in univariate regression analysis , pai-1 was positively associated with bmi , bfm and pbf , and negatively associated with bmr . among the various parameters of ms , pai-1 was positively associated with all parameters of ms , except hdl with which it was negatively associated . pai-1 showed strong positive association with inflammatory markers ( crp , fibrinogen ) , insulin resistance ( fasting plasma insulin and homa - ir ) and total and ldl cholesterol , but had strong negative association with adiponectin [ table 2 ] . multiple regression analysis of various metabolic parameters showed that whr and tg maintained positive association with pai-1 even after adjustment for all metabolic variables . however , hdl , fpg and hypertension lost significance during multiple regression analysis [ table 3 ] . only pbf remained positively associated with pai-1 when adjusted for anthropometric parameters , e.g. bmr , bfm , and bmi , in multiple regression analysis [ table 4 ] . similarly , pai-1 levels showed strong positive association with fibrinogen even after adjustment with other parameters like homa - ir , crp , and fibrinogen [ table 5 ] . roc curve analysis revealed best prediction value of pai-1 at 25.0 ng / ml , with a sensitivity of 92% , specificity of 96% , accuracy of 95% , positive predictive value of 92% , negative predictive value of 96% and positive and negative likelihood ratios of 22.9 and 0.08 , respectively ( roc 0.975 , se 0.0178 , 95% ci = 0.9421.009 ) .", "subjects with ms had significantly lower adiponectin levels than controls ( 4.01 2.24 vs. 8.7 1.77 g / ml ; p < 0.0001 ) [ table 1 ] . adiponectin levels decreased with increasing number of metabolic abnormalities [ figure 1 ] . there was no difference in adiponectin levels between sexes ( 5.23 3.12 vs. 5.71 2.65 g / ml ; p = 0.49 ) . adiponectin levels according to the number of metabolic abnormalities in univariate regression analysis , adiponectin was negatively associated with age , bmi , bfm and pbf , and positively associated with bmr . among the various parameters of ms , adiponectin was negatively associated with all parameters , except hdl - c with which it was positively associated . adiponectin showed strong negative association with inflammatory markers ( crp , fibrinogen ) and procoagulant marker ( pai-1 ) . adiponectin was positively associated with insulin secretion ( homa - s ) and negatively associated with insulin resistance ( homa - ir ) [ table 2 ] . univariate regression analysis of adipokines among all subjects multiple regression analysis showed that among the metabolic parameters , whr , fpg and tg maintained negative association with adiponectin even after adjustment for all metabolic variables . however , hdl and hypertension lost significance during multiple regression analysis [ table 3 ] . only bmi remained negatively associated with adiponectin when adjusted for anthropometric parameters , e.g. bmr , bfm , and percent body fat , in multiple regression analysis [ table 4 ] . bmr showed positive association when adjusted with bmi , but lost significance when bfm was added . similarly , pai-1 levels showed strong negative association with adiponectin [ figure 2 ] even after adjustment with other parameters like homa - ir , crp , and fibrinogen [ table 5 ] . multivariate regression analysis of adipokines with metabolic parameters among all subjects multivariate regression analysis of adipokines with anthropometric parameters among all subjects correlation between adiponectin and pai-1 among all subjects multivariate regression analysis of adipokines with other parameters among all subjects receiver operating characteristic ( roc ) curve analysis revealed best prediction value of adiponectin at 6.7 g / ml with a sensitivity of 83% , specificity of 86% , accuracy of 85% , positive predictive value of 74% , negative predictive value of 84% and positive and negative likelihood ratios of 5.95 and 0.19 , respectively ( roc 0.934 , se 0.0277 , 95% ci = 0.8790.988 ) .", "subjects with ms had significantly higher pai-1 levels than controls ( 53.85 16.45 vs. 17.35 4.45 ng / ml ; p < 0.0001 ) [ table 1 ] . pai-1 levels increased with increasing number of metabolic abnormalities [ figure 3 ] . there was no difference in pai-1 levels between sexes ( 8.59 4.42 vs. 8.21 4.44 ng / ml ; p = 0.71 ) . pai-1 according to the number of metabolic abnormalities in univariate regression analysis , pai-1 was positively associated with bmi , bfm and pbf , and negatively associated with bmr . among the various parameters of ms , pai-1 was positively associated with all parameters of ms , except hdl with which it was negatively associated . pai-1 showed strong positive association with inflammatory markers ( crp , fibrinogen ) , insulin resistance ( fasting plasma insulin and homa - ir ) and total and ldl cholesterol , but had strong negative association with adiponectin [ table 2 ] . multiple regression analysis of various metabolic parameters showed that whr and tg maintained positive association with pai-1 even after adjustment for all metabolic variables . however , hdl , fpg and hypertension lost significance during multiple regression analysis [ table 3 ] . only pbf remained positively associated with pai-1 when adjusted for anthropometric parameters , e.g. bmr , bfm , and bmi , in multiple regression analysis [ table 4 ] . similarly , pai-1 levels showed strong positive association with fibrinogen even after adjustment with other parameters like homa - ir , crp , and fibrinogen [ table 5 ] . roc curve analysis revealed best prediction value of pai-1 at 25.0 ng / ml , with a sensitivity of 92% , specificity of 96% , accuracy of 95% , positive predictive value of 92% , negative predictive value of 96% and positive and negative likelihood ratios of 22.9 and 0.08 , respectively ( roc 0.975 , se 0.0178 , 95% ci = 0.9421.009 ) .", "ms is known to strongly predict long - term risk of diabetes and cvd , and has also been reported to be associated with increased morbidity and mortality . it is becoming increasingly common in the united states and worldwide , and is emerging as the dominant risk factor for cvd in asia . the ms represents a combination of risk determinants , which include atherogenic dyslipidemia , elevated blood pressure , elevated glucose , a prothrombotic state , and a proinflammatory state . in obese persons , adipose tissue products are reported to affect systemic metabolism ; among these are adiponectin , leptin , inflammatory cytokines , pai-1 , resistin , and angiotensinogen . in this study , we evaluated 50 subjects with ms ( 25 males and 25 females ) and 24 controls ( 12 males and 12 females ) . we have used here idf criteria as it provides ethnic - specific criteria for central obesity . all cases had significantly higher whr , bmi bfm and pbf than controls in both the sexes , which is similar to asian indian obesity phenotype . low adiponectin levels have been reported in most of the studies on ms among people of various age groups , ethnicity and gender.[14152127 ] however , one study reported higher adiponectin levels in ms and another found low adiponectin level which was statistically not significant . there was negative graded response of adiponectin levels with metabolic abnormalities [ figure 1 ] . adiponectin was negatively related with age , bmi , bfm and pbf , whr , fpg , hypertension , tg , tc , hscrp , fibrinogen , homa - ir and pai-1 , and positively related with bmr , hdl and homa - s in the present study . similar associations have been reported in the literature.[17263135 ] however , certain differences were observed between the present study and other studies . in this study , adiponectin showed no relation with fasting insulin levels , as also observed by one study from south india , whereas others have reported negative correlation . we have observed negative correlation of cholesterol with adiponectin , similar to that reported by bilgili et al . but others found no relation of adiponectin with tc . , did not observe any relation between adiponectin and hscrp in post - pubertal asian indian adolescents , as seen by us . multiple regression analysis of the metabolic parameters showed whr , fpg and tg to have an independent negative association with adiponectin even after adjustment for all metabolic variables . yang et al . , observed positive association of hdl with adiponectin in multiple regression analysis . however , in our study , hdl and hypertension lost significance during multiple regression analysis . ku et al . , reported correlation between serum adiponectin and bmi , triglyceride , hdl - c and fasting glucose in multiple regression analysis . in the present study , only bmi remained negatively associated with adiponectin when adjusted for anthropometric parameters , e.g. bmr , bfm , and pbf , in multiple regression analysis . jung et al . , showed significant negative correlation of adiponectin levels with percent body fat , lipid profile and homa - ir . bmr showed positive association when adjusted with bmi , but lost significance when bfm was added . similarly , pai-1 levels showed strong negative association with adiponectin even after adjustment with other parameters like homa - ir , crp , and fibrinogen . bilgili et al . , also found an inverse relationship between plasma adiponectin and pai-1 ( r = 0.653 , p < 0.001 ) . roc curve analysis revealed best prediction value at 6.7 g / ml , with a sensitivity of 83% , specificity of 86% , and accuracy of 85% . mohan et al . , also reported similar adiponectin levels ( 5.0 g / ml for males and 6.5 g / ml for females ) in a study from south india . however , studies from japan have suggested lower cut - off point ( 4 g / ml ) of serum adiponectin level for the diagnosis of ms . seino et al . , also suggested that measuring adiponectin may be effective for evaluating the presence of ms in nondiabetic subjects through analysis of area under the curve of roc curves . subjects with ms had significantly higher pai-1 levels than controls , which is similar to that reported in many studies in the literature.[13263945 ] however , pai-1 level was higher in the present study than that reported from other ethnic populations . indian population has higher pai-1 compared to african population , which is explained by the increased frequency of pai-1 4 g allele . pai-1 was positively associated with bmi , bfm and pbf , and negatively associated with bmr . among the various parameters of ms , pai-1 was positively associated with all parameters of ms , except hdl with which it was negatively associated . pai-1 showed a strong positive association with inflammatory markers ( hscrp , fibrinogen ) , insulin resistance ( fasting plasma insulin , homa - ir ) and total and ldl cholesterol , but had strong negative association with adiponectin . tg and whr were independently associated with pai-1 even after adjustment for all metabolic variables in multiple regression analysis . , also found waist circumference as the strongest independent predictor of pai-1 . however , hdl , fpg and hypertension lost significance during multiple regression analysis . only pbf remained positively associated with pai-1 when adjusted for anthropometric parameters , e.g. bmr , bfm , and bmi , in multiple regression analysis . similarly , pai-1 levels showed a strong positive association with fibrinogen even after adjustment with other parameters like homa - ir , crp , and adiponectin . roc curve analysis revealed the best prediction value at 25.0 ng / ml , with a sensitivity of 92% , specificity of 96% , accuracy of 95% , and positive predictive value of 92% . other studies have also made similar observation that pai-1 is an independent determinant of ms in multivariate logistic regression analysis . surprisingly , we have found higher cut - off value for adiponectin and lower cut - off value for pai-1 for diagnosis of ms . the primary limitation of the present study is its cross - sectional design and the inherent possibility that genetic and/or lifestyle factors may have influenced the results of our group comparisons . however , in an effort to minimize the influence of lifestyle behaviors , we studied subjects of similar age who were non - smokers , who were not currently taking medication that could influence inflammatory and oxidative markers ( i.e. statins ) , and who did not differ in habitual physical activity . in addition , we used strict inclusion criteria to eliminate the confounding effects of underlying cardiovascular and metabolic disease .", "in the present study , subjects with ms had higher bmi , bfm and percent body fat , which is reflected in lower level of adiponectin and higher level of pai-1 . also , they had increased insulin resistance and decreased insulin secretion compared to healthy controls . subjects with ms were associated with higher hscrp level , emphasizing low - grade systemic inflammatory state . all these factors were interdependent and associated with other cardiovascular risk factors . although the knowledge on pathogenesis and its association with metabolic risk factors such as obesity , hypertension , and cardiovascular risk is increasing day by day , the challenge is to translate research findings into substantial clinical improvements for patients . demographic and epidemiological evidence indicates that unless an effective preventive strategy is developed , there will be a sharp increase in the global prevalence of cardiometabolic risk factors including diabetes and ms . lifestyle measures have been shown to improve insulin resistance , insulin secretion and various components and effects of ms,[14951 ] and hence there is an urgent need for public health measures to prevent the ongoing epidemic of diabetes and cvd ." ]

[ "in india , 23.9 lakh people were living with hiv / aids ( plha ) in 2009 and children under 15 years accounted for 3.5% of all infections . according to who / unaids estimates , 450,000 children were receiving antiretroviral therapy ( art ) and more than 2 million children still needed art in 2010 . zidovudine ( azt ) , being an important component of standard regimen for first - line art in children , is widely used for managing pediatric hiv . as more and more children are exposed to this drug , the range of adverse reactions can also be expected to expand . nail pigmentation with azt is a well - documented occurrence in adults , especially dark - skinned individuals . , we report a case of zidovudine - induced nail pigmentation in a 12-year - old boy .", "in december 2011 , a 12-year - old boy was brought by guardians to dermatology opd for nail pigmentation involving all fingernails . about 4 years back , art was started for him with stavudine - based regimen ( 12 mg stavudine + 60 lamivudine + 100 mg nevirapine ) because of too low hemoglobin level . but after improvement in hemoglobin level , he has been shifted to zidovudine - based regimen ( zidovudine 300 mg + lamivudine 150 mg + nevirapine 200 mg ) since last 1 year . after 3 months of initiating the new regimen , he noticed bluish - brown discoloration of thumbnails that gradually spread to other fingernails [ figure 1a and b ] and grew in intensity over time [ figure 1c and d ] . there was no history of trauma , use of coloring agents , any triggering factor , or abnormal skin or mucosal pigmentation . ( a ) pigmentation involving all nails ( december 2011 ) ; ( b ) thumbnail involvement ( december 2011 ) ; ( c ) increased pigmentation in all nails ( march 2012 ) ; ( d ) increased pigmentation in thumbnails ( march 2012 ) on examination , he was averagely built , nourished , and fully immunized . local examination revealed diffuse bluish - brown discoloration of all fingernails , but it was more marked in thumbnails . nails were brittle with loss of lunulae and periungual changes [ figure 1c and d ] . the patient and guardians were counseled about harmless nature of this adverse drug reaction ( adr ) and he is receiving the same regimen at present .", "nail pigmentation with zidovudine was first described by furth and kazakis in two black patients in whom progressive hyperpigmentation of all fingernails developed . since then , several such case reports have been published from various parts of the world.[68 ] but all these patients were adults , and we did not come across any case report on pediatric patients . though our patient was receiving three antiretroviral drugs , zidovudine was thought to be the most likely cause of nail pigmentation , as pigmentation developed after 3 months of initiating zidovudine - based regimen . the causality assessment by naranjo algorithm showed that this adr was probable with zidovudine . in previous studies , patients taking zidovudine had noticed nail changes in 48 weeks or even after 56 months.[1011 ] dark - skinned individuals are at higher risk of this adverse effect and it appears to be reversible and dose dependant . nail pigmentation occurs in variety of medical conditions and is also associated with use of several drugs , especially chemotherapeutic agents . the pattern of nail pigmentation may be transverse bands , longitudinal bands , or diffuse discoloration . histopathologic findings of nail biopsy show deposits of brown pigmented granules containing melanin throughout the epidermis . as more patients receive zidovudine , it is important to alert patients about nail pigmentation . though it is harmless and reversible , psychological aspects of this noticeable side effect may hamper adherence and efficacy of therapy . this may also lead to unnecessary investigations and treatment for misdiagnosis such as cyanosis and melanoma . physicians should also focus on preventing adverse effects and distinguishing serious adrs from self - limiting adrs in order to manage prejudiced and fearful patients with available art ." ]

[ "several chemoprotective properties of lycopene on prostate cancer have been proposed , including potent antioxidant properties , decreased lipid oxidation , inhibition of cancerous cell proliferation at the g0-g1 cell cycle transition , and protection of lipoproteins and dna [ 1 , 2 ] . these mechanistic studies have stimulated the examination of lycopene and its primary source , tomato products , on risk of prostate cancer . however , studies on lycopene and tomato intake and prostate cancer incidence have yielded mixed results . the study of this relationship has been complicated by unique and challenging epidemiologic considerations in the measurement of lycopene and on the influence of prostate - specific antigen ( psa ) screening on prostate cancer incidence and progression . as with all epidemiologic studies , this paper briefly describes the methodology essential for conducting studies on the association between lycopene and prostate cancer incidence and provides an updated review of studies of lycopene and tomato products with prostate cancer risk .", "lycopene is a carotenoid devoid of vitamin a activity . the major source by far , particularly in western populations , is tomato and tomato products ; a few other foods such as watermelons and pink grapefruit also contain lycopene . in epidemiologic studies , approaches to assess an individual 's lycopene intake or status include studies that estimate intake of lycopene ( based on reported intake of foods and food content of lycopene from food composition databases ) , studies that assess tomato product intake as a surrogate of lycopene intake , and studies that measure lycopene levels in the serum or plasma . an issue that is not unique for lycopene , but perhaps of special importance for this carotenoid , is the variable absorption of lycopene from different food sources . in particular , cooking in an oil medium substantially enhances bioavailability of lycopene in the intestine because lycopene is highly bound to plant source matrices and is highly lipophilic . the measure of lycopene in the serum has theoretical advantages of accounting for absorption and not relying on study participants ' food recall and accuracy of food composition tables . on the other hand , serum studies have frequently relied on a single measure , and how well a single measurement reflects long - term intake is not entirely clear . also , since lycopene comes largely from tomato sources , circulating lycopene level may be acting as a surrogate of tomato product intake , and other components of tomatoes may account for any observed association with cancer risk . finally , a population that consumes overall low levels of lycopene or similar levels of lycopene across individuals may result in insufficient contrast between high and low consumers .", "psa release into the serum occurs with tissue breakdown between the prostate gland lumen and capillaries . the original purpose of the psa measurement was to monitor prostate cancer progression and recurrence . the food and drug administration approved psa testing for monitoring disease status in men with prostate cancer in 1987 and expanded its use to diagnosing prostate cancer in 1992 . this approval was followed by professional society guidelines that supported the use of psa testing for prostate cancer screening . consequently , psa became widely used as a screening test in the united states and increasingly in other countries . as a screening modality , the sensitivity and specificity of psa varies based on the cut - off . for example , a psa level of 3 ng / ml has a sensitivity of 32% for detecting any prostate cancer and 68% for high - grade prostate cancer and a specificity of 85% . if this level were increased to 4 ng / ml the sensitivity would decrease to 21% for any prostate cancer and 51% for high grade prostate cancer but specificity would improve to 91% . elevated serum psa may precede invasive carcinoma by a minimum of 510 years . thus , psa testing enabled earlier detection of prostate cancer . the rate of first - time psa testing was strongly correlated with prostate cancer incidence rates . with the onset of psa for screening , prostate cancer incidence increased and peaked in 1992 and declined thereafter . prior to widespread psa use for screening , prostate cancer diagnosis was largely prompted by physical exam findings of an enlarged prostate or symptoms ranging from urinary incontinence to more advanced spinal cord compression and bony pain from metastasis ; therefore , prostate cancer was mostly detected in relatively advanced stages . invasive carcinoma prevalence increases with age : 2% for men in their 30 s compared with 64% for men in their 70s . one - third of men under age 80 will have prostate cancer detected on autopsy . the lifetime risk of prostate cancer is 16% while the risk of mortality from prostate cancer is 2.9% . thus a psa screening era beginning in 1988 , fda approved in 1992 , and peaking between 1992 and 1998 has been referred to as a period in which prostate cancers diagnosed by serum psa alone encompassed a variety of stages of prostate cancers , including clinically indolent cancers [ 4 , 7 ] . in addition to diagnosing biologically indolent cancers , psa elevation occurs with benign conditions including benign prostatic hypertrophy , prostatitis , subclinical inflammation , ejaculation , digital rectal exams ( potentially performed just prior to patients having their psa lab drawn ) , perineal trauma , prostatic infarction , urinary retention , biopsy , and transurethral resection of the prostate . the influence of psa on prostate cancer mortality has been controversial , with randomized trials not yielding a clear answer . however , undoubtedly psa screening has caused an increase in the number of indolent cancers being treated aggressively and ultimately led to increased morbidity from side effects of treatment . the majority of newly diagnosed prostate cancers were clinically localized and unlikely clinically significant to involve aggressive medical and surgical therapy such as radical prostatectomy with radiation ablation intended to cure early - stage cancers . for these reasons , in 2011 the united states preventive services task force recommended against psa screening for prostate cancer regardless of age , race / ethnicity , and family history . beyond the clinical consequences , psa screening has altered the landscape of prostate cancer epidemiology . many more cancers are diagnosed , including a substantial proportion of relatively indolent cancers , and the cancers are diagnosed earlier in their natural history , often before evidence of aggressive behavior is manifested . thus , depending on at what stage and on what subtype of prostate cancer a risk factor may be acting , the relationship between this risk factor and prostate cancer risk may differ in populations exposed or not exposed to widespread psa screening . by increasing the heterogeneity in prostate cancers being diagnosed , psa screening has added complexity to the epidemiologic study of prostate cancer .", "a number of randomized clinical trials have examined lycopene and prostate cancer progression and mortality in men diagnosed with prostate cancer . the randomized studies have been small and inconclusive . in a double - blind randomized placebo - controlled trial , 105 african american male veterans recommended for biopsy to detect prostate cancer were administered tomato sauce containing 30 mg / day of lycopene or placebo over 21 days . psa and lycopene levels were measured , and the group randomized to lycopene had an increase in serum lycopene and decrease in psa while the placebo group had the reverse , with a decrease in serum lycopene and increase in psa . this study did not report a significant decrease in prostate cancer risk for individuals administered lycopene , but the study duration of 21 days was likely inadequate to significantly influence prostate cancer risk . one study reported a decline in psa in the lycopene as well as placebo group after 1 month of intervention but return to baseline psa levels for both groups after 4 months of followup . in general , the clinical trials have been considerably limited by size , length of study duration , and other methodological issues and do not provide strong support or refutation of an association between lycopene and prostate cancer risk . prospective and nested case control studies have been published previously in qualitative [ 13 , 14 ] and quantitative reviews . in a meta - analysis of prospective studies up to 2003 , high intake of raw but not cooked tomatoes was associated with a decreased risk of prostate cancer ( relative risk ( rr ) 0.71 , 95% confidence interval ( ci ) : 0.570.87 ) . subsequent cohort studies on dietary lycopene intake [ 16 , 17 ] have not reported significant inverse associations with prostate cancer risk . however , these studies were conducted in the post - psa era that likely encompassed a heterogeneous group of prostate cancers that included latent and incident cancers . among prospective dietary studies , four [ 1821 ] of six cohorts report an inverse relationship between lycopene or tomato consumption and prostate cancer incidence . the largest and only study with multiple assessments of diet was conducted in the health professionals follow - up study ( hpfs ) [ 18 , 19 ] . the hpfs first reported an inverse association between lycopene intake in 1986 with prostate cancer diagnosed between 1986 and 1992 : rr for high versus low quintile of intake = 0.79 ( 95% ci : 0.640.99 , ptrend = 0.04 ) . high intake of tomato - based products was associated with a 35% decreased risk of total prostate cancer ( rr 0.65 , 95% ci : 0.440.95 ) and 53% decreased risk of advanced stage prostate cancer ( rr 0.47 , 95% ci : 0.221.00 ; ptrend = 0.03 ) . the hpfs analysis was updated for prostate cancer cases between 1992 and 1998 using cumulative average updated intakes ( i.e. , averaging intake from all the dietary questionnaires up to the time period of risk ) of lycopene from 1986 to 1998 with a similar inverse association detected : rr = 0.83 ( 95% ci : 0.700.98 , ptrend = 0.02 ) . the hpfs assessed dietary intake every four years , and the timing of intake in relation to period of risk for prostate cancer was assessed . when baseline lycopene intake in 1986 was evaluated for prostate cancer cases during the entire follow - up period , however , statistically significant inverse associations were found when using the questionnaire closest in time to the time period of risk ( rr for high versus low lycopene intake = 0.84 , 95% ci : 0.740.96 , ptrend = 0.02 ) and cumulative average updated lycopene intake ( rr for high versus low lycopene intake = 0.84 , 95% ci : 0.730.96 , ptrend = 0.003 ) . alternatively , a single measurement of dietary intake at baseline may not be the best measurement to reflect the potential impact of lycopene in altering prostate carcinogenesis , compared with multiple updated dietary measurements . individual tomato products were examined in relation to prostate cancer risk , and the strength of the association corresponded to association of the food item with serum lycopene levels , which were concurrently available in the hfps . for example , tomato sauce , the most bioavailable form of lycopene , was most strongly related to decreased prostate cancer risk ( rr for 2 servings / week versus < 1 serving / month = 0.77 , 95% ci : 0.660.90 ) , followed by tomato and pizza but not tomato juice . there was an even stronger association for advanced prostate cancer : rr for 2 servings / week versus < 1 serving / month of tomato sauce = 0.65 ( 95% ci : 0.420.99 , ptrend = 0.02 ) . a similar magnitude decrease in prostate cancer was reported in the california seventh day adventist cohort between 1974 and 1982 for men with high tomato consumption . high intake of tomatoes was associated with a statistically significant 40% decreased risk of prostate cancer ( rr 0.60 , 95% ci : 0.370.97 ) . in another study , a 50% lower risk of prostate cancer was reported for high compared with low tomato consumption in us men between 1987 and 1990 : rr 0.50 ( 95% ci : 0.300.90 , ptrend = 0.03 ) , but few details were provided . dietary cohort studies that did not report associations with prostate cancer incidence frequently had lower lycopene and tomato intake compared with studies that report an association . a dietary cohort study based in the netherlands between 1986 to 1992 did not report an association between tomato intake and prostate cancer incidence . while this cohort took place between the same time period as the initial hpfs analysis , tomato consumption was low compared with the hpfs . in addition , consumption of tomato - based products , which contain more bioavailable lycopene , was not specifically addressed . a diet - based cohort study of individuals in the prostate , lung , colorectal , and ovarian screening trial examined intakes of lycopene and top food sources of lycopene but did not find inverse associations for lycopene , raw tomatoes , canned tomatoes , or other processed tomato products ( ketchup , tomato sauce , pizza , lasagna , tomato and vegetable juice , chili ) with total or nonadvanced prostate cases . predominately white men ( 90.7% ) enrolled in this study between 1993 and 2001 received baseline psa screening or digital rectal examination and completed annual questionnaires . men with a psa level > 4 ng / ml or digital rectal examination concerning for prostate cancer were referred to their medical provider for further diagnostic evaluation and staging of prostate cancer . the majority ( 92% ) of prostate cancers nonadvanced disease ( gleason score < 7 or stage i or ii ) comprised 61% of total prostate cancer cases and was not associated with total lycopene intake or lycopene from processed foods . greater consumption of spaghetti / tomato sauce and pizza was associated with decreased incidence of advanced disease but did not reach statistical significance ( rr 0.81 , 95% ci : 0.571.16 and rr 0.79 , 95% ci : 0.561.10 , respectively ) . the association of tomato products with advanced but not nonadvanced prostate cancer suggests a possible stronger role for lycopene in advanced disease . limitations of this study include the assessment of lycopene intake from a single baseline measurement . in addition , intake for all but raw tomatoes was low in this population , with no more than two servings per week ( mean total lycopene intake 11,511 and standard deviation 8,498 g / d ) . further , a large portion of prostate cancer cases were diagnosed by initial psa screening , and total prostate cancers reflected a heterogeneous mix of mostly nonadvanced prostate cancer cases . dietary lycopene was not reported to have an association with prostate cancer risk in a prospective study from the prostate cancer prevention trial . the pcpt originated as a randomized trial of finasteride but was converted to a prospective observational study . men with an abnormal digital rectal examination or psa level 4 ng / ml or greater were encouraged to receive a prostate biopsy . at the final study year this resulted in the inclusion of incidental cases of prostate cancer that contributed to the substantial 24.8% of prostate cancer cases diagnosed in men originally randomized to the control group . the majority of cancers were localized and detected by screening or incidentally discovered , and it is possible that low - grade cancers have different characteristics from high - grade cancers . in addition , it may be necessary to assess lycopene through simple updated or cumulative average updated intakes rather than a single baseline measurement . a number of studies have examined serum or plasma lycopene from biobanks in relation to subsequent prostate cancer risk . the studies were typically nested case control in design ; incident cases and matched cancer - free controls over the follow - up period were identified , and serum or plasma lycopene was measured in the banked biospecimens . in a meta - analysis of prospective studies up to 2003 , high serum lycopene levels were associated with significant decreased risk of prostate cancer : rr = 0.78 ( 95% ci : 0.611.00 ) . subsequent studies on serum lycopene levels conducted in the post - psa era [ 2328 ] have not reported significant inverse associations with total prostate cancer risk . one of the earliest studies to report an inverse association between serum lycopene and prostate cancer risk was a nested case control study of 103 prostate cancer cases matched with 103 controls among 25,802 male residents of washington county , md who donated blood in 1974 . a nonsignificant 50% reduction in prostate cancer risk was reported ( or 0.50 ; 95% ci : 0.201.29 ) . two of the largest nested case control studies reported inverse associations between plasma lycopene and prostate cancer risk [ 30 , 31 ] . plasma lycopene levels were higher in these multicentered us cohorts compared with other studies , which may reflect the higher education level in these populations . a nested case control study within the physicians ' health study , a randomized , placebo - controlled trial of aspirin and -carotene , assessed incident prostate cancer cases in 578 men compared with 1294 age- and smoking - status - matched controls . men with higher plasma lycopene had a borderline significant decreased risk of prostate cancer ( highest quintile rr = 0.75 ; 95% ci : 0.541.06 ; ptrend = 0.05 ) . there was a significantly greater decreased risk for aggressive ( high stage or high grade ) prostate cancer : highest quintile plasma lycopene , rr = 0.56 ( 95% ci : 0.340.91 ; ptrend = 0.05 ) . these associations were not confounded by covariates including age , smoking status , body mass index , physical activity , alcohol intake , multivitamin use , or plasma total cholesterol level . in a nested case control study within the prospective hpfs cohort , 450 incident cases of prostate cancer diagnosed between 1993 and 1998 were matched with 450 controls by age , time , month , season , and year of blood donation . a nonsignificant inverse association was reported for plasma lycopene and risk of prostate cancer : rr for highest versus lowest quintile , 0.66 ( 95% ci : 0.381.13 ) . this association was statistically significant for men older than 65 years at time of plasma donation : rr for highest versus lowest quintile , 0.47 ( 95% ci : 0.230.98 ) , but was not observed for younger men . serum lycopene was recently assessed in a nested case control study within the prostate cancer prevention trial ( pcpt ) . there was no association between serum lycopene and prostate cancer incidence , but incidentally diagnosed prostate cancer cases by end - of - study biopsies were analyzed alongside prostate cases diagnosed by screening . in a reanalysis that included only cancers diagnosed from abnormal screening the cancers assessed by end - of - study biopsy were relatively static ( e.g. , no psa elevation or sign of clinical progression ) during the study period , so may not be appropriately considered as several other serum lycopene studies reported nonsignificant inverse associations [ 2325 , 27 ] or no association [ 26 , 32 ] with prostate cancer risk . however , these studies were conducted in the post - psa era that likely encompassed a heterogeneous group of prostate cancers that included latent and incident cancers . as with the pcpt , an association with lycopene could be missed . in the large european study ( epic ) by key et al . , a statistically significant inverse association was observed for cases diagnosed at an advanced stage . in this study , men in the highest versus lowest quintile of lycopene level had a rr of 0.40 ( 95% ci : 0.190.88 ) . several studies retrospectively examined the association between tomatoes , tomato - based products or lycopene , and prostate cancer risk , with mixed results . in a meta - analysis of case control studies through 2003 , high intakes of raw tomatoes , cooked tomatoes , and lycopene were not associated with decreased prostate cancer risk . a strong inverse dose - response relationship between lycopene intake and histopathologically confirmed lycopene intake was assessed using a reproducible and validated 130-item food frequency questionnaire for elderly men in china . for lycopene intakes of 16093081 , 30814917 , and > 4917 g / d , the rrs of prostate cancer compared with lycopene intake < 1609 g / d were 0.47 ( 95% ci : 0.250.86 ) , 0.40 ( 95% ci : 0.210.77 ) , and 0.17 ( 95% ci : 0.080.39 ) , respectively . the rrs reported for lycopene and prostate cancer in this study were stronger than some prior studies . this study also examined green tea and vegetable and fruit intake and reported strong , significant inverse associations for all these associations . the incidence of prostate cancer is lower in developing countries such as china , compared with western countries . in china psa screening while further information and stratification based on prostate cancer grade and staging were not provided in this study , the lower prevalence of psa screening practices in china compared with the usa suggests prostate cancer cases in this cohort were more likely to be at advanced stages . the strong association between lycopene and probable advanced prostate cancer suggests a role for lycopene in influencing risk of aggressive cancer . a significant inverse association between tomato intake and prostate cancer was similarly reported in a case control study of 617 canadian men with prostate cancer and 636 age - matched controls conducted between 1989 and 1993 . the rr of prostate cancer was 0.64 ( 95% ci : 0.450.91 ) for tomato intake > 73 g / day compared with < 24 g / day . there was no significant association reported for lycopene intake and prostate cancer . in a case control study of 130 prostate cancer cases in iranian men , tomato consumption of greater than 100 g / week was nonsignificantly inversely associated with decreased prostate cancer risk ( rr 0.45 ; 95% ci : 0.092.12 ) . food intake was assessed based on the past two months of intake , and tomato intake questions included tomato extract and dressing . however , it is unclear whether this tomato group included both raw and processed tomatoes . an additional study reported a nonsignificant inverse association between dietary lycopene and prostate cancer risk while several reported no association [ 3840 ] . three case control studies of plasma lycopene reported strong inverse associations with histopathologically confirmed prostate cancer [ 4143 ] . one study of non - hispanic caucasian men used high - pressure liquid chromatography ( hplc ) to examine plasma lycopene isoforms . cis - lycopenes 2 through 5 individually and in sum as total cis - lycopene and trans - lycopene were not associated with prostate cancer risk . this study suggests the structural type of lycopene measured may influence the ability to detect an association , as one cis isomer but not total cis- or trans - lycopene was associated with decreased prostate cancer risk . however , a study in the hpfs found that the isomers were highly correlated with each other , making any specific effects difficult to distinguish . the multicentered case control third national health and nutrition examination survey ( nhanes iii ) of u.s . caucasian and african american men aged 4079 years reported a significant inverse association between serum lycopene and aggressive prostate cancer ( highest compared with lowest quartile rr = 0.37 ; 95% ci : 0.150.94 ; ptrend = 0.04 ) and nonsignificant association between serum lycopene and prostate cancer ( highest compared with lowest quartile rr = 0.65 ; 95% ci : 0.361.15 ; ptrend = 0.09 ) . caution should be used in interpreting results from case control plasma or serum studies because the cancers could possibly be influencing lycopene level , resulting in reverse causation .", "this paper focused on prostate cancer incidence that may or may not have been detected by initial psa screening and highlights differences in the association with lycopene based on prostate cancers initially screened with psa testing compared with cancers diagnosed in more advanced stages . elevated psa may be attributed to a number of benign factors , including the highly prevalent benign prostatic hypertrophy in older men , and should not be used in isolation along with single serum measurements for the diagnosis of prostate cancer . randomized interventions of lycopene and prostate cancer risk have been limited in scope , and some used psa as an endpoint [ 10 , 11 ] . thus , trials do not provide strong support either for or against a causal association . the epidemiologic literature on lycopene intake or level and prostate cancer based on observational studies has been inconsistent overall . one potential explanation is that there was a relative over - reporting and publishing of positive studies in the earlier years , followed by a correction of this publication bias as the hypothesis grew in interest and null studies were published . if so , then it may be concluded that there is unlikely to be a causal connection between lycopene intake and risk of prostate cancer . an alternative possibility is that the earlier studies were conducted largely before the onset of psa screening , where diagnosis of prostate cancer usually implied a period of increasing aggressive behavior leading to the diagnosis . thus , the exposure was linked to the development of aggressive behavior in cancers with biologic potential to progress . in the psa era , 19921998 with peak in 1992 following fda approval as a screening test for prostate cancer , the diagnosis of prostate cancer is not typically linked to aggressive behavior [ 4 , 7 ] . an example of this phenomenon may be the subgroup of cancers in the pcpt that were diagnosed at end of study biopsy . there was a high prevalence of undiagnosed prostate cancer , even among the youngest group of men in the study ( 5559 years ) , which suggests that most of the cancers eventually diagnosed during the study period were present at baseline . throughout the 7-year followup , the cancers diagnosed at end - of - study biopsy showed no evidence of clinical or biochemical progression . prior studies have shown that most cancers , even many with high - grade gleason scores , do not progress over prolonged time , and it is well established that only a fraction of prostate cancers result in the most advanced and clinically significant stage and mortality . thus , the majority of these cancers was likely present at the onset of the study and may be considered static cancers . in fact , when reanalyzed as a case - only study , higher serum lycopene levels in the pcpt appeared to be inversely associated preferentially with cancers that showed evidence of progression relative to cancers that showed no indication of progression . in modeling two patterns of prostate cancer progression , one with low lycopene exposure and rapid tumor growth that reaches a threshold psa level for clinical diagnosis and the second with high lycopene exposure and slow progression , the latter may be diagnosed at a much later time through an incidental random biopsy rather than psa . thus , asymptomatic cancers diagnosed at the end - of - study by biopsy may signify cancers that were inhibited rather than incident cancer . thus , a possible interpretation is that high levels of lycopene may have inhibited some existing cancers to undergo progression . some evidence supports the premise that psa screening and type of tumor endpoint are critical . for example , the hpfs was analyzed before and after peak psa testing in the early 1990s . before psa testing ( 19861992 ) tomato sauce intake was inversely associated with prostate cancer incidence and stronger for advanced stage cancers . while the association for total prostate cancer incidence was attenuated during the psa era ( 19921998 ) , the association with metastatic prostate cancer persisted . in addition , in the large epic study serum lycopene level was inversely associated with risk of advanced stage prostate cancer but not nonadvanced prostate cancer . as discussed above , studies based on intake are limited by the assessment of intake , food composition databases , and differences in bioavailability . future studies may be improved by better taking into account bioavailability differences among diverse foods . prospective studies are preferable to avoid various biases , such as recall bias , or reverse causation in studies of circulating lycopene . with increasing use of psa , it is becoming increasingly difficult to examine advanced stage prostate cancer , at least in some populations . examining potential mediators or markers of aggressive behavior in tumor tissue may be another useful approach in the further study of lycopene and prostate cancer risk ." ]

[ "common causes of bronchopleural fistula ( bpf ) are lung resection , thoracic surgery , thoracic trauma , pulmonary koch 's , rupture of lung abscess and rupture of emphysematous bullae , as was seen in this case . bpf is an important cause of morbidity and mortality and its management depends on various factors like size of fistula , respiratory reserve of the patient , associated diseases and general condition of the patient . bpfs , which are small in size or are due to minor parenchymal leaks , usually close spontaneously whereas large bpf , those arising from the major bronchi or causing respiratory compromise usually require intervention in the form of bronchoscopic closure , video - assisted thoracic surgery ( vats ) , muscle flap closure , decortication , lobectomy , pneumonectomy and thoracoplasty . many times , a combination of techniques and/or multiple interventions are required . various flaps used for the closure of bpf and reported in the literature are intercostal muscle flap , pericardial flap , latissimusdorsi muscle flap , serratus anterior muscle flap , rectus abdominis muscle flap and omentum . the intercostal muscle flap , as was used in this case , is easy to harvest , causes no functional disability , has adequate vascularity , has adequate length to reach most of the sites and is harvested through the same incision used for thoracotomy . bronchoscopic techniques used for the closure of bpf include application of glue , gelfoam and/or stents ; these techniques are usually successful when the size of the fistula is small . large bpf and those associated with entrapped lung or empyema thoracis are managed with surgery .", "a 50-year - old male patient , a known case of copd , presented with the features of bpf on the right side for 1 month . the patient was a chronic smoker and did not give any history suggestive of pulmonary koch 's or any other associated disease apart from copd . the patient had sudden - onset breathlessness and chest pain 1 month before , which was diagnosed as spontaneous pneumothorax , and an intercostal drain was inserted but even after 1 month of all conservative measures , the lung remained collapsed [ figure 1a ] and there was a large air leak in the intercostal drain ; negative suction on the intercostal drain was also not effective . ct chest revealed collapsed and entrapped lung [ figure 1b and c ] , with surgical emphysema of the subcutaneous tissues due to rupture of the emphysematous bullae on the right side along with presence of emphysematous bullae on the left upper lobe . surgical repair was planned as with all the conservative measures , the lung remained collapsed and the air leak persisted . the patient was emaciated and weak and was pre - operatively optimized with a high - protein diet , multivitamins , bronchodilators , incentive spirometry and antibiotics for another week before surgery . general anesthesia was given using double - lumen endotracheal tube and supplemented with thoracic epidural analgesia and invasive arterial pressure and central venous pressure monitoring were also performed . the right posterolateral approach was chosen , intercostal muscle flap was harvested and part of the fifth rib was resected . the lung was found completely entrapped in a fibrous peel [ figure 2a ] and decortication of the thickened visceral peel was performed from the entire right lung [ figure 2b ] and inferior pulmonary ligament was also ligated and divided . the site of the bpf was localized in the segmental bronchus to apical segment of the right upper lobe and closure of the fistula with polypropylene 40 sutures was performed and reinforced with intercostal pedicled muscle flap [ figure 2c ] . there were multiple small unruptured bullae present near the site of the bpf , and they were also closed with polypropylene 40 sutures . the repair site was tested for air leak after pouring saline in the thoracic cavity and after ensuring no major air leak , two intercostal drains were inserted and standard thoracotomy closure was carried out . the patient was extubated in the operating room and deep breathing exercises were started from the first post - operative day to keep the lungs expanded . chest roentgenogram on the second post - operative day [ figure 3a ] revealed partial re - expansion of the lung along with presence of residual space in the upper zone . with continued chest physiotherapy and respiratory exercises , there was complete re - expansion of the lung with obliteration of the remaining space in the upper zone [ figure 3b ] . histopathological examination of the resected visceral peel revealed non - specific inflammation without any evidence of granuloma formation or dysplasia and cultures were sterile . ( a ) pre - operative chest roentgenogram showing collapsed right lung with intercostal tube in situ . ( b ) pre - operative computed tomography of the chest in the axial section showing collapsed and entrapped right lung . ( c ) pre - operative ct chest in the sagittal section showing collapsed and entrapped right lung ( a ) intraoperative photograph showing collapsed and entrapped right lung . ( c ) intra - operative photograph showing use of intercostal muscle flap for closure of bronchopleural fistula ( a ) post - operative chest roentgenogram showing lung expansion on the second post - operative day . ( b ) post - operative chest roentgenogram showing expanded right lung on the 10th post - operative day after removal of the intercostal drain", "bpf is commonly associated with empyema or empyema develops subsequently if management of bpf is delayed . in this case , pleural fluid and sputum culture were sterile and total and differential leukocyte counts were within the normal range , probably because the patient was on antibiotics . this case is reported to highlight the advantages of intercostal muscle flap for repair of bpf and typical presentation of entrapped lung and its management . vats is now - a - days commonly used for the management of early - stage empyema before the development of thickened peel . closure of bpf through vats may be performed using pleural or pericardial flaps and/or application of glue . open surgery is usually required for late stages of empyema and for muscle flap closure of bpf . lobectomy or even pneumonectomy may be required in cases of bpf with complete destruction of the underlying lobe or lung , respectively , with or without the use of muscle flaps . acute bpf due to dehiscence of bronchial stump after lung resection like pneumonectomy or lobectomy is a serious condition and requires urgent drainage of the pleural space along with intervention for closure of bronchial opening . the intervention can be either through bronchoscopic techniques using gel foam or glue or in unsuccessful cases through surgical approach by revision of the bronchial stump along with the use of muscle flaps . thoracoplasty can be used in some cases where there is recurrence of bpf after muscle flap repair , but the procedure leads to reduction of pulmonary function and chest wall deformity . sometimes the bpf is associated with empyema or infected pleural space ; even in those cases , use of intercostal muscle flaps is associated with favorable outcome because of the good vascularity and autologus nature of the flap thereby increasing the chances of healing . free flaps have also been described in cases like redo surgery where pedicled flaps have already been used or are of insufficient length .", "use of intercostal muscle flap is an easy and effective technique for the repair of bpf ." ]

[ "all bacterial isolates related to the outbreaks ( 1 per patient ) were obtained from clinical samples . the strains were identified phenotypically by rapid i d 32 strep ( biomrieux , marcy letoile , france ) , which yielded profile 22025001100 ( leuconostoc spp . ( biolog , hayward , ca , usa ) ( 98% , t = 0.708 ) . the results were confirmed by 16s rdna sequence analysis , by a previously reported method ( 9 ) , and the analysis of 1,4201,500 bp showed 99% probability that the species were lm , when compared with genbank database sequences . antimicrobial drug susceptibility was determined by microdilution , with dademicroscan system ( baxter health care , west sacramento , ca , usa ) , and mics were confirmed by e - test ( ab biodisk , solna , sweden ) . for interpretation of antimicrobial drug susceptibility , clinical and laboratory standards insitute criteria ( 10 ) for leuconostoc spp . or when appropriate streptococcus spp . the antimicrobial drug susceptibility profiles were almost identical for all genotypes and showed susceptibility to penicillin and gentamicin ( mics of 0.25 mg / l and < 2 mg / l , respectively ) and to levofloxacin , tetracycline , quinupristin - dalfopristin , linezolid , daptomycin , erythromycin , clindamycin , and chloramphenicol . a pulsed - field gel electrophoresis ( pfge ) technique was used to assess the possibility of a clonal relationship among the 48 lm strains . genomic dna was extracted , restricted with apai , and electrophoresed with chef - driii apparatus ( bio - rad laboratories , richmond , ca , usa ) . no differences in the band profile were observed among the 42 strains of the first outbreak ( genotype 1 ) . analysis of the 6 strains isolated in the 2006 outbreak showed different dna band patterns from those corresponding to genotype 1 ( figure 2 ) . of the 6 isolates , 4 shared the same genotype , designated genotype 2 , whereas the remaining 2 isolates showed 2 new genotypes ( genotypes 3 and 4 ) . one lm strain , isolated from the parenteral nutrition catheter of a patient involved in the 2006 outbreak ( genotype 2 ) , was identical to those isolated from blood of the same patient ( figure 2 ) and from 3 other patients involved in the 2006 outbreak ( data not shown ) . mw , molecular weight marker at indicated sizes ; lines 1 to 9 , representative lm isolates from the first outbreak ( genotype 1 ) ; lines 10 , 11 , lm isolates obtained from parenteral nutrition catheter and blood from the same patient ( genotype 2 ) and identical to those from 3 different patients infected in the second outbreak ( data not shown ) ; lines 12 , 13 , lm isolates from 2 different patients involved in the second outbreak ( genotypes 3 and 4 ) most of the 42 patients infected with lm genotype 1 in the first outbreak displayed severe underlying diseases ( table 1 ) ; 9 of the patients died , and 3 of the deaths ( 7.1% ) were directly related to the leuconostoc infection . the bacterial isolates were isolated from blood ( 52.1% ) , catheter ( 21.8% ) , or both ( 26.1% ) . to assess risk factors related to acquisition of lm strains , we performed a case control study . control - patients ( n = 61 ) were randomly selected among remaining patients with another nosocomial infection caused by a non leuconostoc spp . microorganism isolated from a catheter , blood , or both , who were admitted to the same department and at the same time as the patients defined as case - patients . sd , standard deviation ; or , odds ratio ; ci , confidence interval ; ns , variable did not meet criterion for remaining in the multivariate model . predictor variables with p<0.10 in univariate analysis were included in the multivariate model to enable simultaneous adjustment . any process that modifies the gastrointestinal barrier ( inflammation , atresia , resection , obstruction ) . nosocomial infection criteria were those previously established by the centers for disease control and prevention ( atlanta , ga , usa ) ( 12 ) . a multiple logistic regression model was developed to identify potential independent factors associated with acquisition of lm strains . predictor variables with p<0.10 in univariate analysis were included in the multivariate model to enable adjustment . statistical analyses were conducted with spss 14.0 software ( spss inc . , chicago , il , usa ) . according to the multivariate analysis , previous infections ( 38.2% were bacteremias ) ( odds ratio [ or ] = 4.2 ) and parenteral nutrition ( or = 27.8 ) all case - patients received parenteral nutrition , with the exception of 2 , although they received enteral nutrition . parenteral nutrition is a putative source of the infection because all parenteral and enteral nutrition bags are prepared in the central hospital pharmacy and then distributed to the different medical units in the hospital . this possibility was further supported by 1 finding : pfge analysis of isolates obtained from a parenteral nutrition catheter connected to a patient during the second outbreak yielded the same genotype as the isolates obtained from blood from the same patient ( figure 2 ) and from another 3 physically separated , infected patients . the physical distance between these patients as well as the impossibility of retrograde displacement of the bacterial isolate from patient s blood makes it unlikely that the lm strain was acquired by contamination from the blood and indicates parenteral nutrition as the main source of lm transmission in the hospital outbreak . microbiologic controls of parenteral nutrition were reinforced during the second outbreak , and as stated , only 6 cases were detected . moreover , during the second outbreak , microbiologic analysis of environmental samples as well as samples from the digestive tract , skin , and throat of all patients involved did not yield any leuconostoc strains . parenteral nutrition controls performed in the hospital pharmacy department are now routinely assayed for lm isolation . since the last lm outbreak in november 2006 ,", "that 42 lm isolates from the first outbreak shared the same genotype and 4 of 6 isolates in the second outbreak also shared the same ( another ) genotype rules out the possibility of endogenous infections among patients and suggests a common source for each outbreak . the occurrence of cases in patients in areas that were physically separated rules out the possibility of indirect patient - to - patient spread through the hands of healthcare workers or contaminated hospital equipment ( different departments do not share healthcare workers and equipment ) . enteral and parenteral nutrition has previously been described ( 13,14 ) as a risk factor associated with leuconostoc - infections , although no microbiologic evidence was provided in any of the studies . with regard to previous infections in the multiple logistic regression model , this may be related to the alteration of the immune system caused by the microorganism that caused the previous infections . two previous reports have described hospital transmission of leuconostoc spp ( 7,15 ) ; both outbreaks affected a small number of patients , and no epidemiologic studies were conducted to clarify the genetic relationship among the bacterial strains involved or the source of the nosocomial infection . although up to 88 cases of leuconostoc infection have been reported in the scientific literature in the past 25 years , these cases may not be comparable to those reported here , the largest nosocomial outbreak caused by leuconostoc spp . worldwide . this outbreak highlights the importance of lm as an emerging hospital pathogen in patients with underlying diseases and in whom parenteral nutrition may be the source of the initial infection and its spread . every infection with lm could be a yet undetected outbreak and should result in an investigation that focuses on parenteral nutrition or products manufactured in a centralized hospital pharmacy ." ]

[ "the immunosuppressive receptor pd-1 and its ligand pd - l1 have been identified by dr . tasuku honjo and his colleagues at the kyoto university as factors that \n induce programmed cell death . since the mechanism mediated by pd-1 and its ligand was shown to be important for immune \n suppression and tolerance , it has also been reported to be involved in pathogenetic mechanisms of various diseases . \n pd-1 and pd - l1 are single - pass transmembrane molecules expressed on the cell surface , which belong to the b7 family . their expression is induced by \n immune - activating stimuli and is understood as a negative feedback mechanism to suppress excessive immune reactions and let immune responses cease . when the \n receptor pd-1 is bound by its ligand , src homology 2-domain - containing tyrosine phosphatase 2 ( shp-2 ) and shp-1 are recruited to immunoreceptor tyrosine - based \n inhibitory motif and immunoreceptor tyrosine - based switch motif in the intracellular region of pd-1 and suppress antigen receptor signaling mediators . this process results in reduced production of cytokines , such as interferon ( ifn)- and interleukin ( il)-2 , reduced cell \n proliferation and suppressed immune cell activation . in addition to the close involvement in homeostasis of the living body as summarized above , recent studies \n have shown that immunosuppressive factors , pd-1 and pd - l1 , are also involved in immunosuppression in cases of tumors and chronic infections . while generally not \n highly expressed in normal tissues , pd - l1 is expressed at a high rate in tumor tissues in melanoma , lung cancer , colorectal cancer and ovarian cancer , and has \n been demonstrated to be involved in immune evasion by tumors . in patients with renal cell cancer and gastric cancer , \n pd - l1 has been shown to be an important prognostic determinant ; also , the disease progression is faster , and the mortality is higher in patients with tumors \n expressing pd - l1 than in patients without detectable pd - l1 expression [ 51 , 53 ] . in \n addition , pd - l1 expression has also been reported for other tumors including breast cancer , pancreatic cancer and bladder cancer , and pd-1 expression in \n tumor - infiltrating lymphocytes has been confirmed in many types of tumors including melanoma , lung cancer and intrahepatic bile duct cancer . these findings have \n revealed the importance of the pd-1/pd - l1 pathway as an immunosuppression mechanism in a variety of tumors . based on the series of studies on pd-1/pd - l1 in tumor \n diseases , therapeutic means targeting this pathway are being developed . specifically , these new therapeutics are biopharmaceuticals based on anti - pd-1 antibodies , \n anti - pd - l1 antibodies or recombinant proteins that inhibit the pd-1/pd - l1 pathway . these biopharmaceuticals have been reported to show good anti - tumor effects \n regardless of the tumor type and are attracting growing attention as a new , promising class of anti - tumor therapy . fully humanized anti - pd-1 and anti - pd - l1 \n antibodies have already been produced and are actively tested as therapeutic agents in clinical studies ( trials ) , with good anti - tumor effects continuing to be \n reported in patients with melanoma , lung cancer , renal cell cancer and some other types of cancer . in melanoma , which has a very poor prognosis , clinical trials \n conducted in japan and the united states have reported not only the suppressed growth of cancer cells , but also complete remission in some cases . on september , \n 2014 , the anti - pd-1 antibody was finally released by ono pharmaceutical as a new anti - tumor therapeutic agent , and it has become a pioneer \n for innovative immune checkpoint inhibitors ( ono pharmaceutical : https://www.opdivo.jp/contents/action/ ) . this immune checkpoint - targeted immunotherapy was \n selected as breakthrough of the year 2013 by the journal science as a global revolutionary technology . currently , merck , roche and other major pharmaceutical \n companies around the world are accelerating their efforts to develop similar antibody - based drugs ; this class of therapeutics is gaining so much momentum and \n attention that the conventional concept of anti - tumor therapy is being overturned .", "the causative factors of bovine leukemia can be divided \n into viral and non - viral . non - viral bovine leukemia is sporadic and can be subdivided into calf type , thymic type and cutaneous type involving unknown causes . on \n the other hand , enzootic bovine leukemia , which is caused by blv , accounts for the vast majority of cases of bovine leukemia , and its prevalence continues to \n increase . blv infections are latent in the aleukemic ( al ) state , but can emerge as persistent lymphocystosis ( pl ) with non - malignant polyclonal expansion of \n cd5 b - cells that predominantly harbor blv provirus and rarely as malignant b - cell lymphoma in various lymph nodes after long periods of latency \n . the progression of enzootic bovine leukemia is accompanied by marked suppression of cell - mediated immunity [ 8 , 9 , 16 ] , and as the pathogenetic mechanism \n remains unknown , there are no effective vaccines or therapeutic methods available , meaning that affected animals eventually die . bovine leukemia was designated as \n a communicable disease obligated to notify under the act on domestic animal infectious diseases control when it was revised in 1997 . in 2015 , 2,896 cases of \n bovine leukemia were reported ( of which the largest number of 494 cases occurred in hokkaido ) , representing the disease reported in a greater number than any \n other bovine disease required to monitor by the act ( http://www.maff.go.jp/j/syouan/douei/kansi_densen/kansi_densen.html ) . this number is 29.3-fold the number of \n cases reported in 1998 ( 96 affected animals ) , indicating that the increase has not yet been halted . requests for urgent measures against this disease have been \n voiced very frequently by people practicing veterinary medicine and animal husbandry . however , a large - scale survey conducted by the national institute of animal \n health using specimens collected from 2009 to 2011 showed an approximate blv - positive rate of 35% , demonstrating the difficulty of implementing any project to \n select and replace infected cattle .", "comparative analyses of blv - infected cattle by clinical condition have suggested that animals with a high viral load and persistent lymphocytosis are at a high \n risk of disease onset , often serving as infection sources , have a high risk of vertical transmission and have increased levels of cd4cd25foxp3 treg cells , showing increased susceptibility \n to opportunistic infections due to transforming growth factor - beta produced by treg cells , which reduces the production of interferon - gamma and tumor necrosis \n factor - alpha by cd4 t cells and impairs cellular immunity mediated mainly by the cytotoxic activity of nk cells [ 28 , 48 ] . moreover , the proliferative ability of lymphocytes in response to blv was also significantly reduced in \n cattle with persistent lymphocytosis , and lymphocytes were found to produce reduced levels of anti - viral cytokines , such as ifn- , il-2 and il-12 [ 13 , 18 ] . therefore , we analyzed the expression of pd-1 and its ligand , pd - l1 . results \n showed that the pd-1 expression in cd4 and cd8 cells and the pd - l1 expression in virus - infected b cells increase as the disease \n progresses . furthermore , pd - l1 expression negatively correlated with the ifn- expression level , an indicator of immunosuppression , while positively correlating \n with leukocyte count , virus titer and provirus level . antibodies to bovine pd-1 and pd - l1 were established , and the results from pd-1 and pd - l1 binding inhibition \n assays confirmed that they activated anti - viral immunity and that the increase in ifn- production positively correlated with the pd-1 expression rate on \n cd4 t cells . and also , recombinant bovine pd - l2 ( pd - l2-ig ) significantly enhanced ifn- production from virus antigens - stimulated pbmcs derived from \n blv - infected cattle . interestingly , the pd - l2-ig - induced ifn- production was further enhanced by treatment with anti - bovine pd-1 antibody . these results indicated that the pd-1/pd - l pathway constitutes a part of the immunosuppressive mechanism in bovine leukemia ( table 2table 2.change of immune inhibitory molecules in the cause of bovine leukemia virus infectionreceptor / liganduninfectedinfected(disease status)referencesalpllymphomapd-1/pd - l1///// lag-3/mhcclass ii////n.d [ 17 , 41]tim-3/gal-9///// ctla-4/cd80 , cd86/n.d/n.d/n.d/n.dn.d n.d : not demonstrated . ) we also analyzed immunosuppressive receptors other than the pd-1/pd - l1 pathway , \n such as lymphocyte - activation gene 3 ( lag-3 ) [ 17 , 41 ] , t - cell immunoglobulin and \n mucin domain - containing protein 3 ( tim-3 ) , and cytotoxic t - lymphocyte antigen 4 ( ctla-4 ; cd152 ) expressed in antigen - specific lymphocytes and found that expression levels of lag-3 , tim-3 , ctla-4 and their ligands on lymphocytes \n increased as the disease progressed and anti - viral immunity was activated in binding inhibition assays , as was the case for pd-1 ( table 2 ) . currently , clinical studies of these drugs are being carried out at the hokkaido university and other institutions .", "although there are many diseases in cattle involving immune abnormalities ( impairments ) , the mechanisms underlying these diseases remain unknown . our previous \n analyses have shown that immunosuppressive factors , such as pd - l1 , are also involved in immune suppression seen in diseases other than bovine leukemia , namely \n johne s disease and bovine anaplasmosis . furthermore , recent evidence \n suggests that immunosuppressive factors , such as pd-1 , are involved in the reduced immune function in chronic infectious diseases , such as mastitis , bovine \n mycoplasmosis and bovine tuberculosis ( manuscript in preparation ) . our laboratory has been working on the development of a blv vaccine for many years . it is based \n on a vaccine antigen that was found to be promising in in vitro studies . however , although we tried various procedures , the vaccine did not \n prevent infection or even disease onset despite the fact that effector cells were present in vivo ( data not shown ) . results from the present \n analysis suggested that the virus s immune evasion mechanism for lymphocyte exhaustion might be related to the ineffectiveness of the vaccine . future measures \n against chronic infectious diseases will require the development of a new , pre - emptive control method that targets this formidable immune evasion mechanism . to \n achieve this goal , results from more detailed analyses of immune exhaustion in other chronic infections are awaited . for use in humans , several immune \n checkpoint - targeting biopharmaceuticals have been successively developed , including those described above , and they are being actively tested in clinical trials . \n in the future , it is anticipated that they will be applied to veterinary medicine and animal husbandry , including diseases in cattle ." ]

[ "placenta accreta is a pathology characterized by abnormal and firm attachment of the placenta to the myometrium.1 the depth of penetration of the placental villi into the myometrium defines three severity levels of placenta accreta ; accreta , increta , and percreta . accreta , the least severe and most common of the three , occurs when the placental villi attach directly to the myometrium rather than to the decidua basalis . percreta , the most rare and severe manifestation of accreta , is the invasion of the placental villi through the entire thickness of the myometrium , and even further.2 placenta accreta tends to reoccur ; however , little is known regarding the pathophysiological processes leading to this invasive placentation . the most severe complication of placenta accreta is spontaneous rupture of the uterus , which poses diagnostic challenges and management dilemmas , and can be a life - threatening event to the mother and fetus . herein , we describe a woman diagnosed with repeated placenta accreta that was complicated by spontaneous rupture of the uterus . this case demonstrates increasing placental invasiveness and , to the best of our knowledge , is a first report of this kind . furthermore , repeated invasive placentation occurred at the same site , and not at the cesarean section ( cs ) scar , which raises a fundamental question regarding the mechanism of trophoblast implantation and location of recurrence of placenta accreta . understanding the processes that influence the timing and location of this life - threatening complication may set the basis for better diagnosis and management protocols .", "a 32-year - old woman in her fourth pregnancy , with parity of 2 , presented at 19 weeks gestation to the gynecologic emergency department with lower abdominal pain for the past 2 days . her obstetric history included retained placenta in both first and second deliveries , which necessitated manual revision of the uterine cavity and curettage . she had a perforation of the left posterior uterine wall during curettage in her second delivery that was laparoscopically repaired . in her third pregnancy , she presented with an acute abdomen at 19 weeks gestation and underwent exploratory laparoscopy that demonstrated a 2.5 cm rupture in the posterior uterine wall at the site of the previous perforation . laparoscopy was turned into laparotomy ; the rupture was sutured and the patient recovered well . magnetic resonance imaging ( mri ) performed at 21 weeks gestation demonstrated placental tissue penetrating , but not perforating , the myometrium of the posterior uterine wall , which was indicative of placenta increta ( figure 1 ) . after counseling , the couple chose to terminate the pregnancy , and hysterotomy was performed at 22 weeks gestation . in the current pregnancy , upon admission to the emergency department , the patient presented normal vital signs , and the gynecologic examination revealed 19 weeks gestation this suspicion raised by sonography , together with the patient s history , prompted an mri at 24.2 weeks that demonstrated the presence of placenta percreta at the site of the previous placenta increta ( figure 2a ) . following counseling , the couple decided to continue the pregnancy , and the patient was hospitalized for observation . rapid bedside ultrasound examination demonstrated intraabdominal bleeding , and emergency cs was performed . during laparotomy , massive intraabdominal bleeding was observed , originating from a uterine rupture with a perforating placental tissue ( figure 2b ) . following the delivery of the fetus and complete placental removal , as well as suturing of the uterine wall , the bleeding stopped and hysterectomy was avoided . the mother recovered well , while her neonate died of prematurity complications . due to the ominous nature of the patient s obstetric history ,", "placenta accreta , at any level of severity , is a rare obstetric complication with an estimated incidence of between 1 in 533 ( as reported by wu et al3 ) and 1 in 2,500 pregnancies ( as reported by miller et al1 ) . however , once placenta accrete is diagnosed , it has a tendency to reoccur in subsequent pregnancies.4,5 little is known about recurrence of placenta accreta , and specifically its location , histopathological invasiveness , and prognosis . the only known risk factor for repeated placenta accreta is parity.6 here we report , for the first time , a case of four consecutive pregnancies complicated by abnormal placentation . in primary placenta accreta , the strongest independent risk factor has been found to be previous cs.1,7 this is explained by the tendency of implantation and placentation to occur in the scarred area.1 in the case presented here , recurrence occurred in the left uterine cornu , the site of the previous placenta increta , rather than the cs scar . additionally , the clinical manifestation was aggravated with each consecutive pregnancy : retained placenta necessitating manual lysis and curettage in the first and second , placenta increta in the third , and spontaneous uterine rupture due to placenta percreta in the fourth . therefore , this case presents not only placenta accreta recurrence but also increased invasiveness of the placentation . even though placentation is prone to develop within previous cs scars , other prior uterine injuries may play a similar role , and hence are considered to be a risk factor for placenta accreta.7 it is not known whether injury location affects the risk for placenta accreta . the correlation between scarred uteri and placenta accreta is explained by a relative hypoxic environment in the scar tissue8 or the histologically abnormal structure of the scar . this abnormal structure is characterized by defective re - epithelialization and relative abundance of extracellular matrix.9 alternatively , prior uterine injury is associated with dynamic changes in decidual leukocyte distribution,10 which subsequently affects the homing of the blastocyst to its implantation site . once placenta accreta is diagnosed , proper counseling and discussion with the patient should be undertaken regarding further management of the pregnancy in light of the complications involved.11 the most severe complication is spontaneous rupture of the uterus , as seen in this case , which poses both a diagnostic challenge and an immediate risk to the life of both mother and fetus . the incidence of spontaneous uterine rupture is reported to be approximately one in 5,000 ; however , this includes etiologies other than placenta accreta.12 uterine rupture due to placenta accreta is extremely rare , and a systematic review of reported cases is yet to be done . in the past , most cases were managed by hysterectomy , but conservative treatment is becoming common recently.13,14 during the operation , active bleeding stopped promptly and the patient remained hemodynamically stable . completing the procedure outweighed the risk of blood loss involved in hysterectomy , and uterine repair was technically feasible . the location where spontaneous uterine rupture occurs has not been thoroughly studied ; however , some reports associate first trimester ruptures with the fundus and third trimester ruptures with the lower uterine segment.15 in case of previous cs , the rupture usually occurs at the site of the old scar.12 in our patient , the rupture appeared in the left uterine cornu , where the placenta was invading through the myometrium , rather than in the cs scar . this could be explained by the fact that the uterine wall was already disrupted by the placenta percreta prior to the rupture , as was seen in the mri . as with rupture location , factors affecting the timing of uterine rupture due to placenta accreta while it is well established that spontaneous uterine rupture usually occurs in the third trimester,15 there have been reports of first8 and second1619 trimester ruptures as well . in our case , spontaneous rupture occurred at 24 weeks gestation ; a critical time for the fetus . this gestational age marks the limit of viability , since preterm delivery around this time results in 50% long - term survival probability of the newborn.20 in the face of immediate risk for the mother , urgent cs was inevitable , even when considering the probable prematurity complications for the fetus . with the increase in conservative management of placenta percreta although systematic reviews of these complications are not yet available , this insight should be taken into account during counseling following conservative management of placenta accreta .", "notes : transabdominal two - dimensional ultrasound in the transverse plane showing an abnormal placenta with thinning of the myometrium in the left posterior uterine wall , indicated by an asterisk . similar findings are seen in the longitudinal plane in addition to fundal placental lacunas ( arrow head ) with increased blood flow by color doppler scanning ." ]

[ "the online version of this article ( doi:10.1007/s40121 - 014 - 0040-z ) contains supplementary material , which is available to authorized users .", "the annual frequency of drug shortages increased 200% from 2006 to 2010 . furthermore , in 2012 the food and drug administration ( fda ) reported a record number of 251 drugs on shortage . the increasing problem of drug shortages has the potential to adversely affect patient care , delay medical procedures , result in medication errors , and burden the health care system with additional costs [ 35 ] . when these medications are unavailable , it may lead to significant patient harm when clinicians must resort to second- or third - line agents that may have inferior or less evidence for use . this is especially true for shortages of often non - interchangeable , curative therapies such as antimicrobials and oncologic agents , which comprise the majority of shortages . a 2013 survey of infectious disease physicians found that 78% ( n = 489 ) of respondents had to modify their choices of antimicrobial therapy because of a drug shortage in the previous 2 years . poor patient outcomes due to a shortage were reported by 55% ( n = 345 ) of responding physicians who reported having to use alternative agents which were less effective , more toxic , or more costly . the growing magnitude of drug shortages and the risk of patient harm they pose have gained much attention from the government , media , and researchers as strategies are developed to mitigate their effects . while progress has been made on quantifying the magnitude and causes of drug shortages , a lack of data exists on the causality of shortages on patient outcomes as well as the development of a system for reporting and monitoring patient harm on a real - time basis . there remains a need for appropriate tracking of the relationship between drug shortages and patient outcomes in the long term [ 1 , 4 ] . specifically , the need remains for a system where clinicians can report specific instances of patient harm they believe to be due to a drug shortage . traditionally , adverse event reporting is managed through the adverse events reporting system ( aers ) of the fda ; however , aers is known to under - represent actual events due to infrequent clinician reporting . furthermore , drug shortages that lead to patient harm may not be recognized as adverse events . we have suggested that a novel method for maximizing the reporting of adverse events due to drug shortages would be simple , anonymous , use standardized terminology for easy tabulation , and have a mechanism for attributing causality of the adverse event to a drug shortage [ 1 , 4 ] . we focused on shortages of antimicrobial drugs as they are often non - interchangeable , curative , and represent a large portion of overall shortages , thus making them particularly sensitive to shortages that result in patient harm . we hypothesized that a novel method for reporting patient harm due to antimicrobial shortages would aid in anonymous and convenient reporting of these cases of patient harm .", "clinicians were asked anonymously to report occurrences of patient harm related to antimicrobial drug shortages through an online survey ( surveymonkey ; surveymonkey , palo alto , ca , usa ) consisting of 11 questions ( table 1 ) . the survey was distributed through an editorial in pharmacotherapy , a letter in the american journal of health - system pharmacy , and through the american college of clinical pharmacy ( accp ) infectious diseases practice and research network ( i d prn ) email listserv . reports from the survey were tabulated from august 2012 through october 2013 , and three reminder emails were sent to the accp i d prn during this timeframe . this study was approved as exempt by the midwestern university institutional review board.table 1survey questions1please list the full name of your institution ( for de - duplicating purposes)2how many inpatient beds does your institution currently have?3which of the following best describes the location of your institution ? if yes , please list the patient s age5sex : male or female6which antimicrobial was unavailable for your patient?7please list the infection for which treatment or prophylaxis was needed8what adverse event did your patient experience?9please attribute the causality of the shortage to the adverse event that occurred in your patient unrelated : the adverse event is clearly not related to the shortage unlikely : the adverse event is doubtfully related to the shortage possible : the adverse event may be related to the shortage probable : the adverse event is likely related to the shortage10please attribute a severity to the adverse event that occurred in your patient death disabling hospitalization life threatening required intervention other ( please specify)11what was the final patient outcome ? please check all that apply death treatment failure / development of resistance readmission due to treatment failure increased length of hospitalization patient transferred to an institution with a supply of antimicrobial delay of therapy suboptimal treatment other ( please specify ) respondents were surveyed regarding : institution ( for de - duplication purposes ) , patient age ( if < 90 years old ) , sex , antimicrobial on shortage , type of infection requiring treatment or prophylaxis , adverse event , and patient outcome . criteria for causality attribution were obtained from the common terminology criteria for adverse events ( ctcae ) of the national cancer institute . using these criteria , the reporter assessed the relationship between the adverse event and the antimicrobial shortage as unrelated ( clearly not related ) , unlikely ( doubtfully related ) , possible ( may be related ) , or probable ( likely related ) . the severity of the adverse event was also assessed using standardized aers criteria , modified for the setting of infectious diseases . using these criteria , the reporter classified the severity of the adverse event according to the following terminology : death , treatment failure or development of antibiotic resistance , readmission due to treatment failure , increased length of hospital stay , patient transfer to an institution with a supply of antimicrobial , delay of active therapy , canceled care , or other .", "overall , there were seven de - duplicated reports of adverse events related to antimicrobial shortages . the incomplete reports did not provide the level of causality due to a shortage but did report an instance of patient harm . all institutions were in urban settings with 500740 beds ( n = 3 ) or 100249 beds ( n = 1 ) . the infections for which these patients were being treated or receiving prophylaxis included stenotrophomonas maltophilia bacteremia , pneumocystis jirovecii pneumonia , neonatal sepsis of unknown etiology , and cytomegalovirus colitis . final patient outcomes included death , delay of therapy , readmission , and limited access to treatment . two adverse events ( a delay in treatment and an inability to treat with other antimicrobials due to resistance ) were attributed to have probable causality due to a shortage , while the remaining adverse events ( death and an inability to tolerate high oral doses ) were attributed to have unlikely and possible causalities due to a shortage , respectively . the antimicrobials on shortage in the incomplete reports included three cases of a shortage of sulfamethoxazole trimethoprim . the infections for which these patients were being treated or receiving prophylaxis were p. jirovecii pneumonia and stenotrophomonas spp.table 2patient vignettes of complete reports detailing adverse drug events due to antimicrobial shortagespatientage ( sex)antimicrobial on shortageinfection being treatedade experiencedcausality due to shortageseverity of adefinal patient outcome1<90 ( f)sulfamethoxazole trimethoprim iv \n stenotrophomonas maltophilia bacteremiadeathunlikelydeathdeath245 ( f)sulfamethoxazole - trimethoprim ivpcp pneumonianausea / vomiting / diarrhea when given high oral dosepossiblerequired interventiondelay of therapy3<90 ( f)gentamicinempiric neonatal sepsis1 h delay of treatmentprobablerequired interventionreadmission425 ( m)foscarnetcmv colitisuntreatable due to resistanceprobableother : disease still presentother : obtained foscarnet outside the united states \n ade adverse drug event , cmv cytomegalovirus , f female , iv intravenous , m male , pcp \n pneumocystis jirovecii pneumonia patient vignettes of complete reports detailing adverse drug events due to antimicrobial shortages \n ade adverse drug event , cmv cytomegalovirus , f female , iv intravenous , m male , pcp \n pneumocystis jirovecii pneumonia", "the methodology demonstrated in this study illustrates a successful system capable of capturing real - time instances of patient harm and attributing the causality of that harm to antimicrobial shortages . by maintaining a database where the specialists most likely to manage shortages can continuously report instances of patient harm anonymously and conveniently , we believe our methodology offers an ability to capture harmful effects of antimicrobial drug shortages on patient outcomes . clinicians wishing to report on future harms due to antimicrobial shortages can do so at : http://www.surveymonkey.com/s/antimicrobialshortages . the instances of patient harm reported in this study further underline the harmful effects of drug shortages reported elsewhere in the literature . these effects include utilization of less effective or more toxic alternative medications , medical errors , delays in procedures , and higher healthcare costs [ 35 ] . for example , two of the drugs on shortage reported in our survey are first - line agents for their respective indications ( i.e. , sulfamethoxazole trimethoprim for p. jirovecii pneumonia prophylaxis , and foscarnet for cytomegalovirus colitis ) . it is worth noting that two of the three antimicrobials reported to be on shortage in our survey required clinicians to follow special instructions to obtain a supply . trimethoprim was available through drop shipments from the manufacturer only after the need for therapy was documented to the manufacturer . as there may be significant time lags associated with obtaining such products , special measures are required to ensure ready access to the product at the time of need . of further note , the number of full - time equivalents allocated to shortage management has increased in many healthcare institutions ; this has not seemed to curb the inability of some institutions to procure drugs on shortage . one potential solution may be increased education about procuring drugs on shortage and how best to mitigate their harmful effects , which antimicrobial stewardship programs could potentially provide . this survey methodology , a quick and anonymous online survey , offers an advantageous alternative over conventional surveys which may only provide a snapshot of the incidence of patient harm and not specific patient characteristics . the benefits of the fda aers system include that it is a publically available system for reporting adverse events and it provides a form that prompts reporters for pertinent information . however , due to issues such as prescriber disinclination to report for fear of identification and litigation , lack of time to submit reports , and lack of knowledge of the reporting structure , most adverse drug events are never reported . it has been estimated that under - reporting exists over 90% of the time . specifically in regards to the aers system , an original study found that only 57% of prescribers were aware of aers , likely leading to reporting rates ranging from 1% to 5% . we have written about the need for standardization of assessing the impact of antimicrobial shortages on patient outcomes and suggested that the traditional method of reporting adverse events is likely under - reporting the true impact due to the time required for submissions , the complexity of the system , and the personally identifying nature of the report [ 1 , 4 ] . a 2009 review of the determinants of under - reporting of adverse events found under - reporting to be influenced in part by a lack of suitable means to report the event in 75% ( n = 45 ) of all studies , and that the available system was considered to be too bureaucratic or not easy enough in 25% ( n = 45 ) of all studies . the methodology presented here may also be useful in assessing patient harm due to shortages in other drug classes . reports may have been limited as respondents may have not wished to disclose medication errors or adverse events which occurred at their institutions . accuracy of self - reporting is an inherent liability to which all surveys , including the fda aers database , are subject . the results from our survey were driven by large institutions in urban settings ; however , results from elsewhere in the literature clearly demonstrate that institutions of all sizes and settings are affected by shortages [ 6 , 11 ] . despite these limitations , the results of this survey provide valuable information regarding patient harm due to antimicrobial drug shortages .", "our study demonstrated a novel method for encouraging providers to report patient harm due to antimicrobial shortages . this method is standardized , anonymous , convenient , and capable of de - duplicating responses . this pilot study has revealed unique instances of patient harm with assessed causality attributed to antimicrobial shortages . such studies may help gage the true impact of shortages and may help guide policies aimed at allocating appropriate resources to control and prevent patient harm caused by future shortages .", "", "milena m. mclaughlin , erik skoglund , zachary pentoney , and marc h. scheetz have no conflicts of interest to disclose pertaining to the subject matter of this manuscript .", "", "this article is distributed under the terms of the creative commons attribution noncommercial license which permits any noncommercial use , distribution , and reproduction in any medium , provided the original author(s ) and the source are credited ." ]

[ "atrial fibrillation ( af ) is the most common sustained arrhythmia encountered in clinical settings . it is associated with higher risk of mortality , accounting for approximately 12% of all deaths in the general population . the prevalence of af increases substantially with age , affecting around 10% of people over 80 years old . about 0.77% of the chinese population have af . however , the exact pathogenesis of af is still unclear . af is usually considered to be affected by multiple cardiovascular risk factors , including advancing age , male sex , hypertension , diabetes , ischemia , valvular heart disease , left ventricular ( lv ) dysfunction , heart failure , and obesity . furthermore , studies have reported that genetic factors play important roles in the pathogenesis of af , such as kcna5 , kcnq1 , kcne2 , and nup155 . caveolin-1 gene ( cav1 ) encodes a caveolae protein , usually expressed in atrial myocytes . recent genome - wide association studies ( gwas ) have reported that a single - nucleotide polymorphism ( snp ) , rs3807989 , in cav1gene was associated with the susceptibility to af , and the association of this snp with af risk has been replicated in several populations . olesen et al . demonstrated that variants of rs3807989 in cav1gene are associated with af independent of traditional cardiac risk factors in caucasians . however , the findings from the study of li et al . conflict with the results above ; they showed that the snp rs3807989 in cav1 gene may not be a risk factor for af in the chinese han population . in view of this disagreement , it was necessary to perform a meta - analysis to determine the association of cav1 rs3807989 polymorphism with the risk of af in the present study .", "we searched for studies about the association of cav1 rs3807989 polymorphism with the risk of af in the electronic databases pubmed , medlin , and web of science before august 20 , 2015 . rs3807989 or polymorphism or 7q31 and atrial fibrillation ( af ) . only studies conducted in humans were included . concurrently , we manually reviewed the references of reviews to search for additional relevant articles . if the same population was replicated in over 1 publication , only the most recent study with complete data was included in this meta - analysis . the inclusion criteria were : 1 ) cohort or case - control studies ; 2 ) studies about the association between the cav1 rs3807989 ( g / a ) polymorphism and risk of af ; 3 ) studies that provide detailed genetic frequency data ( aa , ga , and gg ) in af cases and controls for extraction ; 4 ) studies published in english ; and 5 ) distribution of genotype in controls was in accord with hardy - weinberg equilibrium ( hwe ) . the exclusion criteria were : 1 ) duplicated studies ; 2 ) studies not conforming to hwe ; and 3 ) incomplete raw data . in case of disagreement on the quality scores between the 2 reviewers , differences were resolved through discussion and consultation with a third reviewer . the following information was extracted from each selected study : name of the first author , year of publication , ethnicity , sample size , age , sex , incidence of hypertension and coronary artery disease , af type , and genotypic distribution of in cases and controls . the quality of each selected study was assessed by 2 reviewers using the newcastle - ottawa scale ( nos ) quality system . genotypic distribution of the controls from selected studies was assessed using hwe with fisher s exact test . all statistical analyses were conducted using stata statistical software 12 . in the current meta - analysis , 5 genetic models allelic model ( g versus a ) , recessive model ( aa versus ga + gg ) , dominant model ( ga + aa versus gg ) , homozygous ( gg versus aa ) , and heterozygous genetic models ( gg versus ga ) were used to confirm the relationship of cav1 rs3807989 polymorphism with the risk of af using the combined odds ratios ( ors ) with corresponding 95% confidence intervals ( cis ) . the q - test and the i statistic ( range , 0100% ) if p<0.1 or i > 50% , the study would be judged to have significant heterogeneity and the random - effects model was used to estimate the pooled or ( dersimonian and laird methods ) ; otherwise , the fixed - effects model was used ( the mantel - haenszel method ) . publication bias was estimated using begg s funnel plot . funnel plot asymmetry was determined by egger s linear regression test .", "we searched for studies about the association of cav1 rs3807989 polymorphism with the risk of af in the electronic databases pubmed , medlin , and web of science before august 20 , 2015 . rs3807989 or polymorphism or 7q31 and atrial fibrillation ( af ) . only studies conducted in humans were included . concurrently , we manually reviewed the references of reviews to search for additional relevant articles . if the same population was replicated in over 1 publication , only the most recent study with complete data was included in this meta - analysis .", "the inclusion criteria were : 1 ) cohort or case - control studies ; 2 ) studies about the association between the cav1 rs3807989 ( g / a ) polymorphism and risk of af ; 3 ) studies that provide detailed genetic frequency data ( aa , ga , and gg ) in af cases and controls for extraction ; 4 ) studies published in english ; and 5 ) distribution of genotype in controls was in accord with hardy - weinberg equilibrium ( hwe ) . the exclusion criteria were : 1 ) duplicated studies ; 2 ) studies not conforming to hwe ; and 3 ) incomplete raw data .", "in case of disagreement on the quality scores between the 2 reviewers , differences were resolved through discussion and consultation with a third reviewer . the following information was extracted from each selected study : name of the first author , year of publication , ethnicity , sample size , age , sex , incidence of hypertension and coronary artery disease , af type , and genotypic distribution of in cases and controls . the quality of each selected study was assessed by 2 reviewers using the newcastle - ottawa scale ( nos ) quality system . genotypic distribution of the controls from selected studies was assessed using hwe with fisher s exact test .", "all statistical analyses were conducted using stata statistical software 12 . in the current meta - analysis , 5 genetic models allelic model ( g versus a ) , recessive model ( aa versus ga + gg ) , dominant model ( ga + aa versus gg ) , homozygous ( gg versus aa ) , and heterozygous genetic models ( gg versus ga ) were used to confirm the relationship of cav1 rs3807989 polymorphism with the risk of af using the combined odds ratios ( ors ) with corresponding 95% confidence intervals ( cis ) . the q - test and the i statistic ( range , 0100% ) if p<0.1 or i > 50% , the study would be judged to have significant heterogeneity and the random - effects model was used to estimate the pooled or ( dersimonian and laird methods ) ; otherwise , the fixed - effects model was used ( the mantel - haenszel method ) . publication bias was estimated using begg s funnel plot . funnel plot asymmetry was determined by egger s linear regression test . a p value less than 0.05 was considered statistically significant .", "a total of 4 articles [ 5,1719 ] involving the association of cav1 rs3807989 polymorphism with af risk were selected in this meta - analysis , including 3758 af cases and 6126 controls . a detailed flow diagram of the search process for this meta - analysis is displayed in figure 1 . table 1 shows the main characteristics of the selected studies and the characteristics of included patients are listed in table 2 . as shown in figure 2 , all 5 comparisons revealed the association between cav1 rs3807989 polymorphism and af risk after meta - analysis with fixed- or random - effects models : allelic model ( g / a ; or=1.228 , 95%ci : 1.0611.420 ; p=0.006 ) , homozygote model ( gg / aa ; or=1.439 , 95%ci : 1.0941.894 ; p=0.009 ) , heterozygote model ( gg / ga ; or=1.257 , 95%ci : 1.0641.486 ; p=0.007 ) , dominant model ( gg / aa+ga ; or=1.287 , 95%ci : 1.0761.540 ; p=0.006 ) , and recessive model ( aa / ga+gg ; or=0.738 , 95%ci : 0.6290.867 ; p<0.001 ) . the overall analyses based on all included studies suggested allelic g carriers might have a higher risk for af . sensitivity analysis was performed to assess the influence of each selected study on the total results . sensitivity analysis revealed that there was no single study influencing the stability of the crude results , due to no changes in the corresponding pooled ors ( figure 3 ) . begg s funnel plot showed an approximately symmetrical shape ( figure 4 ) and no publication bias was observed in egger s test ( p= 0.666 ) .", "a total of 4 articles [ 5,1719 ] involving the association of cav1 rs3807989 polymorphism with af risk were selected in this meta - analysis , including 3758 af cases and 6126 controls . a detailed flow diagram of the search process for this meta - analysis is displayed in figure 1 . table 1 shows the main characteristics of the selected studies and the characteristics of included patients are listed in table 2 .", "as shown in figure 2 , all 5 comparisons revealed the association between cav1 rs3807989 polymorphism and af risk after meta - analysis with fixed- or random - effects models : allelic model ( g / a ; or=1.228 , 95%ci : 1.0611.420 ; p=0.006 ) , homozygote model ( gg / aa ; or=1.439 , 95%ci : 1.0941.894 ; p=0.009 ) , heterozygote model ( gg / ga ; or=1.257 , 95%ci : 1.0641.486 ; p=0.007 ) , dominant model ( gg / aa+ga ; or=1.287 , 95%ci : 1.0761.540 ; p=0.006 ) , and recessive model ( aa / ga+gg ; or=0.738 , 95%ci : 0.6290.867 ; p<0.001 ) . the overall analyses based on all included studies suggested allelic g carriers might have a higher risk for af .", "sensitivity analysis was performed to assess the influence of each selected study on the total results . sensitivity analysis revealed that there was no single study influencing the stability of the crude results , due to no changes in the corresponding pooled ors ( figure 3 ) .", "begg s funnel plot showed an approximately symmetrical shape ( figure 4 ) and no publication bias was observed in egger s test ( p= 0.666 ) .", "we found a significant association of cav1 gene rs3807989 polymorphism with af risk under 5 comparisons : allelic , homozygous , heterozygous , dominant , and recessive genetic models . these findings suggested that individuals with g allele of cav1 gene rs3807989 polymorphism may experience a higher risk of af . as the most common clinical sustained arrhythmia with complex pathogenesis , af reportedly has a hereditary susceptibility . in the past few years , numerous case - control and cohort studies have strongly demonstrated the important roles of multiple genetic variants on genetic predisposition to af . gwass have identified several susceptibility loci on chromosomes 3p22 , 5q35 , 7q31 , 12p12 , and 12q24 that are potentially associated with af . three gwass identified snp rs3807989 in cav1 to be related with af risk in populations of european ancestry . however , several subsequent replication studies yielded inconsistent results ; some studies indicated a significant association of rs3807989 with af , but the others revealed no association . the snp rs3807989 is located on the chromosome of 7q31 in the second intron of cav1 gene encoding caveolin-1 . caveolin-1 ( cav1 ) is a key isoform of caveolae , which are 50- to 100-nm plasma membrane vesicles that play roles in cell signaling and are rich in cholesterol . moreover , the roles of cav1 in the regulation of plasma lipoprotein metabolism has also been shown . in addition , af risk is reportedly associated with mutations and genomic variants in genes that encode ion channels . it was reported that caveolin-1 interacts with potassium channel subunit kir2.1 , generating potassium current ik1 , which affects af development . furthermore , caveolin-1 was shown to affect transforming growth factor beta 1 ( tgf - b1 ) signaling , which has roles in atrial fibrosis . therefore , it is possible that snp rs3807989 may enhance risk of af by regulating the function of these cardiac potassium channels and altering tgf - b1 signaling . in this meta - analysis , we pooled all eligible studies to analyze the association between cav1 gene rs3807989 polymorphism and af risk , with a sample size of 3758 af cases and 6126 controls . firstly , in view of the influence of multiple factors on af , the results would be more precise if individual data were adjusted with some other variables associated with af risk , including coronary heart disease , hypertension , and family history . secondly , in this meta - analysis we only included the studies published in english , which might have biased the results . finally , only investigating the cav1 gene rs3807989 polymorphism without considering other genes or polymorphisms might have provided insufficient statistical power ; therefore , further investigation of the interaction of this polymorphism with other risk factors for af is required .", "our results revealed a significant association between cav1 gene rs3807989 polymorphism and susceptibility to af , suggesting that the presence of allelic g might be one of the genetic factors conferring susceptibility to af . to confirm this association ," ]

[ "oro - facial - digital syndromes ( ofds ) are a rare heterogeneous group of development disorders in which at least nine different forms have been described . ofd ii mohr 's syndrome is transmitted as an autosomal recessive condition characterized by malformations of the oral cavity , face and digits . facial and oral features include tongue nodules , cleft or high - arched palate , missing teeth , broad nose and cleft lip . digital features include clinodactyly , polydactyly , syndactyly , brachydactyly and duplication of the hallux . other systemic features include conductive deafness , choroidal coloboma , renal and congenital heart defects in variable combination . the incidence of mohr 's syndrome is very rare and occurs in one in 3 lakh live births . we report a case of young indian female suffering from ofd type ii ( mohr 's syndrome ) with otolaryngological manifestations .", "a 15-year - old indian female from western maharashtra born out of consanguineous marriage at full term presented with difficulty in speech and decreased hearing in both ears since birth . her mother had a first pregnancy with premature delivery at 7 months and child died immediately after birth . she has two siblings who are normal . during infancy , she had difficulty in feeding due to the high arched palate and tongue nodules . there was no history of radiation exposure or any significant drug intake or any trauma or any major illness during pregnancy period of her mother . vital signs revealed pulse 90/min , regular in nature , blood pressure : 120/80 mmhg right arm supine position . clinical examination revealed mild pallor , bilateral polysyndactyly with duplicated thumbs on both hands and bilateral polysyndactyly of halluces [ figures 1 and 2 ] , missing central incisors , broad nose , high arched palate , ocular hypertelorism and unusual presentation low set ears [ figure 3 ] and tongue nodules [ figure 4 ] . clinical image shows bilateral polysyndactyly of hand , bilateral duplicated thumbs clinical image shows bilateral polysyndactyly of halluces clinical image shows missing central incisors and broad nose and high arched palate and low set ears clinical image shows tongue nodule cardiac , respiratory , abdominal , neurological examinations were unremarkable and intelligence was normal . ophthalmic examination revealed normal fundus . on investigations , hemoglobin - 10.4 g% , total leukocyte count - 7900 cells / mm , dlc- p-79% , l-13% , e-08% , platelets - 275,000/cumm . an x - ray of both hands with forearms anteroposterior ( ap ) view [ figure 5 ] revealed six metacarpals in right hand showing fusion proximally of third and fourth metacarpals . an x - ray of both feet ap view [ figure 6 ] revealed seven metatarsals on the right side and six metatarsals on the left side . x - ray of hand shows polysyndactyly and bilateral duplication of thumbs x - ray of foot shows polysyndactyly and bilateral duplication of hallux", "ofds are a heterogeneous group of rare malformative diseases , characterized by abnormalities of the oral cavity , maxillo - facial region and digits . such phenotypical pattern was first described by mohr in 1941 and later defined as oro - digital - facial dysostoses by papillon - lage and psaume in 1954 and finally named ofds in 1967 by rimoin and engerton . the brachydactyly characters observed in the patient , which is one of the major symptoms of mohr syndrome is explained by norwegian geneticist mohr . there are atleast nine different forms of ofds on the basis of inheritance transmission pattern and phenotypical spectrum , of which the first two types are of common occurrence as compared with other varieties . ofds ii is a rare autosomal recessive disease whose diagnosis is based only on clinical evidence . frequency is rare , one in 3 lakhs live births . the molecular genetic basis is still unknown . because of the variable clinical expression , even intrafamilial , the attribution of the correct diagnosis among the several forms of ofds is often difficult . in addition , the molecular genesis is still unknown for all ofds except for the ofd i which is related to the cxorf 5 gene ( xp22.222.3 ) coding for ofd 1 protein . ofd ii ( mohr syndrome ) is similar to ofd i in that affected individuals usually have hand abnormalities , lobulated tongues and cleft abnormalities . however , a broad nose with a bifid tip is seen in ofd ii instead of the alar hypoplasia which characterizes ofd i. the bilateral hallux , polysyndactyly when present is strongly suggestive of ofd ii . ofd ii is characterized by distinct tongue nodules , rather than the bifid tongue more commonly seen in ofd i. the histopathology of tongue nodules of ofd ii would be either hamartoma or lipoma . although both ofd i and ofd ii may present with porencephaly , corpus callosum agenesis is not seen in ofd ii . conductive hearing loss , typically not seen in ofd i , has been reported in ofd ii . ofd i is the only type in which renal cysts occur which grossly resemble adult polycystic kidney disease , although sometimes types vi and vii may also manifest with renal abnormalities . laryngeal hypoplasia and tracheal stenosis have also been described in a small subset of individuals with ofd ii . however , cowden syndrome is characterized by multiorgan hamartomas , whereas in ofd the hamartomas are limited to the tongue alone . unique and uncommon features noted in this case : \n bilateral duplication of thumbslow set ears . \n bilateral duplication of thumbs with the clinical knowledge and typical radiological appearance , we diagnosed this case as mohr 's syndrome type ii ofds .", "ofd type ii mohr 's syndrome is rarer than ofd i and gets easily confused with , therefore distinctive features and clinico - radiological knowledge between these two is essential and be considered prior to its implications in genetic counseling of such patients . the authors certify that they have obtained all appropriate patient consent forms . in the form the patient(s ) has / have given his / her / their consent for his / her / their images and other clinical information to be reported in the journal . the patients understand that their names and initials will not be published and due efforts will be made to conceal their identity , but anonymity can not be guaranteed there are no conflicts of interest .", "the authors certify that they have obtained all appropriate patient consent forms . in the form the patient(s ) has / have given his / her / their consent for his / her / their images and other clinical information to be reported in the journal . the patients understand that their names and initials will not be published and due efforts will be made to conceal their identity , but anonymity can not be guaranteed", "", "" ]

[ "during the last decades , evidence has emerged to support the relationship between periodontal infection and systemic conditions including cardiovascular diseases , diabetes , obesity and metabolic syndrome . unlike the most common form of chronic periodontitis ( cp ) , aggressive periodontitis ( agp ) develops early in life , progresses faster , and presents more destructive clinical features . it has been indicated that systemic factors play a greater role in the etiology of agp , which in turn exert greater effects on systemic conditions . as expected , higher serum levels of inflammatory mediators , such as interleukin ( il)-17 , tumor necrosis factor- ( tnf- ) and c - reactive protein ( crp ) , have been detected in patients with cp compared to controls , which became even higher in agp patients , even if whose clinical parameters were less severe . the increased systemic inflammation burden has been suggested to be a possible link between periodontal disease and systemic health . for example , pro - inflammatory cytokines were shown to play important roles in the development of dyslipidemia and impaired glucose tolerance , which have been considered as risk factors for many systemic diseases . leptin , since discovered in 1994 , has provided important insights into the intricate network linking nutrition , metabolism , and immune homeostasis . this 16-kda adipose tissue - derived molecule plays important roles in regulating lipid and glucose metabolism , and elevated plasma leptin concentrations have been suggested as an independent risk factor for cardiovascular diseases . in recent years , clinical studies indicated an association between leptin and periodontal infection . serum leptin concentration was reported to be significantly elevated in cp patients compared with periodontal healthy subjects , and was positively correlated with periodontal parameters including probing depth and clinical attachment loss , and could be effectively reduced by periodontal treatment . these results suggested that the systemic leptin level could be greatly influenced by the periodontal conditions , and is a potential mediator between periodontitis and systemic health . we and others have shown elevated systemic inflammatory markers including peripheral leukocytes counts , crp and il-6 in patients with agp . however , evidence is still lacking about whether there is an association between the circulating leptin concentration and the systemic inflammation in patients with agp . the aim of the present study was to evaluate the change of leptin concentration in peripheral blood in patients with agp , and to explore the relationship between leptin and systemic inflammation markers .", "the present study was conducted with the written informed consent of all subjects and was approved by the ethics committee of the peking university health science center . ninety patients with generalized agp ( 33 males and 57 females ) , aged 1442 years , were recruited from the clinic of the periodontology department , peking university school and hospital of stomatology between july 2001 and may 2006 . the diagnosis criteria were defined according to the classification developed at the international workshop for a classification of periodontal diseases and conditions in 1999 : the onset of periodontal disease generally occurred at < 35 years of age , and there were at least eight teeth with probing depth ( pd ) > 6 mm and with radiographic evidence of alveolar bone loss . other factors were also considered : familial aggregation , rapid progression , and the relationship between local factors and periodontal destruction . forty - four healthy volunteers ( 16 males and 28 females ) , aged 2048 years , were recruited from the staff and students of the peking university school and hospital of stomatology . the inclusion criteria were no site with clinical attachment loss , no site with pd > 3 mm , no bone loss on radiographs , and less than 10% of sites with bleeding on probing . the exclusion criterions included systemic diseases , smoking , periodontal therapy within the previous year , antibiotics intake within the previous 3 months , and pregnancy . by their own acknowledgment , all study subjects were free of systemic diseases and were not taking any medication known to affect periodontal status . all recruited subjects accepted a comprehensive blood examination and were referred to physicians when necessary . all subjects belonged to the han race , which makes up the majority of the chinese population . each study subject filled out a questionnaire that noted general background ( including weight and height ) , medical and dental care history , oral hygiene habits , and social status . the body mass index ( bmi ) was calculated as weight in kilograms divided by height in meters squared . according to our previous results , systemic inflammatory markers including white blood cell ( wbc ) count , il-1 , il-6 , crp and tnf- may be correlated with periodontal infection . serum protein variables such as albumin ( alb)/globulin ratio ( a / g ) were also associated with the severity of periodontal destruction . a peripheral blood sample was obtained from each fasting examinee by venipuncture between 8:00 a.m. and 10:00 a.m. , and was divided into two tubes . one tube contained ethylenediaminetetraacetic acid ( edta ) and was used for blood cell analysis by hematology analyzers ( sysmex kx-21 , sysmex , kobe , japan ) ; the other did not contain edta and was used for serum protein analyses by a biochemical analyzer ( hitachi 7060 , hitachi , tokyo , japan ) . serum protein parameters included total protein , alb , globulin , and a / g . plasma samples were obtained from edta - containing tubes and were separated and immediately stored frozen at 70c until required for analysis . plasma levels of leptin , il-1 and il-6 were determined using commercially available enzyme - linked immunosorbent assay ( elisa ) kits ( r and d systems , inc . , minneapolis , mn , usa ) ; and the lower limits of detection were 7.8 pg / ml , 1 pg / ml and 0.16 pg / ml respectively . plasma level of crp was measured using a commercially available elisa kit ( diagnostic system laboratories , inc . , plasma levels of tnf- were measured using a commercially available elisa kit ( bender medsystems , inc . , vienna , austria ) and the lower limit of detection was 0.13 pg / ml . these assays were performed according to the manufacturer 's protocol . plasma leptin levels were analyzed with the analysis of covariance model , controlling for age , gender , and bmi as confounders . partial correlation coefficients between leptin and other parameters including clinical values , hematologic parameters , and pro - inflammatory cytokines were determined , controlling for the potential confounders mentioned above . the values of age , bmi , plasma leptin level , blood cell and serum protein variables were described by mean standard deviation ( sd ) . plasma levels of crp , il-6 , il-1 and tnf- were described by median and interquartile range , and were log10 transformed for the correlation and regression analyses as a result of their nonnormal distributions . chicago , il , usa ) was used for analyses , and p < 0.05 was considered as statistically significant .", "the present study was conducted with the written informed consent of all subjects and was approved by the ethics committee of the peking university health science center . ninety patients with generalized agp ( 33 males and 57 females ) , aged 1442 years , were recruited from the clinic of the periodontology department , peking university school and hospital of stomatology between july 2001 and may 2006 . the diagnosis criteria were defined according to the classification developed at the international workshop for a classification of periodontal diseases and conditions in 1999 : the onset of periodontal disease generally occurred at < 35 years of age , and there were at least eight teeth with probing depth ( pd ) > 6 mm and with radiographic evidence of alveolar bone loss . other factors were also considered : familial aggregation , rapid progression , and the relationship between local factors and periodontal destruction . forty - four healthy volunteers ( 16 males and 28 females ) , aged 2048 years , were recruited from the staff and students of the peking university school and hospital of stomatology . the inclusion criteria were no site with clinical attachment loss , no site with pd > 3 mm , no bone loss on radiographs , and less than 10% of sites with bleeding on probing . the exclusion criterions included systemic diseases , smoking , periodontal therapy within the previous year , antibiotics intake within the previous 3 months , and pregnancy . by their own acknowledgment , all study subjects were free of systemic diseases and were not taking any medication known to affect periodontal status . all recruited subjects accepted a comprehensive blood examination and were referred to physicians when necessary . all subjects belonged to the han race , which makes up the majority of the chinese population . each study subject filled out a questionnaire that noted general background ( including weight and height ) , medical and dental care history , oral hygiene habits , and social status . the body mass index ( bmi )", "according to our previous results , systemic inflammatory markers including white blood cell ( wbc ) count , il-1 , il-6 , crp and tnf- may be correlated with periodontal infection . serum protein variables such as albumin ( alb)/globulin ratio ( a / g ) were also associated with the severity of periodontal destruction . a peripheral blood sample was obtained from each fasting examinee by venipuncture between 8:00 a.m. and 10:00 a.m. , and was divided into two tubes . one tube contained ethylenediaminetetraacetic acid ( edta ) and was used for blood cell analysis by hematology analyzers ( sysmex kx-21 , sysmex , kobe , japan ) ; the other did not contain edta and was used for serum protein analyses by a biochemical analyzer ( hitachi 7060 , hitachi , tokyo , japan ) . serum protein parameters included total protein , alb , globulin , and a / g . plasma samples were obtained from edta - containing tubes and were separated and immediately stored frozen at 70c until required for analysis . plasma levels of leptin , il-1 and il-6 were determined using commercially available enzyme - linked immunosorbent assay ( elisa ) kits ( r and d systems , inc . , minneapolis , mn , usa ) ; and the lower limits of detection were 7.8 pg / ml , 1 pg / ml and 0.16 pg / ml respectively . plasma level of crp was measured using a commercially available elisa kit ( diagnostic system laboratories , inc . plasma levels of tnf- were measured using a commercially available elisa kit ( bender medsystems , inc . , vienna , austria ) and the lower limit of detection was 0.13 pg / ml . these assays were performed according to the manufacturer 's protocol .", "plasma leptin levels were analyzed with the analysis of covariance model , controlling for age , gender , and bmi as confounders . partial correlation coefficients between leptin and other parameters including clinical values , hematologic parameters , and pro - inflammatory cytokines were determined , controlling for the potential confounders mentioned above . the values of age , bmi , plasma leptin level , blood cell and serum protein variables were described by mean standard deviation ( sd ) . plasma levels of crp , il-6 , il-1 and tnf- were described by median and interquartile range , and were log10 transformed for the correlation and regression analyses as a result of their nonnormal distributions . chicago , il , usa ) was used for analyses , and p < 0.05 was considered as statistically significant .", "mean ages of control and agp groups were 25.6 3.8 years and 26.2 4.9 years , respectively . there was no difference in the mean values for age and bmi between the two groups and no significant difference for gender distribution . mean plasma leptin level of agp group was 19.7 4.4 ng / ml , significantly higher than that of the control group ( 7.5 1.3 ng / ml , p < 0.01 ) . table 1 also presented the results of blood cell analysis and serum protein assessment . compared with the control group , significantly higher wbc and neutrophil counts were observed in the agp group ; the alb and a / g were significantly lower in the agp group than in the control group ( p < 0.01 ) . population variables and blood parameters of control and agp groups * compared to the control group , p < 0.01 . bmi : body mass index ; wbc : white blood cell ; neut : neutrophil ; lym : lymphocyte ; alb : albumin ; a / g : albumin / globulin ratio ; agp : aggressive periodontitis ; sd : standard deviation . plasma levels of crp , il-1 , il-6 and tnf- were significantly higher in agp patients compared with controls ( p < 0.01 ) . plasma levels of inflammatory cytokines of control and agp groups * compared with the control group , p < 0.01 . il : interleukin ; crp : c - reactive protein ; tnf- : tumor necrosis factor- ; iqr : interquartile range ; agp : aggressive periodontitis . results of partial correlation analyses were shown in tables 35 . when all the subjects in both groups were pooled for analyses , after controlling for age , gender and bmi , plasma leptin level was significantly positively correlated with wbc and neutrophil counts as well as log - transformed levels of pro - inflammatory cytokines , and the partial correlation coefficients ranged from 0.199 to 0.376 ( p < 0.05 ) . a negative correlation was observed between plasma leptin level and a / g as well as alb , and the r values were 0.246 and 0.198 respectively ( p < 0.01 ) . multiple linear regression analysis was performed to explore the relationship between leptin and other parameters . gender , age , bmi and significant variables in the partial correlation analysis were evaluated . using stepwise method , log - transformed il-1 and il-6 entered the final model , and the standardized values were 0.422 and 0.461 , respectively ( p < 0.001 ) . the relationship between the levels of plasma leptin and blood parameters ( controlling for age , gender and bmi ) * p < 0.05 ; p < 0.01 . wbc : white blood cell ; neut : neutrophil ; lym : lymphocyte ; alb : albumin ; a / g : albumin / globulin ratio ; bmi : body mass index . the relationship between the levels of plasma leptin and inflammatory cytokines ( controlling for age , gender and bmi ) * p < 0.05 ; p < 0.01 . il : interleukin ; crp : c - reactive protein ; tnf- : tumor necrosis factor- ; bmi : body mass index . results of multiple linear regression analysis , stepwise method used ( adjusted r = 0.376 )", "although numerous research have investigated the serum leptin levels in patients with gingivitis and cp , few evidence is present about that in patients with agp , which is a distinct form of periodontitis and characterized by early onset and rapid and severe periodontal destruction , as well as its relationship with systemic inflammatory markers . as far as we knew , this study provided the first evidence about the positive association between plasma leptin levels and systemic inflammatory markers including wbc and neutrophil counts , il-1 and il-6 in patients with agp . however , previous evidence showed that resident cells in the inflammatory periodontal tissue could be an important source of inflammatory mediators , among which il-1 and il-6 were both involved . leptin , with a striking structural similarity with il-6 , shares regulatory and functional similarity with il-6 as well . another research from our group has shown that healthy resident cells in periodontal tissues , such as gingival epithelial cells , gingival connective cells and periodontal ligament cells , all expressed leptin to some extent both in vivo and in vitro . thus , the mechanism contributing to the up - regulation of plasma il-6 levels in periodontitis may propose the same effect on the change of plasma leptin levels . on the other hand , the released lipopolysaccharide , tnf and il-1 from periodontal infection may increase the adipose tissue leptin mrna expression , hereby circulating leptin levels more significantly as suggested by animal studies . in consistent , plasma leptin level positively correlated with the values of systemic inflammation markers even after controlling for age , gender , and bmi . results from multiple linear regression analysis suggested that the higher plasma leptin level in agp group may attribute to elevated plasma il-1 and il-6 levels , which have been observed in agp patients according to our present and previous studies . previous studies have observed that serum leptin levels increased as the severity of periodontal inflammation progressed , which were lowest in the controls , moderate in patients with chronic gingivitis and highest in those with cp . our previous study found that the plasma leptin level in agp reached 20 ng / ml on average , even higher than the reported 12 ng / ml in cp with comparable pd . the rise of serum leptin level above 10 ng / ml is considered as a risk factor for cardiovascular disease . preliminary evidence has shown the elevated serum leptin level in cp was associated with type 2 diabetes and acute myocardial infarction . thus , it is reasonable to suspect that the even higher serum leptin levels in patients with agp may provide a stronger interrelationship between local infection and systemic conditions . in summary , plasma leptin levels may be associated with the inflammatory cytokines from periodontal infection , especially in an aggressive form . these results suggested that leptin could be a potential connection between local infection and systemic health . one of the explanations is that other factors that may affect the circulating leptin level such as body fat percentage and lifestyles were not considered in our study . within the limitation of the present study , elevated plasma leptin concentration was associated with increased systemic levels of inflammatory markers , especially il-1 and il-6 , in agp patients after controlling for age , gender , and bmi ." ]

[ "breast cancer is the most common type of cancer in canadian women [ 1 , 2 ] . every year in ontario , radiation therapy has been established as an effective adjuvant therapy for breast cancer . with radiation therapy , patients no longer need to undergo mastectomy to remove the whole breast . instead , only a small part of the breast needs to be removed , and the rest is treated by radiation therapy . lumpectomy and whole breast radiation achieve the same survival rate as mastectomy , but offers much better cosmetic results and improved health - related quality of life [ 2 , 7 , 8 ] . brachytherapy has emerged as a newer technique that may offer similar control rates as whole breast radiation with the additional benefits such as shorter treatment days and improved convenience [ 9 , 10 ] . another benefit of brachytherapy for breast cancer treatment is that it has the potential to overcome the problems associated with external beam radiation therapy , such as burning of the skin [ 911 ] . in brachytherapy , radioactive sources are implanted directly into the breast . at the toronto - sunnybrook regional cancer center , several software packages for treatment planning were analyzed , such as pinnacle and varian as well as some manual intervention procedures [ 2 , 4 , 12 ] . these systems use ultrasound guidance and have been shown to be very successful . however , these techniques are not suitable for breast brachytherapy because the nature of operation for breast is inherently different than for other organs ; furthermore , there are no existing software solutions entirely suitable for this type of treatment [ 2 , 7 ] . consequently , we sought out to design and build a system to overcome these shortcomings for breast cancer brachytherapy . this 3d virtual simulation environment can be used for seed placement planning , dose analysis , seeds location and spacing examination , modification , visualization , and position verification . this paper presents a report on this new system called vision that was designed , developed , and refined for breast cancer brachytherapy treatment planning . vision is based on the technique of adjuvant partial breast irradiation , uses \\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$$^{103}$$\\end{document}103pd permanent seed implants , and was developed at the toronto - sunnybrook regional cancer center . the system achieves 99.73 % accuracy in volume estimation measured against the true volume and is statistically significantly more accurate than current existing commercial software at the \\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$$p=0.05$$\\end{document}p=0.05 level .", "brachytherapy is one of the more well - known methods for cancer treatment that involves placing radioactive sources directly into or next to the area requiring treatment . this enables clinicians to deliver a high dose with minimal impact on surrounding healthy tissues . brachytherapy has been shown to be a highly successful treatment for cancers of the prostate , cervix , endometrium , breast , skin , bronchus , esophagus , and head and neck , as well as soft tissue sarcomas and several other types of cancer [ 1215 ] . over the last decade , increasing numbers of breast cancer patients are being treated using interstitial radioactive implants [ 4 , 12 , 15 ] . systems have been created to assist in the planning for brachytherapy treatments that provide a visualization environments based on ct / mri images [ 1 , 7 , 11 , 13 , 16 ] . these systems provide doctors with an interactive source layout function , including accurate and quick dosage distribution calculation and dynamical 2d/3d display . these systems also provide features such as data acquisition , registration , segmentation , image processing , 3d reconstruction , and planning report output . clinical practice has shown they meet the therapeutic demands . however , in these systems , there are deficiencies in the features of the treatment planning interface , validation , and verification modules and in the accuracy of the volume calculation particularly for the breast treatment [ 4 , 12 , 13 ] . one of the more widespread systems used is gzp6a high dose rate ( hdr ) brachytherapy system . in their system , the authors claim that it is an essential component for evaluating the correctness of non - predefined treatments and is easy use for medical staff . their system is limited ; however , in that , their system provides only a partial solution for the planning breast treatments . other software systems exist but do not allow for virtual planning [ 1 , 2 , 11 , 12 ] . in summary , general solutions for brachytherapy are known ; however , there are deficiencies in each of these systems ( e.g. , tools , planning modules , verification modules , etc . ) [ 1 , 2 , 4 , 1113 , 15 ] . these existing solutions do not adequately provide the full range of tools or support for oncologists to effectively and accurately treat breast cancer patients . such a system is presented in this paper . in our system , called vision , an entire 3d treatment planning and verification solution are provided .", "in the design and development of vision , the following method was used : reading ct data set , region of interests ( rois ) , and rt plans from pinnacle;reslicing the ct data , rois , and rt to the oblique direction;reconstructing the volume with high resolution;computing volume interpolation for accurate target volume measurement;simulating the fiducial needle and providing surgical templates;facilitating radiation source editing by designing a customized editor for managing \\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$$^{103}$$\\end{document}103pd source model data;determining a template size for the seed implantation usually the template must cover the whole area of the rois;superimposing the simulated template onto each image that has rois along the gantry angle;providing an interface for placing needle / seeds based on the superimposed template;calculating the radial dose distributions on the seeds placed by computer simulation to avoid hot / cold spots to ensure a uniform dose distribution that will cover the entire planned target volume ( ptv ) by adjusting source activity and the number / position of needles / seeds;projecting the seeds back to the original image data set for 3d viewing . reading ct data set , region of interests ( rois ) , and rt plans from pinnacle ; reslicing the ct data , rois , and rt to the oblique direction ; reconstructing the volume with high resolution ; computing volume interpolation for accurate target volume measurement ; simulating the fiducial needle and providing surgical templates ; facilitating radiation source editing by designing a customized editor for managing \\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$$^{103}$$\\end{document}103pd source model data ; determining a template size for the seed implantation usually the template must cover the whole area of the rois ; superimposing the simulated template onto each image that has rois along the gantry angle ; providing an interface for placing needle / seeds based on the superimposed template ; calculating the radial dose distributions on the seeds placed by computer simulation to avoid hot / cold spots to ensure a uniform dose distribution that will cover the entire planned target volume ( ptv ) by adjusting source activity and the number / position of needles / seeds ; projecting the seeds back to the original image data set for 3d viewing . the data collection phase involves a ct scanner on which the patient lies in prone position . the ct images are taken around the chest region traveling in the direction from the head to the feet . the \\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$$z$$\\end{document}z spacing is 5 mm away from the breast and 2 mm on the breast region . oncologists manually determine the ptv , clinical target volume ( ctv ) , and iso center and a gantry angle on each slice around the cavity region where the tumor was removed . the gantry angle is parallel with the rib cage to protect needles from going through the rib and lung region during the operation . seed placement is carried out on the resliced images inside the ptv contours that are reconstructed in the oblique direction . the number of interpolations between two adjacent slices is determined by the distance between them . for example , if the distance is 5 mm , then four interpolations are computed . the reslicing task is done by projecting the data set on the direction perpendicular to the gantry angle after applying interpolation on the ct images and its rois . the new reconstructed data can be described as follows : the \\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$$x$$\\end{document}x direction is parallel with the original \\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$$z$$\\end{document}z directionthe \\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$$y$$\\end{document}y direction is same as the original \\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$$y$$\\end{document}y direction with an angle that is derived from the gantry angle.from posterior to anterior : the \\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$$z$$\\end{document}z direction parallel with the original \\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$$x$$\\end{document}x direction with an angle equal to the gantry angle.the total number of resliced slices is automatically calculated using the rois size along the gantry angle and is described by the following equation:\\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$$\\begin{aligned } \\mathrm{total\\,number}_{\\mathrm{reslices } } = \\left ( \\frac{\\mathrm{roi\\,size\\,along\\,gantry\\,angle}}{\\mathrm{\\,reslice\\,thickness } } \\right ) + 1 \\end{aligned}$$\\end{document}totalnumberreslices = roisizealonggantryanglereslicethickness+1the original data set is recalculated from the view that the gantry angle is specified by oncologist and is suitable for seed placement procedure , see figs . 1 and 2.fig 2 \n vision s reslice views : original data ( left ) , and reconstructed from the left image ( right ) the \\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$$x$$\\end{document}x direction is parallel with the original \\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$$z$$\\end{document}z direction the \\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$$y$$\\end{document}y direction is same as the original \\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$$y$$\\end{document}y direction with an angle that is derived from the gantry angle . the \\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$$z$$\\end{document}z direction parallel with the original \\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$$x$$\\end{document}x direction with an angle equal to the gantry angle . \n vision s reslice image calculations \n vision s reslice views : original data ( left ) , and reconstructed from the left image ( right ) the interpolation component is designed to reconstruct image data and treatment volumes from the original slice thickness and spacing ( can be any size ) into 1 mm in spacing . therefore , the new resolution is always equal to 1 mm . with 5 mm spacing between two adjacent slices , four interpolated images and contours are created to achieve 1 mm of unit spacing . when creating interpolation contours , two types of interpolation process are encountered , overlapped and intersected types . the intersect type is that one contour is inside the other ; the overlapped type is that one contour partially inside the other . the interpolation contour is the dividing line that is equally dividing the region between two contours when only one interpolation is required . 3morphological interpolation process morphological interpolation process when 2d contours are used to define treatment volumes , a partially subjective process is underlined . the accuracy of volume definition depends on numerous image parameters such as the contrast to noise ratio and the signal - to - noise ratio . the volume definition using 2d contours is especially difficult at the edges of the target because of the partial volume effect that is related mostly to the image slice thickness . a low inter- and intra - observer reproducibility was reported in different clinical studies , mainly because of the subjective and objective factors . consequently , a probability function was designed in vision to study the partial volume effect of the volume definition caused by the 2d contouring method . the function is presented below using 26 for the total number of voxels in the neighborhood:\\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$$\\begin{aligned } p=\\frac{\\mathrm{number}\\ , \\mathrm{of}\\ , \\mathrm{voxels}\\,\\mathrm{in}\\ , \\mathrm{the}\\ , \\mathrm{target}\\ , \\mathrm{volume}}{26 } \\end{aligned}$$\\end{document}p = numberofvoxelsinthetargetvolume26the function is able to measure how many voxels belong to ptv in the neighborhood of current voxel . when the entire neighborhood of the current voxel belongs to the target volume , the probability value ( output of the probability function ) is 1 ; otherwise , it is 0 . if part of the neighborhood voxels is inside the target volume and part is outside of the target volume , the probability value is between 0 and 1 . the treatment volume is made up of all the voxels whose neighborhood probability value is greater than the threshold . when the threshold value is larger , the estimated volume is smaller ( more neighborhood voxels are excluded from the target volume ) , see fig . the volumes generated using this probability function is more accurate than other methods when the threshold is set to 0.5.fig . 4volume refinement uses our 3d probability function ; the sharp edges are removed with a degree that matches probability setting volume refinement uses our 3d probability function ; the sharp edges are removed with a degree that matches probability setting task group 43 ( tg-43 ) from the american association of physicists in medicine ( aapm ) is currently used at the toronto - sunnybrook regional cancer center . other kinds of radiation seeds ( also called radial sources ) can be used as radiation sources . the radial sources are simulated by following aapm tg-43 guidelines for brachytherapy to calculate dose distribution on different radiation sources . a source editor interface allows the user to input the radiation source and dose distribution charts . currently , [ \\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$$^{103}$$\\end{document}103pd ( 2335 ) best ] is used for breast cancer brachytherapy . two templates guiding the insertion of needles loaded with seeds are simulated in vision . a fiducial needle used to hook the surgical cavity , which is then attached to a template that guides the insertion of needles , is also simulated . following image shows a real - time implantation operation using a needle one of the templates.fig . 5seed implantation vision provides an accurate , fast , and easy - to - use interface for seed placement on resliced ct data . source placement spacing calculation in both 2d and 3d and dose volume histogram ( dvh ) is available . after seeds are placed on the resliced ct data set , a 3d view with the seeds can be generated for intuitive seed spacing analysis . this is a unique feature of vision that does not exist among commercial brachytherapy treatment planning software systems . this virtual 3d environment displays the seeds in the original data set that provides an intuitive viewing environment . 6virtual seed display on both patient s ptv and ctv with random placed seeds virtual seed display on both patient s ptv and ctv with random placed seeds vision s source editor provides an interface that allows sources to be input and used . currently , \\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$$^{103}$$\\end{document}103pd ( 2335 ) best is used for breast cancer brachytherapy . figure 7 shows an example of source placement editing in 2d and 3d and its dose volume histogram ( dvh ) . the dose at a particular point is calculated by summing the dose of all the seeds that affect the point . \\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$$^{103}$$\\end{document}103pd ( 2335 ) best seed is a cylindrically symmetric source , and dose distribution is a two - dimensional and can be described in terms of a polar coordinate system with its origin at the source center where \\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$$r$$\\end{document}r is the distance to the point of interest and \\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$$q$$\\end{document}q is the angle with respect to the long axis of the source.fig seed placement in 2d and 3d and dose volume histogram ( dvh ) \n vision s user interface . seed placement in 2d and 3d and dose volume histogram ( dvh ) the dose rate , \\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$$p(r,\\theta ) $ $ \\end{document}p(r, ) , at point ( r , \\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$$\\theta $ $ \\end{document} ) can be written as follows:\\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$$\\begin{aligned } p(r,\\theta ) = s_{k}^{\\left [ \\frac{g(r,\\theta ) } { g(ro,\\theta o)}\\right ] g(r,\\theta ) } , \\hbox { where } \\end{aligned}$$\\end{document}p(r,)=skg(r,)g(ro,o)g(r,),where\\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$$r$$\\end{document}r is the distance to the point of interest , \\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$$\\theta $ $ \\end{document} is the angle with respect to the long axis of the source , \\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$$s_{k}$$\\end{document}sk is air kerma strength of the source ; \\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$$\\left [ { \\frac{g\\left ( { r,\\theta } \\right ) } { g\\left ( { r0,\\theta 0 } \\right ) } } \\right ] g\\left ( r \\right ) f(r,\\theta ) $ $ \\end{document}gr,gr0,0grf(r, ) is dose rate constant , \\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$$g(r,\\theta ) $ $ \\end{document}g(r, ) is geometry factor , \\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$$g(r)$$\\end{document}g(r ) is radial dose function , \\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$$f(r , \\theta ) $ $ \\end{document}f(r, ) is anisotropy function . one method of verifying the plan is by projecting the virtual implants back to their original data set . this innovative feature of our vision system allows oncologists to view the implant position and spacing in 3d intuitively .", "the data collection phase involves a ct scanner on which the patient lies in prone position . the ct images are taken around the chest region traveling in the direction from the head to the feet . the \\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$$z$$\\end{document}z spacing is 5 mm away from the breast and 2 mm on the breast region . oncologists manually determine the ptv , clinical target volume ( ctv ) , and iso center and a gantry angle on each slice around the cavity region where the tumor was removed . the gantry angle is parallel with the rib cage to protect needles from going through the rib and lung region during the operation . seed placement is carried out on the resliced images inside the ptv contours that are reconstructed in the oblique direction . the number of interpolations between two adjacent slices is determined by the distance between them . for example , if the distance is 5 mm , then four interpolations are computed .", "the reslicing task is done by projecting the data set on the direction perpendicular to the gantry angle after applying interpolation on the ct images and its rois . the new reconstructed data can be described as follows : the \\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$$x$$\\end{document}x direction is parallel with the original \\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$$z$$\\end{document}z directionthe \\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$$y$$\\end{document}y direction is same as the original \\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$$y$$\\end{document}y direction with an angle that is derived from the gantry angle.from posterior to anterior : the \\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$$z$$\\end{document}z direction parallel with the original \\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$$x$$\\end{document}x direction with an angle equal to the gantry angle.the total number of resliced slices is automatically calculated using the rois size along the gantry angle and is described by the following equation:\\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$$\\begin{aligned } \\mathrm{total\\,number}_{\\mathrm{reslices } } = \\left ( \\frac{\\mathrm{roi\\,size\\,along\\,gantry\\,angle}}{\\mathrm{\\,reslice\\,thickness } } \\right ) + 1 \\end{aligned}$$\\end{document}totalnumberreslices = roisizealonggantryanglereslicethickness+1the original data set is recalculated from the view that the gantry angle is specified by oncologist and is suitable for seed placement procedure , see figs . 1 and 2.fig . 1 \n vision s reslice image calculations fig . 2 \n vision s reslice views : original data ( left ) , and reconstructed from the left image ( right ) the \\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$$x$$\\end{document}x direction is parallel with the original \\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$$z$$\\end{document}z direction the \\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$$y$$\\end{document}y direction is same as the original \\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$$y$$\\end{document}y direction with an angle that is derived from the gantry angle . the \\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$$z$$\\end{document}z direction parallel with the original \\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$$x$$\\end{document}x direction with an angle equal to the gantry angle . \n vision s reslice image calculations \n vision s reslice views : original data ( left ) , and reconstructed from the left image ( right )", "the interpolation component is designed to reconstruct image data and treatment volumes from the original slice thickness and spacing ( can be any size ) into 1 mm in spacing . therefore , the new resolution is always equal to 1 mm . with 5 mm spacing between two adjacent slices , four interpolated images and contours are created to achieve 1 mm of unit spacing . when creating interpolation contours , two types of interpolation process are encountered , overlapped and intersected types . the intersect type is that one contour is inside the other ; the overlapped type is that one contour partially inside the other . the interpolation contour is the dividing line that is equally dividing the region between two contours when only one interpolation is required .", "when 2d contours are used to define treatment volumes , a partially subjective process is underlined . the accuracy of volume definition depends on numerous image parameters such as the contrast to noise ratio and the signal - to - noise ratio . the volume definition using 2d contours is especially difficult at the edges of the target because of the partial volume effect that is related mostly to the image slice thickness . a low inter- and intra - observer reproducibility was reported in different clinical studies , mainly because of the subjective and objective factors . consequently , a probability function was designed in vision to study the partial volume effect of the volume definition caused by the 2d contouring method . the function is presented below using 26 for the total number of voxels in the neighborhood:\\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$$\\begin{aligned } p=\\frac{\\mathrm{number}\\ , \\mathrm{of}\\ , \\mathrm{voxels}\\,\\mathrm{in}\\ , \\mathrm{the}\\ , \\mathrm{target}\\ , \\mathrm{volume}}{26 } \\end{aligned}$$\\end{document}p = numberofvoxelsinthetargetvolume26the function is able to measure how many voxels belong to ptv in the neighborhood of current voxel . when the entire neighborhood of the current voxel belongs to the target volume , the probability value ( output of the probability function ) is 1 ; otherwise , it is 0 . if part of the neighborhood voxels is inside the target volume and part is outside of the target volume , the probability value is between 0 and 1 . the treatment volume is made up of all the voxels whose neighborhood probability value is greater than the threshold . when the threshold value is larger , the estimated volume is smaller ( more neighborhood voxels are excluded from the target volume ) , see fig . the volumes generated using this probability function is more accurate than other methods when the threshold is set to 0.5.fig . 4volume refinement uses our 3d probability function ; the sharp edges are removed with a degree that matches probability setting volume refinement uses our 3d probability function ; the sharp edges are removed with a degree that matches probability setting", "task group 43 ( tg-43 ) from the american association of physicists in medicine ( aapm ) is currently used at the toronto - sunnybrook regional cancer center . other kinds of radiation seeds ( also called radial sources ) can be used as radiation sources . the radial sources are simulated by following aapm tg-43 guidelines for brachytherapy to calculate dose distribution on different radiation sources . a source editor interface allows the user to input the radiation source and dose distribution charts . currently , [ \\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$$^{103}$$\\end{document}103pd ( 2335 ) best ] is used for breast cancer brachytherapy .", "two templates guiding the insertion of needles loaded with seeds are simulated in vision . a fiducial needle used to hook the surgical cavity , which is then attached to a template that guides the insertion of needles , is also simulated . following image shows a real - time implantation operation using a needle one of the templates.fig .", "vision provides an accurate , fast , and easy - to - use interface for seed placement on resliced ct data . source placement spacing calculation in both 2d and 3d and dose volume histogram ( dvh ) is available . after seeds are placed on the resliced ct data set , a 3d view with the seeds can be generated for intuitive seed spacing analysis . this is a unique feature of vision that does not exist among commercial brachytherapy treatment planning software systems . this virtual 3d environment displays the seeds in the original data set that provides an intuitive viewing environment . 6virtual seed display on both patient s ptv and ctv with random placed seeds virtual seed display on both patient s ptv and ctv with random placed seeds", "vision s source editor provides an interface that allows sources to be input and used . currently , \\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$$^{103}$$\\end{document}103pd ( 2335 ) best is used for breast cancer brachytherapy . figure 7 shows an example of source placement editing in 2d and 3d and its dose volume histogram ( dvh ) . the dose at a particular point is calculated by summing the dose of all the seeds that affect the point . \\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$$^{103}$$\\end{document}103pd ( 2335 ) best seed is a cylindrically symmetric source , and dose distribution is a two - dimensional and can be described in terms of a polar coordinate system with its origin at the source center where \\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$$r$$\\end{document}r is the distance to the point of interest and \\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$$q$$\\end{document}q is the angle with respect to the long axis of the source.fig seed placement in 2d and 3d and dose volume histogram ( dvh ) \n vision s user interface . seed placement in 2d and 3d and dose volume histogram ( dvh ) the dose rate , \\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$$p(r,\\theta ) $ $ \\end{document}p(r, ) , at point ( r , \\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$$\\theta $ $ \\end{document} ) can be written as follows:\\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$$\\begin{aligned } p(r,\\theta ) = s_{k}^{\\left [ \\frac{g(r,\\theta ) } { g(ro,\\theta o)}\\right ] g(r,\\theta ) } , \\hbox { where } \\end{aligned}$$\\end{document}p(r,)=skg(r,)g(ro,o)g(r,),where\\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$$r$$\\end{document}r is the distance to the point of interest , \\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$$\\theta $ $ \\end{document} is the angle with respect to the long axis of the source , \\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$$s_{k}$$\\end{document}sk is air kerma strength of the source ; \\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$$\\left [ { \\frac{g\\left ( { r,\\theta } \\right ) } { g\\left ( { r0,\\theta 0 } \\right ) } } \\right ] g\\left ( r \\right ) f(r,\\theta ) $ $ \\end{document}gr,gr0,0grf(r, ) is dose rate constant , \\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$$g(r,\\theta ) $ $ \\end{document}g(r, ) is geometry factor , \\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$$g(r)$$\\end{document}g(r ) is radial dose function , \\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$$f(r , \\theta ) $ $ \\end{document}f(r, ) is anisotropy function .", "one method of verifying the plan is by projecting the virtual implants back to their original data set . this innovative feature of our vision system allows oncologists to view the implant position and spacing in 3d intuitively .", "we have tested the system using more than 30 data sets of breast cancer patients selected from the toronto - sunnybrook regional cancer center after breast cancer treatment . after seed implantation , 3d viewing of target volume containing all the placed seeds is displayed . the reslice calculation our 3d reconstruction algorithm performs volume interpolation because of the non - uniform resolution of the scanned data sets . normally , the in - plane ( \\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$$x$$\\end{document}x\\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$$y$$\\end{document}y ) resolution of a data set is greater than the out - of - plane ( \\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$$z$$\\end{document}z ) resolution . our volume interpolation algorithm in vision is able to adjust the number of interpolations between two slices automatically and then interpolate accordingly ( see fig . 8) . the result spacing and thickness are always a unit of 1 mm between slices . mathematical morphology operation for medial axis finding and level set method [ 19 , 20 ] are employed in the interpolation process.fig . 8plain target treatment volume 3d view , without interpolation ( left ) , and with interpolation ( right ) plain target treatment volume 3d view , without interpolation ( left ) , and with interpolation ( right ) our volume estimation method produces 99.73 % accuracy on sphere phantom data sets . when the probability threshold of volume estimation method is set to 0.5 , the volume estimation gives the highest accurate volume estimation result . a statistically significant accuracy improvement on volume estimation was achieved ( 99.38 % from 92.38 % at the \\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$$p=0.05$$\\end{document}p=0.05 level ) . the true volume for this sphere phantom is as follows : 22.45 cm\\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$$^{3 } \\quad ( { \\mathrm{diameter}=3.5\\,\\mathrm{cm},\\mathrm{volume}=\\frac{4\\pi 3^{3}}{3}}={22.45\\,\\mathrm{cm}^{3}})$$\\end{document}3(diameter=3.5cm , volume=4333=22.45cm3 ) . the volume output from the existing commercial software overestimated the true volume ( see table 2 ; figs . 9 , 10).table 1volume estimations using patient ct data sets using different methods ( in cm\\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$$^{3})$$\\end{document}3 ) \n case no.pinnacleno interpolationinterpolationreslice without interpolationreslice with interpolation110.019.668.789.868.85232.5932.5228.8326.9028.30313.1512.6410.8913.0210.86416.6916.0113.9015.7413.65511.2810.609.5310.679.4864.093.863.494.083.7074.123.893.314.013.30table 2volumes ( in cm\\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$$^{3}$$\\end{document}3 ) and reconstructed volumes after reslice by our method with interpolation and without interpolation on phantom object with known volume ( 22.45 cm\\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$$^{3})$$\\end{document}3 ) \n pinnacleno interpolationinterpolationreslice without interpolationreslice with interpolation24.1624.2323.1324.3422.61fig . 9volume output from existing software , with and without the interpolation method , and pinnacles output ( left graph ) . volumes comparison : no interpolation , interpolation , reslice no interpolation , and reslice with interpolation ( right graph)fig . 10phantom volume estimation : a comparison of several methods : pinnacle , no interpolation , interpolation ( on original slices ) , reslice without interpolation , and reslice with interpolation volume estimations using patient ct data sets using different methods ( in cm\\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$$^{3})$$\\end{document}3 ) \n volumes ( in cm\\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$$^{3}$$\\end{document}3 ) and reconstructed volumes after reslice by our method with interpolation and without interpolation on phantom object with known volume ( 22.45 cm\\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$$^{3})$$\\end{document}3 ) \n volume output from existing software , with and without the interpolation method , and pinnacles output ( left graph ) . volumes comparison : no interpolation , interpolation , reslice no interpolation , and reslice with interpolation ( right graph ) phantom volume estimation : a comparison of several methods : pinnacle , no interpolation , interpolation ( on original slices ) , reslice without interpolation , and reslice with interpolation", "this paper described vision , a 3d computer - assisted treatment planning system we developed for breast cancer brachytherapy treatment . the system was developed using mathematical theories for accurate volume estimation and dose analysis , as well as advanced 3d visualization technologies . the patient treatment volume reconstructed by a method developed in this project significantly improved the accuracy from existing methods and guarantees the high - volume accuracy requirement of radioactive seed implantation procedure for this treatment . the vision system is a virtual 3d environment that allows radiation oncologists to perform volume measurement , seed placement , and dose distribution planning and analysis based on a set of 2d contours on patient ct images . vision is able to embed placed seeds on original patient ct images and displayed in an institutive 3d environment that can be easily manipulated by the oncologist . using our 3d neighborhood probability function to estimate the treatment volume , we were able to rectify the redundant voxels located outside of the target region and minimize the discrepancies in volume definition by 2d manually contouring between adjacent slices . in this research project , advanced mathematical theories were researched and applied , such as mathematical morphology theory , partial differential equations , probability statistics , and mathematical modeling . our system achieves 99.73 % accuracy in volume estimation measured against the true volume and is statistically significantly more accurate than current existing commercial software at the \\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$$p=0.05$$\\end{document}p=0.05 level . future work will focus on automatic source seed placement that could be adjusted by an oncologist if necessary . the purpose of this work was to optimize the seed placements such that radial dose distributions will be uniformly distributed over the entire ptv to avoid hot / cold spots . this , in turn , will assist an oncologist by minimizing the number of seeds required and potentially increasing the effectiveness of the treatment .", "the authors certify that we have no affiliations with or involvement in any organization or entity with any financial interest ( such as honoraria ; educational grants ; participation in speakers bureaus ; membership , employment , consultancies , stock ownership , or other equity interest ; and expert testimony or patent - licensing arrangements ) in the subject matter or materials discussed in this manuscript ." ]

[ "the histologic confirmation is necessary for the definite diagnosis and is essential in determining the treatment for patients with cardiac tumors . depending on the various clinical situations , tissue diagnosis can be made with less invasive methods including cytologic evaluation of pericardial or pleural fluids , or percutaneous biopsy of metastatic subcutaneous lymph nodes . open heart surgery , mediastinoscopy , and metastatic mass exploration are more invasive methods that require general anesthesia . percutaneous transvenous biopsy of cardiac tumor can be done under the guidance of transesophageal echocardiography ( tee ) . recently , intracardiac echocardiography ( ice ) has been introduced to assist many cardiac procedures and it provides high - quality imaging like tee . although it needs local anesthesia and venous puncture with relatively large catheter , it can give us a good guidance during the biopsy of cardiac tumors . in this report , we present two cases of cardiac masses documented by percutaneous transvenous biopsy under the guidance of an ice .", "a 51-year - old woman was admitted to our hospital with a 3-day history of progressive dyspnea and generalized edema . the initial electrocardiogram revealed atrial fibrillation with rapid ventricular response , low qrs voltage , and poor r progression . the chest x - ray showed a water - bottle shaped cardiomegaly and bilateral pleural effusion . the transthoracic echocardiogram ( tte ) showed a large amount of pericardial effusion with diastolic right atrial ( ra ) and ventricular collapse associated with inferior vena caval plethora . it revealed infiltrative masses along the superior and posterior aspect of ra wall ( fig . the computed tomographic ( ct ) scan revealed infiltrating mass on ra wall ( fig . 1b ) and multiple tiny nodules scattered in the whole lung fields . because the cytologic examination from the pericardial fluid was inconclusive , we performed percutaneous biopsy of the ra mass in order to establish a pathological diagnosis . after placement of an 8 fr ultra ice catheter ( acunav , siemens medical solution , mountain view , ca , usa ) into the ra , a 6 fr biopsy catheter was inserted into ra and several pieces of ra mass were obtained ( fig . the procedure was well tolerated under local anesthesia , and no complication occurred during the procedure . although the patient was treated with systemic chemotherapy , she died from hepatic rupture associated with multiple liver metastases at 18 months . a 53-year - old man visited our hospital with a 10-day history of progressive dyspnea and weight loss of 4 kg . the ct scan revealed a huge mass infiltrating both atrial wall and posterior mediastinal extension ( fig . 2b ) . because cytologic confirmation of the pleural fluid was negative and percutaneous needle biopsy of the mediastinal mass could be a high - risk procedure , we performed percutaneous ra mass biopsy in order to get prompt specimens . a 6 fr cardiac biopsy catheter and an 8 fr ultra ice catheter were percutaneously inserted into the ra through the right and left femoral vein , respectively . we obtained several pieces of ra mass with the ice monitoring ( fig . 2c and d ) .", "a 51-year - old woman was admitted to our hospital with a 3-day history of progressive dyspnea and generalized edema . the initial electrocardiogram revealed atrial fibrillation with rapid ventricular response , low qrs voltage , and poor r progression . the chest x - ray showed a water - bottle shaped cardiomegaly and bilateral pleural effusion . the transthoracic echocardiogram ( tte ) showed a large amount of pericardial effusion with diastolic right atrial ( ra ) and ventricular collapse associated with inferior vena caval plethora . it revealed infiltrative masses along the superior and posterior aspect of ra wall ( fig . the computed tomographic ( ct ) scan revealed infiltrating mass on ra wall ( fig . 1b ) and multiple tiny nodules scattered in the whole lung fields . because the cytologic examination from the pericardial fluid was inconclusive , we performed percutaneous biopsy of the ra mass in order to establish a pathological diagnosis . after placement of an 8 fr ultra ice catheter ( acunav , siemens medical solution , mountain view , ca , usa ) into the ra , a 6 fr biopsy catheter was inserted into ra and several pieces of ra mass were obtained ( fig . the procedure was well tolerated under local anesthesia , and no complication occurred during the procedure . although the patient was treated with systemic chemotherapy , she died from hepatic rupture associated with multiple liver metastases at 18 months .", "a 53-year - old man visited our hospital with a 10-day history of progressive dyspnea and weight loss of 4 kg . the ct scan revealed a huge mass infiltrating both atrial wall and posterior mediastinal extension ( fig . 2b ) . because cytologic confirmation of the pleural fluid was negative and percutaneous needle biopsy of the mediastinal mass could be a high - risk procedure , we performed percutaneous ra mass biopsy in order to get prompt specimens . a 6 fr cardiac biopsy catheter and an 8 fr ultra ice catheter were percutaneously inserted into the ra through the right and left femoral vein , respectively . we obtained several pieces of ra mass with the ice monitoring ( fig . 2c and d ) .", "the malignant primary cardiac tumors are extremely uncommon , whereas metastatic cardiac tumors occur more frequently.1,2,3 ) in a patient suspected of malignant cardiac tumor without an option for curative surgical treatment , histopathological confirmation is a mandatory option next to treatment strategy , regardless of its primary focus . depending on the various clinical presentations , pathologic diagnosis can be made with less invasive methods such as cytologic evaluation of pericardial or pleural fluids , or percutaneous biopsy of metastatic subcutaneous lymph node . more invasive methods of tumor biopsy through open heart surgery , mediastinoscopy , or metastatic mass exploration may be needed when less invasive approach is not confirmative . percutaneous transvenous biopsy of cardiac tumor is a good alternative using less invasive tool for tissue diagnosis . traditionally , the fluoroscopy guidance is the most commonly used for the blunt endomyocardial biopsy . because the fluoroscopy is inadequate to target the mass lesion , especially in patients with cardiac tumors , many researchers use tte or tee to guide the prompt site for biopsy.4)5 ) however , tte gives less clear cardiac images than tee , especially for the posterior wall mass and the patient with poor echo window,6 ) and tee requires general anesthesia during the procedure . recently , the ice has been introduced to guide several cardiac procedures including device closure for congenital shunts , septal puncture , radiofrequency catheter ablation for arrhythmias , and intracardiac biopsy of tumor.7,8,9,10,11 ) because ice can give us clearer cardiac imaging without using the general anesthesia , it is more practical and patient - friendly . it can also reduce radiation exposure for the echocardiographer during the procedure . in this report , we showed the feasibility of the ice during targeting of the biopsy catheter , without a requirement of patient sedation . the use of ice during the procedures increase diagnostic yield and can reduce the incidence of cardiac complications associated with inadequate targeting of the biopsy catheters . it can be used for the biopsy of the mass from right - side of the heart , especially in patients with high risk for anesthesia.9,10,11 ) these ice - guided techniques allow the physician to safely and effectively perform endocardial biopsy with short total procedure time and less exposure to radiation ." ]

[ "the lancefield group g beta - hemolytic streptococci ( ggs ) have been recognized as pathogens causing serious infections in humans , although ggs can have a commensal relationship when present on the skin , pharynx , intestinal tract , and vagina.1 the major pathological conditions predisposing ggs infections include malignancy , alcoholism , cardiovascular disease , diabetes mellitus , bone and joint diseases , and cirrhosis of the liver . we report a rare case of endogenous endophthalmitis caused by streptococcus equisimilis , a ggs organism .", "a 74-year - old woman became confused in her daily living , and the confusion was concomitant with a high - grade fever on april 29 , 2008 . she was admitted to a local hospital on the following day and was given intravenous ceftriaxone for 9 days . she had a history of cardiac and brain infarctions and was at the postoperative stage of uterine cancer . ggs was detected in cultures of her blood sample and she was suspected to have infective endocarditis . although the hospital staff had noticed a moderate swelling of her left eyelid since may 1 , 2008 , an ophthalmologist did not examine her until she was referred to us on may 9 , 2008 . physical examination showed the patient to be a very ill woman with a body temperature of 38c . her left eyelids were swollen , and a moderate degree of conjunctival infection with chemosis was observed in her left eye . transthoracic echocardiography disclosed a mobile mass associated with the mitral valve with moderate valvular regurgitation ( figure 1 ) . laboratory tests demonstrated an elevated leucocyte count of 11850/l with 82% of polymorphonuclear cells , a c - reactive protein level of 10.65 mg / dl , lactate dehydrogenase level of 519 iu / l , amylase level of 175 iu / l , and brain natriuretic peptide level of 450.0 pg / ml . she was immediately hospitalized and on the same day ( may 9 , 2008 ) underwent emergency mitral valvuloplasty and both intravitreal and subconjunctival injections of both 1 mg / ml vancomycin and 1 mg / ml meropenem . after the surgery , she was treated with topical antibiotics ( levofloxacin ) and ointment ( oflx ) for approximately 1 month , intravenous gentamicin ( 200 mg / day ) , and intravenous penicillin g potassium ( 240,000 iu / day ) for 9 days . her general condition and ocular inflammation gradually improved with the medical therapy . however , her best - corrected visual acuity remained at light perception . subsequently , cultures from both anterior chamber and vitreous biopsy specimens grew s. equisimilis , which was sequenced by polymerase chain reaction . the s. equisimilis was found to be susceptible to penicillin g , ampicillin , sulbactam sodium / ampicillin sodium , imipenem / cilastatin , levofloxacin , and vancomycin , and was resistant to erythromycin and clarithromycin .", "s. dysgalactiae subsp . equisimilis hosts variants within the lancefield group a , c , l , and g carbohydrates , and was recently determined by gene sequencing to be a subspecies of group g of s. equisimilis . exogenous ggs endophthalmitis has been reported following cataract surgery , penetrating keratoplasty and trabeculectomy.2 on the other hand , endogenous ggs - related endopthalmitis is extremely rare.1 so far , there have been only 8 cases of endogenous ggs - related endophthalmitis;35 4 cases associated with endocarditis , 1 with cellulites of the foot , 1 with facial trauma , 1 with an abscessed tooth , and 1 of unknown origin . we demonstrated a case of an endogenous ggs - related endophthalmitis where s. equisimilis was first identified from both anterior chamber and vitreous biopsies , and where identification was also first made by polymerase chain reaction . the first - line therapy of s. equisimilis - induced infections is penicillin . besides penicillin , s. equisimilis was sensitive to all of the antimicrobial agents we administered . in our case , we suggest that a delay in the diagnosis would have worsened the general conditions of the patient , and would then lead to a poorer prognosis . at present , the efficacy of immediate ocular therapies including vitrectomy and intravitreal antibiotics against ggs - related endogenous endophthalmitis is still controversial.3 only further investigations will answer this question ." ]

[ "polycystic ovary syndrome ( pcos ) is the most common endocrine disorder in women of reproductive age . pcos produces symptoms in approximately 5 to 10% of women of reproductive age ( 1245 years old ) and is thought to be one of the leading causes of the female subfertility . pcos is a medical condition , in which there is an imbalance of the female sex hormones i.e. elevated levels of testosterone , dhea - s , androstenedione , prolactin , and lh along with a normal , high or low estrogen levels . according to the rotterdam criteria , a diagnosis of pcos can be made in a woman if she has 2 of the following 3 manifestations : irregular or absent ovulation , elevated levels of androgenic hormones , and/or enlarged ovaries containing at least 12 follicles each . other conditions with similar presenting signs , such as androgen - secreting tumors or cushing 's syndrome , must be ruled out before a diagnosis of pcos is established . controversies in continuation of metformin therapy throughout pregnancy , in women who have conceived after treatment of pcos , has remained a controversial topic till date . hyperinsulinaemia , insulin resistance and impaired glucose tolerance are very common in women with pcos , particularly in those with a body mass index ( bmi ) > 30 , but insulin resistance may occur in lean women with pcos . an insulin action in the ovary is mediated via the insulin receptor rather than the type 1 insulin - like growth factor ( igf ) receptor , which binds igf - i with high affinity and insulin with low affinity . hyperinsulinaemia has shown to increase androgen production by the ovaries and hence it may play a central role in the pathogenesis of pcos .", "in a randomized , placebo - controlled , double blind study , done on 257 pregnant women with pcos , aged 18 - 42 years , who either received metformin or placebo from first trimester to delivery , failed to demonstrate any reduction of pregnancy - related complications , such as gestational diabetes , pre - eclampsia and pre - term delivery in the metformin group . on the contrary , a prospective study done on 98 pregnant women with pcos who received metformin ( 1700 3000 mg / day ) before conception and up to 37 weeks of pregnancy vs. 110 normal pregnant controls , showed a significant reduction of pregnancy complications , such as gestational diabetes and gestational hypertension but an insignificant decrease in pre - eclampsia incidence with comparable mean neonatal apgar scores , weight and length between the 2 groups . metformin has been shown to have encouraging effects on several metabolic aspects of polycystic ovarian syndrome , such as insulin sensitivity , plasma glucose concentration , and lipid profile and since women with pcos are more likely than healthy women to suffer from pregnancy - related problems like early pregnancy loss , gestational diabetes mellitus and hypertensive states in pregnancy , the use of metformin therapy in these patients throughout pregnancy may have beneficial effects on early pregnancy loss and development of gestational diabetes . however , there is little evidence of its beneficial effect on hypertensive complications in pregnancy . in a 3-year case controlled study , conducted on 197 pregnant women with pcos ( confirmed by rotterdam criteria ) , in which cases comprised of women who continued metformin throughout pregnancy while controls were women who stopped metformin after the first trimester , it was concluded that in comparison to the control group , the study group had a significant reduction in early pregnancy loss . besides reducing the rates of miscarriages , continuing its use in pregnancy is devoid of any adverse effects on the new born as demonstrated by a case - controlled study , measuring pregnancy outcomes , conducted on 137 women with pcos ( rotterdam criteria ) , in which there were 3 groups . the study found that the group , which continued metformin use throughout the entire pregnancy , had diminished incidences of fetal growth restriction , preterm labor , and increased live birth rates . there were also no congenital anomalies , intrauterine deaths or stillbirths reported in the test subjects , suggesting metformin use is not related to teratogenicity . besides the above , the group which continued metformin use in the entire pregnancy had reduced incidences of early pregnancy losses and gestational diabetes . continuing the use of metformin during the first trimester of 66 pregnant women with pcos , demonstrated a lower percentage of small ( < 10 centile ) and large ( > 90 centile ) for gestational age babies as compared to the 66 control groups of normal women without pcos who did not use metformin . neonatal hypoglycemia was also less commonly reported in the metformin group with fewer babies requiring intravenous glucose therapy . metformin is excreted in breast milk , but the amount secreted is clinically insignificant and there have been no reported adverse effects on breastfed infants with mothers who take metformin . a study which measured growth , motor - social development and illness in 61 nursing infants ( 21 males and 40 females ) and 50 formula - fed infants ( 19 males and 31 females ) born to 92 mothers with pcos who were taking metformin ( median of 2.55 gm / day ) throughout pregnancy and lactation , reported that none of the children had any delay in either growth or in developmental milestones . an important link exists in patients between having an abnormal glucose tolerance test and a history of recurrent spontaneous abortions . since women with pcos are more prone than healthier women to have an abnormal glucose tolerance test during pregnancy , these women may also be at an increased risk of having spontaneous first trimester abortions . a prospective clinical - controlled trial concluded that metformin use in pregnant patients with an abnormal glucose tolerance test and history of recurrent spontaneous abortions effectively reduced the chances of first trimester abortion with improved chances of a successful pregnancy . other attributed causes for miscarriages in women with pcos are elevated levels of androgens and luteinizing hormone . metformin with its favorable effects on androgen and lh levels may be useful in reducing rates of early pregnancy loss when used pre conception and continued through pregnancy . its modification of lh levels are evident by a prospective randomized controlled trial , conducted on 32 women with pcos with high pretreatment lh values and 32 women with normal cycles who were recruited to receive metformin ( 850 mg b.i.d ) or placebo , for an average duration of 40 days . there was a significant reduction of lh values in pcos women to normal baseline with metformin therapy while the fsh and tsh levels remained normal . these women also showed reduction in their prolactin levels as compared to their previous high pretreatment levels demonstrating the effect of metformin on the pituitary . contrary to the results of the above - mentioned study , meta - analysis of 17 randomized controlled trials found that metformin use before conception does not reduce abortion risk in women with pcos . women with polycystic ovaries are more insulin - resistant than weight - matched women with normal ovaries . an insulin resistance is seen in 10 15% of slim and 20 40% of obese women with pcos , and women with pcos are at increased risk of developing type 2 diabetes . obesity can negatively influence chances of conception , response to fertility treatment as well as increase risks of miscarriages and congenital anomalies along with increasing the risks for pregnancy related complications . even a moderate amount of weight loss ( 5 - 10% body weight ) , before pregnancy , with or without metformin use has shown to be sufficient in improving metabolic markers . metformin used throughout pregnancy in women with pcos may reduce gestational diabetes incidence by as much as 9-fold . its use during pregnancy in women with pcos facilitates primary and secondary prevention of gestation diabetes . the reduction in incidence of gestational diabetes mellitus has been attributed to metformin 's metabolic , endocrine , vascular , and anti - inflammatory effects . these effects of metformin were demonstrated in a prospective cohort study wherein 360 non - diabetic pcos patients participated who conceived while on metformin by different treatment modalities . the study group comprised of 200 women who continued metformin ( 1000 - 2000 mg/ day ) throughout pregnancy while the control group of 160 women discontinued metformin . the results of the study concluded in favor of the women who continued metformin use who demonstrated statistically significant prevention or reduction in the incidence of gestation diabetes mellitus . of the other studies , which were performed on patients with gestational diabetes , mellitus one was a case controlled study , done on 100 women with gdm who were exclusively treated with metformin , were compared with 100 with gdm - treated exclusively with insulin matched for age , weight , and ethnicity , showed similar baseline maternal risk factors in both groups and similar incidences of gestational hypertension , pre - eclampsia , induction of labor and rate of cesarean section , but significantly greater mean maternal weight gain from enrollment to term in the insulin group . the pregnancy outcomes in the women who were treated with metformin alone , demonstrated lesser incidence of prematurity , neonatal jaundice and admission to neonatal unit with an overall improvement in neonatal morbidity as compared to the women treated with insulin alone . there was no significant difference in the incidence of fetal macrosomia between the 2 groups of women . interestingly , a recent randomized controlled trial , done on 100 women with gdm who did not attain euglycemia with diet , were randomized to receive therapy with insulin or oral metformin concluded that metformin was better suited than insulin for prevention of fetal macrosomia , especially in lean or in moderately overweight women developing gdm in late gestation , and insulin was preferred therapy for women with considerable obesity , high fasting blood glucose levels and an early need for pharmacological treatment . the beneficial effects of metformin in pcos women further include weight loss in obese women with significant changes in waist - to - hip ratio , normalization of abnormal lh / fsh ration , and impaired glucose tolerance as well as significant reduction in insulin resistance . additionally , the use of metformin has a relatively low cost and diminished hazards as compared to those associated with surgical interventions.[2931 ] a rare but serious side effect reported within 3 weeks of imitation of metformin therapy is a mixed ( hepatocellular and cholestatic ) type of hepatic damage with raised ast , alt , alp and bilirubin levels.[3234 ] however , immediate discontinuation of metformin demonstrated an improvement in symptoms and return of liver enzymes to normal baseline value within 3 weeks . hence , it is advisable to monitor liver function tests in patients receiving metformin therapy .", "it has encouraging effects on several metabolic aspects of polycystic ovarian syndrome , such as insulin sensitivity , plasma glucose and lipid profile . its use in patients with pcos during pregnancy reduces a number of pregnancy - related complications , such as gestational diabetes and gestational hypertension . use of metformin throughout pregnancy in women with pcos has shown to reduce the rates of early pregnancy loss , preterm labor , and prevention of fetal growth restriction . there have been no demonstrable teratogenic effects , intra - uterine deaths , still births or developmental delays reported with metformin use in pregnancy . despite these favorable effects of metformin use with scarce serious side effects , no definite guidelines recommending metformin use in pregnant women with pcos exists and hence further research on the topic" ]

[ "the mucoadhesive polymer containing oral drug delivery systems has the capacity to prolong residence time of drugs at the absorption site and facilitate intimate contact with underlying absorptive surface to enhance bioavailability . polymers used in the mucoadhesive formulations include natural , semisynthetic , and synthetic ones . in recent years , a growing interest has been identified in the development of natural polymer - based drug delivery systems due to their biodegradability , biocompatibility , aqueous solubility , swelling ability , easy availability , and cost - effectiveness . amongst various natural polymers , alginates have been widely used in the development of drug delivery applications [ 36 ] . it is composed of linear copolymers of two monomeric units , that is , -d - mannuronic acid and -l - guluronic acid . sodium alginate ( sa ) undergoes ionotropic - gelation by ca to form calcium alginate due to an ionic interaction between carboxylic acid groups of alginate chain and ca . sodium alginate has mucoadhesive property ; however , the cross - linked alginates are usually fragile [ 9 , 10 ] . therefore , blending of different mucoadhesive polymers is one of the most popular approaches to formulate ionotropically cross - linked alginate - based mucoadhesive beads [ 9 , 11 , 12 ] . again , blending with suitable polymers , may improve the drug encapsulation , which is found comparatively lower in alginate - based beads prepared by ionotropic - gelation method . ispaghula ( plantago ovata f. ) husk is an indigenous product of south asia and is widely used herbal product both in traditional and modern medicines . the ispaghula husk mucilage ( ihm ) is white , hydrophilic in nature , and forms a colorless gel in presence of water [ 1416 ] . ihm contains a high amount of highly branched neutral arabinoxylan ( arabinose 22.6% , xylose 74.6% , and traces of other sugars ) and about 35% of nonreducing terminal sugar residues . few investigations had been carried out to formulate mucoadhesive beads as drug delivery matrices using both untreated ispaghula husk and alkaline treated ispaghula husk directly as polymeric blend with sodium alginate [ 1 , 17 , 18 ] . however , no attempt has been taken to formulate mucoadhesive alginate - based beads using isolated ihm as polymeric blend for the use in drug delivery . in the current investigation , the utility of isolated ihm , as a possible natural polymeric - blend with sa for the development of new ihm - blended alginate beads containing glibenclamide through ionotropic - gelation , glibenclamide is a sulfonylurea used in the treatment of non - insulin - dependent diabetes mellitus ( niddm , type - ii ) [ 2 , 19 ] . its plasma half - life is 46 hours , which makes multiple dosing to maintain the therapeutic blood level . therefore , it would be beneficial to develop a mucoadhesive system of glibenclamide using ihm - alginate for oral use , which might facilitate an intimate contact with the mucous membranes ( i.e. , mucoadhesion or bioadhesion ) in the gastrointestinal tract , and thus the gastric residence could be prolonged to release glibenclamide at the target site at controlled rate over an extended period to maximize the therapeutic effect . in the development of any pharmaceutical formulation , an important issue is to design a formulation with optimized quality in a short time period and minimum number of trials [ 20 , 21 ] . traditionally , pharmaceutical formulators develop various formulations by changing one variable at a time while keeping others fixed . however , many experiments do not succeed in their purpose because they are not properly thought out and designed , and even the best data analysis can not compensate lack of planning . therefore , it is essential to understand the influence of formulation variables on the quality of formulations with a minimal number of experimental trials and subsequent selection of formulation variables to develop an optimized formulation using established statistical tools [ 5 , 2224 ] . factorial designs , where all the factors are studied in all possible combinations , are considered the most efficient in estimating the influence of individual variables and their interactions performing minimum numbers of experiments . a computer - aided optimization technique based on 3 ( two factors and three levels ) factorial design and response surface methodology was employed to investigate the effects of two independent process variables ( factors ) , that is , sa : ihm and cross - linker ( cacl2 ) concentration on the properties of glibenclamide - loaded ionotropically gelled ihm - alginate beads such as drug encapsulation and drug release .", "india ) , sa ( central drug house , india ) , ispaghula husk ( shree baidyanath ayurved bhawan pvt . the mucilage from ispaghula ( plantago ovata f. ) husk was extracted according to the previously reported method [ 26 , 27 ] . an amount of 10 ml of 0.1 m hcl was heated to boil in a 100 ml flask and 1 gram of plantago ovata f. husk was added . after total change of color , the flask was finally removed from heat and the solution was filtered through a clean muslin cloth while still hot . in order to separate residual traces of mucilage , the seeds were washed twice with 5 ml of hot water and the solution obtained each time was filtered . the combined filtrate , containing the dissolved mucilage , was mixed with 60 ml of 95% ethyl alcohol , stirred , and allowed to stand for 5 hours . finally , the supernatant liquid was decanted and the precipitate in the beaker was dried in an oven at 50c . the dried ihm cake was grounded with a mortar and passed through a sieve ( 0.15 mm mesh size ) . the isolated ihm powders were packed in a plastic bag and kept airtight desiccators until further use . the glibenclamide - loaded ihm - alginate beads were prepared by ionotropic - gelation technique using calcium chloride ( cacl2 ) as cross - linker . briefly , sa and ihm aqueous dispersions were prepared separately using distilled water . these dispersions were well mixed with stirring for 15 min at 1000 rpm using a magnetic stirrer ( remi motors , india ) . the ratio of drug to polymer was maintained 1 : 2 in all formulations . the final mixtures were homogenized for 15 min at 1000 rpm using a homogenizer ( remi motors , india ) and ultrasonicated for 5 minutes for debubbling . the added droplets were retained in the cacl2 solution for 15 min to complete the curing reaction and to produce rigid beads . the wet beads were collected by decantation and washed two times with distilled water and dried at 37c for 24 h. the dried glibenclamide - loaded ihm - alginate beads were stored in a desiccator until used . a 3 factorial design was employed for optimization with sa : ihm ( x1 ) and concentration of cacl2 ( x2 ) as the prime selected independent variables , which were varied at three levels , low ( 1 ) , medium ( 0 ) , and high ( + 1 ) . the drug encapsulation efficiency ( dee , % ) and 10 hours ( r10 h , % ) were used as dependent variables ( responses ) . the matrix of the design including investigated responses , that is , dee and r10 h , is shown in table 1 . the effects of independent variables upon the all measured responses were modelled using the following quadratic mathematical model generated by 3 factorial design : \n ( 1)y = b0+b1x1+b2x2+b3x1x2+b4x12+b5x22 , \n where y is the response , b0 is the intercept , and b1 , b2 , b3 , b4 , b5 are regression coefficients . x1 and x2 are individual effects ; x1 and x2 are quadratic effects ; x1x2 is the interaction effect . one - way anova was applied to estimate the significance ( p < 0.05 ) of generated models . the response surface methodology was applied to analyze the effect of independent factors ( sa : ihm and cacl2 concentration ) on the measured responses ( dee and r10 h ) . accurately weighed , 100 mg of beads were taken and were crushed using pestle and mortar . the crushed powders of drug containing beads were placed in 500 ml of phosphate buffer , ph 7.4 , and kept for 24 hours with occasionally shaking at 37 0.5c . after the stipulated time , the mixture was stirred at 500 rpm for 15 min on a magnetic stirrer . the polymer debris formed after disintegration of bead was removed filtering through whatman filter paper ( no . 40 ) . the drug content in the filtrate was determined using a uv - vis spectrophotometer ( shimadzu , japan ) at 228.5 nm . the dee of beads was calculated using this following formula : \n ( 2)dee ( % ) = actual drug content in beadstheoretical drug content in beads100 . particle size of 100 dried beads from each batch was measured by optical microscopic method for average particle size using an optical microscope ( olympus ) . samples were gold coated by mounted on a brass stub using double - sided adhesive tape and under vacuum in an ion sputter with a thin layer of gold ( 3 ~ 5 nm ) for 75 seconds and at 20 kv to make them electrically conductive , and their morphology was examined by scanning electron microscope ( zeiss evo 40 , japan ) . samples were reduced to powder and analyzed as kbr pellets by using a fourier transform - infrared ( ftir ) spectroscope ( perkin elmer spectrum rx i , usa ) . spectral scanning was taken in the wavelength region between 4000 and 400 cm at a resolution of 4 cm with scan speed of 1 cm / second . the release of glibenclamide from various ihm - alginate beads was tested using a dissolution apparatus usp ( campbell electronics , india ) . the baskets were covered with 100-mesh nylon cloth to prevent the escape of the beads . glibenclamide - loaded ihm - alginate beads equivalent to 30 mg glibenclamide were taken in 900 ml of dissolution medium ( 0.1 n hcl , ph 1.2 for first 2 hours and phosphate buffer , ph 7.4 for next 8 hours ) . an amount of 5 ml of aliquots was collected at regular time intervals , and the same amount of fresh dissolution medium was replaced into the dissolution vessel to maintain sink condition throughout the experiment . the collected aliquots were filtered and suitably diluted to determine absorbance using a uv - vis spectrophotometer ( shimadzu , japan ) at 228.5 nm against appropriate blank . in order to predict and correlate the in vitro release behaviour of glibenclamide from formulated glibenclamide - loaded ihm - alginate beads , it is necessary to fit into a suitable mathematical model . the in vitro drug release data were evaluated kinetically in different mathematical models [ 5 , 6 ] : ( i)zero - order model : q = kt + q0 , where q represents the drug released amount in time t , and q0 is the start value of q ; k is the rate constant;(ii)first - order model : q = q0e , where q represents the drug released amount in time t , and q0 is the start value of q ; k is the rate constant;(iii)higuchi model : q = kt , where q represents the drug released amount in time t , and k is the rate constant;(iv)korsmeyer - peppas model : q = kt , where q represents the drug released amount in time t , k is the rate constant , and n is the diffusional exponent , indicative of drug release mechanism . zero - order model : q = kt + q0 , where q represents the drug released amount in time t , and q0 is the start value of q ; k is the rate constant ; first - order model : q = q0e , where q represents the drug released amount in time t , and q0 is the start value of q ; k is the rate constant ; higuchi model : q = kt , where q represents the drug released amount in time t , and k is the rate constant ; korsmeyer - peppas model : q = kt , where q represents the drug released amount in time t , k is the rate constant , and n is the diffusional exponent , indicative of drug release mechanism . the korsmeyer - peppas model was also employed in the in vitro drug release behaviour analysis of these formulations to distinguish between competing release mechanisms [ 5 , 6 ] : fickian release ( diffusion - controlled release ) , non - fickian release ( anomalous transport ) , and case - ii transport ( relaxation - controlled release ) . when n is 0.43 , it is fickian release . the mucoadhesivity of optimized glibenclamide - loaded ihm - alginate beads was evaluated by ex vivo wash - off method [ 11 , 12 ] . freshly excised pieces of goat intestinal mucosa ( 2 2 cm ) ( collected from slaughterhouse ) were mounted on glass slide ( 7.5 2.5 cm ) using thread . fifty beads were spread onto the wet tissue specimen , and the prepared slide was hung onto a groove of disintegration test apparatus . the tissue specimen was given regular up and down movement in a vessel containing 900 ml of 0.1 n hcl ( ph 1.2 ) and phosphate buffer ( ph 7.4 ) , separately , at 37c . after regular time intervals , the machine was stopped and the number of beads still adhering to the tissue was counted . \n in vivo studies were performed in alloxan - induced diabetic albino rats of either sex ( weighing 266342 grams ) . the experimental protocol was subjected to the scrutiny of the institutional animal ethical committee and was cleared before starting . the animals were handled as per guidelines of committee for the purpose of control and supervision on experimental animals ( cpcsea ) . all efforts were made to minimize both the suffering and number of animals used . the rats were made diabetic by intraperitoneal administration of freshly prepared alloxan solution at a dose of 150 mg / kg dissolved in 2 mm citrate buffer ( ph 3.0 ) . after one week of alloxan administration , alloxanized rats with fasting blood glucose of 300 mg / dl or more were considered diabetic and were employed in the study for 12 hours . the alloxan - induced diabetic rats were divided randomly into 2 groups of 6 rats each and treated as follows . group a was administered with pure glibenclamide in suspension form , and group b was administered with optimized formulation of glibenclamide - loaded ihm - alginate beads , both at a dose equivalent to 5 mg glibenclamide / kg body weight using oral feeding needle . blood samples were withdrawn ( 0.1 ml ) from tail tip of each rat at regular time intervals under mild ether anesthesia and were analyzed for blood glucose by oxidase - peroxidase method using accu - chek sensor comfort ( roche diagnostics , germany ) test strips . statistical optimization was performed using design - expert version 8.0.6.1 software ( stat - ease inc . the in vivo data were tested for significant differences ( p < 0.05 ) by paired samples t - test . all other data was analyzed with simple statistics . the simple statistical analysis and paired samples t - test", "ihm was isolated from ispaghula ( plantago ovata f. ) husk , and the average yield of ihm was found 39.86% w / w . for the 3 factorial design , a total of 9 trial formulations were proposed by design - expert version 8.0.6.1 software . according to this trial proposal , various glibenclamide - loaded ihm - alginate beads were prepared by ionotropic - gelation technique . when various dispersion mixtures containing polymer - blend ( sa and ihm ) and glibenclamide were dropped into the solutions containing calcium ions , gelled glibenclamide - loaded ihm - alginate beads were formed instantaneously due to electrostatic interaction between negatively charged alginate ions and positively charged calcium ions present in the cross - linking solutions . overview of matrix of the design including investigated responses ( dee and r10 h ) was presented in table 1 . the values of dee and r10 h , measured for all trial formulations , were fitted in the 3 factorial design to get model equations . the design - expert version 8.0.6.1 software provided quadratic model equations involving individual main factors and interaction factors for all response parameters . the results of the anova indicated that these models were significant for all response parameters ( table 2 ) . the model equation relating dee ( % ) as response became dee ( % ) = 87.24 5.22x1 2.49x2 0.06x1x2 + 0.41x1 + 0.35x2 ( r = 0.9999 ; f value = 10398.24 ; p < 0.05 ) . the model equation relating r10 h(% ) as response became r10 h ( % ) = 83.94 + 2.37x1 + 0.01x2 + 0.34x1x2 0.13x1 0.23x2 ( r = 0.9981 ; f value = 309.07 ; p < 0.05 ) . model simplification was carried out by eliminating nonsignificant terms ( p > 0.05 ) from previously mentioned model equations , giving dee ( % ) = 87.24 5.22x1 2.49x2 0.06x1x2 + 0.41x1 + 0.35x2 and r10 h(% ) = 83.94 + 2.37x1 + 0.01x2 + 0.34x1x2 0.23x2 . linear correlation plots between the actual , the predicted response variables are presented in figures 1 and 2 , and their corresponding residual plots showing the scatter of the residuals versus predicted values are presented in figures 3 and 4 . the influences of main effects ( factors ) on responses ( here , dee and r10 h ) were further elucidated by response surface methodology . response surface methodology is a widely proficient approach in the development and optimization of drug delivery devices [ 5 , 8 , 28 ] . response surface methodology encompasses the generation of model equations of the investigated responses over the experimental domain to determine optimum formulation ( s ) . the three - dimensional response surface plot is very useful in learning about the main and interaction effects of the independent variables ( factors ) , whereas two - dimensional contour plot gives a visual representation of values of the response . the three - dimensional response surface plot relating dee ( figure 5 ) indicates the increment of dee with the lowering of sa : ihm ( x1 ) and increasing of cacl2 concentration ( x2 ) . however , an increment in r10 h values with the increasing of sa : ihm ( x1 ) and lowering of cacl2 concentration ( x2 ) is indicated by the three - dimensional response surface plot relating r10 h ( figure 6 ) . all the two - dimensional contour plots relating measured responses ( figures 7 and 8) showed nonlinear relationships between independable variables , investigated for this study . numerical optimization technique using the desirability approach was employed to develop optimized formulations with desired response ( optimum quality ) . the desirable ranges of the independable variables ( factors ) were restricted to 1.00 x1 1.50 and 9.50 x2 11.50 , whereas the desirable ranges of responses were restricted to 95.00 dee 100.00% and 60.00 r10 h 65.00% . the optimal values of responses were obtained by numerical analysis using the design - expert version 8.0.6.1 software based on the criterion of desirability . the desirability plot indicating desirable regression ranges for optimal process variable settings was presented in figure 9 , and overlay plot indicating the region of optimal process variable settings was presented in figure 10 . in order to evaluate the optimization capability of these models generated according to the results of 3 factorial design , optimized glibenclamide - loaded ihm - alginate beads were prepared using one of the optimal process variable settings proposed by the design ( prediction r = 1 ) . the selected optimal process variable setting used for the formulation of optimized formulation was x1 = 1.35 and x2 = 10.99 . the optimized beads containing glibenclamide ( f - o ) were evaluated for dee ( % ) and r10 h(% ) . table 3 lists the results of experiments with predicted responses by the mathematical models and those actually observed . the optimized glibenclamide - loaded ihm - alginate beads ( f - o ) showed dee of 94.43 4.80% and r10 h of 65.78 3.44% with small error values ( 0.94 , and 3.69 , resp . ) , indicating that mathematical models obtained from the 3 factorial design were fitted well . the dee ( % ) of all these glibenclamide - loaded ihm - alginate beads was within the range between 68.03 1.77 and 94.43 4.80% w / w ( tables 1 and 3 ) . it was observed that dee ( % ) was increased with the lowering of sa : ihm in polymer - blend , which may be due to increase in viscosity of the polymeric solution by the ihm addition as polymeric - blend with sa . this might have prevented drug leaching to the cross - linking solution and the elevation of cross - linking by cacl2 . again , the dee of these beads was increased with increasing cacl2 concentration in cross - linking solutions , due to the high degree of cross - linking by the concentrated calcium ions . the glibenclamide - loaded ihm - alginate beads prepared using lower cacl2 concentration might have larger pores due to insufficient cross - linking , and drug leaching may occur through the pores that may result in lower drug encapsulation . the average bead size of glibenclamide - loaded ihm - alginate beads was within the range of 0.80 0.06 to 1.47 0.12 mm ( table 4 ) . increase in the average size of beads was found with the increasing incorporation of ihm as a polymer - blend with sa . this could be attributed due to the increase in viscosity of polymer - blend solution with incorporation of ihm in increasing ratio that in turn increased the droplet size of polymer - blend solutions to the cross - linking solutions during preparation . again , the decrease in average size of these formulated ihm - alginate beads was observed , when concentrated cacl2 solution was used for cross - linking , which might be due to shrinkage of polymeric gel by higher degree of cross - linking . the surface morphological analysis of glibenclamide - loaded ihm - alginate beads was visualized by sem and presented in figure 11 . their surface morphologies appeared to have rough with characteristic large wrinkles and cracks , as it was evident from the sem photographs . these cracks and wrinkles might be caused by partly collapsing the polymeric gel network during drying . the ftir spectra of pure glibenclamide , glibenclamide - loaded ihm - alginate beads , and ihm - alginate beads without drug are shown in figure 12 . the ftir spectrum of pure glibenclamide and the principal absorption peaks appeared at 3314 cm due to the nh stretching , 3116 cm for aromatic hydrogen absorption , and a peak at 1717 cm occurs due to c = o absorption peak . in the ftir spectrum of glibenclamide - loaded ihm - alginate beads , this indicates that glibenclamide maintained its identity after formulation of ihm - alginate beads through ionotropic - gelation technique . in both the ftir spectra of glibenclamide - loaded ihm - alginate beads and ihm - alginate beads without drug , the strong and broad absorption band peaks had been observed between 36003200 cm due to oh stretching along with some complex bands in the region 12001030 cm due to c o and c o c stretching vibrations , which are the characteristic of the natural polysaccharides . in addition , absorption bands in the regions 930820 cm and 785730 cm were also observed due to vibrational modes of pyranose rings of polysaccharides . the presence of strong asymmetric stretching absorption band between 1650 cm and 1620 cm and weaker symmetric stretching band near 1420 cm supported the presence carboxylate anion of alginate structure . the ftir analysis confirmed the compatibility of the glibenclamide with sa and ihm used to prepare the glibenclamide - loaded ihm - alginate beads by ionotropic - gelation technique . the in vitro glibenclamide release studies were carried out for glibenclamide - loaded ihm - alginate beads in the 0.1 n hcl ( ph , 1.2 ) for first 2 hours and then in phosphate buffer ( ph , 7.4 ) for next 8 hours . glibenclamide release from these ihm - alginate beads in the acidic ph was found slow due to the shrinkage of alginate at acidic ph . the trace amount of drug release at the initial stage of the dissolution study could probably be due to the surface adhered drug . after that , glibenclamide release was observed faster in phosphate buffer ( ph , 7.4 ) comparatively , due to the higher swelling rate of these beads in phosphate buffer . the cumulative drug released from these formulated beads containing glibenclamide in 10 hours ( r10 h , % ) was within the range of 65.78 3.44% to 92.07 4.05% , and this was found to be higher with the decreasing sa to ihm ratio in the polymer - blend and increasing cacl2 concentration in cross - linking solution . in case of comparatively higher ihm containing beads , the more hydrophilic property of ihm could bond better with water to form viscous gel - structure . this might blockade the pores on the surface of beads and sustain drug release profile . again , the glibenclamide release from ihm - alginate beads prepared using higher cacl2 concentration was comparatively sustained than the beads formulated with that of lower concentration . the higher concentration of cacl2 ( cross - linker ) could produce high degree of cross - linking and thereby slower the drug release from highly cross - linked glibenclamide - loaded ihm - alginate beads . the in vitro drug release data from various glibenclamide - loaded ihm - alginate beads were evaluated kinetically using various mathematical models like zero - order , first - order , higuchi , and korsmeyer - peppas models . the result of the curve fitting ( r ) into various mathematical models is given in table 5 . when the respective r of glibenclamide - loaded ihm - alginate beads was compared , it was found to follow the zero - order model ( r = 0.992 to 0.997 ) over a period of 10 hours . this was also observed to be closest to korsmeyer - peppas model ( r = 0.985 to 0.994 ) . the best fit of zero - order model indicated that the glibenclamide release from these ihm - alginate beads followed controlled - release pattern . the values of diffusional exponent ( n ) determined from korsmeyer - peppas model ranged from 1.025 to 1.115 , indicating the drug release from these glibenclamide - loaded ihm - alginate beads following the super case - ii transport mechanism controlled by swelling and relaxation of polymeric - blend ( sa - ihm ) matrix . this could be attributed due to polymer dissolution and polymeric chain enlargement or relaxation . the ex vivo wash - off behavior of optimized glibenclamide - loaded ihm - alginate beads ( f - o ) using goat intestinal mucosa was found faster in intestinal ph ( 7.4 ) than that in gastric ph ( 1.2 ) . in gastric ph , the percentage of beads adhered onto the goat intestinal mucosal tissue varied from 64.88 5.06% over 10 hours , whereas this was 30.47 3.86% in intestinal ph ( figure 14 ) . thus , the results of the ex vivo wash - off test indicated that the newly developed optimized glibenclamide - loaded ihm - alginate beads had good mucoadhesivity . in alloxan - induced diabetic rats , the comparative in vivo blood glucose level and the mean percentage reduction in blood glucose level after oral administration of pure glibenclamide and optimized glibenclamide - loaded ihm - alginate mucoadhesive beads ( f - o ) are presented in figures 15 and 16 , respectively . in case of the group treated with pure glibenclamide ( group a ) , a rapid reduction in blood glucose level was observed within 2 - 3 hours of administration , and after that , the blood glucose level recovered rapidly towards the normal level . in case of the group ( group b ) treated with optimized glibenclamide - loaded ihm - alginate mucoadhesive beads , the reduction in blood glucose level was found slower than that of the group treated with pure glibenclamide ( group a ) up to 3 hours . significant differences ( p < 0.05 ) were found between the blood glucose levels after administration of pure glibenclamide and optimized glibenclamide - loaded ihm - alginate mucoadhesive beads ( f - o ) at each time point measured . however , the reductions in glucose level were increased gradually with the increment of time in case of group b ( treated with optimized glibenclamide - loaded ihm - alginate mucoadhesive beads ) and were sustained over 10 hours . a 25% reduction in glucose level is considered a significant hypoglycemic effect . therefore , the significant hypoglycemic effect by the optimized glibenclamide - loaded ihm - alginate mucoadhesive beads ( f - o ) was observed over 10 hours .", "in this investigation , glibenclamide - loaded ihm - alginate mucoadhesive beads were successfully developed and optimized . these developed optimized mucoadhesive beads demonstrated high drug encapsulation , good mucoadhesivity with the biological membrane , sustained drug release profile at a controlled rate , and significant antidiabetic activity in alloxan - induced diabetic rats over prolonged period after oral administration . therefore , these glibenclamide - loaded ihm - alginate mucoadhesive beads were found suitable for prolonged systemic absorption of glibenclamide through sustained drug release and mucoadhesive properties after oral administration maintaining tight blood glucose level and improved patient compliance in the management of non - insulin - dependent diabetes mellitus . moreover , the technique for the preparation of these beads was found simple , economical , and consistent . this type of beads can also be exploited for drug delivery of other drugs to improve their bioavailability and therapeutic efficacy ." ]

[ "", "heart failure ( hf ) can result from cardiac overload or injury as well as from a complex interplay of genetic , neurohormonal , and inflammatory factors . hf is classified as being associated with a reduced ejection fraction ( hfref ) or with a normal ejection fraction ( hfnef ) . the percentages of patients and the mortality rates are similar in patients with hfref and hfnef . the likelihood of survival is higher in patients with hfref than in those with hfnef , and the survival rate in hfnef has not significantly improved in recent years . various biomarkers , including those for inflammation and neurohormones , provide important information about the pathogenesis , risk stratification , and diagnosis of hf and are used to monitor response to therapy . inflammatory markers are closely associated with pathogenesis , poor functional state , and adverse prognosis in patients with hf . pentraxin 3 ( ptx3 ) is a newly identified member of the pentraxin superfamily , which includes creactive protein ( crp ) and serum amyloid p. in contrast to crp , which is produced by the liver , ptx3 is produced by various cell types in various tissues , especially in the vasculature , in response to inflammatory stimuli . ptx3 may reflect local inflammatory status in tissues and thus may be a new biomarker of inflammation . we recently demonstrated that plasma levels of ptx3 , but not highsensitivity crp ( hscrp ) , were significantly higher in patients with hfnef than in nonhf patients . in addition , these elevated levels of ptx3 were significantly and independently correlated with the presence of hfnef in patients with normal left ventricular ejection fraction ( lvef ) . other studies have also shown that ptx3 is a predictor of adverse clinical outcome in patients with hfref . although much attention has been focused on hfref , less is known regarding factors that correlate with clinical outcome in patients with hfnef . the irbesartan in heart failure with preserved ejection fraction ( ipreserve ) study demonstrated that age , presence of diabetes mellitus , history of hospitalization for hf , new york heart association classification , nterminal probtype natriuretic peptide levels , and lvef were associated with adverse outcomes in patients with hfnef . this study was designed to determine the ability of plasma ptx3 levels to predict future cardiovascular events in patients with hfnef .", "we initially screened 747 chronic hf patients under a clinically stable condition with new york heart association functional class ii to iv who were referred to kumamoto university hospital , kumamoto , japan . none of the patients had any noncardiac causes of hflike symptoms , especially lung disease ( eg , chronic obstructive lung disease ) . the diagnosis of hfnef was based on the criteria formulated by the european working group on hfnef . hfref was defined as reduced systolic left ventricular ( lv ) function ( lvef50% ) . hfnef was defined as normal or mildly abnormal systolic lv function ( lvef>50% ) with lv diastolic dysfunction . lv diastolic dysfunction for hfnef was defined as ( 1 ) a ratio of mitral early diastolic peak flow velocity to tissue doppler early mitral annular diastolic velocity ( e / e ) 15 ; ( 2 ) e / e 8 and < 15 and btype natriuretic peptide ( bnp ) levels > 200 pg / ml ; or ( 3 ) e / e 8 and < 15 and lv mass index ( lvmi ) 122 g / m ( females ) or 149 g / m ( males ) . patients were excluded if they had active systemic inflammatory disease , chronic renal failure requiring hemodialysis , collagen disease , presence of malignancy , or acute coronary syndrome within 3 months preceding enrollment . the study complied with the declaration of helsinki regarding investigation in humans and was approved by the institutional review committee of each institution . the study was also conducted in accordance with the guidelines of the ethics committee of our institution . this study was registered at the university hospital medical information network clinical trials registry with the identification number umin000002170 . flow chart showing the protocol that was used for enrollment of hfnef patients in the present study . bnp indicates btype natriuretic peptide ; e / e , ratio of mitral early diastolic peak flow velocity to tissue doppler early mitral annular diastolic velocity ; hf , heart failure ; hfnef , hf with normal ejection fraction ; lvef , left ventricular ejection fraction ; lvmi , left ventricular mass index ; nyha , new york heart association . ptx3 levels were measured using a highsensitivity enzymelinked immunosorbent assay system ( values ranged from 0.1 to 20 ng / ml ; perseus proteomics ) . other factors that were measured included serum hscrp levels and plasma tumor necrosis factor , interleukin6 , and bnp levels . echocardiography was performed in standard parasternal and apical views by a specialized echocardiologist using commercially available ultrasound systems ( vivid 7 , gevingmed ultrasound ; aplio xg , toshiba ) . lvef was measured in biplane apical ( 2 and 4chamber ) views using a modification of simpson 's method . the e / e ratio is used as an index of lv filling pressure and abnormal lv relaxation . to assess lv diastolic function , e / e was measured , as described previously , as was the medial annulus of e / e. lv mass was calculated , as described previously , and the lvmi was expressed relative to body surface area . patients with hfnef were followed prospectively at the outpatient clinic until december 2012 or until an endpoint occurred . the endpoint was a composite of cardiovascular death , nonfatal mi , unstable angina pectoris , nonfatal ischemic stroke , hospitalization for hf decompensation , or coronary revascularization . cardiovascular events were ascertained from a review of medical records and confirmed by direct contact with the patients , their families , and physicians . patients were divided into low and highptx3 groups based on the median concentration of ptx3 ( 3.0 ng / ml ) . cardiovascular death was defined as death because of mi ( within 28 days ) , congestive heart failure , or documented sudden death without apparent noncardiovascular causes . mi was diagnosed as a rise or fall in cardiac biomarkers ( plasma creatine kinasemb or cardiac troponint ) greater than the 99th percentile of the upper limit of normal , together with evidence of myocardial ischemia with at least one of the following : ecg changes ( recent stt changes , left bundle branch block , or a pathological q wave ) or imaging evidence of new loss of viable myocardium or new regional wall motion abnormality . unstable angina pectoris was diagnosed from new or accelerating symptoms of myocardial ischemia accompanied by recent ischemic sttwave changes . ischemic stroke was diagnosed by both neurological symptoms and radiological evidence , excluding intracranial hemorrhage . hospitalization for hf decompensation was defined as admission for symptoms typical of hf with objective signs of worsening hf requiring intravenous drug administration . coronary revascularization was defined as coronary artery bypass grafting or percutaneous coronary intervention in patients with stable angina pectoris . for subjects experiencing 2 or more cardiovascular events , parameters with a normal distribution , as assessed by the shapirowilk test , are expressed as meansd . parameters with a skewed distribution , such as ptx3 , hscrp , tumor necrosis factor , interleukin6 , and bnp levels , as well as e / e and lvmi , are shown as median values ( interquartile range ) and were logarithmically transformed before linear regression analysis . differences between continuous variables were analyzed by the unpaired t test and the mannwhitney u test , as appropriate . linear regression analysis was used to determine the associations between ptx3 and bnp levels , lvmi , inflammatory makers , and cardiovascular events . survival data were analyzed by the kaplanmeier method and assessed by the logrank test . age and the ability of any marker to predict cardiovascular events was assessed by cox proportional hazards regression analysis . in cox proportional hazards regression analyses , associations between groups and all other parameters were first analyzed by univariate analysis followed by multivariable analysis after adjustment for factors that were significant with univariate analysis . model 1 incorporated the inflammatory makers ptx3 , hscrp , tumor necrosis factor , interleukin6 , and bnp . model 2 incorporated the 5 prognostic factors ( pf5 ) that were identified during the ipreserve study in patients with hfnef age , presence of diabetes mellitus , previous hospitalization for hf , new york heart association classification , and lvef as well as bnp and ptx3 . model 4 incorporated pf5 , bnp , hscrp , and ptx3 . estimates of the cstatistic for cox proportional hazards regression models were calculated . calibration of cox regression models was also performed by the grnnesby and borgan calibration test . the incremental effects of addition of ptx3 to pf5 and bnp levels to predict future cardiovascular events were evaluated using the net classification index ( nri ) , as previously described . patients were stratified into 1 of 3 risk categories based on pf5 and bnp levels measured during the mean 30month followup period : low risk ( 0% to < 10% ) , intermediate risk ( 10% to 20% ) , or high risk ( > 20% ) . ptx3 was subsequently used to reclassify the risk category for ascertaining whether there would be improvement in the nri . the nri was calculated using the following equation : nri=([number of events reclassified as highernumber of events reclassified as lower]/number of events)([number of nonevents reclassified as lowernumber of nonevents reclassified as higher]/number of nonevents ) . all analyses were performed using spss version 19.0j for windows ( ibm corporation ) , stata version 11 ( stata corporation ) , and sas version 9.1.3 ( sas institute inc ) .", "we initially screened 747 chronic hf patients under a clinically stable condition with new york heart association functional class ii to iv who were referred to kumamoto university hospital , kumamoto , japan . none of the patients had any noncardiac causes of hflike symptoms , especially lung disease ( eg , chronic obstructive lung disease ) . the diagnosis of hfnef was based on the criteria formulated by the european working group on hfnef . hfref was defined as reduced systolic left ventricular ( lv ) function ( lvef50% ) . hfnef was defined as normal or mildly abnormal systolic lv function ( lvef>50% ) with lv diastolic dysfunction . lv diastolic dysfunction for hfnef was defined as ( 1 ) a ratio of mitral early diastolic peak flow velocity to tissue doppler early mitral annular diastolic velocity ( e / e ) 15 ; ( 2 ) e / e 8 and < 15 and btype natriuretic peptide ( bnp ) levels > 200 pg / ml ; or ( 3 ) e / e 8 and < 15 and lv mass index ( lvmi ) 122 g / m ( females ) or 149 g / m ( males ) . patients were excluded if they had active systemic inflammatory disease , chronic renal failure requiring hemodialysis , collagen disease , presence of malignancy , or acute coronary syndrome within 3 months preceding enrollment . the study complied with the declaration of helsinki regarding investigation in humans and was approved by the institutional review committee of each institution . the study was also conducted in accordance with the guidelines of the ethics committee of our institution . this study was registered at the university hospital medical information network clinical trials registry with the identification number umin000002170 . flow chart showing the protocol that was used for enrollment of hfnef patients in the present study . bnp indicates btype natriuretic peptide ; e / e , ratio of mitral early diastolic peak flow velocity to tissue doppler early mitral annular diastolic velocity ; hf , heart failure ; hfnef , hf with normal ejection fraction ; lvef , left ventricular ejection fraction ; lvmi , left ventricular mass index ; nyha , new york heart association .", "ptx3 levels were measured using a highsensitivity enzymelinked immunosorbent assay system ( values ranged from 0.1 to 20 ng / ml ; perseus proteomics ) . other factors that were measured included serum hscrp levels and plasma tumor necrosis factor , interleukin6 , and bnp levels .", "echocardiography was performed in standard parasternal and apical views by a specialized echocardiologist using commercially available ultrasound systems ( vivid 7 , gevingmed ultrasound ; aplio xg , toshiba ) . lvef was measured in biplane apical ( 2 and 4chamber ) views using a modification of simpson 's method . the e / e ratio is used as an index of lv filling pressure and abnormal lv relaxation . to assess lv diastolic function , e / e was measured , as described previously , as was the medial annulus of e / e. lv mass was calculated , as described previously , and the lvmi was expressed relative to body surface area .", "patients with hfnef were followed prospectively at the outpatient clinic until december 2012 or until an endpoint occurred . the endpoint was a composite of cardiovascular death , nonfatal mi , unstable angina pectoris , nonfatal ischemic stroke , hospitalization for hf decompensation , or coronary revascularization . cardiovascular events were ascertained from a review of medical records and confirmed by direct contact with the patients , their families , and physicians . patients were divided into low and highptx3 groups based on the median concentration of ptx3 ( 3.0 ng / ml ) .", "cardiovascular death was defined as death because of mi ( within 28 days ) , congestive heart failure , or documented sudden death without apparent noncardiovascular causes . mi was diagnosed as a rise or fall in cardiac biomarkers ( plasma creatine kinasemb or cardiac troponint ) greater than the 99th percentile of the upper limit of normal , together with evidence of myocardial ischemia with at least one of the following : ecg changes ( recent stt changes , left bundle branch block , or a pathological q wave ) or imaging evidence of new loss of viable myocardium or new regional wall motion abnormality . unstable angina pectoris was diagnosed from new or accelerating symptoms of myocardial ischemia accompanied by recent ischemic sttwave changes . ischemic stroke was diagnosed by both neurological symptoms and radiological evidence , excluding intracranial hemorrhage . hospitalization for hf decompensation was defined as admission for symptoms typical of hf with objective signs of worsening hf requiring intravenous drug administration . coronary revascularization was defined as coronary artery bypass grafting or percutaneous coronary intervention in patients with stable angina pectoris . for subjects experiencing 2 or more cardiovascular events ,", "parameters with a normal distribution , as assessed by the shapirowilk test , are expressed as meansd . parameters with a skewed distribution , such as ptx3 , hscrp , tumor necrosis factor , interleukin6 , and bnp levels , as well as e / e and lvmi , are shown as median values ( interquartile range ) and were logarithmically transformed before linear regression analysis . differences between continuous variables were analyzed by the unpaired t test and the mannwhitney u test , as appropriate . linear regression analysis was used to determine the associations between ptx3 and bnp levels , lvmi , inflammatory makers , and cardiovascular events . the ability of any marker to predict cardiovascular events was assessed by cox proportional hazards regression analysis . in cox proportional hazards regression analyses , associations between groups and all other parameters were first analyzed by univariate analysis followed by multivariable analysis after adjustment for factors that were significant with univariate analysis . model 1 incorporated the inflammatory makers ptx3 , hscrp , tumor necrosis factor , interleukin6 , and bnp . model 2 incorporated the 5 prognostic factors ( pf5 ) that were identified during the ipreserve study in patients with hfnef age , presence of diabetes mellitus , previous hospitalization for hf , new york heart association classification , and lvef as well as bnp and ptx3 . calibration of cox regression models was also performed by the grnnesby and borgan calibration test . the incremental effects of addition of ptx3 to pf5 and bnp levels to predict future cardiovascular events were evaluated using the net classification index ( nri ) , as previously described . patients were stratified into 1 of 3 risk categories based on pf5 and bnp levels measured during the mean 30month followup period : low risk ( 0% to < 10% ) , intermediate risk ( 10% to 20% ) , or high risk ( > 20% ) . ptx3 was subsequently used to reclassify the risk category for ascertaining whether there would be improvement in the nri . the nri was calculated using the following equation : nri=([number of events reclassified as highernumber of events reclassified as lower]/number of events)([number of nonevents reclassified as lowernumber of nonevents reclassified as higher]/number of nonevents ) . all analyses were performed using spss version 19.0j for windows ( ibm corporation ) , stata version 11 ( stata corporation ) , and sas version 9.1.3 ( sas institute inc ) .", "table 1 shows the clinical characteristics of the participating patients . the median ptx3 level was 3.0 ng / ml . mean age , new york heart association class , and bnp levels were higher and mean body mass index , waist circumference and estimated glomerular filtration rate were lower in the highptx3 group ( > 3.0 ng / ml ) than in the lowptx3 group ( 3.0 ng / ml ) . lvmi values were significantly higher in the highptx3 group than in the lowptx3 group , whereas lvef and e / e were similar in these 2 groups . simple linear regression analysis showed a positive and significant correlation between ln(ptx3 ) and ln(bnp ) ( r=0.295 , p<0.001 ) ( figure 2a ) and a significant but weak positive correlation between ln(ptx3 ) and ln(lvmi ) ( r=0.114 , p<0.05 ) ( figure 2b ) . furthermore , simple linear regression analysis showed a significant but weak positive correlation between ln(ptx3 ) and ln(tumor necrosis factor ) ( r=0.106 , p<0.05 ) but not ln(hscrp ) ( p=0.11 ) or ln(interleukin6 ) ( p=0.80 ) . demographic and clinical characteristics of patients with hfnef data are meansd , number of patients ( % ) , or median ( interquartile range ) . acei indicates angiotensinconverting enzyme inhibitors ; arb , angiotensin ii receptor blocker ; bnp , btype natriuretic peptide ; cad , coronary artery disease ; e / e , mitral early diastolic peak flow velocity to tissue doppler early mitral annular diastolic velocity ; gfr , glomerular filtration rate ; hdl , highdensity lipoprotein ; hf , heart failure ; hfnef , heart failure with normal ejection fraction ; hscrp , highsensitive creactive protein ; il6 , interleukin6 ; ldl , lowdensity lipoprotein ; lv , left ventricle ; lvef , left ventricular ejection fraction ; nyha , new york heart association ; ptx3 , pentraxin 3 ; tnf , tumor necrosis factor. relationships between ptx3 and bnp levels and ptx3 levels and lvmi . simple linear regression analysis shows a positive and significant correlation between ( a ) ln(ptx3 ) and ln(bnp ) ( r=0.295 , p<0.001 ) and ( b ) a significant but weak positive correlation between ln(ptx3 ) and ln(lvmi ) ( r=0.114 , p<0.05 ) . bnp indicates btype natriuretic peptide ; lvmi ; left ventricular mass index ; ptx3 , pentraxin 3 . the mean followup period was 30 months ( range : 1 to 59 months ) . during this time , 106 of these patients experienced cardiovascular events , including cardiovascular death ( n=9 ) , nonfatal mi ( n=4 ) , unstable angina pectoris ( n=13 ) , ischemic stroke ( n=9 ) , hospitalization for hf decompensation ( n=41 ) , and coronary revascularization ( n=30 ) . the frequency of cardiovascular events was significantly higher in the highptx3 group ( n=75 ) than in the lowptx3 group ( n=31 , p<0.001 ) ( table 2 ) . hfrelated cardiovascular events , including cardiovascular death and hospitalization for hf decompensation , were significantly higher in the highptx3 group ( n=41 ) than in the lowptx3 group ( n=9 ) ( p<0.001 ) ( table 2 ) . kaplanmeier analysis showed that the probability of cardiovascular events was also significantly higher in the highptx3 group than in the lowptx3 group ( p<0.001 , logrank test ) ( figure 3a ) . cardiovascular events in hfnef patients with low and high plasma ptx3 levels differences between the groups were assessed by the logrank test . hf indicates heart failure ; hfrelated cardiovascular events , cardiovascular death and hospitalization for hf decompensation ; hfnef , heart failure with normal left ventricular ejection fraction ; ptx3 , pentraxin 3 . kaplanmeier analysis for the probability of cardiovascular events . patients with ( a ) high ptx3 levels and low ptx3 levels , ( b ) subgroups of patients with high and low ptx3 levels plus bnp , and ( c ) subgroups of new york heart association class ii patients with high and low ptx3 levels are shown . bnp indicates btype natriuretic peptide ; ptx3 , pentraxin 3 . the combination of ptx3 and bnp levels led to identification of subgroups ( n=116 , highptx3 and bnp group ; n=64 , highptx3 and lowbnp group ; n=64 , lowptx3 and highbnp group ; and n=116 , lowptx3 and bnp group ) with significantly different probabilities of cardiovascular events ( p<0.001 , logrank test ) ( figure 3b ) . in the lowbnp ( p=0.02 ) and highbnp ( p<0.01 ) groups , the probability of cardiovascular events was significantly higher in those with high ptx3 levels than in those with low ptx3 levels . even among patients with mild hf symptoms ( new york heart association class ii ) , the outcomes were poorer in patients with high ptx3 levels than in those with low ptx3 levels ( p<0.001 , logrank test ) ( figure 3c ) . the results of univariate and multivariable cox proportional hazards analyses for cardiovascular events are shown in tables 3 and 4 . multivariable cox proportional hazards analysis identified ptx3 ( hazard ratio [ hr ] : 1.16 ; 95% ci : 1.05 to 1.27 ; p<0.01 ) , highdensity lipoprotein cholesterol ( hr : 0.99 ; 95% ci : 0.97 to 0.99 ; p<0.05 ) , lvmi ( hr : 1.03 ; 95% ci : 1.05 to 1.27 ) , and bnp ( hr : 1.08 ; 95% ci : 1.03 to 1.14 ; p<0.001 ) as predictors of future cardiovascular events after adjustment for significant factors that were identified by univariate analysis ( table 3 ) . using the forced inclusion model , which evaluated levels of inflammatory markers and bnp ( model 1 ) in multivariable cox hazards analysis , ptx3 , but not hscrp , significantly predicted cardiovascular events ( hr : 1.17 ; 95% ci : 1.07 to 1.28 ; p<0.001 ) . in the forced inclusion model , which included pf5 and bnp , ptx3 significantly predicted cardiovascular events ( model 2 : hr : 1.16 ; 95% ci : 1.05 to 1.27 ; p<0.01 ; model 4 : hr : 1.16 ; 95% ci : 1.06 to 1.27 ; p<0.01 ) ( table 4 ) . furthermore , multivariable cox proportional hazards analysis identified ptx3 ( hr : 1.16 ; 95% ci : 1.01 to 1.35 ; p<0.05 ) and bnp ( hr : 1.21 ; 95% ci : 1.11 to 1.31 ; p<0.001 ) as predictors of future hfrelated cardiovascular events , including cardiovascular death and hospitalization for hf decompensation , after adjustment for significant factors identified by univariate analysis . we classified patients with hfnef into 4 groups according to the levels of ln(ptx3 ) : first quartile ( < 0.59 , ptx3 : < 1.80 ng / ml ) , second quartile ( 0.59 to 1.10 , ptx3 : 1.80 to 3.00 ng / ml ) , third quartile ( 1.10 to 1.35 , ptx3 : 3.00 to 3.85 ng / ml ) , and fourth quartile ( > 1.35 , ptx3 : > 3.85 ng / ml ) ; the relative risk of total cardiovascular events was 1 ( reference ) , 1.36 , 2.71 ( p<0.001 versus the reference ) , and 3.17 ( p<0.001 versus the reference ) , respectively . the logtransformation values of ptx3 demonstrated a linear association with the occurrence of cardiovascular events in patients with hfnef ( r=0.965 , p=0.03 ) . cox proportional hazards analysis of factors that were predictive of future cardiovascular events in patients with hfnef after adjustment for significant factors identified by univariate analysis bnp indicates btype natriuretic peptide ; cad , coronary artery disease ; e / e , mitral early diastolic peak flow velocity to tissue doppler early mitral annular diastolic velocity ; gfr , glomerular filtration rate ; hdl , highdensity lipoprotein ; hf , heart failure ; hfnef , heart failure with normal ejection fraction ; hr , hazard ratio ; hscrp , highsensitivity creactive protein ; il6 , interleukin6 ; ldl , lowdensity lipoprotein ; lvef , left ventricular ejection fraction ; nyha , new york heart association ; ptx3 , pentraxin 3 ; tnf , tumor necrosis factor. cox proportional hazards analysis of factors that were associated with future cardiovascular events in hfnef patients using forced inclusion models bnp indicates btype natriuretic peptide ; ci , confidence interval ; hf , heart failure ; hfnef , heart failure with normal ejection fraction ; hr , hazard ratio ; hscrp , highsensitive creactive protein ; il6 , interleukin6 ; lvef , left ventricular ejection fraction ; nyha , new york heart association ; ptx3 , pentraxin 3 ; tnf , tumor necrosis factor. we also estimated the cstatistics of pf5 alone . separate incorporation of ptx3 and bnp into pf5 increased the cstatistics for the prediction of future cardiovascular events from 0.617 for pf5 alone to 0.656 for pf5 plus ptx3 and pf5 plus bnp ( table 5 ) . moreover , incorporation of ptx3 and bnp into pf5 increased the cstatistics to 0.683 ( p<0.05 ) . in addition , the pf5 plus bnp plus ptx3 model performed better than the pf5 plus bnp model ( cstatistics : 0.683 versus 0.656 ) . we also confirmed good calibration for the analysis by grnnesby and borgan statistics ( p=0.19 ) . cstatistics for cox proportional hazards analysis predicting future cardiovascular events in patients with heart failure with normal ejection fraction bnp indicates btype natriuretic peptide ; pf5 , the 5 factors identified in the ipreserve study as prognostic in patients with heart failure with normal ejection fraction ( age , presence of diabetes mellitus , previous hospitalization for heart failure , new york heart association classification , and left ventricular ejection fraction ) ; ptx3 , pentraxin 3 . the nri was significant after ptx3 was included : 12.2% for patients without cardiovascular events , 0% for those with cardiovascular events , and 12.2% overall ( p<0.01 ) ( table 6 ) . reclassification of the risk of pf5 and bnp for cardiovascular events after the addition of ptx3 bnp indicates btype natriuretic peptide ; pf5 , the 5 factors identified in the ipreserve study as prognostic in patients with heart failure with normal ejection fraction ( age , presence of diabetes mellitus , previous hospitalization for heart failure , new york heart association classification , and left ventricular ejection fraction ) ; ptx3 , pentraxin 3 .", "table 1 shows the clinical characteristics of the participating patients . the median ptx3 level was 3.0 ng / ml . mean age , new york heart association class , and bnp levels were higher and mean body mass index , waist circumference and estimated glomerular filtration rate were lower in the highptx3 group ( > 3.0 ng / ml ) than in the lowptx3 group ( 3.0 ng / ml ) . lvmi values were significantly higher in the highptx3 group than in the lowptx3 group , whereas lvef and e / e were similar in these 2 groups . simple linear regression analysis showed a positive and significant correlation between ln(ptx3 ) and ln(bnp ) ( r=0.295 , p<0.001 ) ( figure 2a ) and a significant but weak positive correlation between ln(ptx3 ) and ln(lvmi ) ( r=0.114 , p<0.05 ) ( figure 2b ) . furthermore , simple linear regression analysis showed a significant but weak positive correlation between ln(ptx3 ) and ln(tumor necrosis factor ) ( r=0.106 , p<0.05 ) but not ln(hscrp ) ( p=0.11 ) or ln(interleukin6 ) ( p=0.80 ) . demographic and clinical characteristics of patients with hfnef data are meansd , number of patients ( % ) , or median ( interquartile range ) . acei indicates angiotensinconverting enzyme inhibitors ; arb , angiotensin ii receptor blocker ; bnp , btype natriuretic peptide ; cad , coronary artery disease ; e / e , mitral early diastolic peak flow velocity to tissue doppler early mitral annular diastolic velocity ; gfr , glomerular filtration rate ; hdl , highdensity lipoprotein ; hf , heart failure ; hfnef , heart failure with normal ejection fraction ; hscrp , highsensitive creactive protein ; il6 , interleukin6 ; ldl , lowdensity lipoprotein ; lv , left ventricle ; lvef , left ventricular ejection fraction ; nyha , new york heart association ; ptx3 , pentraxin 3 ; tnf , tumor necrosis factor. relationships between ptx3 and bnp levels and ptx3 levels and lvmi . simple linear regression analysis shows a positive and significant correlation between ( a ) ln(ptx3 ) and ln(bnp ) ( r=0.295 , p<0.001 ) and ( b ) a significant but weak positive correlation between ln(ptx3 ) and ln(lvmi ) ( r=0.114 , p<0.05 ) . bnp indicates btype natriuretic peptide ; lvmi ; left ventricular mass index ; ptx3 , pentraxin 3 .", "the mean followup period was 30 months ( range : 1 to 59 months ) . during this time , 106 of these patients experienced cardiovascular events , including cardiovascular death ( n=9 ) , nonfatal mi ( n=4 ) , unstable angina pectoris ( n=13 ) , ischemic stroke ( n=9 ) , hospitalization for hf decompensation ( n=41 ) , and coronary revascularization ( n=30 ) . the frequency of cardiovascular events was significantly higher in the highptx3 group ( n=75 ) than in the lowptx3 group ( n=31 , p<0.001 ) ( table 2 ) . hfrelated cardiovascular events , including cardiovascular death and hospitalization for hf decompensation , were significantly higher in the highptx3 group ( n=41 ) than in the lowptx3 group ( n=9 ) ( p<0.001 ) ( table 2 ) . kaplanmeier analysis showed that the probability of cardiovascular events was also significantly higher in the highptx3 group than in the lowptx3 group ( p<0.001 , logrank test ) ( figure 3a ) . cardiovascular events in hfnef patients with low and high plasma ptx3 levels differences between the groups were assessed by the logrank test . hf indicates heart failure ; hfrelated cardiovascular events , cardiovascular death and hospitalization for hf decompensation ; hfnef , heart failure with normal left ventricular ejection fraction ; ptx3 , pentraxin 3 . patients with ( a ) high ptx3 levels and low ptx3 levels , ( b ) subgroups of patients with high and low ptx3 levels plus bnp , and ( c ) subgroups of new york heart association class ii patients with high and low ptx3 levels are shown . the combination of ptx3 and bnp levels led to identification of subgroups ( n=116 , highptx3 and bnp group ; n=64 , highptx3 and lowbnp group ; n=64 , lowptx3 and highbnp group ; and n=116 , lowptx3 and bnp group ) with significantly different probabilities of cardiovascular events ( p<0.001 , logrank test ) ( figure 3b ) . in the lowbnp ( p=0.02 ) and highbnp ( p<0.01 ) groups , the probability of cardiovascular events was significantly higher in those with high ptx3 levels than in those with low ptx3 levels . even among patients with mild hf symptoms ( new york heart association class ii ) , the outcomes were poorer in patients with high ptx3 levels than in those with low ptx3 levels ( p<0.001 , logrank test ) ( figure 3c ) .", "the results of univariate and multivariable cox proportional hazards analyses for cardiovascular events are shown in tables 3 and 4 . multivariable cox proportional hazards analysis identified ptx3 ( hazard ratio [ hr ] : 1.16 ; 95% ci : 1.05 to 1.27 ; p<0.01 ) , highdensity lipoprotein cholesterol ( hr : 0.99 ; 95% ci : 0.97 to 0.99 ; p<0.05 ) , lvmi ( hr : 1.03 ; 95% ci : 1.05 to 1.27 ) , and bnp ( hr : 1.08 ; 95% ci : 1.03 to 1.14 ; p<0.001 ) as predictors of future cardiovascular events after adjustment for significant factors that were identified by univariate analysis ( table 3 ) . using the forced inclusion model , which evaluated levels of inflammatory markers and bnp ( model 1 ) in multivariable cox hazards analysis , ptx3 , but not hscrp , significantly predicted cardiovascular events ( hr : 1.17 ; 95% ci : 1.07 to 1.28 ; p<0.001 ) . in the forced inclusion model , which included pf5 and bnp , ptx3 significantly predicted cardiovascular events ( model 2 : hr : 1.16 ; 95% ci : 1.05 to 1.27 ; p<0.01 ; model 4 : hr : 1.16 ; 95% ci : 1.06 to 1.27 ; p<0.01 ) ( table 4 ) . furthermore , multivariable cox proportional hazards analysis identified ptx3 ( hr : 1.16 ; 95% ci : 1.01 to 1.35 ; p<0.05 ) and bnp ( hr : 1.21 ; 95% ci : 1.11 to 1.31 ; p<0.001 ) as predictors of future hfrelated cardiovascular events , including cardiovascular death and hospitalization for hf decompensation , after adjustment for significant factors identified by univariate analysis . we classified patients with hfnef into 4 groups according to the levels of ln(ptx3 ) : first quartile ( < 0.59 , ptx3 : < 1.80 ng / ml ) , second quartile ( 0.59 to 1.10 , ptx3 : 1.80 to 3.00 ng / ml ) , third quartile ( 1.10 to 1.35 , ptx3 : 3.00 to 3.85 ng / ml ) , and fourth quartile ( > 1.35 , ptx3 : > 3.85 ng / ml ) ; the relative risk of total cardiovascular events was 1 ( reference ) , 1.36 , 2.71 ( p<0.001 versus the reference ) , and 3.17 ( p<0.001 versus the reference ) , respectively . the logtransformation values of ptx3 demonstrated a linear association with the occurrence of cardiovascular events in patients with hfnef ( r=0.965 , p=0.03 ) . cox proportional hazards analysis of factors that were predictive of future cardiovascular events in patients with hfnef after adjustment for significant factors identified by univariate analysis bnp indicates btype natriuretic peptide ; cad , coronary artery disease ; e / e , mitral early diastolic peak flow velocity to tissue doppler early mitral annular diastolic velocity ; gfr , glomerular filtration rate ; hdl , highdensity lipoprotein ; hf , heart failure ; hfnef , heart failure with normal ejection fraction ; hr , hazard ratio ; hscrp , highsensitivity creactive protein ; il6 , interleukin6 ; ldl , lowdensity lipoprotein ; lvef , left ventricular ejection fraction ; nyha , new york heart association ; ptx3 , pentraxin 3 ; tnf , tumor necrosis factor. cox proportional hazards analysis of factors that were associated with future cardiovascular events in hfnef patients using forced inclusion models bnp indicates btype natriuretic peptide ; ci , confidence interval ; hf , heart failure ; hfnef , heart failure with normal ejection fraction ; hr , hazard ratio ; hscrp , highsensitive creactive protein ; il6 , interleukin6 ; lvef , left ventricular ejection fraction ; nyha , new york heart association ; ptx3 , pentraxin 3 ; tnf , tumor necrosis factor. we also estimated the cstatistics of pf5 alone . separate incorporation of ptx3 and bnp into pf5 increased the cstatistics for the prediction of future cardiovascular events from 0.617 for pf5 alone to 0.656 for pf5 plus ptx3 and pf5 plus bnp ( table 5 ) . moreover , incorporation of ptx3 and bnp into pf5 increased the cstatistics to 0.683 ( p<0.05 ) . in addition , the pf5 plus bnp plus ptx3 model performed better than the pf5 plus bnp model ( cstatistics : 0.683 versus 0.656 ) . we also confirmed good calibration for the analysis by grnnesby and borgan statistics ( p=0.19 ) . cstatistics for cox proportional hazards analysis predicting future cardiovascular events in patients with heart failure with normal ejection fraction bnp indicates btype natriuretic peptide ; pf5 , the 5 factors identified in the ipreserve study as prognostic in patients with heart failure with normal ejection fraction ( age , presence of diabetes mellitus , previous hospitalization for heart failure , new york heart association classification , and left ventricular ejection fraction ) ; ptx3 , pentraxin 3 .", "the nri was significant after ptx3 was included : 12.2% for patients without cardiovascular events , 0% for those with cardiovascular events , and 12.2% overall ( p<0.01 ) ( table 6 ) . reclassification of the risk of pf5 and bnp for cardiovascular events after the addition of ptx3 bnp indicates btype natriuretic peptide ; pf5 , the 5 factors identified in the ipreserve study as prognostic in patients with heart failure with normal ejection fraction ( age , presence of diabetes mellitus , previous hospitalization for heart failure , new york heart association classification , and left ventricular ejection fraction ) ; ptx3 , pentraxin 3 .", "to the best of our knowledge , this report is the first to show a significant association between plasma levels of ptx3 , a marker of inflammation , and adverse cardiovascular outcomes in patients with hfnef . the addition of high ptx3 levels to the pf5 and bnp levels , which were previously found to be prognostic in patients with hfnef , improved their risk stratification , as indicated by a substantial increase in the cstatistics and significance of nri . activation of the inflammatory process is important in the pathogenesis of hf and in adverse prognosis of patients with this condition . several studies have investigated the role of inflammation as a therapeutic target , although initial trials had limited success . consequently , specific antiinflammatory approaches for the different types and stages of hf ( ie , hfnef and hfref ) remain a priority , as does a better understanding of the mechanisms underlying hfrelated inflammation . the established inflammatory marker hscrp is an independent predictor of morbidity and mortality in patients with hf . elevated crp levels predict hospitalization of hf patients , although the association between crp and hf events is no longer significant after adjustment for the presence of lv diastolic dysfunction . consequently , the relationships between inflammatory markers and the prognosis of patients with hfnef remain unclear . , remodeling is driven by the loss of cardiomyocytes , whereas in hfnef , a systemic inflammatory state induces oxidative stress in the coronary microvascular endothelium , which drives myocardial dysfunction and remodeling . other studies have shown that serum levels of inflammatory cytokines are high in patients with hfnef and that interleukin16 , a cytokine considered an important mediator in inflammation , promotes cardiac fibrosis and myocardial stiffening in hfnef . consequently , investigating the relationships between inflammatory markers and prognosis in hfnef is important . we observed a significant correlation between plasma levels of ptx3 , a novel inflammatory maker , and future cardiovascular events in patients with hfnef . furthermore , considerable evidence suggests that ptx3 may better reflect local inflammatory status in tissues than does liverderived crp . we previously reported that ptx3 was partly produced in the coronary circulation in patients with hfnef . these results suggest that ptx3 , rather than crp , reflects vascular and cardiac inflammation in patients with hfnef and might be a cardiovascular biomarker for the assessment and management of hf . in the present study , we showed that increased inflammation as assessed by ptx3 measurement was significantly associated with poor prognosis for hfnef patients by multivariable cox hazards analysis . ptx3 as an inflammation maker and bnp as a myocardial stress marker to the previously established prognostic factors in the ipreserve study of hfnef patients improved their risk stratification performance , as indicated by an increase in the cstatistics . these results suggest the possible relative merits of these 2 biomarkers for future risk management in hfnef . in nri analyses , the addition of ptx3 was able to provide a more appropriate risk assessment in patients who were evaluated as having a high risk state by previously described hfnef prognostic factors ( pf5 plus bnp ) in patients without cardiovascular events . furthermore , the addition of ptx3 never resulted in a worse risk classification in patients with cardiovascular events . consequently , the significance of nri was shown by incorporating ptx3 into the new riskassessment model . the site of ptx3 production in patients with hfnef remains unclear . under normal physiological conditions , ptx3 is expressed in atherosclerotic lesions , adipose tissue , and the heart with acute and subacutephase hf ; however , the types of cells that express ptx3 in failing hearts of patients with hfnef and chronic hf have not been determined . accumulation of the extracellular matrix ( ie , fibrosis ) may also be pathophysiologically important in progression of the hfnef disease process and be a contributor to subsequent events . hfnef may also be caused by structural and molecular abnormalities of the cardiovascular system , including cardiac and noncardiac factors , such as those associated with vascular functions . we recently demonstrated significant involvement of endothelial dysfunction in the prognosis of patients with hfnef , suggesting that improvement in endothelial function could be a potential therapeutic target in patients with hfnef . ptx3 is produced by fibrous tissues and endothelial cells in response to inflammatory stimuli and is considered an important marker of vascular pathology . in patients with acute mi and infectious myocarditis , ptx3 is produced by macrophages , endothelial cells , and , to a lesser extent , myocardiocytes and is localized in the interstitium . the interstitial localization of ptx3 in human failing hearts suggests that ptx3 is produced locally by fibroblasts in the cardiac interstitium . consequently , in patients with hfnef , ptx3 might be produced by myocardial fibroblasts and/or endothelial cells rather than in subclinical atherosclerotic lesions in patients with hfnef . we found that the frequency of hfrelated cardiovascular events , including cardiovascular death and hospitalization for hf decompensation , was significantly higher in patients with high ptx3 levels than in those with low ptx3 levels . this finding suggests that ptx3 is more predictive of future hfrelated cardiovascular events than of vascular events in patients with hfnef . we used the median value of ptx3 ( 3.0 ng / ml ) as the cutoff point in the present study . suzuki et al demonstrated that the median value of ptx3 was 3.7 ng / ml in patients with hfref and split the patients into 2 groups : those above and those below 4.0 ng / ml . in this study , patients with hfref were targeted , and it has already been demonstrated that patients with hfref have higher inflammatory activity than those with hfnef . we previously demonstrated that the 75% range value of ptx3 was 2.90 ng / ml in nonhf patients with risk factors ( hypertension , 67.8% ; diabetes mellitus , 37.4% ; dyslipidemia , 57.1% ; and coronary artery disease , 55.0% ) . furthermore , inoue et al showed that ptx3 levels were < 2.28 ng / ml in healthy volunteers . in previous studies of cardiovascular events in stable patients with coronary risk factors , thus , we consider that the median value of 3.0 ng / ml for ptx3 was a clinically meaningful cutoff point in our study . first , our study included only a relatively small number of patients in a single center . second , the population of this study was relatively young and predominantly male ; had a low prevalence of atrial fibrillation , a higher frequency of mild hf , relatively lower bnp levels ; and had less frequent use of diuretics . because our institution is an educational hospital and the design was a singlecenter study in japan , the recruited patients with hfnef might have had differences in characteristics compared with those in western studies . consequently , a large , multiracial , multicenter study is required to confirm our results . recent studies in mouse models have shown that ptx3 has a cardioprotective effect , suggesting that ptx3 might protect the cardiovascular system by modulating the immune inflammatory balance . further in vivo and in vitro experiments are required to determine the exact role of high ptx3 levels in hfnef . despite these limitations , a largescale multicenter trial is warranted to further examine the pathological role and clinical significance of ptx3 in hfnef .", "high plasma ptx3 levels , but not other inflammatory markers including hscrp , are significantly correlated with future cardiovascular events in patients with hfnef .", "we are grateful to megumi nagahiro and saeko tokunaga of the department of cardiovascular medicine , faculty of life sciences , kumamoto university , kumamoto , japan , for their skillful technical assistance ." ]

[ "muscle morphological characteristics , such as anatomical muscle cross - sectional area ( csa ) , \n muscle length , and muscle volume ( mv ) are important physiological variables for assessing \n the functional capacity of a muscle . although magnetic resonance imaging ( mri ) and computed \n tomography scans are the gold standard for measuring anatomical csa and mv , ultrasound is a \n utilizable technique that can be easily applied to clinical assessment and field \n surveys1 . in a small muscle , anatomical \n csa and mv can be measured using multiple images of individual muscles created by portable \n ultrasound . one study2 investigated the \n validity and reliability of mv measurements of the medial gastrocnemius using \n three - dimensional ultrasound , and reported that ultrasound overestimated mv by approximately \n 2 ml ( 1.1% ) and underestimated muscle length by 3 mm ( 1.3% ) across all joint angles compared \n to mri - measured values . in addition , the same study reported excellent reliability for \n repeated measures of mv ( intrarater correlation coefficient ( icc ) = 0.99 ) and muscle length \n ( icc = 0.97 ) . these results suggest that multiple ultrasound images of a small muscle can \n accurately measure muscle morphological variables . the foot is the point of direct contact between the body and ground surface during standing \n and walking . muscle forces generated by the toes and ankles may play an important role in \n maintaining balance because muscle strength is essential for posture and stability3 , 4 . a \n few studies have reported that toe flexor muscle strength is associated with postural \n control . for example , handa et al.5 \n reported significant positive correlations between toe flexor strength and one - leg standing \n balance with the eyes open ( r = 0.443 , p < 0.01 ) as well as functional reach ( r = 0.620 , \n p < 0.01 ) , in an analysis grouping men and women together . kurihara et al.6 examined the relationships between toe \n flexor muscle strength and intrinsic and extrinsic foot muscle sizes in young men and women \n and found significant correlations between toe flexor muscle strength and mri - measured \n anatomical csa in the medial parts ( r = 0.775 , p < 0.01 ) and lateral parts ( r = 0.739 , p \n < 0.01 ) of foot intrinsic muscles . recently , abe et al.7 reported a significant positive association between toe flexor \n muscle strength and accelerometer - determined light and moderate physical activities and \n average step counts . the results of these previous studies suggest that bigger intrinsic \n foot muscles in active individuals may be associated with greater toe flexor strength as \n well as good postural control . in a previous mri study6 , however , only one mri image was used to determine the anatomical \n csa of individual intrinsic foot muscles , even though the foot has several toe flexor \n muscles with differing distributions among the toes . therefore , the purpose of this study \n was to test the hypothesis that toe flexor muscle strength is related to the anatomical and \n physiological csa of intrinsic toe flexor muscles and that these morphological and \n functional variables associate with physical performance .", "thirty - four young adults aged 20 to 35 years ( 17 men and 17 women ) were recruited through \n printed advertisements and by word of mouth . before accepting their informed consent , a \n written description of the purpose and safety of the study was distributed to all of the \n potential subjects . all subjects were healthy and free of overt chronic disease ( e.g. , \n neuromuscular disorders , arthritic disorders , etc ) as assessed by self - report . the rate of \n regular sports activity ( at least twice a week ) , among the subjects was 65% ( 82% in men and \n 47% in women ) . the main types of sports activities were judo ( 29% ) , resistance exercise \n ( 21% ) , and soccer ( 21% ) for men , and jogging / running ( 50% ) and canoeing ( 25% ) for women . the \n study was conducted in accordance with the principles of the declaration of helsinki and was \n approved by the ethics committee for human experiments of the national institute of fitness \n and sports in kanoya , japan . anatomical csa was measured using b - mode ultrasound ( aloka prosound 6 , tokyo , japan ) with \n a 7.5 mhz linear array transducer ( 76 mm wide ) in two intrinsic toe flexor muscles , the \n flexor digitorum brevis ( fdb ) and abductor hallucis ( abh ) , as described previously8 . all subjects lay in the prone position \n during scanning of the two muscles . using anatomic landmarks described by crofts et al.8 , a linear transducer coated with \n water - soluble transmission gel was placed on the skin surface of the measurement sites , and \n cross sections of each muscle were imaged . ultrasound images of each site were stored on a \n personal computer , and anatomical csa was measured using image - j software . the mean values \n ( two images ) of each site were used for data analysis . all ultrasound measurements were \n performed on the left ( non - dominant ) foot , and dominance was ascertained by asking each \n subject which foot they used to perform well - learned skills using a questionnaire9 . the muscle volume and muscle length of the fdb were estimated using multiple ultrasound \n images from the sole of the foot . after foot length ( the distance between the tip of the \n great toe and the edge of the heel ) measurements , all measurement sites were marked at 50% \n of the foot length as well as at contiguous 1-cm intervals from the point of 50% of the foot \n length in both the proximal and distal directions . 1.before the start of ultrasound testing , foot length ( the distance between the tip of \n the great toe and the edge of the heel ) was measured and then all measurement sites \n were marked at 50% of the foot length as well as at contiguous 1-cm intervals from the \n point of 50% of the foot length in both the proximal and distal directions . typical \n ultrasound images ( young woman , 20 yr ) revealing transverse scans of the foot at \n contiguous 1-cm intervals from the point of 50% of the foot lengthfdb : flexor digitorum brevis ) and the anatomical csa of the fdb was measured using the procedure described above . \n muscle volume was calculated by multiplying anatomical csa by distance interval ( 1 cm ) . the \n distance between the most proximal image and the most distal image in which the fdb was \n visible was defined as the length of the fdb muscle . to calculate physiological csa , the \n fiber length of the fdb was estimated using the ratio of fiber length to muscle length \n ( average of the second , third , fourth toes ) as reported by kura et al10 . the physiological csa of the fdb was calculated by \n dividing muscle volume by fiber length . the test - retest reliability ( icc , sem and minimal \n difference ) was previously determined using the data of 7 young subjects ( 5 men and 2 women ) \n scanned twice within 7 days ( at least one day apart ) for anatomical csa of the fdb ( 0.924 , \n 0.13 cm , 0.36 cm ) and abh ( 0.949 , 0.21 cm , \n 0.58 cm ) and muscle volume of fdb ( 0.971 , 0.57 cm , \n 1.57 cm ) . before the start of ultrasound testing , foot length ( the distance between the tip of \n the great toe and the edge of the heel ) was measured and then all measurement sites \n were marked at 50% of the foot length as well as at contiguous 1-cm intervals from the \n point of 50% of the foot length in both the proximal and distal directions . typical \n ultrasound images ( young woman , 20 yr ) revealing transverse scans of the foot at \n contiguous 1-cm intervals from the point of 50% of the foot length fdb : flexor digitorum brevis toe flexor muscle strength ( tfs ) was measured using a toe - grasp dynamometer ( tkk3361 , \n takei , tokyo , japan ) , as described previously11 , \n 12 . while barefoot , subjects stood in \n front of a wall and the left foot then the subjects were \n instructed to lift the right foot and maintain a one - legged upright standing position on the \n dynamometer , with both hands on the wall in front of them , while holding the dynamometer \n grasp bar with their toes . the distance between the bar and the heel was adjusted to the \n foot size of the subjects so that the distal phalanges of the great toe and fifth toe and \n the middle phalanges of the second to fifth toes could be placed on the toe grasp bar . \n subjects were allowed to perform one test trial , followed by two maximum effort trials \n ( tfs-5-toes ) , and the best value of the left foot was used for the data analysis . the \n subjects also performed two maximum effort trials to measure toe flexor muscle strength \n without the contribution of the great toe ( tfs-4-toes ) . in these trials , a small metal plate \n was placed between the great toe and the toe grasp bar during these measurements for \n preventing the great toe from grasping the toe grasp bar of the dynamometer . maximal toe \n flexor strength divided by body weight was calculated to evaluate the relative toe flexor \n strength . the test - retest reliability of toe flexor strength ( tfs-5-toes and tfs-4-toes ) \n measurements using the icc , sem and minimal difference was previously determined using the \n data of 7 young subjects ( 5 men and 2 women ) tested twice within 7 days ( at least one day \n apart ) : 0.962 , 1.2 kg and 3.3 kg for tfs-5-toes and 0.883 , 1.1 kg and 3.1 kg for \n tfs-4-toes . maximum walking speed was measured by timing each subject as they walked along a 10-meter \n corridor with a ceramic floor surface . the total length of the marked corridor was 14 \n meters , allowing 2-meter acceleration and deceleration zones . the width of the corridor was \n constricted to 1 meter to encourage subjects to maintain a straight course . subjects used \n their own footwear and had to start 2 meters before the beginning of the start line , and to \n continue until the 2 meters past the goal line . after one practice trial , subjects performed \n two maximum speed timed trials . subjects were asked to walk down the corridor as fast as \n possible without running . times were measured with an electronic timing system ( nearest \n 0.01 s , brower timing system , draper , usa ) . the best time was converted to a maximum speed \n measurement ( unit , m / s ) and the best value was used as the maximum walking speed . the \n test - retest reliability of this measurement using the icc , sem and minimal difference was \n previously determined using the procedure described above : 0.930 , 0.14 the functional reach test was measured using the method described in a previously reported \n study4 . before the start of the test , \n subjects were instructed to stand with both feet touching a marked line and to maintain that \n foot position throughout testing . the subject then performed shoulder forward flexion with \n the right shoulder until an angle of 90 degrees was reached . next , the subjects tried to extend their middle finger as \n far forward as possible without moving their feet and keeping their arm parallel to the \n ground . the distance moved by the end of the middle finger between the starting position and \n maximum forward position subjects performed two trials , and the best value was used \n for the functional reach test . the test - retest reliability of this measurement using the \n icc , sem and minimal difference was previously determined fusing the procedure described \n above : 0.889 , 2 cm and 5 cm , respectively . before \n comparisons were made , the distributions of the dependent variables were tested for \n normality using the shapiro - wilk test . the difference between men and women was tested for \n significance using the unpaired student s t - test , and when variables were not normally \n distributed , the mann - whitney u test was used . pearson product correlations were performed \n to determine the relationships between toe flexor muscle strength and intrinsic toe flexor \n muscle size as measured by ultrasound and between the morphological and functional variables \n of toe flexor muscle and physical performance .", "men were taller and heavier than women . compared with \n women , men had higher anatomical csa in the fdb and abh , as well as muscle volume and \n physiological csa of the fdb . maximum tfs-5-toes and tfs-4-toes were higher in men than in \n women ; however , the specific strength ( tfs-4-toes per unit physiological csa ) of the fdb , \n walking speed and functional reach were similar for both men and women ( table 1table 1.maximum toe flexor muscle strength , physical performance and ultrasound \n measurements of intrinsic foot muscle sizes of young men and womenmenwomenoverall(n=17)(n=17)(n=34)age ( yrs)24 ( 4)24 ( 4)24 ( 4)height ( m)1.71 ( 0.05)*1.60 ( 0.05)1.66 ( 0.07)body mass ( kg)72.9 ( 11.4)*52.1 ( 5.1)62.5 ( 13.6)body mass index ( kg / m)24.8 ( 3.1)*20.4 ( 2.0)22.6 ( 3.4)foot length ( cm)25.2 ( 1.2)*22.6 ( 0.7)23.9 ( 1.6)flexor digitorum brevisacsa max ( cm)2.61 ( 0.38)*1.65 ( 0.33)2.13 ( 0.60)mv ( cm)11.95 ( 2.93)*6.66 ( 2.10)9.31 ( 3.67)pcsa ( cm)6.38 ( 1.04)*3.95 ( 0.97)5.17 ( 1.58)abductor hallucisacsa ( cm)2.89 ( 0.69)*2.02 ( 0.59)2.46 ( 0.77)tfs-5 toes ( kg)29.1 ( 5.3)*21.2 ( 4.7)25.1 ( 6.4)tfs-4 toes ( kg)10.4 ( 3.2)*6.4 ( 2.6)8.4 ( 3.5)tfs-4 toes / pcsa ( kg / cm)1.63 ( 0.40)1.62 ( 0.56)1.63 ( 0.48)walking speed ( m / s)3.19 ( 0.65)3.14 ( 0.66)3.17 ( 0.64)functional reach ( cm)38.1 ( 6.3)39.1 ( 4.0)38.6 ( 5.2)maximum toe flexor muscle strength with ( tfs-5 toes ) and without ( tfs-4 toes ) the \n contribution of the great toe ; acsa , anatomical cross - sectional area ; mv , muscle \n volume ; pcsa , physiological cross - sectional area . * maximum toe flexor muscle strength with ( tfs-5 toes ) and without ( tfs-4 toes ) the \n contribution of the great toe ; acsa , anatomical cross - sectional area ; mv , muscle \n volume ; pcsa , physiological cross - sectional area . * significant difference from women , p<0.001 there was a significant correlation between tfs-5-toes and tfs-4-toes of men ( r = 0.739 , p \n < 0.001 ) and women ( r = 0.731 , p < 0.001 ) . both tfs-5-toes and tfs-4-toes correlated \n positively with the maximum walking speed of men ( r = 0.584 , p = 0.014 and r = 0.553 , p = \n 0.021 , respectively ) , women ( r = 0.748 , p < 0.001 and r = 0.533 , p = 0.028 , respectively ) \n and the whole sample ( r = 0.535 , p = 0.001 and r = 0.459 , p = 0.006 , respectively ) . however , \n the correlations between tfs-5-toes and functional reach of both men ( r = 0.399 ) and women \n ( r = 0.166 ) were not significant ( p>0.05 ) . anatomical csa of the abh did not significantly correlate with tfs-5-toes of either men ( r \n = 0.034 , p = 0.896 ) or women ( r = 0.387 , p = 0.125 ) ; however , the correlation of the whole \n sample was significant ( r = 0.454 , p = 0.006 ) . for women , there were significant positive \n correlations between tfs-5-toes and anatomical csa max ( r = 0.713 , p = 0.001 ) , muscle volume \n ( r = 0.604 , p = 0.010 ) , and physiological csa ( r = 0.687 , p = 0.002 ) of the fdb . for men , \n however , the observed anatomical csa max ( r = 0.143 , p = 0.584 ) , muscle volume ( r = 0.332 , p \n = 0.192 ) , and physiological csa ( r = 0.333 , p = 0.191 ) of the fdb did not correlate \n significantly with tfs-5-toes . physiological csa of the fdb correlated positively with \n tfs-4-toes of men ( r = 0.541 , p = 0.025 ) , women ( r = 0.573 , p = 0.016 ) and the whole sample \n ( r = 0.720 , p < 0.001 ) ( fig . 2fig . 2.relationships between physiological cross - sectional area ( csa ) in the flexor \n digitorum brevis ( fdb ) and toe flexor muscle strength ( tfs-4 toes ) of young men and \n women . tfs-4 open circles are men and filled circles are women ) . relationships between physiological cross - sectional area ( csa ) in the flexor \n digitorum brevis ( fdb ) and toe flexor muscle strength ( tfs-4 toes ) of young men and \n women . tfs-4", "the main findings of the present study were that physiological csa of the fdb was \n significantly correlated with tfs-4-toes of both men and women ; physiological csa of the fdb \n was significantly correlated with tfs-5-toes of women , but not that of men ; there was a \n significant correlation between toe flexor muscle strength and maximum walking speed in both \n genders . in the present study , the fdb was selected as representative of the intrinsic toe flexor \n muscles , because a more accurate estimation of muscle volume by ultrasound and calculation \n of physiological csa of the muscle can be achieved than of the other intrinsic toe flexor \n muscles . the fdb muscle volume reliability results ( icc of 0.971 and sem of \n 0.57 cm ) indicate that the ultrasound method of the present study is a good \n repeatable technique for measuring muscle volume . the fdb is located in the sole of the foot \n and separates into four tendons that insert onto the middle phalanges of the four lateral \n toes10 ( without the great toe ) . \n therefore , our results demonstrate that the physiological csa of the fdb is associated with \n tfs-4 toes of both men and women , even though the correlation was only moderate . toe flexor \n muscle strength is generated from a combination of the intrinsic and extrinsic foot muscles . \n in the hand , the grip strength decreases by approximately 50% after median and ulnar nerve \n ( intrinsic muscles ) blocks compared with the pre - block measurement13 . accordingly , the contribution of extrinsic toe flexor \n muscles may reflect the moderate correlations between tfs-4 toes and physiological csa of \n the fdb . in addition , individual differences in the moment arm ( located between the center \n of curvature of the metatarsal head and the center of the flexor tendon ) and/or differences \n in the dominant / non - dominant sides may also be unknown factors14 . our findings show that the anatomical and physiological csa of the fdb of women were \n significantly correlated with tfs-5 toes . for men only one study6 has examined the relationships between toe flexor muscle strength \n and intrinsic and extrinsic foot muscle sizes in young sedentary adults ( 14 men and 12 \n women ) and a pooled sample was used for data analysis . that study reported significant \n correlations between tfs-5 toes and mri - measured anatomical csa of the medial parts \n ( r=0.775 , p<0.01 ) and lateral parts ( r=0.739 , p<0.01 ) of the foot intrinsic muscles , \n although only one mri image was used in that investigation . in the present study , the reason \n for the lack of a significant correlation between tfs-5 toes and the fdb muscle size \n observed in men is unknown . approximately half of our young women \n were sedentary and the other half performed mainly jogging / running or canoeing . therefore , \n our women participants may have had relatively homogeneous morphological and functional \n properties of the toe flexor muscles , which might partially explain the significant \n correlations . on the other hand , most of our young men were physically active and performed \n different sports including judo , resistance exercise and/or soccer . a likely explanation is \n that physical activity in different sports may elicit non - homogeneous features among toe \n flexor muscles , especially between the great toe and the four other toes . together , the \n results of the present and previous studies suggest that differences in sports experience \n may be a factor underlying the poor correlation of tfs-5-toes and fdb muscle size in young \n men . additional research into these issues is needed . in the present study , both tfs-4-toes and tfs-5-toes this finding is consistent with the results of \n previous studies5 , 15 which found significant correlations between 10-m walking \n performance and tfs-5-toes ( r=0.459 , p<0.01)5 and improved 50-m dash time following 8 weeks of toe flexor strength \n training15 . thus , the results of the \n present and previous studies demonstrate that toe flexor muscle strength is an important \n factor determining maximum walking speed . on the other hand , no significant correlation of \n tfs-5-toes and functional reach of either young men or women was found . although a pooled \n sample with a wide age range ( 20 to 84 yrs ) was used , one study reported a significant \n positive correlation ( r=0.620 , p<0.01 ) between tfs-5-toes and functional reach5 . the discrepancy in the results of the \n present and that previous study is not known , but the difference in subject age ranges \n between the two studies may have played a role . in conclusion , although toe flexor muscle strength correlated positively with walking speed \n in both genders , its correlation with functional reach was not statistically significant . \n the lack of a \n significant relationship between tfs-5-toes and physiological csa of the fdb in men may be \n related to different experiences in sports ." ]

[ "cardiomyogenesis ( generation of cardiomyocytes ) had not been convincingly demonstrated in the adult mammalian heart until very recently ; the potential for myocardial regeneration was only recognized in organisms such as fish and amphibians . however , carefully designed and performed studies have produced compelling evidence for the existence of cardiomyocytes in the adult heart , that were formed well after birth , in rodents and even humans . although the various studies do not agree about the rate of cardiomyocyte renewal in adults , this is clearly low and inadequate to replenish the substantial losses of cells after major injuries such as a myocardial infarction . in addition , controversy surrounds the putative cellular sources of postnatal cardiomyogenesis : do new myocytes arise from proliferation of pre - exisiting ones or from cardiomyogenic differentiation of endogenous progenitors ? in this review , we will present the evidence supporting the contribution of these two mechanisms in adult cardiomyogenesis and discuss their relative importance in different settings , such as normal ageing and post - myocardial injury . we will also critically present the existing methodologies that allowed the investigation of these mechanisms , with emphasis on their strengths and limitations .", "while lower vertebrates ( such as newts and zebrafish ) and neonatal mice possess a robust ability for myocardial regeneration , the ability of the mammalian heart to generate myocytes beyond the early neonatal period has been controversial . during the 20th century , the postnatal mammalian heart was viewed as a post - mitotic static organ , in which increases in mass occur exclusively through myocyte hypertrophy ( i.e. increase in cell size ) , rather than hyperplasia ( increase in cell number ) . the first studies hinting towards postnatal cardiomyogenesis in the human heart can be traced back to the 1970s . by employing histopathological , biochemical and cytophotometric techniques ( to measure dna content and nuclear ploidy ) , adler et al . they found that while normal hearts contained 2 billion cardiomyocytes , hearts with pathologic hypertrophy contained up to 4.8 billion cardiomyocytes . these findings suggest that adult human hearts may generate new cardiomyocytes during pathologic hypertrophy . in 1998 , the anversa group examined explanted human hearts obtained from end - stage heart failure patients and from control subjects ( who died of non - cardiovascular causes ) . fluorescent immunohistochemistry ( ihc ) , for sarcomeric proteins and propidium iodide ( pi , a dna dye which labels the cell nucleus ) , demonstrated the presence of cardiomyocytes undergoing mitosis ( either nuclear division [ karyokinesis ] or cell division [ cytokinesis ] ) in control hearts ( 14 mitotic myocytes / million myocytes ) . in end - stage heart failure hearts , the number of mitotic cardiomyocytes increased 10-fold ( 140 mitotic myocytes / million myocytes ) . these rates of myocyte mitosis ( if they translate into genuine proliferation ) project to an annual turnover of 10% in the healthy adult human heart and 107% in the failing human heart . fluorescent ihc for sarcomeric proteins , pi and ki67 ( a protein expressed in the nucleus of cells in the active phases of the cell cycle [ late g1 , s , g2 , and m phase ] ) in human hearts obtained from patients who died 412 days post myocardial infarction demonstrated ki67 expression in 4% of myocyte nuclei in the infarct border zone and in 1% of myocytes in the remote myocardium . mitosis ( karyokinesis or cytokinesis ) was observed in 0.08% of myocytes ( 800 mitotic myocytes / million myocytes ) in the border zone and 0.03% of myocytes ( 300 mitotic myocytes / million myocytes ) in the remote myocardium . if such exceptionally high rates of myocyte cell cycling could be persisted and resulted in genuine proliferation ( while no significant myocyte loss occurred post - myocardial infarction beyond the initial ischemic insult ) , then all myocytes lost after an infarct affecting 30% of the left ventricle could be replaced within as little as 18 days . more recently , the anversa group investigated the rates of myocyte turnover in the aging human heart . fluorescent ihc for sarcomeric proteins , ki67 , phosphorylated histone h3 ( h3p , a marker of karyokinesis ) and aurora - b - kinase ( a marker of cytokinesis ) was performed in explanted hearts from human subjects who died of non - cardiovascular causes . the investigators reported that myocyte turnover increases with age , and that female hearts possess a higher regenerative capacity compared to male hearts . in the female heart , myocyte turnover occurs at an annual rate of 10% , 14% , and 40% at 20 , 60 , and 100 years of age , respectively . the corresponding values in the male heart are 7% , 12% , and 32% per year . the investigators calculated that from 20 to 100 years of age , the myocyte compartment is replaced 15 times in women and 11 times in men . performed fluorescent immunocytochemistry for h3p in dissociated myocytes isolated from explanted hearts from human subjects who died of non - cardiovascular causes . fluorescent immunohistochemistry ( in tissue sections ) for mitotic kinesin - like protein was employed for investigation of myocyte cytokinesis . the investigators reported a decrease in myocyte turnover with age : annual myocyte turnover is 100% during the first year of life , decreases to 1.9% at 20 years of age and drops to 0.04% in subjects older than 40 years . the investigators calculated that during the first two decades of life , the total number of myocytes in the left ventricle increases 3.4 fold . however , it needs to be noted that while cardiomyocyte karyokinesis was detectable throughout life , no instances of myocyte cytokinesis were observed beyond 20 years of age . while the aforementioned studies demonstrate that human myocytes can re - enter the cell cycle and may possess some ability to proliferate beyond the early postnatal period , the calculated turnover rates need to be interpreted with caution . estimations of the total number of myocytes per heart ( as performed by adler et al . ) are complicated , require numerous assumptions and can be confounded by problematic discrimination of myocyte versus non myocyte nuclei ( which in those studies was performed based on nuclear size and morphology ) . quantification of cardiomyocyte cycling with histology ( as performed by the anversa group ) is prone to sampling error and can be complicated by the fact that conventional histology has been shown to be problematic for identification of cardiomyocyte nuclei ( this will be discussed later ) . finally , estimation of turnover rates based on exceedingly rare and brief ( mitosis in adult rat cardiomyocytes lasts 1.8 h in vitro ) events that may not represent instances of genuine myocyte division ( mitotic events involving in karyokinesis and myocyte multinucleation , but not cytokinesis and generation of daughter cells ) leaves significant room for error . ideally , slow processes ( like myocyte regeneration ) need to be quantified over time , rather than based on a single snapshot . to that end , a more reliable approach to study birth of new myocytes over prolonged periods of time is the pulse - chase approach . in pulse - chase experiments cells ( in our case cardiac myocytes ) are exposed to a labeled compound ( pulse ) , and then are followed for a period when the labeled compound is no longer administered ( chase ) . however , while pulse - chase approaches can be readily implemented in experimental animals ( where pulsing is typically performed through administration of nucleoside analogues ) , extraordinary circumstances are required for this approach with humans . examples of such extraordinary circumstances were the above - ground nuclear testing during the cold war , which resulted in the temporary release of large quantities of c into the atmosphere between 1955 and 1963 ( c pulse ) . after the limited nuclear test ban treaty in 1963 , atmospheric c concentration dropped exponentially ( chase ) , resulting in unique pulse - chase conditions . in a seminal study , bergmann et al . hypothesized that postnatally generated cardiomyocytes the concentration of c in dna of myocytes can be used to retrospectively establish a date mark for when myocytes were born ( by identifying the year that atmospheric c levels were similar to c levels in myocyte dna ) . this can be achieved since : a ) c levels in the human body reflect those of the atmospheric air ( c reacts with oxygen in the atmosphere to form co2 , which then enters the biotope through photosynthesis ) ; and b ) dna remains stable following the last cell division . by measuring c concentration ( with accelerator mass spectrometry ) in dna extracted from fluorescence - activated - sorted myocyte ( troponin positive ) nuclei isolated from explanted hearts ( 12 hearts total , 10 from subjects who died of non - cardiovascular causes and 2 from patients who died due to an acute myocardial infarction ) , bergmann et al mathematical modeling demonstrated that postnatal cardiomyogenesis decreases with age : cardiomyocyte turnover is 1%/year at the age of 25 and gradually decreases at 0.45%/year at the age of 75 , resulting in an exchange of 45% of myocytes during a 50-year span . a more recent study by the anversa group employed similar methods but yielded strikingly different results . performed carbon dating with accelerator mass spectrometry in dna extracted from myocytes obtained from 19 healthy hearts and 17 hearts with cardiomyopathy . it should be noted that in this study myocytes were isolated based on density centrifugation , rather than fluorescence - activated cells sorting of troponin positive nuclei ( as in the study by bergmann et al . ) . the investigators found that the healthy adult human heart replaces its entire myocyte compartment 8 times between 20 and 78 years of age . somewhat unexpectedly , the turnover rate of myocytes was found to be similar to that of endothelial cells and cardiac fibroblasts . it has been argued that staining of myocyte nuclei for troponin ( as performed by bergmann et al . ) only identifies nuclei of senescent myocytes ; this could result in significant underestimation of myocyte turnover . another unique circumstance allowing for implementation of a pulse - chase approach to measure myocyte turnover in the human heart is the use of radiosensitizing nucleoside analogues for therapeutic purposes in cancer patients . nucleoside analogues are incorporated into newly - synthesized dna of cycling cells and can therefore serve as markers of dna synthesis . investigated incorportation of the thymidine analogue iododeoxyuridine ( idu ) into dna of myocytes by fluorescent immunohistochemistry in hearts explanted from 8 cancer patients that had previously ( 8 days 4 years before death and heart explantation ) received infusions of the radiosensitizing agent . the investigators found idu labeling ( i.e. dna synthesis ) in 2.546% of myocyte nuclei , which projects to an annual myocyte turnover of 22% . concerns have been raised that such high turnover rates are difficult to reconcile with high labeling indices of idu after long chase periods : rapid cell turnover would presumably translate into death of a significant portion of idu - labeled myocytes as well as into substantial dilution of idu ( to undetectable levels ) due to rapid cell proliferation during the chase period ; both processes would result in significantly lower myocyte labeling indices of idu at the time of death . a perhaps more logical explanation for the high rates of idu myocyte labeling in that study is that a substantial portion of the measured dna synthesis may represent instances of abortive cell - cyle re - entry , resulting in polypolidization or binucleation , rather than genuine myocyte proliferation ( more on that later ) . while the investigators attempted to rule out polyploidization as a significant confounding factor ( they surprisingly reported that > 80% of human myocyte nuclei are diploid , in contrast to several other studies suggesting that the majority is polyploidy ) , no effort was undertaken to quantify to the potential contribution of bi / multinucleation to the measured rates of dna synthesis . the estimated rates of myocyte turnover measured in adult mammalian hearts ( human and mouse ) are depicted schematically in figure 1 . taken together , even though reported rates of myocyte turnover vary wildly ( by more than 1 order of magnitude ) , the aforementioned studies convincingly establish that the human heart can generate new myocytes beyond the early postnatal period . however , studies in human subjects can not provide insight into the cellular origins of postnatal mammalian cardiomyogenesis : do newly - generated myocytes arise from division of pre - existing myocytes or from cardiomyogenic differentiation of endogenous progenitors ?", "a landmark study by soonpaa and field in 1998 demonstrated convincingly that preformed cardiomyocytes can actively cycle in the adult mouse heart . pulse - chase experiments were performed in transgenic mice , in which a nuclear - localized -galactosidase reporter gene was expressed in cardiomyocytes ( driven by the -myosin heavy chain [ mhc ] promoter ) . adult mice received injections of h - thymidine and were sacrificed 4 h after the last injection . heart sections were processed for x - gal reaction ( to identify cardiomyocyte nuclei ) and autoradiography ( to identify incorporation of h - thymidine into the dna , i.e. dna synthesis ) . normal adult hearts had a myocyte labeling index of 0.0006% ( 1/180000 cardiomyocyte nuclei had incorporated h - thymidine ) . this projects to an annual myocyte turnover of 1% ( if dna synthesis is accompanied by genuine cell division ) . after myocardial injury ( focal cauterization ) , myocyte cycling in the border zone increased 14-fold ( labeling index of 0.0083% [ 3/36000 cardiomyocyte nuclei had incorporated h - thymidine ] ) . with regard to the cellular origins of cycling cardiomyocytes , identification of morphologically mature cardiomyocytes that have synthesized their dna within 4 h after a single injection of a nucleoside analogue ) can only be attributed to dna synthesis in pre - existing myocytes ( as differentiation of progenitors to mature myocytes would take longer ) . more recently , an elaborate study by the lee group investigated the contribution of resident myocyte proliferation to postnatal cardiomyogenesis by a combination of genetic fate - mapping , stable isotope labelling and multi - isotope imaging mass spectrometry . the investigators employed an inducible fate mapping approach utilizing bitransgenic mhc- mercremer / zeg mice . in these mice , induction of cre recombinase activity ( driven by mhc promoter ) by 4-oh - tamoxifen results in efficient ( 80% ) permanent genetic labeling of myocytes ( and their progeny ) by green fluorescent protein ( gfp ) . 4-oh - tamoxifen - pulsed adult , healthy bitransgenic mice underwent pulsing with n - thymidine over a 10-week period . multi - isotope imaging mass spectrometry ( which has a resolution capacity of < 1 m and thus can readily distinguish cardiomyocyte nuclei from adjacent non - cardiomyocyte nuclei ) in sections from explanted hearts revealed a n myocyte labeling index of 0.8% over 10 weeks ; this projects to an annual rate of myocyte dna replication of 4.4% . the investigators undertook extensive efforts to calculate the contribution of abortive cell cycle re - entry ( resulting in polyploidization and/or multinucleation , rather than genuine cell division ) to the measured dna synthesis . perhaps not surprisingly , they found that the majority of dna synthesis occurred in polyploid and/or multinucleated myocytes . however 17% of the measured dna synthesis could not be explained away by these confounding factors , leaving generation of new myocytes as the only likely explanation and suggesting an annual myocyte turnover of 0.74% in the healthy adult mouse heart . with regard to the cellular origins of postnatal cardiomyogenesis , n+ cardiomyocytes expressed gfp at a similar frequency as n- myocytes , suggesting that in the normal heart new myocytes are generated mainly through proliferation of pre - existing myocytes , rather than differentiation of endogenous progenitors . similar experiments performed in adult mice post - myocardial infarction showed a 20-fold increase in myocyte division in the infarct border zone during the first 8 weeks following injury , which was also attributed to proliferation of pre - existing myocytes rather than contributions of endogenous progenitors to the myocyte pool . in a parallel study at the marbn laboratory , we attempted to quantify postnatal cardiomyogenesis and trace its cellular origins using a combination of genetic fate mapping with long - term pulsing with the nucleoside analogue bromodeoxyuridine ( brdu ) . healthy adult bitransgenic mhc - mercremer / zeg mice were pulsed with 4-oh - tamoxifen to genetically label pre - existing cardiomyocytes with gfp . figure 2 depicts two genetically labeled pre - existing cardiomyocytes ( pseudocolored in green ) that have incorporated brdu ( pseudocolored in white ) . measurement of dna synthesis ( brdu incorporation ) in pre - exisiting ( gfp+ ) cardiomyocytes by different methods ( flow cytometry of whole cells , flow cytometry of isolated myocyte nuclei , fluorescent immunocytochemistry of dissociated cardiomyocytes and fluorescent immuhistochemistry in cardiac sections ) demonstrated that 0.4% of pre - existing ( gfp+ ) myocytes synthesized dna during 5 weeks of brdu pulsing , suggesting an annual rate of dna replication in resident myocytes of 4% . actively cycling cardiomyocytes were smaller and more - often mononucleated compared to non - cycling myocytes . quantification of the contributions of polyploidization and multinucleation to the measured rates of brdu incorporation demonstrated that abortive cell - cycle re - entry without genuine cell division could explain 69% of the observed dna synthesis ; thus the calculated annual rate of myocyte turnover due to cardiomyocyte proliferation in the adult healthy mouse heart was 1.3% . myocardial infarction resulted in a 2-fold increase in the total number of proliferating myocytes in the left ventricle during the first 5 weeks post - injury ; this increase was attributed to an upregulation in proliferation of pre - existing myocytes in the border zone ( 10 fold compared to normal heart ) , but not in the remote myocardium . taken together , the aforementioned studies suggest that mammalian myocytes retain a limited but measurable capacity to proliferate in the healthy adult heart , and that myocyte proliferation increases modestly in the border zone following myocardial infarction .", "during the past decade several studies supported the notion that the adult mammalian heart contains its own reservoir of stem cells . numerous populations of putative adult endogenous cardiomyocyte progenitors have been proposed ( including c - kit cells , sca-1 cells , side population cells , cardiosphere - forming cells , ssea-1 cells , pdgfr cells and neural - crest derived cells ) largely based on expression of surface markers or functional properties that have been used to mark progenitors in other organs . the high number of distinct populations of putative endogenous myocyte progenitors is difficult to reconcile with the limited regenerative capacity of the adult mammalian heart . importantly , while several cell types have been shown to express cardiac proteins in vitro or after delivery into recipient hearts following ex vivo expansion , their physiologic importance and contribution to cardiomyocyte replenishment in the normal or injured adult heart remains controversial . genetic fate mapping is a powerful tool that enables study of cardiac regeneration in vivo . perhaps the most compelling evidence indicating postnatal contribution of endogenous progenitors to the adult myocyte pool comes from a landmark study performed at the lee laboratory . using mhc - mercremer / zeg adult bitransgenic mice , hsieh et al . achieved inducible genetic labeling of 80% of preexisting myocytes with gfp , without any detectable labeling of progenitor - like cells ( which in their inactive state presumably do not express mhc ) . in the normal heart , the percentage of gfp+ myocytes remained unchanged over 1 year of follow - up , indicating that progenitor cells do not contribute significantly to myocyte renewal during normal aging . in contrast , when mice were subjected to myocardial infarction the percentage of gfp+ cardiomyocytes decreased from 83% to 68% in the border zone and to 77% in the remote myocardium over a 3-month follow - up period . following pressure - overload , the percentage of gfp+ myocytes decreased from 83% to 76% over 3 months . these results indicate that post - cardiac injury , unlabeled progenitors undergo cardiomyogenic differentiation , resulting in dilution of gfp+ myocytes by gfp myocytes ( generated from unlabeled precursors ) ( figure 3a ) . alternatively , the observed dilution of the labeled myocyte pool could be attributed to intrinsic differences between gfp+ and gfp- myocytes , i.e. increased proliferative capacity of gfp- myocytes post - injury or increased susceptibility of gfp+ myocytes to injury ( even though the latter hypothesis has not been shown to occur ) . brdu pulsing revealed increased incorporation of brdu in gfp- myocytes ( compared to gfp+ myocytes ) post - injury , a finding also compatible with generation of new myocytes from progenitors . based on these findings , the contribution of endogenous precursors to the myocyte pool post - injury appears to be quite substantial : over a 3-month period , 15% of myocytes in the border zone and 6% of all myocytes in the left ventricle arise from cardiomyogenic differentiation of progenitors . the results of this study ( particularly the increased brdu labeling of gfp- myocytes ) do not fully agree with a more recent study from the same group ( described earlier ) , in which no increased n incorporation into gfp myocytes could be detected by multi - isotope imaging mass spectrometry , suggesting no significant contribution of endogenous precursors to the myocyte pool post - injury . this discrepancy may be a result of the very small number of mononucleated / diploid n+ myocytes ( 16 n+ myocytes/ 7063 myocytes analyzed ) detected in injured hearts by multi - isotope imaging mass spectrometry ( an extremely time - consuming method that precludes analysis of large amounts of tissue ) ; this number may be too small to detect differences in the rate of n incorporation in gfp+ and gfp myocytes . at the marbn lab after inducible genetic labeling of cardiomyocytes by gfp , adult bitrangenic mhc - mercremer / zeg mice received daily brdu injections for 5 weeks . comparison of brdu incorporation in gfp+ and gfp cardiomyocytes ( by flow cytometry , immunocytochemistry and histology ) revealed similar rates of brdu labeling in both myocyte subsets in healthy mice . these findings indicate that in the normal adult mouse heart , myocyte turnover occurs predominantly through proliferation of resident myocytes , without any measurable progenitor - mediated myocyte formation . however , post - myocardial infarction we could detect a contribution of endogenous precursors to the myocyte pool ( 1% of myocytes in the left ventricle arose from progenitor cell differentiation over a 5-week period post - injury ) ( figure 4 ) . a different technique ( viral gene tagging ) to study endogenous cardiac regeneration was employed by the anversa group . injected lentiviruses expressing gfp in the atria and ventricular apex ( presumably sites of cardiac stem cell niches ) of adult mice . one to 5 months later , nested polymerase chain reaction revealed common viral integration sites in c - kit+ cells , cardiomyocytes , endothelial cells and fibroblasts isolated from the infected hearts . since lentiviruses are semi - randomly integrated in the host genome of infected cells , these results suggest that postnatally - generated cardiomyocytes , endothelial cells and fibroblasts in the healthy adult mouse heart derive from clonal activation of endogenous stem cells . six months after viral injection , 25% of myocytes in the mid - portion of the left ventricle ( a myocardial region away from the sites of viral injections ) were gfp+ , presumably arising from migration of gfp+ infected progenitor cells to that region and subsequent differentiation . these results indicate a remarkable capacity of the adult mouse heart for stem - cell mediated cardiomyocyte replenishment . however , it needs to be emphasized that viral gene tagging can not reveal the identity of the parental stem cell . the fact that c - kit cells shared similar viral integration sites as cardiomyocytes , endothelial cells and fibroblasts could be a result of viral infection of a yet unknown progenitor that gives rise to all four celltypes . fate mapping of resident myocytes or viral gene tagging can not reveal the identity of endogenous progenitors , as they indirectly capture the net result of their activation and differentiation . this can only be performed through forward fate mapping experiments in which endogenous progenitors ( but not pre - existing myocytes ) are genetically labeled in a prospective manner , enabling direct visualization of their future contributions to the myocyte pool ( figure 3b ) . such an approach was undertaken at the fukuda lab in order to investigate the contribution of neural - crest derived cells to postnatal cardiomyogenesis . tamura et al . used bitransgenic mice in which activation of cre - recombinase ( under the control of protein-0 promoter ) induces gfp expression , resulting in genetic labeling of neural - crest derived cells by gfp . in the healthy heart , neural - crest derived ( gfp+ ) cardiomyocytes were undetectable during the first week after birth but appeared at 2 weeks postnatally and increased in number thereafter ; however , their absolute contributions to the myocyte pool were minimal ( 0.3% gfp+ cardiomyocytes in the septum , < 0.1% gfp+ cardiomyocytes in the rest of the left ventricle ) . after myocardial infarction , small gfp+ cardiomyocytes ( presumably arising from differentiation of neural - crest - derived cells ) first appeared in the border zone 2 weeks post - injury and gradually increased in number thereafter ( comprising 3% of total cardiomyocytes in the border zone at 12 weeks post - injury ) . while this study is limited by the fact that the activity of cre - recombinase was not temporally controlled in an inducible manner ( and thus spontaneous activation of the protein-0 promoter in resident cardiomyocytes would result in gfp labeling ) it suggests that progenitor cells may contribute to generation of new myocytes ( especially post - injury ) . using a similar forward fate mapping approach , ellison et al recently reported that endogenous c - kit+ cardiac cells are a source of newly formed cardiomyocytes , after myocardial injury , in adult rodents . the investigators used a model of a single , high isoproterenol dose that produces severe , albeit spontaneously resolving , myocardial injury . endogenous c - kit+ cardiac cells were genetically labeled by exogenous administration of a lentivirus expressing cre - recombinase . under the control of a c - kit promoter , in hearts of ryp reporter mice . in this mouse model , expression of cre - recombinase in c - kit+ cell results in genetic labeling of infected c - kit+ cells with yellow fluorescent protein ( yfp ) . after isoproterenol injury , a significant fraction of cardiomyocytes were yfp+ , indicating that they comprise newly generated cardiomyocytes arising from cardiomyogenic differentiation of infected c - kit+ cells . while this study suggests an important role of progenitor cell - mediated cardiomyogenesis post - injury , it is in contrast with previous studies , reporting that adult c - kit+ cells have only angiogenic but not cardiomyogenic potential . in addition , the implemented spontaneously - resolving model of heart failure may not be physiologically relevant . finally , it needs to be emphasized that c - kit is not a specific marker of stem cells , but it is rather expressed in a variety of cells ( e.g. mast cells ) and more importantly in myocytes themselves during both proliferation and differentiation . thus , the precise expression pattern of c - kit in forward fate mapping models has to be delineated at baseline prior to temporal assessment of possible progeny , before concrete conclusions can be reached . currently , several studies using forward fate - mapping approaches for putative markers of endogenous progenitors ( including c - kit , sca-1 and nkx2 - 5 ) are ongoing in multiple labs . taken together , the aforementioned studies suggest that endogenous progenitors may generate new myocytes in the adult heart . while their role in postnatal cardiomyogeneis during normal ageing appears to be limited ( as most studies concur that myocyte turnover in the healthy heart most likely occurs through proliferation of pre - existing myocytes ) , multiple studies indicate progenitor cell - mediated cardiomyocyte renewal occurs following myocardial injury . it needs to be emphasized that the two proposed mechanisms of myocyte turnover ( cardiomyocyte proliferation and differentiation of endogenous progenitors ) are not mutually exclusive . the adult mammalian liver has an impressive capacity to regenerate ; following acute 70% partial hepatectomy , the adult liver can fully regenerate within days ( in rodents ) to weeks ( in humans ) , through division of mature hepatocytes and cholangiocytes , which re - enter the cell cycle and divide . however , during chronic liver injuries , hepatic progenitor cells also become activated and contribute to liver regeneration .", "in addition , inherent characteristics of cardiac tissue architecture and cardiomyocyte biology further complicate quantification of postnatal cardiomyogenesis and tracing of its cellular origins in the mammalian heart . below , we review the major challenges when studying endogenous postnatal cardiac regeneration . first , since postnatal cardiomyogenesis in the mammalian heart most likely occurs at very low levels , pulse - chasing approaches with long pulsing periods are preferable in experimental animals , as they maximize the chance of capturing rare events of myocyte proliferation . however , long - term administration of radiolabeled thymidine or halogenated nucleoside analogues ( like brdu ) may be toxic and could affect the cycling rates of cardiomyocytes . nevertheless , we did not observe any differences in the rates of actively - cycling ( ki67 + ) cardiomyocytes in mice that received brdu for up to 5 weeks compared to mice that did not receive brdu . second , the use of conventional histology ( which typically employs confocal microscopy for analysis of cardiac sections stained for sarcomeric proteins , dna [ for nuclear identification ] and [ in some cases ] cellular borders ) to identify cardiomyocyte nuclei is problematic . ang et al . performed a careful study to investigate the fidelity of conventional myocyte nuclear identification using confocal microscopy . a transgenic mouse in which cardiomyocyte nuclei are genetically labelled ( by a nuclear - localized -galactosidase reporter gene driven by the mhc promoter ) was used as the gold - standard . the investigators demonstrated that conventional histological approaches typically misidentify myocyte nuclei 10% of the time , thus significantly compromising accurate quantification of rare events ( like active cycling of myocytes ) . the limitations of conventional microscopy can be overcome by use of transgenic lineage reporters that mark cardiomyocyte nuclei , implementation of approaches with powerful resolution capacity ( e.g. multi - isotope imaging mass spectrometry ) , or analysis of enzymatically dissociated cardiomyocytes . third , it needs to be emphasized that dna incorporation of nucleoside analogues or nuclear expression of cell - cycle proteins , while demonstrating cell - cycle activity , does not necessarily translate into genuine cell division and proliferation ; important confounding factors that need to be accounted for include polyploidization ( dna proliferation without karyokinesis and cytokinesis ) and bi / multinucleation ( dna proliferation and karyokinesis without cytokinesis ) , cell fusion and dna repair ( figure 5 ) . while cell fusion and dna damage and repair are exceptionally rare events that can not account for the magnitude of measured turnover rates , polypolidization and bi / multinucleation are particularly relevant when studying cardiomyogenesis , as abortive cell - cycle re - entry is quite prevalent in myocytes ( most myocytes in the mouse heart are diploid and binucleated , while most myocytes in the human heart are polyploid and mononucleated ) . we and others have found that the majority of the measured myocyte cell - cycle activity in the normal or infarcted mouse heart can be attributed to polyploidization and binucleation , rather than true myocyte division . cardiomyocyte cytokinesis is a brief ( the m phase occupies 2% of the cell cycle ) and rare event , and detection of the cleavage furrow between diving myocytes ( a hallmark of cytokinesis ) is complicated by the compact myocardial architecture as well as by division of adjacent non - myocyte cells ( which actively cycle at substantially higher rates compared to myocytes ) ; thus myocyte division is difficult to visualize convincingly and quantify accurately . a more viable strategy may be to quantify the magnitude of abortive cell - cycle re - entry and subtract it from the total measured dna synthesis . to that end , measurements of ploidy levels ( by flow cytometry for dna content or by visualization of the number of sex chromosomes by fluorescence is situ hybridization ) and number of nuclei ( preferably by analysis of dissociated myocytes ) should be performed in cardiomyocytes that have incorporated nucleoside analogues . finally , while genetic fate mapping is the only reliable tool that can be used to trace the cellular origins of organ regeneration in vivo , its implementation in studies of postnatal cardiomyogenesis does not come without problems . while several groups have used the mhc - mercremer / zeg bitrasngenic mouse for inducible marking of pre - existing myocytes , multiple studies have reported activity of the -mhc promoter in non - myocyte cells that possess characteristics compatible with endogenous cardiac progenitors . in addition , development of new lineage - tracing models that could allow for forward fate mapping of cardiac progenitors ( in order to prospectively investigate their contributions to the myocyte pool ) is complicated by lack of specific cardiac stem cell markers and by potential re - expression of such markers in cardiomyocytes during stress - induced activation of a fetal - gene program ( figure 3 ) .", "there is now ample and compelling evidence that cardiomyogenesis does occur in the adult mammalian heart , albeit at an insufficient rate to restore cardiac function after substantial cell losses such the ones that occur after a myocardial infarction . proliferation of pre - existing cardiomyocytes appears as the dominant mechanism of generation of novel cardiomyocytes , at least during normal ageing , although after myocardial injury , differentiation of progenitor cells may also contribute to this phenomenon . cell therapies have already reached the stage of clinical trials ; most of the cells currently under investigation ( with the exception of embryonic stem cells and induced pluripotent stem cells ) do not differentiate into functional cardiomyocytes and act through paracrine activation of endogenous reparative and regenerative pathways . recently , insight has been provided to the mechanisms that control exit and re - entry of cardiomyocytes to the cardiac cycle , together with ways to manipulate the potential of cardiomyocytes for division and proliferation . it is reasonable to expect that therapeutic amplification of endogenous regenerative mechanisms will bolster cardiomyocyte repopulation of injured myocardium and will result in effective therapies for cardiovascular disease and heart failure , in the not so remote future .", "" ]

[ "data were obtained from the finnish national prescription register and special reimbursement register , maintained by the social insurance institution ( sii ) of finland . the national prescription register contains records of all reimbursed drug purchases of all finnish residents living in noninstitutionalized settings . the special reimbursement register includes information on all individuals who are entitled to reimbursement of medication for certain chronic diseases , such as ad or diabetes . to be included in the special reimbursement register , the diagnosis must be based on explicit predefined criteria and written documentary evidence , including results of a diagnostic test , such as imaging or blood biochemistry , must be provided to the sii by a physician . data from these registers have previously been applied in nationwide drug utilization studies ( 30 ) . in finland ( population , 5.3 million ) , all citizens are covered by a tax - supported public health system and have access to health services , regardless of age , ethnic background , or socioeconomic status , and individual - level data on purchases of reimbursed prescription medicines and hospital visits are collected and updated continuously on statutory registers ( 31 ) . thus , these data are available on all individuals , provided that they have a social security number ( i.e. , all citizens and noncitizens living in finland for at least 2 years but excluding persons who were living abroad for > 1 year at the time of the study ) . each resident of finland is assigned a unique social security number , and this identification number was used to track information from registers . changes in social security numbers in the 1970s mean that reliable automated linkage without individual checking and recoding of pins is possible from 1972 onwards , and thus we included data from 1972 onwards only . data linkage was performed by sii , and all data were de - identified before submission to the research team . no ethics committee approval was required as de - identified data were used and participants were not contacted . all community - dwelling people with a verified ad diagnosis , residing in finland on 31 december 2005 ( n = 28,093 ) were identified from the special reimbursement register , and a single age- , sex- , and region of residence matched control subject per ad case subject ( n of matched case - control pairs = 28,093 ) was identified . ad diagnosis was based on the national institute of neurological and communicative disorders and stroke and the alzheimer 's disease and related disorders association ( nincds - adrda ) and the dsm - iv criteria for ad ( 32,33 ) . in brief , the main diagnostic criterion is progressive memory loss , supported by abnormal magnetic resonance imaging or cerebrospinal fluid biomarker findings . alternative explanations for memory impairment , such as severe depression , metabolic disturbances ( including hyperglycemia per se ) , and other forms of dementia , such as vascular dementia , needed to be excluded . the finnish current care guidelines recommend that all people with ad are treated with memantine or acetylcholinesterase inhibitors unless there is a specific contraindication ( including gastric ulcer / intestinal tract operation < 6 months previously or severe asthma ) ( 34 ) . patients with mild or moderate ad are entitled to reimbursed ad medication , but the reimbursement is not withdrawn if / when the disease progresses . diabetes is diagnosed on the basis of fasting capillary blood glucose concentration ( sii reimbursement criterion cutoff is 7.0 mmol / l ) or 2-h glucose concentration if an oral glucose tolerance test has been performed ( cutoff 11.1 mmol / l ) ( 35 ) . individuals with type 1 diabetes have been entitled to reimbursed insulin since 1964 , whereas the criteria for reimbursed type 2 diabetes medication have varied over time . type 2 diabetes was first mentioned in 1981 criteria stating that medication for those with type 2 diabetes is reimbursed if they have not benefited from lifestyle modification lasting at least 3 months . in 1994 , the criteria for type 2 diabetes was updated to recommend 6-month dietary intervention as a first - line therapy and requesting that the pharmacotherapy for type 2 diabetes be used for at least 6 months , including a report of outcomes , before applying for special reimbursement . people with gestational diabetes have not been entitled to reimbursement , unless the need for pharmacotherapy is prolonged . thus , we applied a robust age - based classification so that people who were < 40 years of age when they were diagnosed with diabetes were classified as having type 1 diabetes and those who were at least 40 years of age were classified as having type 2 diabetes . this cutoff has been suggested as a simple and relatively reliable method for differentiating people with type 1 and type 2 diabetes ( 36 ) . people with diabetes diagnosed at < 65 years of age were categorized as having diabetes in midlife , and those who were at least 65 years of age when diabetes was diagnosed were classified as having late - life diabetes . statistical analyses were performed with stata 12.0 ( stata corp lp , college station , tx ) . the difference in the mean age of ad diagnosis between those with and without diabetes was compared with the student t test , and differences in the duration of diabetes and age at diabetes diagnosis between case and control subjects were compared with the kruskal - wallis test . the association of diabetes with ad was assessed in a case - control study including all 28,093 matched pairs . crude ors and pooled ors according to the history of cardiovascular disease groups ( no / yes ) were calculated . information on cardiovascular conditions ( hyper-/hypotension , ischemic heart disease , familial hypercholesterolemia , embolisms and thrombosis , myocardial infarctions , heart failure and cardiac arrests , atherosclerosis , and aneurysms ) was obtained from the special reimbursement register and finnish national hospital discharge register ( details available from a .- m.t . ) .", "data were obtained from the finnish national prescription register and special reimbursement register , maintained by the social insurance institution ( sii ) of finland . the national prescription register contains records of all reimbursed drug purchases of all finnish residents living in noninstitutionalized settings . the special reimbursement register includes information on all individuals who are entitled to reimbursement of medication for certain chronic diseases , such as ad or diabetes . to be included in the special reimbursement register , the diagnosis must be based on explicit predefined criteria and written documentary evidence , including results of a diagnostic test , such as imaging or blood biochemistry , must be provided to the sii by a physician . data from these registers have previously been applied in nationwide drug utilization studies ( 30 ) . in finland ( population , 5.3 million ) , all citizens are covered by a tax - supported public health system and have access to health services , regardless of age , ethnic background , or socioeconomic status , and individual - level data on purchases of reimbursed prescription medicines and hospital visits are collected and updated continuously on statutory registers ( 31 ) . thus , these data are available on all individuals , provided that they have a social security number ( i.e. , all citizens and noncitizens living in finland for at least 2 years but excluding persons who were living abroad for > 1 year at the time of the study ) . each resident of finland is assigned a unique social security number , and this identification number was used to track information from registers . changes in social security numbers in the 1970s mean that reliable automated linkage without individual checking and recoding of pins is possible from 1972 onwards , and thus we included data from 1972 onwards only . data linkage was performed by sii , and all data were de - identified before submission to the research team . no ethics committee approval was required as de - identified data were used and participants were not contacted .", "all community - dwelling people with a verified ad diagnosis , residing in finland on 31 december 2005 ( n = 28,093 ) were identified from the special reimbursement register , and a single age- , sex- , and region of residence matched control subject per ad case subject ( n of matched case - control pairs = 28,093 ) was identified . ad diagnosis was based on the national institute of neurological and communicative disorders and stroke and the alzheimer 's disease and related disorders association ( nincds - adrda ) and the dsm - iv criteria for ad ( 32,33 ) . in brief , the main diagnostic criterion is progressive memory loss , supported by abnormal magnetic resonance imaging or cerebrospinal fluid biomarker findings . alternative explanations for memory impairment , such as severe depression , metabolic disturbances ( including hyperglycemia per se ) , and other forms of dementia , such as vascular dementia , needed to be excluded . the finnish current care guidelines recommend that all people with ad are treated with memantine or acetylcholinesterase inhibitors unless there is a specific contraindication ( including gastric ulcer / intestinal tract operation < 6 months previously or severe asthma ) ( 34 ) . patients with mild or moderate ad are entitled to reimbursed ad medication , but the reimbursement is not withdrawn if / when the disease progresses .", "diabetes is diagnosed on the basis of fasting capillary blood glucose concentration ( sii reimbursement criterion cutoff is 7.0 mmol / l ) or 2-h glucose concentration if an oral glucose tolerance test has been performed ( cutoff 11.1 mmol / l ) ( 35 ) . individuals with type 1 diabetes have been entitled to reimbursed insulin since 1964 , whereas the criteria for reimbursed type 2 diabetes medication have varied over time . type 2 diabetes was first mentioned in 1981 criteria stating that medication for those with type 2 diabetes is reimbursed if they have not benefited from lifestyle modification lasting at least 3 months . in 1994 , the criteria for type 2 diabetes was updated to recommend 6-month dietary intervention as a first - line therapy and requesting that the pharmacotherapy for type 2 diabetes be used for at least 6 months , including a report of outcomes , before applying for special reimbursement . people with gestational diabetes have not been entitled to reimbursement , unless the need for pharmacotherapy is prolonged . thus , we applied a robust age - based classification so that people who were < 40 years of age when they were diagnosed with diabetes were classified as having type 1 diabetes and those who were at least 40 years of age were classified as having type 2 diabetes . this cutoff has been suggested as a simple and relatively reliable method for differentiating people with type 1 and type 2 diabetes ( 36 ) . people with diabetes diagnosed at < 65 years of age were categorized as having diabetes in midlife , and those who were at least 65 years of age when diabetes was diagnosed were classified as having late - life diabetes .", "statistical analyses were performed with stata 12.0 ( stata corp lp , college station , tx ) . the difference in the mean age of ad diagnosis between those with and without diabetes was compared with the student t test , and differences in the duration of diabetes and age at diabetes diagnosis between case and control subjects were compared with the kruskal - wallis test . the association of diabetes with ad was assessed in a case - control study including all 28,093 matched pairs . crude ors and pooled ors according to the history of cardiovascular disease groups ( no / yes ) were calculated . information on cardiovascular conditions ( hyper-/hypotension , ischemic heart disease , familial hypercholesterolemia , embolisms and thrombosis , myocardial infarctions , heart failure and cardiac arrests , atherosclerosis , and aneurysms ) was obtained from the special reimbursement register and finnish national hospital discharge register ( details available from a .- m.t . ) .", "the prevalence of diabetes with reimbursed medication in 2005 was 11.4% in the whole study population , 10.7% ( n = 3,012 ) among control subjects ( i.e. , those without ad ) , and 12.0% ( n = 3,372 ) among ad cases . a history of cardiovascular diseases was more common among those with diabetes than those who did not have diabetes ( or 2.91 [ 95% ci 2.663.18 ] , n = 5,159 , 80.8% , and n = 27,941 , 56.1% , respectively , including those with and without ad ) . people with ad were more likely to have a history of clinically verified and medically treated diabetes ( either type 1 or type 2 diabetes ) in the unadjusted analysis ( or 1.14 [ 95% ci 1.081.20 ] ) , and the association was strengthened after adjusting for cardiovascular diseases ( adjusted or 1.31 [ 1.221.41 ] ) . the association between diabetes and ad was similar in individuals with no history of cardiovascular diseases ( n = 23,086 , or 1.39 [ 1.231.57 ] ) and those with cardiovascular diseases ( n = 33,100 , or 1.29 [ 1.211.37 ] ) . the associations were similar in both sexes ( adjusted or 1.27 [ 1.171.39 ] and 1.40 [ 1.231.59 ] in women and men , respectively ) . association between diabetes and incident ad in the whole study population , according to previous cardiovascular disease ( cvd ) , sex , and onset age of diabetes . * adjusted for cardiovascular diseases . both midlife and late - life diabetes were more common among those with ad ( table 1 and fig . midlife diabetes was more strongly associated with ad than diabetes diagnosed in late life ( crude or 1.42 [ 95% ci 1.281.60 ] and 1.05 [ 1.001.12 ] for midlife and late - life diabetes , respectively ) . the associations were strengthened after adjusting for cardiovascular diseases ( pooled or 1.60 [ 1.341.84 ] and 1.25 [ 1.161.36 ] for midlife and late life , respectively ) . the median age at diabetes diagnosis was 71.4 years ( interquartile range 64.677.0 years ) , ranging from 15.4 to 98.9 years . those with ad were younger when diabetes was diagnosed ( table 1 ) and thus the duration of diabetes was longer in case subjects than control subjects ( fig . only 54 people were < 40 years of age when they were diagnosed with diabetes , suggesting that the majority had type 2 diabetes . the exclusion of these 54 people who putatively had type 1 diabetes had no effect on the association ( data not shown ) . age at ad diagnosis between those with and without diabetes was similar ( mean age 78.0 years , sd 0.1 for both groups ) . individual dots represent observations outside the 95% cis . altogether , 757 ( 22.4% ) of those with ad and diabetes received the entitlement of reimbursed diabetes medication after ad diagnosis . the median time interval was 2.0 years ( interquartile range 0.73.9 years ) , and 35.9% ( n = 272 ) of ad cases with diabetes received the decision on reimbursed medication within 1 year of ad diagnosis .", "in this nationwide case - control study , people with clinically verified ad were more likely to have a history of clinically verified and medically treated diabetes than the general aged population . the association between diabetes and ad was similar in individuals with or without a history of cardiovascular disease , and adjustment for cardiovascular diseases strengthened the association . our findings also showed that in finland , ad patients who receive a diagnosis of diabetes often do so within 12 years of ad diagnosis . this is likely due to the exclusion of alternative diagnoses , which is required before receiving reimbursed ad medication . our findings and estimates are consistent with a previous meta - analysis on type 2 diabetes and ad ( 1 ) . people with type 1 diabetes have also been suggested to have an increased risk of cognitive dysfunction ( 9 ) . in our study , the mean age at diabetes diagnosis was 70 years , and only 52 of all 6,384 people with diabetes were < 40 years of age when they were diagnosed , suggesting that the majority had type 2 diabetes . considering the high average age ( 79.7 years ) , it is not surprising that only a small minority of the sample were < 40 years of age when diagnosed with diabetes . mortality among people with type 1 diabetes in finland was significantly higher in the 1970s ( 37 ) , so these individuals were less likely to survive to an older age than they would be today . according to the hypothesis that midlife vascular risk may be more strongly associated with ad than late - life risk factors ( 20 ) , we found a stronger association with midlife diabetes than late - life diabetes . this is in line with previous studies showing that long - term diabetes is more strongly associated with cognitive impairment and dementia ( 38 ) and that diabetes in midlife increases the risk of ad ( 29 ) . although this previous study found no association between late - life diabetes and ad ( 29 ) , another recent study investigating the midlife and late - life vascular risk factors concluded that the association of diabetes was of similar magnitude in both age groups ( 39 ) . the age - dependent effect may be due to smaller effects of the ad disease process on midlife factors than on factors assessed in late life . midlife vascular risk factors may also be a more accurate reflection of the vascular load during adulthood ( 40 ) . the estimates from our study ( unadjusted 95% ci 1.081.20 ) are comparable , although lower than in the meta - analysis by profenno et al . ( 1 ) ( 95% ci 1.331.79 ) , although our adjusted estimates ( 1.221.41 ) are consistent with the previous findings . this could be due to differences in the definition of diabetes . in half of the studies included in that meta - analysis , the diabetes diagnosis was based on self - report or use of diabetes medication ( 2123,25 ) , whereas in our study , all diabetes diagnoses were performed in healthcare settings and based on the assessment of blood glucose concentrations , which is mandatory for reimbursed diabetes medication in finland . there were also differences in sample size : the conclusions of profenno et al . ( 1 ) were based on 21,560 individuals , including 1,306 ad case subjects , whereas our sample included 28,093 ad case subjects . however , our study is limited in the sense that individuals with type 2 diabetes are underrepresented , as approximately one - third of type 2 diabetes is treated by lifestyle modifications only ( 36 ) . our sample would cover all individuals with type 1 diabetes ( who were able to survive to their 70s or 80s ) , as the insulin replacement therapy is necessary , and the majority of people with advanced type 2 diabetes or those who did not benefit from lifestyle modification . we were not able to adjust for lifestyle or socioeconomic confounders , such as obesity , smoking , or education as these data were not available from the registers we used . however , we attempted to capture some variation in these factors by adjusting for cardiovascular diseases . since there was no data on glycosylated hemoglobin concentrations or glucose concentrations after the reimbursement was accepted by sii , we could not assess whether those with better control of blood glucose concentrations had a different risk of ad . diabetes is commonly undiagnosed , especially among older individuals ( 41 ) , so the misclassification of people with undetected diabetes or diabetes treated with lifestyle modifications as not having diabetes is likely . this has implications for the interpretation of the results : our findings are not as informative on the association of all stages of diabetes as they are on the association of clinically verified and medically treated diabetes . due to the lack of a systematic cognitive assessment of each person included in this study , it is likely that people with cognitive impairment and ad or other dementias were included in the control group . thus , our results are likely an underestimation of the true association between diabetes and ad , although they are consistent with previous studies that were able to adjust for confounders or systematically assess the blood glucose concentrations of participants ( 1 ) . the strengths of the study are sample size , representativeness , length of follow - up , and verified diagnosis of ad . the study sample includes all community - dwelling individuals with ad residing in finland in 2005 . we included only noninstitutionalized people , but it is unlikely that the association between diabetes and ad would be different among institutionalized individuals . we had access to data collected over 30 years , whereas previous studies on type 2 diabetes ( 2126 ) , apart from a few exceptions ( 2729 ) , have included < 10 years of follow - up . since the information on diabetes medication , age at diabetes diagnosis , ad , and cardiovascular diseases was extracted from the registries , the results are not affected by recall bias . although the register - based diagnoses of ad likely underestimate the true prevalence , these diagnoses are more reliable than ad diagnoses extracted from other sources of routine healthcare data , e.g. , national hospital discharge register , as the diagnoses in the special reimbursement register are based on dsm - iv and nincds - adrda criteria whereas the accuracy of diagnoses from the national hospital discharge register may vary considerably , depending on the facility ( e.g. , specialized geriatrics unit vs. general healthcare visit ) . in conclusion , results from this unique nationwide case - control study show that individuals with ad are more likely to have a history of medically treated diabetes than the older population in general and that the association is independent of cardiovascular diseases ." ]

[ "the interventions for carotid artery stenosis , vein graft and acute myocardial infarction could embolize a large amount of plaque debris , especially unstable , ulcerative , and thrombus containing lesions ( 1 ) . distal protection devices such as filterwire ex have been widely used in carotid artery stenting to prevent distal embolization of plaque debris ( 2 ) . the large amount of atherothrombotic debris entrapped in the filter could reduce or stop antegrade flow and may be shown as no reflow phenomenon in case using filter type distal protection device . we present a case of pseudo no - reflow phenomenon after postdilatation of the stent in severe carotid artery stenosis and successful recovery with aspiration thrombectomy using export aspiration catheter .", "a 70-yr - old man was diagnosed with asymptomatic carotid artery stenosis during preoperative risk assessments . he had been treated in our hospital for congestive heart failure and stable angina for 2 yr . carotid angiogram showed no significant stenosis in the left carotid artery and a 90% stenosis in the right internal carotid artery ( fig . shuttle sheath ( 7f , cook medical , bloomington , in , u.s.a . ) was positioned to right common carotid artery via right femoral artery . to prevent distal embolization of plaque debris during angioplasty , filterwire ex ( boston scientific , natick , ma , u.s.a . ) was positioned in the right cervical internal carotid artery distal to stenotic lesion . after predilation with 4.0 mm balloon , 8 mm self - expanding wall stent ( boston scientific ) was positioned across the lesion and was deployed in stenotic lesion . after postdilation of the stent with 6.0 mm balloon , carotid angiogram showed abrupt complete flow interruption ( fig . we decided to perform aspiration thrombectomy using export aspiration catheter ( medtronic ave , santa rosa , ca , u.s.a . ) ( fig . after several passes of export aspiration catheter into the basket ( over the filterwire ex ) , antegrade flow was fully restored ( fig . 3 ) . after retrieval of filterwire ex , whitish debris was noted within the basket ( fig . the patient complained of slight speech disturbance and this neurological abnormality was completely recovered within 24 hr after stenting .", "obstructive carotid artery lesions are known to contain friable , ulcerated and thrombolic material that have the potential to embolize during intervention and may be responsible for the majority of the neurologic events during carotid artery stenting ( 1 ) . a number of \" distal protection \" strategies , designed to capture embolic debris released during carotid intervention , have been evaluated for their efficacy in minimizing the risk of embolic neurologic events . the intravascular filter type distal protection device offers the advantage of a constant cerebral perfusion during carotid artery stenting and allows more time for careful and precise intervention ( 2 ) . during carotid artery stenting using filter type distal protection device , microscopic particles larger than the size of the filter pores ( 80 to 130 m ) could be captured . ( 3 ) reported that carotid artery stenting with filter type distal protection device experienced flow impairment due to filter obstruction in 7.9% of procedures , which was resolved in all cases after filter removal . in our case , we suspected this pseudo - no - reflow phenomenon was induced by obliteration of filter pore by massive atherosclerotic debris . we considered to remove filter by retrieval catheter , however , this process may cause entrapment of filter device to retrieval catheter and embolize massive amount of atherosclerotic debris . therefore , we choose aspiration thrombectomy using export aspiration catheter . after aspiration thrombectomy , flow interruption in the right internal carotid artery was completely restored , therefore , we confirmed this phenomenon as pseudo - no - reflow phenomenon instead of true no - reflow phenomenon . yadav ( 4 ) recommended practically in his review paper if there is no forward blood flow during carotid angioplasty with filter type distal protection device , this should be aspirated before the filter is collapsed . our case is the first case report of pseudo - no - reflow phenomenon in carotid artery stenting using filter type distal protection device and successful recovery of this phenomenon by aspiration thrombectomy using export aspiration catheter . ( 5 ) recently reported that successful management of pseudo - no - reflow phenomenon by the export aspiration catheter in ostial saphenous vein graft intervention using filterwire ex protection . in conclusion , the large amount of atherothrombotic debris entrapped in the filter during carotid intervention could stop antegrade flow . this phenomenon is pseudo - no - reflow phenomenon instead of true no - reflow phenomenon ." ]

[ "although cutaneous melanoma represents less than 5% of the skin cancer is responsible for 80% of cancer deaths with this localization . many studies have also shown that superficial spreading melanomas are found in histological contiguity with a dysplastic nevi . tumor infiltrating lymphocytes are playing an important role , being a strong maker for the immune response in malignant melanoma . the migration of the lymphocytes occurs via high endothelial vessels ( hev ) , blood vessels that are generally found in the lymphoid structures . recently , some studies reported the presence of hevs in solid tumors , including melanoma . in light plump appeareance , examination being surrounded by lymphocytes.this fact supports the hypothesis of thir implication in lymphocytic migration . hev endothelial cells express high levels of 6-sulfo sialyl lewis x ligands recognizd by the specific antibody meca-79 . in this study we have evaluated the potential correlations between the histopathological features of three different skin lesions ( dysplastic nevi , thin and thick cutaneous melanomas ) and the detected number of hev blood vessels ( assessed by the expression levels of the meca-79 ) .", "we have included formalin - fixed and paraffin - embedded tissue samples from a retrospective cohort of patients with dysplastic nevus and primary melanoma collected from 2002 to 2011 ( at the department of pathology of the hospital clinico universitario , valencia ) . the work was conducted in accordance with the declaration of helsinki principles and under the supervision of the hospital clinico universitario ethics committee . we have analyzed a total of 60 samples , 20 of dysplastic nevi and 40 samples of primary cutaneous melanoma ( 20 samples of thin melanoma<1 mm and 20 samples of thick melanoma>1 mm ) during a 10 year period ( 2002 - 2011 ) . the included clinico - pathological characteristics were : age , gender , anatomic sites , regression , breslow thickness , mitoses , clark level , the lymphocytic infiltration ( table 1 ) . characteristics of the patients included in the study the immunohistochemical study ( envision , ref . k5007 , dako , denmark ) was performed with hev - specific mouse monoclonal antibody meca-79 . endogenous peroxidase activity was blocked by incubation in s2023 ( dako ) for 10 min . the slides were incubated for 30 min . with primary antibody meca-79 ( final dilution 100 mg / ml , 30 , at room temperature ) . adjacent control sections were incubated with monoclonal anti - sialyl - i antibody at the same concentrations and using the same procedure . evaluation of the immunohistochemistry was performed by two of the authors ( cm and ga ) , having no knowledge of clinical or molecular data , using an olympus bx40 light microscope , and leica dmd108 digital microscope ( leica microsystems , germany ) . the comparation between groups were analyzed by the two - tailed non - parametric mann - whitney u test and kruskal - wallis test .", "we have included formalin - fixed and paraffin - embedded tissue samples from a retrospective cohort of patients with dysplastic nevus and primary melanoma collected from 2002 to 2011 ( at the department of pathology of the hospital clinico universitario , valencia ) . the work was conducted in accordance with the declaration of helsinki principles and under the supervision of the hospital clinico universitario ethics committee . we have analyzed a total of 60 samples , 20 of dysplastic nevi and 40 samples of primary cutaneous melanoma ( 20 samples of thin melanoma<1 mm and 20 samples of thick melanoma>1 mm ) during a 10 year period ( 2002 - 2011 ) . the included clinico - pathological characteristics were : age , gender , anatomic sites , regression , breslow thickness , mitoses , clark level , the lymphocytic infiltration ( table 1 ) .", "k5007 , dako , denmark ) was performed with hev - specific mouse monoclonal antibody meca-79 . endogenous peroxidase activity was blocked by incubation in s2023 ( dako ) for 10 min . the slides were incubated for 30 min . with primary antibody meca-79 ( final dilution 100 mg / ml , 30 , at room temperature ) . adjacent control sections were incubated with monoclonal anti - sialyl - i antibody at the same concentrations and using the same procedure . evaluation of the immunohistochemistry was performed by two of the authors ( cm and ga ) , having no knowledge of clinical or molecular data , using an olympus bx40 light microscope , and leica dmd108 digital microscope ( leica microsystems , germany ) .", "the comparation between groups were analyzed by the two - tailed non - parametric mann - whitney u test and kruskal - wallis test .", "the most common localization of primary melanoma was trunk 57.5% , followed by extremities 35 % and head 7.5% . localization of skin pigmented lesions included in the study lymphocytic infiltration was present in 80% sample of dysplastic nevus and 75% of primary melanomas . the predominant clark index was iii for 15 samples , iv in 11 samples , ii in 7 samples , v in 4 cases and i in 3 cases ( fig.2 ) . distribution of melanoma samples by clark index ulceration was present in 25% of melanoma samples . positive meca-79 vessels were found at 67% of primary melanoma samples ( fig . 3 , 4 ) and 30% of dysplastic nevi ( fig . 5 ) . dysplastic nevus , meca-79 positive vessels , x20 thin cutaneous melanoma(<1 mm ) , meca-79 positive vessels , x20 thick melanomas ( > 1 mm ) , meca-79 positive vessels , x20 using kruskal wallis non - parametric test we found a positive association between high endothelial vessels and anatomic sites ( p<0,01 ) . we noticed using mann - whitney test a significant correlation between meca-79+vessels and the presence of regression in melanoma samples ( p<0,05 ) . finally we found no significant association between the number of vessels and age , gender , anatomic sites , breslow thickness , ulceration , clark level .", "patients with multiple dysplastic nevi have an increased risk for development of melanoma and to make the distinguish from dysplastic nevi , melanoma sometimes can be challenging . regression is associated with dense lymphocytic infiltrates , the process starts with a dense lichenoid infiltrate of lymphocytes , and ends with fibrosis and/or melanosis within a thickened papillary dermis . [ 6 , 7 ] high endothelial vessels are implicated in lymphocytic trafficking , recently some studies reported the presence of hevs in solid tumors , including melanoma fact that sustain the implication of this type of vessels in anti - tumor response . in this study we have evaluated the potential correlations between the histopathological features of three different skin lesions ( dysplastic nevi , thin and thick cutaneous melanomas ) and the detected number of hev blood vessels ( assessed by the expression levels of the meca-79 ) . we observed that the highest number vessels were found in thin melanoma samples ( fig.6 ) . situation of meca-79 positive vessels in the pigmented lesions included in the study in a similar study , martinet et al.(8 ) detected a high number of hevs in dubreuilh melanoma followed by superficial spreading melanoma . no significant correlation was found between meca-79+vessels and sex , gender , ulceration , breslow thickness , clark level . presence of high endothelial vessels can predict lymphocytes infiltration by governing lymphocyte recruitment and may represent a local vascular respons facilitating the migration of lymphocytes into tumor tissue .", " a better understanding of tumor microenvironment and mechanisms involved in anti - tumor response can play an important role in development of future melanoma therapeutic strategies ." ]

[ "fracture of stems in primary cemented hip arthroplasty is a known complication and has been attributed to varus positioning , excessive weight of the patient , resorbtion of the femoral calcar and failure of the cement mantle . attribute this to reduction in proximal support either in the form of bone loss or an extended trochanteric osteotomy [ eto ] against a distally well - fixed stem . thigh pain , late osteolysis , aseptic loosening and lack of osseous integration are some other complications of uncemented femoral components . reconstruction of the femoral offset during revision hip arthroplasty is important for maintaining the stability of the joint . this coupled with the absence of adequate proximal support in aseptic loosening or eto can lead to increase in implant stresses when the stem is well fixed distally . [ 5 , 6 ] smaller stems in particular are at a greater risk of fracture as the bending moment of a homogenous cylinder is inversely proportional to product of the young s modulus of elasticity and its area moment of inertia . the visible clips were present from the primary surgery and were used to tag the abductor repair case 1 : postoperative radiograph showing a cable plate applied to support a distal peri - prosthetic fracture case 2 : radiograph showing fracture through an echelon stem just distal to the extended trochanteric osteotomy site case 2 : post - operative follow - up radiograph we report 3 cases of uncemented revision stem fractures . we summarize the variables affecting our patients especially regarding poor proximal support and small size of stems .", "a 77-year - old gentleman had a right total hip arthroplasty done in 1998 and subsequently underwent a revision in 2004 of both the femoral and acetabular components for instability and failed prosthesis . an extended trochanteric osteotomy was used to extract the femoral stem which was replaced with a cementless bowed solution stem [ depuy inc . 4 years later with he presented the emergency department with deteriorating groin pain in the absence of trauma . his radiograph [ x - ray 1 ] showed an extensive proximal osteolysis and a transverse fracture at the junction of the proximal and middle third of the stem . his re - revision surgery consisted of a proximal femoral osteotomy to remove proximal end of the stem with care . the stem was replaced with a 16 mm reef prosthesis [ depuy , warsaw , indian ] . the reaming caused a vancouver c type periprosthetic fracture and was treated with a dall - miles cable plate . the eto was repaired using dall - miles cables [ x - ray 2 ] . the post operative xray was taken at the patients last outpatient visit prior to discharge at a time period of 2 years post surgery . a 71-year - old lady had had a left total hip replacement , which had been revised in 2007 for aseptic loosening . components used were a 12 mm echelon stem [ smith and nephew , memphis , tennessee ] . in 2008 she presented with repeated dislocation and underwent further revision with change of liner and exchange of head . in 2009 she presented for routine outpatient review for osteoarthritis of the left knee and incidentally complained of left hip and groin pain for the past month . her radiograph [ x - ray 3 ] showed a fracture of the echelon stem with an obvious non - union of the eto and severe osteolysis under the stem collar . at the time of surgery the trochanteric fragment simply lifted off the femur once the dall - miles clamp was removed . a dall - miles cable was inserted distal to the claw and a proximal osteotomy was performed to reveal the upper 4 cm of the stem . a size 12.5 mm curved osteotome was used carefully throughout the stem to free it up and then using vice - grips and a series of punches the stem was extracted . as the distal cement plug was still present from the primary surgery an intramedullary wire was then passed down through it and 8 mm to 8.5 mm reamers were used to remove it . a mooreland hook was then used to retrieve cement and the canal was further reamed to 14 mm . the stem was replaced with a restoration cone bowed stem [ stryker , mahwah , new jersey ] . this patient continues to do well on ongoing follow - up [ x - ray 4 ] . case 3 : full - length radiograph showing fracture through distal third portion of stem case 3 : magnified view of the same radiograph showing the fractured stem an 82 year old presented to the outpatients departs with worsening difficulty while walking , increasing stiffness and pain in his left hip for 1 month . he had trouble flexing the hip and was focally tender over the greater trochanter and immediately distal to it . he had had a loosening of a left total hip replacement in 2003 that required revision . he underwent revision of the acetabular component with bone grafting of acetabulum and proximal femur . in 2007 the femur was reamed to 13 mm and a restoration stem [ stryker , mahwah , new jersey ] was inserted . in 2012 his radiograph [ x - ray 5 and 6 ] showed a fracture at the femoral stem immediately proximal to the femoral isthmus . during his surgery the distal stem was well fixed and there was a prolonged and difficult trephining over the stem . the stem was eventually removed requiring a vertical cortical breach from the long trephine in distal femur . a 22 mm distal and 23 mm x 75 mm proximal body reclaim modular stem [ depuy inc . he has had an uneventful course of recovery and remains pain free to date with no complaints [ x - ray 7 and 8 ] .", "a 77-year - old gentleman had a right total hip arthroplasty done in 1998 and subsequently underwent a revision in 2004 of both the femoral and acetabular components for instability and failed prosthesis . an extended trochanteric osteotomy was used to extract the femoral stem which was replaced with a cementless bowed solution stem [ depuy inc . 4 years later with he presented the emergency department with deteriorating groin pain in the absence of trauma . his radiograph [ x - ray 1 ] showed an extensive proximal osteolysis and a transverse fracture at the junction of the proximal and middle third of the stem . his re - revision surgery consisted of a proximal femoral osteotomy to remove proximal end of the stem with care . the stem was replaced with a 16 mm reef prosthesis [ depuy , warsaw , indian ] . the reaming caused a vancouver c type periprosthetic fracture and was treated with a dall - miles cable plate . the eto was repaired using dall - miles cables [ x - ray 2 ] . the post operative xray was taken at the patients last outpatient visit prior to discharge at a time period of 2 years post surgery .", "a 71-year - old lady had had a left total hip replacement , which had been revised in 2007 for aseptic loosening . components used were a 12 mm echelon stem [ smith and nephew , memphis , tennessee ] . in 2008 she presented with repeated dislocation and underwent further revision with change of liner and exchange of head . in 2009 she presented for routine outpatient review for osteoarthritis of the left knee and incidentally complained of left hip and groin pain for the past month . her radiograph [ x - ray 3 ] showed a fracture of the echelon stem with an obvious non - union of the eto and severe osteolysis under the stem collar . at the time of surgery the trochanteric fragment simply lifted off the femur once the dall - miles clamp was removed . a dall - miles cable was inserted distal to the claw and a proximal osteotomy was performed to reveal the upper 4 cm of the stem . a size 12.5 mm curved osteotome was used carefully throughout the stem to free it up and then using vice - grips and a series of punches the stem was extracted . as the distal cement plug was still present from the primary surgery an intramedullary wire was then passed down through it and 8 mm to 8.5 mm reamers were used to remove it . a mooreland hook was then used to retrieve cement and the canal was further reamed to 14 mm . the stem was replaced with a restoration cone bowed stem [ stryker , mahwah , new jersey ] . this patient continues to do well on ongoing follow - up [ x - ray 4 ] . case 3 : full - length radiograph showing fracture through distal third portion of stem case 3 : magnified view of the same radiograph showing the fractured stem", "an 82 year old presented to the outpatients departs with worsening difficulty while walking , increasing stiffness and pain in his left hip for 1 month . he had trouble flexing the hip and was focally tender over the greater trochanter and immediately distal to it . he had had a loosening of a left total hip replacement in 2003 that required revision . he underwent revision of the acetabular component with bone grafting of acetabulum and proximal femur . in 2007 the femur was reamed to 13 mm and a restoration stem [ stryker , mahwah , new jersey ] was inserted . in 2012 his radiograph [ x - ray 5 and 6 ] showed a fracture at the femoral stem immediately proximal to the femoral isthmus . during his surgery the distal stem was well fixed and there was a prolonged and difficult trephining over the stem . the stem was eventually removed requiring a vertical cortical breach from the long trephine in distal femur . a 22 mm distal and 23 mm x 75 mm proximal body reclaim modular stem [ depuy inc . he has had an uneventful course of recovery and remains pain free to date with no complaints [ x - ray 7 and 8 ] .", "femoral metaphyseal bone loss and multiple hip surgery can make revision arthroplasty with cement challenging . [ 8 - 9 ] distal diaphyseal fixation achieved in extensively porous coated stems used in uncemented revision , help bypass this problem . these implants give a tight diaphyseal fit and ensure good stability to reduce the likelihood of mechanical failure . however , in these distally well fixed revision stems , finite element analysis done by busch et al . showed that a stress riser arose at the distal end of the eto and coincided with all 5 of their fractured uncemented porous coated stems . they also found that undersized stems , high bmi ( > 30 ) poor proximal bone support , smaller diameter stems [ < 13.5 mm ] and extended trochanteric osteotomy were more prone to fracture . as can be seen from table 1 . majority of these variables pertaining to the cases above are similar . in case 1 with solution stem [ depuy inc . warsaw , indiana ] the fracture was at the junction between proximal and middle thirds , as the patient had been symptomatic but ambulatory for 4 months prior to diagnosis we attribute its failure to cantilever forces occurring at the said junction . patient weight ( 107 kg ) may have also been a contributory factor . in case 2 with echelon stem [ smith and nephew , memphis , tennessee ] the stem fracture was at the distal end of the eto non union keeping with the authors impression that it would lead to the earlier fracturing of the stem relative to the other two cases . the mechanism of failure as in the previous case would be cantilever forces generated by a weak proximal support . in case 3 restoration stem [ stryker , mahwah , new jersey ] the stem fracture was distal in comparison to the previous two cases , we believe that the stress riser was due to the distal fixation rather than a weak proximal support . what is notable is that in all cases there was an absence of trauma and all patients presented with chronic complaints . summary of variables affecting the cases stress risers in extensively porous coated stems are derived from un - united extended trochanteric osteotomy ( eto ) , proximal bone loss and periprosthetic fractures . in the case of an un - united eto proximal bone deficiency can be supported by cancellous impaction allografting or a strut allograft on the tension side of the femur . impaction allografting supplements the proximomedial bone stock ( calcar ) and may help decrease cantilever forces . unfortunately this is not without complication as higher hoop stresses increase the risk of fracture . the authors did not attempt to augment the proximal bone stock by this method for the same reason . augmenting the tension side of the femoral eto with a strut allograft and securing it with proximal and distal cables was an option , unfortunately this was neither available nor routine practice in our unit . the main principle of revision surgery is to achieve a stable fixation of the femoral component . the diaphyseal portion of the femur offers adequate bone stock and can be used for the same as a tight fit also offers good rotation stability . adequate implants and tools must be available during revision [ 14 , 15 ] as stem extraction can be lengthy and difficult as it was in case 3 . lastly when revising with modular stems one must note that most stems fail at the junction of the stem taper . this is due to reducing cross sectional area of the stem taper , it coinciding with the eto and fretting corrosion that may affect the junction . ", "when planning complex revision cases involving long uncemented stems , attention should be given to the above - mentioned variables . x - rays of patients , which have the above , mentioned risk factors should be closely scrutinized as early diagnosis of impending failure can make revision surgery less difficult ." ]

[ "these include open , laparoscopic , or endoscopic approaches . however , there are disadvantages and limitations with each of these techniques . the open method requires a large incision with its associated morbidity , and the laparoscopic techniques described so far are technically challenging in the pediatric population . the endoscopic approach has poor results as the cystenteric opening is small and tends to occlude leading to recurrence and infection . we describe our combined technique of laparoscopic and gastroscopic transgastric cystogastrostomy for pseudopancreatic cysts in children .", "she had high amylase and lipase levels and a computed tomographic ( ct ) scan showed necrotizing pancreatitis . subsequently , an abdominal ct scan revealed a well - formed wall enhancing pseudopancreatic cyst ( fig . axial cut of computed tomographic scan demonstrating pseudocyst posterolateral to stomach . under anesthesia a pediatric pentax gastroscope ( pentax medical company , montvale , new jersey , united states ) three more 5-mm step ports were placed under direct vision : 2 ports on either side of the umbilicus and 1 port just under the costal arch to retract the gall bladder . using these ports , the stomach was insufflated with air from the gastroscope and two sutures of 30 vicryl were placed to pexy the stomach to the abdominal wall using a granee needle ( r - med , oregon , ohio , united states ) ( fig . a 12-mm port was then directly introduced into the stomach under vision of the gastroscope as well as the laparoscope ( fig . it is very important to have the visualization through the gastroscope while placing the initial transgastric port as the cyst protruding from the posterior gastric wall compromises the gastric lumen severely . if performed without the visualization of the gastroscope there is a risk injury to the posterior gastric wall during the transgastric port placement . one of the other ports used for gallbladder removal was then also introduced into the stomach under vision . the 5-mm 30-degree telescope was then introduced into the stomach and the stomach was continuously insufflated with low flow . a laparoscopic needle was introduced through the laparoscopy port into the cyst to confirm the position of the cyst ( fig . a harmonic scalpel was then introduced into the stomach through the same port and an opening was made into the posterior wall of the stomach in to the cyst ( fig . once this was achieved a 30-mm endo gia ( covidien , mansfield , massachusetts , united states ) stapler was introduced through the 12-mm umbilical port and a stapled cystogastrostomy was achieved ( fig . ( a ) laparoscopic needle inserted in the posterior gastric wall to confirm the presence of pseudocyst . ( b ) harmonic scalpel used to incise the posterior wall of stomach and the pseudocyst after needle aspiration of the pseudocyst . ( c ) endo gia stapler being applied to the posterior gastric wall and the pseudocyst . ( d ) endo gia stapler applied to the posterior gastric wall and the pseudocyst .", "under anesthesia a pediatric pentax gastroscope ( pentax medical company , montvale , new jersey , united states ) was introduced into the stomach . three more 5-mm step ports were placed under direct vision : 2 ports on either side of the umbilicus and 1 port just under the costal arch to retract the gall bladder . using these ports , the stomach was insufflated with air from the gastroscope and two sutures of 30 vicryl were placed to pexy the stomach to the abdominal wall using a granee needle ( r - med , oregon , ohio , united states ) ( fig . a 12-mm port was then directly introduced into the stomach under vision of the gastroscope as well as the laparoscope ( fig . it is very important to have the visualization through the gastroscope while placing the initial transgastric port as the cyst protruding from the posterior gastric wall compromises the gastric lumen severely . if performed without the visualization of the gastroscope there is a risk injury to the posterior gastric wall during the transgastric port placement . one of the other ports used for gallbladder removal was then also introduced into the stomach under vision . the 5-mm 30-degree telescope was then introduced into the stomach and the stomach was continuously insufflated with low flow . a laparoscopic needle was introduced through the laparoscopy port into the cyst to confirm the position of the cyst ( fig . a harmonic scalpel was then introduced into the stomach through the same port and an opening was made into the posterior wall of the stomach in to the cyst ( fig . once this was achieved a 30-mm endo gia ( covidien , mansfield , massachusetts , united states ) stapler was introduced through the 12-mm umbilical port and a stapled cystogastrostomy was achieved ( fig . ( a ) laparoscopic needle inserted in the posterior gastric wall to confirm the presence of pseudocyst . ( b ) harmonic scalpel used to incise the posterior wall of stomach and the pseudocyst after needle aspiration of the pseudocyst . ( c ) endo gia stapler being applied to the posterior gastric wall and the pseudocyst . ( d ) endo gia stapler applied to the posterior gastric wall and the pseudocyst .", "the patient tolerated the procedure well with no intraoperative complications and was started on a regular diet on the fourth postoperative day . she had well - healed scars and was tolerating a regular diet with no other problems .", "pancreatic pseudocysts , because of pancreatitis , trauma , or ductal obstruction , are uncommon in children.1 however , they may require treatment if symptomatic or persist after 4 to 6 weeks . internal drainage of pancreatic pseudocysts has traditionally been accomplished by laparotomy , although laparoscopic and endoscopic modalities have recently been described . the open technique has been shown to have mortality rates of 1 to 6% , complication rates of 10 to 40% , and recurrence rates of 5 to 20%.2 \n the laparoscopic technique consists of either creation of an anterior gastrotomy to create a psuedocyst gastrostomy or identification of the cyst stomach interface through the lesser sac.3 both modalities have been shown to be safe and effective in the adult literature but both can be technically challenging and cumbersome in the smaller working space in children . endoscopic therapy alone involves identifying the region of the cyst bulge with the endoscope , needle localization of the tract , and stent placement for internal drainage . however , the cystenteric opening is limited in size which can lead to occlusion , infection , or recurrence.4 \n 5 beckingham et al performed endoscopic drainage in 34 adults with a success rate of 71% . the failures were found to be associated with pseudocysts complicated by acute necrotizing pancreatitis and cyst wall thickness greater than 1 cm.6 repeated procedures due to catheter - related complications requiring additional anesthetics are not ideal in the pediatric population . melman et al compared the three techniques for drainage of pancreatic pseudoscyts in adults and found lower primary success rates for endoscopic drainage as compared with laparoscopic and open cystgastrostomies as well as the need for repeat procedures.5 \n the approach of combined laparoscopic and endoscopic / gastroscopic pseudocyst gastrostomy using intraperitoneal and as well as intragastric visualization has been described in the adult literature but has not been previously reported in children.4 \n 7 the use of the laparoscopy during cystgastrostomy allows for pseudocyst debridement , fashioning a large communication between the cyst and stomach , as well as minimizes the risk of complications such as gastric perforation . in addition , laparoscopy adds the ability to add other procedures if needed such as cholecystectomy as was done in this case . gastroscopy helps in visualization of the primary transgastric port placement preventing injury to the posterior gastric wall and gastric insufflation during the procedure . finally , the decreased need for additional port sites leads to an improved cosmetic result which is of particular interest in the pediatric population .", "laparoscopic gastroscopic transgastric cystogastrostomy is a safe technique for the treatment of pancreatic pseudocysts in children ." ]

[ "however , due to the high computational cost required for \n reconstruction , its real - time imaging applications remain \n challenging . bolus - chasing computed tomography ( ct ) angiography is \n a primary example which demands real - time ct feedback . to address this problem , for example , xtrillion ( by terarecon , \n inc . ) uses an application - specific pci card , while mercury \n computer systems relies on blade - based linux clusters . however , \n the specialized hardware is expensive and unsuitable for general \n purpose applications . alternatively , efforts are made using \n graphic cards [ 2 , 3 ] , since the main operation for commercial \n ct reconstruction is backprojection , similar to texture mapping in \n computer graphics . although graphics cards are highly \n optimized , they do not support floating - point calculations . that \n the latest graphics cards can implement virtual floating - point \n calculations [ 3 , 5 ] , they do not support full 32 bits \n floating calculations . another bottle - neck is that the graphic \n cards require data exchange between cpu and gpu . in this paper , a multi - core pc - based acceleration scheme is \n proposed for filtered - backprojection-(fbp- ) based image \n reconstruction . third , the single - instruction multiple - data \n ( simd ) technique is employed for data - level parallel processing . \n fourth , the multithreading programing is done to take advantage of \n multi - core processors , realizing the true parallel computation \n capability . finally , an intel c++ complier is used to optimize the \n code for intel processors . the ct reconstruction algorithm is \n overviewed , and then each of our acceleration techniques is \n described . in section 3 , numerical experiments on \n various datasets and different pcs are presented to \n evaluate the speedups with our scheme and the conventional \n implementation . in section 4 , relevant issues and \n research directions are discussed .", "the most popular multislice ct reconstruction methods remain data \n rebinning - based fan - beam reconstruction filtered backprojection \n ( fbp ) algorithms . therefore , our work is focused on the typical \n fan - beam fbp algorithm . note that the application of our scheme is \n not limited to the fan - beam case , because it can also be applied \n to accelerate the latest approximate cone - beam algorithms \n [ 68 ] , which can be treated as generalized fan - beam \n reconstruction algorithms . in a typical ct setting , the data acquisition system ( an x - ray \n source and a detector assembly ) is rotated rapidly in the gantry \n while the patient on a table is translated into the gantry \n opening . this process is illustrated in figure 1 . \n because the multi - row detector arrays span a very small cone \n angle , acquired helical scan data are usually rebinned into a \n series of virtual circular scan data for reconstruction of a stack \n of images . here we assume a method from , in \n which the virtual fan - beam projection data are calculated \n according to the following formula : \n ( 1)pc ( ,,z0)=ph(,,z())zbza + zb + ph(,+2,z(+2))zaza + zb , \n where = + k \n 2 , k \n n , so that za \n z0 \n zb , pc \n denotes virtual circular scan data , ph \n denotes acquired helical projection , \n za and zb \n are the distances from projections a and \n b to the virtual circular plane , respectively , in \n figure 2 , and are the projection \n angles shown in figure 3 . after transforming helical projection data \n ph to circular fan - beam projection \n data pc , the conventional fan - beam \n reconstruction algorithm can be used . as the rebinning \n cost is insignificant , our optimization targets the reconstruction \n process : \n ( 2a)f(x , y , z0)=021l2pc , f(0,,z0)d , \n ( 2b)pc , f(,,z0)=pc(,,z0)dcos 22sin2h( ) , \n ( 2c)l = d2+r22drcos( ) , \n ( 2d)0 = arcsinrsin( ) l , \n where f is an object function to be \n reconstructed , pc , \n f are the filtered projection data , \n d is the distance from the source to the center \n of rotation , and h( ) is the ramp filter \n . while the inner convolution is the filtration process , \n the outer integration is the most time - consuming backprojection \n process , as shown in figure 4(a ) . \n since the backprojection is the bottleneck , let us analyze the \n backprojection process as shown in algorithm 1 . \n clearly , a large part of the computational cost is due to the \n inner loop that calculates 0 , \n 1/l , interpolation coefficients , and \n accumulates the incremental contributions to the final \n reconstruction . in the following , we show how the backprojection \n can be speeded up using various techniques . for our circular fan - beam reconstruction , two types of symmetries \n are available , which are referred to as the right - angle symmetry \n and complement symmetry . the right - angle symmetry , or 90-degree \n symmetry , is shown in figure 5 . that is , a new pair of \n source and pixel positions is obtained by applying a 90-degree \n rotation to a current pair of source and pixel positions . the \n resultant 4 pairs of source and pixel positions share the same \n 1/l and 0 , which \n can be calculated from ( 3 ) and ( 4 ) , respectively . \n as the interpolation coefficients required by the backprojection \n are determined by 0 , they are the same as \n well . therefore , for the four sets under consideration , the \n calculations of these parameters need to be done only once : \n ( 3)lset1 = d2+r22drcos ( )=d2+(xp2+yp2)2drcos(tan1(xp , yp))=d2+(yp2+xp2)2drcos(+2tan1(yp,xp))= lset2 = d2+(xp2+yp2)2drcos(+tan1(xp,yp))= lset3=d2+(yp2+xp2)2drcos(+32tan1(yp , xp))= lset4 , \n ( 4)0,set1=arcsinrsin(tan1(xp , yp))l = arcsinrsin(tan1(yp , xp)/2)l=0,set2=arcsinrsin(tan1(xp , yp))l=0,set3=arcsinrsin(tan1(yp , xp)3/2)l = 0set4 , \n where ( xp , \n yp ) denotes the pixel \n in the first quadrant . the following two requirements , which are \n usually satisfied in practice , are necessary to use the \n right - angle symmetry . the first requirement is that the projection \n data must be available at the involved four angles . namely , the \n number of projections in a full scan must be divisible by 4 , which \n is reasonable for current medical ct scanners . for instance , a \n somatom system generates 1160 projections per turn , while a \n lightspeed scanner produces 984 projections per turn . the other \n requirement is that the reconstruction region must be symmetric \n about the x- and y - axes , such \n as a square or a circle in the clinical imaging situation . \n the second type of symmetry is the complement symmetry , as shown \n in figure 6 . here , a pair of source and pixel \n positions complements the other pair of source and pixel positions \n if they are symmetric with respect to a diagonal line ( e.g. , \n y = x ) . for these 2 pairs of \n source and pixel positions , l s are the \n same , while 0 for one has the opposite \n sign of that for the other , as shown by ( 5 ) and \n ( 6 ) , respectively , \n ( 5)lset1 = d2+r22drcos ( )=d2+(xp2+yp2)2drcos(tan1(xp , yp))=d2+(yp2+xp2)2drcos(2tan1(yp , xp))= lset2c , \n ( 6)0,set1=arcsinrsin(tan1(xp , yp))l = arcsinrsin(tan1(yp , xp)(/2))l=0,set1c . \n therefore , such a symmetry can also be used to reduce the \n computational cost . the requirements for use of the complement \n symmetry are the same as those for the right - angle symmetry . \n using these two types of symmetries , the backprojection can be \n significantly speeded up , since only one set of parameters needs \n to be calculated for the eight sets . the implementation of the \n backprojection is accordingly modified , as shown in \n algorithm 2 . note that after the calculation of \n 0 and l once for 8 pairs of source and detector \n positions , 8 filtered projection values are put to 8-pixel \n positions together in the inner - loop . to evaluate the computational complexity , the time for cpu to \n access data must be considered , especially for the ct \n reconstruction process because the backprojection requires \n frequent visits to a great amount of filtered projection and image \n data . the cpu data access mechanism with multi - level caches is \n illustrated in figure 7 . specifically , a cache can be \n used to reduce the average time to access data in the main memory \n ( ram ) . the cache is a smaller , faster memory chip which stores \n copies of data from the most frequently used main memory \n locations . as long as a majority of memory accesses are to the \n cached memory locations , the average latency of memory accesses \n will be reduced to the cache latency , instead of the main memory \n latency . the l2 cache is faster than ram and about \n 1 2 mb . the slowest ram is 1 4 gb . when the processor needs to read from or write to the main memory , \n it first checks if the data is in the cache . if it is in the \n cache , we say that a cache hit has occurred ; otherwise a cache \n miss is counted . in the case of a cache hit , however , in the case of a \n cache miss , it takes much longer time to access the data . due to \n the limited cache capacity , one way to execute the code \n efficiently is to increase the hit rate by optimizing the data \n structures . usually , projection data are sequentially stored in the order of \n , while reconstructed images are stored rowwisely . thus , \n for implementation of the right - angle and symmetry , the access to \n 8 pairs of projection and image data will very likely result in \n cache misses due to the address gaps , as shown in \n figure 8 . such misses within the inner loop will \n cause a significant latency . to address this problem , in our \n optimized data structures all the data are arranged into blocks \n indexed to reflect symmetric relationships . therefore , the cache \n miss rate can be greatly reduced in the inner loop . the simd technique enables the data - level parallelism like in a \n vector processor , as shown in figure 9 . with an simd \n processor , one instruction can process a block of data at a time \n instead of just one datum , which is much more efficient than the \n conventional single instruction single - data ( sisd ) technique . \n small - scale ( 64 or 128 bits ) simd operations are now popular \n supported by general pc cpus , such as those from intel and amd \n [ 12 , 13 ] . we use the intel sse ( streaming simd extensions ) \n instruction set to implement the simd technique in our \n backprojection process . within the inner loop , we backproject 8 \n projection data onto 8 pixels , according to the same \n instructions such as interpolation , weighting , and accumulation . \n therefore , we have a perfect situation to employ the simd \n technique . as the sse only supports simultaneous processing of 4 \n floating data at a time ( 128-bits register ) , 8 data are processed \n in two groups . in recent years their efforts have now \n shifted from improving the clock speed to increasing the number of \n cores within a processor . however , a processor with more \n than one core can not achieve a better performance unless parallel \n computation schemes are applied . therefore , to take advantage of \n multi - core processors , multi - threaded programing must be done . from the flowchart of our algorithm , thus , the backprojection can be \n implemented in parallel by assigning different loop ranges to \n various cores of the processor . after all the threads are \n finished , the final result can be assembled from the results of \n each thread . in our implementation ( figure 4(b ) and \n algorithm 2 ) , we divide the loop of \n y , instead of the loop of . usually , the \n number of cores on a pc is 2 , 4 or 8 , it is not common for \n n/4 to be an integer , but it \n is always the case for \n ny to be 256 , 512 , \n or 1024 . our parallel implementation on a multi - core pc is more \n efficient than that on a pc cluster in terms of time required for \n data exchange between threads . in our case , the data exchange is \n via on board ram bus , while the pc cluster 's data exchange \n via local network is significantly slower . the intel c++ compiler creates applications that can run at the \n fastest speeds on the intel processors . it can take the full \n advantage of the intel processors when compiling codes and \n generating object files . this provides an integrated development \n environment . in our implementation , we use it to optimize the code \n for pentium d and xeon processors .", "to test the gain of our scheme , we ran our accelerated code on \n pentium d and xeon pcs . , different sizes of projection \n datasets and reconstructed images were tested to evaluate the \n efficiency under various conditions . here to test effeteness of each technique , the reconstruction \n times and speedups are tested by applying them gradually . the \n reconstruction experiments are done based on our hp6200 \n workstation and reconstructing a 512 512 image from a \n projection dataset ( 1160 672 ) . the reconstruction results \n are shown by applying techniques step by step \n ( table 2 ) . the overall speedup and individual speedups \n for each technique are also calculated to show the efficiency of \n them . the speedup results for different projection datasets and image \n matrix sizes are shown in tables 3 , 4 , and \n figure 10 . significant speedups were achieved using our scheme . \n in the case of 1160 views and 512 512 image , the \n reconstruction time was decreased from 52 seconds to 1.35 seconds . \n for a one - core computer , the speedup was more than 20 times . for a \n two - core computer , the images reconstructed using our scheme and the \n conventional method are shown in figure 11 . all the \n images were reconstructed using 32-bit floating - point data and \n were displayed in the same window [ 0.97 , 1.05 ] . the images \n reconstructed using our accelerated and conventional schemes are \n essentially the same .", "as the ct reconstruction algorithm is highly parallelizable , the \n speedup can be improved with more cores almost linearly . for \n example , with two quad - core processors , the speedup that could be \n achieved is more than 100 . as compared to other acceleration \n techniques , such as those based on specialized hardware and \n graphics cards , our general purpose pc - based scheme is much \n cheaper without compromising image quality . for example , a \n general purpose hp or dell workstation with a top - line two \n quad - core processor and 8 gb ram is less than $ 7000 . all \n calculations are based on 32-bit floating point data , providing \n sufficient accuracy for medical imaging applications . in terms of the absolute reconstruction time for a 512 512 \n image from 1160 projection views if the latest multi - core processor is \n used , the total time can be easily decreased by several folds . as \n the computers we have still use the previous generation processor , \n the potential improvement is at least 5 times if we are equipped \n with the latest quad - core processors , that is , the \n reconstruction time may be reduced to 0.3 second . hence , it is \n quite promising for real - time ct applications , such as project on \n bolus - chasing ct angiography . in conclusion , our acceleration scheme has integrated several \n techniques including utilization of geometric symmetry , \n optimization of data structures , single - instruction multiple - data \n ( simd ) processing , multi - threaded computation , and an intel c++ \n complier . as a result , it has speeded up the reconstruction \n process by 40 times , as compared to the conventional \n implementation on a general purpose pc with 2 cores . further work \n is in progress to improve our results using the latest pcs and \n extend our scheme for cone - beam reconstruction ." ]

[ "the amination of c h bonds provides a \n route to n - alkyl and n - aryl amine \n derivatives that avoids typical functional group interconversions \n and reactants containing a functional group already present at the \n position where a c n bond is desired . n bonds are \n particularly challenging to achieve , but such reactions could directly \n modify complex molecules , create chemical feedstocks , or create functionalized \n polymers . methods for the oxidation of alkanes by \n the combination of peroxides and iron complexes have been developed , but intermolecular functionalization of purely unactivated c h \n bonds with reagents that form products containing common nitrogen - based \n functionality are rare . h bonds have been catalyzed by copper complexes \n and occur at benzylic or allylic positions . reactions catalyzed by dirhodium complexes are the most developed \n for the synthesis of complex molecules . although remarkable \n developments and applications have been reported for intramolecular \n reactions , intermolecular reactions are more limited . h \n bond of the substrate , such that the preferred sites of reactions \n are tertiary , benzylic , and secondary c h bonds . when a nitrene is the reactive intermediate , the nitrogen - based \n reagent is limited to those containing just one substituent . we sought an alternative route to the intermolecular functionalization \n of alkyl c h bonds that could form n - alkyl \n amides , carbamates , and imides , in addition to the formation of sulfonamides . \n amides , carbamates , and imides are more common synthetic intermediates \n or final products than those generated by prior copper - catalyzed reactions \n with alkyl c h bonds . we also \n sought to conduct these transformations with readily accessible complexes \n of first - row metals . although copper - catalyzed reactions at allylic \n and benzylic c h bonds with carboxylic acids and sulfonamides \n in the presence of peroxides is well - known ( karasch - sosnovsky reaction ) , and the mechanism of these reactions has been studied , the amidation of c h bonds with such reagents has been limited \n to reactions at benzylic c h bonds . we report the reactions of common amides , carbamates , and \n imides \n with alkanes to form n - alkyl derivatives with simple \n copper catalysts and a peroxide ( scheme 1 ) . \n the amidation of alkanes under our catalytic conditions preferentially \n forms the products from amidation at secondary sites over tertiary \n sites and even leads to the functionalization of primary c mechanistic data from the stoichiometric reactions \n of isolated copper amidate or imidate complexes indicate that the \n transformation of alkanes to n - alkyl products likely \n occurs by the reactions of a alkyl radicals with copper(ii ) amidate \n and imidate complexes .", "h bonds , we evaluated the reactivity \n of benzamide ( 0.5 mmol ) and cyclohexane ( 10 equiv ) with 2.55.0 \n mol % of various copper precatalysts and oxidants . results for the \n copper - catalyzed amidation of cyclohexane with benzamide are presented \n in table 1 . the combination of copper and tbuootbu was crucial for catalysis ; other \n peroxide - based oxidants and redox - active 3d transition metals did \n not yield the amidation product . conditions : 0.5 mmol of benzamide , \n 5.0 mmol of cyclohexane , 0.0125 mmol of catalyst , 0.0125 mmol of ligand , \n 1.0 mmol of oxidant , 1 ml of phh at 100 c for 24 h. gc yield with n - dodecane \n as the internal standard . the reactions \n catalyzed by cu(i ) and cu(ii ) salts without ligand \n gave the n - cyclohexylbenzamide in low yields ( entry \n 14 , 1027% ) . however , the reactions catalyzed by cu(i ) \n and bipyridine ( bipy ) , gave n - cyclohexylbenzamide \n in a measurably higher 36% yield . reactions catalyzed by the well - defined \n [ ( l1)cucl ] precatalyst ( entry 8) ( l1 = ( ( ( 2-(dimethylamino)ethyl)imino ) \n methyl)phenoxide ) provided 83% of n - cyclohexylbenzamide . \n finally , we found that the reaction of benzamide with cyclohexane \n catalyzed by the simple combination of phenanthroline ( phen ) ( entry \n 6 ) or 4,7-dimethoxy - phenantronline ( ( meo)2phen ) ( entry \n 7 ) and cui formed n - cyclohexylbenzamide in nearly \n quantitative yield . the scope of benzamides that undergo \n this c h bond amination \n reaction is summarized in table 2 . benzamides \n containing electron - withdrawing groups , such as cl , br , f , and cf3 ( a d ) , underwent the reaction to give \n good yields of the corresponding amidation product ( 7382% ) . \n benzamides containing electron - donating groups , such as me , bu , and ome ( e k ) , also underwent \n the amidation process , but the isolated yields of the amidation products \n were slightly lower ( 5578% ) than those of the benzamides containing \n electron - withdrawing groups . heteroaromatic amides , such as 2-thienylamide ( m ) and 2-pyridylamide ( l ) , also underwent the \n oxidative coupling with cyclohexane to give the corresponding n - alkyl products . the reaction of the 2-pyridylamide is \n noteworthy because the 2-pyridylamide product could form a strong \n chelating ligand that would prevent catalysis . the position of the \n substituent on the benzamide ( ortho , meta , or para ) did not have a \n pronounced effect on the reaction yields . conditions : 0.5 \n mmol of amide , 5.0 \n mmol of cyclohexane , 0.0125 mmol of cui , 0.0125 mmol of ( meo)2phen , 1.0 mmol of tbuootbu , 1 ml of phh at 100 c for 24 h. four equivalents of oxidant . the reactions of cyclohexane with primary and secondary \n alkyl amides , \n carbamates and imides also occurred ( table 2 ) . the yields of the reactions of cyclohexane with acetamide ( n ) , tert - butylcarbamate ( o ) , \n and toluenesulfonamide ( p ) to form n - cyclohexylacetamide , tert - butyl - n - cyclohexylcarbamate , and n - cyclohexyltoluenesulfonamide \n ( 38% , 42% , and 55% , respectively ) were lower than those that formed n - alkyl benzamides . however , the reaction of tert - butylcarbamate , with excess tbuootbu ( 4 equiv ) gave tert - butyl - n - cyclohexylcarbamate \n in 75% yield . the reactions of cyclohexane with secondary nitrogen \n sources ( n - methylbenzamide , phthalimide , pyrrolidinone , \n and n - me - p - toluenesulfonamide ) also \n occurred \n to form the corresponding n - alkyl products . the yields \n of these reactions were variable ( 1075% ) ( q t ) , but they do demonstrate that the mechanism can not involve a nitrene \n intermediate . the reaction of phthalimide was improved from 20% to \n 75% by changing the solvent from benzene to 1,2-dichlorobenzene to \n increase the solubility of the reagent . the selectivities for \n amidation of various alkanes with benzamide \n are presented in table 3 . h bonds formed \n products from functionalization at the secondary c h bonds \n ( entry 15 ) . for example , the major products of the reactions \n of benzamide with trans- and cis-1,4-dimethylcyclohexane ( entry 1,2 ) resulted from amidation of secondary \n c h bonds , while the minor products resulted from the amidation \n of primary c no product was formed from amidation \n of the tertiary c h bond . likewise , the reaction of 3-ethylpentane \n ( entry 5 ) occurred preferentially at secondary and primary c the reaction of 2,4-dimethylpentane \n ( entry 7 ) , in which the secondary c h bond is hindered , occurred \n exclusively at the primary c h bond . this product distribution \n contrasts that of most c h oxidations by a radical mechanism . for reactions of cycloalkanes ranging from cyclopentane to cyclododecane , \n the ring size did not affect the yield of the corresponding n - alkyl products ( 6980% ) ( entry 8) . conditions : 0.5 mmol of benzamide , \n 1 ml of alkane ( 1017 equiv ) , 0.0125 mmol cui , 0.0125 mmol \n of ( meo)2phen , 2.0 mmol of tbuootbu , 1 ml of o - c6h4cl2 at \n 100 c for 36 h. regioselectivity determined by crude h nmr . yield for the reaction \n with t - butylcarbamate . to assess \n whether copper - amidate and copper - imidate complexes with cu in the \n oxidation state of + 1 and + 2 are intermediates in the catalytic amidation \n reactions , we synthesized and characterized a variety of these amidate \n and imidate complexes supported by phen and 2-(dimethylamino)ethyl)imino)methyl ) \n phenoxide ( l1 ) ( scheme 2 ) . salt - metathesis \n reactions of [ ( phen)cucl]2(-cl)2 with \n potassium phthalimide ( kphth ) or a combination of naotbu and h2nso2ph or h2ncoph in thf \n at room temperature yielded air- and moisture - stable [ ( phen)cu(phth)2 ] ( 1-phth2 ) , [ ( phen)cu(nhso2ph)2 ] ( 2 ) , and [ ( phen)cu(nhcoph)2 ] ( 3 ) , respectively . phen - ligated cu(i ) complexes containing benzamidate and \n benzenesulfonamidate \n ligands were isolated from the reaction of [ cu(mes)]n with phen , followed by the addition of benzenesulfonamide \n and benzamide to produce the corresponding products [ ( phen)2cu][cu(nhso2ph)2 ] ( 4 ) and [ ( phen)2cu][cu(nhcoph)2 ] ( 5 ) . the complex \n [ ( phen)cu(phth ) ] ( 1-phth ) salt - metathesis reactions \n of [ ( l1)cucl ] with phthalimide \n ( hphth ) , benzenesulfonamide , \n and benzamide produced the corresponding cu(ii ) complexes of [ ( l1)cu(phth ) ] ( 6 ) , [ ( l1)cu(nhso2ph ) ] ( 7 ) , and [ ( l1)cunhcoph ] ( 8) ( scheme 2 ) . previous structural \n characterizations of phen - ligated copper(i ) \n amidate and imidate complexes revealed that these complexes can exist \n as mononuclear or ion - pair species . therefore , we assessed the atomic \n connectivity of 1-phth2 and 4 by single crystal x - ray diffraction ( xrd ) analysis . all pertinent bond distances and angles for these \n complexes are listed in the caption of figure 1 . phen - ligated cu(ii ) phthalimidate 1-phth2 is mononuclear in the solid state with a square planar \n geometry around the cu(ii ) ion ( figure 1 ) . molecular \n structures of [ ( phen)cu(phth)2 ] ( 1-phth2 ) , [ ( phen)2cu ] [ cu(nhso2ph)2 ] ( 4 ) , [ ( l1)cu(phth ) ] ( 6 ) , and [ ( l1)cu(nhso2ph ) ] ( 7 ) shown with 50% thermal ellipsoid . selected bond lengths ( ) \n and angles ( ) of 1-phth2 : cu1n1 = 2.0480(14 ) ; cu1n2 = 2.0363(14 ) ; cu1n3 \n = 1.9667(14 ) ; n1cu1n3 = 170.29(5 ) ; n1cu1n2 \n = 93.45(5 ) ; n1cu1o1 = 92.5(3 ) . selected bond lengths \n ( ) and angles ( ) of 4 : cu1n1 \n = 1.9920(15 ) ; cu1n2 = 2.1079(16 ) ; cu1n3 = 1.8553(17 ) ; \n n1cu1n2 = 81.75(6 ) ; n3cu1n3 \n = 178.92(10 ) . selected bond lengths ( ) and angles ( ) of 6 : cu1n1 = 1.938(7 ) ; cu1n2 = 2.045(7 ) ; \n cu1n3 = 1.958(7 ) ; cu1o1 = 1.919(6 ) ; n1cu1n3 \n = 175.2(3 ) ; n1cu1n2 = 83.4(3 ) ; n1cu1o1 \n = 92.5(3 ) . selected bond lengths ( ) and angles ( ) of 7 : cu1n1 = 1.956(6 ) ; cu1n2 = 2.104(6 ) ; \n cu1n3 = 1.972(6 ) ; cu1o1 = 1.993(5 ) ; n1cu1n3 \n = 170.0(2 ) ; n1cu1n2 = 83.7(2 ) ; n1cu1o1 \n = 91.2(2 ) . in contrast , the copper(i ) \n compounds were ion pairs in the solid \n state . the structure of phen - ligated benzenesulfonamidate 4 is an ion pair consisting of the cationic [ ( phen)2cu ] , in which cu(i ) is ligated by two phen ligands in a distorted \n tetrahedral environment , and the linear anion [ cu(nhso2ph)2 ] ( figure 1 ) . in contrast to the diverse molecular structures of phen - ligated \n copper species , complexes 6 and 7 containing \n the tridentate amino imine phenoxide ligands are mononuclear cu(ii ) \n species with square - planar geometries in the solid state ( figure 1 ) . these structures are also mononuclear in solution , \n as evidenced by x - band epr spectroscopy recorded at 20 k in ch2cl2 indicating an axial environment . to determine whether the structures of 1-phth2 and 4 in solution \n differ from those \n in the solid state we measured the conductivities \n of 1-phth2 , and 4 in dmso . the conductivities of 1-phth2 , and 4 ( 1.0 mm in dmso , 25 c ) were compared \n to those of a 1.0 mm ( dmso ) solution of ferrocene ( 0.2 cm mol ) and n(bu)4cl ( 11.1 cm mol ) . the conductivity of the solutions of cu(i ) complexes 4 and 5 in dmso ( 1.0 mm ) were 33.0 and 23.1 cm mol , respectively . \n these values are similar to the reported values for related ( phen)cu(i ) \n amidate and imidate complexes . in contrast , \n the conductivity of the solution of 1-phth2 was 0.0 cm mol , showing that 1-phth2 retains its neutral , mononuclear structure in dmso . \n moreover , the results for conductivity of 6 ( 0.0 cm mol ) and 7 ( 0.1 cm mol ) also revealed that these complexes are neutral molecules \n in solution . unfortunately , the insolubility of 1-phth2 and 4 in benzene prevented \n the measurement of their conductivities in a less polar solvent . to gain information on the mechanism \n of the catalytic amidation of alkanes , we conducted catalytic and \n stoichiometric reactions with isolated [ ( phen)cu(phth)n ] ( n = 1 , 2 ) complexes . these well - defined complexes \n contain a reactive phthalimidate group bound to copper in the oxidation \n states of + 1 and + 2 . first , we investigated the effect of the \n oxidation state of the metal in the copper complexes lying on the \n catalytic reaction . the reactions of cyclohexane with hphth catalyzed \n by 2.5 mol % of 1-phth2 and 2.5 \n mol % of 1-phth produced n - cyclohexylphthalimide \n ( cy - phth ) in 54% and 80% yield , respectively ( scheme 3 ) . n - methylphthalimide ( me - phth ) was observed \n in 13% and 20% yields in the reactions catalyzed by 1-phth2 and 1-phth , respectively . \n the observation of this side - product implies the intermediacy of a tert - butoxy radical because this radical is known to undergo \n -me scission to generate a methyl radical . this methyl radical can then combine with 1-phth2 to form me - phth ( scheme 3 ) . the observation of this side \n product suggests that the n - cyclohexylphthalimide \n forms from a reaction between 1-phth2 and a cyclohexyl radical generated from hydrogen atom abstraction \n of cyclohexane by a tert - butoxy radical . in the reaction catalyzed by 1-phth , the \n orange solution \n of 1-phth rapidly transformed to a light - blue suspension . \n a similar light - blue suspension was also observed in the reaction \n catalyzed by 1-phth2 . moreover , 1-phth2 was isolated from a reaction \n of 1-phth , tbuootbu , \n and hphth in benzene at 100 c for 0.5 h ( scheme 4 ) . the identity of 1-phth2 was confirmed by comparison of its ir spectrum to that of the authentic \n sample of 1-phth2 , prepared by \n the method in scheme 2 , and by elemental analysis . \n the isolation of 1-phth2 from \n the reaction catalyzed by 1-phth clearly demonstrates \n that a cu(i)-imidate or amidate is a short - lived species in the presence \n of excess oxidant and imide or amide under catalytic conditions . therefore , \n under the catalytic condition , the predominant species in the system \n is a cu(ii)-amidate or imidate complex . second , we investigated the role of oxidant in the catalytic \n reaction \n by conducting a series of stoichiometric reactions with 1-phth and 1-phth2 in the presence \n and absence of tbuootbu . c h \n bond amidations of cyclohexane by copper complexes have been proposed \n to occur by insertion of a copper - nitrene intermediate into a c h \n bond or by hydrogen atom abstraction . in one study , a copper - nitrene \n species stabilized by sc and an isolated bridging copper - nitrene \n complex were shown to undergo stoichiometric reactions with cyclohexane \n to form n - cyclohexyl-4-methylbenzenesulfonamide and n - cyclohexyladamantane , respectively . in another study , an isolated , three - coordinate cu(ii)-nhad ( ad \n = adamantane ) complex was shown to react with cyclohexane to form n - cyclohexyladamantane ; this reaction was proposed to occur \n by abstraction of a hydrogen atom from cyclohexane and capture of \n the cyclohexyl radical by cu(ii ) . a mechanism \n involving a nitrene intermediate in our system is ruled out by the \n reaction of secondary nitrogen reagents ( i.e. , phthalimide ) with cyclohexane \n to form the corresponding n - alkyl product , but reaction \n of the amidate and imidate complexes with the alkane could occur . thus , we tested the potential reactions of the copper amidate and \n imidate complexes with cyclohexane . to do so , we performed stoichiometric \n reactions of 1-phth and 1-phth2 with cyclohexane . these reactions would assess whether \n these complexes are capable of abstracting a hydrogen atom from cyclohexane . \n the reaction of 1-phth or 1-phth2 with cyclohexane ( 80 equiv ) in mecn or benzene without tbuootbu at 100 c for 2472 \n h produced no cy - phth detectable by gc ( scheme 5 , a ) . the absence of any cy - phth product from these reactions rules \n out a mechanism involving hydrogen atom abstraction by the cu(i ) or \n cu(ii ) phthalimidates and combination of the resulting alkyl radical \n with the copper complexes . however , the stoichiometric reaction of 1-phth2 with cyclohexane and tbuootbu ( 16 equiv ) for 24 h produced cy - phth ( 70% \n yield based \n on copper ) , me - phth , and cy - otbu in a 70:25:35 ratio \n ( scheme 5 , b ) . the analogous reaction of 1-phth with cyclohexane and tbuootbu ( 16 equiv ) also produced cy - phth ( 73% yield based on copper ) , \n me - phth , and cy - otbu in a 73:21:32 ratio ( scheme 5 , c ) . formation of the ether product has been observed \n from cu(i)-catalyzed decomposition of tbuootbu and recombination of a cyclohexyl radical with a cu otbu functionality . moreover , \n the observation of cy - otbu suggests that [ ( phen)cu(phth)(otbu ) ] is a likely intermediate in these reactions lacking \n free phthalimide ; reaction of the cyclohexyl radical with this complex \n would form cy - phth and cy - otbu . the formation \n of n - alkyl amides in the presence \n of tbuootbu , but not in the absence \n of tbuootbu , was observed for copper \n complexes 1-phth2 or 1-phth . complexes 26 also reacted with \n cyclohexane to produce their corresponding n - alkyl \n products in the presence of tbuootbu , but not in the absence of tbuootbu . these studies provide further evidence \n that tbuootbu leads to formation \n of tert - butoxy radical , which cleaves the alkane \n c h bond . to investigate if the cu(ii ) complex 1-phth2 and the cu(i ) complex 1-phth react by \n a common pathway , we measured the kinetic isotope effect of the amination \n reactions catalyzed by these two complexes . reactions of the combination \n of cyclohexane and cyclohexane - d12 in \n a single vessel containing phth , tbuootbu , and 2.5 mol % 1-phth2 occurred \n with a primary kie of 2.7 0.1 . the reaction of 1-phth under the same experimental conditions occurred with a primary kie \n of 3.0 0.3 . the similarity of these values is consistent with \n reaction of cu(i ) and cu(ii ) complexes through the same c h \n bond cleavage step . furthermore , the catalytic reaction of cyclohexane \n and cyclohexane - d12 in the same vessel \n with benzamide and 2.5 mol % of the phen - ligated cu(ii ) benzamidate \n complex 5 occurred with a primary kie value of 2.8 \n 0.4 . these results imply that the same c h bond cleavage step \n occurs for reactions of the different copper - amidate complexes . results from the stoichiometric and catalytic reactions of 1-phth2 and 1-phth strongly \n suggest that a tert - butoxy radical is responsible \n for the c h abstraction of cyclohexane . to assess this hypothesis \n further , we performed experiments that would trap the tert - butoxy and alkyl radicals . first , we conducted the catalytic \n reaction in the presence of diphenylmethanol ( 2.5 equiv ) ( scheme 6 , a ) , a common probe for tert - butoxyl \n radical . this alcohol can react with an alkoxy radical \n by abstraction of the c h hydrogen atom from cu(ii)-diphenylmethoxide \n to form a cu(ii)-ketyl radical that is then oxidized to form benzophenone \n to regenerate cu(i ) . alternatively , an \n alkoxy radical abstracts the c h bond of diphenylmethanol to \n form a ketyl radical . this ketyl radical undergoes another hydrogen \n atom abstraction at the oh group by another alkoxy radical to form \n benzophenone . consistent with the generation \n of an alkoxy radical , the catalytic reaction conducted in the presence \n of diphenylmethanol formed the n - cyclohexyl benzamide \n product in only 47% yield , based on benzamide . instead of the n - cyclohexyl amide , a large amount of benzophenone ( 2.4:1.0 \n ratio of benzophenone to n - cyclohexyl benzamide ) \n formed . this reaction to form benzophenone decreases the amount of \n available tert - butoxy radical for hydrogen atom abstraction \n of cyclohexane and thus decreased the yield of the n - cyclohexyl benzamide product . second , we probed \n for the formation of tert - butoxy \n radical by conducting the reaction in the presence of the hydrogen \n atom donor 9,10-dihydroanthracene . the tert - butoxy \n radical should abstract the weak c h bond of 9,10-dihydroanthracene \n over the stronger c h bonds in cyclohexane . indeed , the catalytic \n reaction of benzamide with cyclohexane conducted under the standard \n conditions , except for the addition of 3 equiv of 9,10-dihydroanthracene , \n yielded anthracene as the only organic product besides tert - butanol ( scheme 6 , b ) . finally , to \n probe for a transient cyclohexyl radical in the reaction , \n we performed the catalytic reaction in the presence of cbr4 ( scheme 7 , a ) , which would trap a cyclohexyl \n radical to form bromocyclohexane . the reaction of benzamide \n with cyclohexane and tbuootbu at \n 100 c for 24 h did not form any product from the amidation of \n cyclohexane . instead , bromocyclohexane formed in 90% yield , based \n on benzamide . this result is consistent with the intermediacy of a \n cyclohexyl radical in the catalytic reaction . the reaction of this alkane in the presence of cbr4 and 2.5 mol % cui/(meo)2phen in benzene at 100 \n c for 24 h ( scheme 7 , b ) formed the products \n from bromination at the tertiary and the secondary sites : cis- and trans-1-bromo-1,4-dimethylcyclohexane \n and cis- and trans-2-bromo-1,4-dimethylcyclohexane . \n the two sets of constitutional isomers formed in a ratio of 1.7:1 \n and a combined 86% yield based on cbr4 . the 1-bromo-1,4-dimethylcyclohexane \n diastereomers were obtained as a 1.2:1 mixture , indicating that the \n transient tertiary radical formed under this condition undergoes facile \n racemization . to investigate whether \n an alkyl radical would react with the copper imidates to form an n - alkyl product , we conducted reactions of the phthalimidate \n complex 1-phth2 with precursors \n to alkyl radicals . we chose to use peroxides as the precursors to \n alkyl radicals , and we performed these reactions with 1-phth2 instead of 1-phth because \n our data indicate that 1-phth2 is the predominant complex under catalytic conditions . the reaction \n of 1-phth2 with tbuootbu and ( ph(me)2co)2 at \n 100 c for 18 h generated me - phth in 64% and 81% yield based \n on copper , respectively ( scheme 8) . the rate \n of -me scission of the cumyloxide radical is faster than that \n of the tert - butoxy radical . thus , the higher yield \n of n - alkyl product from the reaction of dicumyl peroxide \n than from the reaction of tbuootbu is consistent with the rate of generation of the methyl radical . these results with radical probes and alkyl radicals provide \n strong \n evidence that an alkoxy radical generates an alkyl radical by hydrogen \n atom abstraction and that the alkyl radical combines with a copper(ii)-amidate \n and -imidate species to produce the amidation and imidation products . \n the formation of products from halogenation at the tertiary c h \n bond of the dimethylcyclohexane indicates that the absence of the \n products from amination at the tertiary c n bond ( vide infra ) . reactions in acetonitrile provide evidence against a carbocationic \n intermediate that could form by oxidation of the radical and combination \n of the cation with the copper amide or imidates . the amidation \n of cyclohexane with hphth in wet acetonitrile ( scheme 3 ) produced me - phth ( 80% ) , and this result argues against a \n transient carbocation in our system . additional measurements of kie values \n were conducted to determine the turnover - limiting step ( tls ) of the \n catalytic reaction . the kie determined from independent measurements \n of the rates of amidation of cyclohexane and cyclohexane - d12 catalyzed by 10 mol % of 3 was 2.9 \n 0.1 . this primary kie indicates that \n hydrogen atom abstraction of cyclohexane by a tert - butoxy radical is the turnover - limiting step in the catalytic process . to identify the tls and to explain the observed primary kie we obtained \n the kinetic data by measuring the concentration of cyclohexylbenzamide \n and n - methylbenzamide versus time by the method of \n initial rates with varied concentrations of oxidant , cyclohexane , \n and benzamide . at copper concentrations \n of 23 mm , the reaction was found to be first - order in oxidant , first - order \n in cyclohexane , and zero - order in benzamide . the reaction order of \n oxidant and cyclohexane is consistent with turnover - limiting c the dependence of the reaction rate on the concentration of oxidant \n and cyclohexane was lower for reactions conducted with higher concentrations \n of these two reagents . when the concentration of oxidant and cyclohexane \n exceeded 1.0 m , there was little dependence of the rate of cyclohexane \n amidation on the concentration of these two species . the order of cu is complex ; our data indicates that \n the reaction \n rate is positively dependent on the concentration of cu . however , \n the order of the reaction in the concentration of copper varied between \n first - order and essentially zeroth - order . a similar dependence of reaction rate on the concentration of copper \n was reported for copper - catalyzed allylic oxidation of cyclohexene \n by tert - butyl perbenzoate in benzene . at low concentration of copper , the rate of \n allylic oxidation increased with increasing concentration of copper ; \n however , the rate of this reaction was less dependent on the concentration \n at higher concentrations of copper . in addition \n to the difference in dependence of the rate on the \n concentration of copper , we observed a difference in yield of the \n amination products as a function of the concentration of copper . reactions \n conducted with a higher mol % of the cu catalyst formed the n - alkyl amide product in lower yields than the reactions \n conducted with a lower loading of the cu catalyst . specifically , reactions \n of cyclohexane conducted with 2.8417.0 mm 5 yielded \n 9499% of the n - cyclohexy benzamide product , \n while those conducted with 34.045.5 mm 5 gave \n the n - cyclohexyl benzamide product in 76% yield , \n along with menhcoph ( 10% ) and unreacted benzamide . perhaps , at higher \n loading of cu(i ) , faster decomposition of peroxide leads to a higher \n concentration of tert - butoxy radical , relative to \n the concentration of copper complex , and the tert - butoxy radical undergoes processes that do not lead to the n - alkyl amide product . the tert - butoxy \n radical is known to undergo multiple \n nonproductive pathways : ( 1 ) -me scission for the methylation \n of the bound cu(ii)-amidate ; ( 2 ) coupling of methyl radicals ; and ( 3 ) reaction of tert - butoxy \n radical with cu(i ) to form cu(ii)-otbu . the quenching of the tert - butoxy radical at high \n concentration of copper offers one possible explanation for the lower \n yield of product at high loading of cu(i ) compared to low loading \n of cu(i ) and the lower order in copper . regardless of the origin \n of the effect of the concentration of \n copper on yield , a copper complex does not directly participate in \n the c h bond cleavage of cyclohexane . several pieces of data \n provide evidence that copper is not required for c h cleavage \n of cyclohexane . for example , in the absence of copper , the reaction \n of adamantane with tbuootbu and \n cbr4 at 100 c for 24 h produced a mixture of 1-bromoadamantane \n and 2-bromoadamantane in a ratio of 2.6:1 , respectively . the same reaction conducted in the presence \n of copper , formed a mixture of products containing 1-bromoadamantane \n and 2-bromoadamantane in a 2:1 ratio . the similarity of the ratio \n of products in the presence and absence of copper suggest that copper \n is not directly involved in the c h cleavage step . first , copper \n catalyzes the decomposition of tbuootbu to generate tert - butoxy radical , which is the \n species that cleaves the c h bond of the alkanes . specifically , \n reaction of 1-phth with tbuootbu and hphth in the absence of a hydrogen atom donor ( i.e. , \n cyclohexane ) leads to rapid oxidation of 1-phth to 1-phth2 and exclusive formation of \n me - phth , in which the methyl radical is derived from tert - butoxy radical by -me scission . additional evidence for copper - catalyzed formation of tert - butoxy radical is the observation of benzophenone from diphenylmethanol \n under catalytic conditions . second , copper \n participates in the events after the turnover - limiting step of c h \n activation by tert - butoxy radical to form the n - alkyl product . this proposal is corroborated by the reaction \n of methyl radicals , derived from the tertiary alkoxy radical precursors \n ro - or ( r = tbu , ph(me)2c ) , with 1-phth2 to generate \n the me - phth product . our proposed mechanism for c h amidation \n of cyclohexane \n by 1-phth is summarized in scheme 9 . our proposed mechanism begins with the decomposition of tbuootbu initiated by 1-phth to produce a tert - butoxy radical and a potential \n intermediate containing an alkoxide and a phthalimidate ligand [ ( phen)cu(phth)(otbu ) ] . the tert - butoxy radical can regenerate tbuootbu by secondary geminate recombination \n or can abstract a hydrogen atom from an alkane to form an alkyl radical . in this case , the turnover - limiting step is \n abstraction of a hydrogen atom from cyclohexane by a tert - butoxy radical to produce a cyclohexyl radical , which recombines \n with 1-phth2 to expel cy - phth \n and regenerate 1-phth to close the cycle . this species could be a transient cu(iii ) \n intermediate ligated by a cyclohexyl and amidate ligand . such a species \n could undergo rapid reductive elimination to release the n - alkyl product and to regenerate cu(i ) . prior mechanistic and dft investigations of the kharasch - sosnovsky \n reaction have led to the conclusion that these oxidative reactions \n occur by formation of a cu(iii ) species , which forms the c o \n bond by reductive elimination . conversely , dft calculations on the combination of a cyclohexyl \n radical with the three - coordinate [ ( nacnac)cu(ii)-otbu ] ( nacnac = [ arnc(me)]2ch ; ar = 2,6-cl2c6h3 ) to form cy - otbu suggest that capture of the alkyl radical at the oxygen atom of \n the otbu ligand is thermodynamically favorable ( g = 13.4 kcal / mol ) , whereas combination of the alkyl \n radical at cu(ii ) to form the square planar complex [ ( nacnac)cu(iii)(cy)(otbu ) ] is thermodynamically disfavored ( g = + 14.9 kcal / mol ) . thus , it is possible \n that the alkyl radical reacts directly with the imidate or amidate \n ligands to form the n - alkyl imide and amide products . the selectivity of secondary ( 2 ) and primary sites ( 1 ) \n over tertiary ( 3 ) sites for the amidation of alkanes by this \n copper system is different from the selectivity of 3 > 2 \n > 1 for hydrogen abstraction by a tert - butoxy \n radical . this selectivity for secondary \n over primary and tertiary sites has been observed in the copper - catalyzed \n amidation of benzylic c h bonds , and the rationale for such \n selectivity was based on steric effects . h bonds results from the recombination of alkyl \n radicals with phen - ligated cu(ii ) amidate and imidate complexes ; we \n propose that the tertiary radical is too hindered to recombine with \n phen - ligated cu(ii ) amidate and imidate complexes and the alkyl radical \n undergoes decomposition . to address this proposal , we determined \n the mass balance of the \n reaction . this information would provide insight into the fate of \n all the alkyl radicals that could form . the amidation of adamantane \n afforded a ratio of 1.6 n-(adamantan-1-yl)benzamide \n to 1.0 n-(adamantan-2-yl)benzamide and 1-phenyladamantane . \n the 1-phenyladamantane product likely results from the direct reaction \n of 1-adamantyl radical with benzene . the \n observation of 1-phenyladamantane reveals another pathway by which \n tertiary alkyl radicals decompose in the reaction . the alkene likely forms from the decomposition \n of the tertiary radical , and this decomposition likely occurs because \n the combination of the tertiary radical with the phen copper amidate \n or imidate is sterically disfavored .", "in summary , we have described a copper - catalyzed amidation of unactivated \n alkanes by benzamide , sulfonamide , carbamate , phthalimide , and their \n derivatives . the amidation of alkanes under our catalytic conditions \n preferentially forms the products from amidation at secondary sites \n over tertiary sites . h bonds to \n form n - alkyl products is observed when the secondary \n c h bonds are hindered . potential cu(ii)-amidate and -imidate \n intermediates were isolated , characterized , and demonstrated to be \n intermediates for c h amidation of cyclohexane . our mechanistic \n data imply that the tert - butoxy radical , not a copper - nitrene \n or copper - aminyl species , leads to the activation of aliphatic c " ]

[ "sales and service workers face customers during working hours and the standardized expression of emotions , including kindness and sympathy , are important components of their job requirements ( 1 ) . standardized expression of emotions is socially desirable , especially to the organization , and it is essential to maintaining a positive economic relationship between the customers and the sales and service workers . the standardized expression of desirable emotions and the act of hiding undesirable emotions is also an essential component of a new type of work demand ( 2 ) , namely an emotional demand ( 34 ) . furthermore , these employees can be categorized as performing \" emotional labor \" ( 5 ) . hochschild provided the first definition of emotional labor including cognitive , bodily , and expressive components ( 6 ) . for example , when customers expect a positive interaction , workers should try to smile and express happiness . accommodation of the emotional demands from customers is an essential component of the social , and ultimately the economic , skills of sales and service workers . however , some studies have suggested that excessive emotional demands could lead to disconnect between displayed and felt emotions , or emotional dissonance . furthermore , various studies have demonstrated that chronic exposure to emotional demands with low job control causes service workers to feel higher levels of exhaustion and cynicism ( 8) . emotional exhaustion in the workplace can increase suicidal ideation ( 9 ) . chronic excessive emotional demands , in turn , lead to increased risk of depression ( 10 ) . hiding one 's emotions has been found to be associated with increased suicidal ideation in depressed older adults ( 11 ) . therefore , in sales and service workers , there is a possibility that excessive emotional demands , including hiding one 's emotions , are linked to suicidal ideation . actually , suicide mortality rate of sales and service workers in korea has been increasing steadily ( 12 ) . kessler et al . ( 13 ) reported the probability of transitioning from suicidal ideation to suicidal plans and then to an attempt using the national comorbidity survey from the united states . the transition probability from suicidal ideation to suicidal plans was 34% , and the transition probability from plans to an attempt was 72% . in addition , the transition probability from suicidal ideation to an unplanned suicidal attempt was 26% . these results suggest that investigations of suicidal ideation are a starting point in preventing the risk of death due to suicide . a study reported that the emotional exhaust and burn out were related to suicidal ideation in medical doctor ( 14 ) , but little has known whether high emotional demands increase the risk of suicidal ideation in sales and service workers in asian countries , to our best knowledge . emotional demands are enforced in the workplace to serve a variety of customers ' demands ; hence , occupational strain is increased in sales and service workers . the structure of the work organization is an important consideration in the reduction of occupational stress . a person 's sense of having little or no control over their job performance or work conditions ( low job control ) has been associated with an increased risk of developing occupational stress , which is linked to psychological and physiological diseases ( 15 ) . low job control has been found to decrease employees ' work effectiveness ( 1617 ) , requiring more time and effort to meet customers ' demands . a prospective cohort study in japan demonstrated that low job control is a strong predictor of suicidal death ( 18 ) . therefore , we hypothesized that emotional demands and job control in the workplace may influence suicidal ideation in sales and service workers . we also tested the demand - control hypothesis ( 1920 ) to examine whether the interaction of high job demands and low job control has an effect on suicidal ideation . we used data from the 4th korea national health and nutrition examination survey ( knhanes ) , which consists of comprehensive questionnaires including individual covariates related to suicidal ideation and lifestyle factors ( 2021 ) . the aim of this study was to investigate 1 ) whether high emotional demands or low job control were associated with suicidal ideation , and 2 ) the interactive effects of high emotional demands and low job control on suicidal ideation .", "nine occupational categories in the 4th knhanes corresponded to the korean standard classification of occupations . of the 10,023 economically active participants in the study , 1,999 sales and service workers were selected . four participants were excluded from the study due to missing responses to questions about suicidal ideation . finally , a total of 1,995 participants ( 824 men and 1,171 women ) were included in the analyses . the 4th knhanes includes a questionnaire that assesses individuals for the presence of suicidal ideation during the past year . to assess suicidal ideation , participants were asked , \" have you felt as though you wanted to die during past year ? \" yes ' or no ' responses indicated the presence or absence of suicidal ideation , respectively ( 21 ) . emotional demands and job control at work were also measured by the self - report questionnaire . the following questions were asked : \" i should hide my emotions while working \" ( 22 ) was used to assess emotional demands , and \" i have the authority to control my job , and i can use that authority during work \" was used to assess the degree of job control . the response categories for these items used a 4-point likert - type scale ranging from never ' , rarely ' , yes ' , to always ' . the yes ' and always ' responses were assigned a high rating and the never ' and rarely ' responses were assigned a low rating for both questions ( emotional demands and job control ) . four groups were defined as high vs. low emotional demand and job control as follows : group i had low emotional demands and high job control , group ii had low emotional demands and low job control , group iii had high emotional demands and high job control , and group iv had high emotional demands and low job control . total family income divided by family size ( total number of family members who live together ) was calculated to define the household income . the standard income level was estimated according to strata of age ( 5-year intervals ) and gender . the standard income level was categorized as low , middle - low , middle - high , or high . smoking history was classified as non - smoker , former smoker , or current smoker . a non - smoker was defined as a person with a lifetime history of smoking fewer than 100 cigarettes . heavy alcohol consumption was defined as drinking 7 or more glasses of alcohol on 2 or more occasions per week in men , and 5 or more glasses on 2 or more occasions per week in women . high physical activity was defined as more than 20 minutes of physical activity that was of sufficient time and intensity to produce perspiration , performed 3 or more times per week . chi - square tests were used to compare the prevalence of suicidal ideation across demographic characteristics ( table 1 ) . the prevalence ( % ) of suicidal ideation is reported according to high emotional demands and low job control . the odds ratio ( ors ) and 95% confidence intervals ( 95% cis ) for suicidal ideation were estimated using multiple logistic regression analysis . high physical activity was defined as more than 1/3 hour of physical activity which sufficient to get sweating , and three or more times per week . \n heavy alcohol drinking was defined as drinking seven or more glasses of alcohol on 2 or more occasions per a week in men , and 5 or more glasses on 2 or more occasions per a week in women . all participants provided written informed consent for their voluntary participation in the study . the identifying information of all participants this survey was approved by the institutional review board ( irb ) of the korea centers for disease control and prevention ( irb : 2007 - 02-con-04-p ; 2008 - 04exp-01-c ; 2009 - 01con-03 - 2c ) .", "nine occupational categories in the 4th knhanes corresponded to the korean standard classification of occupations . of the 10,023 economically active participants in the study , 1,999 sales and service workers were selected . four participants were excluded from the study due to missing responses to questions about suicidal ideation . finally , a total of 1,995 participants ( 824 men and 1,171 women ) were included in the analyses .", "the 4th knhanes includes a questionnaire that assesses individuals for the presence of suicidal ideation during the past year . to assess suicidal ideation , participants were asked , \" have you felt as though you wanted to die during past year ? \" yes ' or no ' responses indicated the presence or absence of suicidal ideation , respectively ( 21 ) . emotional demands and job control at work were also measured by the self - report questionnaire . the following questions were asked : \" i should hide my emotions while working \" ( 22 ) was used to assess emotional demands , and \" i have the authority to control my job , and i can use that authority during work \" was used to assess the degree of job control . the response categories for these items used a 4-point likert - type scale ranging from never ' , rarely ' , yes ' , to always ' . the yes ' and always ' responses were assigned a high rating and the never ' and rarely ' responses were assigned a low rating for both questions ( emotional demands and job control ) . four groups were defined as high vs. low emotional demand and job control as follows : group i had low emotional demands and high job control , group ii had low emotional demands and low job control , group iii had high emotional demands and high job control , and group iv had high emotional demands and low job control . total family income divided by family size ( total number of family members who live together ) was calculated to define the household income . the standard income level was estimated according to strata of age ( 5-year intervals ) and gender . the standard income level was categorized as low , middle - low , middle - high , or high . smoking history was classified as non - smoker , former smoker , or current smoker . a non - smoker was defined as a person with a lifetime history of smoking fewer than 100 cigarettes . heavy alcohol consumption was defined as drinking 7 or more glasses of alcohol on 2 or more occasions per week in men , and 5 or more glasses on 2 or more occasions per week in women . high physical activity was defined as more than 20 minutes of physical activity that was of sufficient time and intensity to produce perspiration , performed 3 or more times per week .", "chi - square tests were used to compare the prevalence of suicidal ideation across demographic characteristics ( table 1 ) . the prevalence ( % ) of suicidal ideation is reported according to high emotional demands and low job control . the odds ratio ( ors ) and 95% confidence intervals ( 95% cis ) for suicidal ideation were estimated using multiple logistic regression analysis . high physical activity was defined as more than 1/3 hour of physical activity which sufficient to get sweating , and three or more times per week . \n heavy alcohol drinking was defined as drinking seven or more glasses of alcohol on 2 or more occasions per a week in men , and 5 or more glasses on 2 or more occasions per a week in women .", "this survey was approved by the institutional review board ( irb ) of the korea centers for disease control and prevention ( irb : 2007 - 02-con-04-p ; 2008 - 04exp-01-c ; 2009 - 01con-03 - 2c ) .", "the prevalence of suicidal ideation was 10.3% in men ( 85 of 824 ) and 21.3% in women ( 249 of 1,171 ) . the prevalence of suicidal ideation in workers with high emotional demands and low job control was higher than workers with low emotional demands and high job control for both genders : 13.2% and 15.1% vs. 7.4% and 8.7% in men ; 26.8% and 25.4% vs. 15.0% and 18.8% in women , respectively ( table 1 ) . the prevalence of suicidal ideation was higher in women with lower individual and household income levels and in those who were heavy alcohol drinkers and current smokers compared to the women in the other groups ( table 1 ) . there was an inverse relationship between physical activity and suicidal ideation in men , but not in women . the prevalence of suicidal ideation in men was 5.5% in physically active workers and 10.6% in workers who were not physically active ( p = 0.046 ) . the ors for suicidal ideation were associated with high emotional demands in both genders ( or , 2.07 ; 95% ci , 1.24 - 3.45 in men , or , 1.97 ; 95% ci , 1.42 - 2.75 in women ) adjusted for age , household income , and employment characteristics ( paid vs. self - employed ) . low job control increased the odds of suicidal ideation in men ( or , 1.96 ; 95% ci , 1.01 - 384 ) , but not in women ( or , 1.33 ; 95% ci , 0.91 - 1.93 ) . further adjustment for smoking , alcohol drinking and physical activity habit attenuated the association between suicidal ideation and low job control in men ( model ii of table 2 ) . model i , adjusted for age , house hold income , pain worker ( vs. self - employed worker ) ; model ii , model i + adjusted for smoking , alcohol drinking and physical activity habit . we next analyzed the interactive effects of the two job characteristics ( emotional demands and job control ) on suicidal ideation . the number of male workers was 431 in group i ( low emotional demands and high job control ) , 67 in group ii ( low emotional demands and low job control ) , 273 in group iii ( high emotional demands and high job control ) , and 53 in group iv ( high emotional demands and low job control ) . the number of female workers was 486 , 147 , 388 , and 150 in groups i , ii , iii , and iv , respectively . the prevalence rates of suicidal ideation in male workers were 7.9% ( n = 34 ) , 10.5% ( n = 7 ) , 12.8% ( n = 35 ) , and 17.0% ( n = 9 ) for groups i , ii , iii , and iv , respectively ( p for this trend is 0.008 ) . the prevalence rates of suicidal ideation in female workers were 15.8% ( n = 77 ) , 16.3% ( n = 24 ) , 25.3% ( n = 98 ) , and 33.3% ( n = 50 ) for groups i , ii , iii , and iv , respectively ( p for this trend is below 0.001 ; fig . 1 ) . prevalence ( % ) of suicidal ideation for high emotional demands with low job control . compared to group i ( low emotional demands and high job control ) , group iii ( high emotional demands and high job control ; or , 1.93 ; 95% ci , 1.08 - 3.45 in men , or , 1.60 ; 95% ci , 1.06 - 2.42 in women ) and group iv ( high emotional demands and low job control ; or , 4.60 ; 95% ci , 1.88 - 11.29 in men , or , 2.69 ; 95% ci , 1.64 - 4.40 in women ) were more likely to experience suicidal ideation after controlling for age , household income , employment characteristics , smoking , alcohol drinking and physical activity habit ( model ii in table 3 ) . ors for suicidal ideation were 1.12 and 0.98 for men and women with low emotional demands and low job control , respectively and 1.93 and 1.60 for men and women with high emotional demands and low job control , respectively . the ors for high emotional demands and low job control were 4.60 in men and 2.69 in women . these ors are somewhat greater than the sums of the ors ( 3.05 in men , 2.58 in women ) . model i , adjusted for age , house hold income , pain worker ( vs. self - employed worker ) ; model ii , model i + adjusted for smoking , alcohol drinking and physical activity habit .", "in the current study , we found that high emotional demands in both gender and low job control in men are related to suicidal ideation in sales and service workers after adjustment for age , household income and employment status . sales and service personnel are often the first workers to face customers who argue , complain , and make various demands . because economic decisions are dependent on customer demands , standardized emotional displays are essential economic skills for sales and service workers . hiding and expressing emotions are also important skills needed to maintain positive relationships with customers . recently , standardized emotions used in work settings have been labeled \" emotional labor \" in order to adequately represent the skill set ( 5 ) . in the current study , the questionnaire item \" i should hide my emotions while working \" was presented to sales and service workers . the response values included in the questionnaire reflect only the act of hiding one 's emotions , without addressing how one expresses emotions or experiences emotional dissonance . hence , the results of the current study can not be applied directly to concepts of emotional labor . however , the act of hiding one 's emotions is the most important component of emotional labor , and employers encourage this behavior . therefore , we categorized respondents as high or low emotional demand based on this item in the current study . careful attention is needed to generalize our current results to the broader concept of emotional labor . patterns of suicide have been found to vary by occupation , and there are certain occupational and industrial groups that have an especially high risk of suicide ( 23 ) . some studies have reported that there are occupation - specific causes and methods of suicide , and this knowledge provides us with strategies to understand and prevent suicide in certain occupations ( 24 ) . for example , epidemiological studies have revealed that easy access to lethal means in medically - related occupations ( 25 ) , loneliness due to isolation in miners and farmers , and low income and inadequate social support systems are related to poor psychological well - being in manual workers ( 26 ) . suicide rates fluctuate according to the national macroeconomic conditions for farmers , fishery , and forestry workers ( 27 ) . in light of the evidence regarding occupation - specific causes of suicide , our results suggest that high emotional demands are important risk factors for suicidal ideation in sales and service workers , and further that these factors have additive effects . the mortality rate due to suicide is steadily increasing in korean service and sales workers ( 12 ) . we calculated the age - standardized prevalence of suicidal ideation in service and sales worker using the 4th knhanes : 8.6% in men , and 19.2% in women ( data not shown in the results section ) . prevalence was highest among non - manual occupational groups in both genders , though it was not significantly higher than the prevalence in manual occupational groups . standardized expressions and the act of hiding one 's emotions are desired by the organization regardless of their individual characteristics ; however , they cause depersonalization and emotional exhaustion ( 28 ) . the increase in emotional demands accelerates exhaustion and results in burnout and depression ( 29 ) . these related associations support the findings of the current study , namely that high emotional demands increase the odds of suicidal ideation in sales and service workers . the relationship between low job control and suicidal ideation in men was no longer significant after adjusting for age , household income , employment characteristics , smoking , alcohol consumption , and physical activity ( model ii in table 2 ) . furthermore , low job control in women did not show a significant relationship with suicidal ideation in any of the logistic models . although there was an interaction effect between high emotional demands and low job control ( table 3 ) , the combination of low emotional demands and low job control ( group ii ) was not associated with a significant increase in the odds of suicidal ideation , whereas high emotional demands and high job control ( group iii ) did show this association in both genders . these results suggest that high emotional demands have a stronger relationship with suicidal ideation compared to low job control in the sales and service workers in this study . in the current study , the relationship between suicidal ideation and some of the covariates differ between men and women . first , low job control increased the odds of suicidal ideation after controlling for high emotional demands , household income , and employment characteristics in men , but not in women ( table 2 ) . the current results suggest that the association between low job control and suicidal ideation is somewhat stronger in men than in women . in contrast to previous studies ( 31 ) , our study shows that lower levels of household income are more strongly related with the risk of suicide in women . high physical activity had an inverse relationship with suicidal ideation in men , but alcohol consumption and smoking did not ( table 1 ) . in contrast , women showed a significant relationship between suicidal ideation , alcohol consumption , and smoking ( table 1 ) . we hope that the gender differences found in our study communicate that gender - specific strategies are needed to prevent suicide among sales and service workers . there are several limitations of the current study . because it is a cross - sectional study design , the direction of causality can not be determined . the act of hiding one 's emotions can be associated with personality , which may make some individual workers suffer more from stress . this indicates the possibility of an interaction between a personality trait ( hiding one 's emotions ) and job demands affecting suicidal ideation . a more comprehensive study including personality ( 3233 ) and organization - specific factors is needed . there may also have been selection biases , namely healthy worker selection and healthy worker survival . in other words , if a worker has difficulties performing emotional labor , the worker may be less likely to select a service job ( healthy worker selection ) . in contrast , workers who are good at hiding their emotions are more likely to keep their service job ( healthy worker survival ) . selection bias would attenuate the association between hiding one 's emotions and suicidal ideation ; nonetheless , our study shows a significant association between hiding one 's emotions and suicidal ideation . however , these limitations ( including the cross - sectional study design , potential influence of personality , and selection biases ) should be taken into consideration when interpreting our results . furthermore , individuals who died as a result of suicide are not included in the study . however , the rate of suicide attempts was not high enough to influence the results of the current study . the percentage of successful suicide attempts was 5.8% in koreans between the ages of 20 and 69 ( 34 ) . we also could not control for past job or careers due to a lack of information . although the employment characteristics of workers were controlled for in the regression models , specific positions held by the sales and service workers were not controlled for due to a lack of information . it is possible that workers in lower positions experienced more occupational stress than those in higher positions . further studies are needed to clarify the effects of position on the association between high emotional demands at work and suicidal ideation . in conclusion , these results suggest that high emotional demands in both genders , as well as low job control in men , might play a crucial role in increasing the risk of suicidal ideation in sales and service workers . furthermore , we found the interaction effects of combining high emotional demands and low job control on suicidal ideation for both genders . these interesting associations remained significant even after controlling for individual risk factors such as age , household income , employment characteristics , smoking , alcohol drinking and physical activity habit ." ]

[ "the traditional medical practitioner or traditional healer can be defined as someone who is recognized by the community in which he lives as competent to provide health care by using vegetable , animal and mineral substances and certain other methods based on the social , cultural and religious backgrounds as well as the prevailing knowledge , attitudes and beliefs regarding physical , mental and social well - being and the causation of disease and disability in the community . traditional healers used different medicinal formulas from various natural substances ( animal , mineral and vegetable ) . they have extensive knowledge on the use of plants and herbs for medicinal and nutritional purposes . the mishings are an ethnic group inhabiting the districts of dhemaji , north lakhimpur , sonitpur , tinsukia , dibrugarh , sibsagar , jorhat and golaghat of assam . a few live in and around pasighat of east siang district of arunachal pradesh . they are the second largest tribal group in north - east india , followed by the bodos . their chief festival is ali - aye - ligang , in the month of february , which marks the beginning of the sowing season . moreover , due to their affinity towards living close to river banks brings about malaria and water - borne diseases and they developed traditional healing practices to protect themselves from different diseases and traditional healing practices of those days are still preferred by the people of this community in this modern era . details of medicinal plants used in india were reported and records on folk medicines used by mishing tribes is lesser known.[36 ] however , tribal communities in arunachal pradesh , resembling mishings i.e. adi , apatani and nyishi also use locally available herbs for treatment of ailments.[712 ] traditional healing practices amongst mishing tribes is the method to treat ailments by using herbs in form of fresh drug , crushed juice , decoction of drug part and powdered medicine for oral intake and paste for local application on skin diseases and wounds . they use locally available medicinal herbs , cultivated drugs from different habitat as well as cultivating depleting medicinal plants , they have also faith on divines and worships for cure of ailments . the study reveals detailed documentation of healing practices used by traditional healers for their community health with full faith and confidence . malaria and jaundice being the prominent diseases in north east india are widely treated by traditional healers and 68 herbs have been recorded treating malaria and about 88 for treating jaundice .", "in folk medicine or ethno medicinal studies , the most reliable method is one involving field survey . during various field survey in forest areas and adjoining villages , villagers were consulted about their primary method of treatment during illness . after getting information about the persons involved in local healing practices authors made attempt to come in contact with these healers with an idea of exchange of knowledge gathered from established system of herbal medicine like ayurveda and local herbs used in other adjoining community . during course of interaction knowledge about single and easily accessible compound drugs used in ayurveda and easily available in the area it involves meeting with the herbalists and experts in the field for getting first hand information . practitioner of herbal medicines who are experts in treating in general different ailments and who are also expert in different methods of treatment were consulted for getting some first hand data . in the present study the work is restricted to some herbal - medical practitioners within different mishing groups inhabiting in assam and arunachal pradesh . the herbalists consulted were convinced about the importance of documentation of ethnic knowledge about the medicinal plants used in various curative purposes . it requires tactful handling and persuasion to bring out the information from the herbal practitioners . during course of study traditional informers on healing practices were interviewed under which in total 7 healers from dhemaji and north lakhimpur districts and 4 from foothills of east siang district were interacted some of which are mr u. c. kardong , mr lakhidhar payeng , mr khogen kardong , mrs maloti naro and other associated with the above practitioners . these traditional healers belong to 4 villages in north lakhimpur and 3 in dhemaji district of assam and one village in east siang district of arunachal pradesh . the detail information about the plants and part used in the treatment of different ailments were collected . plant specimens were collected for identification and herbarium preparation . while most of the plants are commonly occurring plants known to most of the people , some of the plants were identified consulting the herbarium specimen in the botanical survey of india ( bsi ) , itanagar . the herbarium specimens are preserved in the herbarium of ayurveda regional research institute , itanagar for authentication and future reference .", "mishing community is one of the major tribal communities which are distributed from arunachal pradesh to plains of assam and bifurcated from time to time due to their migration from hills of arunacha pradesh to plains of assam . during this migration they developed their knowledge by acquiring from other nearby communities and used herbs available in and around their villages for various treatments of ailments [ table 1 ] . as per information given on system it was found that long back the responsible persons in the villages was village head called gaon burha in arunachal mishing but during these interactions more than 3 persons belonging to same or different family are involved in healing practices by developing some cultivation of herbs used in their practices and not naturally occurring in the nearby areas just like aloe barbadensis , barleria cristata , glycyrrhiza glabra etc . under healing practices of mishing community general herbalist , bone setters , ojhas related with bhoot badha , dondai using mantra tantra etc . some common type of treatment like cuts and wound , sprain and skin diseases where external application is involved is practiced by all those who get affected immediately . use of certain herbs like centella asiatia , houttuyinia cordata , phyllanthus emblica and terminalia citrina is in common practice as protective medicine and is commonly sold in vegetable shops . folk medicines used by mishing community of north east india types of traditional healers amongst mishing tribes presently all traditional healers of this community are not performing the same functions , nor do they all fall into the same category . . they have their own methods of diagnosis and their own particular medicine . by interviewing it was found that there are different types of traditional healers on basis of there expertise in north east india . traditional medical practitioners treat all age groups and all problems , using and administering medicines that are readily available and affordable . their treatment is comprehensive and has curative , protective and preventive elements , and can be either natural or ritual or both , depending on the cause of the disease . it includes among others , ritual sacrifice to appease the ancestors , ritual and magical strengthening of people and possessions , steaming , purification ( e.g. ritual washing , or the use of emetics and purgatives ) , sniffing of substances , cuts , wearing charms and piercing . the ethno medicinal information regarding treatment of different diseases collected in course of field study is presented here in tabular form for easy reference . the study shows that malaria , jaundice and female menstruation problems are the prominent diseases in this community as most of the traditional healers are prescribed medicine for these treatments . in this study , 55 medicinal plants encountered from different parts of the mishing inhabitant area used by this community in their daily ailment from various diseases . different parts of the medicinal plant species were used for curing different diseases and mostly leaves ( 36.84% ) were used followed by stem ( 14.03% ) , root ( 10.52% ) and bark ( 7.02% ) . asteraceae ( 5 species ) , apocynaceae ( 4 species ) and 3 each in euphorbiaceae , malvaceae and acanthaceae were found . some of the plants can be categorized as highly prioritized medicinal plants as they are of immense value in curing various diseases but are in the low niche . these plants are widely used under traditional healing practices but due to multiple use they are depleting from their habitat viz . eventually , these species are now on the freeway towards extinction due to over exploitation , road construction , encroachment of habitat by the immigrants of the neighbouring community . local inhabitants adapted cultivating some of the locally available herbs like acorus calamus , alstonia scholaris , centella asiatica , leucas indica , nymphea stellata , tabernemontana divaricata and some others from habitats of different climatic condition like aloe barbadensis , glycyrrhiza glabra which meet out the requirement of drugs for daily requirement . some of the prominent herbs of the area are ageratum conyzoides , clerodendrum infortunatum , leucas indica , sida acuta , solanum viarum , etc . which are commonly available in the habitat and are used for meeting out requirement of drug for treating ailments few commonly observed trees and shrubs are alstonia scholaris , costus speciosus ficus racemosa , oroxylum indicum , plumaria alba , ricinus communis , etc . most of the plant products after formulation are used orally , whereas for skin disease and bone facture medicines are not prescribed for oral consumption . it was found that in most of the cases the plant products are prepared with combination of some other plants or some other products . the plants uses in mixture all may not contain the properties to relief from particular disease but some might be reduced side effect on treatment .", "mishing community is one of the major tribal communities which are distributed from arunachal pradesh to plains of assam and bifurcated from time to time due to their migration from hills of arunacha pradesh to plains of assam . during this migration they developed their knowledge by acquiring from other nearby communities and used herbs available in and around their villages for various treatments of ailments [ table 1 ] . as per information given on system it was found that long back the responsible persons in the villages was village head called gaon burha in arunachal mishing but during these interactions more than 3 persons belonging to same or different family are involved in healing practices by developing some cultivation of herbs used in their practices and not naturally occurring in the nearby areas just like aloe barbadensis , barleria cristata , glycyrrhiza glabra etc . under healing practices of mishing community general herbalist , bone setters , ojhas related with bhoot badha , dondai using mantra tantra etc . some common type of treatment like cuts and wound , sprain and skin diseases where external application is involved is practiced by all those who get affected immediately . use of certain herbs like centella asiatia , houttuyinia cordata , phyllanthus emblica and terminalia citrina is in common practice as protective medicine and is commonly sold in vegetable shops . folk medicines used by mishing community of north east india types of traditional healers amongst mishing tribes presently all traditional healers of this community are not performing the same functions , nor do they all fall into the same category . . they have their own methods of diagnosis and their own particular medicine . by interviewing it was found that there are different types of traditional healers on basis of there expertise in north east india . traditional medical practitioners treat all age groups and all problems , using and administering medicines that are readily available and affordable . their treatment is comprehensive and has curative , protective and preventive elements , and can be either natural or ritual or both , depending on the cause of the disease . it includes among others , ritual sacrifice to appease the ancestors , ritual and magical strengthening of people and possessions , steaming , purification ( e.g. ritual washing , or the use of emetics and purgatives ) , sniffing of substances , cuts , wearing charms and piercing .", "the ethno medicinal information regarding treatment of different diseases collected in course of field study is presented here in tabular form for easy reference . the study shows that malaria , jaundice and female menstruation problems are the prominent diseases in this community as most of the traditional healers are prescribed medicine for these treatments . in this study , 55 medicinal plants encountered from different parts of the mishing inhabitant area used by this community in their daily ailment from various diseases . different parts of the medicinal plant species were used for curing different diseases and mostly leaves ( 36.84% ) were used followed by stem ( 14.03% ) , root ( 10.52% ) and bark ( 7.02% ) . asteraceae ( 5 species ) , apocynaceae ( 4 species ) and 3 each in euphorbiaceae , malvaceae and acanthaceae were found . some of the plants can be categorized as highly prioritized medicinal plants as they are of immense value in curing various diseases but are in the low niche . these plants are widely used under traditional healing practices but due to multiple use they are depleting from their habitat viz . eventually , these species are now on the freeway towards extinction due to over exploitation , road construction , encroachment of habitat by the immigrants of the neighbouring community . local inhabitants adapted cultivating some of the locally available herbs like acorus calamus , alstonia scholaris , centella asiatica , leucas indica , nymphea stellata , tabernemontana divaricata and some others from habitats of different climatic condition like aloe barbadensis , glycyrrhiza glabra which meet out the requirement of drugs for daily requirement . some of the prominent herbs of the area are ageratum conyzoides , clerodendrum infortunatum , leucas indica , sida acuta , solanum viarum , etc . which are commonly available in the habitat and are used for meeting out requirement of drug for treating ailments few commonly observed trees and shrubs are alstonia scholaris , costus speciosus ficus racemosa , oroxylum indicum , plumaria alba , ricinus communis , etc . most of the plant products after formulation are used orally , whereas for skin disease and bone facture medicines are not prescribed for oral consumption . it was found that in most of the cases the plant products are prepared with combination of some other plants or some other products . the plants uses in mixture all may not contain the properties to relief from particular disease but some might be reduced side effect on treatment .", "the traditional healing practices in mishing tribes of arunachal pradesh and assam was insufficiently documented and authors made efforts to document the healing practices used by mishing community with details of methodology and doses . to cope up with the objectives authors made interaction with villagers in different villages in dhemaji and north lakhimpur districts of assam and foot hills of east siang district of arunachal pradesh to know about genuine and reliable traditional healers in the area and came in contact with 11 traditional healers who are engaged in herbal treatment . during course of interaction 55 different herbs and their parts were found using in various treatments . these herbs were belonging to herbs , shrubs and tree either from locally available sources or adapted through cultivation in their small herbal gardens . prevalent diseases treated by the mishing healers are jaundice , malaria , menstrual disorders , joint pains skin diseases etc . prior to this certain other plants used by mishing tribes of assam were described . however , most of the plants involved in traditional practice described in this paper are different and if some of the plants are reported in these communications they are for other diseases . the description of all above mentioned plants are on the basis of ethno medicinal knowledge . plants are used by mishing community in different places on the basis of availability of those plants and the proper knowledge about efficacy of those plants against the particular disease . for safe uses of different medicinal plants , we need randomised clinical trials for some of the manual therapies and further research is need to ascertain the efficacy and safety of several other practices and medicinal plants . we have to develop a proper study about the traditional medicine and the ratio of curative measurement applied to different patients on the use of those plants . the study on such types of documentation is of great importance for north eastern institute of folk medicine in the sense that the institute will get sufficient information on traditional healers and mode administration of medicine for treating ailments on one hand and sufficient tool for proving authenticity of drugs used in healing practice through pharmacology , phytochemistry and other pharmaceutical constants . similarly services of these traditional healers are of great importance to public as they are rendering their services to public in very remote places where people are really in need of health services . these traditional healers need to be involved in all sorts of trainings to youngsters as well as refreshing their knowledge with healers of other communities . though they are acquiring and correlating their knowledge with established records and information available with other communities . involving cultivating and using aloe barbadensis and glycyrrhiza glabra is the example and availability of drugs from other climatic zones in the crude drugs markets of major markets in assam strengthen the concept of exchanging knowledge with other communities . the role of government for the existence of this system of medicine should be : 1 . to give due recognition to their contribution and involvement ; 2 . to delineate the specific scope , limit and role of traditional healers in public health promotion ; 3 . to undertake research and development activities ; 4 . to provide orientation and support to folk - healers ; 5 . to monitor and" ]

[ "to differentiate between the individual diagnoses of patients presenting at memory clinics with cognitive complaints and often depressive symptoms , more accurate diagnostic measures are needed . the term subjective cognitive impairment ( sci ) describes patients with subjective cognitive complaints and occurs before mild cognitive impairment ( mci ) . which persons should be treated or investigated further , it is important to find reliable correlates of both subjective cognitive complaints and objective cognitive impairment . objective cognitive impairment has been found in 11% of nondemented elderly , while estimates of memory complaints in nondemented elderly range from 22 to 56% . for early diagnosis of dementia and alzheimer 's disease ( ad ) , it is important to know when cognitive complaints are accurate , i.e. reflect actual performance , but the existing findings regarding accuracy of complaints in mci are divergent . significant associations between cognitive complaints and performance have been found in a few community - based samples , while other studies have not found such associations . one review study suggests that nondemented individuals are generally able to accurately identify their cognitive problems , while patients with ad dementia underestimate their cognitive problems . early ad is typically characterized by neuronal loss in the medial temporal lobes and memory impairment . the degree of awareness of one 's cognitive state may decrease as the disease progresses and frontal lobe functions decrease . combinations of ad - related csf biomarkers ( tau and a proteins ) predict the development of dementia in mci . the findings from one recent study indicate that csf levels of a42 are already fully decreased at least 5 - 10 years before conversion to ad dementia , whereas total tau ( t - tau ) and phosphorylated tau ( p - tau ) seem to be later markers . previously , we have found associations between memory and csf tau levels in the sci / mci sample , and associations between csf biomarkers and cognition in mci have been found by other researchers . still , many aspects regarding the relationship between biological changes related to degeneration in terms of csf biomarkers and clinical symptoms in predementia stages remain unclear . the association between csf biomarkers and both cognitive complaints and performance has not been studied in sci . depressive symptoms occur commonly in sci and mci and constitute another known risk factor for dementia . people that are depressed complain , and the criteria for depression include sci and/or objective cognitive impairment . positive correlations have been found between depression and memory complaints in a few studies of normal and cognitively impaired samples . our first hypothesis is that individuals with sci judge their performance more accurately than mci patients . the second hypothesis is that cognitive complaints are associated with depressive symptoms and csf biomarkers are associated with objective cognitive impairment .", "the project was approved by the south - eastern norway committee for medical research ethics . patients with subjective cognitive complaints which had lasted 6 months or more and who had attended a university - based memory clinic between september 2005 and january 2010 were assessed for inclusion in the study . inclusion criteria were no or very mild problems with activities of daily living and global deterioration scale ( gds ) score 2 ( sci , n = 23 ) or 3 ( mci , n = 47 ) as determined from a clinical interview and screening tests . screening tests included parameters 13 - 20 ( memory , disorientation , abstract thinking , visuospatial ability , language , sensory aphasia , visual agnosia , and apraxia ) from the stepwise comparative status analysis ( step ) , word fluency , interference , and numeral - letter items from the i - flex , and items from the neurobehavioral cognitive status examination ( cognistat ) as well as mini - mental state examination ( mmse ) . to be classified as gds 2 , subjects had to score 28 on mmse , 0 on step variables , a total sum < 2 on the elements from i - flex , and there had to be a maximum of one domain where they scored 0.5 on the clinical dementia rating ( cdr ) scale . subjects classified as gds 3 scored 26 on mmse , 1 on step variables , 2 on i - flex variables , and there were more than one cdr domain where they scored 0.5 , albeit none where they scored 1 . the following criteria for exclusion were established : psychiatric disorder ( including major depressive episode ) , stroke , cancer , drug abuse , solvent exposure or anoxic brain damage . the four neuropsychological variables , used in the analyses , were termed : word list memory ( 30-min recall ) of the rey auditory verbal learning test ( ravlt ) , visual memory ( 30-min recall ) of the rey complex figure test ( rcft ) , working memory of the letter - number sequencing subtest , wechsler adult intelligence scale third edition , and response inhibition ( naming colors of the ink of inconsistently colored names ) of the color - word interference test . self - reported depressive symptoms were assessed by the symptom checklist-90-r ( scl-90-r ) on the same day as the neuropsychological examination was performed . the questionnaire consists of 90 items and is designed to evaluate a broad range of psychological problems and symptoms of psychopathology , including a 13-item subscale for depressive symptoms . the items are rated on a five - point scale of distress from not at all to extremely. in addition to scl-90-r , depressive symptoms were assessed using a short version of the geriatric depression scale , namely gds-15 . two of the scl-90-r items concern memory and concentration complaints , which are rated on a five - point scale of distress from not at all ( 0 ) to extremely ( 4 ) . csf samples were collected by lumbar puncture through the l3/l4 or l4/l5 inter - space . csf concentrations of a42 , t - tau , and p - tau were routinely examined using commercially available enzyme - linked immunosorbent assay kits ( innogenetics , belgium ) . raw scores of the csf variables were used in all analyses . both raw scores and frequencies of pathological levels t - tau level was considered abnormal if t - tau 300 ng / l for patients under 50 years , > 450 ng / the statistical package for social sciences ( spss 16.0 ) was used for all statistical analyses . to compare characteristics of the patient groups , the independent - samples t test and the test were used . the pearson correlation method was used to test for associations between cognitive complaints and test performance . linear multiple regression analysis was performed to assess the impact of depressive symptoms and csf biomarkers on subjective cognitive complaints and cognitive performance . the variable of depressive symptoms was entered together with one of three csf variables at a time as the predictor variables . only one csf variable was included per model because of the colinearity among the predictor variables . as there was a significant group difference in age , age was used as a confounder in each model . the term ", "the project was approved by the south - eastern norway committee for medical research ethics . patients with subjective cognitive complaints which had lasted 6 months or more and who had attended a university - based memory clinic between september 2005 and january 2010 were assessed for inclusion in the study . inclusion criteria were no or very mild problems with activities of daily living and global deterioration scale ( gds ) score 2 ( sci , n = 23 ) or 3 ( mci , n = 47 ) as determined from a clinical interview and screening tests . screening tests included parameters 13 - 20 ( memory , disorientation , abstract thinking , visuospatial ability , language , sensory aphasia , visual agnosia , and apraxia ) from the stepwise comparative status analysis ( step ) , word fluency , interference , and numeral - letter items from the i - flex , and items from the neurobehavioral cognitive status examination ( cognistat ) as well as mini - mental state examination ( mmse ) . to be classified as gds 2 , subjects had to score 28 on mmse , 0 on step variables , a total sum < 2 on the elements from i - flex , and there had to be a maximum of one domain where they scored 0.5 on the clinical dementia rating ( cdr ) scale . subjects classified as gds 3 scored 26 on mmse , 1 on step variables , 2 on i - flex variables , and there were more than one cdr domain where they scored 0.5 , albeit none where they scored 1 . the following criteria for exclusion were established : psychiatric disorder ( including major depressive episode ) , stroke , cancer , drug abuse , solvent exposure or anoxic brain damage .", "the four neuropsychological variables , used in the analyses , were termed : word list memory ( 30-min recall ) of the rey auditory verbal learning test ( ravlt ) , visual memory ( 30-min recall ) of the rey complex figure test ( rcft ) , working memory of the letter - number sequencing subtest , wechsler adult intelligence scale third edition , and response inhibition ( naming colors of the ink of inconsistently colored names ) of the color - word interference test .", "self - reported depressive symptoms were assessed by the symptom checklist-90-r ( scl-90-r ) on the same day as the neuropsychological examination was performed . the questionnaire consists of 90 items and is designed to evaluate a broad range of psychological problems and symptoms of psychopathology , including a 13-item subscale for depressive symptoms . the items are rated on a five - point scale of distress from not at all to extremely. in addition to scl-90-r , depressive symptoms were assessed using a short version of the geriatric depression scale , namely gds-15 .", "two of the scl-90-r items concern memory and concentration complaints , which are rated on a five - point scale of distress from not at all ( 0 ) to extremely ( 4 ) .", "csf samples were collected by lumbar puncture through the l3/l4 or l4/l5 inter - space . csf concentrations of a42 , t - tau , and p - tau were routinely examined using commercially available enzyme - linked immunosorbent assay kits ( innogenetics , belgium ) . raw scores of the csf variables were used in all analyses . both raw scores and frequencies of pathological levels t - tau level was considered abnormal if t - tau 300 ng / l for patients under 50 years , > 450 ng /", "the statistical package for social sciences ( spss 16.0 ) was used for all statistical analyses . to compare characteristics of the patient groups , the independent - samples t test and the test were used . the pearson correlation method was used to test for associations between cognitive complaints and test performance . linear multiple regression analysis was performed to assess the impact of depressive symptoms and csf biomarkers on subjective cognitive complaints and cognitive performance . the variable of depressive symptoms was entered together with one of three csf variables at a time as the predictor variables . only one csf variable was included per model because of the colinearity among the predictor variables . as there was a significant group difference in age , age was used as a confounder in each model . the term ", "demographic data were similar in sci and mci except for age . as expected , cognitive performance ( mmse , word list / visual memory , response inhibition , and working memory ) was significantly better in sci compared to mci , but both groups reported a similar degree of memory and concentration complaints . depressive symptoms were not significantly different between the groups , although there was a high variability in depression scores in both groups . csf a42 levels were higher ( but not significantly so ) in sci compared to mci , while t - tau levels were significantly lower and p - tau levels were lower at trend level in sci compared to mci . there was a significant negative relationship between visual memory performance and concentration complaints as well as between response inhibition and both memory and concentration complaints in patients with sci ( the better the test performance , the less complaints ) . in the same group , there were also negative relationships between memory complaints and performance on tests of working memory , word list and visual memory , but they were only significant at trend level . in mci , significant positive relationships were found between word list / visual memory performance and concentration complaints , i.e. a lower performance was associated with less complaints . no significant associations were found between test performance and memory complaints in mci . in order to assess the impact of depressive symptoms and csf biomarkers ( explanatory variables ) on the reported cognitive complaints and cognitive performance ( the dependent variables ) , linear regression analyses were performed ( tables 3 , 4 ) . scl-90-r depressive symptoms , but not csf biomarkers , predicted subjective memory and concentration complaints in both groups of patients . in contrast , csf biomarkers ( a42 , t - tau , and p - tau ) were significant predictors of cognitive test performance . in the sci group ( table 3 ) , a42 was a significant predictor of word list / visual memory and p - tau was a significant predictor of response inhibition . in the mci group ( table 4 ) , t - tau was a significant predictor of word list memory ( significance at trend level was achieved for visual memory ) , and p - tau was a significant predictor of visual memory ( significance at trend level was achieved for word list memory ) . we also explored the associations of depression with cognitive complaints and test performance , using gds-15 as the depression measure . the results were largely similar in sci , with the exception that the gds-15 score was negatively associated with response inhibition . in mci , the gds-15 score did not correlate with cognitive complaints or test performance ( data not shown ) .", "demographic data were similar in sci and mci except for age . as expected , cognitive performance ( mmse , word list / visual memory , response inhibition , and working memory ) was significantly better in sci compared to mci , but both groups reported a similar degree of memory and concentration complaints . depressive symptoms were not significantly different between the groups , although there was a high variability in depression scores in both groups . csf a42 levels were higher ( but not significantly so ) in sci compared to mci , while t - tau levels were significantly lower and p - tau levels were lower at trend level in sci compared to mci .", "table 2 shows the correlations between test performance and cognitive complaints . there was a significant negative relationship between visual memory performance and concentration complaints as well as between response inhibition and both memory and concentration complaints in patients with sci ( the better the test performance , the less complaints ) . in the same group , there were also negative relationships between memory complaints and performance on tests of working memory , word list and visual memory , but they were only significant at trend level . in mci , significant positive relationships were found between word list / visual memory performance and concentration complaints , i.e. a lower performance was associated with less complaints .", "in order to assess the impact of depressive symptoms and csf biomarkers ( explanatory variables ) on the reported cognitive complaints and cognitive performance ( the dependent variables ) , linear regression analyses were performed ( tables 3 , 4 ) . scl-90-r depressive symptoms , but not csf biomarkers , predicted subjective memory and concentration complaints in both groups of patients . in contrast , csf biomarkers ( a42 , t - tau , and p - tau ) were significant predictors of cognitive test performance . in the sci group ( table 3 ) , a42 was a significant predictor of word list / visual memory and p - tau was a significant predictor of response inhibition . in the mci group ( table 4 ) , t - tau was a significant predictor of word list memory ( significance at trend level was achieved for visual memory ) , and p - tau was a significant predictor of visual memory ( significance at trend level was achieved for word list memory ) . we also explored the associations of depression with cognitive complaints and test performance , using gds-15 as the depression measure . the results were largely similar in sci , with the exception that the gds-15 score was negatively associated with response inhibition . in mci , the gds-15 score did not correlate with cognitive complaints or test performance ( data not shown ) .", "this study has investigated correlates of cognitive complaints and cognitive test performance in patients with sci and mci . depressive symptoms and csf biomarkers were assessed as possible correlates because of their importance for the differential diagnosis of dementia . subjects with sci were included since they constitute a group of particular interest for the early detection of neurodegenerative disease . in addition to neuropsychological data , we have studied both memory and concentration complaints , while most of the existing studies have aggregated the complaints into one complaint score instead of analyzing them by domain . we have used the self - rating questionnaires scl-90-r and gds-15 for the assessment of cognitive complaints and depressive symptoms . relatively high mmse scores ( sci mean score 29 and mci mean score 28 ) imply that most of patients are reliable sources of information . still , a decrease in reliability is expected with disease progression ( e.g. , from sci to mci ) . the sci and mci groups studied reported a similar amount of memory and concentration complaints . cognitive complaints increased with decreasing cognitive function in sci and decreased with decreasing cognitive function in mci . these results suggest that patients with incipient cognitive difficulties ( sci ) , not satisfying the clinical criteria for mci , assess their cognitive abilities more correctly , while patients with mci tend to underestimate their cognitive difficulties . similarly , disagreement between patients and their informants was associated with mci but not sci in another recent study . depressive symptoms , but not csf biomarkers , were significantly associated with cognitive complaints , which is in accord with the findings from earlier studies of normal and cognitively impaired samples . we have not found an association between depressive symptoms and cognitive impairment , except for the association between response inhibition and depressive symptoms as measured by gds-15 in sci . in comparison , depressive symptoms were negatively correlated with cognitive functioning in another recent study of healthy middle - aged and older adults . taking into account that depressive symptoms in midlife or in late life are associated with an increased risk of developing dementia , the association between depressive symptoms and response inhibition / cognitive complaints in our study may reflect an etiologic relationship between depression and very early cognitive changes due to dementia . we found negative associations between memory and csf tau measurements in the mci subsample and positive associations between a42 and memory in the cognitively healthier sci subsample . we have previously found similar associations between tau and memory in the overlapping sci / mci sample , which was not divided into sci and mci . to our knowledge , this is the first study of patients with sci and mci , giving support to the amyloid cascade hypothesis by using cognitive data . here , we find the associations between memory and csf a42 in sci and the associations between memory and tau biomarkers in mci , which agrees with recent findings of buchhave et al . , suggesting that altered a metabolism precedes tau - related pathology and neuronal degeneration in ad . incipient ad is the most prevalent underlying disease and is characterized by white matter diffusivity changes encompassing the memory network . in addition to memory performance , we have studied working memory and response inhibition . in sci , response inhibition was significantly associated with memory / concentration complaints and csf p - tau , while working memory was associated with memory complaints at trend level . these findings suggest that response inhibition is a sensitive measure of early cognitive decline in predementia phases . previously , we have found that worse performance on response inhibition was associated with increased white matter diffusivity underlying the superior frontal cortex . an important limitation has to do with the difficulties of detecting effect sizes in small group data sets , exposing the method to type ii error . with few subjects in the sci group although an extensive screening procedure was used for the classification of subjects , the groups may be overlapping and may contain , among other conditions , chronic ischemic disease , normal aging , early - stage ad , and non - ad predementia . still , a high variance in depression scores and high relationships between depressive symptoms and cognitive complaints suggest that some of the subjects could be included due to cognitive complaints related to their depressiveness . a cross - sectional study design may not be optimal since depressive disturbances can fluctuate and may not be present at every examination . the follow - up of the populations studied will help determine the long - term clinical significance of the results .", "this study aims to improve early diagnosis of dementia by investigating correlates of cognitive complaints and cognitive test performance in sci and mci . considering the question if cognitive complaints reflect actual performance , the results from this study demonstrate that patients with sci , not satisfying clinical criteria for mci , assess their cognitive abilities more correctly , while patients with mci tend to underestimate their cognitive difficulties . further , the findings shed light on the nature of cognitive complaints and cognitive impairment by demonstrating that depressive symptoms are associated with cognitive complaints , while degenerative changes ( relating to pathological levels of csf biomarkers ) are associated with an objective cognitive decline in high - risk predementia states . the results of the present manuscript are preliminary and need further confirmation on larger , prospective samples ." ]

[ "major problem in ocular therapeutics is the attainment of optimal drug concentration at the site of action , which is compromised mainly due to precorneal loss resulting in only a small fraction of the drug being ocularly absorbed . the effective dose administered may be altered by increasing the retention time of medication into the eye by using in situ gel - forming systems . the anatomy , physiology , and biochemistry of the eye render this organ exquisitely impervious to foreign substances . the challenge to the formulator is to circumvent the protective barriers of the eye without causing permanent tissue damage . ophthalmic ointments ensure superior drug bioavailability by increasing the contact time , minimizing the dilution by tears , and resisting nasolacrimal drainage . major disadvantage of ointment , providing blurred vision , due to this it could be used either night time or for treatment on the outside and edges of the eyelids . suspension as ophthalmic delivery systems relies on the assumption that particles may persist in conjunctival sac . precorneal drug loss can be minimal , such as retarding drainage by using diffusion - controlled , nonerodible polymeric insert . the major disadvantage of inserts is the lack of patient acceptance owing to difficult administration . the development of newer , more sensitive diagnostic techniques and therapeutic agents render urgency to the development of more successful ocular delivery systems . the primitive ophthalmic solution , suspension , and ointment dosage forms are clearly no longer sufficient to combat these diseases , and current research and development efforts to design better therapeutic systems are the primary focus of this research work . the aim of the present investigation is to formulate an in situ gel using novel gum system . in situ gel solution increases the residence time and also sustain the release mechanism of the drug .", "sodium alginate and hpmc - e 50lv was obtained from the nice chemicals , ahmedabad , india . the polymeric solution was prepared by dispersing required quantity of sodium alginate as main polymer and hpmc- e 50 lv , hpmc- k4 m as co - polymers in water using a magnetic stirrer until the polymers completely dissolve . aqueous solution of moxifloxacin hydrochloride was added in to the polymeric solution with continuous stirring . the ph of the solution was adjusted to 6.5 using 0.1 n naoh/0.1 n hcl . the in situ gel formulations are depicted in table 1 . formulation design of in situ gelling system the formulated in situ gel solution was tested for clarity , ph , gelling capacity , and drug content estimation . evaluation parameters of formulations the gelling capacity of the prepared formulation was determined by placing a drop of the formulation in a vial containing 2 ml of freshly prepared simulated tear fluid and visually observed . the time taken for its gelling the samples were analyzed at 37c 0.5c by a circulating bath connected to the viscometer adaptor prior to each measurement.[710 ] the angular velocity of the spindle was increased 1 to 4 and the viscosity of the formulation was measured . the drug content estimation was carried out by diluting 1 ml of prepared formulation in 100 ml of distilled water and analyzed using uv - visible spectrophotometer ( shimadzu uv-1700 pc , shimadzu corporation , japan ) at 290 nm . the in vitro release of moxifloxacin hydrochloride from the prepared formulations was studied using a modified diffusion testing apparatus . the freshly prepared simulated tear fluid ( ph 7.4 ) was used as a diffusion medium . semi permeable membrane , previously soaked in the diffusion medium for overnight , was tied to one end of a specially designed glass cylinder ( open at both ends ) having inner diameter of 3.4 cm . two milliliter of formulation was accurately pipette into the glass cylinder known as donor chamber . the cylinder was suspended in a beaker ( acceptor chamber ) containing 100 ml of diffusion medium so that the membrane just touches the surface of the medium . acceptor chamber was maintained at a temperature of 37 2c with a stirring rate of 50 rpm using magnetic stirrer . about 1 ml of sample was withdrawn at a time interval of 1 hour and replaced with an equal volume of fresh diffusion medium . the aliquots were diluted with the diffusion medium and analyzed at 290 nm using uv spectrophotometer . in a similar manner , 2 ml of pure drug solution ( 0.5% w / v in distilled water ) and 2 ml marketed product ( milflox ) were studied in a similar manner . \n the standard minimum inhibitory concentration ( mic 2 g / ml ) of control and developed formulations containing moxifloxacin were prepared . a total of 60 ml of nutrient agar media was prepared and sterilized at 15 lb / sq - inch pressure for 18 minutes in an autoclave ; 0.5 ml of microorganism suspension was poured into the above medium which is maintained at temperature of 52c to 58c . after solidification of the media , sterile solutions of moxifloxacin hydrochloride ( standard solutions ) and the developed formulations diluted suitably with sterile distilled water ( test solutions ) were poured in to the cup of sterile nutrient agar petri plates . this was previously seeded with test organisms ( escherichia coli and staphylococcus aureus ) . after allowing diffusion of the solutions for 2 hours the zone of inhibition ( zoi ) was measured around each cup and compared with that of control . ocular irritation study was performed on optimized formulation in four albino rabbits ( male ) , each weighing about 2 to 3 kg , and 0.1 ml of the optimized sterile moxifloxacin hydrochloride formulation was instilled in to cul - de - sac twice a day for a period of 14 days . sterile optimized ophthalmic formulation was filled in glass vials , closed with gray butyl rubber closures and sealed with an aluminium caps . the vials contain optimized formulation were kept in stability chamber , maintained at 40 2c and 75 5 % rh for one month . samples were withdrawn weekly and estimated for drug content , ph , visual appearance , gelling capacity and in vitro drug release .", "the polymeric solution was prepared by dispersing required quantity of sodium alginate as main polymer and hpmc- e 50 lv , hpmc- k4 m as co - polymers in water using a magnetic stirrer until the polymers completely dissolve . aqueous solution of moxifloxacin hydrochloride was added in to the polymeric solution with continuous stirring . the ph of the solution was adjusted to 6.5 using 0.1 n naoh/0.1 n hcl . the in situ gel formulations are depicted in table 1 . formulation design of in situ gelling system", "the formulated in situ gel solution was tested for clarity , ph , gelling capacity , and drug content estimation .", "the gelling capacity of the prepared formulation was determined by placing a drop of the formulation in a vial containing 2 ml of freshly prepared simulated tear fluid and visually observed . the time taken for its gelling was noted .", "the samples were analyzed at 37c 0.5c by a circulating bath connected to the viscometer adaptor prior to each measurement.[710 ] the angular velocity of the spindle was increased 1 to 4 and the viscosity of the formulation was measured .", "the drug content estimation was carried out by diluting 1 ml of prepared formulation in 100 ml of distilled water and analyzed using uv - visible spectrophotometer ( shimadzu uv-1700 pc , shimadzu corporation , japan ) at 290 nm .", "the in vitro release of moxifloxacin hydrochloride from the prepared formulations was studied using a modified diffusion testing apparatus . the freshly prepared simulated tear fluid ( ph 7.4 ) was used as a diffusion medium . semi permeable membrane , previously soaked in the diffusion medium for overnight , was tied to one end of a specially designed glass cylinder ( open at both ends ) having inner diameter of 3.4 cm . two milliliter of formulation was accurately pipette into the glass cylinder known as donor chamber . the cylinder was suspended in a beaker ( acceptor chamber ) containing 100 ml of diffusion medium so that the membrane just touches the surface of the medium . acceptor chamber was maintained at a temperature of 37 2c with a stirring rate of 50 rpm using magnetic stirrer . about 1 ml of sample was withdrawn at a time interval of 1 hour and replaced with an equal volume of fresh diffusion medium . the aliquots were diluted with the diffusion medium and analyzed at 290 nm using uv spectrophotometer . in a similar manner , 2 ml of pure drug solution ( 0.5% w / v in distilled water ) and 2 ml marketed product ( milflox ) were studied in a similar manner . \n", "the drug was allowed to diffuse through a solid agar medium . the standard minimum inhibitory concentration ( mic 2 g / ml ) of control and developed formulations containing moxifloxacin were prepared . a total of 60 ml of nutrient agar media was prepared and sterilized at 15 lb / sq - inch pressure for 18 minutes in an autoclave ; 0.5 ml of microorganism suspension was poured into the above medium which is maintained at temperature of 52c to 58c . after solidification of the media , sterile solutions of moxifloxacin hydrochloride ( standard solutions ) and the developed formulations diluted suitably with sterile distilled water ( test solutions ) were poured in to the cup of sterile nutrient agar petri plates . this was previously seeded with test organisms ( escherichia coli and staphylococcus aureus ) . after allowing diffusion of the solutions for 2 hours the zone of inhibition ( zoi ) was measured around each cup and compared with that of control .", "ocular irritation study was performed on optimized formulation in four albino rabbits ( male ) , each weighing about 2 to 3 kg , and 0.1 ml of the optimized sterile moxifloxacin hydrochloride formulation was instilled in to cul - de - sac twice a day for a period of 14 days .", "sterile optimized ophthalmic formulation was filled in glass vials , closed with gray butyl rubber closures and sealed with an aluminium caps . the vials contain optimized formulation were kept in stability chamber , maintained at 40 2c and 75 5 % rh for one month . samples were withdrawn weekly and estimated for drug content , ph , visual appearance , gelling capacity and in vitro drug release .", "in the present investigation , efforts were made to prepare the sustained release moxifloxacin hydrochloride in situ gel forming ophthalmic solution using polymers such as sodium alginate and hpmc . sodium alginate a novel ophthalmic gel - forming mucoadhesive polymer , which gets converted to gel in the presence of divalent - cations ( calcium ion ) present in the lachrymal fluid ( ph 7.4 ) , was used as the gelling agent . the prepared in situ gel formulations were evaluated for clarity , ph measurement , gelling capacity , drug content estimation , rheological study , in vitro diffusion study . the ph of in situ gel solution was found to be around 6.5 for all the formulations . the formulation should have an optimum viscosity that will allow for easy instillation into the eye , which would undergo a rapid sol to gel transition ( triggered by ion exchange ) as shown in table 2 . rheological evaluation of all the formulation exhibited newtonian flow before gelling and exhibited pseudoplastic flow after gelling in the eye . additionally , the gel formed in situ should maintain its integrity without dissolving or eroding for a prolonged period . rheological studies of formulations formulations f1 to f6 ( before gelling ) formulations f1 to f6 ( after gelling ) from the in vitro results it was observed that percentage release of the drug from the developed formulations f1 ( 93.86% ) , f2 ( 92.78% ) , f3 ( 89.97% ) , f4 ( 82.80% ) , f5 ( 80.49% ) , and f6 ( 78.71% ) as shown in figure 3 . this could be the reason of higher concentration of sodium alginate and hpmc k4 m among the developed formulations . by observing the drug release profile it can be conclude that release is not stagnant even end of 10 hours . formulation f6 showed highest zone of inhibition values against s. aureus ( 28.66 mm ) and e. coli ( 30.99 mm ) , respectively , compared to other developed formulations . comparative in vitro diffusion profile of pure drug , marketed product and f1 to f6 formulations antimicrobial efficacy study was performed on f6 formulation using gram + ve s. aureus and gram -ve e. coli organism . the zone of inhibition of f6 ophthalmic formulation found to be 28.66 and 30.99 mm , respectively , for gram + ve s. aureus and gram -ve e. coli organism . the study indicated moxifloxacin hydrochloride retained its antimicrobial activity when formulated as gel forming ophthalmic system against both selected s. aureus and e. coli . zone of inhibition values of formulation f1 to f6 and pure drug at the concentration of 2 g / ml against staphylococcus aureus and escherichia coli ocular irritation study was performed using healthy albino rabbits after getting prior permission from the institutional animal ethics committee . the eyes of each rabbits were examined at particular time interval after instillation of the optimized formulation ( f6 ) . no ocular damage or abnormal clinical signs to the cornea , iris or conjunctiva were visible . the result of ocular irritation studies indicates that formulations containing all ingredients are non - irritant to rabbit eye . accelerated stability studies were carried out at 40 2c at 75 5 % rh for 1 month using stability chamber . the samples were analyzed periodically on every week , and found that there are no changes in visual appearance , clarity , ph , and gelation . assay values after 1 month of storage are found almost same ( deviating not more than one percent ) .", "moxifloxacin hydrochloride , a broad spectrum antibacterial agent used in the treatment of ocular infections , was successfully formulated as in situ gel - forming eye drops using sodium alginate as a gelling agent in combination with hpmc as a viscosity enhancing agent . thus , the developed formulation is a viable alternative to conventional eye drops by virtue of its ability to enhance bioavailability through its longer precorneal residence time and ability to sustain drug release . also important is the ease of administration afforded and decreased frequency of administration resulting in better patient acceptance ." ]

[ "neurofibromatosis affects 1:3,000 individuals , and characterized by largely benign but often debilitating tumors that grow in the nervous system . its course is unpredictable : it can cause a variety of benign nerve tumors including plexiform , dermal , and optic glioma tumors ; in some cases malignant peripheral nerve sheath tumors can develop in the plexiform tumours . down 's syndrome is one of the most common and easily recognized genetic conditions in humans . the estimated prevalence in the united states is approximately 15 per 10,000 live births ( ie , 1 out of every 700 ) most often , it is the result of nondisjunction on chromosome 21 during maternal meiotic division .", "we herein present the case of a 17-year - old boy with complaints of skin lesions over the back associated with mild itching since 3 months . he was a known case of down 's syndrome with a history of seizures in childhood [ figure 1 ] . the lesions gradually increased in size and number , and similar lesions started developing over his forehead since 23 weeks . on examination , multiple skin colored papules of varying size were present over the entire back and the forehead . velvety thickening of the skin and hyperpigmentation of the axillae suggestive of acanthosis nigricans was present . the characteristic features of down 's syndrome , including simian crease , mongoloid facies , and mental retardation were present . canities and a solitary keloid over the chest were also seen apart from the clinical features of down 's syndrome . on oral examination , scrotal tongue , abnormal dentition , and other investigations such as ct scan brain , 2d echo , and ecg were normal . histopathology of the nodule from the back revealed focally thinned out epidermis with intact basal layer ; the papillary dermis showed a mild perivascular infiltrate . deeper dermis showed a benign spindle cell proliferation suggestive of neurofibromatosis [ figure 3 ] . physical appearance of down 's syndrome ( a ) neurofibromas ( b ) sebaceous cyst ( c ) acanthosis nigricans , and axillary freckling ( d ) scrotal tongue focally thinned out epidermis with intact basal layer with the papillary dermis showing a mild perivascular infiltrate .", "the presentation of a patient with two unrelated genetic disorders is uncommon , although not statistically impossible . however , in two of these reports , a third medical condition was also present . in one report , breast cancer was reported . in the other , our patient had down 's syndrome , neurofibromatosis , dental anomalies , and ocular defects and keloids . in the large majority of cases , trisomy 21 there is no current evidence to support the idea that this is anything other than a chance occurrence . the two conditions are not related , and the likelihood of a person being born with these two conditions is approximately 1 in 2,700,000 births . they however overlap in their manifestations . both are associated with intellectual impairment to differing degrees . macroglossia occurs in both conditions , as may facial , dental , and occlusal abnormalities . hearing and speech are affected in both conditions , as may the ability to maintain an acceptable level of oral hygiene . mutations in the gene results in abnormal control of cell growth , differentiation , and aberrant myelination . our patient with of neurofibrmatosis type 1 with down 's syndrome is the first such to have a keloid and sebaceous cyst apart from myopia and dental anomalies . the unpredictable nature and course of the two genetic disorders along with multiple acquired conditions in this patient make it difficult for patients , teachers , care givers , and medical / dental providers to create and maintain long - term care plans . the authors certify that they have obtained all appropriate patient consent forms . in the form the patient(s ) has / have given his / her / their consent for his / her / their images and other clinical information to be reported in the journal . the patients understand that their names and initials will not be published and due efforts will be made to conceal their identity , but anonymity can not be guaranteed .", "the authors certify that they have obtained all appropriate patient consent forms . in the form the patient(s ) has / have given his / her / their consent for his / her / their images and other clinical information to be reported in the journal . the patients understand that their names and initials will not be published and due efforts will be made to conceal their identity , but anonymity can not be guaranteed .", "", "" ]

[ "micropolar fluids are those fluids consisting of randomly oriented particles suspended in a viscous medium , which can undergo a rotation that can affect the hydrodynamics of the flow , making it a distinctly non - newtonian fluid . they constitute an important branch of non - newtonian fluid dynamics where microrotation effects as well as microinertia are exhibited . modelling and analysis of the dynamics of micropolar fluids have been the field of very active research due to their application in a number of processes that occur in chemical , pharmaceutical , and food industry . such applications include the extrusion of polymer fluids , solidification of liquid crystals , cooling of a metallic plate in a bath , animal bloods , exotic lubricants , and colloidal and suspension solutions , for example , for which the classical navier - stokes theory is inadequate . the essence of the theory of micropolar fluids lies in the extension of the constitutive equations for newtonian fluids so that more complex fluids can be described by this theory . in this theory , rigid particles contained in a small fluid volume element are limited to rotation about the centre of the volume elements described by microrotation vector . it is well known that heterogeneous mixtures , such as ferro liquids , colloidal fluids , most slurries , and suspensions , are some liquids with polymer activities which behave differently from newtonian fluids . the main difference is that these types of fluids have a microstructure and exhibit microrotational effects and can support surface and body couples which are not present in the theory of newtonian fluids . in order to study such types of fluids eringen developed the theory of microfluids which include the effect of local rotary inertia , the couple stress , and inertial spin . this theory is expected to be successful in analyzing the behavior of non - newtonian fluids . eringen also developed the theory of micropolar fluids for the case where only microrotational effects and microrotational inertia exist . he extended the theory of thermomicropolar fluids and derived the constitutive law for fluids with microstructure . an excellent review of micropolar fluids and their applications was given by ariman et al . . in view of lukaszewicz , micropolar fluids represent those fluids which consist of randomly oriented particles suspended in a viscous medium . several authors have studied the characteristic of the boundary layer flow of micropolar fluid under different boundary conditions . takhar and soundalgekar [ 6 , 7 ] studied the flow and heat transfer of micropolar fluid past a porous plate . further , they [ 8 , 9 ] discussed these problems past a continuously moving porous plate . often experimental and analytical investigations of free convection flows are carried out by the researchers , since in many situations in technology and nature , one continually encounters masses of fluid arising freely in an extensive medium due to the buoyancy effects . [ 10 , 11 ] investigated the natural convection from a heated vertical plate in micropolar fluid . the problem of flow and heat transfer for a micropolar fluid past a porous plate embedded in a porous medium has been of great use in engineering studies such as oil exploration and thermal insulation . raptis and takhar and kim have considered the micropolar fluid through a porous medium . all the above mentioned studies are limited only to applications where radiative heat transfer is negligible . the role of thermal radiation in the flow heat transfer process is of great relevance in the design of many advanced energy conversion systems operating at higher temperatures . thermal radiation within these systems is usually the result of emission by hot walls and the working fluid . nuclear power plants , gas turbines , and the various propulsion devices for aircraft , missiles , satellites , and space vehicles are examples of such engineering areas . perdikis and raptis illustrated the heat transfer of a micropolar fluid in the presence of radiation . raptis studied the effect of radiation on the flow of a micropolar fluid past a continuously moving plate . recently , elbashbeshy and bazid and kim and fedorov have reported on the radiation effects on the mixed convection flow of micropolar fluid . makinde examined the transient free convection interaction with thermal radiation of an absorbing emitting fluid along moving vertical permeable plate . rahman and sattar studied transient convective flow of micropolar fluid past a continuous moving porous plate in the presence of radiation . moreover , when the radiative heat transfer takes place , the fluid involved can be electrically conducting in the sense that it is ionized owing to high operating temperature . accordingly , it is of interest to examine the effect of the magnetic field on the flow . thermal radiation effects on hydromagnetic natural convection flow with heat and mass transfer play an important role in manufacturing processes taking place in industries for the design of fins , glass production , steel rolling , casting and levitation , furnace design , and so forth . the process of fusing of metals in an electrical furnace by applying a magnetic field and the process of cooling of the first wall inside a nuclear reactor containment vessel where the hot plasma is isolated from the wall by applying a magnetic field are examples of such fields where thermal radiation and magnetohydrodynamics ( mhd ) are correlative . this fact was taken into consideration by abd - el aziz in his study on micropolar fluids . raptis and massalas studied magnetohydrodynamic flow past a plate by the presence of radiation . the rotating flow of an electrically conducting fluid in presence of magnetic field has got its importance in geophysical problems . investigation of hydromagnetic natural convection flow in a rotating medium is of considerable importance due to its application in various areas of geophysics , astrophysics , and fluid engineering , namely , maintenance and secular variations in earth 's magnetic field due to motion of earth 's liquid core , internal rotation rate of the sun , structure of the magnetic stars , solar and planetary dynamo problems , turbo machines , rotating mhd generators , rotating drum separators for liquid metal mhd applications , and so forth . it may be noted that coriolis and magnetic forces are comparable in magnitude and coriolis force induces secondary flow in the flow - field . changes that take place in the rotation suggest the possible importance of hydromagnetic spin - up . taking into consideration the importance of such study , unsteady hydromagnetic natural convection flow past a moving plate in a rotating medium mention maybe made of research studies of singh , raptist and singh , tokis , nanousis , and singh et al . . this problem of spin - up in magnetohydrodynamic rotating fluids has been discussed under varied conditions by takhar et al . . the study of heat and mass transfer due to chemical reaction is also very importance because of its occurrence in most of the branches of science and technology . the processes involving mass transfer effects are important in chemical processing equipment which is designed to draw high value products from cheaper raw materials with the involvement of chemical reaction . ibrahim and makinde investigated radiation effect on chemically reactive mhd boundary layer flow of heat and mass transfer past a porous vertical flat plate . babu and satya narayan examined chemical reaction and thermal radiation effects on mhd convective flow in a porous medium in the presence of suction . das and sivaiah investigated studied the effect of chemical reaction and thermal radiation on heat and mass transfer flow of mhd micropolar aid in a rotating frame of reference . convection problems associated with heat sources within fluid - saturated porous media are of great practical significance in geophysics and energy - related problems , such as recovery of petroleum resources , cooling of underground electric cables , storage of nuclear waste materials groundwater pollution , fiber and granular insulations , chemical catalytic reactors , and environmental impact of buried heat generating waste . [ 32 , 33 ] presented an analysis on mhd free convection and mass transfer adjacent to moving vertical plate for micropolar fluid in a rotating frame of reference in presence of heat generation / absorption and a chemical reaction using perturbation technique . babu and narayana analyzed unsteady free convection with heat and mass transfer flow for a micropolar fluid through a porous medium with a variable permeability bounded by a semi - infinite vertical plate in the presence of heat generation , thermal radiation and first - order chemical reaction . the current development of magnetohydrodynamics application is toward a strong magnetic field ( so that the influence of electromagnetic force is noticeable ) and toward a low density of the gas ( such as in space flight and in nuclear fusion research ) . under this condition the rotating flow of an electrically conducting fluid in the presence of a magnetic field is encountered in cosmic fluid dynamics , medicine and biology . mhd was pioneered cowling and he emphasized that when the strength of the applied magnetic field is sufficiently large , ohm 's law needs to be modified to include hall current . the hall effect is merely due to the sideways magnetic force on the drafting free charges . the electric field has to have a component transverse to the direction of the current density to balance this force . in many works of plasma physics , much attention is not paid to the effect caused due to hall current . however , the hall effect can not be completely ignored if the strength of the magnetic field is high and the number of density of electrons is small as it is responsible for the change of the flow pattern of an ionized gas . hall effect results in a development of an additional potential difference between opposite surfaces of a conductor for which a current is induced perpendicular to both the electric and magnetic field . , saha et al . , and ahmed et al . have presented some model studies on the effect of hall current on mhd convection flow because of its possible application in the problem of mhd generators and hall current . preeti and chaudhary analyzed an unsteady hydromagnetic flow of a viscoelastic fluid from a radiative vertical porous plate , taking the effects of hall current and mass transfer into account . studied the heat and mass transfer in unsteady free convection flow with radiation absorption past an impulsively started infinite vertical porous plate subjected to strong magnetic field including the hall effect . investigated the simultaneous effects of hall current and free stream velocity on the magneto hydrodynamic flow over a moving plate in a rotating fluid . recently , seth et al . investigated the problem of an unsteady mhd free convective flow past an impulsively started vertical plate with ramped temperature immersed in a porous medium with rotation and heat absorption taken into account the hall effect . when heat and mass transfer occur simultaneously in a moving fluid , the relations between the fluxes and the driven potential are important . it has been found that an energy flux can be generated not only by temperature gradients but by composition gradient as well . the energy caused by a composition gradient is called the dufour or the diffusion - thermo effect , also the mass fluxes can also be caused by the temperature gradient and this is called the soret or thermal diffusion effect ; that is , if two regions in a mixture are maintained at different temperatures so that there is a flux of heat , it has been found that a concentration gradient is set up and in a binary mixture , one kind of a molecule tends to travel toward the hot region and the other kind toward the cold region . the dufour effect is neglected in this study because it is of a smaller order of magnitude than the magnitude of thermal radiation which exerts a stronger effect on the energy flux . soret or thermal diffusion effect has been utilized for isotope separation in mixtures between gases with very light molecular weight ( h2 , he ) and medium molecular weight ( n2 , air ) and it was found to be of a magnitude that it can not be neglected due to its practical applications in engineering and sciences . soret effects due to natural convection between heated inclined plates have been investigated by raju et al . . m. g. reddy and n. b. reddy investigated soret and dufour effects on steady mhd free convective flow past an infinite plate . mohamed studied unsteady mhd flow over a vertical moving porous plate with heat generation and soret effect . practically , in many engineering applications , the particle adjacent to a solid surface no longer takes the velocity of the surface . the particle at the surface has a finite tangential velocity ; it slips along the surface . this flow regime is called the slip - flow regime and this effect can not be neglected . the fluid slippage phenomenon at the solid boundaries appear in many applications such as microchannels or nanochannels and in application where a thin film of light oils is attached to the moving plates or when the surface is coated with special coating such as thick monolayer of hydrophobic octadecyltrichlosilane , that is , lubrication of mechanical device , where a thin film of lubricant is attached to the surface slipping over one another or when the surfaces are coated with special coating to minimize the friction between them . chaudhary and jain examined the effects of radiation on the hydromagnetic free convection flow set up due to temperature as well as species concentration of an electrically conducting micropolar fluid past a vertical porous plate through porous medium in slip - flow regime . chaudhary and sharma [ 49 , 50 ] studied the free convection flow past a vertical porous plate with variable suction in slip - flow regime . have considered the magnetohydrodynamic unsteady flow of a viscous stratified fluid through a porous medium past a porous flat moving plate in the slip flow regime with heat source . singh and kumar presented the fluctuating heat and mass transfer on unsteady free convection flow of radiating and reacting fid past a vertical porous plate in slip flow regime using perturbation analysis . kumar and chand have studied the effect of slip conditions and the hall current on unsteady mhd flow of a viscoelastic fluid past an infinite vertical porous plate through porous medium . recently , oahimire et al . investigated the effects of thermal - diffusion and thermal radiation on unsteady heat and mass transfer by free convective mhd micropolar fluid flow bounded by a semi - infinite vertical plate in a slip - flow regime under the action of transverse magnetic field with suction . to the best of our knowledge , considerably less work has been done concerning the combined effect of hall current and soret effect on chemically reactive magnetomicropolar fluid flow incorporating the effect of rotation in slip flow regime in the presence of radiation and heat absorption . the results are in accordance with the physical realities which validate the correctness of our work presented here .", "consider an unsteady hydromagnetic flow of an incompressible , viscous , and electrically conducting micropolar fluid past an infinite vertical permeable plate embedded in a uniform porous medium in slip - flow regime and in a rotating system taking hall current , thermal radiation , soret effect , and chemical reaction into account . the coordinate system is chosen in such a way that x - axis is considered along the porous plate in vertically upward direction , y - axis is taken along the width of the plate , and z - axis normal to the plane of the plate in the fluid as shown in figure configuration ( figure 1 ) . since the plate is infinite in extent in x- and y- directions , hence all physical quantities will be independent of x and y and they are functions of z and t only ; that is , u/x = u/y = v/x = v/y = 0 , and so forth . a magnetic field of uniform strength b0 is applied in a direction parallel to z - axis which is perpendicular to the flow direction . it is assumed that the induced magnetic field generated by fluid motion is negligible in comparison to the applied one . this assumption is justified because magnetic reynolds number is very small for liquid metals and partially ionized fluids which are commonly used in industrial applications . it is assumed that there is no applied or polarized voltage so the effect of polarization of fluid is negligible . this corresponds to the case where no energy is added or extracted from the fluid by electrical means . the entire system is rotating with an angular velocity about the normal to the plate . it is assumed here that the hole size of the porous plate is significantly larger than the characteristic microscopic length scale of the porous medium . the fluid is considered to be a gray , absorbing - emitting but nonscattering medium and the rosseland approximation is used to describe the radiative heat flux . the radiative heat flux in the x - direction is considered negligible in comparison with that of z - direction . when the strength of the magnetic field is very large , the generalized ohm 's law in the absence of electric field takes the following form : ( 1)j+eeb0jh=evh+1enepe . under the assumption that the electron pressure ( for weakly ionized gas ) , the thermoelectric pressure and ion - slip conditions are negligible ; now the above equation becomes ( 2)jx=eh01+m2mvu , jz=eh01+m2mu+v , where u is the x - component of v , v is the y - component of v , and m ( = ee ) is hall parameter . the suction velocity is assumed to be w = w0(1 + aet with these foregoing assumptions , the governing equations under boussinesq approximation can be written in a cartesian frame of reference as follows consider the following : ( 4)ut+wuz2v = +r2uz2+gttt+gccc ukr2z+e2h02mvu1+m2,vt+wvz+2u = +r2vz2uk+r1ze2h02mu+v1+m2 . \n consider the following : ( 7)ct+wcz=dm2cz2+dmkttm2tz2rccc. the initial and boundary conditions suggested by the physics of the problem are ( 8)u=v=0 , 1=2=0,t = t , c=ckkkkkkkkkkkkkkikkfor t0,(9)u=ur+luz , v=0,1=12vz , 2=12uz,t = tw , c=cwikkkkkkkkkkkkkkkkkkkat z=0u0 , v0 , 10,20 , tt , ccikkkkkkkkkkkkkkkkkkkkkias zikkkkkkkkkkkkkkkkkkkkkkikfor t>0 . the boundary condition for microrotation components 1 and 2 describes its relationship with the surface stress . in the above boundary condition ( 9 ) the plate is in uniform motion and subjected to variable suction and slip boundary condition . in the parameter l = ( ( 2 m1)/m1)l , l is the molecular mean free path and m1 is the tangential momentum accommodation coefficient . integration of continuity equation ( 3 ) for variable suction velocity normal to the plate gives ( 10)w=w01+aet , where w0 represents the normal velocity at the plate which is positive for suction and negative for blowing . the radiative heat flux term by using rosseland approximation is given by ( 11)qr=43art4z. we assume that the temperature differences within the flow are such that t may be expressed as a linear function of the temperature t. this is accomplished by expanding t in a taylor series about t and , neglecting higher - order terms , we have ( 12)t44t3t3t4 . by using ( 11 ) and proceeding with analysis , we introduce the following dimensionless variables : ( 14)u = uur , v = vur , z = zur,t = tur2 , =ur2 , 1=1ur2 , 2=2ur2,gr=gttwtur3 , gc=gccwcur3,r=2ur2 , s = w0ur , =r,=tttwt , c = cccwc , k = kur22,m=eh0ur , =j , pr=cpk , sc=dm , f=4t3kar , q = q2ur2k , sr = dmkttwttmcwc , =rcur2 , h = lur. in view of ( 14 ) , the governing equations ( 4)(7 ) and ( 13 ) reduce to the following dimensionless form : ( 15)uts1+aetuzrv = 1+2uz2+gr+gmm21+m2 + 1ku 2z+mm21+m2v,(16)vts1+aetvz+ru = 1+2vz2m21+m2 + 1kv+1zmm21+m2u,(17)1ts1+aet1z=21z2,(18)2ts1+aet2z=22z2,(19)ts1+aetz=1pr1 + 4f32z2qpr,(20)cts1+aetcz=1sc2cz2+sr2cz2c . the boundary conditions ( 8)-(9 ) in view of ( 14 ) are then given by the following dimensionless form : ( 21)u = v=0 , 1=2=0 , =0 , c=0kkkkkkkkkkkkkkkkkkkkkkkkkkkkkfor t0u=1+huz , v=0 , 1=12vz,2=12uz , =1 , c=1kkkkkkkkkkkkkkkkkkkkkkkkkat z=0u0 , 10 , 20,0 , c0kkkkkkkkkkkkkkkkkkkkas zkkkkkkkkkkkkkkkkkkkkkkkfor t>0 . to simplify ( 15)(18 ) , we substitute the fluid velocity and angular velocity in the complex form as v = u + iv , = 1 + i2 and we get ( 22)vts1+aetvz+irv = 1+2vz2+gr+gmm21+m2 + 1kv izimm21+m2v,ts1+aetz=2z2 . the associated boundary conditions ( 21 ) become ( 23)v=0 , =0 , =0 , c=0kkkkkkkkkkkkikkkkkkkkkkfor t0v=1+huz , =i2vz , =1 , c=1kkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkiat z=0v0 , 0 , 0 , c0kkkkkkkkkkkkkkkkkkikkkkkkkkkkas zkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkfor t>0 .", "in order to reduce the above system of partial differential equations to a system of ordinary differential equations in dimensionless form , we represent the translational velocity v , microrotation velocity , temperature , and concentration c as ( 24)vz , t = v0z+etv1z+o2,z , t=0z+et1z+o2,z , t=0z+et1z+o2,cz , t = c0z+etc1z+o2 . by substituting the above equations ( 24 ) into ( 19 ) , ( 20 ) , ( 22)-(23 ) and equating the harmonic and nonharmonic terms and neglecting the higher - order terms of o( ) , we obtain the following pairs of equations for ( v0 , 0 , 0 , c0 ) and ( v1 , 1 , 1 , c1 ) . zero - order equations are : ( 25)1+v0+sv0a1v0+gr0+gmc0+i0=0,0+s0=0,3 + 4f0+3prs03q0=0,c0+sscc0scc0=sr0. first - order equations are : ( 26)1+v1+sv1a2v1+gr1+gmc1 + av0+i1=0,1+s11=sa0,3 + 4f1+3prs13q+pr1 = 3prsa0,c1+sscc1sc+c1=sscac0srsc1. the prime denotes differentiation with respect to y. the corresponding boundary conditions can be written as ( 27)v0=1+hv0z , v1=hv1z,0=i2v0z , 1=i2v1z,0=1 , 1=0 , c0=1 , c1=0 at z=0v00 , v10 , 00,10 , 00 , 10,c00 , c10kkkkkkkkkkkas z. solving ( 25)-(26 ) satisfying the boundary conditions ( 27 ) we obtain the expression for translational velocity v , microrotation velocity , temperature , and concentration c as ( 28)vz , t = b11er5z+b8er1z+b9er3z+b10es/z+etb20er7z+b13er1z+b17er5z+b18es/z+b19er6z + b14er2z+b15er4z+b16er3z + b17er5z+b18es/z+b19er6z,(29)z , t = d1es/z+etd2er6z+b12es/z,(30)z , t = er1z+etb1er1zer2z,(31)cz , t = b3er3z+b2er1z+etb4er3z+b5er1z + b6er2z+b7er4z . the exponential indices and the coefficients appearing in ( 28)(31 ) are given in the appendix . in technological applications , the wall shear stress , the wall couple stress , and the heat and mass transfer rate are often of great interest . the skin friction coefficient ( cf ) at the wall in dimensionless form is given by ( 32 ) cf=wz=0ur2=1+1+i2vzz=0(33 ) = 1+1+i2 b11r5+b8r1+b9r3+b10s+b17r5+b18s+b19r6 + etb20r7+b13r1+b17r5+b18s+b19r6 + b14r2+b15r4+b16r3 + b17r5+b18s+b19r6 . the couple stress coefficient ( cm ) at the plate is defined by ( 34)mw=zz=0 and in the dimensionless form it is given by ( 35)cm = mwjur=1+2zz=0=1+21zz=0+i2zz=0=1+2d1s+etd2r6+b12s. knowing the temperature field , it is interesting to study the effect of the free convection and thermal radiation on the rate of heat transfer and this is given by ( 36)qw=ktz43art4zz=0 . using t4tt 3t the above equation becomes ( 37)qw=ktwtur1 + 4f3zz=0 . the rate of heat transfer between the fluid and the plate is studied in terms of nondimensional nusselt number , which is given by ( 38)nu = xqwktwt=rex1 + 4f3zz=0 , where rex = urx/ is the local reynolds number ( 39)nurex1=1 + 4f3zz=0=1 + 4f3r1+etb1r1r2 . the definitions of the local mass flux and the local sherwood number are , respectively , given by ( 40)jw=dmczz=0,shx = jwxdmcwc=rexczz=0,shxrex1=czz=0=b3r3+b2r1+etb4r3+b5r1+b6r2+b7r4 .", "in the preceding sections , the governing equations along with the boundary conditions are solved analytically employing the perturbation techniques . the effects of main controlling parameters as they appear in the governing equations are discussed on the temperature , concentration c , translational velocity v , microrotation , skin - friction cf , nusselt number , and sherwood number . in order to get a physical insight of the problem the above physical quantities are compiled numerically and displayed graphically . in the entire calculations we have chosen = 0.01 , = 0.1 , t = 1 and a = 1 while pr , s , f , q , sr , sc , m , m , gr , gm , r , h , k , , and are varied over the range which are listed in the figure legends . the numerical values of fluid temperature computed from the analytical solutions ( 29 ) are illustrated graphically versus boundary layer coordinate z in figure 2 for various values of prandtl number ( pr ) , suction parameter ( s ) , heat absorption parameter ( q ) , and radiation parameter ( f ) . the values of prandtl number are chosen as pr = 0.71 , 0.025 , and 7.0 which physically correspond to air , mercury , and water at 25 temperature and one atmospheric pressure . it is inferred that the temperature falls more rapidly for water in comparison to air which is physically true thus the thermal boundary layer falls quickly for large value of prandtl number . the thickness of thermal boundary layer is greatest for pr = 0.025 ( mercury ) than for pr = 0.71 ( air ) , thereafter for pr = 7 ( water ) and finally the lowest for pr = 11.62 ( water at 4c ) ; that is , an increase in prandtl number results in a decrease of temperature . the reason underlying such a behavior is that pr signifies the relative effects of viscosity to thermal conductivity and smaller values of prandtl number possess high thermal conductivity and therefore heat is able to diffuse away from the surface faster than at higher values of pr . the fluid temperature also decreases with an increase of heat absorption parameter ( q ) and suction parameter ( s ) . the temperature decreases with an increase in the heat absorption parameter because when heat is absorbed the buoyancy forces decrease the temperature profiles . the effect of thermal radiation parameter ( f ) is to enhance the fluid temperature throughout the boundary layer region . this is consistent with the fact that thermal radiation provides an additional means to diffuse energy because thermal radiation parameter f = 4t/kar and therefore an increase in f implies a decrease in rosseland mean absorption coefficient ar for fixed values of t and k. thus it is pointed out that radiation should be minimized to have the cooling process at a faster rate . the temperature profiles attain their maximum value at the wall and decrease exponentially with z and finally tend to zero as z . hence the accuracy is checked and it validates that the analytical results for temperature is correct . graphical results of concentration profiles c for different values of schmidt number ( sc ) and chemical reaction parameter ( ) are displayed in figure 3(a ) . the values of schmidt number are chosen to represent the most common diffusing chemical species which are of interest and they are sc = 0.22 ( hydrogen ) , sc = 0.3 ( helium ) , sc = 0.6 ( water vapor ) , sc = 0.94 ( carbon dioxide ) and sc = 2.62 ( propylbenzene ) at 25c temperature and one atmospheric pressure . a comparison of curves in the figure show the concentration distribution decreases at all points in the flow field with an increase in schmidt number because smaller values of sc are equivalent to increasing chemical molecular diffusivity ( d ) . this shows that the heavier diffusing species have a greater retarding effect on the concentration distribution . furthermore , it is interesting to note that concentration profiles fall slowly and steadily for hydrogen ( sc = 0.22 ) and helium ( sc = 0.30 ) but falls very rapidly for water vapor ( sc = 0.6 ) and propylbenzene ( sc = 2.62 ) . physically this is true because of the fact that the water vapor can be used for maintaining normal concentration field whereas hydrogen can be used for maintaining effective concentration field . similar effects are seen in the case when chemical reaction parameter ( ) is increased . further , this figure clearly demonstrates that the concentration profiles decrease rapidly when chemical reaction parameter is increased this is due to the fact that boundary layer decreases with an increase in the value of in this system , results in the consumption of the chemical and hence result in decreasing concentration profile . the effects of heat absorption parameter ( q ) and soret number ( sr ) on concentration profiles across the boundary layer are displayed in figure 3(b ) . the results show that concentration boundary layer suppresses with an increase in heat absorption parameter and soret number . the profiles fall rapidly with an increase of soret number and thereafter increase and tend to zero as z . figure 3(c ) is plotted to show the effects of radiation parameter ( f ) and suction parameter ( s ) on the species concentration profiles . it is revealed that the presence of suction parameter diminishes the concentration distribution whereas reverse phenomena are observed with increasing values of radiation parameter . in figures 3(a)3(c ) the concentration profiles attain their maximum value at the wall and decrease exponentially with z and finally tend to zero as z . hence it is found to be in good agreement with boundary condition given in ( 23 ) . moreover these figures provide a check of our analytical solution for the concentration field . the microrotation profiles ( ) against span wise coordinate z incorporating the effect of various parameters influencing the flow field are demonstrated in figures 4(a)4(h ) . it is revealed from figures 4(a)4(h ) that these profiles attain a distinctive maximum value near surface of the plate and decrease properly on increasing boundary layer coordinate z to approach free stream value . figure 4(a ) shows the influence of prandtl number ( pr ) , suction parameter ( s ) and radiation parameter ( f ) on microrotation profiles . physically , it is true due to the fact that an increase in prandtl number increase the viscosity of the fluid , so the fluid becomes thick and consequently leads to a decrease in velocity . this figure further indicates that the microrotation profiles decrease with an increase in suction parameter ( s ) because sucking decelerates the fluid particles through the porous wall and hence reduce the growth of the fluid boundary layer as well as thermal and concentration boundary layers . indicating the usual fact that suction stabilizes the boundary layer growth . this is because when the intensity of heat generated through thermal radiation increases , the bond holding the components of the fluid particle is easily broken and the fluid velocity will increase . from figure 4(b ) it is perceived that microrotation profiles decrease with an increase in heat absorption parameter ( q ) . figure 4(c ) elucidates the influence of magnetic parameter ( m ) and hall parameter ( m ) on microrotation profiles ( ) ; it is clear from these curves that these profiles increase when magnetic parameter and hall current parameter are increased . the profiles corresponding to m = 0 reveals that microelements close to the wall are unable to rotate ; hence , is very small . figure 4(d ) demonstrates the effect of thermal and concentration buoyancy forces , that is , grashof number ( gr ) and modified grashof number ( gm ) on the microrotation profiles . here the negative value of grashof number ( gr < 0 ) , physically , corresponds to heating of the plate while the positive value ( gr > 0 ) represents cooling of the plate . hence , it is observed from the comparison of the curves that an increase in thermal grashof number leads to an increase in the velocity due to an enhancement in buoyancy forces . an increase in grashof number indicates small viscous effects in the momentum equation and consequently causes an increase in the velocity profiles . furthermore , the comparison of the curves illustrates that velocity increases with increasing gm . the modified grashof number ( gm ) represents the relative strength of concentration buoyancy forces to viscous hydrodynamic force . as expected , the fluid velocity increases and the peak value is more distinctive due to an increase in the species buoyancy force . the profiles attain a maximum value near the wall and then decrease rapidly to approach the free stream value . hence we are confident at the accuracy of our solution given by ( 30 ) . for various values of rotational parameter ( r ) , figure 4(f ) presents the effect of viscosity ratio ( ) and material parameter ( ) on . the magnitude of microrotation is greater for a newtonian fluid ( = 0 ) with given parameters as compared with micropolar fluids ( 0 ) . also , it is observed that the magnitude of microrotation profiles decrease with an increase in material parameter ( ) and viscosity ratio ( ) . rarefaction effects that give rise to slip flow become significant when the molecular mean free path is comparable to characteristic length of the system . the microrotation profiles presented in figure 4(g ) incorporate the influence of rarefaction parameter ( h ) and permeability parameter ( k ) . it is noticed that an increase in the value of rarefaction parameter decreases the magnitude of microrotation profiles while the comparison of curves for different values of permeability parameter ( k ) reflects that profiles increase with increasing values of k. a similar behavior is also expected because when we increase the permeability it increases the size of the pores inside the porous medium due to which the drag force decreases and hence the magnitude of microrotation profiles increases . microrotation profiles showing the variation of soret parameter ( sr ) , schmidt number ( sc ) , and generative chemical reaction ( ) are presented in figure 4(h ) . it is analyzed that the influence of sr , sc , and is to reduce the magnitude of microrotation profiles . comparison of the curves in this figure indicate that the magnitude of microrotation profiles is the greatest for helium ( he : sc = 0.3 ) and then for carbon dioxide ( co2 : sc = 0.94 ) and the lowest for propylbenzene ( c9h10 : sc = 2.62 ) . physically it is justified this figure also displays the fact that these profiles decrease during the destructive reaction ( > 0 ) . figures 5(a)5(h ) illustrate graphically the behavior of translational velocity ( v ) versus boundary layer coordinate z for various involved parameters governing the flow field . for various values of prandtl number ( pr ) , suction parameter ( s ) , and radiation parameter ( f ) , it is clearly evident that translational velocity decreases on increasing pr because since prandtl number is the ratio of kinematic viscosity to thermal diffusivity , so as pr increases , the kinematic viscosity of the fluid dominates the thermal diffusivity of the fluid which leads to decreasing of the velocity of the flow field . moreover , it is noticed that velocity first increases in the region adjacent to the plate and then decreases on moving away from the plate with increase in the suction parameter ( s ) showing the suction has a stabilizing effect on the flow field . this figure also incorporates the fact that radiation ( f ) tends to accelerate the translational velocity throughout the boundary layer region . physically , it is true , as higher radiation occurs when temperature is higher and ultimately the velocity rises . the velocity distribution attains maximum value in the neighborhood of the wall and then decrease to approach the free stream value . the effect of heat absorption parameter on translational velocity ( v ) is depicted in figure 5(b ) and it is found that velocity reduces due to the presence of heat absorption parameter ( q ) . \n figure 5(c ) incorporates the influence of magnetic parameter ( m ) and hall parameter ( m ) on the translational velocity profiles ( v ) . this phenomenon has an excellent agreement with the physical fact that the presence of transverse magnetic field in an electrically conducting fluid always generates a resistive type of force called lorentz force which is similar to drag force and hence serves to decelerate the flow . form this figure it is also found that hall currents ( m ) tends to accelerate the fluid velocity throughout the boundary layer region which is consistent with the fact that hall currents induces flow in the flow field . the combined effect of thermal and concentration buoyancy forces on the translational velocity are depicted in figure 5(d ) . it is evident from this figure that with an increase in grashof number ( gr ) and modified grashof number ( gm ) , which is a measure of thermal and concentration buoyancy forces , there is a substantial growth in the momentum boundary layer for the same reasons as explained earlier in this section . figure 5(e ) depicts the effect of rotational parameter ( r ) on the fluid velocity and it is perceived that rotation tends to retard fluid velocity throughout the flow field . this is due to the reason that coriolis force is dominant in the region near to the axis of rotation . variation of translational velocity profiles for different values of soret parameter ( sr ) , schmidt number ( sc ) , and chemical reaction ( ) are displayed in figure 5(f ) . the comparison of the curves shows that the velocity of the flow field decreases due to an increase in schimdt number and soret number . it is also observed from this figure that velocity decreases during the destructive reaction ( < 0 ) . \n figure 5(g ) depicts the influence of viscosity ratio ( ) and permeability parameter ( k ) on the translational velocity ( v ) . for different values of permeability parameter this figure shows that velocity increases with increasing values of k while an increasing viscosity ratio ( ) results in an enhancement of the total viscosity in fluid flow because is directly proportional to vortex viscosity which makes the fluid more viscous and so weakens the convection currents and hence the velocity decreases . figure 5(h ) incorporates the effect of slip or rarefaction parameter ( h ) and material parameter ( ) on the translational velocity ( v ) . it is observed that an increase in the values of rarefaction parameter result in an enhancement of the flow field inside the boundary layer . this behavior is readily understood from the velocity slip condition at the surface ( 23 ) . the case when h = 0 corresponds to the no slip condition and in the present case it reduces to the case when the plate moves with constant velocity in the longitudinal direction . the effects are more visible in the region near to the plate and afterwards it fall slowly and steadily to its free stream value as z . lastly the velocity decreases with increasing material parameter ( ) . in figures 5(a)5(h ) we observe that the velocity become maximum in the vicinity of the plate and then decreases away from the plate and finally takes asymptotic values far away from the plate . the numerical values of nusselt number computed from the analytical solution given in ( 39 ) are presented graphically versus time ( t ) in figure 6 for various values of prandtl number ( pr ) , suction parameter ( s ) , heat absorption parameter ( q ) , and radiation parameter ( f ) . it is noteworthy that the prandtl number , suction parameter , heat absorption parameter , and radiation parameter enhance the rate of heat transfer at the surface of the plate . the reason behind this phenomenon is explained earlier in the text . the rate of heat transfer is more for water ( pr = 7.0 ) than that of air ( pr = 0.71 ) . c(0 ) at the porous plate versus time ( t ) . from all these figures it is analyzed that sherwood number increase with an increase in schmidt number ( sc ) , chemical reaction parameter ( ) , soret number ( sr ) , suction parameter ( s ) , heat absorption parameter ( q ) , and radiation parameter ( f ) . the variation of couple stress coefficient ( cm ) for various involved parameters is displayed in figures 8(a)8(h ) versus time ( t ) . figure 8(a ) exhibits that couple stress coefficient decreases with increasing values of radiation parameter ( f ) and suction parameter ( s ) it increases with increasing values of prandtl number ( pr ) . the effect of heat absorption parameter ( q ) on cm is shown in figure 8(b ) and it is found that couple stress coefficient enhances with the rise in the values of q. from figures 8(c)8(f ) it is apparent that the effect of increasing values of magnetic parameter ( m ) , hall parameter ( m ) , grashof number ( gr ) , modified grashof number ( gm ) , rotational parameter ( r ) and viscosity ratio ( ) are to decrease the values of couple stress coefficient whereas reverse effect is found on increasing the values of material parameter ( ) . figure 8(g ) shows a substantial growth in couple stress coefficient with increasing values of slip parameter ( h ) while reverse happen for increasing values of permeability parameter ( k ) . finally , the schmidt number ( sc ) , soret number ( sr ) , and chemical reaction parameter ( ) have the tendency to increase couple stress coefficient and this is clearly visible in figure 8(h ) . from all these figures from figures 8(a)to 8(h ) it is understandable that as time progresses couple stress coefficient ( cm ) is getting enhanced whereas from figures 9(a)to 9(h ) it is visible that skin friction coefficient ( cf ) is getting suppressed for increasing values of time ( t ) . the skin friction is an important phenomenon which characterizes the frictional drag at the solid surface , so the numerical values of skin friction coefficient ( cf ) computed from ( 33 ) is presented in figures 9(a)9(h ) taking different values of f , s , pr , q , m , m , gr , gm , r , sc , sr , , , , k , and h. the skin friction coefficient increases with increasing values of radiation parameter while it decreases with increase in suction parameter , prandtl number , and heat absorption parameter and this fact is depicted in figures 9(a ) and 9(b ) . it is noticed from figure 9(c ) that the skin friction coefficient is reduced due to an increase in magnetic field strength as expected , since the applied magnetic field tends to impede the flow motion and thus reduces the surface friction force while the hall parameter tends to increase the skin friction . figure 9(d ) demonstrates the growth in skin friction for increasing values of thermal buoyancy parameter ( gr ) and modified grashof number ( gm ) because an increase in buoyancy effect in mixed convection flow leads to an acceleration of the fluid flow which increases the friction factor . an opposite trend is observed for increasing values of rotational parameter ; that is , cf decreases with an increase in r. the influence of schmidt number ( sc ) , soret number ( sr ) , and chemical reaction parameter ( ) on skin friction coefficient is exhibited in figure 9(f ) and all these parameters tend to retard the surface friction forces . finally , figures 9(g ) and 9(h ) exhibit a significant growth in cf with increasing values of viscosity ratio , permeability parameter , and slip parameter while reverse happens with increasing material parameter .", "the effects of various parameters on the temperature , concentration c , translational velocity v , microrotation , skin - friction cf , nusselt number , and sherwood number are examined . from the present calculations , we arrive at the following findings.thermal radiation tends to enhance fluid temperature whereas there is a decrement in fluid temperature with an increase of prandtl number , suction parameter , and heat absorption parameter.the species concentration profiles decrease at all points in the flow field with an increase in schmidt number , chemical reaction parameter , heat generation parameter , soret number , and suction parameter but are enhanced with an increase in radiation parameter while these physical quantities show reverse trend for sherwood number.thermal radiation , magnetic parameter , hall parameter , and permeability parameter tend to enhance the microrotation distribution whereas these physical quantities have reverse effect on couple stress coefficient.microrotation profiles decrease with an increase in prandtl number , material parameter , slip parameter , soret number , schmidt number , and chemical reaction parameter whereas these physical quantities have reverse effect on couple stress coefficient.microrotation profiles and couple stress coefficient decrease with an increase in suction parameter , rotation parameter , and viscosity ratio.thermal radiation parameter , permeability parameter , and slip parameter tend to enhance the translational velocity profiles throughout the boundary layer region and the skin - friction coefficient.prandtl number , magnetic parameter , suction parameter , rotation parameter , soret number , schmidt number , chemical reaction parameter , viscosity ratio , and material parameter tend to enhance both translational velocity profiles and skin - friction coefficient.slip parameter increases the translational velocity profiles but decreases the skin - friction coefficient.thermal radiation parameter , prandtl number , suction parameter , and heat absorption parameter tend to enhance dimensionless rate of heat transfer , that is , nusselt number . thermal radiation tends to enhance fluid temperature whereas there is a decrement in fluid temperature with an increase of prandtl number , suction parameter , and heat absorption parameter . the species concentration profiles decrease at all points in the flow field with an increase in schmidt number , chemical reaction parameter , heat generation parameter , soret number , and suction parameter but are enhanced with an increase in radiation parameter while these physical quantities show reverse trend for sherwood number . thermal radiation , magnetic parameter , hall parameter , and permeability parameter tend to enhance the microrotation distribution whereas these physical quantities have reverse effect on couple stress coefficient . microrotation profiles decrease with an increase in prandtl number , material parameter , slip parameter , soret number , schmidt number , and chemical reaction parameter whereas these physical quantities have reverse effect on couple stress coefficient . microrotation profiles and couple stress coefficient decrease with an increase in suction parameter , rotation parameter , and viscosity ratio . thermal radiation parameter , permeability parameter , and slip parameter tend to enhance the translational velocity profiles throughout the boundary layer region and the skin - friction coefficient . prandtl number , magnetic parameter , suction parameter , rotation parameter , soret number , schmidt number , chemical reaction parameter , viscosity ratio , and material parameter tend to enhance both translational velocity profiles and skin - friction coefficient . thermal radiation parameter , prandtl number , suction parameter , and heat absorption parameter tend to enhance dimensionless rate of heat transfer , that is , nusselt number ." ]

[ "we report a case of sle - associated myopericarditis in a young male without clear evidence of viral infection based on viral markers in blood . the patient 's cardiac function dramatically improved after treatment with steroids without any additional complications .", "a 19-year - old male was admitted to the combined armed forces hospital with a 7-day history of fever , cough , dyspnea , orthopnea , and chest pain . based on the chest radiograph and computed tomography , he was diagnosed with a pericardial effusion and pneumonia ( fig . 1a ) , and was transferred to our hospital for evaluation of the cause and treatment . his blood pressure was 110/70 mmhg , pulse rate was 112 beats / min , respiratory rate was 24 breaths / min , and body temperature was 38. jugular veins were engorged . on cardiac auscultation , the cardiac rhythm was regular and rapid , summation gallops were heard at the cardiac apex , and there were pericardial friction rubs along with left lower sternal border in the sitting position . bilateral pretibial pitting edema was present on admission . on admission , blood tests showed white blood cell count of 5,420/mm , hemoglobin 10.6 g / dl and platelet count of 94,000/mm . c - reactive protein was 4.59 mg / l ( normal , 0 - 3 mg / l ) . the blood chemistry revealed blood urea nitrogen to be 24.0 mg / dl , creatinine 1.1 mg / dl , total protein 5.7 g / dl , and albumin 2.6 g / dl . the levels of cardiac markers were elevated ; troponin - i 0.87 ng / ml ( normal , 0 - 0.05 ng / ml ) and myoglobin 371 ng / dl ( normal , 16.3 - 96.5 ng / dl ) . an electrocardiogram ( ecg ) revealed sinus tachycardia and diffuse t - wave inversion in which leads ( fig . echocardiography demonstrated severe left ventricular systolic dysfunction { left ventricular ejection fraction ( lvef ) was 18% } with severe global hypokinesia and preserved wall thickness ( fig . a large amount of pericardial effusion was observed 13 mm anterior to the right ventricle , 18 mm around the right atrium and 2 mm posterior to the lv . at first , we suspected viral myopericarditis , and started conservative treatment for congestive heart failure and pericarditis . but , there was no improvement in lvef as well as in the clinical findings . viral markers for cytomegalovirus , coxsackie virus b type 2 , herpes simplex virus , and epstein - barr virus were all negative . during conservative treatment , he complained of new - onset ankle joint pain and tender erythematous swellings in both the ankles . the immunofluorescence tests were positive for anti - nuclear antibody ( 1 : 640 titre ) , anti - dsdna antibodies ( 683.4 iu / ml ) , and anti - extractable nuclear antigen antibodies ( anti - sm , anti - rnp , anti - ro , and anti - la ) , and the complement level was low ( table 1 ) . we concluded that the patient had sle according to the american rheumatism association / american college of rheumatology classification criteria for sle . on the 13th day of admission , we started treatment with high - dose glucocorticoids ( methylprednisolone 1,000 mg intravenously daily for three days followed by 1 mg / kg per day in divided doses ) . on follow - up examination , ecg showed normalization of t - wave inversion ( fig . 2c ) and echocardiography obtained just before discharge showed improved systolic function ( fig . chest x - ray also showed improving consolidation in both the lung fields and cardiomegaly ( fig . complement 3 was normalized and anti - dsdna antibodies decreased from 683.4 iu / ml to 383.8 iu / ml ( who u / ml , normal 0 - 93 ) . he was discharged on the 33rd day of admission with oral prednisolone , and he visited the outpatient department 1 month later . in this 1 month , he had no symptoms . echocardiography revealed normal lvef , without significant valvular disease and pericardial effusion compared to the last examination ( table 2 ) . subsequently , the steroid medication was tapered and it was planned to maintain him on sle - specific treatment in the rheumatologic department .", "sle is an autoimmune inflammatory disease of unknown etiology that affects various parts of the body , including all components of the cardiovascular system.1 ) the prevalence of lupus ranges from approximately 40 - 150 cases per 100,000 in the usa.2 ) in adults , the female - to - male ratio is 7 - 15 : 1.3 ) cardiac involvement in sle may comprise of involvement of the pericardium , myocardium , endocardium , heart valves , and coronary or pulmonary arteries.4 ) pericardial involvement is the most frequent cause of symptomatic cardiac disease5 ) and is the most common echocardiographic finding in sle patients . the pericardium can be involved by acute and chronic inflammatory changes ; granular deposition of immunoglobulin and c3 , demonstrated by direct immunofluorescence,6 ) supporting the role of immune complexes in the development of pericarditis . myocarditis is an uncommon , often asymptomatic manifestation of sle with a prevalence of 8 - 25% in different studies.7 ) global hypokinesis may be an echocardiographic indication of myocarditis and is present in approximately 6% of sle patients.8 ) the gold standard for diagnosing myocarditis in sle remains the endomyocardial biopsy.9 ) however , an endomyocardial biopsy is invasive with procedure - related risks and the diagnostic yield is low in 10 - 20% of cases , so it is not powerful enough to confirm the diagnosis.10 ) lupus myocarditis can be diagnosed based on clinical suspicion and echocardiographic evidence of a reduced lvef and segmental or global wall motion abnormality , once the other etiologies , such as viral and ischemic cardiomyopathy , have been excluded.9)11 ) immunofluorescence studies demonstrate fine granular immune complexes and complement deposition in the walls and perivascular tissues of myocardial blood vessels , supporting the hypothesis that lupus myocarditis is an immune complex - mediated disease . lupus myocarditis , although mild , has to be treated immediately with high - dose corticosteroids . in the most severe forms , it is necessary to use intravenous pulse corticosteroid therapy ( methylprednisolone 1 g / day for three consecutive days ) followed by high doses of oral prednisone . immunosuppressants , namely cyclophosphamide or azathioprine , and intravenous igg may be beneficial in the treatment of myocarditis.5 ) early mechanical circulatory supports help to save the life and prevent multi - organ failures in patients with fulminant myocarditis.12 ) in the present case , the patient was initially diagnosed with myopericarditis on the basis of his symptoms , diffuse t - wave inversion on ecg , elevated cardiac markers and echocardiographic findings . however , there was no improvement in his symptoms and the common cardiotrophic viral markers were all negative . also , the patient had pericarditis , thrombocytopenia and proteinuria . because the previous typical clinical signs and the positive immunofluorescence tests were suitable for making the diagnosis of sle , we confirmed the diagnosis of myopericaditis associated with sle in this patient . after a provisional diagnosis of myopericarditis with sle was made , he was treated with intravenous corticosteroid pulse therapy ( methylprednisolone 1 g / day for three consecutive days ) followed by high doses of oral prednisone . after 3 days of steroid therapy , the patient 's signs and symptoms were stabilizing and echocardiographic findings were improved . initially , we had considered myopericarditis to be caused by viral infection ; however , the final diagnosis was myopericarditis during presentation of primary sle based on the clinical manifestations , echocardiography , immunofluorescence tests and good response to steroid therapy . because the treatment of sle induced myopericarditis should be needed for some specific therapy such as corticosteroid , this case shows that careful investigation is needed for search of the cause of myopericarditis in a young male , and not only viral infection but also autoimmune disease should be investigated for . in this report , we described the first case of a korean young male sle patient in whom the first manifestation was of myopericarditis and treatment with glucocorticoids resulted in a good clinical outcome ." ]

[ "the rapidly increasing use of microwave radiation , has raised public concern about possible detrimental effects of non - ionizing radiation sources which work in this frequency range ( 13 ) . radio detection and ranging ( radar ) equipments send and transmit high - power rf waves by producing a high - voltage and high frequency alternating electrical current . radar workers are routinely exposed to pulsed high frequency electromagnetic fields , which are produced to locate and identify the presence , direction or range of airplanes , ships , control towers or other , usually moving objects . nowadays , radar systems , which operate at radio frequencies ( rf ) between 300 mhz and 18 ghz , are widely used for navigation , aviation , national defense , weather forecasting and even to speed control ( hand - held police radars ) . as radiations emitted by radar systems must travel long distances in order to detect objects , the power must be relatively high at transmission site . recent studies conducted on the health effects of occupational exposure to military radar radiations indicate some detrimental effects such as induction of oxidative stress ( decreased glutathione concentration vs. increased concentration of malondialdehyde ) ( 4 ) , reduced fertility ( 5 ) , increased level of dna damage and chromatid breaks ( 6 ) . furthermore , some non - emf hazards such as radar equipment - related electrical injury are also reported ( 7 ) . there are also reported risks such as increased incidence of hemolymphatic cancers that can be caused by microwaves generated by radars or ionizing radiation produced by electronic devices producing the microwaves ( 8) . on the other hand , there are published reports that could not show any detrimental effect in radar workers . in a 40-year controlled longitudinal belgian study , no increase in all - cause mortality in military personnel who were in close contact with radar equipments was found ( 9 ) . over the past years our laboratory has focused on studying the health effects of exposure of humans to some common sources of electromagnetic fields such as mobile phones ( 1012 ) , mri ( 13 ) and possible implications of pre - exposure to radiofrequency radiations ( 1416 ) . the aim of this study was to assess if occupational exposure of military radar personnel affect their general health .", "this study was conducted on apparently healthy male and female workers employed in a military radar site with a frequency range of 218 ghz . in this study , health effects of this radiation in personnel who routinely work with radar systems are investigated . all required permissions were obtained from the authorities . as in this study informed consent was essential before enrolling a participant , 100 workers ( mean age of 33.426.87 years , ranged 2450 years ) including 91 males and 9 females participated in the study , gave their informed consent before beginning the study . a previously approved questionnaire ( 10 ) including personal information , job status , possibility of exposure to other sources of electromagnetic fields ( mobile phones , crts , etc ) and adverse health symptoms ( self reported ) was used . the 28-item general health questionnaire ( ghq ) initially developed by goldberg and hillier to screen for somatic symptoms , anxiety and insomnia , social dysfunction , and severe depression was used as a self - administered tool for assessment of general mental health and mental distress . the validity and reliability of the persian version of this questionnaire , which is understandable to almost every iranian , was approved previously ( 17 ) . a modified bracy simple visual reaction time test ( 18 ) that was developed in the center for research in radiation sciences ( crrs ) , shiraz university of medical sciences , was used in this study . visual reaction time ( vrt ) of all participants was recorded with a simple blind computer - assisted - visual reaction time test . to evaluate participants sustained attention and response time , the participants were asked to respond as quickly as possible by a single right click on a computer mouse when a red square on the display was replaced by a green one . the students had to perform some preliminary tests for orientation with the test . in this stage , reaction time after orientation , to reduce random variation of measurements , each test was repeated 7 times in both real and sham exposure phases . modified wechsler memory scale test the test includes four subtests including forward and backward digit span , paired words and word recognition . after training , to perform the wms digit span memory test , participants were asked to repeat back a list of digits , which were spoken live - voice , by an expert member of our research team at a rate of approximately one digit per second . this study was approved by the research ethics committee at the shiraz university of medical sciences and informed consent was obtained from all participants .", "this study was conducted on apparently healthy male and female workers employed in a military radar site with a frequency range of 218 ghz . in this study , health effects of this radiation in personnel who routinely work with radar systems are investigated . all required permissions were obtained from the authorities . as in this study informed consent was essential before enrolling a participant , 100 workers ( mean age of 33.426.87 years , ranged 2450 years ) including 91 males and 9 females participated in the study , gave their informed consent before beginning the study . seventy one percent of these workers had university degrees ( b.sc and m.sc ) . a previously approved questionnaire ( 10 ) including personal information , job status , possibility of exposure to other sources of electromagnetic fields ( mobile phones , crts , etc ) and adverse health symptoms ( self reported ) was used .", "the 28-item general health questionnaire ( ghq ) initially developed by goldberg and hillier to screen for somatic symptoms , anxiety and insomnia , social dysfunction , and severe depression was used as a self - administered tool for assessment of general mental health and mental distress . the validity and reliability of the persian version of this questionnaire , which is understandable to almost every iranian , was approved previously ( 17 ) .", "a modified bracy simple visual reaction time test ( 18 ) that was developed in the center for research in radiation sciences ( crrs ) , shiraz university of medical sciences , was used in this study . visual reaction time ( vrt ) of all participants was recorded with a simple blind computer - assisted - visual reaction time test . to evaluate participants sustained attention and response time , the participants were asked to respond as quickly as possible by a single right click on a computer mouse when a red square on the display was replaced by a green one . the students had to perform some preliminary tests for orientation with the test . in this stage , reaction time after orientation , to reduce random variation of measurements , each test was repeated 7 times in both real and sham exposure phases .", "the test includes four subtests including forward and backward digit span , paired words and word recognition . after training , to perform the wms digit span memory test , participants were asked to repeat back a list of digits , which were spoken live - voice , by an expert member of our research team at a rate of approximately one digit per second . this study was approved by the research ethics committee at the shiraz university of medical sciences and informed consent was obtained from all participants .", "as shown in table 1 , the mean age of the participants was 33.426.87 ( ranged 2450 ) years . forty eight percent of the participants had worked 8 hours or less than 8 hours per day , while forty - eight and two percent of the participants had worked 910 hours per day and more than 10 hours per day , respectively . only one percent of the participants had worked less than 5 days per week , while 84% and 15% of the participants had worked 5 days per week and 6 days per week , respectively . moving to work experience as a cardinal factor that determines the occupational health effects , 20% of the participants had work experiences of 24 months or less while 30% , 35% and 15% had work experiences in the range of 25148 , 49120 and more than 121 months , respectively . on the other hand , considering the average distance of the participants from radar antennas , 33% had worked in distances of 4 meters or less , while 47% and 20% had worked in distances of 510 meters and more than 10 meters , respectively . mean ( sd ) ghq-28 scores of participants in all subsets and the scores in each subsection of somatic symptoms , anxiety/ insomnia , social dysfunction , and severe depression are shown in table 2 . the mean scores of ghq for somatic symptoms in radar workers and the control group were 1.03 0.49 and 1.45 0.26 ( p<0.0001 ) , respectively . the scores for anxiety / insomnia in radar workers and the control group were 0.99 0.58 and 1.70 1.40 ( p<0.001 ) , respectively . for social dysfunction the scores in radar workers and the control group were 1.08 0.34 and 1.49 0.29 ( p<0.0001 ) , respectively . finally , for severe depression these scores in radar workers and the control group were 0.44 0.52 and 1.66 0.35 ( p<0.0001 ) , respectively . the mean scores of ghq for somatic symptoms in the control group and radar workers who worked 8 hours , 910 hours and more than 10 hours per day were 1.45 0.26 , 1.07 0.50 , 1.03 0.48 and 0.61 0.07 ( p<0.0001 ) , respectively . for anxiety / insomnia , the mean scores in the control group and radar workers who worked 8 hours , 910 hours and more than 10 hours per day were 1.70 1.40 , 1.02 0.62 , 0.99 0.56 and 0.82 0.36 ( p<0.001 ) , respectively . for social dysfunction , the mean scores in the control group and radar workers who worked 8 hours , 910 hours and more than 10 hours per day were 1.49 0.29 , 1.08 0.36 , 1.09 0.34 and 0.93 0.25 ( p<0.0001 ) , respectively . for severe depression , the mean scores in the control group and radar workers who worked 8 hours , 910 hours and more than 10 hours per day were 1.66 0.35 , 0.52 0.54 , 0.40 0.51 and 0.07 0.08 ( p<0.0001 ) , respectively . altogether , the total scores of ghq for all 4 subsets in the control group and radar workers who worked 8 hours , 910 hours and more than 10 hours per day were 1.53 0.22 , 1.82 0.38 , 1.77 0.49 and 2.08 0.64 ( p<0.0001 ) , respectively . on the other hand , work experience played a significant role in ghq scores . the mean scores of ghq for somatic symptoms in the control group and radar workers who had work experiences of 24 months , 2548 , 49120 and more than 120 months were 1.45 0.26 , 1.04 0.40 , 1.01 0.48 , 0.91 0.49 and 1.18 0.59 ( p<0.0001 ) , respectively . for anxiety / insomnia , the mean scores in the control group and radar workers who had work experiences of 24 months , 2548 , 49120 and more than 120 months were 1.70 1.40 , 0.97 0.47 , 1.08 0.53 , 0.89 0.70 and 1.08 0.60 ( p<0.001 ) , respectively . for social dysfunction , the mean scores in the control group and radar workers who had work experiences of 24 months , 2548 , 49120 and more than 120 months were 1.49 0.29 , 0.96 0.29 , 1.13 0.34 , 1.11 0.41 and 1.07 0.25 ( p<0.0001 ) , respectively . for severe depression , the mean scores in the control group and radar workers who had work experiences of 24 months , 2548 , 49120 and more than 120 months were 1.66 0.35 , 0.40 0.55 , 0.47 0.47 , 0.49 0.56 and 0.35 0.52 ( p<0.0001 ) , respectively . on the other hand , the distance from the antenna played also a significant role in mean ghq - scores of the participants . the mean scores of ghq for somatic symptoms in the control group and radar workers who had worked at an average distance of 4 meters , 510 and more than 10 meters were 1.45 0.26 , 1.06 0.40 , 1.05 0.54 and 0.95 0.50 ( p<0.0001 ) , respectively . for anxiety / insomnia , the mean scores in the control group and radar workers who had worked at an average distance of 4 meters , 510 and more than 10 meters were 1.70 1.40 , 1.10 0.55 , 0.97 0.62 and 0.89 0.54 ( p<0.001 ) , respectively . for social dysfunction , the mean scores in the control group and radar workers who had worked at an average distance of 4 meters , 510 and more than 10 meters were 1.49 0.29 , 1.13 0.34 , 1.04 0.29 and 1.10 0.47 ( p<0.001 ) , respectively . for severe depression , the mean scores in the control group and radar workers who had worked at an average distance of 4 meters , 510 and more than 10 meters were 1.66 0.35 , 0.43 0.42 , 0.43 0.60 and 0.49 0.50 ( p<0.0001 ) , respectively . altogether , the total scores of ghq for all 4 subsets in the control group and radar workers who had worked at an average distance of 4 meters , 510 and more than 10 meters were 1.53 0.22 , 1.54 0.22 , 1.49 0.23 and 1.49 0.43 , respectively . these differences were not statistically significant ( p=0.77 ) . the relationship between reaction time and the participants work experience is shown in table 3 . chi - square test revealed a statistically significant relationship between work experience and reaction time ( p < 0.001 ) . on the other hand , there was a significant relationship between participants age and the reaction time ( p < 0.001 ) . after adjustment for age , reaction time remained associated with work experience . the reaction time of the radar workers and the control group in different age categories is shown in table 4 . this table clearly shows that regardless of the age category , there is a statistically significant difference between reaction time of the radar workers and the control group . the scores of the short - term memory of radar workers and the control group for each subtest are shown in table 5 . according to this table , for all subtests ( forward and backward digit span , paired words and word recognition ) , the scores of the radar workers are significantly higher than those of the control group .", "results showed that the mean reaction time in radar works was significantly lower than that of the control group ( 238.58 + / 23.47 milliseconds vs 291.86 + / 28.26 milliseconds , p<0.0001 ) . these results may lead us to this conclusion that occupational exposure to radar radiations decreases reaction time , which may lead to a better response to different hazards . on the other hand , the scores of forward digit span , backward digit span , word recognition and paired words in radar workers were significantly lower than those of the control group ( 3.56 + / 0.77 vs. 4.29 + / 1.06 , p<0.0001 ; 2.70 + / 0.69 vs. 3.62 + / 0.95 , p<0.0001 ; 3.37 + / 1.13 vs 5.86 + / 1.11 , p<0.0001 ; 13.56 + / 1.78 vs. 15.21 + / 2.20 , p<0.0001 , respectively ) . findings of reaction time in this study generally confirm the findings of our previous study that indicated exposure to mobile phone radiations caused decreased reaction time in university students ( 12 ) . generally speaking , our findings are in contrast with those of other investigators who have reported detrimental health effects of the occupational exposure to radar radiations such as decreased sperm motility and viability in highly exposed group compared to those of the lowly exposed and control groups ( 19 ) , increased sperm dysmorphia and alteration in quality of semen in response to changes in microwave frequency , distance , intensity , exposure time and quality of shielding ( 20 ) , increase in frequency of micronuclei ( 21 ) . on the other hand these findings are not in line with those reports that showed biological alterations without major clinical implications such as increased igg , igm and iga level and decreased count of lymphocytes and t8 cells ( 22 ) or even some beneficial bioeffects such as lower all - cause mortality rate in military conscripts who served in battalions with anti - aircraft radars versus controls ( 9 ) . investigation of the general and more specifically mental health that is believed to be an integral and essential component of health was among the main goals of this study . the who constitution states : health is a state of complete physical , mental and social well - being and not merely the absence of disease or infirmity . in this light , mental health is more than the absence of mental disorders or disabilities ( 23 ) . exposure to radiofrequency radiation has not consistently been shown to have an effect on well - being or self - reported symptoms such as headache , fatigue , dizziness and concentration difficulties ( 24 ) . in this light , our study interestingly showed that the scores of ghq for all 4 subsets in the control group were higher than those of radar workers . this clearly indicates that the levels of psychological distress in radar workers are less than those of the control group . in the former soviet union anecdotal reports of symptoms such as insomnia , memory loss , and headache led to some early reports indicating possible psychiatric or psychological effects of exposure to electromagnetic fields ( 25 ) . however , after several decades , these reports are still unconfirmed but recently , hypotheses relating emf to problems such as neurodegenerative disorders have attracted a worldwide interest ( 26 ) . in our study , the short - term memory scores in radar workers were less than those of the control group . this finding is in line with the results obtained in a study on 317 seventh grade students ( 144 boys , 173 girls , median age 13 years ) . in this study , in children who reported more mobile phone voice calls , the accuracy of working memory was poorer and reaction time for a simple learning task was shorter ( 27 ) . despite much dissimilarity , some of our findings are clearly in contrast with some recent studies that report lack of evidence for a direct association between frequency and severity of non - specific physical symptoms and higher levels of emf exposure ( 10 , 11 , 28 ) .", "altogether , the results obtained in this study indicate that occupational exposure to radar microwave radiations are not linked to major adverse health effects . however , as the short - term memory scores in radar workers were less than those of the control group , attempts for reducing exposure of radar workers to radiofrequencies generated by radar systems should be performed .", "ethical issues ( including plagiarism , informed consent , misconduct , data fabrication and/or falsification , double publication and/or submission , redundancy , etc ) have been completely observed by the authors ." ]

[ "a 4-year - old male neutered domestic shorthair cat was presented to the oregon state university cardiology service for suspected pericardial effusion . cardiac tamponade was documented and pericardiocentesis yielded purulent fluid with cytologic results supportive of bacterial pericarditis . the microbial population consisted of pasteurella multocida , actinomyces canis , fusobacterium and bacteroides species . conservative management was elected consisting of intravenous antibiotic therapy with ampicillin sodium / sulbactam sodium and metronidazole for 48 h followed by 4 weeks of oral antibiotics . re - examination 3 months after the initial incident indicated no recurrence of effusion and the cat remained free of clinical signs 2 years after presentation .", "bacterial pericarditis is a rare cause of pericardial effusion in cats . growth of p multocida , a canis , conservative management with broad - spectrum antibiotics may be considered when further diagnostic imaging or exploratory surgery to search for a primary nidus of infection is not feasible or elected .", "pericardial disease in cats is relatively uncommon , with a reported prevalence ranging from 1.0 - 2.3% in post - mortem studies . the most common causes of pericardial effusion in cats results from congestive heart failure secondary to cardiomyopathic disease and neoplasia . other less frequently cited etiologies include trauma , disseminated intravascular coagulation , uremic pericarditis , peritoneopericardial diaphragmatic hernia , feline infectious peritonitis , coagulopathy , hypoalbuminemia and infective pericarditis . infective pericarditis includes viral , bacterial , fungal or parasitic colonization of the pericardium , and is rarely reported in cats . this case report describes a cat with bacterial pericarditis with previously undocumented microorganisms and a favorable clinical response to conservative medical management .", "a 4-year - old male neutered domestic shorthair cat presented to the primary veterinarian after being found recumbent and dyspneic at home . mild pyrexia ( 39.5c ) , muffled heart sounds and weak femoral pulses were identified on physical examination . thoracic radiographs revealed a globoid cardiac silhouette , and the cat was referred immediately to the oregon state university ( osu ) cardiology service for suspected pericardial effusion ( figures 1 and 2 ) . review of the incoming thoracic radiographs suggested a large - volume pericardial effusion with a small amount of concurrent pleural effusion . the cat s past pertinent history was unremarkable ; it was an indoor cat with no historical altercations with the other household cat . there is a generalized increase in cardiac silhouette size with dorsal deviation of the thoracic trachea . the increased opacity of the cranial mediastinum is most consistent with fat infiltration ventrodorsal radiograph . the cat is positioned obliquely upon presentation to osu , the cat was depressed but responsive . it was hypothermic ( 36.7c ) and tachypneic ( 60 breaths per minute ) with a high - to - normal heart rate ( 220 beats per minute ) . its mucous membranes were blanched and tacky ; no capillary refill time could be obtained . the cat s heart sounds were muffled and femoral pulse quality was poor . echocardiography was performed emergently , confirming a large volume of anechoic pericardial effusion with cardiac tamponade ( figure 3 ; see also supplementary material ) . a small volume of pleural effusion was also present , likely due to impaired filling of the right heart with cardiac tamponade . pericardiocentesis was prioritized and buprenorphine ( 0.15 mg / kg iv , buprenex ; rickitt benckiser healthcare ) was administered for sedation . following aseptic skin preparation of the right fourth sixth intercostal space at the costochondral junction , pericardiocentesis performed with an 18 g intravenous catheter resulted in the removal of 80 ml of malodorous opaque red - tinged fluid flecked with white particles . cytologic evaluation of the pericardial fluid indicated a markedly increased nucleated cell count ( 138,100/l ; international system of units si : 138.1 10/l ) consisting of 20% macrophages and 80% degenerative neutrophils , many with intracellular bacteria of various types . these findings were consistent with a septic suppurative exudate ; consequently , the pericardial fluid was submitted for aerobic and anaerobic bacterial culture and antimicrobial susceptibility . testing for non - bacterial microorganisms ( fungal , viral etiologies ) was not performed . diastolic collapse of the right atrium and ventricle was noted , consistent with cardiac tamponade . the lumens of the right ventricle ( rv ) and left ventricle ( lv ) are labeled . the pericardial effusion is diffusely present around the ventricles ( * ) the signs of cardiogenic shock resolved following pericardiocentesis . the echocardiographic examination was completed with no evidence of structural heart disease or neoplastic masses . cardiac tamponade was abolished and a small amount of residual pericardial and pleural effusions remained after pericardiocentesis . other diagnostics performed included complete blood count ( cbc ) , chemistry panel , urinalysis , feline immunodeficiency virus ( fiv ) and feline leukemia virus ( felv ) antigen testing ( idexx laboratories ) , blood pressure measurement and ecg . the cat s blood pressure was 130 mmhg ( doppler method ) and its ecg indicated sinus rhythm with a left anterior fascicular block - like pattern . the relevant laboratory test abnormalities are listed in table 1 ; abnormalities were consistent with sepsis ( eg , transitional leukogram , mild hyperbilirubinemia ) . the urine sample was obtained several hours after fluid therapy , indicating a urine specific gravity of 1.018 without bilirubin , glucose , protein , cells or bacteria present . wbc = white blood cell diagnostic and therapeutic options were discussed with the cat s owners , including the recommendation to pursue computed tomography ( ct ) to search for a local thoracic or distant source of infection . owing to financial limitations , the owners elected to pursue conservative management with hospitalization and empiric parenteral antibiotic therapy . ampicillin sodium / sulbactam sodium ( 30/kg mg iv q8h ; aurobindo pharma ) , metronidazole ( 15 mg / kg iv q12h ; claris lifesciences ) and intravenous fluid therapy ( lactated ringer s solution ) were initiated . the cat s 5% dehydration deficit was replaced over 6 h , followed by a maintenance fluid rate of 20 ml / h . over the next 48 h , a cbc and chemistry panel were repeated 2 days after presentation ; the relevant results are presented in table 1 . after 2 days of hospitalization , the cat was transitioned to oral medications and discharged with instructions to receive amoxicillin / clavulanic acid ( 20 mg / kg po q8h ; pfizer ) and metronidazole ( 10 mg / kg po q12h ; watson pharma private ) for 4 weeks . at the time of discharge , the pleural effusion was likely either residual pleural fluid from impaired diastolic filling of the right heart during cardiac tamponade , or the result of pericardial effusion leakage following percardiocentesis . the final aerobic culture results yielded heavy growth of both pasteurella multocida and actinomyces canis . aerobic antimicrobial susceptibility testing suggested p multocida was sensitive to ampicillin though resistant to clindamycin and tobramycin . the cat presented to osu for re - evaluation 1 week after discharge and was reported to have normal appetite , energy and demeanor at home . a recheck cbc indicated normalization of the white blood cell count ( 8970/l ; si 8.97 10/l ) with an unremarkable leukogram . furthermore , the chemistry panel indicated complete resolution of the previous electrolyte disturbances , as well as normalization of creatine kinase and alanine aminotransferase . continuation of the antibiotic regimen was recommended and recheck examination was advised following completion of the course . the cat was re - evaluated by echocardiography 3 months after its initial presentation , and no recurrent effusion was noted .", "feline bacterial pericarditis has been sparsely reported in the veterinary literature . in a large - scale retrospective study of pericardial effusion in 146 cats , several mechanisms can result in septic pericarditis , including pericarditis secondary to localized spread of infection ( eg , pneumonia , suppurative mediastinal lymphadenitis ) , hematogenous infection , extension of endocarditis / myocarditis , or direct inoculation resulting from penetrating wounds , migrating foreign material or surgery . the associated clinical signs are often related to hemodynamic compromise from pericardial effusion or related to systemic infection ( eg , pyrexia , weight loss ) . of the published case reports , some have shown a documented predisposing infection , whereas the inciting etiology was not conclusively identified in others . a cat in one report developed bacterial pericarditis in close temporal proximity to a dental prophylaxis with a common oropharyngeal microorganism , peptostreptococcus . clavulanic acid for approximately 3 weeks and a full recovery was reported 6 weeks after completion of the antibiotic course . another recent case report described bacterial pericarditis in an intact female cat with pyometra and hematogenous spread of escherichia coli . that cat responded well to a 4 week course of enrofloxacin and metronidazole following peri - cardiectomy , and remained clinically stable 1 year later . conversely , another published report of feline bacterial pericarditis identified infection with a mixed population of enterobacteriaceae species and coagulase - negative staphylococcus species without an obvious predisposing cause . an anaerobic culture was not performed , and the cat responded favorably to an 8 week course of broad - spectrum antimicrobial therapy . owing to the multiple organisms involved , direct inoculation via a penetrating wound or foreign material the case reported here did not have a readily apparent systemic or focal infection , or any immune - modulating systemic diseases ; however , an exhaustive search was not pursued . bite wounds are generally associated with the oral flora of the biting animal rather than the skin flora of the victim . the most common aerobic isolate in cat bites is p multocida , and anaerobic isolates commonly include fusobacterium and bacteroides species . though the cat reported here was exclusively housed indoors , another cat was present in the household and may have incited the infection through an unwitnessed altercation . less likely , this infection may have resulted from atraumatic hematagenous spread of bacteria and alternate sources of infection ( eg , odontogenic , esophageal , pleuropulmonary ) were not systematically excluded . while the incidence and causes of septic pericarditis vary across species , the diagnostic approach and therapeutic goals remain the same . identification of the specific pathogen(s ) , related antibiotic susceptibility and source of the infection are paramount . cytology and culture of the pericardial fluid is crucial in the diagnosis of septic cases , unlike most other causes of pericardial effusion . in addition , blood cultures are advised in humans as they are positive in 4070% of cases . aerobic and anaerobic susceptibility testing is also recommended , although most laboratories do not routinely perform susceptibility testing on anaerobic isolates . as anaerobic pericarditis is associated with odontogenic infection , esophageal disease , pleuropulmonary infection , abdominal infection and pelvic infection in humans , a thorough search for adjacent and distant infections owing to the low incidence and small number of published case reports , the ideal therapy for septic pericarditis in cats is unclear . results of susceptibility testing facilitate antibiotic selection , although , if unavailable , broad - spectrum coverage is recommended based on the wide range of bacterial isolates reported . the standard of care in affected humans involves aggressive medical management , including an indwelling pericardial catheter for drainage and targeted antibiotic therapy . in dogs affected by bacterial pericarditis , eradication of the source of the infection is imperative and surgical exploration is indicated in cases that have failed medical management or have suspected abscessation identified on diagnostic imaging . consequently , advanced imaging , exploratory surgery and pericardectomy could be advised in affected cats , although , interestingly , complete recovery has been reported with antibiotics alone in previous cases and the cat reported here . the development of constriction is an important potential sequela to septic and non - septic pericarditis , and should be assessed on patient follow - up . constriction is theorized to occur secondarily to the influx of inflammatory cells into the pericardial space , ultimately leading to proliferation of fibrotic connective tissue and neovascularization . these changes can result in a loss of pericardial elasticity and thus limit diastolic filling . in a prospective human study , 9/500 ( 1.8% ) patients developed constriction over a median follow - up time of 72 months . while overall constriction is a rare complication of human viral or idiopathic pericarditis ( < 0.5% ) , the risk of constriction was highest in the bacterial pericarditis group ( 33% ) . the prevalence of constriction in cats is unknown , although echocardiographic evidence of constrictive physiology was identified in one cat with septic pericarditis . constrictive pericarditis is difficult to definitively diagnose , but echocardiographic findings of a thickened pericardium and respiratory variation of > 25% in mitral inflow velocities can be highly suggestive . in the case presented here , no subjective or clinical evidence of constrictive pericarditis was identified during the limited echocardiograms during recheck examinations ; however , concern exists for its development nonetheless .", "the cat reported here fully recovered following conservative therapy consisting of pericardiocentesis and broad - spectrum antibiotic treatment . larger retrospective or prospective studies could help further characterize treatment strategies and prognosis in affected cats ." ]

[ "germline mutations in the tumor suppressor genes brca1 and brca2 account for 3% to 5% of all breast cancer cases and 10% to 15% of ovarian cancer cases . the lifetime risk of breast cancer in brca1 and brca2 mutation carriers is estimated at 47% to 66% and 40% to 57% , respectively . the ovarian cancer risk in brca1 and brca2 mutation carriers is estimated at 35% to 46% and 13% to 23% , respectively . the median onset age for breast cancer in brca mutation carriers is 40 to 50 years , while that for sporadic cases is 60 to 70 years . previous studies conducted in unaffected brca mutation carriers have indicated that prophylactic mastect - omy effectively reduces the residual lifetime risk of breast cancer to < 5% . however , this evidence was derived from retrospective and short - term follow - up prospective studies , so it is not clear whether a bilateral risk - reducing mastectomy ( rrm ) provides better survival when compared with intensive surveillance . risk - reducing salpingo - oophorectomy ( rrso ) has been demonstrated to reduce risk of ovarian cancer to 85% , also derived from retrospective and short - term follow - up . they recommend rrso for brca mutation carriers especially upon completion of child - bearing in the national cancer center network guidelines because of the absence of reliable methods of early detection and the poor prognosis associated with advanced ovarian cancer , although they hold rrm to an option for brca mutation carriers . in japan , risk - reducing surgery as well as genetic counseling or genetic test is outside the health insurance , so we perform risk - reducing surgery for brca mutation carriers in the limited hospital facilities after the ethics committee granted permission . the safety and feasibility of nipple - sparing mastectomy ( nsm ) or skin - sparing mastectomy ( ssm ) in brca mutation carriers is debatable , and a consensus of which procedure should be performed has not yet been reached . we report a 38-year - old japanese women diagnosed with brca2 mutation that underwent prophylactic bilateral ssm with excision of the nipple to preserve the areola skin . furthermore , we provide a review of the literature on the risk management of brca mutation carriers , especially the concepts and procedures of rrm .", "a 38-year - old japanese woman was diagnosed as a brca2 mutation carrier after genetic counseling and testing and was referred to kitano hospital in april 2014 to undergo risk - reducing surgery . her father had been diagnosed with prostate cancer when he was 49 years old ; he had died from the disease 2 years later . her mother was alive but had a history of arrhythmia that was diagnosed when she was 64 years old . her paternal grandmother had been diagnosed with breast cancer when she was 54 years old and had died from the disease 10 years later . although her maternal grandfather died at the age of 72 years because of metastatic cancer , the precise details were not known . her ancestry was japanese , and she was unaware of any ashkenazi jewish heritage . because of her family history , the fact that she was a widowed mother with three children , and her knowledge of hereditary breast and ovarian cancer , she worried about that , and consulted a genetic counselor to undergo brca mutation testing . after genetic counselor showed all of the risk management options for brca mutation carriers , frequent mammography , breast magnetic resonance imaging ( mri ) , clinical breast examinations , chemoprevention , and prophylactic surgery including extent of cancer risk reduction , risks associated with surgeries , reconstructive options , management of menopausal symptoms , and reproductive desires , addressing psychosocial , social , and quality of life aspects , she finally desired rrm and rrso . the ethics committee granted permission for the rrm in may 2014 , and we provided informed consent prior to the rrm . the need for rrso remained to be discussed because of concerns associated with rrso such as menopausal disorders caused by iatrogenic fertility . breast mri showed rapid early enhancement with linear and ductal distribution in both the breasts , and the possibility of ductal carcinoma in situ could not be ruled out . axillary node enlargement was not observed . in july 2014 , to improve aesthetic and psychological outcomes according to her preference , she underwent a bilateral ssm with excision of the nipple to preserve the areola skin . using indigo carmine , we demarcated the perimeter of the breast tissue preoperatively to ensure complete excision of the mammary gland . immediate breast reconstruction was performed using the standard prosthetic reconstructive technique of two - stage expander - implant reconstruction . on pathological examination she was disease - free at a 1-year follow - up and her general condition was good .", "although the american society of clinical oncology has previously recommended that brca mutation testing should be conducted only for those with at least a 10% likelihood of carrying a mutation , it is currently recommended for any individual with a suggestive family history if the result would affect the magnitude of medical management . risk management for brca mutation carriers includes frequent mammography , breast mri , clinical breast examinations , chemoprevention , and prophylactic surgery . previous studies conducted in unaffected brca mutation carriers have indicated that prophylactic mastectomy effectively reduces the residual lifetime risk of breast cancer to < 5% . conducted a prospective study of 139 pathogenic brca1/2 carriers , among whom , 76 underwent prophylactic mastectomy and 63 were followed by regular surveillance . they showed that there were no cases of breast cancer after rrm with a mean follow - up 2.91.4 years , whereas there were eight cases of breast cancers in the surveillance group after a mean follow - up of 31.5 years . conducted a retrospective study of 639 women with a family history of breast cancer that underwent prophylactic mastectomy . with a median follow - up of 14 years , they reported that prophylactic mastectomy was associated with a 90% reduction in the incidence of breast cancer , with only seven women developing breast cancer . however , randomized controlled trials to evaluate the potential impact of rrm on survival have not been conducted , and it remains unclear whether bilateral rrm improves survival compared with intensive surveillance . the only available data is derived from risk estimates assessed using mathematical models of risk - reducing interventions . developed a monte carlo model of breast screening with annual mammography plus mri in subjects aged 25 to 69 years ; rrso was performed in those aged 40 to 50 years and rrm was performed in those aged 25 to 50 years . they reported that rrm at age 25 plus rrso at age 40 years maximizes survival probability , substituting mammography plus mri screening for rrm seemed to offer comparable survival . as far as chemoprevention is concerned , tamoxifen reduced breast cancer incidence among healthy brca2 carriers by 62% . in this case , after we discussed all of the risk management options for brca mutation carriers recommended by the national comprehensive cancer network ( nccn ) guidelines , she has finally chosen to have rrm , because she has believed rrm might release from the fear of future cancer more than other cancer preventive options . she made choice to have rrm by her responsibility that 37-year - old widowed mother with three young children , concerning that prophylactic mastectomy effectively reduces the residual lifetime risk of breast cancer to < 5% which is superior than chemoprevention , although addressing psychosocial effect of mastectomy , and risks associated with surgeries . bresser et al . reported that 95% of women opted for rrm because of decreased cancer - related psychological distress . they tend to have young children and a greater awareness of the genetic nature of cancer in the family compared with those who opt for regular surveillance , as well as in this case . for brca1 or brca2 mutation carriers at high risk for ovarian cancer , the absence of reliable methods of early detection and the poor prognosis associated with advanced ovarian cancer have impelled them to the performance bilateral rrso after completion of childbearing , ideally by age 35 to 40 years . as to the chemoprevention option , oral - contraceptive use protected against ovarian cancer both for carriers of the brca1 mutation ( odds ratio , 0.5 ; 95% confidence interval , 0.30.9 ) and for carriers of the brca2 mutation ( odds ratio , 0.4 ; 95% confidence interval , 0.21.1 ) . in this case , the need for rrso remained to be discussed in the ethics committee , and she underwent rrm at first before rrso , as following reasons : firstly , the most important reason is that there is the difference between the risk of breast cancer and of gynecologic cancer in age of 30s in brca2 mutation . the timing of rrso is controversial , while nccn guidelines panel recommends rrso for women with a known brca1 or brca2 mutation , typically between ages 35 and 40 years and upon completion of childbearing . it is well established that among women with brca2 mutation , the risk of gynecologic cancer is only 2% to 3% by the mean age of 50 years , while it increases in the late 30s in women with brca1 mutation . however , the risk of breast cancer is over 20% in 30s in women with brca2 mutation . secondly , mutation carriers who undergo rrso at a young age face medical problems such as osteoporosis , and cardiovascular disease , as well as quality - of - life issues associated with menopause , hot flashes , vaginal dryness , sexual dysfunction , sleep disturbances , and cognitive changes . thirdly , women who undergo bilateral mastectomy but who have ovaries intact can use oral contraceptive safety for protecting against ovarian cancer . oral contraceptive use has been associated with a small increase in the risk of breast cancer in young and old women . in a large meta - analysis , current use of oral contraceptives was associated with a relative risk 1.2 for breast cancer . she has not use oral contraceptive even after rrm , because she desire to have children , but she can take oral contraceptive after she gave up having children . fourthly , short - term hormone replacement therapy after rrso may be useful after rrm to improve their quality - of - life for women without increasing the risk of breast cancer , when no history of breast cancer has confirmed pathologically . as far as the method of rrm is concerned , ssm and nsm are increasingly performed instead of the conventional total mastectomy to allow for immediate breast reconstruction and to achieve a natural aesthetic outcome . the oncological risk associated with remaining mammary gland is unclear , and there remains a small risk of cancer arising beneath the nipple and areola in nsm . reynolds et al . evaluated 62 nipple - areolar complex ( nac ) tissues from 33 female brca1/2 mutation carriers who underwent mastectomy and found that 24% of nacs contained terminal duct lobular units ( tdlus ) , with only 8% found in the nipple papilla , and they estimated that nsm might be appropriate and oncologically safe for women with brca mutation carriers , but tdlus can be found in the nac and are more likely at the base of the nipple , so the significance of this for long - term risk is unknown . however , hartmann et al . reported that no significant difference in the incidence of breast cancer between women who underwent subcutaneous mastectomy and those who underwent total mastectomy . the prose study followed 105 brca1/2 mutation carriers who underwent a bilateral prophylactic mastectomy , at least 30% of whom had subcutaneous mastectomies . at 6.4 years of follow - up , two women who underwent subcutaneous mastectomies developed breast cancer , with one developing metastatic breast cancer in the axilla and the other developing breast cancer in residual breast tissue . in a review of the literature , van verschuer et al . reported that 21 primary breast cancers occurred after 6,044 prophylactic mastectomies , three occurred after a total mastectomy , and 17 occurred after a conservative mastectomy , but that the majority of primary breast cancers did not originate near nac or skin flap but were found in the chest wall or axilla . they suggested that oncological surgeons should be diligent , ensuring complete removal of all glandular tissue , especially in the axillary tail and chest wall , and that the skin flaps and nac should be dissected as thin as possible . current nsm and ssm techniques aim for skin flaps < 5 mm and for a nac thickness of 2 to 3 mm . ssm and nsm using peri - areolar or inframammary incisions can be challenging , because of difficulty of removal of remaining mammary gland in all quadrants and in the axillary tail . detection of brca1/2 mutations gave rise to a new concept in prophylactic medicine , although risk management for brca1/2 mutation carriers requires further discussion . it is generally accepted that a randomized controlled study design would allow a better evaluation of risk reducing surgery on cancer risk and mortality reduction , it is generally accepted that randomized approach would not be ethical for the management of these patients and therefore , this field of research is limited to undertaking observation studies , which intrinsic methodological limitation . the patient finally described herein chose to undergo bilateral ssm for rrm with the excision of the nipple and preservation of the areola skin . the best choice of risk reduction for brca mutation is different from each others , so it is important that the decision making should be made with knowledge of risk management options , through receiving counseling about the risks and benefits of each options ." ]

[ "data for the analysis were collected through structured phone interviews with a national sample of 27 hmos . the surveyed hmos include 15 hmos currently serving rural medicare risk enrollees , 1 hmo that recently dropped its medicare risk contract to serve rural enrollees , and 11 hmos that have commercial enrollees in 5 or more rural counties , but no rural medicare risk enrollees . the study also analyzed secondary data on hmo characteristics , medicare risk enrollment , and aapcc rates . the risk sample consisted of hmos serving 100 or more rural medicare risk enrollees as of december 1995 , stratified by the number of rural medicare risk enrollees . the commercial sample consisted of hmos that had five or more rural counties in their commercial service areas , but were not serving rural medicare risk enrollees as of december 1995 ; this sample was stratified by census region . interview protocols were developed using the literature on hmos and medicare risk contracts , including the 1990 mathematica study , and consisted of open - ended questions and probes regarding the hmo 's decisionmaking , experiences , and future plans regarding medicare risk products in rural areas . at each hmo , one or more senior managers who were knowledgeable about the hmo 's medicare risk product or the hmo 's decision not to offer the product were interviewed . three of the hmos in the risk sample had pre - tax equity and fiscal responsibility act ( tefra ) of 1982 demonstration projects , five hmos began their medicare risk contracts between the mid-1980s and 1991 , and eight hmos signed contracts after 1993 . these hmos range in age from 8 to 51 years , with a median age of 13 years ( table 1 ) . six are mixed - model hmos , seven are individual practice associations ( ipas ) , one is a group model , and one is a staff model . the 11 hmos in the commercial sample are younger than those in the risk sample , and a greater percentage are ipa models ( table 2 ) . only 2 of these plans have more than 100,000 enrollees , compared with 12 of the 15 plans with rural medicare risk enrollees . the percentages of for - profit hmos and nonprofit hmos in the two groups are similar . compared with hmo plans nationally ( interstudy , 1996 ) , the hmos in the risk sample are older , have larger total enrollment , are less likely to have for - profit tax status , and are more likely to be mixed - model hmos . their organizational characteristics resemble those of all hmos with medicare risk contracts ( physician payment review commission and prospective payment assessment commission , 1995 ) . the risk sample hmos represent more than one - fourth of the 50 hmos nationally that were serving at least 100 rural medicare risk enrollees at the end of 1995 . therefore , we are reasonably confident that the study results are generalizable to all hmos that were serving rural medicare risk enrollees when the study was conducted . however , the results may not be fully generalizable to new health plans , e.g. , provider - sponsored organizations ( psos ) , that develop to contract with the medicare program on a risk basis in the future .", "most of the risk sample hmos cited a combination of factors in their decisions to serve rural medicare risk enrollees . these hmos are all well - established plans with large commercial populations , and several indicated that their decision to offer a medicare risk product in rural areas was influenced by their experiences offering commercial products in those areas . seven hmos cited the presence of significant senior populations in some rural areas as a motivating factor for offering the medicare risk product . for six hmos , having an established provider network in rural areas was a major factor . the hmos were especially interested in contracting with major employers with large numbers of retirees in rural areas . one hmo official stated : we wanted to have a well - rounded offering , from a provider and consumer perspective , by covering medicare and medicaid as well as commercial . this hmo added that it did not enter the medicare risk business thinking it would make money . two hmos described hcfa 's requirement that a medicare risk service area be contiguous as a factor in their decisions . two hmos specifically mentioned competition from other hmos in rural areas as a motivating force for serving rural medicare enrollees . geographic necessity , i.e. , the desire to expand in a state that is mostly rural , played a role in one hmo 's decision to expand to rural counties . secondary effect ; it chose to serve urban areas and portions of the nearby rural counties just came with them . four hmos described aapcc rates as one of several factors they considered in their decisions to serve rural counties . one hmo selected rural counties where aapcc rates were not outrageously low compared with the urban counties in its service area ; other hmos indicated that they were serving rural areas in spite of low aapcc rates . these hmos balanced low rural aapcc rates with other factors such as capacity in the provider network , provider willingness to work with the plan , the growing number of retirees in some rural areas , and a desire to establish their medicare risk products in advance of the competition . for the commercial sample , aapcc rates emerged as the most important factor in hmos ' decisions not to offer a medicare risk product in rural areas . several hmos described low aapcc rates in rural counties as the only reason why they are not offering a medicare risk product in the rural portions of their commercial service areas . other hmos cited a combination of factors , including low aapcc rates , inability to develop a sufficient provider network , and small numbers of medicare beneficiaries . these findings are in accord with research indicating that the rural counties currently served by medicare risk hmos have significantly larger populations , higher population density , and higher aapcc rates , and are more likely to be located adjacent to urban areas , compared with rural counties not served by medicare risk hmos ( moscovice , casey , and krein , 1998 ) .", "most of the risk sample hmos cited a combination of factors in their decisions to serve rural medicare risk enrollees . these hmos are all well - established plans with large commercial populations , and several indicated that their decision to offer a medicare risk product in rural areas was influenced by their experiences offering commercial products in those areas . seven hmos cited the presence of significant senior populations in some rural areas as a motivating factor for offering the medicare risk product . for six hmos , having an established provider network in rural areas was a major factor . the hmos were especially interested in contracting with major employers with large numbers of retirees in rural areas . one hmo official stated : we wanted to have a well - rounded offering , from a provider and consumer perspective , by covering medicare and medicaid as well as commercial . this hmo added that it did not enter the medicare risk business thinking it would make money . two hmos described hcfa 's requirement that a medicare risk service area be contiguous as a factor in their decisions . two hmos specifically mentioned competition from other hmos in rural areas as a motivating force for serving rural medicare enrollees . geographic necessity , i.e. , the desire to expand in a state that is mostly rural , played a role in one hmo 's decision to expand to rural counties . secondary effect ; it chose to serve urban areas and portions of the nearby rural counties just came with them . four hmos described aapcc rates as one of several factors they considered in their decisions to serve rural counties . one hmo selected rural counties where aapcc rates were not outrageously low compared with the urban counties in its service area ; other hmos indicated that they were serving rural areas in spite of low aapcc rates . these hmos balanced low rural aapcc rates with other factors such as capacity in the provider network , provider willingness to work with the plan , the growing number of retirees in some rural areas , and a desire to establish their medicare risk products in advance of the competition . for the commercial sample , aapcc rates emerged as the most important factor in hmos ' decisions not to offer a medicare risk product in rural areas . several hmos described low aapcc rates in rural counties as the only reason why they are not offering a medicare risk product in the rural portions of their commercial service areas . other hmos cited a combination of factors , including low aapcc rates , inability to develop a sufficient provider network , and small numbers of medicare beneficiaries . these findings are in accord with research indicating that the rural counties currently served by medicare risk hmos have significantly larger populations , higher population density , and higher aapcc rates , and are more likely to be located adjacent to urban areas , compared with rural counties not served by medicare risk hmos ( moscovice , casey , and krein , 1998 ) .", "the 15 hmos in the rural sample have rural medicare service areas that range in size from 1 county to 20 counties , with a median of 5 rural counties . twelve of these hmos currently have a rural medicare service area that is smaller than their rural commercial service area . the differences between the hmos ' medicare and commercial service areas range from one county to the majority of rural counties in a state . these hmos most frequently cited low aapcc rates and difficulty contracting with providers in some counties as reasons for selective exclusion of rural counties from their medicare service areas . five of the 15 risk sample hmos and 3 of the 11 commercial sample hmos identified hcfa 's access standards ( which require that enrollees have access to primary and specialty care within certain distance or travel times ) as federal requirements that are more difficult for the hmo to meet in rural areas . monopolies in some rural counties ( e.g. , counties with a single ipa or hospital that refuses to negotiate a capitated contract ) make it more difficult to meet the access standards . the risk sample hmos reported using a variety of reimbursement methods for their medicare risk products , depending on the hmo model type , its ability to negotiate capitated contracts , and/or the volume of medicare risk patients . most frequently , these hmos pay some or all rural physicians on a discounted fee - for - service ( ffs ) basis , while capitating urban physicians . the risk sample hmos reported varying degrees of competition from other hmos in their rural medicare risk service areas . most of the hmos , however , reported that competition is limited to one or two other medicare risk plans in a portion of their rural service areas , in contrast to the significant competition that exists in many urban areas . for a few hmos , competition in their rural service areas is primarily in the form of medicare cost and/or supplemental products . five hmos did not know whether the utilization patterns of their rural medicare risk enrollees differ from those of urban enrollees . for most of these hmos , rural enrollees comprise a small percentage of their medicare risk enrollees , and they have not examined rural utilization patterns separately . a few hmos have not observed any differences in rural and urban utilization patterns while others , including two hmos with large numbers of rural enrollees , reported that utilization has been higher in rural areas . of the 15 hmos with rural medicare risk enrollees , 8 hmos were able to differentiate between the financial experience of their medicare risk product in rural areas and in urban areas . five of these eight hmos said their medicare risk products were unprofitable in rural areas ( and either profitable or breaking even in urban areas ) , while two hmos said they were breaking even in rural areas and making a profit in urban areas . one hmo reported that its financial experience in both urban and rural areas has been moderately positive . one hmo did not describe its financial experience with the medicare risk product , and six hmos described their overall financial experience without distinguishing between rural and urban areas . two of these hmos said their medicare risk products were unprofitable overall , two hmos said they were breaking even , and two reported that their financial experience varied from county to county within their service area . in addition , the interviewed hmo that dropped its medicare risk contract did so because both the hmo and the rural clinic , its only provider in the area , were experiencing financial losses under the risk contract . no clear relationship emerged between the hmos ' financial experience with medicare risk products in rural areas and either the length of time the hmo has offered the product or the number of rural enrollees . the hmos that reported unprofitable medicare risk products in rural areas include both hmos that have had these products for several years and hmos that began offering them more recently . they also include some hmos with large numbers of rural medicare risk enrollees , as well as hmos with relatively fewer rural medicare risk enrollees . hmos with low rural aapcc rates ( less than $ 375 ) were more likely to say their medicare risk products are losing money in rural areas , while those with moderate rural rates ( $ 375 to $ 499 ) were more likely to say they are breaking even or profitable . four of the 15 hmos with medicare risk products in rural areas plan to expand their rural medicare service areas in the near future . one of these hmos plans to add two rural counties , and the other three hmos plan to add several rural counties . likely to add one rural county , while another hmo will only add medicare enrollees from nearby rural areas who obtain care in urban areas . four hmos have no plans to expand their rural medicare service areas ; one of these hmos plans to drop some rural counties unless rates increase or contracting requirements change . for three hmos , future rural expansion depends on aapcc changes ; one of these hmos is also evaluating the status of some rural counties in its current service area . two hmos may expand their medicare risk service areas in the future as they expand their commercial service areas . among the group of hmos not currently serving rural medicare risk enrollees , one of the two hmos with urban medicare risk enrollees plans to serve rural enrollees in the future , and the other plans to serve them if its rural aapcc rates increase . three hmos in the commercial sample are considering medicare risk contracts , but have not decided whether to submit applications or which counties would be in their service areas . six hmos have no plans to serve rural medicare risk enrollees in the near future . two of these hmos have submitted medicare risk applications for urban service areas , and another is preparing such an application . one hmo applied for a medicare cost contract ; a second was considering a medicare cost or medicare select product , and a third was considering a traditional medicare supplemental product .", "four of the 15 hmos with medicare risk products in rural areas plan to expand their rural medicare service areas in the near future . one of these hmos plans to add two rural counties , and the other three hmos plan to add several rural counties . likely to add one rural county , while another hmo will only add medicare enrollees from nearby rural areas who obtain care in urban areas . four hmos have no plans to expand their rural medicare service areas ; one of these hmos plans to drop some rural counties unless rates increase or contracting requirements change . for three hmos , future rural expansion depends on aapcc changes ; one of these hmos is also evaluating the status of some rural counties in its current service area . two hmos may expand their medicare risk service areas in the future as they expand their commercial service areas . among the group of hmos not currently serving rural medicare risk enrollees , one of the two hmos with urban medicare risk enrollees plans to serve rural enrollees in the future , and the other plans to serve them if its rural aapcc rates increase . three hmos in the commercial sample are considering medicare risk contracts , but have not decided whether to submit applications or which counties would be in their service areas . six hmos have no plans to serve rural medicare risk enrollees in the near future . two of these hmos have submitted medicare risk applications for urban service areas , and another is preparing such an application . one hmo applied for a medicare cost contract ; a second was considering a medicare cost or medicare select product , and a third was considering a traditional medicare supplemental product .", "the results summarized in this article underscore the importance of aapcc rates as a factor in hmos ' decisions to offer medicare risk products in rural areas , but also identify several other factors that influence these decisions , including the hmo 's experience with commercial hmo products in rural areas , whether the hmo has an established rural provider network ( or believes it can successfully develop one ) , employer demand for retiree coverage , the presence of sufficiently large senior populations , the hmo 's corporate mission , contiguous service area requirements , and competition from other hmos . this article also shows that aapcc rates and provider network considerations are important factors in decisions made by a number of hmos to exclude rural counties in their commercial service areas from their medicare risk contract service areas . these results suggest that the changes in the aapcc payment methodology are most likely to affect the willingness of two groups of hmos to serve rural medicare risk enrollees . the first group is hmos that have excluded rural counties in their commercial service areas from their medicare risk contract service areas primarily because of low aapcc rates . the second group includes hmos that serve rural commercial populations , but do not offer a rural medicare risk product because of low aapcc rates in those rural counties . hmos that are serving rural medicare risk enrollees unintentionally or only at the hmos ' urban facilities appear unlikely to increase the number of rural enrollees they serve as a result of the aapcc changes . increases in rural aapcc rates will not directly affect other factors cited by some hmos as disincentives to medicare risk product development in rural areas . these include small numbers of rural medicare beneficiaries or the unwillingness of rural providers to contract with the hmo on a capitated basis . however , the aapcc changes may indirectly reduce some of these barriers . for example , to the extent that increased aapcc rates allow hmos to offer rural physicians , hospitals , and other providers more favorable reimbursement , the aapcc changes may encourage previously reluctant rural providers to participate in hmo provider networks . alternatively , some of these rural providers may be motivated by increased aapcc rates and the potential regulatory flexibility of federal pso standards to develop psos , either in competition with hmos or as joint ventures with hmos or insurance companies . although the majority of medicare risk enrollees are individuals , this study indicates that large employers seeking hmo coverage for retirees now play a growing role in encouraging hmos to offer medicare risk products in some rural areas . this article also suggests that competition in a few medicare risk markets is motivating some hmos to expand their medicare risk service areas to include rural counties . in another sign of potential near - term growth in the rural medicare risk contract market , several hmos described a proposed strategy of initially developing their medicare risk product in urban areas where aapcc rates are higher and contracting with providers is easier , and then expanding to rural areas . a number of hmos , however , reported financial losses on their rural medicare risk products , and nearly all of the hmos currently serving rural medicare risk enrollees indicated that their financial experience in rural areas has been less positive than in urban areas . the for - profit hmos interviewed have clear expectations that their medicare risk products will be profitable or will not be continued . a number of the non - profit hmos suggested that they did not expect to make money on a rural medicare risk product , however , they acknowledged the need to break even over the long term . some indemnity insurers with substantial numbers of rural medicare beneficiaries in supplemental products operate affiliated hmos and are encouraging their rural commercial populations to move to managed care . the future of medicare risk contracting in rural areas may depend in part on whether these organizations decide to offer medicare risk products through affiliated hmos , and the degree to which they encourage their medicare supplemental subscribers to move to managed care . the success of medicare risk contracting in rural areas also will depend on whether increased aapcc rates allow hmos to offer rural enrollees the type of medicare risk products that have competed successfully with medicare supplemental products in higher aapcc urban markets , i.e. , products with zero premiums or low premiums compared with supplemental products , as well as additional benefits such as prescription coverage ." ]

[ "this randomized , double - blind , placebo - controlled , parallel group , 24-week study with a subsequent 24-week extension enrolled male and female patients with type 2 diabetes between 29 july 2008 and 4 july 2009 . the study took place at 105 sites in argentina , canada , india , mexico , peru , philippines , taiwan , and united states and was completed on 15 june 2010 . institutional review boards or independent ethics committees approved this protocol , and each patient provided written informed consent . patients 18 years old having fasting c - peptide 1.0 ng / ml and bmi 45.0 kg / m entered group a or b. group a patients had received 12 weeks of pioglitazone 30 or 45 mg / day and had hba1c 7.0 and 10.5% . group b patients were drug naive for the previous 10 weeks with hba1c 8.0 and 11.0% or had received pioglitazone 15 mg / day or any dose of rosiglitazone with hba1c 8.0 and 11.0% or had received 8 weeks of metformin 1700 mg / day or sulfonylurea less than or equal to half the maximal dose with hba1c 7.0 and 11.0% . group b patients could not be on > 1 oral antidiabetic medication , and patients on more than half the maximum dose of sulfonylurea or metformin were excluded . group b patients underwent a 10-week dose - optimization period in which their initial therapy was discontinued , and pioglitazone 30 mg / day was started and increased to 45 mg / day if possible . group b patients were discontinued if their fasting plasma glucose ( fpg ) was > 270 mg / dl ( 15.0 mmol / l ) after 3 weeks or after 6 weeks with hba1c < 7.0 or > 11.0% . exclusion criteria included aspartate or alanine aminotransferases > 2.5 times the upper limit of normal , total bilirubin > 2.0 mg / dl , serum creatinine 2.0 mg / dl , urine albumin / creatinine ratio > 1,800 mg / g , calculated creatinine clearance < 50 ml / min , and congestive heart failure class iii and iv . patients with prerandomization hba1c 7.0 and 10.5% entered the 2-week , single - blind lead - in period and received diet and exercise counseling . randomized patients received double - blind dapagliflozin 5 or 10 mg or placebo every day ( oral administration ) with open - label pioglitazone 30 or 45 mg / day , stratified by pre - enrollment diabetes treatment group a and b. to ensure adequate representation from group a , randomization was set to recruit at least one - third of the patients from this group . the primary objective compared the change at 24 weeks from baseline in hba1c with each dose of dapagliflozin plus pioglitazone versus placebo plus pioglitazone . secondary objectives included change from baseline in fpg , postprandial glucose ( ppg ) measured by 120-min postchallenge response to an oral glucose tolerance test , and total body weight . if fpg was > 270 mg / dl ( 15.0 mmol / l ) ( week 48 ) , > 240 mg / dl ( 13.3 mmol / l ) ( week 812 ) , or > 200 mg / dl ( 11.1 mmol / l ) ( week 1224 ) , then patients were eligible to receive open - label rescue medication ( metformin or sulfonylurea ) . patients completing the first 24 weeks of the study were eligible for an additional 24 weeks . during weeks 24 to 48 , if hba1c was > 8.0 ( week 2536 ) or > 7.5% ( week 3647 ) , patients were eligible to receive open - label rescue medication . data obtained after rescue were excluded from the efficacy analysis but included in safety analysis . adverse events , laboratory abnormalities , and vital signs were assessed for the safety and tolerability of treatment . hypoglycemia definitions are in the supplementary appendix and were documented for any event the investigator considered to be a hypoglycemic event , regardless of blood glucose measurement . signs , symptoms , and events suggestive of urinary tract infection ( uti ) and genital infection were solicited at every visit . preferred term lists included a broad spectrum of signs and symptoms of utis and genital infections in addition to specific diagnoses . seated blood pressure was determined after 5 min of rest followed by the orthostatic blood pressure measurements . average blood pressure was determined from three replicate measurements taken at least 1 min apart in each position ( seated , supine , and standing ) . statistical analyses at week 24 ( last observation carried forward ) including changes from baseline in hba1c , fpg , ppg , and body weight were performed using ancova with treatment group as an effect and baseline value and strata based on pre - enrollment antidiabetic therapy as covariates in the model . secondary end points were tested for significance sequentially . at week 48 , analyses of change from baseline in hba1c , fpg , ppg , and body weight were performed using longitudinal repeated - measures analysis over time including the fixed categorical effects of strata based on pre - enrollment antidiabetic therapy , treatment , week , and treatment - by - week interaction as well as the continuous fixed covariates of baseline measurement and baseline measurement - by - week interaction . rescue was added as an additional effect to the mixed model when the analysis was performed on data regardless of rescue .", "statistical analyses at week 24 ( last observation carried forward ) including changes from baseline in hba1c , fpg , ppg , and body weight were performed using ancova with treatment group as an effect and baseline value and strata based on pre - enrollment antidiabetic therapy as covariates in the model . secondary end points were tested for significance sequentially . at week 48 , analyses of change from baseline in hba1c , fpg , ppg , and body weight were performed using longitudinal repeated - measures analysis over time including the fixed categorical effects of strata based on pre - enrollment antidiabetic therapy , treatment , week , and treatment - by - week interaction as well as the continuous fixed covariates of baseline measurement and baseline measurement - by - week interaction . rescue was added as an additional effect to the mixed model when the analysis was performed on data regardless of rescue .", "of the 972 enrolled patients , 558 met the entrance criteria , and 480 entered the lead - in phase with pioglitazone . almost equal numbers of patients came from group a ( 48% , 200 out of 420 ) and group b ( 52% , 220 out of 420 ) ( supplementary fig . the proportion of patients who were discontinued or rescued for lack of glycemic control was less with dapagliflozin ( 1118% ) than with placebo ( 34% ) . demographics and baseline characteristics treatment with dapagliflozin 5 and 10 mg added on to pioglitazone resulted in statistically significant mean reductions in hba1c , fpg , and ppg when compared with placebo at week 24 ( table 2 ) and were maintained through week 48 ( table 2 ) . the mean reduction from baseline in hba1c with dapagliflozin plus pioglitazone ranged from 0.82 to 0.97% compared with 0.42% with the placebo plus pioglitazone at week 24 ( p = 0.0007 and p < 0.0001 for dapagliflozin 5- and 10-mg groups , respectively . ) at 48 weeks , the mean reductions in hba1c were maintained , and dapagliflozin groups ranged from 0.95 to 1.21% compared with 0.54% with the placebo plus pioglitazone . 1a ) and similar between groups a and b over time ( data not shown ) . 1b ) in the dapagliflozin groups and significant at week 24 ( table 2 ) . at week 48 , a greater reduction in mean change from baseline in ppg was observed with dapagliflozin plus pioglitazone ( 60.4 to 80.9 mg / dl [ 3.35 to 4.49 mmol / l ] ) than with placebo plus pioglitazone ( 25.4 mg / dl [ 1.41 mmol / l ] ) ( table 2 ) . change from baseline at weeks 24 and 48 in efficacy parameters , vital signs , and laboratory values changes in glycemic parameters for placebo ( circles ) , dapagliflozin 5 mg ( squares ) , and dapagliflozin 10 mg ( triangles ) all plus pioglitazone 30 mg . a : mean change from baseline in hba1c after adjustment for baseline value over time . b : mean change from baseline in fpg after adjustment for baseline value over time . d : mean change from baseline in total body weight after adjustment for baseline value over time . includes patients who took at least one dose of double - blind study medication . the increase in mean urinary glucose to creatinine ratio from baseline was maintained in the dapagliflozin groups over time ( fig . the placebo group experienced a mean increase in body weight of 3.0 kg through week 48 . dapagliflozin groups had a slight weight reduction initially , followed by gradual weight gain toward the baseline values at week 24 and gains of 1.4 and 0.7 kg for 5 and 10 mg , respectively , at week 48 ( table 2 and fig . these changes for the dapagliflozin groups were significant at week 24 compared with placebo , maintained throughout 48 weeks ( table 2 ) , and appeared to be dose - dependent over time ( fig . the placebo group experienced a mean increase in seated blood pressure at weeks 24 and 48 , whereas both dapagliflozin groups experienced mean decreases ( table 2 ) . small mean increases in hematocrit occurred in both dapagliflozin treatment groups ( 1.362.04% ) , whereas the placebo showed 0.44% change at week 48 . small changes were observed on mean fasting ldl cholesterol ( 1.13.4% for dapagliflozin and 4.5% for placebo ) , total cholesterol ( 0.02.0% for dapagliflozin and 1.9% for placebo ) , triglycerides ( 3.74.2% for dapagliflozin and 13.5% for placebo ) , and hdl cholesterol ( 4.17.2% for dapagliflozin and 1.3% for placebo ) at week 48 . no clinically relevant changes in calcium , magnesium , phosphorous , or serum 25 hydroxyvitamin d concentrations were apparent in any treatment group throughout the study ( data not shown ) . there were small increases within the normal limits for parathyroid hormone and small mean changes in bone markers ( serum procollagen type 1 n - propeptide , cooh - terminal telopeptide of type 1 collagen , n - terminal telopeptide of type 1 collagen , and osteocalcin ) compared with placebo , which were unlikely to be clinically significant . the proportion of patients who reported at least one adverse event was similar for dapagliflozin ( 68.170.7% ) and placebo ( 66.9% ) through week 48 . one death due to septic shock was reported on day 117 in the dapagliflozin 5-mg group within 2 days of presenting with acute cholecystitis . discontinuations were low and similar between the dapagliflozin and the placebo groups , none due to hypoglycemia . adverse and special interest events through week 48 all of the renal events listed in table 3 occurred during the first 24-week period , and no additional events occurred during the second 24-week period . they included serum creatinine increase ( four events ) , creatinine renal clearance decrease ( one event ) , glomerular filtration rate decrease ( one event ) , and abnormal renal function test ( one event ) . the proportion of patients with an event suggestive of uti was 7.9 , 8.5 , and 5.0% with placebo , dapagliflozin 5 mg , and 10 mg , respectively , through week 48 . signs , symptoms , and other events suggestive of genital infection were more common in both dapagliflozin treatment groups ( 8.69.2% ) than in the placebo group ( 2.9% ) through week 48 . most events suggestive of uti or genital infection were of mild or moderate intensity ; none of these events were serious or led to withdrawal from the study except for one patient ( dapagliflozin 5 mg ) with recurrent utis . patients treated with pioglitazone plus dapagliflozin 5 or 10 mg had a lower rate of peripheral edema ( 4.3 and 2.1% , respectively ) compared with pioglitazone plus placebo ( 6.5% ) ( table 3 ) . two patients ( one female and one male ) from the dapagliflozin 5-mg group experienced limb fractures ( one foot and one hand , respectively ) during the first 24-week period . one patient on placebo had an event of heart failure , and one patient on dapagliflozin 5 mg had urothelial bladder cancer detected on day 144 .", "in this study , the addition of dapagliflozin to pioglitazone lowered hba1c levels and attenuated the pioglitazone - related weight gain in patients with type 2 diabetes inadequately controlled on pioglitazone alone . dapagliflozin acts in the kidney by inhibiting the reabsorption of glucose ( 15,16 ) and is not only capable of reducing fpg but also reabsorption of higher glucose load postprandially as shown in this study . these beneficial effects of dapagliflozin on hyperglycemia were maintained for almost 1 year and were consistent with sustained pharmacodynamic activity on glycosuria . the glucosuria induced by sglt-2 inhibition might be suspected to lead to hypoglycemia , utis , and genital infections . however , hypoglycemia events were rare in this study . no clear relationship to dapagliflozin was observed for events suggestive of utis , although one patient withdrew from the trial due to recurring utis . consistent with previous reports ( 5,6,8 ) , events suggestive of genital infections were higher in patients on dapagliflozin than on placebo . urinary excretion of glucose also leads to caloric loss and the addition of dapagliflozin to pioglitazone can potentially mitigate weight gain due to pioglitazone . the differences between placebo and dapagliflozin - treated groups in weight were mainly driven by continuous weight gain in the placebo group , reflecting probably that pioglitazone was initiated or optimized during the prerandomization period , whereas no meaningful changes from baseline occurred in dapagliflozin groups . dapagliflozin , acting as a mild diuretic , may also mitigate the fluid retaining effects of pioglitazone as evidenced by fewer reports of edema . some studies suggest that pioglitazone may modestly lower blood pressure ( 17 ) , a beneficial effect for patients with diabetes . when dapagliflozin was used as monotherapy ( 5 ) or in combination therapy ( 6,8 ) , there was also some suggestive mild lowering of blood pressure . in this study , addition of dapagliflozin to pioglitazone was associated with a modest further decrease in blood pressure beyond the effect of pioglitazone alone in the absence of any ill effects such as hypotensive events or measured orthostatic hypotension . thus , along with effects on weight , dapagliflozin may add to the blood pressure benefit of pioglitazone . congestive heart failure , bladder cancer , or bone fractures , known side effects of long - term use of pioglitazone , were rare events ; too rare at this stage to infer any effect on the risk of these events with the addition of dapagliflozin ( 13,14,18 ) . two fractures did occur in the dapagliflozin 5-mg group , but all patients received pioglitazone , and thiazolidinediones are known to increase the risk of fractures ( 19 ) . dapagliflozin added on to pioglitazone resulted in sustained glycemic benefits in both fasting and postprandial plasma glucose concentrations . as a possible mild diuretic and consistent glucouretic , dapagliflozin mitigated the weight gain and fluid retention due to pioglitazone . even though more genital infections occurred with dapagliflozin than placebo , dapagliflozin added on to pioglitazone was effective and well - tolerated . the direct removal of glucose by dapagliflozin complements the insulin - sensitizing action of pioglitazone , providing a potential combination that balances well the benefits and risks of therapy for some patients with type 2 diabetes ." ]

[ "chronic kidney disease ( ckd ) is a public health problem that affects more than 20 million people in the us . an average dialysis patient may require more than 12 medications . a pooled analysis identified 1,593 medication - related problems in 385 dialysis patients , with over- or under- dosing errors accounting for 20.4% of these issues . despite the large number of patients affected and the devastating consequences of medication related problems , our understanding of the impact of kidney disease on drug disposition is incomplete , particularly for those drugs eliminated primarily by non - renal pathways . obviously , clearance of drugs that depend primarily on the kidneys for elimination is reduced , but significant changes also occur in drug exposure with medications that are eliminated by the liver , intestine , and possibly other organs . in 2009 , the fda published a survey of new drug applications ( nda ) approved between january 2003 and july 2007 that assessed the impact of renal impairment on systemic exposure of new molecular entities . in this analysis , nda sponsors for 37 orally administered drugs included renal impairment studies as part of their submission ; 23 ( 62% ) of these were eliminated by non - renal pathways ( defined as fraction eliminated via renal route < 15 ) . despite being cleared non - renally , 13 of these 23 new drugs ( 57% ) showed an average 1.5-fold increase in area under the plasma concentration - time curve ( auc ) in renally impaired patients compared with health controls . in fact , the change in drug exposure for five drugs cleared mainly by hepatic metabolism and/or transport were of a magnitude ( viz . duloxetine auc + 2.0-fold , tadalafil auc + 2.7- to 4.1-fold , rosuvastatin cplasma + 3-fold , telithromycin auc + 1.9-fold , solifenacin auc + 2.1-fold ) that required labeling recommendations for dose adjustment in renally impaired patients . seven other drugs showed an effect of renal impairment on drug exposure but did not require dosage adjustment ( aliskiren , alfuzosin , aprepitant , ranolazine , vardenafil , darifenacin , and lanthanum ) . these data along with a large body of earlier literature suggest that ckd alters the pharmacokinetics of drugs that are cleared by non - renal mechanisms ; however , the underlying molecular mechanisms accounting for these pharmacokinetic changes remain poorly defined ( reviewed by nolin , leblond and others ) . the purpose of the present mini - review is to highlight the present gaps in our understanding of the impact of ckd on non - renal drug clearance involving metabolism and transport processes and to identify areas of opportunity for future research .", "the following is a brief introduction to the key drug - metabolizing enzymes and drug transporters whose function is known to be altered in ckd . phase i drug metabolism , involving oxidation , reduction , and hydrolysis , generally converts drug molecules to more polar or water soluble metabolites that are readily excreted by the kidneys or via the biliary system . drug oxidation , which is particularly known to be altered in ckd , is catalyzed by two large families of enzymes , namely the cytochrome p450 ( cyps ) and flavin - containing monoxygenases ( fmos ) . many of the cyps exhibit genetic polymorphisms which range from gene duplication resulting in gene overexpression to null mutations producing a non - functional enzyme . the recent focus of cyp research is on enzymes expressed in the liver and the intestinal mucosa , which govern the oral bioavailability ( i.e. , first - pass metabolism ) and systemic metabolic clearance of drug molecules . human hepatic cytochrome p450s include cyp3a4 and 3a5 ( 40% of total liver p450 content ) , cyp2cs ( 25% ) , cyp1a2 ( 18% ) , cyp2e1 ( 9% ) , cyp2a6 ( 2% ) , cyp2d6 ( 2% ) and cyp2b6 ( < 1% ) , as well as fmo3 . human intestinal cyps that are functionally important include cyp1a1 , cyp3a4 , cyp3a5 , and cyp2j2 . cyp1a1 , cyp1a2 , cyp3a5 , cyp4a1 , and fmo1 are also expressed in human kidneys , but at levels much lower than in the liver and intestine . many drugs or their phase i metabolites also undergo conjugation reactions mediated by phase ii enzymes . in particular , n - acetylation and o - glucuronidation of drugs or drug metabolites are known to be altered in ckd . the liver and intestinal mucosa are the major sites for the biotransformation of drugs and drug metabolites by phase ii enzymes ( figure 1 ) . it should be noted that the products of phase i and phase ii metabolism are not always pharmacologically inactive or less toxic than the parent drug . transporters are transmembrane proteins facilitating the passage of both drugs and other xenobiotics across biological barriers encountered during drug absorption , tissue distribution , and excretion . transporters , like drug - metabolizing enzymes , are expressed differentially across body tissues and are characterized as either uptake or influx transporters ( transport into the cellular barrier ) or efflux transporters ( transport out of the cellular barrier ) . the importance of transporters in governing the intestinal absorption of drugs and nutrients and renal tubular secretion or reabsorption of drugs or their metabolites is increasingly being recognized . on the other hand , the role of hepatic sinusoidal transporters in regulating the access of drug substrates to the hepatocellular enzymes and that of canalicular transporters in biliary excretion of drugs and/or their conjugate metabolites are not as widely appreciated . recent studies in experimental models of ckd have demonstrated altered expression and/or activities of intestinal and hepatic drug transporters that could modulate the respective intestinal absorption and hepatic uptake and metabolism of drugs .", "more than 75 commonly used drugs have been reported to exhibit altered non - renal clearance in patients with ckd ( see table 1 for compilation ) . only a few are subject to primary phase ii metabolism , namely o - glucuronidation ( diacerein , morphine , oxprenolol , and zidovudine ) and n - acetylation ( isoniazid and procainamide ) . in almost all cases , reduced non - renal clearance , along with an increase in oral bioavailability in some cases ( especially for drugs that undergo first - pass metabolism in the intestinal mucosa and/or liver ) , was observed in ckd . a case in point is the diminished non - renal clearance of nimodipine , which could result in as much as a 7-fold increase in its auc , although the increase in drug exposure is usually more modest ( 1.5 - 3.0-fold ) , variable across patients , and dependent upon the degree of renal impairment and the dialysis regimen in patients near or at the end - stage of renal disease . increased clearance has been reported for a handful of drugs , including phenytoin , fosinopril , cefpiramide , nifedipine , bumetanide , and sulfadimidine . at least in the case of phenytoin , the apparent acceleration in non - renal clearance is attributed to reduced binding of phenytoin to albumin in uremic serum resulting in a higher fraction of circulating drug being available for uptake and metabolism by the liver . a number of mechanisms have been hypothesized for the impairment of drug metabolism in ckd , particularly metabolic pathways mediated by cyp enzymes . the supporting evidence is drawn largely from experimental studies in animal models of acute and chronic renal failure . the proposed mechanisms include : alterations in gene transcription and protein translation , reduced cyp expression due to inhibition of hemoprotein biosynthesis and/or increased enzyme degradation , depletion of co - factors ( e.g. , supply of nadph ) , and direct competitive inhibition of cyp enzyme by circulating uremic constituents . supply of -aminolevulinic acid is recognized as a rate - limiting step in the hepatic synthesis of cytochrome p450 hemoproteins . total microsomal cytochrome p450 content is consistently reduced in various experimental models of renal failure , and mitochondrial -aminolevulinic synthetase activity is depressed in the two - step 5/6 nephrectomy model in rats . leber et al . reported that intraperitoneal supplementation of -aminolevulinic acid in rats following subtotal nephrectomy normalized the level of cytochrome p450 in the liver , but did not reverse the reduction in cyp activities ; hence , interference of hemoprotein synthesis is not a major mechanism of uremia s effect on cyp functioning in the rat . in addition , there is no experimental evidence in support of a diminished pool of hepatic nadph / nadh in renal failure , thereby limiting microsomal oxidation reactions . currently , the two most likely mechanisms are transcriptional and/or translational modifications and direct competitive inhibition of the cyp enzymes . nolin et al . have provided a thorough summary of experimental studies conducted over the past decade , which clearly demonstrated reduced expression of cyp genes and gene products ( i.e. , reduced mrna and protein , or reduced protein with no change in mrna ) in several animal models of ckd . the precise mechanism(s ) of the down - regulation of cyp genes in these ckd models remains unknown . also , there is no prima facie evidence that transcriptional and/or translational modifications in cyp genes involved in drug metabolism occur in humans with ckd . the only available human data come from ex vivo studies of uremic serum obtained from patients with end - stage renal disease ( esrd ) , which showed that incubating rat hepatocytes in primary culture with uremic human serum led to a decrease in protein expression and activity for all the major xenobiotic - metabolizing cyps ( i.e. , 1a , 2c , 2d , 3a and 4a families ) , except for cyp2e1 . observed that , while pre - hemodialysis serum caused significant reductions in cyp protein expression compared to serum from healthy controls , post - dialysis serum showed no effect . fractionation of uremic serum by ultrafiltration and size - exclusion hplc revealed that the inhibitory constituents have a molecular weight range between 10 and 15 kda . these investigators postulated that proinflammatory cytokines and parathyroid hormone , which have the requisite molecular size and are known to be elevated in ckd , could mediate the down - regulation of cyps in ckd . indeed , a follow - up study by the same group provided strong evidence that parathyroid hormone was a major component in uremic rat serum responsible for cyp down - regulation , and parathyroidectomy abolished the alteration in cyp transcription and translation . possible mechanisms of parathyroid hormone s effect on cyp gene regulation include increased camp production , elevations in intracellular calcium , and/or activation of the nf-b pathway . down - regulation of cyp gene expression in response to proinflammatory cytokines and other mediators of acute phase response ( e.g. , interleukin-1 , interleukin-6 , tumor necrosis factor- , interferon ) are well established . it is also possible that circulating uremic constituents interfere with signaling of nuclear receptors involved in transcriptional activation of cyp genes , such as pregnane - x - receptor ( pxr ) and constitutive androstane receptor ( car ) . also , uremic plasma ultrafiltrate and peritoneal dialysate have been shown to inhibit vdr - rxr hetero - dimerization and attenuate activation of vitamin d responsive genes , which include cyp3a4 . the ex vivo evidence for uremia - induced transcriptional and translational modifications appears convincing , but there are caveats . interspecies differences exist in the binding and activation of nuclear receptors ( e.g. , pxr ) that regulate transcription of cyp genes , particularly between rodents and humans . in addition , the human orthologs of rat cyp enzymes often have vastly different drug substrate selectivity . the degree of uremia in animal models often exceeds that observed in stage iii ckd subjects and may not be generalizable to this population ; however , it may mimic the uremic state observed in patients with stage iv ckd or in sub - optimally dialyzed stage v subjects . hence , caution should be exercised in extrapolating genomic and functional data gathered from studies with rat hepatocytes and severely uremic animal models to the clinical context in ckd patients . it would be of considerable interest to repeat the ex vivo studies of uremic human serum on short term cyp regulation using a three - dimensional human hepatocyte culture system ( vide infra ) . the presence of circulating , competitive inhibitor(s ) of cyp enzymes in uremic blood or plasma was demonstrated in some of the early experimental studies . as early as 1985 , terao et al . showed a reduced extraction of s - propranolol a high intrinsic clearance cyp substrate , by livers isolated from normal rats perfused with uremic blood . furthermore , livers from acute renal failure rats showed no reduction in s - propranolol extraction when perfused with normal blood from control rats . this set of cross - perfusion experiments presented the first evidence of a rapidly acting inhibitory factor(s ) in uremic blood directly affecting the functioning of hepatic cyp enzymes . a later study by the same laboratory showed that a low molecular weight ultrafiltrate fraction ( < 10 kda ) of uremic plasma obtained from esrd patients was capable of inhibiting the oxidative metabolism of s - propranolol in human liver microsomes mediated by cyp2d6 and cyp1a2 . corroborating evidence of circulating uremic inhibitors have also been provided by yoshitani et al . who showed that uremic sera from experimental models of acute renal failure in rats were capable of inhibiting oxidative metabolism of losartan in rat liver microsomes . likewise , taburet et al . reported that uremic plasma from esrd patients inhibited the metabolism of the cyp2c9 probe tolbutamide and the cyp3a probe midazolam in human liver microsomes from donors with normal renal function . another piece of indirect evidence comes from pharmacokinetic studies in esrd patients undergoing hemodialysis ; where the metabolic clearance of both propranolol and telithromycin following oral administration was partially or completely normalized when the drug was given shortly after a regular dialysis session compared to before dialysis . the rapid reversibility of uremia s effect is more consistent with dialytic removal of competitive enzyme inhibitors than reversal of uremia - induced down - regulation of cyp . while the latter process normally takes several days to achieve in accordance to the turnover half - life of cytochrome p450s ( 24 hours ) , downregulation in the expression of one or more cyp proteins until now , no systematic investigation has been undertaken to identify the putative cyp inhibitors in uremic blood of ckd patients . unfortunately , our incomplete understanding of the effect of uremia on drug metabolism means that we are unable to predict which drug substrates and under what clinical circumstance would we expect to encounter a significant perturbation in metabolic clearance that warrants dosage adjustment . early on , it was hypothesized that uremic inhibition of metabolic clearance may be confined to drug substrates of select cyp subfamilies if competitive enzyme inhibition by circulating uremic inhibitors is cyp specific . soon it became apparent that uremic inhibition is observed in members of nearly every major drug - metabolizing cyp subfamilies ; more puzzling is the fact that inhibition is inconsistent in its manifestation across substrates for the same cyp isoenzyme . for example , most of the lipophilic -adrenergic blockers are metabolized to a large extent by cyp2d6 . whereas the first - pass and systemic clearance of orally administered propranolol and bufuralol are significantly reduced in ckd patients resulting in 3- to 5-fold increases in auc , the same is observed with substrates of cyp3a : first - pass metabolism and systemic clearance of midazolam are not affected by renal dysfunction ; in contrast , increased oral bioavailability and decreased systemic clearance have been reported for other cyp3a - selective substrates , such as the antidepressant reboxetine and the dihydropyridine calcium channel blockers nicardipine , nimodipine , and nitrendipine . thus , until we have identified the uremic constituents that modulate cyp - mediated metabolism , we will not begin to appreciate the exact nature and complexity of the effects of kidney disease on drug metabolism . for cyp enzymes exhibiting allosteric behavior , such as cyp1a1 , cyp2b6 , cyp2c8 , cyp2c9 , and cyp3a4/5 , heterotropic cooperativity induced by two substrates or a substrate - inhibitor pair can lead to either apparent activation or inhibition in metabolism . the outcome of interactions become even harder to predict when multiple inhibitors are present , which is the likely scenario in uremia ; such complex uremia retention solute - drug interactions will require meticulous enzyme kinetic studies . for those substrates whose first - pass metabolism is inhibited , we will need to delineate the separate effects of uremia on drug extraction at the intestinal mucosa versus that at the liver . leblond et al . have shown that uremia - induced down - regulation of some cyps is tissue - specific ; for example , chronic renal failure in rats induced by two - stage , 5/6 nephrectomy resulted in a significant down - regulation in cyp1a2 in the intestine but not in the liver , whereas the opposite is observed with cyp2c11 . some of the variability in the effects of renal disease on drug metabolism undoubtedly reflects differences in the stage of kidney disease and severity of uremia of patients between studies . there is always the problem of unrecognized confounders , such as differences in diet and nutritional support that may give rise to variations in composition and levels of uremic toxins , and the ever present problem of assessing drug - drug interactions .", "there is increasing awareness that uptake transport of drugs across the sinusoidal membrane of hepatocytes regulates the access of drug substrates to hepatocelluar enzymes as well as canalcular transport into the bile canaliculi , and can be a rate - limiting step in the overall process of hepatic drug clearance . in 1984 , bowmer , yates and their colleagues reported that the hepatic uptake of two anionic dyes ( indocyanin green and bromosulfophthalein ) that are non - selective oatp substrates were reduced in acute renal failure rats . the functional and clinical significance of these findings did not become evident until a series of recent investigations showed that inhibition of uptake transport into the liver may explain to a large extent the reduced non - renal clearance observed in ckd patients for several commonly used drugs that are moderately good to high affinity substrates of human hepatic oatps : erythromycin , eprosartan , fexofenadine , and digoxin . the inhibitory mechanism(s ) of hepatic drug uptake was explored to a limited extent in the above referenced studies . incubated normal rat hepatocytes with uremic serum drawn from patients with esrd and showed a 29% decrease in oatp1a4 expression and a 37% increase in p - gp expression in rat hepatocytes exposed to uremic serum compared with those exposed to healthy serum ; the effect on oatp is consistent with the in vivo finding of a 63% decrease in the oral clearance of fexofenadine . a subsequent in vitro investigation with digoxin by tsujimoto et al . also yielded similar findings it would be important to replicate these findings in human hepatocytes since the complement of human sinusoidal oatps ( oatp1b1 , oatp1b3 , and oatp2b1 ) are not functional orthologs of rat sinusoidal oatps . it is also relevant to note that among the various anionic uremic toxins tested , 3-carboxy-4-methyl-5-propyl-2-furanpropionic acid ( cmpf ) was consistently shown to be the most potent inhibitor of roatp or hoatp for the uptake of erythromycin , eprosartan , and digoxin , with a ki in the order of 20 to 50 m , which is within the plasma concentration range reported in uremic patients ( median 254 m , maximum 392 m ) . another uremic constituent , p - cresol it is important to recognize that sinusoidal uptake transport and intracellular processing by hepatocellular metabolism and canalicular secretion into bile are coupled kinetic processes ; moreover , either or both transport and metabolic steps can be altered by uremia to produce the net effect of reduced hepatic clearance . hence , in vitro modeling of functional disruption of hepatocellular processes must be evaluated in a cell - based system that maintains the coupling of transport at the sinusoidal membrane and enzymatic function at the endoplasmic reticulum . all in vitro studies conducted to date in this area have used hepatocytes isolated from rat or human livers and maintained in short - term , conventional monolayer culture ; as a result , the hepatocytes do not retain cell polarity ( i.e. , sinusoidal versus canalicular membrane domain ) and rapidly de - differentiate . over the past decade , the sandwich - cultured human hepatocyte model ( sch ) has gained favor in order to study the complex interplay between metabolic enzymes and transporters . when cultured on a substrate of biocoat with an overlay of matrigel or collagen , primary hepatocytes develop a cuboidal three - dimensional structure with intact bile canaliculi and proper localization of efflux transporters ( e.g. , oatps , p - gp , mrps , and concentrative / equilibrative nucleoside transporters ) , while maintaining functional metabolic enzymes ( e.g. , cyps , udp - glucuronosyltransferases ) . this system features the connecting between sinusoidal uptake , intracellular metabolism , and efflux into the bile canaliculi , and allows assessment of the net effects of these sequential processes on heaptic drug processing . exposing sch to uremic serum or its derived fractions could provide a more realistic in vitro model for investigating the alterations in drug metabolism and transport observed in ckd patients . an emerging novel approach to enhancing in vitro tissue or organ system models relevant to altered drug metabolism microphysiological systems utilize microfluidic technologies , can incorporate three dimensional architecture and mimic physiological fluid shear stress . these microphysiological systems frequently use human cell sources to overcome concerns about species differences in drug transport and metabolism . human microphysiological systems are currently under development at the university of washington and other institutions , and should expand our ability to explore the interactions between kidney disease and hepatic drug metabolism and transport . microphysiological systems can also feature microvascular endothelial cells and perivascular cells cultured on a 3-dimensional scaffold that form luminal or microvasular structures ; hence , the systems can recapitulate normal perfusion flow and the resulting physiological dynamics of solute transport . it is conceivable that eventually we will be able to capture the impact of impairment in kidney function on hepatocyte function through coupling of vascularized microphysiological systems based on human kidney and liver . great strides have been made in understanding the effects of ckd on drug disposition in the past 15 years , particularly on how uremia affects hepatic drug metabolism and coupled transport . nonetheless , as highlighted in this review , important questions remain regarding the underlying uremic mechanisms . until we fully understand uremia s impact on drug metabolism and transport at the cellular and molecular level , it will be difficult to develop a rational strategy for drug dosing in the ckd population . it is also clear that progress will depend on the application of novel techniques and methodologies to delineate the complex and multiplex details of uremia s effect on the drug disposition system ." ]

[ "in this article we will use the term variable number tandem repeat ( vntr ) to encompass both microsatellites and minisatellites however not all tandem repeat domains are polymorphic in repeat copy number .", "sva elements only represent 0.13% of the genome , representing ~2700 elements , constituting the youngest of the retrotransposable elements in the human genome and are hominid specific . they consist of a hexamer repeat ( ccctct ) , an alu - like sequence , a gc - rich vntr , a sine and a poly a - tail as with other retrotransposons much effort has been expended on the retrotransposition event itself giving rise to disease . this has resulted in the identification of at least 8 well characterized diseases in which the retrotransposition event has caused the disease , in the majority of cases by affecting alternative slicing", "our hypothesis is that the sva element could impart a hominid specific regulatory twist on regulation of the gene in which they have inserted ( assuming that insertion is not in an exon or destroys intron / exon boundaries etc ) . in the promoter they would act as classical mediators of gene expression . analysis of human genome release 19 ( hg19 ) indicates that of the 2676 sva elements in the human genome , 433 are present within 10 kb 5 of the main transcriptional start site 1 . sva elements are functional in conventional reporter gene assay both in vitro ( cell line ) and in vivo ( chick embryo ) 2 . sva elements are polymorphic , most clearly via vntr domains ( flanking and internal ) a. we have previously shown in other genes ( as have many others ) that vntrs are both polymorphic biomarkers associated with disorders and transcriptional regulatory domains in vivo and in vitro b. vntrs are common regulatory domains in viruses ; i. they in part control hsv-1 virus latency in dorsal root ganglia ( via a similar cccctc repeat to that found in the flanking sequence of the sva element ) ii . sva elements can be associated with active chromatin adjacent to : a. positive affymetrix probe arrays in the human cns b. encode active histone marks 4 . sva elements have the potential to form structures which may be strong modulators of genome structure / function : a. potential g4 quadruplex b. strong cpg component approaching the classical requirements to be defined as cpg islands , which is consistent with their differential methylation in tumors", "in our analysis of the fus sva element we generated reporter gene constructs that were analyzed in both the neuroblastoma cell line , sk - n - as and a chicken embryo model the distance of the sva element from its site of action on a specific promoter or transcriptional start site can be quite large . it has been demonstrated by us and others when attempting to reproduce endogenous gene expression in transgenic models , that regulatory domains utilized by a locus can be 100kb+ away from the gene itself . our own studies on the endogenous expression of the neuropeptide , substance p encoded by the tac1 gene demonstrated that although the gene itself from 5 to 3 utr was 8 kb , we required a dna fragment of 350 kb to reproduce the appropriate expression patterns the recent evolution of sva elements has imposed restricted sequence variation in each of the sva subclasses ; this may allow a concerted response to challenge by groups of sva elements with similar primary sequence based on sequence specific dna binding proteins . in this manner it might be possible for sva elements containing similar primary sequence such as is present in the hexamer repeat or central vntrs to bind similar transcription factors based on shared consensus dna binding domains . thus alterations in active transcription factor complement in the cell might modulate several sva elements by the same signal transduction pathways .", "the frequency of sva element retrotransposition is estimated to be 1:916 births which would correspond to 7 10", "our recent work suggests that sva elements can in part modulate genome function via their action as a transcriptional or epigenetic modulator . polymorphism in the vntrs within these retrotransposons demonstrates a mechanism not only for differential regulatory function associated with genotype but a way to rapidly integrate polymorphism in the sva element as a potential biomarker for disease association without the requirement for retrotransposition ." ]

[ "bicycle riding is popular throughout the world for transportation , recreation , sports , and health - related benefits . 53% are men . in korea , according to the needs of the times , such as economic development and increased leisure time , a trend for preferring environmentally friendly sports , and growing interest in health and well - being , the awareness of cycling as a leisure sport has recently increased . there were 24,406 recreational bicycle riders in 911 bicycle clubs in korea as of january 2010 . bicycling is an ideal form of aerobic , nonimpact exercise with established protective cardiovascular effects and a beneficial influence on the risk of hypertension , diabetes , and stroke . although there are controversies about changes to the genitourinary system in subjects who cycle , bicycle riding has been known as a common source of acute traumatic injuries as well as overuse injuries [ 4 - 6 ] . bicycling studies suggest perineal trauma , pressure , or both may have a role in these genitourinary hazards . many of them directly affect the genitourinary tract , causing genital numbness , erectile dysfunction ( ed ) , priapism , infertility , hematuria , and effects on serum prostate - specific antigen ( psa ) levels . many healthy recreational bicycle riders have questioned urologists about the relationship between bicycle riding and prostate - related lower urinary tract symptoms ( luts ) . but to the best of our knowledge , there has been no study of luts in male recreational bicyclists . with this study , our goal was to evaluate the impact of bicycle riding on luts and sexual dysfunction in men with the use of amateur marathoners as a control group of physically equivalent individuals with a low level of perineal pressure or trauma .", "a total of 22 healthy male amateur bicycle riders from two bicycling clubs in jeonju , korea , were studied . the recruitment criteria were age between 40 and 50 , bicycling period of more than 1 year before the study , three or more times of cycling per week , and 30 minutes or more of cycling duration per time . the controls were 17 healthy male marathoners from an amateur marathon club in jeonju , korea . , all subjects were informed about the experimental procedures , which were in accordance with the ethical standards of chonbuk national university hospital , and were required to give written informed consent . the evaluation contained a study questionnaire assessing sports participation habits , urological and medical history , the international prostate symptom score ( ipss ) , the international index of erectile function ( iief ) , the international continence society ( ics ) male questionnaire - short form , the overactive bladder symptom score ( oabss ) , and the premature ejaculation diagnostic tool ( pedt ) . an ipss of more than 7 defined the voiding dysfunction ( vd ) group , and erectile ed was defined as a score of 21 or less on the iief-5 , an abridged 5-item version of the iief-15 , which ensured identification of the mildest forms of ed . furthermore , we examined serum total prostate - specific antigen ( tpsa ) , free prostate - specific antigen ( fpsa ) , uroflowmetric values , postvoid residual ( pvr ) urine volume , and transrectal ultrasound ( trus , b&k medical , herlev , denmark ) of the prostate in all subjects . chicago , il , usa ) . to test differences between the two groups in serum tpsa , fpsa , uroflowmetric values , pvr urine volume , calculated volume of the prostate using trus , and the total or subscale score of each questionnaire , we used independent - sample t - tests with statistical significance as p<0.05 . also , we compared the two groups for the prevalence of vd and ed by using the chi - square or fisher 's exact tests with statistical significance as p<0.05 .", "a total of 22 healthy male amateur bicycle riders from two bicycling clubs in jeonju , korea , were studied . the recruitment criteria were age between 40 and 50 , bicycling period of more than 1 year before the study , three or more times of cycling per week , and 30 minutes or more of cycling duration per time . the controls were 17 healthy male marathoners from an amateur marathon club in jeonju , korea . , all subjects were informed about the experimental procedures , which were in accordance with the ethical standards of chonbuk national university hospital , and were required to give written informed consent .", "the evaluation contained a study questionnaire assessing sports participation habits , urological and medical history , the international prostate symptom score ( ipss ) , the international index of erectile function ( iief ) , the international continence society ( ics ) male questionnaire - short form , the overactive bladder symptom score ( oabss ) , and the premature ejaculation diagnostic tool ( pedt ) . an ipss of more than 7 defined the voiding dysfunction ( vd ) group , and erectile ed was defined as a score of 21 or less on the iief-5 , an abridged 5-item version of the iief-15 , which ensured identification of the mildest forms of ed . furthermore , we examined serum total prostate - specific antigen ( tpsa ) , free prostate - specific antigen ( fpsa ) , uroflowmetric values , postvoid residual ( pvr ) urine volume , and transrectal ultrasound ( trus , b&k medical , herlev , denmark ) of the prostate in all subjects .", "chicago , il , usa ) . to test differences between the two groups in serum tpsa , fpsa , uroflowmetric values , pvr urine volume , calculated volume of the prostate using trus , and the total or subscale score of each questionnaire , we used independent - sample t - tests with statistical significance as p<0.05 . also , we compared the two groups for the prevalence of vd and ed by using the chi - square or fisher 's exact tests with statistical significance as p<0.05 .", "a total of 22 recreational bicyclists ranging in age from 42 to 57 years completed the questionnaires and were included in the assessment . the riders had cycled for a period of 1 to 10 years ( range , 4.052.04 years ) , 3 to 6 times per a week ( range , 4.231.19 times ) , and with 60 to 240 minutes of cycling duration per time ( range , 9159 minutes ) . the subjects ' body mass index ( bmi ) ranged from 22.8 to 34.6 kg / m ( range , 25.92.67 kg / m ) . there were no significant differences between the two groups in age , bmi , comorbidities , or exercise habits ( table 1 ) . there were no significant differences in the total and subscale scores of the ipss between the two groups . the prevalence of vd on the basis of the ipss was not significantly different between the two groups ( 8/22 vs. 4/17 , p=0.494 ) . there were no significant differences in total and subscale scores of the iief between the two groups . the prevalence of ed based on the iief was not significantly different between the two groups ( 11/22 vs. 10/17 , p=0.748 ) . also , we found no statistical differences in other questionnaires such as the oabss , ics male questionnaire - short form , and pedt ( table 2 ) . as shown in table 3 , there were no significant differences between the two groups regarding uroflowmetric parameters such as peak urinary flow rate ( qmax ) , voided urine volume , or pvr urine volume . in all subjects , prevoid urine volume was at least 150 ml and voided urine volume was at least 125 ml . in the cyclists , the mean calculated volume of the prostate by trus was 23.32 cc and there was no statistically significant difference between the two groups ( 23.32 vs. 23.71 , p=0.848 ) . also , the serum tpsa level was within the normal range in all subjects and there was no significant difference between the two groups ( 0.800 vs. 0.888 , p=0.470 ) . the prevalence of a significantly low qmax , excess pvr , or benign prostatic hyperplasia was not significantly different between the two groups ( table 3 ) .", "the most common bicycling - associated urogenital problems are nerve entrapment syndromes presenting as genitalia numbness , which was reported in 50% to 90% of cyclists , followed by erectile dysfunction in 13% to 24% . other less common symptoms include priapism , penile thrombosis , infertility , hematuria , torsion of the spermatic cord , prostatitis , perineal nodular induration , and elevated psa , which are reported only sporadically . bicycle riding is used throughout the world for well - known exercise , fitness , and recreational benefits . as such , it is not surprising that these statements have created much controversy . in our study population , we investigated in particular the relationship between bicycle riding and luts or sexual dysfunction by use of questionnaires ; thus , we did not ask the study group about complications such as genitalia numbness . to date recently , saka et al reported that bicycle riding has no impact on serum psa levels and urinary flow parameters . the goal of their study was to investigate whether professional bicycle riding altered plasma concentration of tpsa , fpsa , percent free psa ( f / t psa ) , and urinary flow parameters in healthy men . we present a cross - sectional study of the effects of bicycle riding , a sport with perineal impact , on genitourinary function in men . in our study , the subjects were amateur recreational bicycle riders from clubs , and we aimed to find any hazards of bicycle riding in male luts or sexual dysfunction . our hypothesis was that if bicycle riding had any impact on the genitourinary tract there would be significant differences in genitourinary functional parameters between a regular long - term bicycle - riding group and control group of physically equivalent individuals with a low level of perineal pressure or trauma , such as a regular long - term marathon running group . however , there were no significant differences between the two groups regarding the questionnaires , uroflowmetric parameters , pvr urine volume , prostate volume , or serum psa level . thus , we found the inverse of our hypothesis : that bicycle riding may have no hazardous impact on genitourinary health in recreational male bicycle riders . the prevalence of luts or vd as defined by an ipss of 8 was not significantly different between the two groups . physical activity has been documented to be protective against luts in previous studies , and the perineal impact of bicycle riding does not seem to offset that effect . many of the bicyclists enrolled were very energetic and confident of their health , and there were no significant differences in the uroflowmetric analysis results , trus - measured prostate volume , or serum psa level . bicycle - riding - induced perineal impacts do not have enough influence on the prostate mechanically or physiologically . previous reports about the effect of bicycling on serum psa concentrations were not conclusive , but in recent studies the dominant finding was that there was no statistically or clinically significant change in psa levels regardless of cycling [ 7 - 12 ] . no other published data have compared questionnaires evaluating luts , uroflowmetric analysis results , or trus - measured prostate volume of regular long - term amateur bicycle riders with a control group of physically equivalent individuals with a low level of perineal pressure or trauma such as a regular long - term runner group . previous studies have reported an association between bicycling and sexual dysfunction , but those studies were based on biological measurements such as penile blood flow , focused on sexual dysfunction after prolonged exposure to perineal impact , or suggested a trend but no strong association . the results of our study support the observation of others that bicycle riding has no effect on luts and male sexual function . first , the cross - sectional study structure may have affected the validity of the results . we did not collect baseline data about luts and sexual dysfunction parameters before activity from either group . we implemented a cross - sectional study design as an efficient and cost - effective investigation to perform a preliminary exploration for an association with the potential to generate additional hypotheses for more structured research . second , the small number of subjects may have introduced some selection bias into the results . however , we suspect that the influence of the bias may be weak because almost all of the 5th and 6th decades of each club participated in our study . we plan to do vertical , annual follow - up studies of the subjects . the fact that the results of our study are consistent with data from other studies in similar sports supports the validity of our results and decreases the chance of systemic errors . more assessment of the effect of bicycle riding on the human pelvic anatomy and genitourinary complaints is warranted to further validate the results of this study .", "concern about bicycle riding as a leisure sport has recently increased as many urological outpatients and healthy recreational bicyclists have questioned urologists about the relationship between bicycle riding and prostate - related luts and sexual dysfunction . in our opinion , bicycle riding seems to have no statistically measurable effect on luts or sexual functioning in men , at least in amateur recreational bicyclists . there is a need for further large - scale research on this subject and study of the underlying mechanisms leading to cycling - related luts and sexual dysfunction ." ]

[ "however , it is difficult to determine an appropriate resection line using only the laparoscopic approach . for more appropriate resection , laparoscopic and endoscopic cooperative surgery ( lecs ) on the other hand , gastric plexiform angiomyxoid myofibroblastic tumor ( pamt ) has recently emerged as a new entity among gastrointestinal mesenchymal tumors which was first described by takahashi et al . in 2007 . this is a rare tumor with equal gender distribution and occurs primarily in adults with a wide age range of 783 years [ 3 , 4 ] . however , the bland nuclear features , low proliferative index and absence of necrosis , vascular invasion , recurrence and metastasis in all cases of pamt reported to date justify its characterization as a benign tumor . suggested that vascular invasion and extragastric extension of the tumor were not typically observed in pamt . currently , distal or partial gastrectomy remains the treatment of choice . to our knowledge ,", "a 39-year - old male patient visited our hospital because of epigastric pain . in an upper gastrointestinal endoscopy examination , gastroscopy revealed a 3.5 3.0 cm sessile polypoid mass with a smooth surface in the anterior wall of the gastric antrum with a recessed area . we considered that this tumor was located in the muscle layer ( fig . 1 ) . the ct scan showed a heterogeneous tumor in the gastric antrum , which was drastically enhanced with contrast medium , and consisted of a number of highly stained small nodules around the tumor rim ( fig . 2 ) . radiological imaging suggested differential diagnoses of angioma and solitary fibromyxoma because of the hypervascular nature of the tumor . however , because the tumor did not protrude into the lumen of the stomach , these diagnoses were unlikely .", "lecs combines laparoscopic gastric resection with endoscopic imaging for tumor location and determining an appropriate resection line . aggregations of small polypoid nodules , red - colored and angiomatous , were characteristically seen on the serous membrane surface , and appeared like a metastatic lymph node nodule ( fig . first , we located the tumor and cut the surrounding mucosa of the lesion by endoscope . we perforated the gastric wall at the distal side of the tumor using needle knife without injuring the pylorus . next , the seromuscular layer was dissected laparoscopically with an ultrasonically activated device tracing the mucosal line cut . a partial gastrectomy by lecs revealed the tumor at the antrum of the greater curvature side of the stomach , and the incision line was closed on suturing by layer - to - layer anastomosis . the tumor was composed of bland spindle cells which were separated by abundant myxomatous stroma and showed plexiform growth in the entire stomach wall ( fig . the tumor cells were negative for cd117 ( c - kit ) , cd34 and s-100 protein , but diffusely positive for smooth muscle actin consistent with predominant myofibroblastic differentiation ( fig . the tumor was especially characterized by multiple nodules protruding outward from within the serosa , and we diagnosed the patient with pamt . the patient received supportive care without any specific medication during hospitalization and had no recurrence or metastasis during follow - up for 9 months after the surgery .", "pamt is a rare mesenchymal tumor of the stomach , which consists of spindle cells with myofibroblastic characteristics . estimated that the frequency of pamt is less than 1/150 that of gastrointestinal stromal tumor , but only 28 cases of pamt have been reported , including the present case . the prevalence of pamt does not vary by sex ( m : f = 1 : 1 ) and it can develop at any age ( range : 783 years ) . there are few reports describing the ct findings for pamt [ 2 , 7 ] . they reported that ct findings of tumor location in the gastric antrum , a heterogeneous internal enhancement effect , and small nodules with a strong enhancement in the rim could be used for radiologic diagnosis of pamt . in our case , all three ct findings were evident . pamt is considered a benign tumor . however , due to its rarity , the true biological potential of pamt remains unknown . so , complete resection when functional preservation is possible is appropriate . on the other hand , lecs is the best procedure for complete resection while preserving the pylorus because of the gastric antrum of predilection for pamt . to our knowledge ,", "when a myxoid spindle cell lesion is observed in endoscopic biopsy or when there are characteristic ct findings , pamt should be included in the differential diagnosis .", "", "" ]

[ "myelodysplastic syndromes ( mdss ) represent a group of clonal hematological disorders characterized by progressive cytopenia reflecting defects in erythroid , myeloid and megakaryocytic maturation . anemia , neutropenia and thrombocytopenia , separated or in combination , despite a hyper- or normocellular marrow define mds . hypoplastic mds ( h - mds ) accounts for 1217% of all patients with mds . clonality studies of mature blood cells and immature progenitors suggest that a myeloid lymphoid stem cell might be the principal target for clonal transformation at least in a major part of mds . an association between mds and autoimmune disorders and with chronic t - cell disorders like large granular lymphocytic leukemia ( lgl ) has been recognized and is suggestive of an abnormal functioning immune system in mds . lymphoproliferative disorders , especially t - prolymphocytic leukemia ( pll ) developing in an h - mds patient , is extremely rare and has an aggressive course . we are reporting a unique case of t - pll developing in h - mds , and this is probably the first case report in the literature .", "a 45-year - old male was admitted with generalized weakness , palpitation , gradual weight loss and frequent syncopal attacks for more than 2 years . on examination , the iron profile was : serum iron 115.50 g / dl , total iron binding capacity 177.10 ng / ml and markedly elevated b12 levels ( > 2000 pg / ml ) . hemoglobin was 3.9 gm% , total leukocyte count was 2100 cells / cumm , platelet count was 70,000 cells / cumm and reticulocyte count was 0.8% at the time of admission . pancytopenia [ figure 1a ] was persistent on every visit and the peripheral smear showed normocytic and macrocytic rbcs , leukopenia , hypogranular and pseudo pelger - huet neutrophils [ figure 1b and 1c ] , which were characteristic with relative lymphocytosis and no blasts in the peripheral smear ; the platelet count was reduced . the bone marrow aspiration smears and cell block preparation showed severe hypocellularity ( < 20% for his age ) [ figure 1d ] . sparse erythroid cells with dyserythropoiesis [ figure 2a and 2b ] , minimal dysmyelopoietic ( hypogranular and hyposegmented myeloid cells - 10% ) and dysmegakaryopoietic ( hypolobated and micromegakaryocytes [ figure 2c and 2d ] features were evident with blasts < 5% and absence of fibrosis in biopsy sections . the possibility of aplastic anemia and hypoplastic acute myeloid leukaemia ( h - aml ) were ruled out . a diagnosis of primary h - mds was made in the absence of chemotherapy and radiotherapy . the patient was transfusion dependent and later started on thalidomide . on follow - up within few months , because of persistent pancytopenia , the patient was subjected for repeat bone marrow study , where the smear and section showed cellular marrow with diffuse infiltrate of mature lymphocytes ( 60% ) [ figure 3a and b ] with no evidence of improved hematopoiesis . the neoplastic cells showed a mature t - cell immunophenotype , cd3 + , cd4 + , cd5 + , cd7 + and cd8 + , and tdt- , cd20- , cd23- , cd79a- , cd34- , bcl2- and cyclind1- , and was diagnosed as t - pll . ( d ) hypocellular marrow - cell block preparation h and e , 10 ( a ) dyserythropoiesis with multinucleation in bma . ( c ) dysmegakaryopoiesis - cell block h and e , 40. ( d ) dysmegakaryopoiesis bma ( a ) lymphoid infiltrate in bma .", "the diagnosis may be difficult in h - mds if the aspirate is so sparsely cellular as to preclude cytogenetic studies . significant clonal cytogenetic abnormalities are present in only half of all mds cases , and full karyotype analysis , which requires cells in metaphase , may not be possible because cells may be scarce or senescent . we encountered similar problems when there was hypocellular marrow , but later , when diagnosed as t - pll , the marrow culture showed a normal karyotype . there is growing scientific evidence supporting the hypothesis that cytogenetic abnormalities are not the initiating clonal event but are acquired during disease progression . h - mds has yet to be shown to alter the disease course or prognosis , but some studies suggest benefit from immunosuppressive therapeutics . it is presently unknown whether h - mds patients have a preceding , but unrecognised , phase of excessive apoptosis insufficiently compensated by hyperproliferation , or whether their disease is more related to aplastic anemia . several years ago , in vitro studies have proven that autologous cytotoxic t - lymphocytes can exert an inhibitory effect on mds myelopoiesis . an association between mds and autoimmune disorders and with chronic t - cell disorders like lgl has been recognized and is suggestive of an abnormal functioning immune system in mds . but , occurrence of t - pll in h - mds is extremely rare and , possibly , this is the first case in the literature . the immunophenotype is that of mature t - cell , which is usually cd4 + but , occasionally , can be cd8 + , which was evident in our case . expression of cd7 helps to distinguish it from other clpds , like sezary syndrome and adult t - cell leukemia / lymphoma . to conclude , the finding of activated and clonal t - cell population in mds is further argument for the use of immunosuppression to treat the cytopenias of mds ." ]

[ "intracranial foreign bodies via the transorbital route are rare.1 amongst cases of transorbital intracranial injury , projection of the foreign body through the superior orbital fissure occurs in an estimated 68% and damage typically occurs to the brainstem , cavernous sinus , or temporal lobe.2 introduction of a foreign body via the orbit can occur either via missile projection or via stab injury , and the trajectory into the brain may be related to the mechanism of injury.23 obtaining a thorough history and establishing a high level of suspicion for these types of injuries when periorbital trauma is found on physical exam is important , as in the case of missiles the patient may be unaware that a foreign body was retained24 and stab injuries may be associated with psychiatric illness that may limit reliable history . 567 here we describe a unique foreign body within the brain : the bristled end of an electric toothbrush , which entered the parenchyma of a patient 's right temporal lobe as a projectile through the medial orbit . the case is framed here in a description of the radiographic findings as a function of the mechanism of injury relative to similar cases , the surgical decision making involved in safe extraction of intracranial foreign bodies via modern modified skull base technique , and considerations for antibacterial prophylaxis .", "a 35-year - old woman employed as a dental hygienist was transferred from an outside facility to our level - one trauma center after presenting with a foreign body in her right orbit . she reported that while at home the prior evening , she was in the bathroom with her husband who became enraged when his electric toothbrush failed to work properly , and that he threw the device at a nearby wall . the toothbrush ( sonicare ; philips , andover , massachusetts , usa ) reportedly shattered into numerous pieces upon impact with the wall and one of these flew directly into the patient 's right medial orbit . she stated that in addition to pain , initially she had blurred but not absent vision in the right eye . at the time of presentation to our institution , her eye had swollen shut and she complained of constant , severe aching pain in her right eye and a bilateral headache that radiated to the back of her neck . at the outside facility the patient was medicated for pain and given piperacillin / tazobactam ( zosyn , pfizer , new york , new york , usa ) , and a computed tomography ( ct ) scan of the head and a ct angiogram ( cta ) were obtained , as were basic serum laboratories . on examination at our institution the patient had stable vital signs ; she had a glasgow coma scale ( gcs ) of 15 and was in moderate distress . her right eyelid was swollen shut , and there was no obvious external foreign object visible . there was a small curvilinear laceration just below her medial canthus , and her lacrimal punctum were intact .", "a cta and a thin - cut ct scan of the head were obtained prior to surgery for surgical planning and neuronavigational purposes ( fig . a foreign body with visible bristles consistent with the head of the toothbrush was visualized entering medially to the globe , traveling through the superior orbital fissure ( sof ) , and breaking through the greater sphenoid wing into the middle fossa with a laterally displaced fragment and ending in the anterior temporal lobe ( fig . the optic canal was intact ; however , the shaft of the toothbrush head did appear to touch the optic nerve . preoperative computed tomography ( ct ) and computed tomography angiography ( cta ) with toothbrush violating the right middle fossa . ( a ) axial ct with fracture through the right sphenoid bone with toothbrush bristles visible . ( d ) lateral cta showing proximity of foreign body to right middle cerebral artery ( mca ) bifurcation . after neurosurgery service evaluation , ophthalmology was consulted and the decision was made to perform urgent surgical extraction of the foreign body . the patient was consented for a modified frontotemporal orbitozygomatic craniotomy with extraction of the intraorbital and intracranial portions of the toothbrush . in the operating room a curvilinear incision was made behind the hairline from the root of the zygoma curving gently toward the contralateral mid - pupillary line . a two - piece supraorbital modification of the orbitozygomatic approach was performed as described previously8 by drilling three bur holes one at the mccarty keyhole , one in the inferior squamous bone , and one in the posterior frontal calvarium . these were connected with a foot - plate drill to create a pterional craniotomy , and the drill was also used to extend the craniotomy anteriorly to the edge of the orbital bar . a reciprocating saw was used to score a sagittal cut through the orbital rim lateral to the supraorbital foramen and then a coronal cut medial to lateral along the anterior skull base toward the superior orbital fissure , as well as a lateral cut just lateral to the frontozygomatic suture down to the superior orbital fissure . the sphenoid wing was drilled down and the lateral orbital wall was partially taken down to the superior orbital fissure to further decompress the orbit ( fig . 3b ) . the temporal lobe could then be elevated , and the skull base followed toward the superior orbital fissure until the bristles of the toothbrush head could be located ( fig . the sphenoid was then drilled laterally to the trajectory of the foreign body until there was sufficient space to mobilize the toothbrush ( fig . 3c ) . when the head of the toothbrush was freed and mobile it was pulled posteriorly while simultaneously maintaining pressure on the toothbrush shaft to keep it pressed down against the skull base to help prevent additional friction on the optic nerve ( fig . ophthalmology measured the intraocular pressure immediately before ( 19 mm hg ) and after surgical treatment ( 8 mm hg ) . ( d ) distal end of toothbrush fragment exiting middle fossa ( note downward pressure being placed to keep it against the skull base and preventing further damage to optic nerve ) . her vision remained 20/400 throughout her 3-day hospitalization , and limited lateral rectus function was noted . our infectious disease team was consulted for recommendations for antibiotic coverage for intraparenchymal oral flora . she was also evaluated by our social work service and was deemed safe to return home with her husband . two weeks postictus , the patient noted improving pain and improving vision ( 20/50 ) . since the event she had quit her job as a dental hygienist", "after neurosurgery service evaluation , ophthalmology was consulted and the decision was made to perform urgent surgical extraction of the foreign body . the patient was consented for a modified frontotemporal orbitozygomatic craniotomy with extraction of the intraorbital and intracranial portions of the toothbrush . in the operating room a curvilinear incision was made behind the hairline from the root of the zygoma curving gently toward the contralateral mid - pupillary line . a two - piece supraorbital modification of the orbitozygomatic approach was performed as described previously8 by drilling three bur holes one at the mccarty keyhole , one in the inferior squamous bone , and one in the posterior frontal calvarium . these were connected with a foot - plate drill to create a pterional craniotomy , and the drill was also used to extend the craniotomy anteriorly to the edge of the orbital bar . a reciprocating saw was used to score a sagittal cut through the orbital rim lateral to the supraorbital foramen and then a coronal cut medial to lateral along the anterior skull base toward the superior orbital fissure , as well as a lateral cut just lateral to the frontozygomatic suture down to the superior orbital fissure . the sphenoid wing was drilled down and the lateral orbital wall was partially taken down to the superior orbital fissure to further decompress the orbit ( fig . 3b ) . the temporal lobe could then be elevated , and the skull base followed toward the superior orbital fissure until the bristles of the toothbrush head could be located ( fig . the sphenoid was then drilled laterally to the trajectory of the foreign body until there was sufficient space to mobilize the toothbrush ( fig . 3c ) . when the head of the toothbrush was freed and mobile it was pulled posteriorly while simultaneously maintaining pressure on the toothbrush shaft to keep it pressed down against the skull base to help prevent additional friction on the optic nerve ( fig . ophthalmology measured the intraocular pressure immediately before ( 19 mm hg ) and after surgical treatment ( 8 mm hg ) . ( d ) distal end of toothbrush fragment exiting middle fossa ( note downward pressure being placed to keep it against the skull base and preventing further damage to optic nerve ) . her vision remained 20/400 throughout her 3-day hospitalization , and limited lateral rectus function was noted . our infectious disease team was consulted for recommendations for antibiotic coverage for intraparenchymal oral flora . she was also evaluated by our social work service and was deemed safe to return home with her husband .", "two weeks postictus , the patient noted improving pain and improving vision ( 20/50 ) . since the event she had quit her job as a dental hygienist .", "the neurosurgical literature contains an abundance of reports of foreign bodies that have entered the cranial vault via the sof . penetrating traumatic injury of the brain via the skull is relatively uncommon , representing 0.4% of traumatic head injuries,9 and though the transorbital route certainly represents only a small fraction of these injuries , descriptions of foreign bodies entering the brain via the sof are especially interesting as it is second in size only to the foramen magnum as a route to the brain that can be traversed without bony fracture . protection of the brain within a strong bony enclosure is an extremely conserved feature of vertebrate evolution ; therefore , brain injuries that bypass this guard highlight a chilling vulnerability to relatively low force mechanisms . this report adds not only another novel man - made object to the list of those that have entered living human brain , but also draws attention to a unique trajectory and mechanism of insertion as well as approaches to surgical management and considerations for prevention of infection . reports of toothbrush injury upon the brain are rare . excluding reports of nonpenetrating toothbrush - induced seizures,1011 there is only one report of a toothbrush handle entering the brain.12 in that case the handle end entered the sof and terminated in the medial middle fossa ; the bristled end of the brush , however , remained well outside of the orbit . although there has been a prior report of the bristled end of a toothbrush entering the medial orbit,13 the brush in that case avoided the sof and ended up extracranially in the ethmoid sinuses . most reports of intracranial foreign bodies that enter through the sof describe objects that approximate a wedge or stylus shape , allowing them to dissect through tissue planes , slide against the orbital walls , and pass through the slitlike sof . examples of these types of foreign bodies include pens and pencils,451214 chopsticks,1516 paintbrush handles,17 and knives.1819 the blunt , widened end of a toothbrush makes for an atypical missile head and warrants special consideration for removal . many reports of intracranial foreign bodies entering via the orbit describe a cautious orbital removal , pulling the object out of the brain via the orbit after appropriate imaging has been obtained . other cases are managed via extensive surgical approaches,18 but even in many of these cases the goal is protection of critical anatomy and reduction of bony obstacles prior to withdrawal of the object via the orbit and repair of dural defects after removal . descriptions of anterograde removal of transorbital intracranial foreign bodies are scarce.320 although the head to shaft ratio of the foreign body described here is considerably less than that of a hunting arrow , the anterograde technique of removing the intracranial foreign body along its trajectory of entry as described by o'neill et al20 was felt to have the lowest risk of additional injury to brain parenchyma , neurovasculature , and the optic nerve in this case , given the enlarged leading end of the toothbrush . the patient 's presentation was consistent with a traumatic sof syndrome ( rochon - duvigneaud syndrome ) , prompting urgent decompression of the sof by removal of the foreign body.21 the orbitofrontal modification of the frontotemporal orbitozygomatic approach used in this case allowed for decompression of the orbit and an improved trajectory , and also allowed the brain to sag away from the temporal skull base , thus minimizing the need for brain retraction while drilling the skull base . the majority of reported transcranial foreign bodies that traverse the sof are introduced in a stabbing fashion , presumably at relatively low velocities . missile - type entry is less common and is believed to be more likely to involve bony fracture rather than simply following the course of the orbital walls into the sof at the orbital apex.23 in this case the lightweight toothbrush head became a projectile missile after it detached from the heavy battery base unit upon impact with a wall . the resultant injury with a trajectory through the sof but with fracture of the medial sphenoid wing was fittingly somewhere in between a low - velocity stab wound where the bony anatomy guides the entire trajectory and a maximal velocity missile injury where the foreign body shows little respect for the bony structures . the trajectory in this case notably fits the zone - entry model outlined by turbin et al2 in which an entry point in the medial inferior aspect of the lower eyelid ( zone 3c ) predicts temporal lobe injury and sphenoid wing injury . this case also serves as testimony to the potentially minimized physical exam findings with transorbital intracranial injuries . if the shaft of the foreign body remains visibly protruding from the orbit , it is likely to garner quite a lot of attention regardless of the true extent of intracranial injury however , as numerous authors have pointed out in similar cases , if the entire object lies behind the plane of the face , the initial physical presentation can mute what may end up being a very drastic intracranial injury . this is perhaps best illustrated in a case where the diagnosis of a transorbital intracranial pen was overlooked until autopsy.5 any foreign body entering the brain parenchyma under unsterile conditions raises a significant concern for cerebritis , meningitis , or abscess formation even after rapid complete extraction of the offending object . in their review of transorbital penetrating injuries , schreckinger et al4 recommended initiation of broad - spectrum antibiotics with good central nervous system ( cns ) availability early on , but admittedly there are no data - supported guidelines for postoperative microbe control . in a 1977 review of 42 cases of retained transorbital intracranial wooden bodies , nearly half of the patients developed intracranial abscess.22 another pre - ct era study described 13 infections in a review of 44 patients ( 30% ) with transorbital intracranial injury.1 importantly however , in 16 of the patients in that group ( 36% ) diagnosis was delayed for more than 24 hours ( most more than 1 week ) . in the modern neurosurgical era , gross total removal should be possible early on in the vast majority of cases and the risk of serious infection considerably lower . even in an era of frequent neuroimaging , it should be noted that a high index of suspicion may be necessary for rapid diagnosis of retained foreign bodies in cases of periorbital trauma . in turbin et al 's more recent 2006 review,2 4 of 21 cases ( 19% ) of occult ( delayed diagnosis ) transorbital intracranial foreign bodies were described as complicated by abscess or meningitis , whereas 1 of 16 cases ( 6% ) of nonoccult injury was described as complicated by abscess . in the case described here , the toothbrush bristles exposed to the oral flora of another individual were introduced into the orbit and brain parenchyma of our patient . used toothbrush bristles are known to harbor an extensive variety of aerobic and anaerobic pathogens originating from cutaneous and oral flora.2324 therefore , despite the lack of evidence supporting postsurgical prophylaxis , at the recommendation of our infectious disease service broad prophylactic coverage with clindamycin and ciprofloxacin for 1 week was considered appropriate .", "we present a unique case of transorbital traumatic brain injury from a bristled toothbrush head projectile . surgical management of transorbital intracranial injury should take into account intraocular pressure , the presence of an orbital apex syndrome or superior orbital fissure syndrome , the potential for additional damage to neurologic or vascular anatomy , and the potential need for bony decompression and dural repair . modern skull base approaches that permit simultaneous orbital decompression with optimal brain exposure and operative trajectories may be well suited to penetrating orbital injuries . attention to the shape of the foreign body and surrounding neurovascular structures should guide whether an anterograde or retrograde ( back out through the orbit ) removal is indicated . although wooden objects have a reputation as potent fomites , bristled oral - care objects should also be regarded as high risk for infection if they violate natural defensive barriers . a multidisciplinary approach to transorbital intracranial injuries is recommended with ophthalmology , neurosurgery , infectious disease , and potentially facial plastics services involved early on in management . given the high incidence of either psychological disease and or violence associated with these types of injuries in the literature , psychiatric or social work consults should be strongly considered as well ." ]

[ "because \n of the therapeutic potential of inhibiting fatty acid amide \n hydrolase ( faah ) for the treatment of pain , inflammatory , or sleep disorders , there is a continuing interest in the development \n of selective inhibitors of the enzyme . the distribution of faah is consistent with its role in regulating \n signaling fatty acid amides including anandamide ( 1a ) and oleamide ( 1b ) at their sites of action ( figure 1 ) . although \n faah is a member of the amidase signature family of serine hydrolases \n for which there are a number of prokaryotic enzymes , it is the only \n well - characterized mammalian enzyme bearing the family s unusual \n ser ser lys catalytic triad . early studies following the initial identification of the \n enzyme \n led to the disclosure of a series of substrate - inspired inhibitors \n that were used to characterize the enzyme as a serine hydrolase . subsequent studies disclosed several classes of inhibitors that \n provide opportunities for the development of inhibitors with therapeutic \n potential . these include the reactive aryl carbamates and ureas that irreversibly carbamylate the faah active site catalytic serine . a second , and one of the earliest classes , is \n the -ketoheterocycle - based inhibitors that bind to faah by reversible hemiketal formation with the active \n site catalytic serine . many of these reversible , competitive inhibitors \n have been shown to be selective for faah versus other mammalian serine \n hydrolases as well as efficacious analgesics in vivo . in these studies , 2 ( ol-135 ) emerged as a potent ( ki = 4.7 nm ) and selective ( > 60300 fold ) prototypical faah inhibitor that induces analgesia \n and increases endogenous anandamide levels . it lacks significant off - site target activity , does not bind cannabinoid \n ( cb1 or cb2 ) or vanilloid ( trp ) receptors , and does not significantly \n inhibit common p450 metabolism enzymes or the human ether - a - go - go \n related gene product ( herg ) . the analgesic effects of 2 are observed without the respiratory depression or chronic dosing \n desensitization characteristic of opioid administration or the increased \n feeding and decreased motor control characteristic of cannabinoid \n ( cb ) agonist administration . it possesses \n a relatively short duration of in vivo activity relative to irreversible \n inhibitors , although further conformational constraints in the c2 \n acyl chain of 2 have provided inhibitors that are not \n only orally active but also exhibit extended durations of in vivo \n activity . activity \n relationship ( sar ) studies on 2 exploring substitution \n of the central oxazole , the c2 acyl side chain , and the central heterocycle , the x - ray characterization of inhibitor - bound complexes defined \n key features that impact inhibitor affinity and selectivity . these include not only the ser241 hemiketal formation with the inhibitor \n electrophilic carbonyl and its interaction with the enzyme oxyanion \n hole but also an unusual ser217-mediated oh h - bond \n to the activating heterocycle and the key anchoring interaction of \n the terminal phenyl group of the c2 acyl chain . the structural studies \n also revealed that cys269 is located adjacent to c5 of the inhibitor \n pyridine substituent , which in turn is engaged in a series of intricate \n interactions in the enzyme cytosolic port . herein , we report results of a systematic study of candidate inhibitors \n containing modifications at the pyridyl c5-position of 2 and related inhibitors that in principle could covalently trap this \n proximal cys269 to provide inhibitors that alkylate or cross - link \n the faah active site . in turn , this could be expected to enhance their \n potency , potentially enhance their selectivity , and extend their in \n vivo duration of action ( figure 2 ) . herein , \n we detail the systematic inhibitor modifications that led to the discovery \n and characterization of such inhibitors and the unexpected trends that the additional strategically placed \n electrophiles display .", "the series 1 analogues \n ( 322 ) were accessed from 5-(tributylstannyl)oxazole 1e(36 ) by stille coupling with the appropriate 2-chloro- or 2-bromopyridine \n ( scheme 1 ) . this was followed typically by \n tbs ether deprotection \n ( bu4nf ) and oxidation of the liberated alcohol with dess martin \n periodinane ( dmp ) to provide the corresponding \n -ketoheterocycles : 3 , 7 , 9 , 14 , and 1822 . the \n remaining inhibitors were accessed by further modification of the \n pyridyl c5 substituent ( scheme 1 ) . the second series , in which the pyridine of 2 is replaced \n with an alkyl linker to the pendant electrophile , was accessed by \n sonogashira coupling of 5-bromooxazole 1f(43 ) with the appropriate alkyne ( scheme 2 ) . the alkyne intermediate was reduced to the corresponding \n alkane with h2 and palladium on carbon or palladium hydroxide . \n this was followed by tbs ether deprotection ( bu4nf ) and \n oxidation of the liberated alcohol with dess martin periodinane \n ( dmp ) to yield the series 2 c5-substituted oxazoles : 23 and 28 . further elaboration of the terminal electrophile \n ( r group ) yielded the remaining compounds : 2427 and 2932 . the initial characterization of the \n candidate inhibitors and their comparison with 2 was \n conducted using purified recombinant rat faah ( rfaah ) expressed in escherichia coli(55 ) at \n 2023 c as previously disclosed . the initial rates of hydrolysis ( > 1020% reaction ) were \n monitored \n using enzyme concentrations below the initially measured ki values by following the breakdown of c - oleamide , \n and ki values were established as previously \n described ( dixon plot ) . series 1 was developed directly on the basis of 2 ( ki = 4.7 nm ) , placing a potential thiol - capturing \n electrophile at the 5-position of the pyridine ring ( 58 , 11 , 12 , 14 , and 1622 ) . thioesters 5 and 16 were expected to be the most straightforward \n traps for the cys269 thiol by thioester exchange . without preincubation \n of the inhibitors with the enzyme , these inhibitors along with their \n precursors ( 322 ) were tested for \n binding and inhibition of rfaah ( figure 3 ) . \n all display potencies similar to 2 , exhibiting ki values in the low nanomolar range . in series \n 2 , the pyridine ring was replaced by an alkyl chain of appropriate \n length capped with the thiol - engaging moiety . as modeled , this flexible \n linker is able to reach through the cytosolic pocket and place the \n potentially reactive electrophile proximal to cys269 . like the series \n 1 inhibitors and without preincubation with the enzyme , all series \n 2 inhibitors exhibited effective faah inhibition with potencies that \n approach or match that of 2 ( figure 3 ) . because the cys269 \n alkylation was expected to be slow relative to the rapid hemiketal \n formation , the time - dependent inhibition of faah was examined . this \n was accomplished by preincubation of the inhibitors with recombinant \n rfaah for a period of 16 h. as previously observed , reversible , \n competitive inhibitor 2 does not display time - dependent \n inhibition of faah , and its ki value remains \n unchanged with the enzyme in contrast , a select \n subset of inhibitors ( 11 , 14 , 17 , and 2022 ) in series 1 exhibited \n significant increases in potency , displaying 220-fold improvements \n in ki over the same time period , consistent \n with slow irreversible inhibition of faah . surprisingly , thioesters 5 or 16 did not exhibit this time - dependent increase \n in enzyme inhibition potency . similarly , chloride 12 was \n found to be relatively nonpotent and insensitive to preincubation \n with the enzyme , whereas the corresponding bromide 11 was initially more potent and exhibited the most pronounced time - dependent \n increase in potency of all inhibitors . both nitrile 7 and its imidate 8 , where the candidate electrophile \n is attached directly to the pyridyl ring , did not display time - dependent \n increases in potency , whereas both the homologated nitrile 14 and its imidate 17 , where a methylene spacer separates \n the electrophile and pyridyl ring , did exhibit increases in potency \n with the enzyme inhibitor preincubation . of the series of inhibitors \n that might be expected to serve as michael acceptors for a thiol conjugate \n addition ( 1822 ) , including the ,-unsaturated \n ester 18 and nitrile 19 , only those bearing \n the weaker activating substituents ( 2022 vs 18 and 19 ) that would be expected to \n react slower and to be intrinsically less reversible displayed the \n exceptionally potent and time - dependent faah inhibition improvements . \n notably and throughout this series , it was not the anticipated electrophiles \n that exhibited the time - dependent inhibition of faah characteristic \n of a slow irreversible inhibitor , but rather it was a less - well - recognized \n alternative ( 14 and 17 vs 16 , 11 vs 12 , and 2022 vs 1819 ) . finally , no \n inhibitor in series 2 that bears the flexible linker to the second \n electrophile displayed the time - dependent increases in potency , indicating \n that the conformationally restricted placement of the second electrophile \n is important to observation of the targeted alkylation . for the inhibitors \n that displayed time - dependent increases in inhibitor potency , enzyme \n activity did not recover after this time period and is indicative \n of irreversible enzyme inhibition . the compounds \n that demonstrated time - dependent improvements in potency were further \n investigated by lineweaver -ketoheterocycle inhibitors including 2 were shown to display well - behaved competitive , reversible inhibition \n kinetics . despite expectations but consistent with the lack of time - dependent \n faah inhibition , lineweaver burk kinetic analysis of thioesters 5 , 16 , and 25 after 3 h preincubation \n with the enzyme confirmed that they also behave as reversible , competitive \n inhibitors , analogous to 2 and related -ketoheterocycle \n inhibitors ( figure 5 ) . thus , despite the expectations \n of a facile transthioesterification with cys269 , the thioesters exhibit \n enzyme inhibition characteristic of reversible inhibitors , suggesting \n that reaction with cys269 does not occur . significantly , thioesters 5 and 25 were \n recovered unchanged from the assay buffer ( 6 h ) and from enzymatic \n assays ( 5 ) , indicating that they are not undergoing chemical \n hydrolysis or transient enzyme adduct formation and subsequent hydrolysis \n under the conditions of the assay . burk kinetic analysis \n of 5 , 16 , and 25 demonstrate \n reversible , competitive \n inhibition . in contrast , the inhibitors \n that demonstrated a time - dependent \n increase in inhibitor potency also exhibited noncompetitive inhibition \n of faah when preincubated with the enzyme for 3 h prior to lineweaver this is expected \n of irreversible enzyme inhibition and consistent with cys269 alkylation \n or addition to the pendant electrophile . in the case of 11 , this entails cys269 thiol nucleophilic displacement of the benzylic \n bromide to provide the corresponding thioether , and its structure \n has been confirmed by x - ray analysis of the inhibitor bound to faah . the noncompetitive enzyme inhibition presumably \n entails thiol nucleophilic addition to the electrophile to provide \n the cys269-linked thioimidate for 14 and 17 , and it presumably involves an apparent irreversible thiol conjugate \n addition to 2022 . interestingly , \n both the ,-unsaturated nitrile 19 and ester 18 , which do not exhibit time - dependent increases in inhibitor \n activity or the potent ki values consistent \n with irreversible inhibition , displayed mixed kinetics , exhibiting \n competitive inhibition at low inhibitor concentrations and noncompetitive \n inhibition at high concentrations . presumably , this indicates that \n the thiol conjugate addition products derived from 18 and 19 are either formed less effectively or , more \n likely , that they may be sufficiently reversible at 23 c to \n less effectively trap cys269 as an apparent irreversible inhibitor \n of the enzyme . burk analysis demonstrates noncompetitive \n faah \n inhibition for ( a ) 11 , ( b ) 14 , ( c ) 17 , ( d ) 20 , ( e ) 21 , and ( f ) 22 . dialysis dilution ( 4 \n c , 18 h , 370-fold ) of the faah - inhibitor mixture following 3 \n h of preincubation with 2 restored full enzyme activity , \n consistent with its reversible enzyme inhibition , whereas the mixtures \n containing 11 , 14 , and 1722 remained relatively unchanged , failing to restore faah \n activity , indicative of irreversible enzyme inhibition under the conditions \n monitored ( 4 c , ph 9 , figure 7 ) . it is \n notable that 14 and 17 ( not shown ) , which \n presumably form a cys269 thioimidate adduct , do not appear to be even \n slowly reversible under these conditions . similarly , 2022 displayed irreversible inhibition of faah , \n consistent with their time - dependent , noncompetitive enzyme inhibition . \n interestingly , dialysis dilution at 4 c also did not restore \n enzyme activity with both the ,-unsaturated nitrile 19 and ester 18 , which do not exhibit time - dependent \n faah inhibition and displayed concentration - dependent mixed competitive / noncompetitive \n kinetics in the lineweaver this \n suggests that their inhibition of faah following the 3 h incubation \n ( 22 c ) is not reversible at 0 c . unfortunately , the reversibility \n of 18 and 19 at 23 c could not be \n established because of the instability of faah at 23 c over \n the dialysis time frame . faah mixtures \n illustrates \n reversible inhibition by 2 and establishes irreversible \n faah inhibition by 11 , 14 , and 1722 . after 3 h preincubation of purified recombinant \n rat faah with compounds at concentrations that result in inhibition \n of ca . 80% enzyme activity ( 22 c ; 3 h ; 100 nm , 2 ; 80 nm , 11 and 14 ; 100 nm , 18 and 19 ; 150 nm , 20 ; and 80 nm , 21 and 22 ) , and following measurement of residual enzyme \n activity , dialysis dilution ( 4 c , 18 h , 370-fold dilution ) of \n the mixtures resulted in nearly full recovery of enzyme activity for 2 but little or no recovery of enzyme activity for 11 , 14 , and 1722 under \n the conditions monitored ( 4 c , ph 9 ) ; conducted in triplicate \n and reported as the percent enzyme inhibition sd . the selectivity \n of the time - dependent , \n irreversible faah inhibitors 17 and 2022 were examined along with 11 and 14 that were recently disclosed using \n activity - based protein profiling ( abpp ) of the serine hydrolases . abpp methods permit the testing of serine hydrolases \n in their native state and eliminate the need for their recombinant \n expression , purification , and the development of specific substrate \n assays . because inhibitors are screened against many enzymes in the \n proteome in parallel , both relative potency and selectivity can be \n simultaneously evaluated . previous studies have shown that the -ketoheterocycle \n class of inhibitors are selective for faah , although four enzymes \n have emerged as potential competitive targets : triacylglycerol hydrolase \n ( tgh ) , hydrolase containing domain 6 ( abhd6 ) , monoacylglycerol \n lipase ( magl ) , and the membrane - associated hydrolase kiaa1363 . each \n inhibitor was tested for its effects on the fluorophosphonate ( fp)-rhodamine \n probe labeling of serine hydrolases in the mouse brain ( contains kiaa1363 , \n magl , and abhd6 ) and heart membrane ( contains tgh ) proteome at concentrations \n ranging from 10 nm to 100 m . the selectivity assessments were \n conducted following 6 h inhibitor incubation with the proteomes and \n all inhibitors showed superb selectivity for faah over kiaa1363 and \n abhd6 ( > 10-fold ) , excellent selectivity over magl ( > 200-fold ) , \n and good selectivity over tgh ( figure 8) . abpp selectivity \n screen in mouse brain membrane proteome ( 1 mg / ml ) \n with fp - rhodamine ( 100 nm ) , inhibitor \n preincubation with the proteome was conducted for 6 h. in initial efforts \n to screen for in vivo inhibition of faah and its subsequent pharmacological \n effects , the set of inhibitors displaying the time - dependent , irreversible \n faah inhibition ( 11 , 14 , 17 , and 2022 ) were examined alongside \n of 2 for their ability to increase the endogenous levels \n of a series of lipid amide signaling molecules that are substrates \n for faah in both the brain ( cns effect ) and liver ( peripheral effect , \n not shown ) . thus , the effects of the inhibitors on the endogenous \n levels of the faah substrates anandamide ( aea ) , oleoyl ethanolamide \n ( oea ) , and palmitoyl ethanolamide ( pea ) were measured . notably , it \n is the increase in endogenous levels of anandamide and its subsequent \n action at cannabinoid ( cb1 and cb2 ) receptors that are thought to \n be responsible for the analgesic and anti - inflammatory effects of \n faah inhibitors . administration of inhibitor in three mice per time point for \n an initial screen ( 30 mg / kg ) . significantly , increases in endogenous \n levels of anandamide in the brain requires > 90% inhibition of faah \n for in vivo enzyme inhibition . with the \n exception of imidate 17 , which matched the increased \n anandamide levels observed with 2 after 3 h , each of \n the additional inhibitors proved to be roughly equivalent ( 11 , 14 , and 20 > 21 and 22 ) , increasing anandamide levels approximately 2-fold over \n that of 2 and approximately 3-fold over vehicle treatment \n ( figure 9 ) . , \n 30 mg / kg , n = 3 ) . with pea and oea , which show significant enhancements in \n endogenous \n levels with partial enzyme inhibition and are less sensitive to the \n extent of faah inhibition , all of the inhibitors that displayed time - dependent , \n irreversible faah inhibition matched or exceeded the activity of 2 , producing elevations of 312-fold over vehicle . \n of these as a result , more detailed dose- \n and time - dependent studies of 11 and 14 were \n conducted as reported elesewhere . the \n results of these studies revealed that they cause accumulation of \n all three lipid amides in the brain with peak levels achieved within \n 1.53 h , that these elevations exceed those achieved with the \n reversible inhibitor 2 , that these elevations are maintained \n > 6 h ( vs 23 h for 2 ) , consistent with irreversible \n enzyme inhibition , and that they exhibit long acting in vivo activity \n in a mouse model of neuropathic pain .", "the design , synthesis , and characterization \n of -ketoheterocycles \n that additionally target the remote cys269 nucleophile found in the \n cytosolic port of faah provided inhibitors \n that slowly react with the enzyme nucleophile , effectively providing \n time - dependent , irreversible inhibitors of the enzyme that maintain \n or enhance their selectivity for faah over other serine hydrolases . \n the electrophiles capable of targeting cys269 were incorporated as \n a c5 substituent on the pyridyl group of the 5-(pyrid-2-yl ) oxazole \n of 2 and ranged from the reactive benzylic bromide 11 to the otherwise benign nitrile 14 . the irreversible \n inhibitors of faah displayed an expected sensitivity to the position \n of the electrophile introduction , but those that were successful exhibited \n surprising trends in apparent reactivity toward cys269 that would \n not be easily predicted . a preliminary in vivo characterization of \n the identified irreversible faah inhibitors confirmed their ability \n to raise endogenous brain levels of the enzyme substrates , including \n anandamide , in mice to a greater extent ( > 2-fold ) and for a longer \n duration ( > 6 h ) than the reversible -ketoheterocycles on \n which \n they are based . two of these ( 11 and 14 ) \n were characterized in greater detail , as reported elsewhere , along \n with their long acting in vivo efficacy in a mouse model of neuropathic \n pain .", "c - labeled oleamide was \n prepared from c - labeled oleic acid as described . the truncated rat faah ( rfaah ) was expressed \n in e. coli and purified as described , and the purified recombinant rfaah was used \n in the inhibition and reversibility assays unless otherwise indicated . \n the purity of each tested compound ( > 95% ) was determined on an \n agilent \n 1100 lc / ms instrument using a zorbax sb - c18 column ( 3.5 mm , 4.6 mm \n 50 mm , with a flow rate of 0.75 ml / min and detection at 220 \n and 253 nm ) with a 1098% acetonitrile / water/0.1% formic acid \n gradient ( two different gradients ) . the enzyme reaction \n was initiated by mixing 1 nm rfaah ( 800 , 500 , or 200 pm rfaah for \n inhibitors with ki 12 \n nm ) with 20 m c - labeled oleamide in 500 l \n of reaction buffer ( 125 mm triscl , 1 mm edta , 0.2% glycerol , 0.02% \n triton x-100 , and 0.4 mm hepes , ph 9.0 ) at room temperature in the \n presence of three different concentrations of inhibitor . the enzyme \n reaction was terminated by transferring 20 l of the reaction \n mixture to 500 l of 0.1 n hcl at three different time points . \n the c - labeled oleamide ( substrate ) and oleic acid ( product ) \n were extracted with etoac and analyzed by tlc as detailed . burk kinetic \n analysis was performed as described , confirming \n competitive , reversible inhibition for 5 , 16 , and 25 and noncompetitive inhibition for 11 , 14 , 17 , and 2022 ( figures 5 and 6 ) . the reversibility \n of faah inhibition by 2 , 11 , 14 , and 1722 was assessed by dialysis \n dilution using purified recombinant rfaah . the enzyme was placed in \n 15 ml of faah assay buffer ( 125 mm tris , 1 mm edta , 0.2% glycerol , \n 0.02% triton x-100 , and 0.4 mm hepes , ph 9.0 ) . the dialysis experiment \n was performed in the predialysis mix at or near the apparent ic80 . the final assay inhibitor concentrations used were 100 \n nm , 2 , 18 , and 19 ; 80 nm , 11 , 14 , 21 , and 22 ; \n and 150 nm , 20 . samples were preincubated with the enzyme \n for 3 h at room temperature ( 22 c ) before 300 l was removed \n and assayed in triplicate in a faah activity assay . the remaining \n sample ( 2.7 ml ) was injected into a dialysis cassette employing a \n 10 000 mw cutoff membrane . the mixture was dialyzed against \n 1 l of pbs at 4 c on a stir plate for 18 h. the postdialysis \n faah activity was assessed by assaying 300 l samples taken \n from the dialysis cassettes in triplicate . faah activity is expressed \n as a percentage of vehicle - treated faah ( dmso alone ) and is shown \n in figure 7 . mouse tissues were dounce - homogenized \n in pbs buffer ( ph 8.0 ) , and \n membrane proteomes were isolated by centrifugation at 4 c ( 100 000 g , 45 min ) , washed , resuspended in pbs buffer , and adjusted \n to a protein concentration of 1 mg / ml . proteomes were preincubated \n with inhibitors ( 10100 000 nm , dmso stocks ) for 6 h \n and then treated with fp - rhodamine ( 100 nm , dmso stock ) at room temperature \n for 10 min . reactions were quenched with sds - page loading buffer , \n subjected to sds - page , and visualized in - gel using a flatbed fluorescence \n scanner ( mirabio ) . labeled proteins were quantified by measuring integrated \n band intensities ( normalized for volume ) ; control samples ( dmso alone ) \n were considered to have 100% activity . inhibitors \n were prepared as a saline emulphor emulsion for intraperitoneal \n ( i.p . ) administration by vortexing , sonicating , and gently heating \n neat compound directly in an 18:1:1 v / v / v solution of saline / ethanol / emulphor . \n male c57bl/6j mice ( < 6 months old , 2028 g ) were administered \n inhibitors in saline emulphor emulsion or an 18:1:1 v / v / v saline / emulphor / ethanol \n vehicle i.p . at a volume of 10 l / g weight . after the indicated \n amount of time ( 1 , 3 , or 6 h ) , mice ( n = 3 for each \n compound at each time point ) were anesthetized with isofluorane and \n killed by decapitation . total brains ( 400 mg ) and a portion \n of the liver ( 100 mg ) were removed and flash frozen in liquid \n n2 . animal experiments were conducted in accordance with \n the guidelines of the institutional animal care and use committee \n of the scripps research institute . tissue was weighed and \n subsequently dounce - homogenized in 2:1:1 v / v / v chcl3/meoh / tris \n ph 8.0 ( 8 ml ) containing standards for lipids ( 50 pmol of d4-pea , 2 pmol of d4-aea , and 10 nmol of pentadecanoic acid ) . the mixture was vortexed \n and then centrifuged ( 1400 g , 10 min ) . the organic \n layer was removed , dried under a stream of n2 , and resolubilized \n in 2:1 v / v chcl3/meoh ( 120 l ) , and 10 l of \n this resolubilized lipid was injected onto an agilent g6410b qqq instrument . \n lc separation was achieved with a gemini reverse - phase c18 column \n ( 5 m , 4.6 mm 50 mm , phenomonex ) together with a precolumn \n ( c18 , 3.5 m , 2 mm 20 mm ) . mobile phase a was composed \n of 95:5 v / v h2o / meoh , and mobile phase b was composed of \n 65:35:5 v / v / v . the flow \n rate for each run started at 0.1 ml / min with 0% b. at 5 min , the solvent \n was immediately changed to 60% b with a flow rate of 0.4 ml / min and \n increased linearly to 100% b over 10 min . this was followed by an \n isocratic gradient of 100% b for 5 min at 0.5 ml / min before equilibrating \n for 3 min at 0% b at 0.5 ml / min ( 23 min total per sample ) . the following \n ms parameters were used to measure the indicated metabolites in positive \n mode ( precursor ion , product ion , collision energy in v ) : aea ( 348 , \n 62 , 11 ) , oea ( 326 , 62 , 11 ) , pea ( 300 , 62 , 11 ) , d4-aea ( 352 , 66 , 11 ) , and d4-pea \n ( 304 , 62 , 11 ) . the capillary was set to 4 kv , the ionization source \n was set to 100 v , and the delta emv was set to 0 . lipids were quantified \n by measuring the area under the peak in comparison to the standards \n ( n = 3 for each inhibitor at each time point ) ." ]

[ "to introduce a case of iridoschisis patient who underwent cataract surgery successfully without pupil device .", "a 64-year - old female who showed iridoschisis of her both eyes underwent cataract operation at her right eye without a pupillary device . the preoperative and postoperative ophthalmologic examinations including visual acuity , intraocular pressure , reaction of anterior chamber , and degree of damage on iris was evaluated respectively .", "iris fibrils were held in place by ophthalmic viscosurgical device ( ovd , sodium hyaluronate 3%-sodium chondroitin sulfate 4% , viscoat ) that was injected into the anterior chamber . a small capsulorrhexis was made and the nucleus was delivered with low - power phacoemulsification , most of which was performed under the anterior capsule . there were no intraoperative complications such as tear of the iris , hyphema , loss of mydriasis , or rupture of the posterior lens capsule . the edema of corneal stroma and inflammation of anterior chamber was shown at immediate - postoperative period , but completely subsided 2 weeks later .", "in iridoschisis patients , there is a risk of aspiration of iris fibers during cataract surgery . with adequate use of ovd and careful modulation of surgical devices ,", "a 64-year - old female presented with gradual loss of vision in the right eye ( od ) of one year duration . about six months ago , she had undergone intracapsular cataract extraction , anterior vitrectomy , and scleral fixation of intraocular lens ( iol ) in the left eye ( os ) . at that time , the preoperative best corrected visual acuities ( bcva ) were 20/400 od , 20/30 os . the slit lamp biomicroscopy of both eyes ( ou ) showed clear cornea , deep and clear ac , and the angle was wide open . both eyes had splitting of the anterior layers of the iris with fibrillar degeneration extending from 3 to 6 o ' clock od , and from 4 to 6 o ' clock os . additionally , there was diffuse atrophy of iris from 11 to 1 o ' clock os ( fig . the right eye showed nuclear and cortical cataract associated with posterior subcapsular cataract , and the left eye was pseudophakia . specular microscopy of the od revealed regular , hexagonal shape of endothelial cells without any abnormalities like bullae or guttae , and the endothelial cell count was 2865 cells / mm . pupil dilation is performed using 3 drops of tropicamide 0.5% and phenylephrine hydrochloride 0.5% at 5-minute intervals 1 hour prior to surgery . topical anesthesia was applied using alcaine and 3% lidocaine , and a paracentesis was done at 10 o ' clock . a 2.75 mm main clear corneal incision was performed using the keratome blade . a dispersive ophthalmic viscosurgical device ( ovd ) , sodium hyaluronate 3%-sodium chondroitin sulfate 4% ( viscoat , alcon ) was injected through the clear corneal wound to stabilize the anterior chamber and protect the iris stroma by displacing aqueous from the ac and pushing the iris strands from the pupillary aperture . an anterior continuous curvilinear capsulorhexis not exceeding over the pupillary margin was performed using the 26 g needle and capsular forceps . after hydrodissection and hydrodelineation , careful phacoemulsification was performed ( allergan sovereign phaco system , sov680330 ) for nucleus removal with special care not to touch the iris tissue . aspiration was used to clean residual cortical fibers from the capsular bag . when a loss of the protective effect of viscoelastic material was observed during surgery , the maximum limit of the vacuum was 300 mmhg and the aspiration rate , 20 cc / mmhg . the height of the irrigation bottle is maintained less than 60 cm to minimize the turbulence within the chamber . total us time was 48 seconds with a mean final rate of 10% of potency . the capsular bag was inflated with viscoelastics , and a single - piece acrylic intraocular lens ( acry - sof sa60at , alcon ) was inserted . the iol was safely placed in the capsular bag and centered , followed by aspiration of the residual viscoelastics . finally , bss carbacol ( carbachol 0.01% , miostat ) was used to constrict the pupil . postoperatively , the inflammatory response in the ac was moderate , some fibrillar materials were seen . the cornea showed some descemet folds , and the pupil was round and undamaged ( fig . one week after surgery , the uncorrected visual acuity was 20/100 od , and improved to 20/30 on the two weeks postoperative day . there were traces of cells in the ac , but no fibrillar materials were seen ( fig . the patient 's last visit was 1 month after surgery when ucva was 20/40 , and bcva 20/20 .", "iridoschisis is a very rare condition resulting in one or more layers of the anterior iris surface . a localized area of iris stroma is cleaved in two with the anterior atrophic portion disintegrating into fibrils . the separated stromal fibers go through a degenerative process in which they detach and free float in the anterior chamber , creating a \" shredded wheat \" appearance . the condition primarily affects the inferior iris quadrants and rarely superior quadrants.9 - 13 glaucoma occurs in 50% of the cases and is of the angle closure type.15 whether iris changes are responsible or iridoschisis occurs more frequently in eyes that are predisposed to angle closure is unclear.16 while primary angle closure glaucoma has been implicated in iridoschisis formation , the affected fibers may bow forward , leading to anterior synechiae and angle closure glaucoma.5,6,14,15 in the present case , the anterior chamber angle was wide open and the iop were within normal limits . it is a matter of concern that the clinicians are prone to misdiagnose this condition , especially in the case with dark colored iris . there have been only three cases of report in 1990's.13,14 differential diagnosis must include axenfeld - reiger anomaly , ices , or other conditions which accompany the degenerative change of iris stroma . an abnormal corneal endothelium that migrates across the chamber angle on to the surface of the iris is the common feature of the ice syndromes.17 the iris in ices is usually atrophic rather than split , and peripheral anterior synechiae ( pas ) extends to schwalbe 's line specular microscopy has shown the abnormal corneal endothelial cells , so called \" ice cells \" , which are pleomorphic and resemble corneal guttata . it occurs mostly unilateral and the clinical symptoms are presented earlier than iridoschisis ( about 3 or 4 decades ) . there is hypoplasia of the iris stroma with filaments connected to abnormal peripheral cornea.18 in this case , the clinical features most coincidence with iridoschisis , rather than ices or axenfeld - reiger syndrome . the condition was bilateral and there was no pas or connection of iris fibrils with peripheral cornea . specular microscopy showed normal shape and count of corneal endothelial cells . considering that our patient had been diagnosed as bilateral ices before , there may have been other misdiagnosed and unreported cases . because iridoschisis is associated with aging , cataract is often a concomitant issue.2 the disorganized anterior layer of the iris and fibrillar material in the pupillary axis has a tendency to become drawn in by the suction of the i / a cannula and phaco tip during phacoemulsification . pupil dilation in these patients is also poor because this condition may be associated with pseudoexfoliation syndrome or atrophy of the pupillary margin.11 if the loose iris fibrils become drawn and entrapped in the aspiration port , there is a strong chance of complications like bleeding , iris tears , loss of mydriasis , and disruption of the blood - aqueous barrier.9 many methods have been tried to stabilize the iris fibers during cataract operation in the presence of iridoschisis . most of them are based on mechanical restraint of the disorganized iris using flexible iris hooks , iris retractors or pupil expanders , such as multiple iris hooks or graether pupil expander.2,9,11,12 these mechanical supports provide additional pupillary dilation , stabilize the capsule , and trap some of the fibers at pupillary margin during phacoemulsification . but these supportive devices can also induce strain and trauma to iris tissue resulting in increased inflammation after postoperative period . sometimes they lead to defects in the pupillary margin or to an atonic pupil.11 moreover , long , free - floating , torn fibers may not be trapped and may still extend over the rim into the surgical field.9 in withdrawing these instruments , iris fibers can be trapped in the stab incisions , and such fibers may act as an entrance for epithelial cells and micro - organisms.9 in this case , without mechanical restraint of iris , we minimized the iris trauma through the right choice of the viscoelastic material , careful manipulation of phaco tip or i&a cannula , and reducing the turbulence by using the minimum required fluidic parameters achieved with lowering the total phaco power and the height of the irrigation bottle . the allergan sovereign phaco system has a peristaltic fluidic pump system with vacuum range of 0~500 mmhg and flow range of 0~40 cc / min . the maximal fluidic parameters showed in the presented case were relatively lower than the values that had been usually set for conventional cataract surgery . viscoat has been known to have a very high dynamic viscosity at high shear rate . this property and a poor cohesion provide a better corneal endothelial protection during in vitro phacoemulsification . 19,20 although the removal time of ovd is longer with dispersive viscoat than other cohesive ovds ( sodium hyaluronate 1.4% , healon gv , or sodium hyaluronate 1.0% , provisc),21 viscoat is less influenced by turbulent flow while cohesive ovds tend to be washed out suddenly which could result in sudden collapse of anterior chamber.21,22 furthermore , the cohesive ovd fragment behind the iol is exposed to too little turbulent flow to move towards the aspiration port unless the i&a tip is placed behind the iol or a special technique is used.23 a small capsulorhexis that did not extend vertically beyond the middle of the pupil was performed deliberately to allow he anterior capsule to act as an additional barrier between the iris and instruments . to protect the friable and disorganized iris from further damage , if a loss of the protective effect or the movement of iris fibril were observed , the ovd was injected additionally . the machine settings , including flow rate and vacuum limit , as well as port diameter are different between phacoemulsification needle and i / a tip . the former is related to the retention ability of ovds and the latter to removal property.23 although we were not able to manage the diameter of phaco or i&a tips , the minimum possible amount of us energy , bss flow rate and vacuum limit enabled the surgical procedures to be performed under safer environment . there was no iris trauma , intraoperative iris bleeding , or posterior capsular rupture during surgery . the corneal edema had disappeared by two weeks after surgery , and the ac inflammation had subsided after one month postoperatively . the final bcva od had improved from the preoperative one , from 20/400 to 20/20 . this is a case which emphasizes the importance of exact preoperative diagnosis and differential diagnosis in iridoschisis . in the absence of proper clinical impression and proper preoperative preparation , our patient had been diagnosed as ices , and underwent icce , anterior vitrectomy and scleral fixation of iol on the contralateral eye ( os ) . in conclusion , for iridoschisis is a very rare condition and easy to be confused with other diseases , one must consider this condition into differential diagnosis if the iris abnormalities are suspicious ." ]

[ "neural stimulation has a long history of use in a range of therapeutic applications , including regulating organ function and treating a variety of neurological disorders . neurostimulators are also used to provide forms of sensory perception ; for example , electrical stimulation of auditory neurons using electrodes implanted in the cochlea can provide hearing sensations to people with a severe to profound hearing impairment . a related application is visual prostheses ( bionic eyes ) , in which electrodes implanted within the visual system are used to electrically elicit visual percepts in people with minimal light perception . this research has expanded in recent years , and several distinct techniques are being developed . these include stimulation of the visual cortex using cortical electrode arrays , and stimulation of retinal neurons using electrode arrays implanted at various intraocular sites . one such device being developed by bionic vision australia ( bva ) targets retinal neurons using an electrode array implanted in the suprachoroidal space , between the choroid and scleral layers of the eye . this implantation site has the advantages of surgical simplicity and long term stability at the expense of increased distance from the retinal neuronal targets which may increase the charge levels required to elicit percepts and limit spatial resolution , . whilst preclinical studies can provide some insight into the specifications required for a neurostimulator that will be efficacious for a suprachoroidal retinal prosthesis , there are still many unknowns . for example , the electrical properties of the electrode - tissue interface and the charge levels required to elicit a neural response are undetermined for degenerated human retina . to address this , 1 ) . the percutaneous connector provides a direct electrical connection to each electrode in the device , allowing maximum flexibility in the stimuli applied . this enables the stimulation parameter space to be thoroughly explored using an external stimulator and the performance of a suprachoroidal implant to be evaluated . the results can then be used to inform the design of future devices , including fully implanted systems . \n ( a ) an electrode array ( top left ) designed to be implanted in the suprachoroidal space of the eye is connected to a percutaneous connector ( bottom right ) via a leadwire . ( b ) the percutaneous connector is implanted behind the ear and provides an external electrical connection to the implanted electrodes . ( c ) a schematic illustration of the electrode layout of the array ( not to scale ) . twenty stimulating electrodes ( \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ 17\\times 600 \\mu \\text{m}$ \n \\end{document } and \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ 3\\times 400 \\mu \\text{m}$ \n \\end{document } diameter ) are arranged in a hexagonal grid , which is surrounded by thirteen interconnected \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ 600\\mu \\text{m}$ \n \\end{document } diameter electrodes that form a guard - ring return . an additional return electrode ( not shown ) is implanted subcutaneously close to the percutaneous connector . ( a ) an electrode array ( top left ) designed to be implanted in the suprachoroidal space of the eye is connected to a percutaneous connector ( bottom right ) via a leadwire . ( b ) the percutaneous connector is implanted behind the ear and provides an external electrical connection to the implanted electrodes . ( c ) a schematic illustration of the electrode layout of the array ( not to scale ) . twenty stimulating electrodes ( \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ 17\\times 600 \\mu \\text{m}$ \n \\end{document } and \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ 3\\times 400 \\mu \\text{m}$ \n \\end{document } diameter ) are arranged in a hexagonal grid , which is surrounded by thirteen interconnected \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ 600\\mu an additional return electrode ( not shown ) is implanted subcutaneously close to the percutaneous connector . to minimize the risk of harmful effects of stimulation , it is essential that the external neurostimulator adheres with established design principles of safe electrical stimulation . these include the use of charge - balanced biphasic pulses , post - stimulus electrode shorting and output coupling capacitors to maintain charge recovery , , charge limits and charge density limits to prevent damaging stimulation being delivered , as well as appropriate electrical isolation in accordance with iec60601 - 1 . the use of constant - current stimulation pulses is also required to ensure that changes in impedance at the electrode - tissue interface are intrinsically compensated for , allowing precisely predetermined amounts of charge to be reliably delivered . to fully exploit the unrestricted access to the electrodes provided by the percutaneous connection 2 ) must have appropriately wide ranges and a resolution that allows flexibility in the values used . preclinical studies investigating suprachoroidal stimulation using a feline model have used phase widths ranging from \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ 100\\mu \\text{s}$ \n \\end{document } to 3ms , with 300-\\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ 1200\\mu \\text{s}$ \n \\end{document } recommended as optimal for eliciting visual responses whilst balancing charge and current requirements . as shorter phase widths require larger currents to deliver a given amount of charge , the neurostimulator must have an adequately high maximum output current . for example , a biphasic pulse with 500nc per phase , a charge level that has been required in some preclinical suprachoroidal stimulation studies , , would require a current of 5ma when using a \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ 100\\mu \\text{s}$ \n \\end{document } phase width . the compliance voltage , the maximum voltage that can be produced to maintain delivery of a specified constant current , must also be sufficiently high . the compliance voltage required is dependent on the current delivered , the phase width and the electrode impedance , defined as the peak voltage of a biphasic pulse divided by the stimulus current amplitude . a preclinical study using suprachoroidal electrodes of the same size as those used in this study ( \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ 600\\mu \\text{m}$ \n \\end{document } diameter ) recorded electrode impedances between 11 - 15k\\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ \\omega $ \n \\end{document } using \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ 75\\mu \\text{a}$ \n \\end{document } pulses with a \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ 25\\mu \\text{s}$ \n \\end{document } phase width , suggesting a high voltage compliance will be required to use large currents . other preclinical studies that used smaller , higher - impedance electrodes ( \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ \\le 395\\mu \\text{m}$ \n this stimulator was capable of eliciting visual responses using currents up to 2ma . consequently , a maximum compliance voltage of 40v is considered a suitable requirement , as it provides headroom for using short ( \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ \\le 100\\mu \\text{s}$ \n \\end{document } ) phase widths and higher currents . a high degree of electrode configurability is also required to enable delivery of stimuli via various combinations of active and return electrodes ; for example , a configuration using a single remote return electrode has been theorized to have different current spread properties than a configuration using multiple nearby electrodes as the return , which may affect percept appearance , . additionally , it is desirable for the external stimulator to be small and portable to facilitate stimulation whilst the patient is mobile . \n charge - balanced , constant - current biphasic stimulus pulse parameters . whilst there are various commercial neurostimulators available from companies such as natus neurology inc . ( grass technologies ) , digitimer limited , and fhc incorporated , they generally have limitations in one or more of the specifications required . , usa ) is a constant - current biphasic stimulator that can deliver up to 15ma and has a high degree of electrode configurability when combined with an esax electrode switching array ( natus neurology inc . however , the resolution of the pulse parameters is restricted to a small number of steps , the frequency range is limited to 2 - 100hz and the current accuracy is only specified for loads of 100-\\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ 2000\\omega $ \n \\end{document } \n . the need to combine separate modules and the need for a mains power supply also limit the portability of the system . taking into account all of the requirements , there appears to be no appropriate neurostimulator available for use in evaluating a suprachoroidal implant , and consequently a custom solution was required . this article details the design of a highly configurable , high compliance voltage , 32-electrode neurostimulator , known as neurobi , and its application in determining whether visual percepts could be elicited using a prototype suprachoroidal electrode array implanted in one patient with approximately 20 years of light perception vision only due to retinitis pigmentosa . the configurability of neurobi together with its capability to deliver stimulation across a wide range of parameters make it suitable not only for use with a prototype suprachoroidal electrode array , but also for many other clinical applications , including prediction and suppression of epileptic seizures through stimulation of subdural electrode arrays , and deep brain stimulation .", "the major functional components of neurobi and its place within a typical patient - testing setup are illustrated in fig . 3 . under the control of a host personal computer ( pc ) and an embedded microcontroller , neurobi is designed to deliver sequences of highly adjustable ( table 1 ) charge - balanced , constant - current biphasic pulses to any combination of outputs connected to an implanted electrode array . the pulses are generated using a single current source whose direction is switched to reverse the polarity of the stimulating electrodes and produce the alternating phases . a switch array connects the pulse generation circuitry to the desired output configuration via coupling capacitors . \n figure 3.block diagram illustrating the major functional components of neurobi and its place within a typical patient - testing setup.table 1neurobi stimulus parameters.current amplitude0-l0ma ( \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ \\mathrm{1}\\mu\\mathrm{a\\hspace{0.33em}steps}$ \n \\end{document})phase width\\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ 20\\mu\\mathrm{s-3ms}\\hspace{0.33em}(\\mathrm{1}\\mu\\mathrm{s\\hspace{0.33em}steps}{)}$ \n \\end{document}interphase gap\\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ 20\\mu\\mathrm{s-3ms}\\hspace{0.33em}(\\mathrm{1}\\mu\\mathrm{s\\hspace{0.33em}steps}{)}$ \n \\end{document}stimulation period\\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ 160\\mu\\rm{s-5s}$ \n \\end{document}number of outputs32electrode configurabilityarbitrarynominal compliance voltageselectable 10/20/30/40vdependent on phase width and interphase gap used block diagram illustrating the major functional components of neurobi and its place within a typical patient - testing setup . dependent on phase width and interphase gap used a maximum phase width of 3ms was chosen to be consistent with preclinical experiments . the maximum interphase gap was also set to 3ms to allow gaps equal to the phase width to be used . a maximum current amplitude of 10ma was chosen to allow the use of narrow phase widths ( e.g \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ 100\\mu \\text{s}$ \n \\end{document } ) . the maximum compliance voltage was set to 40v , but was made adjustable under software control to allow lower levels to be used if high voltages were not required . using a lower compliance voltage setting minimizes the risk of high voltages accidentally being applied to tissue and also reduces the power consumption of the device by lowering the supply rails . a resolution of \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ 1\\mu \\text{a}$ \n \\end{document } and \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ 1\\mu \\text{s}$ \n \\end{document } was used to maximize the flexibility in the selectable values . the connection to the host pc is via universal serial bus ( usb ) , which provides power and communication to neurobi to configure device settings , control the delivery of stimuli and to record data . communication messages consist of packets of bytes , which include a start byte to mark the beginning of a message , a command identification byte specifying the message function , a number of data bytes and a checksum byte for message verification . external trigger lines are also provided by neurobi , which can be used to initiate delivery of preloaded stimuli and to indicate when pulses are being delivered . the power and data lines of the usb connection and the trigger lines are isolated within neurobi to 5kv . the isolated usb data line is then converted into four universal asynchronous receiver / transmitters ( uart ) using a quad serial - to - usb converter ( ft4242h , ftdi chip , uk ) . this allows the host pc to communicate with neurobi over four serial ports , with different ports used for sending command messages , debug information , stimulus current measurements , and voltage waveform data recorded by neurobi . the four uarts are connected to the microcontroller ( kinetis k40 mk40x256vlq100 , freescale semiconductor , usa ) , which is responsible for controlling the function of neurobi , including handling communication , managing power settings , buffering sequences of pulses for delivery , and coordinating stimulus generation . the isolated usb power is routed through to a power management chip ( ltc3567 , linear technology , usa ) that supplies power to the system and opportunistically charges a lithium polymer battery . the battery is primarily used to ensure safe shutdown in the event that usb connectivity is unexpectedly lost , but can also be used as the sole power supply for the device to facilitate ambulatory applications by eliminating the need for a portable computer ( e.g. laptop , tablet , or single - board computer ) to power the device . the power management chip generates a 3.3v regulated supply that provides power to the microcontroller and communication circuitry , and an unregulated supply that feeds a step - up converter and two low - noise 5/3.3v dc supplies . the step - up converter is capable of generating the high - voltage supply rail required to power the pulse generation and routing circuitry with a software - controllable compliance voltage of 10 , 20 , 30 , or 40v . the use of a single switched current source to generate the stimulus pulses has the advantage of intrinsic charge matching for symmetric biphasic pulses , as the same circuitry is used to produce both phases . it also has the benefit of requiring only a single high - voltage supply , as opposed to the dual supplies that would be required if a source and sink were used . the design of a precision current source with a compliance voltage of up to 40v , a slew rate sufficient for generating microsecond - scale pulses , as well as high efficiency and an output impedance high enough to ensure less than 1% variation in current across tissue loads , required careful consideration . a discrete bipolar junction transistor ( bjt ) based topology was used as it could be tailored to meet these specifications , at the expense of increased design complexity . in comparison , operational amplifier based topologies such as the improved howland current pump used in some other neurostimulators , , are limited by the capabilities of the operational amplifier used . a chip that could meet the slew rate , supply rail and output offset requirements for this application was not identified . a linearized bjt and current mirror were used to create the current source ( fig . an improved wilson current mirror was used to achieve high output impedance and to mitigate error due to finite base current . additional matched transistors are connected in parallel on the output side to provide accurate current scaling . this also improved power efficiency by minimizing the total branch current required for a given output current . matched emitter degeneration resistors were also used to improve bjt beta matching and the output impedance of the current source . \n figure 4.current source used to generate stimulus pulses , consisting of a linearized bjt and an improved wilson current mirror with additional current scaling . current source used to generate stimulus pulses , consisting of a linearized bjt and an improved wilson current mirror with additional current scaling . the current source is connected to quad high - voltage single - pole single - throw switches ( adg5412 , analog devices , usa ) , which are used to interchange the direction of current flow to produce biphasic pulses . a high voltage 4-channel multiplexer ( mux ) ( adg5404 , analog devices , usa ) is then used to route the current to either the switch array or to one of three low temperature coefficient resistive loads that are used to verify the amplitude and for calibration . a high input impedance waveform capture circuit comprising a fully differential amplifier and a 16-bit analog - to - digital converter ( ad7694 , analog devices , usa ) is also connected across the output lines of the current direction switches . this is used for current - source calibration and to measure the voltage waveform across the output electrodes during stimulation with a sampling rate of 100 kilosamples per second . each output can be individually connected as either an active or return line using high - voltage 4-channel muxs ( adg5204 , analog devices , usa ) . when not being used for stimulation , each output can be set to be open circuit or connected to a common point . the common - point connection allows electrodes to be shorted together after stimulation , which is an established method for removing residual charge in tissue due to charge imbalance . all high - voltage switches and muxs used in neurobi feature trench isolation to prevent latch - up due to electrode voltages beyond supply rails . as stimulation safety was of paramount importance to the design of neurobi , coupling capacitors are used on each output for protection against residual direct current ( dc ) due to leakage and charge imbalance . including capacitors also protects tissue in the event that an output stage fails catastrophically by blocking dc from being applied to the electrodes . choosing an appropriate capacitor size is a compromise between compliance voltage reduction and physical size . a \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ 10\\mu \\text{f}$ \n \\end{document } ceramic ( x7r ) capacitor was chosen as for a 500nc per phase pulse , a stimulation level which has been used preclinically to measure evoked responses with a suprachoroidal array , , the compliance voltage reduction is only 50mv whilst using a reasonably sized surface - mount package ( 1210 ) . the outputs of neurobi are connected to the patient s implanted electrode array via an electrode enable switch box . this additional safety feature allows the electrodes to be individually connected to or disconnected from neurobi . the electrode enable switch box consists of an array of momentary push buttons each connected to a low - voltage normally - open relay . when the button for a particular electrode is pressed , power is supplied to the coil of the relay by a simple toggle on / off circuit and the connection is established . an led in the push button is powered through a second pole of the relay to indicate that the electrode is connected . stop button is connected to the electrode enable box which removes the power from the relays when actuated , causing them to revert to the open state and completely disconnecting the stimulator . this allows the patient or researcher to immediately cut off all stimulation in the event that any discomfort or other unexpected effects occur . to deliver a stimulus , commands are first sent from the host pc to load neurobi with the desired pulse parameters ( phase width , interphase gap , rate ) and electrode configuration ( fig . 5 ) . up to 256 different stimulus parameter sets and 255 electrode configurations can be loaded . before each parameter set or electrode configuration is stored , the nominated values are checked against defined limits and any unacceptable values are rejected . commands can then be sent to trigger the delivery of a stimulus using a particular parameter set and electrode configuration with a specified current amplitude and number of repetitions . prior to any stimulus being delivered , the charge per phase is calculated within neurobi and compared to a safe limit . the user can set the charge limit to an appropriate value by sending a command message from the host pc . \n stimuli comprising different electrode configurations and pulse parameters can then be delivered , either one at a time or in a sequence . stimulus delivery process . stimuli comprising different electrode configurations and pulse parameters can then be delivered , either one at a time or in a sequence .", "prior to neurobi being used clinically with patients , extensive functional and safety testing was performed both internally and by independent external engineers . stimulation pulses were delivered to a variety of test loads using a range of parameters , with the resulting output waveforms verified for accuracy ( fig . the current output was measured to be accurate to within 2% for currents greater than \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ 100\\mu \\text{a}$ \n \\end{document}. the output impedance and voltage compliance were characterized for a range of output current levels ( fig . the charge injection , the amount of unwanted charge injected into the output current path due to stray capacitance within the switching integrated circuits , was also measured and found to be less than 1nc . \n figure 6.stimulation waveform recorded across a 10k\\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ \\omega $ \n \\end{document } test load using a fluke 190 - 204 scopemeter ( fluke corporation , usa ) . the measured pulse parameters correspond with the defined settings of \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ 200\\mu \\text{s}$ \n \\end{document } phase width , \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ 100\\mu \\text{s}$ \n \\end{document } interphase gap , 1.5ms stimulation period and 1ma current amplitude . \n ( b ) measured compliance voltage as a function of output current using a 3ms phase width ( worst case ) with nominal settings of 10 , 20 , 30 , and 40v . voltage compliance is reduced for long phase widths and large currents due to charging of the output coupling capacitors . stimulation waveform recorded across a 10k\\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ \\omega $ \n \\end{document } test load using a fluke 190 - 204 scopemeter ( fluke corporation , usa ) . the measured pulse parameters correspond with the defined settings of \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ 200\\mu \\text{s}$ \n \\end{document } phase width , \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ 100\\mu \\text{s}$ \n \\end{document } interphase gap , 1.5ms stimulation period and 1ma current amplitude . ( b ) measured compliance voltage as a function of output current using a 3ms phase width ( worst case ) with nominal settings of 10 , 20 , 30 , and 40v . voltage compliance is reduced for long phase widths and large currents due to charging of the output coupling capacitors . the residual dc resulting from stimulation of the suprachoroidal electrode array using neurobi was measured in vitro for a range of pulse parameters under various load conditions . preclinical studies establishing a safe limit for residual dc in a suprachoroidal retinal prosthesis have not been reported . however , dc levels of less than 100na have been shown to cause no damage when applied to the cochlea . based on this data a risk analysis was performed in accordance with iso 14971 , covering failure modes and the use of neurobi with human subjects . both neurobi and the electrode enable box passed electrical safety tested to australian standard ( as ) 3551 ( 2004 ) and the electromagnetic emissions of neurobi were found to conform with as cispr11 ( 2011 ) . additionally , neurobi passed electrostatic discharge immunity testing in accordance with as 61000.4.2 ( 2002 ) . the initial application for neurobi was to determine whether visual percepts could be elicited in one patient with profound vision loss using a suprachoroidal electrode array . measurement of electrode impedances was also required to verify connectivity and to inform compliance voltage requirements . following approval from the royal victorian eye & ear hospital human research ethics committee and trial registration ( www.clinicaltrials.gov , trial # nct01603576 ) , one patient with profound vision loss due to retinitis pigmentosa was selected through a clinical screening process . the selected patient was a 52 year old female with rod - cone dystrophy and approximately 20 years of light perception only vision . informed consent was obtained in accordance with the declaration of helsinki . following preliminary testing with this patient , further details on patient selection are reported elsewhere . the suprachoroidal electrode array ( fig . 1 ) consisted of twenty platinum discs ( \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ 17\\times 600 \\mu \\text{m}$ \n \\end{document } and \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ 3\\times 400 \\mu \\text{m}$ \n \\end{document } diameter ) arranged in a hexagonal grid within a silicone substrate . the implant also included thirteen interconnected \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ 600\\mu \\text{m}$ \n \\end{document } platinum discs and two 2 mm platinum discs for use as return electrodes . each electrode was individually connected via a helical platinum / iridium wire to the pins of a titanium percutaneous connector , which was implanted behind the patient s ear . the lead wire and electrode array were tunneled subcutaneously to the orbit and inserted into the suprachoroidal space through a scleral incision . an additional electrode was also implanted adjacent to the percutaneous connector for use as a remote return . stimulus delivery was controlled using a purpose - built graphical user interface , called eyesee , running on the host pc . eyesee was responsible for managing experimental procedures , communicating with neurobi via a custom device driver and applying additional safety features , including enforcing charge limits . ideally , the maximum charge that can be safely delivered using a suprachoroidal array would be defined through preclinical safety studies . however , whilst chronic suprachoroidal stimulation safety studies have been performed , they are yet to define a safe charge limit precisely . in the absence of more appropriate data , the shannon model of safe levels of electrical stimulation with a \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ k$ \n \\end{document } value of 1.85 , as shown in , was used to define maximum charge limits . if the specified charge per phase exceeded the relevant limit , 447nc for a \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ 600\\mu \\text{m}$ \n \\end{document } electrode and 298nc for a \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ 400\\mu \\text{m}$ \n \\end{document } electrode , eyesee would not deliver the stimulus . the compliance voltage required for a given stimulus was also estimated before stimulus delivery using the nominated current amplitude and measured electrode impedances to ensure it was within range . electrode impedances were measured using biphasic pulses and were defined as the voltage at the end of the first phase divided by the current amplitude ( fig 8) . the voltage waveforms were recorded using the neurobi waveform capture circuit and an average of 50 pulses was used to calculate the impedance for each electrode . a common - ground configuration was used , where one active electrode was stimulated against all others . in this configuration , the parallel connection of multiple return electrodes created a low - impedance path , so that the recorded impedance value was dominated by the impedance of the individual active electrode . \n ( a ) current waveform measured by stimulating a test load and dividing the recorded voltage samples by the known resistance . ( b ) voltage waveform recorded from an implanted \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ 600\\mu \\text{m}$ \n \\end{document } electrode using a common - ground return . both waveforms were recorded using the neurobi waveform capture circuit and are the average of 50 pulses . filled circles = averaged samples , open circle ( marked by arrow ) = voltage data point used to calculate impedance . example current and voltage waveforms used to measure electrode impedance . ( a ) current waveform measured by stimulating a test load and dividing the recorded voltage samples by the known resistance . ( b ) voltage waveform recorded from an implanted \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ 600\\mu \\text{m}$ \n \\end{document } electrode using a common - ground return . both waveforms were recorded using the neurobi waveform capture circuit and are the average of 50 pulses . filled circles = averaged samples , open circle ( marked by arrow ) = voltage data point used to calculate impedance . stimulation parameters of \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ 500\\mu \\text{s}$ \n \\end{document } phase width , \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ 20\\mu \\text{s}$ \n \\end{document } interphase gap , \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ 75\\mu \\text{a}$ \n \\end{document } current amplitude and 500pps rate , were chosen for measuring electrode impedances , based on the results of preclinical studies , . using these parameters , impedances were measured to be 16.5 - 20k\\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ \\omega $ \n \\end{document } ( \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ 600\\mu \\text{m}$ \n \\end{document } electrodes ) , 23.5 - 25.5k\\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ \\omega $ \n \\end{document } ( \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ 400\\mu \\text{m}$ \n \\end{document } electrodes ) and 2.5 - 5.5k\\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ \\omega $ \n \\end{document } ( return electrodes ) . two electrodes were initially detected as open circuit , but those faults were traced to poor contacts within the percutaneous connector that were rectified later by replacing an externally accessible component . the \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ 600\\mu \\text{m}$ \n \\end{document } impedances measured were approximately 5k\\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ \\omega $ \n \\end{document } higher than those recorded preclinically , however this can be attributed to different phase widths being used ( \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ 500\\mu \\text{s}$ \n \\end{document } vs \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ 25\\mu \\text{s}$ \n \\end{document } ) and differences between a sighted feline model and a degenerate human retina . an iterative stair - case procedure was used , whereby stimuli with progressively increasing charge per phase were delivered until a percept was reported by the subject . the charge per phase this process was repeated until 8 turning points had been recorded , with the average of the last six turning points used as the perceptual threshold . if the charge per phase increased to the safe charge limit , the procedure was aborted and the electrode was considered to be unable to elicit a visual percept using the stimulation parameters selected . perceptual threshold values were recorded in units of nc and also in db re 10nc , as perceived brightness is expected to be proportional to the logarithm of stimulus intensity . the threshold - estimating procedure was performed on nineteen electrodes , with one \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ 600\\mu \\text{m}$ \n \\end{document } electrode excluded as it was apparently open - circuit due to a poor contact in the percutaneous connector . based on results of preclinical studies , stimulation parameters of \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ 500\\mu \\text{s}$ \n \\end{document } phase width , \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ 20\\mu \\text{s}$ \n \\end{document } interphase gap , 50pps rate , and 0.5s duration were chosen with a monopolar electrode configuration , where an individual electrode was stimulated against one of the 2 mm intraocular returns . charge per phase was modulated by adjusting the current amplitude . visual percepts were successfully elicited on all \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ 600\\mu \\text{m}$ \n \\end{document } electrodes tested , with threshold levels in the range 100 - 370nc ( 20 - 31.4db ) . the safe charge limit was reached before a perceptual threshold could be obtained for two of the \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ 400\\mu \\text{m}$ \n \\end{document } electrodes , whilst the other \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ 400\\mu \\text{m}$ \n \\end{document } electrode produced a percept with a threshold of 190nc ( 25.6db ) . two \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ 600\\mu \\text{m}$ \n \\end{document } electrodes were also tested using a common - ground configuration , producing perceptual thresholds of 176nc ( 24.9db ) and 360nc ( 31.1db ) . shapes varied from simple ovals filled with cream - grey light , to complex shapes with multiple light and dark regions . the location of phosphenes in the visual field was also reported to vary in a manner consistent with the layout of the electrode array .", "preliminary clinical test results have shown it to be effective in eliciting visual percepts in a profoundly vision - impaired subject with approximately 20 years of light perception vision only , implanted with a suprachoroidal electrode array . the final device is a highly configurable neurostimulator in a relatively small form factor , with dimensions of 170 mm \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ \\times \\,\\ , 130 $ \n \\end{document}mm \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ \\times \\,\\ , 55 $ \n \\end{document}mm and weight of 800 g ( fig . figure 9.photo of neurobi ( top right ) , electrode enable switch box ( bottom ) and stop button ( top left ) . photo of neurobi ( top right ) , electrode enable switch box ( bottom ) and stop button ( top left ) . by stimulating individual electrodes with neurobi the perceptual thresholds are approximately 2 times higher than those measured using chronic epiretinal stimulation in humans , however higher thresholds are expected as a suprachoroidal implant is further from the retinal stimulation targets . these results suggest that the suprachoroidal space is a viable implantation site for a retinal prosthesis . further work is required to characterize the phosphenes elicited and to determine how they can be used to functionally improve the patient s vision . following this successful preliminary testing , two additional patients have been implanted with the suprachoroidal device and all three patients have been subject to weekly psychophysics sessions . psychophysics testing is being performed to determine the optimum stimulation parameters for a suprachoroidal retinal prosthesis ; to characterize the appearance and location of the visual percepts elicited ; and to investigate how to build useful visual information by stimulating multiple electrodes closely in time . a head - mounted video camera has also been integrated with neurobi and the host pc to provide real - time stimulation based on the visual scene in front of the patient . this has allowed standard visual acuity tests to be performed and enabled patient performance to be assessed in a number of activities of daily living , such as navigation and object recognition . the initial results obtained suggest that the full capabilities of neurobi will be required to undertake psychophysics testing with the prototype suprachoroidal electrode array . the threshold levels measured ( 100 - 370nc ) are approaching the defined safe charge limit for a \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ 600\\mu \\text{m}$ \n \\end{document } electrode ( 447nc ) . subsequently , stimuli up to the limit will be required to be able to stimulate at levels above threshold . the safe charge limit corresponds to \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ 894\\mu \\text{a}$ \n \\end{document } for a \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ 500\\mu \\text{s}$ \n \\end{document } phase width ; however , if shorter phase widths are used , higher currents will be required . for example , if a \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ 100\\mu \\text{s}$ \n \\end{document } phase width is used the safe limit would correspond to 4.47ma , which is still well within the capabilities of neurobi . the electrode impedances measured suggest that the highest compliance voltage setting ( 40v ) will also be required . using ohm s law as a crude estimator of compliance voltage requirements , a series combination of a \\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ 400\\mu \\text{m}$ \n \\end{document } electrode ( up to 25.5k\\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ \\omega $ \n \\end{document } ) and a return electrode ( up to 5.5k\\documentclass[12pt]{minimal } \n \\usepackage{amsmath } \n \\usepackage{wasysym } \n \\usepackage{amsfonts } \n \\usepackage{amssymb } \n \\usepackage{amsbsy } \n \\usepackage{upgreek } \n \\usepackage{mathrsfs } \n \\setlength{\\oddsidemargin}{-69pt } \n \\begin{document } \n } { } $ \\omega $ \n \\end{document } ) , as used in a monopolar configuration , could require up to 31v when stimulated at 1ma . whilst it is not expected that the electrode - tissue interface will behave as a purely resistive conductor , this approximation illustrates that a high voltage compliance capability may be required in some conditions . to the authors knowledge , the capabilities of neurobi in terms of current output , compliance voltage , electrode configurability and portability are not achievable with commercially available external or implantable stimulators . this flexibility of neurobi will be used with psychophysics testing to explore and refine the stimulator specifications required for a suprachoroidal implant . these can then be used to inform production of a fully implantable stimulator device that is designed to meet those requirements . its versatility makes it suitable for use in stimulating any neural interface with an externally accessible connection . additionally , with relatively minor modifications , the switch array can be expanded to 128 channels and setup to route electrode connections to external recording equipment when not being used for stimulation . currently , neurobi is being used preclinically to test spatiotemporally complex patterns of stimulation that have been proposed for suppressing epileptic seizures and is being integrated into an existing closed - loop system for epileptic seizure detection and suppression , . it is also intended that neurobi will be used in a seizure prediction system that probes cortical excitability using subdural electrodes , for cortical mapping prior to surgical resection , and in a closed - loop deep brain stimulation system . whilst the effectiveness of symmetric biphasic waveforms ( as in figure 2 ) for neurostimulation is well established , other waveforms , such as sine waves or asymmetric biphasic pulses , , may provide benefits such as greater neuronal selectivity and/or reduced perceptual thresholds . a stimulator with arbitrary waveform capabilities will allow these concepts to be evaluated , including whether they are safe for chronic use . the capability to simultaneously deliver current to multiple electrodes in a controlled manner would allow advanced stimulation strategies to be applied , such as current steering which has the potential to improve the spatial resolution of retinal prostheses , . a device with the necessary capabilities is required to evaluate the safety and efficacy of such strategies .", "the initial application for neurobi was to evaluate the capabilities of a suprachoroidal retinal prosthesis in visually impaired humans . using neurobi , reproducible phosphenes were successfully elicited in one patient with light perception vision only , suggesting that the suprachoroidal space is a viable implantation site for a retinal prosthesis . the results obtained from subsequent experiments performed using neurobi will guide the design of next - generation devices and progress the development of a commercially viable visual prosthesis that can provide functional vision to the profoundly vision - impaired . the configurability of neurobi also makes it suitable for use in a number of other clinical neurostimulation applications and it is already being used to develop treatments for epilepsy and other neurological disorders . as such , neurobi is a valuable tool for translating clinical research into therapeutic devices ." ]

[ "urolithiasis in children remains endemic in our region afflicting children of < 1 year to 15 years of age . in fact stone disease comprises more than 60% of the urological disease burden in a urology center . many children present late with large stone burden associated with varying degree of renal failure . in developed countries , management of pediatric stone disease has shifted from the historic open surgical procedures to newer minimally invasive techniques ( mis ) , e.g. , shockwave lithotripsy ( swl ) , percutaneous nephrolithotomy ( pcnl ) , ureterorenoscopy ( urs ) utilizing ultrasound and laser as a source of intracorporeal lithotripsy.[35 ] although our experience is similar where mis techniques constitute the mainstay of treatment of patients with stones , large number of stone formers presenting with complex and neglected stones and their geographic / demographic variables still necessitate treatment by open surgery . in this paper , we describe the need and outcome of open surgical procedures in the era of mis from the perspective of a developing country .", "this is a retrospective analysis of 3969 pediatric stone surgeries performed in 3053 patients between january 2004 and december 2008 at a tertiary care urology center . the whole treatment was offered free to all patients on a model based on community government partnership where the infrastructure is provided by the government and funds by the community . this allows our center to provide free comprehensive treatment with the lifelong follow - up . hospital records were reviewed for demographics , area of residence , travel distance , and socioeconomic factors from the medical social department . clinical history , operation notes , pertinent radiographic , and laboratory findings and procedures undertaken were recorded from the patients records . apart from the type of surgery performed , other factors analyzed included stone bulk and complexity , blood transfusions , hospital stay , stone free rates , and intra- and postoperative complications .", "swl was advised for stone size up to 1.5 cm , preferable with normal renal functions , good cortical thickness , no or minimal hydronephrosis , and without urinary tract infection ( uti ) . ultrasound combined with x - ray was used for stone imaging . swl in majority of the children were performed under general anesthesia ; however , in selected older children intravenous sedation has been used . pcnl was performed in patient with stones greater than 1.0 cm , favorable pelvicalyceal anatomy , age more than 1 year , preferably good cortical thickness , and no uti . open surgery was performed in children with large bulk of stones , anatomical abnormalities , marked obstructive cortical atrophy and scarring , gross hydronephrosis , or uti . nephrectomy was performed in end - stage kidneys with stones including pyonephrosis / xanthogranulomatous pyelonephritis . ureteric stones : ureterorenoscopy using holmium : yag ( ho : yag ) laser or pneumatic lithoclast was used to fragment ureteric stones upto 1.5 cm , preferably in lower and midureter . lager stones greater than 1.5 cm , and impacted stones with uti , or with anatomical abnormalities wanting open surgical correction ( ureteroneocystostomy ) were managed by ureterolithotomy . vesical stones : perurethral cystolithotripsy ( pucl ) was performed in stones upto 2.5 cm using pneumatic lithoclast or ho : yag laser . large size stones with uti and lower urinary tract abnormalities were managed by percutaneous cystolithotripsy ( pccl ) and cystolithotomy . furthermore open surgery was undertaken where logistic and economic factors made this modality the preferred choice for the patients .", "swl was advised for stone size up to 1.5 cm , preferable with normal renal functions , good cortical thickness , no or minimal hydronephrosis , and without urinary tract infection ( uti ) . ultrasound combined with x - ray was used for stone imaging . swl in majority of the children were performed under general anesthesia ; however , in selected older children intravenous sedation has been used . pcnl was performed in patient with stones greater than 1.0 cm , favorable pelvicalyceal anatomy , age more than 1 year , preferably good cortical thickness , and no uti . open surgery was performed in children with large bulk of stones , anatomical abnormalities , marked obstructive cortical atrophy and scarring , gross hydronephrosis , or uti . nephrectomy was performed in end - stage kidneys with stones including pyonephrosis / xanthogranulomatous pyelonephritis . ureteric stones : ureterorenoscopy using holmium : yag ( ho : yag ) laser or pneumatic lithoclast was used to fragment ureteric stones upto 1.5 cm , preferably in lower and midureter . lager stones greater than 1.5 cm , and impacted stones with uti , or with anatomical abnormalities wanting open surgical correction ( ureteroneocystostomy ) were managed by ureterolithotomy . vesical stones : perurethral cystolithotripsy ( pucl ) was performed in stones upto 2.5 cm using pneumatic lithoclast or ho : yag laser . large size stones with uti and lower urinary tract abnormalities were managed by percutaneous cystolithotripsy ( pccl ) and cystolithotomy . furthermore open surgery was undertaken where logistic and economic factors made this modality the preferred choice for the patients .", "in the last two decades , over 7235 patients presented with urolithiasis in our outpatient department ( opd ) and emergency room . establishment of a dedicated pediatric stone clinic increased the number of patients many fold as a result about 42% ( 3053 ) presented within the last 5 years . between january 2004 and december 2008 , 3969 surgeries were performed in 3053 patients by minimally invasive methods and/or open surgery [ table 1 ] . the mean age of the patients was 6.35 3.7 with a male - to - female ratio of 2.8:1 and a range of 25 days ( < 1 month ) to 15 years . these patients required initial management in the form of hemodialysis in 210 ( 40.5% ) , peritoneal dialysis in 30 ( 5.7% ) , percutaneous nephrostomy ( pcn ) in 163 ( 31.4% ) , and double j stent placement in 114 ( 22% ) . anatomical abnormalities included complex pelvicalyceal anatomy in 98 , pelviureteric junction obstruction ( pujo ) in 35 , ectopic , horseshoe , cross - fused ectopic kidneys in 40 , and duplex system with nonfunctioning upper or lower moiety in 14 patients . many of the factors were prevalent in combination and about one - third of the open surgeries were performed due to inability to visit the center on multiple occasions either for economic or logistic reasons , i.e. , place of residence several hundred kilometers from the center . of the 3053 patients , 1404 ( 46% ) were from rural areas with a mean travel distance of 175 145 km ( even upto 1000 km ) and a mean travel time of 13 8 h by road transport . of the 1404 patients from rural area , 547 ( 39% ) were managed by open surgery as compared to 362 ( 22% ) of the patients from urban areas . one of the reasons of necessitating open surgery is the large stone burden and this includes partial staghorn and staghorn stones . the mean size of the kidney stone was 5.05 5.88 cm , ureter 1.95 1.33 cm , and bladder 7.6 3.2 cm . stones at multiple sites in 305 ( 26% ) and large stone burden in 440 ( 37.4% ) [ figure 1 ] were other important factors . gross hydronephrosis and thin cortex with thickness in the range 0.3 - 0.6 cm were the other factors . children < 1 year and majority of infants , those with large burden were treated by open surgery . the other group included coagulation disorders , hemoglobinopathies , and comorbids where open surgery was undertaken after corrective measures to avoid similar treatment on repeated occasions for mis . overall success rate was 90% in pcnl , 96% in urs , 100% in cystolithotripsy , and 81% in swl . mean hospital stay , blood requirement , and stone - free rates were similar in pyelolithotomy and pcnl . surgical modalities in pediatric stone formers frequencies of factors necessitating open surgery complex large stone burden . ( a ) large stones at multiple sites specially in right ureter . outcome measures in minimally invasive surgery and open surgery comparison of outcome and complications in various modalities for treatment of renal stones", "advances in technology have changed the management of stone disease . there has been a paradigm shift from open surgical procedures to the era of mis . in developed countries , more than 95% of patients the few that still require open surgery are the patients with anatomical abnormalities and complex large stone burden . in fact open surgery is now a last resort when all else fails with mis . however there is a contrast when it comes to developing countries where open surgery still retains its importance in the armamentarium for the management of stone disease . indications for open surgery from our experience can be divided into two groups first technical which are more or less prevalent in every part of the world . these include anatomical abnormalities , complex and large stones , neglected stones with renal failure , and failed mis and second socioeconomic which are generally specific to developing countries . considering the first criteria , the disease is endemic with large number of patients and a significant proportion of present with complex and large stone burden and many in renal failure . almost 1/5th of our population present in renal failure and other reports from the region give a similar picture with a range of 5 - 15% . this is in contrast to developed countries where the overall burden is small and patients present early due to high degree of awareness , screening , and availability of urological services . in our population , open surgery therefore remains the preferred approach for patients with complex stone burden , specially where these are associated with anatomical abnormalities , e.g. , pelvic uretro junction obstruction ( pujo ) , horseshoe kidneys , pelvic kidney , malrotated kidney , severe obstruction , cortical atrophy and scarring , and with uti or sepsis . socioeconomic factors that necessitate open surgical procedures include poor infrastructure , paucity of urological facilities , and residence of poor patients in the rural areas . considering pakistan as an example of a developing country , the per capita income is $ 1,000 and 33% of the population lives below the poverty line mostly in rural areas and the government expenditure on health is 1.3% of gdp . facilities where available are offered at a cost which is beyond majority of the patients . they therefore seek alternate therapies and only present at tertiary centers when the stone burden has become too large , patients are in sepsis , and/or varying degree of renal failure . these factors combined with poverty , malnutrition , and logistic problems all contribute to the neglected stone disease . therefore when patients travel long distances to the tertiary care centers , they prefer open surgery as one - time treatment because repeated visits are economically not feasible . almost a third of our patients from rural areas preferred open surgery to avoid costs of travel , board and lodge in the city , even though all treatment is offered free at our center . our policy of free treatment , therefore , brings patients to us from far and wide as reflected by the large number of surgeries performed at our center . management of stone disease , therefore , has to be viewed in the context of the technical aspects related to disease pattern and burden and the socio - economic conditions of the patients . presently , at our center 70% of the surgeries are by mis where the number of patients is very large as compared to that which is seen in centers in developed countries with low incidence of stone disease . although mis has enabled us to treat large number of patients with excellent stone - free rates , swl 81% , pcnl 90% , urs 96% , and cystolithotripsy 100% which are comparable to other centers in the world , for the large stone burden with prevalence rate of 10 - 15% mis will have little impact . we therefore have to invest in preventative and awareness strategies to reduce the stone burden . economic forecasts for the region predict that the two reasons that necessitate open surgery are likely to persist in the foreseeable future . therefore mis and open surgery will be required side by side and will remain important components for the management of stone disease .", "minimally invasive surgery is the way forward ; however the pattern of stone disease , patient volume , and overall economy still gives open surgery the therapy of choice status in many situations . therefore the scope of open surgery will remain much wider for a large population of patients for considerable time in developing countries ." ]

[ "patients undergoing orthopedic surgery are of different ages and sizes . regional analgesia and anesthesia are often beneficial for these patients . the choices of anesthesia are as varied as the operations done through the scope , and include general blocks , central neuraxial blocks , peripheral nerve blocks , and intra - articular local anesthetic techniques.1 in the last decade , bupivacaine has been the most frequently used agent for spinal and epidural anesthesia.2,3 in ambulatory surgery , such as diagnostic knee arthroscopy , bupivacaine may delay the recovery of motor function and cause urinary retention , leading to delayed discharge.4,5 unilateral spinal anesthesia is frequently used in lower limb surgery.6,7 several advantages are claimed for this anesthetic technique , including fewer hemodynamic complications,8 selective block on the operated side , avoidance of unnecessary paralysis on the nonoperated side , better mobilization during the recovery period , lower incidence of postoperative urine retention,9 as well as good patient satisfaction.10 to achieve successful unilateral anesthesia , several factors are required , including needle shape and bevel direction , site and speed of injection of anesthetic , volume , baricity , and concentration of the anesthetic solution , as well as an appropriate degree of operating table inclination.11,12 moreover , patient posture is thought to be fundamental in determining the level of anesthesia spread , particularly when a hyperbaric anesthetic solution is used.13 previous studies have failed to determine the ideal dose of local anesthetic to achieve unilateral spinal anesthesia . therefore , our aim was to evaluate the influence of the dose of hyperbaric bupivacaine on the success of unilateral spinal anesthesia by assessment of maximum sensory and motor block on the operative and nonoperative sides during knee arthroscopy and its effect on hemodynamics .", "this study was carried out as a prospective , randomized , double - blind clinical trial . after approval of the local ethics committee and informed patient consent was obtained , 80 male and female patients undergoing diagnostic knee arthroscopy in routine surgical theaters at the suez canal university hospital in ismailia were enrolled in this study . inclusion criteria were american society of anesthesiologists ( asa ) score i ii , age 2150 years , body mass index < 30 kg / m , and height 160180 cm . patients with skin infection at the site of regional anesthesia , coagulopathy , taking anticoagulant drugs , having allergy to local anesthetic drugs , hypovolemia , low fixed cardiac output , neurologic disorder , or spine deformity were excluded from the study . the patients were randomly allocated into four groups ( n = 20 each ) receiving different doses of hyperbaric bupivacaine 0.5% . group 1 received 5 mg , group 2 received 7.5 mg , group 3 received 10 mg , and group 4 received 12.5 mg . all patients were given 2 mg midazolam intravenously as premedication , as well as an intravenous infusion of 7 ml / kg of lactated ringer solution . standard monitoring was used , including noninvasive blood pressure , electrocardiogram , peripheral pulse oximetry , and respiratory rate measurements . all patients were placed in a lateral position on the operative side , while the vertebral column was positioned as horizontally as possible . under complete aseptic technique and after back sterilization , dural puncture was performed using a midline approach at the l3l4 interspace with a 25 gauge spinal needle . using sealed envelopes prepared according to a computer generated randomization table , patients in each group received different doses of bupivacaine ( marcaine spinal heavy , astra , sweden ) , ie , group 1 received 5 mg bupivacaine 0.5% 1 ml , group 2 received 7.5 mg bupivacaine 0.5% 1.5 ml , group 3 received 10 mg bupivacaine 0.5% 2 ml , and group 4 received 12.5 mg bupivacaine 0.5% 2.5 ml . after observation of free flow of cerebrospinal fluid , the spinal needle aperture was turned toward the dependent side and the selected dose of local anesthetic solution was injected slowly with an injection speed of 0.5 ml/10 seconds without further aspiration maneuvers . patients were maintained in the lateral decubitus position for a 20-minute period , after which patients were turned to the supine position.11,14 an independent blinded observer evaluated the evolution of sensory and motor blocks on both sides immediately after turning the patient supine for 20 minutes after the block , and then after 10 minutes . sensory block was assessed as complete loss of sensation to pinprick ( via a 23 gauge hypodermic needle ) . motor block was assessed using a modified bromage scale whereby patients were asked to flex the limb at the hip , knee , and ankle joints , and the results were recorded as 0 = no motor block , 1 = hip blocked , 2 = hip and knee blocked , 3 = hip , knee , and ankle blocked.9 patients were judged ready for surgery when complete loss of pinprick sensation was reported at t12 on the operative limb . postoperative analgesia included oral ketorolac ( 50 mg every eight hours ) , with the first dose administered before surgery by the intravenous route.9 requirement for rescue analgesia was recorded . motor and sensory block was monitored in the postanesthesia care unit at 10-minute intervals until time to complete regression of spinal block . occurrence of adverse events , including nausea , vomiting , pruritus , and urine retention was also recorded . statistical analysis was performed using the program spss version 15 ( spss inc , chicago , il ) . demographic data , onset times to anesthetic block , and surgery times were analyzed by one - way analysis of variance ( anova ) , whereas changes over time were analyzed with a two - way anova for repeated measures . categoric variables were analyzed using contingency table analysis and the chi - square test with the appropriate corrections .", "all patients were placed in a lateral position on the operative side , while the vertebral column was positioned as horizontally as possible . under complete aseptic technique and after back sterilization , dural puncture was performed using a midline approach at the l3l4 interspace with a 25 gauge spinal needle . using sealed envelopes prepared according to a computer generated randomization table , patients patients in each group received different doses of bupivacaine ( marcaine spinal heavy , astra , sweden ) , ie , group 1 received 5 mg bupivacaine 0.5% 1 ml , group 2 received 7.5 mg bupivacaine 0.5% 1.5 ml , group 3 received 10 mg bupivacaine 0.5% 2 ml , and group 4 received 12.5 mg bupivacaine 0.5% 2.5 ml . after observation of free flow of cerebrospinal fluid , the spinal needle aperture was turned toward the dependent side and the selected dose of local anesthetic solution was injected slowly with an injection speed of 0.5 ml/10 seconds without further aspiration maneuvers . patients were maintained in the lateral decubitus position for a 20-minute period , after which patients were turned to the supine position.11,14 an independent blinded observer evaluated the evolution of sensory and motor blocks on both sides immediately after turning the patient supine for 20 minutes after the block , and then after 10 minutes . sensory block was assessed as complete loss of sensation to pinprick ( via a 23 gauge hypodermic needle ) . motor block was assessed using a modified bromage scale whereby patients were asked to flex the limb at the hip , knee , and ankle joints , and the results were recorded as 0 = no motor block , 1 = hip blocked , 2 = hip and knee blocked , 3 = hip , knee , and ankle blocked.9 patients were judged ready for surgery when complete loss of pinprick sensation was reported at t12 on the operative limb . postoperative analgesia included oral ketorolac ( 50 mg every eight hours ) , with the first dose administered before surgery by the intravenous route.9 requirement for rescue analgesia was recorded . motor and sensory block was monitored in the postanesthesia care unit at 10-minute intervals until time to complete regression of spinal block . occurrence of adverse events , including nausea , vomiting , pruritus , and urine retention was also recorded . statistical analysis was performed using the program spss version 15 ( spss inc , chicago , il ) . demographic data , onset times to anesthetic block , and surgery times were analyzed by one - way analysis of variance ( anova ) , whereas changes over time were analyzed with a two - way anova for repeated measures . categoric variables were analyzed using contingency table analysis and the chi - square test with the appropriate corrections .", "there were no significant differences in age , gender , body mass index , and duration of surgery between the patients in the four groups ( table 1 ) . no statistically significant difference was found between the four groups for heart rate changes during surgery ( figure 1 ) . there was a statistically significant decrease in mean arterial blood pressure in group 3 and 4 patients who had been injected with 10 mg and 12.5 mg , respectively . in group 3 , this drop lasted for only 15 minutes and , thereafter returned to near baseline values , while in group 4 this drop remained until the end of the operation ( figure 2 , table 2 ) . sensory block on the nonoperative side was significantly less than that on the operative side . in group 1 and in group 2 , strict unilateral anesthesia was reported among 90% and 85% of patients , respectively , in whom the level of sensory block on the operative side was t10 and t8 , respectively . in groups 3 and 4 , none of the studied patients showed strict unilateral spinal anesthesia and the sensory block in the non - operative side reached t12 and t8 levels , respectively , while the level of sensory block in the operative limb reached t6 and t5 , respectively ( tables 3 , 4 , and 5 ) . motor block on the operative side was statistically significant when compared with the nonoperative side ( p < 0.05 ) . motor block on the operative side in groups 2 , 3 , and 4 was statistically significant compared with motor block on operative side in group 1 , while no statistically significant difference was reported when comparing pairs of the former three groups . unilateral motor block ( modified bromage scale 0 ) was reported in 95% of patients in group 1 , 90% in group 2 , and only 5% in group 3 , while none of the patients in group 4 showed unilateral motor block ( table 6 ) . the time required for regression of motor block ( bromage scale 0 ) was more prolonged with higher doses and the difference was statistically significant . the regression time was 59.8 ( 55100 ) , 98.3 ( 60120),123.9 ( 60150 ) , and 148.9 ( 110180 ) minutes for groups 1 , 2 , 3 , and 4 respectively . the incidence of nausea , vomiting , and urine retention was similar in the four study groups ( table 7 ) .", "the ideal selective spinal anesthesia for knee arthroscopy would provide minimal or no motor blockade at the end of the surgical procedure , such that the patient can be fast tracked.5 using a minidose of lidocaine - fentanyl15 or hyperbaric bupivacaine,16 ben - david et al discharged their knee arthroscopy patients at 145 minutes and 202 minutes , respectively . as regards the hemodynamic effects of different doses of hyperbaric bupivacaine during surgery , no statistically significant differences were found between the four study groups with regard to heart rate changes during surgery . hypotension is a common complication of spinal anesthesia , occurring in 15%17 to 33%18 of patients when larger doses of local anesthetic have been used . unilateral spinal anesthesia with hypobaric or hyperbaric bupivacaine was associated with less hypotension,19,20 which is consistent with our results . in our study , unilateral spinal anesthesia ( regarding sensory block ) was reported by 90% and 85% of patients in group 1 and group 2 , respectively , while in group 3 and group 4 none of the studied patients showed unilateral anesthesia . for motor block , unilateral anesthesia was recorded in 95% of patients in group 1 , 90% in group 2 , and only 5% in group 3 , while none of the patients in group 4 showed unilateral spinal anesthesia . valanne et al21 compared the effect of 4 mg and 6 mg of hyperbaric bupivacaine for spinal anesthesia in 106 ambulatory adult patients undergoing knee arthroscopy . however , rapid regaining of motor function was reported with the lower dose . in our study , the time to regression of motor block was found to be significantly increased with increasing the injected dose of hyperbaric bupivacaine , with mean times of 59.8 , 98.3 , 123.6 and 148.9 minutes in groups 1 , 2 , 3 , and 4 , respectively . in another study , fanelli et al9 compared unilateral and conventional bilateral bupivacaine spinal block in outpatients undergoing knee arthroscopy . in the unilateral group , they used 8 mg of hyperbaric bupivacaine 0.5% in 50 patients in lateral decubitus position after spinal injection was maintained in the unilateral group for 15 minutes . they found that , for the unilateral group , sensory and motor blocks on the operated limb were t9 ( t12t2 ) with a bromage score 0/1/2/3 in 0/2/3/45 patients , respectively , in the unilateral group . two segment regressions of sensory level and home discharge required 81 25 minutes and 281 83 minutes with bilateral block , and 99 28 minutes and 264 95 minutes with unilateral block . borghi et al22 carried out a prospective , randomized , blinded study among 90 asa i and ii outpatients scheduled for elective knee arthroscopy . after placement of the patients in the lateral decubitus position , they received spinal block with 4 , 6 , or 8 mg of 0.5% hyperbaric bupivacaine on the operative side , injected slowly with the needle orifice directed toward the dependent side using a 25-gauge whitacre needle . the maximum level of sensory block on the operative and nonoperative sides was , respectively , t10 ( t12t6 ) and ( < l2 ) in the 4 mg group , t8 ( t12t6 ) and ( < l5 ) in the 6 mg group , and t7 ( t12t5 ) and ( < t10 ) in the 8 mg group . unilateral sensory block was observed in 27 patients in the 4 mg group ( 90% ) , 28 patients in the 6 mg group ( 93% ) , and 23 patients in the 8 mg group ( 77% , p < 0.28 ) . complete unilateral motor block was observed in 29 patients in the 4 mg group ( 97% ) , 28 patients in the 6 mg group ( 93% ) , and 28 patients in the 8 mg group ( 93% , p = 0.80 ) . complete regression of spinal anesthesia required 71 20 minutes in the 4 mg group ( range 40110 minutes ) , 82 25 minutes in the 6 mg group ( range 30160 minutes ) , and 97 37 minutes in the 8 mg group ( range 50 to 120 minutes ) . analysis of side effects showed that the injected dose did not affect the incidence of side effects , such as nausea , vomiting , urinary retention , or need for analgesia . although our study was different from other studies regarding dose , position , and patients being kept on the lateral side for 20 minutes , our results were found to be consistent with earlier ones because higher doses of hyperbaric bupivacaine were associated with higher levels of maximum sensory and motor block and longer duration to achieve regression of sensory block .", "unilateral sensory and motor block , a faster recovery profile , and a stable hemodynamic state can be achieved with doses of 5 mg and 7.5 mg of hyperbaric bupivacaine 0.5% injected slowly through pencil - point directional needles in patients who are maintained in the lateral decubitus position for 20 minutes . however , 7.5 mg of hyperbaric bupivacaine 0.5% was the dose required for adequate unilateral spinal anesthesia with adequate sensory and motor block ." ]

[ "noncompaction cardiomyopathy ( nccm ) is a recently recognized rare disorder [ 1 , 2 ] . it is characterized by prominent myocardial trabecularizations , and deep intertrabecular recesses leading to the spongy appearance of the myocardium . the disease is frequently associated with systolic and diastolic heart failure ( hf ) , ventricular arrhythmias , and systemic embolization . alterations in arterial function have been demonstrated in patients with hf [ 5 , 6 ] . with two - dimensional transthoracic echocardiography ( tte ) , ascending aortic diameter changes during a heart cycle can be measured . when blood pressure data are also available , aortic elasticity can be characterized [ 7 , 8 ] . this study was designed to examine aortic stiffness in nccm patients and to compare these results to age- and gender - matched controls .", "a total of 20 patients with typical echocardiographic features of nccm were investigated [ 3 , 9 ] . clinical assessment included medical and family history , physical examination , electrocardiography , two - dimensional echocardiography , and , in most cases , contrast echocardiography . their results were compared to 20 age- and gender - matched controls without apparent cardiovascular disease . informed consent was obtained from each patient , and the study was approved by the institutional review board and complied with the declaration of helsinki . \n table 1.clinical and demographic data of nccm patientsnccm patientsage ( years)38 16male ( % ) 8 ( 40)diabetes ( % ) 1 ( 5)index eventarrhythmia ( % ) 6 ( 30)heart failure ( % ) 8 ( 40)screening ( % ) 6 ( 30)electrocardiogramatrial fibrillation ( % ) 2 ( 10)lv hypertrophy ( % ) 3 ( 15)left bundle branch block ( % ) 6 ( 30)nccm noncompaction cardiomyopathy clinical and demographic data of nccm patients nccm noncompaction cardiomyopathy previously proposed echocardiographic diagnostic criteria for nccm by jenni et al . were used : ( 1 ) absence of coexisting cardiac anomalies , ( 2 ) segmental , excessive thickening of the left ventricular ( lv ) wall with a two - layered structure : a thin , compacted epicardial layer and a much thicker , noncompacted layer with the characteristic appearance of numerous , prominent trabeculations ( meshwork ) and deep intertrabecular recesses , ( 3 ) color doppler evidence of deeply perfused intertrabecular recesses , and ( 4 ) predominant localization of thickening in the lv apical , midlateral , and midinferior walls . hypertensive heart disease was excluded by clinical and echocardiographic examinations ( septal thickness < 13 mm ) . systolic and diastolic blood pressures ( sbp and dbp , respectively ) were measured in the supine position with an automatic mercury cuff sphygmomanometer from the left arm after 10 min of rest . none of the patients or controls used coffee or tea within 1 h before blood pressure measurements . all patients underwent a complete two - dimensional tte and doppler study using a philips sonos 7500 echocardiography equipment ( philips , best , the netherlands ) in the left lateral decubitus position from multiple windows . the lv wall segments were analyzed according to the 9-segment model as described by jenni et al . . systolic and diastolic ascending aortic diameters ( sd and dd , respectively ) were recorded in m - mode at a level of 3 cm above the aortic valve from a parasternal long - axis view ( fig . 1 ) . the sd and dd were measured at the time of maximum anterior motion of the aorta and at the peak of the qrs complex , respectively . \n 1measurements of systolic ( sd ) and diastolic ( dd ) diameters of the ascending aorta are shown on the m - mode tracing obtained at a level 3 cm above the aortic valve measurements of systolic ( sd ) and diastolic ( dd ) diameters of the ascending aorta are shown on the m - mode tracing obtained at a level 3 cm above the aortic valve aortic stiffness index ( ) was defined as ln(sbp data are reported as means standard deviation . for variables , student s t test and analysis of variance ( anova ) test the reproducibility of the aortic diameter measurements was tested in all nccm patients at both systole and diastole by two independent , blinded observers .", "a total of 20 patients with typical echocardiographic features of nccm were investigated [ 3 , 9 ] . clinical assessment included medical and family history , physical examination , electrocardiography , two - dimensional echocardiography , and , in most cases , contrast echocardiography . their results were compared to 20 age- and gender - matched controls without apparent cardiovascular disease . informed consent was obtained from each patient , and the study was approved by the institutional review board and complied with the declaration of helsinki . \n table 1.clinical and demographic data of nccm patientsnccm patientsage ( years)38 16male ( % ) 8 ( 40)diabetes ( % ) 1 ( 5)index eventarrhythmia ( % ) 6 ( 30)heart failure ( % ) 8 ( 40)screening ( % ) 6 ( 30)electrocardiogramatrial fibrillation ( % ) 2 ( 10)lv hypertrophy ( % ) 3 ( 15)left bundle branch block ( % ) 6 ( 30)nccm noncompaction cardiomyopathy clinical and demographic data of nccm patients nccm noncompaction cardiomyopathy", "were used : ( 1 ) absence of coexisting cardiac anomalies , ( 2 ) segmental , excessive thickening of the left ventricular ( lv ) wall with a two - layered structure : a thin , compacted epicardial layer and a much thicker , noncompacted layer with the characteristic appearance of numerous , prominent trabeculations ( meshwork ) and deep intertrabecular recesses , ( 3 ) color doppler evidence of deeply perfused intertrabecular recesses , and ( 4 ) predominant localization of thickening in the lv apical , midlateral , and midinferior walls . hypertensive heart disease was excluded by clinical and echocardiographic examinations ( septal thickness < 13 mm ) .", "systolic and diastolic blood pressures ( sbp and dbp , respectively ) were measured in the supine position with an automatic mercury cuff sphygmomanometer from the left arm after 10 min of rest . none of the patients or controls used coffee or tea within 1 h before blood pressure measurements .", "all patients underwent a complete two - dimensional tte and doppler study using a philips sonos 7500 echocardiography equipment ( philips , best , the netherlands ) in the left lateral decubitus position from multiple windows . the lv wall segments were analyzed according to the 9-segment model as described by jenni et al . . systolic and diastolic ascending aortic diameters ( sd and dd , respectively ) were recorded in m - mode at a level of 3 cm above the aortic valve from a parasternal long - axis view ( fig . 1 ) . the sd and dd were measured at the time of maximum anterior motion of the aorta and at the peak of the qrs complex , respectively . \n 1measurements of systolic ( sd ) and diastolic ( dd ) diameters of the ascending aorta are shown on the m - mode tracing obtained at a level 3 cm above the aortic valve measurements of systolic ( sd ) and diastolic ( dd ) diameters of the ascending aorta are shown on the m - mode tracing obtained at a level 3 cm above the aortic valve", "aortic stiffness index ( ) was defined as ln(sbp / dbp)/[(sd - dd)/dd ] , where ln is the natural logarithm .", "data are reported as means standard deviation . for variables , student s t test and analysis of variance ( anova ) test", "the reproducibility of the aortic diameter measurements was tested in all nccm patients at both systole and diastole by two independent , blinded observers .", "the presenting symptoms were hf in eight ( 40% ) and arrhythmias in six ( 30% ) patients . the remaining six ( 30% ) asymptomatic patients were nccm relatives and were diagnosed after family screening ( table 1 ) . three hf patients were in nyha - class iii hf and the other five were in nyha - class ii . cardiac medication used in nccm patients were : angiotensin - converting enzyme inhibitors in 13 ( 65% ) , beta - blockers in 11 ( 55% ) , oral anticoagulant therapy in 10 ( 50% ) , diuretics in 8 ( 40% ) , digitalis in 2 ( 10% ) , and nitrate in 1 ( 5% ) . the number of noncompacted segments in the nccm patients was 4.6 2.0 in the nccm group and ( as seen in table 2 ) these patients had significantly increased lv dimensions and reduced lv ejection fraction . aortic stiffness index ( ) was significantly increased in nccm patients compared to controls . for controls , nccm patients with moderate hf , and nccm patients with severe hf , values were 3.5 1.1 , 7.9 5.5 , and 10.4 1.8 , respectively ( p < 0.001 ) . aortic stiffness indices of all individual patients and controls are presented in fig . 2 . \n table 2.transthoracic echocardiographic and blood pressure data in nccm patients and normal subjectsgroup 1 ( normal subjects)group 2 ( nccm patients)lv end - diastolic diameter ( mm)47.4 3.661.0 10.9lv end - systolic diameter ( mm)29.9 2.948.2 12.3lv ejection fraction ( % ) 67.5 5.936.0 17.6systolic aortic diameter ( mm)26.7 4.126.6 4.4diastolic aortic diameter ( mm)23.3 3.824.6 4.3pulsatile change in aortic diameter ( mm)3.4 1.12.0 1.2systolic blood pressure ( mmhg)125.2 12.9120.4 17.4diastolic blood pressure ( mmhg)77.8 8.574.1 9.6aortic pulse pressure ( mmhg)47.4 8.746.3 11.7aortic stiffness index ( )3.5 1.18.3 5.2continuous variables are given as mean standard deviationlv left ventricular , nccm noncompaction cardiomyopathyp < 0.001fig . nccm noncompaction cardiomyopathy transthoracic echocardiographic and blood pressure data in nccm patients and normal subjects continuous variables are given as mean standard deviation lv left ventricular , nccm noncompaction cardiomyopathy individual indices of nccm patients and control subjects . nccm noncompaction cardiomyopathy the mean standard deviation difference in values obtained by two observers for the measurements of aortic diameter at systole was 0.7 2.2 mm , with a correlation coefficient between these independent measurements of 0.88 ( p < 0.01 ) ( figs . the difference between these observations was 0.05 1.95 mm , with a correlation coefficient between observations of 0.9 ( p < 0.01 ) . the difference in values that were detected by observers was within twofold of the standard deviation of the mean ( figs . 3a interobserver correlation ( r = 0.88 , p < 0.01 ) between aortic systolic diameters in nccm patients . b interobserver correlation ( r = 0.9 , p < 0.01 ) between aortic diastolic diameters in nccm patients . nccm noncompaction cardiomyopathy a interobserver correlation ( r = 0.88 , p < 0.01 ) between aortic systolic diameters in nccm patients . b interobserver correlation ( r = 0.9 , p < 0.01 ) between aortic diastolic diameters in nccm patients .", "the presenting symptoms were hf in eight ( 40% ) and arrhythmias in six ( 30% ) patients . the remaining six ( 30% ) asymptomatic patients were nccm relatives and were diagnosed after family screening ( table 1 ) . three hf patients were in nyha - class iii hf and the other five were in nyha - class ii . cardiac medication used in nccm patients were : angiotensin - converting enzyme inhibitors in 13 ( 65% ) , beta - blockers in 11 ( 55% ) , oral anticoagulant therapy in 10 ( 50% ) , diuretics in 8 ( 40% ) , digitalis in 2 ( 10% ) , and nitrate in 1 ( 5% ) .", "the number of noncompacted segments in the nccm patients was 4.6 2.0 in the nccm group and ( as seen in table 2 ) these patients had significantly increased lv dimensions and reduced lv ejection fraction . aortic stiffness index ( ) was significantly increased in nccm patients compared to controls . for controls , nccm patients with moderate hf , and nccm patients with severe hf , values were 3.5 1.1 , 7.9 5.5 , and 10.4 1.8 , respectively ( p < 0.001 ) . table 2.transthoracic echocardiographic and blood pressure data in nccm patients and normal subjectsgroup 1 ( normal subjects)group 2 ( nccm patients)lv end - diastolic diameter ( mm)47.4 3.661.0 10.9lv end - systolic diameter ( mm)29.9 2.948.2 12.3lv ejection fraction ( % ) 67.5 5.936.0 17.6systolic aortic diameter ( mm)26.7 4.126.6 4.4diastolic aortic diameter ( mm)23.3 3.824.6 4.3pulsatile change in aortic diameter ( mm)3.4 1.12.0 1.2systolic blood pressure ( mmhg)125.2 12.9120.4 17.4diastolic blood pressure ( mmhg)77.8 8.574.1 9.6aortic pulse pressure ( mmhg)47.4 8.746.3 11.7aortic stiffness index ( )3.5 1.18.3 5.2continuous variables are given as mean standard deviationlv left ventricular , nccm noncompaction cardiomyopathyp < 0.001fig . nccm noncompaction cardiomyopathy transthoracic echocardiographic and blood pressure data in nccm patients and normal subjects continuous variables are given as mean standard deviation lv left ventricular , nccm noncompaction cardiomyopathy individual indices of nccm patients and control subjects .", "the mean standard deviation difference in values obtained by two observers for the measurements of aortic diameter at systole was 0.7 2.2 mm , with a correlation coefficient between these independent measurements of 0.88 ( p < 0.01 ) ( figs . the difference between these observations was 0.05 1.95 mm , with a correlation coefficient between observations of 0.9 ( p < 0.01 ) . the difference in values that were detected by observers was within twofold of the standard deviation of the mean ( figs . 3a interobserver correlation ( r = 0.88 , p < 0.01 ) between aortic systolic diameters in nccm patients . b interobserver correlation ( r = 0.9 , p < 0.01 ) between aortic diastolic diameters in nccm patients . nccm noncompaction cardiomyopathy a interobserver correlation ( r = 0.88 , p < 0.01 ) between aortic systolic diameters in nccm patients . b interobserver correlation ( r = 0.9 , p < 0.01 ) between aortic diastolic diameters in nccm patients .", "nccm is a recently recognized disorder characterized by a loosened , spongy myocardium associated with a high incidence of progressive systolic and diastolic hf . in recent studies , alterations have been demonstrated in arterial function in patients with chronic hf [ 1114 ] . to the best of authors s knowledge , this is the first time that the aortic distensibility in a series of nccm patients was examined . in this study , increased aortic stiffness index ( ) was found in nccm patients compared to age- and gender - matched controls . in prior studies , it has been shown that pulsatile changes in ascending aortic vessel diameter can be indirectly measured during routine tte . stefanadis et al . found that noninvasive measurements of aortic distensibility were as accurate as invasive methods . aortic stiffness index ( ) relies on aortic and blood pressure data and is one of the most frequently used parameters to characterize arterial stiffness [ 7 , 8 ] . increased aortic stiffness is an independent risk factor , predictor of cardiovascular mortality , and a contributor to lv afterload [ 15 , 16 ] . increased aortic stiffness occurs early during the development of pacing - induced congestive hf in animals [ 17 , 18 ] and has also been described in clinical patients with hf [ 5 , 6 ] , with comparable changes in arterial distensibility in ischemic and idiopathic dilated cardiomyopathy . . demonstrated that the distensibility of the proximal aorta is markedly reduced in older patients with hf due to lv systolic dysfunction beyond the changes from the aging process . giannattasio et al . described that arterial compliance is impaired in congestive hf , and although more marked in severe congestive hf , the impairment is manifested in mild congestive hf as well . nakamura et al . described vascular hypertrophic remodeling and endothelial dysfunction - associated alterations in vascular wall elastic properties in limb muscle conduit arteries in patients with congestive hf . poelzl et al . described an intriguing relationship between phenotype changes and functional impairment in peripheral conduit arteries of hf patients . neurohormonal changes associated with hf include an increase in sympathetic drive and an activated renin angiotensin system resulting in increased plasma norepinephrine levels causing vasoconstriction and sodium retention [ 2023 ] . early atheromatous changes and endothelial dysfunction can also be associated with hf , and can affect vascular elasticity . however , there is also an interaction between aortic stiffening and hf . aortic stiffening can increase lv load causing lv stiffening with increased wall tension , early impairment in diastolic lv relaxation , and contractility inducing lv hypertrophy and fibrosis [ 26 , 27 ] . these results suggest that aortic stiffness may contribute to the progression of systolic and diastolic lv dysfunctions .", "during this study , brachial cuff pressure measurement instead of a direct assessment of aortic pulse pressure by catheter was used . however , previous studies demonstrated an excellent correlation in aortic distensibility measured by invasive and noninvasive methods . coronary artery disease is correlated with increased aortic stiffness and was not excluded in most but not in all our patients by coronary angiography . the aortic elastic properties of control patients were somewhat larger than those described in the literature . the reason for this can be the larger body mass index ( 29.0 5.1 kg / m ) in our controls . however , a relatively higher in the normal subjects in our study only strengthens the abnormal findings in the nccm patients .", "increased aortic stiffness can be observed in patients with nccm with moderate to severe hf ." ]

[ "peribiliary cysts are cystic dilatations of the peribiliary glands of the liver hilum and portal tracts , which lack communication with the lumen of the biliary tree [ 1 , 2 ] . peribiliary cysts are often under diagnosed , however , as they are usually asymptomatic and the reported prevalence based on imaging diagnosis is only 9% in among patients with cirrhosis . they are therefore often discovered incidentally , though rarely can lead to symptoms such as obstructive jaundice , and intrahepatic ductal dilatation on cholangiography , which may be misinterpreted as intrahepatic or hilar cholangiocarcinoma ( cca ) [ 1 , 6 ] . misdiagnosis of peribiliary cysts as cca in patients with decompensated cirrhosis may lead delay or denial in listing an otherwise suitable candidate for orthotopic liver transplantation ( olt ) . we present a case of a patient awaiting olt , with a new finding of intrahepatic biliary ductal dilatation initially thought to be secondary to cca , but ultimately diagnosed as multiple peribiliary cysts .", "his decompensations included hepatic encephalopathy and ascites for which he underwent transjugular intrahepatic portosystemic shunt procedure . in may 2015 , the patient was hospitalized for acute on chronic liver failure , with a rise in his model for end - stage liver disease ( meld ) score from 19 to 35 . on physical examination , he had jaundice , abdominal distension and bilateral peripheral edema . initial blood tests revealed an alkaline phosphatase at 599 u / l ( reference < 125 u / l ) and total bilirubin at 13.6 ( direct bilirubin 11.6 ) . u / l ( normal 045 u / l ) and aspartate transaminase ( ast ) 358 u / l ( normal 035 u / l ) . carbohydrate antigen 19 - 9 ( ca 19 - 9 ) was normal at 4 . baseline hepatic function tests from 2 weeks prior revealed an alkaline phosphatase of 93 , total bilirubin of 6.4 , direct bilirubin of 2.7 , alt of 23 , ast of 85 and inr of 2 . magnetic resonance imaging ( mri ) of the abdomen revealed increased t2 signal intensity within the bile ducts and significant dilation predominantly of the left biliary ductal system , with a lesser dilation of the right - sided bile ducts ( fig . 1 ) . this was a new finding as compared to imaging from 6 months prior to hospitalization . the cholestatic pattern of liver enzyme abnormality and new biliary ductal dilatation in the absence of choledocholithiasis or a pancreatic head mass was concerning for cca . \n figure 1:mri abdomen demonstrating increased t2 signal intensities along the left bile ducts and to lesser extent the right bile ducts . mri abdomen demonstrating increased t2 signal intensities along the left bile ducts and to lesser extent the right bile ducts . endoscopic ultrasound ( eus ) demonstrated a complex cystic mass at the hilum measuring 29.8 28.6 mm . endoscopic retrograde cholangiopancreatography ( ercp ) revealed an irregular common hepatic duct with a stricture at the hilum and a stricture of the left intrahepatic duct , with proximal intrahepatic ductal dilation ( fig . there was suspicion that the liver hilum was biopsied rather than the targeted cystic mass , thus cca could not be ruled out . the decision was made to perform a biopsy of the cystic mass at the time of olt and to abort transplantation if there was evidence of malignancy . \n figure 2:ercp demonstrating mild - to - moderate intrahepatic ductal dilatation with multifocal biliary strictures . ercp demonstrating mild - to - moderate intrahepatic ductal dilatation with multifocal biliary strictures . in june 2015 , the patient underwent olt . both manual inspection and frozen section examinations of four lymph nodes from the portal structures and the distal margin of the common bile duct ruled out malignancy . examination of the explant revealed a 4.0 3.5 2.0 cm cystic area at the hilum , 0.2 cm from the bile duct margin . the cysts appeared to run adjacent to the right and left hepatic ducts and caused focal narrowing of the bile duct lumen with proximal biliary ductal dilatation . figure 3:the liver was grossly cirrhotic with an ill - defined lesion consisting of multiple variably sized cystic spaces in the hilar area that did not communicate with the bile ducts . \n sections of the cystic spaces showed variably sized cystic structures predominately lined by simple cuboidal to columnar biliary - type epithelium . the liver was grossly cirrhotic with an ill - defined lesion consisting of multiple variably sized cystic spaces in the hilar area that did not communicate with the bile ducts . sections of the cystic spaces showed variably sized cystic structures predominately lined by simple cuboidal to columnar biliary - type epithelium .", "peribiliary cysts may present a diagnostic challenge in the patient with end - stage liver disease , due to the possibility of being mistaken for cholangiocarcinoma [ 3 , 7 ] . such a misdiagnosis can result in delay in listing for olt or even inappropriate exclusion from transplantation , in otherwise acceptable candidates . therefore , awareness of this condition is of critical importance to the transplant physician and surgeon . the ideal imaging modalities to identify peribiliary cysts include magnetic resonance cholangiography / pancreatography ( mrcp ) and drip infusion cholangiographic computed tomography ( dic - ct ) . while mri can demonstrate the presence of cysts , a diagnostic feature of peribiliary cysts is their lack of communication with the biliary tree . this can be confirmed using mri with 2d and 3d mrcp sequences , where the cysts appear as a string of bead - like lesions along the hepatic hilum and/or bile ducts . dic - ct is another option to diagnose peribiliary cysts , though prior reports where peribiliary cysts were diagnosed by dic - ct were in patients without liver disease . dic - ct may have a limited role in identifying peribiliary cysts in patients with decompensated cirrhosis since it requires normal hepatic function to clearly depict the bile ducts . hepatic dysfunction and hyperbilirubinemia are known to result in insufficient delineation of the bile ducts when using dic - ct . therefore , mrcp may be a better modality for identifying peribiliary cysts in those with end - stage liver disease . in our patient , the diagnosis of peribiliary cysts was not made until explant examination despite performance of mri without mrcp , eus and ercp . although the patient did not undergo mrcp , the combination of mri and ercp could have led to a diagnosis of peribiliary cysts prior to examination of the explant . our case , therefore , demonstrates the importance to the transplant community of being cognizant of this condition , and further suggests that a diagnosis of peribiliary cysts should be considered in patients with cirrhosis who present with intrahepatic biliary dilatations and obstructive jaundice . in conclusion , we present a case which demonstrates that peribiliary cysts may present with imaging findings concerning for cca . imaging with mrcp and dic - ct can make a definitive diagnosis , though the degree of hepatic dysfunction may limit the usefulness of dic - ct . the diagnosis of peribiliary cystic disease should be considered in patients with end - stage liver disease who present with cholestasis and biliary ductal dilatation , along with negative biopsy of the biliary ductal system for malignancy .", "" ]

[ "a 49-year old woman presented in october 2007 with abdominal bloating , pain , and obvious ascites . after imaging data was obtained , in december 2007 the patient underwent total abdominal hysterectomy ( tah)/bilateral salpingo - oophorectomy ( bso ) and debulking surgery to remove as much of the tumour as possible . after surgery the patient was diagnosed with serous ovarian adenocarcinoma , stage iii c. first - line chemotherapy was the recommended taxol / carboplatin combination standard - of - care for 3 cycles , which finished in march 2008 . in june 2010 the patient relapsed and there was recurrence of disease , presenting as rapidly accumulating ascites . the patient was rechallenged with platinum second - line ; treatment was taxol / carboplatin for 6 cycles , which was completed in october 2010 . the patient then agreed to participate in a phase ii study investigating the ca-125 doubling time in patients with advanced disease treated with tamoxifen citrate . in april 2011 there was recurrence of disease , and in august 2011 the patient received trabectedin + pld combination for 5 cycles as fourth - line therapy . the patient achieved a good clinical response according to ca-125 measurement , and the chemotherapy was stopped given the good clinical status of the patient . in january 2012 the patient experienced disease progression and received subsequent treatment with gemcitabine / carboplatin / bevacizumab combination therapy for 6 cycles , plus bevacizumab 15 mg / kg every 3 weeks as maintenance therapy . in june 2013 the patient experienced further disease progression and received taxol / carboplatin as weekly treatment for 6 cycles until january 2014 , after which the patient 's disease was stable . disease recurrence occurred in march 2014 , with ascites , para - aortic lymph node involvement , and peritoneal disease . the patient was subsequently re - challenged with trabectedin + pld as seventh - line of chemotherapy . 1a ) , and ct imaging showed a clinical response and improvement in symptoms ( fig . the dose of trabectedin + pld was adjusted for this patient due to grade 3 fatigue . the trabectedin dose was reduced from 1.1 to 0.9 mg / m , and pld was reduced from 30 to 25 mg / m . the management plan for this patient is to continue treatment with trabectedin + pld until disease progression . the patient has finished 11 cycles so far and is still in remission , and continues to do well . in summary , this case study describes a new concept in the management of a roc patient who has received 7 different lines of chemotherapy and has experienced recurrent disease . trabectedin + pld combination was effective as a non - platinum / non - taxane alternative to intercalate between platinum - based therapies . in fact , trabectedin has been administered for 6 or more cycles in 52% of patients treated with the combination dose and schedule respectively . the combination regimen has been used for up to 21 cycles , and no cumulative toxicities have been observed in patients treated with multiple cycles . so whilst doxorubicin is limited by its cumulative dose due to cardiotoxicity , trabectedin plus pld can be used to disease progression . in the case study described here the patient is doing well , and will continue maintenance treatment with trabectedin + pld , with repeat echo every 12 weeks , until disease progression .", "as with all cytotoxic regimens there are some practical considerations to treating patients with trabectedin + pld . infusion at a dose of 1.1 mg / m , immediately after pld 30 mg / m , for the treatment of ovarian cancer ( fig . the following steps must be taken when administering the combination : \n all patients must receive corticosteroids e.g. 20 mg of dexamethasone i.v . infusion of trabectedin 1.1 mg / m , immediately after pld , every 3 weeks through a central venous line all patients must receive corticosteroids e.g. 20 mg of dexamethasone i.v . infusion of trabectedin 1.1 mg / m , immediately after pld , every 3 weeks through a central venous line as with other cytotoxic regimens , monitoring of patients receiving trabectedin + pld is recommended ( box 1 ) . the patient must satisfy the following criteria for initiation of treatment and prior to each re - treatment : \n absolute neutrophil count ( anc ) 1,500/mmplatelet count 100,000/mmbilirubin upper limit of normal ( uln)alkaline phosphatase 2.5 uln ( consider hepatic isoenzymes 5-nucleotidase or gamma glutamyl transpeptidase ( ggt ) to determine whether the elevation is of hepatic or osseous origin.albumin 25 g / l.alanine aminotransferase ( alt ) and aspartate aminotransferase ( ast ) 2.5 mol / l ) or creatinine clearance 60 ml / mincreatine phosphokinase ( cpk ) 2.5 ulnhaemoglobin 9 g / dl absolute neutrophil count ( anc ) 1,500/mm platelet count 100,000/mm bilirubin upper limit of normal ( uln ) alkaline phosphatase 2.5 uln ( consider hepatic isoenzymes 5-nucleotidase or gamma glutamyl transpeptidase ( ggt ) to determine whether the elevation is of hepatic or osseous origin . alanine aminotransferase ( alt ) and aspartate aminotransferase ( ast ) 2.5 uln serum creatinine 1.5 mg / dl ( 132.6 mol / l ) or creatinine clearance 60 ml / min creatine phosphokinase ( cpk ) 2.5 uln otherwise treatment should be delayed and/or reduced for up to 3 weeks until the criteria are met , as highlighted in the case study above ( box 2 ) .", "a single institution 's experience with trabectedin + pld combination , as a non - platinum / non - taxane alternative to intercalate between platinum - based therapies is reported here . a real - life case study is presented of a heavily - treated patient with advanced disease who was treated with trabectedin + pld fourth - line and subsequently rechallenged at seventh - line , who continues to do well on treatment . this case study demonstrates the utility of the combination at any line of relapse in roc patients with advanced disease .", "professor tahir received speaker fees from pharmamar for his participation at the bgcs 2014 symposium ." ]

[ "song et al.1 first reported the anterolateral thigh ( alt ) flap as a septocutaneous flap based on the descending branch of the lateral circumflex femoral artery ( lcfa ) in 1984 . recently , the alt flap has become a popular option for soft tissue reconstruction of the oral cavity23 . it is easily raised and has long and good caliber vascular pedicles with suitable vessel diameter , different tissues with large amounts of skin are available , and there is minimum morbidity at the donor site2 . however , the alt flap has been criticized due to variations in vascular pedicles and perforator anatomy , making flap elevation challenging4 . kimata et al.5 and kawai et al.6 reported anatomical variations in the alt flap in the japanese population and surgical concerns regarding dissection of the flap . valdatta et al.7 and yu8 reported flap characteristics in the western population . the alt flap is mostly supplied by one to three perforators of the descending branch of the lcfa . it can be located clinically by measuring the midpoint of a line drawn from the anterior superior iliac spine ( asis ) to the superolateral border of the patella . however , there is some variation in the location of these perforators . in addition , the oblique branch of the lcfa often runs between the descending and the squatransverse branches of the lcfa9 . however , many reports have shown that harvested alt flap has more musculocutaneous perforators ( up to 87%)13 . in the present study , we investigated the surgical anatomy of the alt flap in a series of eight cases , focusing on the pattern of perforators and variation in pedicle course compared with previous studies .", "cases of reconstructive surgery using alt free flaps were enrolled from the database of all patients who underwent ablative surgery for oral and maxillofacial cancers from 2014 to 2015 in the department of oral and maxillofacial surgery in asan medical center ( seoul , korea ) . eight patients were included in the study , and their medical records were carefully reviewed . demographic data included gender , age , pathological data , tumor stage , primary site , and whether adjuvant raidotherapy was performed . operative records were reviewed regarding flap size , thickness , pedicle length , and anastomosis of vessels . the number of perforators included in the skin peddle was counted , and the perforators feeding skin were investigated as to whether they ran through the septum in the vastuslateralis muscle ( septocutaneous ) or through the intramuscular portion ( musculocutaneous).(fig . 1 ) yu8 and urken et al.10 noted that the course of the main pedicle in alt free flaps derived from three origins of the lcfa . variation in the pedicle course was recorded according to classification as types i , ii , and iii . in type i , the vascular pedicle derives from the descending branch of the lcfa , and that in type ii from the transverse branch of the lcfa . 2 ) we considered the pedicles of type iii unusable , as did yu8 and urken et al.10 , due to the small caliber and short length . therefore , patients with type iii variation were excluded because it was not possible to use the alt flap . the study protocol was reveiwed and approved by the institutional review board of asan medical center ( s2016 - 1056 - 0001 ) .", "the mean age of patients was 61 years , and the male to female ratio was 4:4 . the eight cases comprised six squamous cell carcinomas , one adenoid cystic carcinoma , and one osteosarcoma . ( table 1 ) microvascular reconstructions with alt free flaps were performed for all surgical defects in the maxilla ( five cases ) , buccal mucosa ( two cases ) , and floor of the mouth ( one case ) . ( table 1 ) the mean flap size was 10.05.6 cm , and the mean thickness was 1.0 cm . lcfas were anastomosed with the facial artery in four cases , superior thyroid artery in two cases , and superficial temporal artery in two cases . in vein anastomosis , one or two venae comitantes were used , and recipient veins included the facial , superior thyroid , superficial temporal , external jugular , and branches of internal or external jugular veins.(table 2 ) all flaps successfully survived . although one case showed partial necrosis at the edge of flap , it did not affect the result of reconstruction . 3 ) type i pedicles were present in five patients , and type ii pedicles in three patients who needed intramuscular dissection for flap elevation . however , type iii pedicles , which are reported to occur in 1% to 5% of patients810 , were not observed in the eight cases.(table 3 )", "it has moderate thickness , low morbidity at the flap donor site , long pedicle length , and appropriate vessel diameter . in addition , a simultaneous two - team approach can be used , with the feasibility of two skin islands based on two separate cutaneous perforators28 . with these advantages , the alt flap has become the workhorse for oral and maxillofacial reconstruction . in our serial cases , flaps of various sizes were elevated according to defect size in the oral and maxillofacial area , which ranged from 4 to 7 cm in width and 7 to 12 cm in length . harvested soft tissue of these sizes was considered adequate to cover most defects caused by resection of oral and maxillofacial cancers except in rare cases of a huge tumor mass that might be inoperable or should only be covered by a latissimus dorsi flap . in a study of alt flap characteristics in the western population by yu8 , the mean flap thickness was 19.9 mm in women and 12.9 mm in men . nakayama et al.11 reported the average thickness of alt flap in asian population to be 7.1 mm , with intermediate thickness of subcutaneous fat compared to other free flaps used in oral and maxillofacial reconstruction such as the radial forearm free flap and rectus abdominis flap . the thickness of the harvested flap in our cases ranged from 0.6 to 1.5 cm ( mean , 1.0 cm ) , which was comparable to the previous results . a flap thickness of about 20 mm might be the limit for use in soft tissue reconstruction of the oral and maxillofacial area , especially for the buccal mucosa and tongue except in total glossectomy . in our study , the maximum thickness of an alt flap was 1.5 cm . the thickness of the alt flap was considered appropriate for oral and maxillofacial defects regardless of gender . urken et al.10 reported that the vascular pedicle of alt flaps varied from 8 to 16 cm , although this could vary depending on patient stature , extent of proximal dissection of the lcfa , and location of skin perforators . the length of pedicles in alt free flaps might be not a limitation for reconstruction of oral and maxillofacial area . in our series , there were no problems related to pedicle length , even when used for large defects in the maxilla with microvascular anastomosis of the flap to neck vessels such as the facial , superior thyroid , and superficial temporal vessels . despite these many advantages , the complicated distribution of feeding perforators and the anatomical variation of pedicle courses in the muscular structures of the alt area yu8 reported that perforators are most consistently located around the midpoint of the reference line from the asis to the superolateral border of the patella . kimata et al.5 also reported that cutaneous perforators were concentrated near the midpoint of this reference line . chana and wei12 reported that the majority of skin perforators were located within a circle of 3 cm radius centered at this midpoint . xu et al.13 reported that at least one perforator was located in the inferolateral quadrant of this circle in 80% of cases . however , choi et al.2 reported that the cutaneous perforators were broadly distributed from 4/10 to 8/10 area between the asis and the superolateral border of the patella . in this study , the flaps in four cases included one perforator , and the flaps in the other four cases included two perforators . however , the number of perforators did not affect the survival or viability of the harvested flaps . we could find at least one main perforator in a circle of 3 cm radius centered at the midpoint of the reference line . feeding perforators can be classified into two categories : septocutaneous perforators , which were first reported by song et al.1 , run in the intermuscular space , and musculocutaneous perforators penetrate the vastus lateralis muscle14 . valdatta et al.7 reported that only five of 34 perforators identified were septocutaneous ( 14.7% ) . kimata et al.5 reported that 31 of 171 perforators ( 18.1% ) were septocutaneous perforators . in 38 elevations of alt flaps from a total of 160 perforators in a cadaver study by choi et al.2 , 28 perforators ( 17.5% ) were septocutaneous and 132 perforators ( 82.5% ) were musculocutaneous . similarly , xu et al.13 and zhou et al.15 reported that septocutaneous perforators were found in 40.8% of 42 cadavers and in 37.5% of 32 patients . these studies suggest that the blood supply of the alt flap is mostly derived from musculocutaneous perforators . therefore , a more refined surgical technique is required to dissect these perforators through the vastus lateralis muscle2 . this additional procedure was time - consuming and cumbersome , but did not affect the design or size of flap that could be harvested . the second important consideration is the course of the main pedicle of the alt free flap . 2 ) in type i , the most common ( 90% ) , the descending branch sends off one to three cutaneous perforators to the flap . surgical dissection type ii accounts for 4% of the cases and requires tedious dissection to free the pedicle from the vastus lateralis along its entire length16 . , the alt flap can not be used for free tissue transfer , and the cutaneous perforator is a direct branch of the profundus femoris vessels . it pierces the rectus femoris muscle to reach the skin and is therefore more anteriorly located . because of the small caliber and short pedicle length , however , it has been reported that the flap could be converted to an anteromedial thigh flap1017 . in our cases , the alt free flap could be used for reconstruction of various soft tissue defects , including those of relatively large size . . some anatomical variations , such as the distribution of perforator and courses of pedicles , might be a barrier for the application of alt free flap to various reconstruction cases . however , these problems can be overcome with an understanding of anatomical variation and meticulous surgical dissection .", "alt free flaps are considered reliable options for reconstruction of soft tissue defects of the oral and maxillofacial area ." ]

[ "diabetic retinopathy is the most common complication in diabetes.1,2 it is a chronic , progressive , potentially sight - threatening disease of the retinal microvasculature that is associated with prolonged hyperglycemia and other conditions linked to diabetes mellitus such as hypertension.3 the threat to sight is due to either growth of new vessels leading to intraocular hemorrhage and possible retinal detachment with profound sight loss or localized damage to the macula of the eye with loss of central visual acuity.3 grading of diabetic retinopathy is based on visible signs of increasing severity on ophthalmoscopy and on imaging . diabetic retinopathy is classified as proliferative or nonproliferative ( background / preproliferative ) retinopathy based on the presence or absence of abnormal new vessels , respectively . subgroups of nonproliferative diabetic retinopathy ( mild , moderate , preproliferative ) reflect increasing severity of the disease , which consequently results in shortening of screening intervals.4 nonproliferative diabetic retinopathy is typically managed by optimizing the patient s general health . it is hypothesized that this technique reduces the amount of ischemic retina , and thus the production of angiogenic molecules . diabetic maculopathy is divided into three types , based on whether it causes focal , ischemic or diffuse edema , and may include tractional ( vitreoretinal ) or nontractional ( intraretinal ) components.3 the management of diabetic macular edema has advanced significantly with the introduction of anti - vegf ( vascular endothelial growth factor ) treatments.3 however , macular laser treatment still plays a major role in treating noncenter - involving macular edema.5 vision loss due to diabetic retinopathy is one of the leading causes of visual loss worldwide and is an important cause of impaired vision and disability in the working - age population.6,7,8 advanced diabetic eye disease has a negative influence on quality of life.6 therefore , eye screening for the diabetes population aims to identify patients with early signs of sight - threatening disease to facilitate efficient treatment and prevent loss of sight .", "the danish registry of diabetic retinopathy ( diabase ) was established to monitor the development of diabetic eye disease in denmark and to evaluate the accessibility and effectiveness of diabetic eye screening programs with focus on interregional variations.9 the main aim of the registry is to enable evaluation of quality of care for patients with diabetic eye disease .", "the target population includes all patients diagnosed with diabetes in denmark . at present , denmark ( 5.5 million inhabitants ) has ~320,000 diabetes patients with an annual increase of ~27,000 newly diagnosed patients.10 the prevalence of diabetes in denmark has more than doubled since 1996 and was 5737 per 100,000 people in 2012.10 diabase contains data on all diabetes patients aged 18 years who attend screening for diabetic eye disease in the five regions of denmark . eye examination of children with diabetes is recorded in the children diabetes registry ( dandiabkids [ children and teenagers with diabetes < 18 years old ] ) . in 2011 , the adult diabetes registry ( adult patients with diabetes from 18 years old ) , the diabase , and the dandiabkids joined to form the danish diabetes database.9 diabase receives data collected from hospital eye departments and private ophthalmological practices where diabetes patients aged 18 years attend diabetic eye screening . in denmark , diabetes care is managed by both primary care physicians in private practice and hospital - based endocrinologists . diabetic eye screening for most patients attending their primary care physician is delivered by an ophthalmologist in private practice . patients being followed in endocrinology departments receive diabetic eye screening in the eye department of the respective hospital . an annual report analyzing diabetes screening data from the previous year is issued every spring by the steering committee . the systematic collection of outpatient data from hospitals in denmark started in 2007 and was extended nationwide in 2010 . data collection on patients screened by ophthalmologists in private practice started in 2013 . in 20142015 , the registry included data from 77,968 diabetes patients;11 of these patients , 57,985 had been screened by ophthalmologists in private practice , whereas 20,291 patients had been screened in hospitals.11", "key quality indicators for diabase were selected according to international standards for good clinical practice : two process indicators to examine efficiency and three performance indicators to examine outcome9 ( table 1 ) . indicator measurements are based on the collection of data with regard to the following main variables:9 \n registering screening unitpatient name and unique danish identification numberdate of screening visitindication for screeningprevious eye surgerybest corrected visual acuityscreening method ( slit lamp examination or retinal photography)diabetic retinopathy and maculopathy grading according to wilkinson et al12quality of screening photographdefinition of next examination ( screening , treatment)interval to next screening visit . registering screening unit patient name and unique danish identification number date of screening visit indication for screening best corrected visual acuity screening method ( slit lamp examination or retinal photography ) diabetic retinopathy and maculopathy grading according to wilkinson et al12 quality of screening photograph definition of next examination ( screening , treatment ) interval to next screening visit . the data on diabetes type and duration of disease are recorded in the adult diabetes registry .", "a diabase report containing calculations of the key indicators is published every year . at annual meetings , data issues , interregional variations , and definition of indicators diabase identifies patients with newly diagnosed maculopathy as diabetic maculopathy , newly diagnosed . in case of treatment for diabetic eye disease after completion of treatment , patients re - enter regular diabetic eye screening and are described as resumed routine screening.9 patients with treated diabetic maculopathy are recorded in the category treated maculopathy , stable . diabase classifies treated patients as laser - treated proliferative diabetic retinopathy , stable . in case of relapse requiring additional laser treatment , patients are labeled laser - treated proliferative diabetic retinopathy , recurrence . until 2013 , this indicator measured the proportion of diabetes patients who received eye screening at least every 2 years . however , the interval for screening visits should be tailored to the severity of disease.4,5 to provide the basis for individualized eye screening intervals , the definition of this indicator was changed to measure the proportion of patients who were screened within the defined time interval ( table 2 ) . neither hospital eye departments nor ophthalmologists in private practice met the standard for this variable ( at least 90% of patients should obtain eye screening within the defined interval ) . as this is the first year , this indicator is calculated in its altered state , the amount of data collected is still insufficient to provide a proper analysis . the nationwide prevalence of nonproliferative diabetic retinopathy is 18% , with 47% of patients screened in hospitals and 14% by ophthalmologists in private practice ( table 3 ) . mild nonproliferative diabetic retinopathy alone contributes to 13% , while 78% of diabetes patients do not have diabetic retinopathy . however , there are differences between patients screened in hospitals and by ophthalmologists in private practice . eighty - six percent of patients screened by ophthalmologists in private practice display no retinopathy , with minor interregional variations . only 53% of patients screened in hospitals have no diabetic retinopathy , with a wide interregional disparity . these numbers indicate that a higher proportion of patients with more severe diabetes are being treated in hospital departments compared to private ophthalmological practice . in the central denmark region , 11% of patients screened in hospitals have proliferative diabetic retinopathy , newly diagnosed , a significantly higher number than in other regions of denmark . even though diabase clearly defines the criteria for classification of preproliferative versus proliferative diabetic retinopathy , regional traditions may play a role in differing interpretations . sight - threatening subtypes ( newly diagnosed and previously treated recurrent proliferative diabetic retinopathy ) comprise 3% of patients . the overall prevalence of patients without diabetic maculopathy is 97% in the registry ( 91% screened in hospitals vs 98% screened by ophthalmologists in private practice ) . only 2% of all patients have newly diagnosed diabetic maculopathy , and an equally small number of patients have stable maculopathy after treatment ( table 4 ) . diabetic retinal changes may progress as well as regress , essentially depending on medical treatment and diabetic control . the proportion of diabetes patients progressing to a more severe level of diabetic eye disease is a key outcome measurement for diabase ( table 5 ) . this requires at least two eye screening visits with retinopathy and maculopathy grading . to calculate this indicator , patients with the poorest - seeing eye and in the most severe stage of disease at the first of the screening visits are excluded from the assessment . furthermore , the proportion of diabetes patients regressing to a milder stage of diabetic eye disease is assessed ( table 6 ) . this also requires at least two eye screening visits with retinopathy and maculopathy grading . to calculate this indicator , patients with the poorest - seeing eye and in the mildest stage of disease ( none ) at the first of the screening visits are excluded from the assessment . in 20142015 , however , this figure is lower than that reported during 20132014 ( 14%).9 five percent of patients screened by ophthalmologists in private practice progress to a more severe disease compared to 15% of patients screened in hospitals . the proportion of patients regressing to a milder stage of disease has been analyzed for the first time in 20142015 . eighteen percent of patients screened in hospitals regress to a milder stage of disease ( interregional variation between 12% and 23% ) . twenty - four percent of patients screened by ophthalmologists in private practice regressed to a milder stage of disease . nonetheless , the percentage of these patients is significantly higher in the north denmark region ( 58% ) than in the other regions , where percentages vary between 19% and 28% . this difference may be based on variations in grading due to region - specific circumstances .", "diabase identifies patients with newly diagnosed maculopathy as diabetic maculopathy , newly diagnosed . in case of treatment for diabetic eye disease , screening is temporarily discontinued . after completion of treatment , patients re - enter regular diabetic eye screening and are described as resumed routine screening.9 patients with treated diabetic maculopathy are recorded in the category diabase classifies treated patients as laser - treated proliferative diabetic retinopathy , stable . in case of relapse requiring additional laser treatment , patients are labeled laser - treated proliferative diabetic retinopathy , recurrence . until 2013 , this indicator measured the proportion of diabetes patients who received eye screening at least every 2 years . however , the interval for screening visits should be tailored to the severity of disease.4,5 to provide the basis for individualized eye screening intervals , the definition of this indicator was changed to measure the proportion of patients who were screened within the defined time interval ( table 2 ) . neither hospital eye departments nor ophthalmologists in private practice met the standard for this variable ( at least 90% of patients should obtain eye screening within the defined interval ) . as this is the first year , this indicator is calculated in its altered state , the amount of data collected is still insufficient to provide a proper analysis . the nationwide prevalence of nonproliferative diabetic retinopathy is 18% , with 47% of patients screened in hospitals and 14% by ophthalmologists in private practice ( table 3 ) . mild nonproliferative diabetic retinopathy alone contributes to 13% , while 78% of diabetes patients do not have diabetic retinopathy . however , there are differences between patients screened in hospitals and by ophthalmologists in private practice . eighty - six percent of patients screened by ophthalmologists in private practice display no retinopathy , with minor interregional variations . only 53% of patients screened in hospitals have no diabetic retinopathy , with a wide interregional disparity . these numbers indicate that a higher proportion of patients with more severe diabetes are being treated in hospital departments compared to private ophthalmological practice . in the central denmark region , 11% of patients screened in hospitals have proliferative diabetic retinopathy , newly diagnosed , a significantly higher number than in other regions of denmark . even though diabase clearly defines the criteria for classification of preproliferative versus proliferative diabetic retinopathy , regional traditions may play a role in differing interpretations . sight - threatening subtypes ( newly diagnosed and previously treated recurrent proliferative diabetic retinopathy ) comprise 3% of patients . the number of patients with recurrence after treatment is very small . one percent of patients are recorded as laser treated and stable . the overall prevalence of patients without diabetic maculopathy is 97% in the registry ( 91% screened in hospitals vs 98% screened by ophthalmologists in private practice ) . only 2% of all patients have newly diagnosed diabetic maculopathy , and an equally small number of patients have stable maculopathy after treatment ( table 4 ) . diabetic retinal changes may progress as well as regress , essentially depending on medical treatment and diabetic control . the proportion of diabetes patients progressing to a more severe level of diabetic eye disease is a key outcome measurement for diabase ( table 5 ) . this requires at least two eye screening visits with retinopathy and maculopathy grading . to calculate this indicator , patients with the poorest - seeing eye and in the most severe stage of disease at the first of the screening visits are excluded from the assessment . furthermore , the proportion of diabetes patients regressing to a milder stage of diabetic eye disease is assessed ( table 6 ) . this also requires at least two eye screening visits with retinopathy and maculopathy grading . to calculate this indicator , patients with the poorest - seeing eye and in the mildest stage of disease ( none ) at the first of the screening visits are excluded from the assessment . in 20142015 , however , this figure is lower than that reported during 20132014 ( 14%).9 five percent of patients screened by ophthalmologists in private practice progress to a more severe disease compared to 15% of patients screened in hospitals . the proportion of patients regressing to a milder stage of disease has been analyzed for the first time in 20142015 . eighteen percent of patients screened in hospitals regress to a milder stage of disease ( interregional variation between 12% and 23% ) . twenty - four percent of patients screened by ophthalmologists in private practice regressed to a milder stage of disease . nonetheless , the percentage of these patients is significantly higher in the north denmark region ( 58% ) than in the other regions , where percentages vary between 19% and 28% . this difference may be based on variations in grading due to region - specific circumstances .", "diabase identifies patients with newly diagnosed maculopathy as diabetic maculopathy , newly diagnosed . in case of treatment for diabetic eye disease , screening is temporarily discontinued . after completion of treatment , patients re - enter regular diabetic eye screening and are described as resumed routine screening.9 patients with treated diabetic maculopathy are recorded in the category diabase classifies treated patients as laser - treated proliferative diabetic retinopathy , stable . in case of relapse requiring additional laser treatment ,", "until 2013 , this indicator measured the proportion of diabetes patients who received eye screening at least every 2 years . however , the interval for screening visits should be tailored to the severity of disease.4,5 to provide the basis for individualized eye screening intervals , the definition of this indicator was changed to measure the proportion of patients who were screened within the defined time interval ( table 2 ) . neither hospital eye departments nor ophthalmologists in private practice met the standard for this variable ( at least 90% of patients should obtain eye screening within the defined interval ) . as this is the first year , this indicator is calculated in its altered state , the amount of data collected is still insufficient to provide a proper analysis .", "the nationwide prevalence of nonproliferative diabetic retinopathy is 18% , with 47% of patients screened in hospitals and 14% by ophthalmologists in private practice ( table 3 ) . mild nonproliferative diabetic retinopathy alone contributes to 13% , while 78% of diabetes patients do not have diabetic retinopathy . however , there are differences between patients screened in hospitals and by ophthalmologists in private practice . eighty - six percent of patients screened by ophthalmologists in private practice display no retinopathy , with minor interregional variations . only 53% of patients screened in hospitals have no diabetic retinopathy , with a wide interregional disparity . these numbers indicate that a higher proportion of patients with more severe diabetes are being treated in hospital departments compared to private ophthalmological practice . in the central denmark region , 11% of patients screened in hospitals have proliferative diabetic retinopathy , newly diagnosed , a significantly higher number than in other regions of denmark . even though diabase clearly defines the criteria for classification of preproliferative versus proliferative diabetic retinopathy , regional traditions may play a role in differing interpretations . sight - threatening subtypes ( newly diagnosed and previously treated recurrent proliferative diabetic retinopathy ) comprise 3% of patients . the overall prevalence of patients without diabetic maculopathy is 97% in the registry ( 91% screened in hospitals vs 98% screened by ophthalmologists in private practice ) . only 2% of all patients have newly diagnosed diabetic maculopathy , and an equally small number of patients have stable maculopathy after treatment ( table 4 ) .", "diabetic retinal changes may progress as well as regress , essentially depending on medical treatment and diabetic control . the proportion of diabetes patients progressing to a more severe level of diabetic eye disease is a key outcome measurement for diabase ( table 5 ) . this requires at least two eye screening visits with retinopathy and maculopathy grading . to calculate this indicator , patients with the poorest - seeing eye and in the most severe stage of disease at the first of the screening visits are excluded from the assessment . furthermore , the proportion of diabetes patients regressing to a milder stage of diabetic eye disease is assessed ( table 6 ) . this also requires at least two eye screening visits with retinopathy and maculopathy grading . to calculate this indicator , patients with the poorest - seeing eye and in the mildest stage of disease ( none ) at the first of the screening visits are excluded from the assessment . in 20142015 , however , this figure is lower than that reported during 20132014 ( 14%).9 five percent of patients screened by ophthalmologists in private practice progress to a more severe disease compared to 15% of patients screened in hospitals . the proportion of patients regressing to a milder stage of disease has been analyzed for the first time in 20142015 . eighteen percent of patients screened in hospitals regress to a milder stage of disease ( interregional variation between 12% and 23% ) . twenty - four percent of patients screened by ophthalmologists in private practice regressed to a milder stage of disease . nonetheless , the percentage of these patients is significantly higher in the north denmark region ( 58% ) than in the other regions , where percentages vary between 19% and 28% . this difference may be based on variations in grading due to region - specific circumstances .", "diabase was established by n andersen in collaboration with the danish ophthalmological society and the organization of danish ophthalmologists in private practice,13 based on the status screening for diabetic retinopathy in denmark.14 the registry is led by a steering committee of medical retina specialists representing the five regions of denmark , the chairman of the danish ophthalmological society , and the chairman of the organization of danish ophthalmologists in private practice . initially , the register was partly funded by hovedstadens sygehusfllesskab ( association of hospitals in the capital region of denmark ) . diabase is funded and operated by the danish clinical registries ( rkkp ) , which is financed and owned by the five danish regions .", "the systematic collection of data from diabetic eye screening in denmark is still in the development process . data analysis from diabase s latest annual report ( 20142015)11 reveals a decrease in the prevalence of diabetic retinopathy from 26% to 22% compared to the previous report ( 20132014 ) , whereas the number of patients diagnosed with diabetes has increased between 1996 and 2012.10 additionally , the proportion of patients with regression ( 20% ) is greater than the proportion of patients with progression ( 10% ) of diabetic retinopathy . the diabase is a useful tool to observe the quality of screening , prevalence , and progression / regression of diabetic eye disease . thus , it contributes to ensure a high quality of care for diabetes patients in denmark . reducing the overall morbidity and mortality associated with diabetes by preventing complications may help to relieve the large economic burden of the disease ." ]

[ "most of the time , chemotherapy works in leukemia patients ; however , despite high remission rate after chemotherapy , relapse always exists . hence , it is highly necessary to find markers that enable the prediction of relapse . monitoring minimal residue disease ( mrd ) is an important clinical factor in the assessment of response to chemotherapy , guiding therapeutic intervention and predicting relapse . there are pressing needs to choose a marker to detect mrd for a greater population of patients . the wt1 gene is located on the short arm of chromosome 11 in locus 11p13 , encoded as a zinc - finger transcriptional factor that has recognized as an important regulator of normal and malignant hematopoiesis , and also , this gene is known to control cellular apoptosis . the expression of wt1 gene in blast leukemia may cause resistance of blast to apoptosis and cause poor clinical outcomes . the normal expression of wt1 is restricted in adults to a few numbers of tissues . in the normal bm , wt1 expression is limited to cd34 + cells and there are not in peripheral blood ( pb ) cells ; therefore , expression of wt1 is limited to early progenitors of the blood system , several studies have demonstrated that wt1 is overexpressed in acute myeloid leukemia ( aml ) , acute lymphoblastic leukemia ( all ) , myelodysplastic syndrome ( mds ) , and blast crisis of chronic myeloid leukemia ( cml ) , and this gene is highly expressed in more than 80% of aml patients in bone marrow ( bm ) and pb in comparison with normal control . this overexpression of wt1 in acute leukemia could thus represent a universal molecular marker of malignant hematopoiesis and is suggested as the usefulness of quantitative assessment of wt1 expression as a marker for mrd . the biological functions of wt1 overexpression in patients with acute leukemia are not clearly understood , but it has been suggested that wt1 affects the pathogenesis of human leukemia during cellular differentiation and growth arrest . low expression of wt1 and high expression of it are accompanied with clinical remission and relapse , respectively , which shows the fact that wt1 may be a potential prognostic factor and a therapeutic target in aml . here , we analyzed wt1 expression in a cohort of 126 patients with aml using real - time quantitative reverse transcription polymerase chain reaction ( rq - rt - pcr ) and considered the usefulness of this marker for predicting relapse in our regions .", "a total of 126 aml patients consisting of 70 males ( 55.6% ) and 56 females ( 44.4% ) with a median age of 26 years ( age range of 176 years ) were recruited for the wt1 overexpression study . all patients were diagnosed with aml at the molecular pathology and cancer research center from april 2014 to june 2015 , a total of 14 months . this clinical study was approved by the ethics committee of participating institutions and each patient provided informed consent before the initiation of the studies , 2 ml of bm aspiration or pb sample was collected in the ethylenediaminetetraacetic acid and heparin vacutainer from all 126 patients for the molecular and cytogenetic study , respectively , before treatment . the wt1 overexpression was defined in this study as 50 copies wt1/10 abl in pb sample and 250 copies wt1/10 abl in bm sample . aml was defined based on criteria which are written below and definitive diagnosis was done by an expert hematologist . patient characteristics \n presence of 20% myeloid blasts in bm or pb specimenpositive myeloperoxidase , specific and nonspecific esterase , sudan black , and periodic acid schiff staining of patient 's slidepositive markers such as cd13 , cd117 , cd64 , cd14 , and cd117 in peripheral samplesdiscovering aml - related genetic disorders such as t(8;21 ) , t(15;17 ) , and t(6;9 ) . \n presence of 20% myeloid blasts in bm or pb specimen positive myeloperoxidase , specific and nonspecific esterase , sudan black , and periodic acid schiff staining of patient 's slide positive markers such as cd13 , cd117 , cd64 , cd14 , and cd117 in peripheral samples discovering aml - related genetic disorders such as t(8;21 ) , t(15;17 ) , and t(6;9 ) . mononuclear cells , including leukemic blasts , were separated from bm or pb samples on a ficoll histopaque 1077 ( sigma - aldrich company , saint louis , mo , usa ) density gradient . total rna was extracted using rneasy mini kit following the manufacturer 's protocol ( qiagen , hilden , germany ) . samples were incubated for 10 min at 20c , 45 min at 42c , and 3 min at 99c , followed by 10 min at 4c . to construct a wt1 plasmid and abl plasmid for the standard curve in the rq - pcr assay , we added the following primers and reagents with a final volume of 50 l to amplify a wt1 and abl rt - pcr product : \n wt1-forward primer : exon 7 - 5_-ggcatctgaga ccagtgagaa-3_wt1-reverse primer : exon 10 5_-ggactaattca tcgaccggg-3abl - f : tgg aga taa cac tct aag cat aac taa aggtabl - r : gat gtagtt gct tgg gac . \n wt1-reverse primer : exon 10 5_-ggactaattca tcgaccggg-3 abl - f : tgg aga taa cac tct aag cat aac taa aggt abl - r : gat gtagtt gct tgg gac . pcr buffer 1x : 10 mm tris - hcl , 50 mm kcl ( ph 8.3 ) , mgcl2:2.5 mm ( final concentration ) , dntp : 200 m ( final concentration ) , 400 nm of each primer ( final concentration ) , taq enzyme : 1 u and 3 l of cdna product . use the following thermal cycler temperatures and time conditions : initial melting at 95c for 30 s , 35 pcr cycles at the following conditions : 94c for 30 s , 65c for 1 min , 72c for 1 min . then , we cloned the pcr products into the instaclone pcr cloning kit ( thermo scientific ) according to the manufacturer 's instructions . the selected clones were screened for the presence of the insert by pcr and then sequenced for confirmation . the plasmid was extracted using the genejet plasmid miniprep kit ( thermo scientific ) and quantified spectrophotometrically . the copy number for 1 six successful serial dilutions ( 10,0000 , 10,000 , 1000 , 100 , and 10 copies ) of each genes were prepared . the expression ratio was given in 100 wt1/abl , and wt1 overexpression was defined in this study as 50 copies wt1/10 abl in pb sample and 250 copies wt1/10 abl in bm sample as previously recommended . a dilution series of a known concentration of abl and wt1 plasmid was used for the creation of a standard curve . the pcr conditions , primer , and probe for the detection and amplification of pml - rara , aml1-eto , cbfb - myh11 , and nup - dek samples have been described elsewhere . all the rt - rt - pcr reactions were performed on a 7700 abi platform . in each reaction , 5 l of cdna was amplified . each reaction contained 12.5 l of mastermix ( taqman universal pcr master mix ) , 200 nm hybridization probe ( wt1-probe : cttacagatgcacagcaggaagcacactg ) , 300 nm of each primer ( [ wt1-f : caggctgcaa taagagatattttaagct ] and [ wt1-r : gaagtcacactggtatggtttctca ] ) . the rq - pcr primers and probe for abl are as follows : forward primer 5_-tggagataacactc taagcataactaaaggt-3 , reverse primer 5_-gatgtagttgcttgggaccca-3 , taqman probe 5_-ccatttttggtttgggcttcacaccatt-3 . sterilized water to reach a final volume of 25 l 50 cycles of denaturation at 95c for 15 s followed by annealing / extension at 60c for 60 s was added . chromosome analysis was performed on synchronized 24 h and 48 h using fdur / uridine block with cell density of 10 cells / ml . aliquots of bm aspirate were suspended in rpmi 1640 supplemented with 20% fetal calf serum , l - glutamine , and antibiotics . after 24 h incubation at 37c , colcemid was added to a final concentration of 0.05 g / ml for 30 min . the cells were exposed to a hypotonic solution ( 0.075 mol / l kcl ) for 30 min at 37c and then fixed three times in methanol : acetic acid ( 3:1 , v / v ) for 30 min each . clonal karyotypic abnormalities were identified and described according to the 2013 international system of human cytogenetic nomenclature . statistical analysis was done using spss v 13 ( spss inc . , chicago , il , usa ) . whitney , student 's t - test , and anova , were applied according to data distribution and the results interpretations are described in the next section . data were reported in the form of mean standard deviation in the present study and .", "mononuclear cells , including leukemic blasts , were separated from bm or pb samples on a ficoll histopaque 1077 ( sigma - aldrich company , saint louis , mo , usa ) density gradient . total rna was extracted using rneasy mini kit following the manufacturer 's protocol ( qiagen , hilden , germany ) . samples were incubated for 10 min at 20c , 45 min at 42c , and 3 min at 99c , followed by 10 min at 4c .", "to construct a wt1 plasmid and abl plasmid for the standard curve in the rq - pcr assay , we added the following primers and reagents with a final volume of 50 l to amplify a wt1 and abl rt - pcr product : \n wt1-forward primer : exon 7 - 5_-ggcatctgaga ccagtgagaa-3_wt1-reverse primer : exon 10 5_-ggactaattca tcgaccggg-3abl - f : tgg aga taa cac tct aag cat aac taa aggtabl - r : gat gtagtt gct tgg gac . \n wt1-reverse primer : exon 10 5_-ggactaattca tcgaccggg-3 abl - f : tgg aga taa cac tct aag cat aac taa aggt abl - r : gat gtagtt gct tgg gac . pcr buffer 1x : 10 mm tris - hcl , 50 mm kcl ( ph 8.3 ) , mgcl2:2.5 mm ( final concentration ) , dntp : 200 m ( final concentration ) , 400 nm of each primer ( final concentration ) , taq enzyme : 1 u and 3 l of cdna product . use the following thermal cycler temperatures and time conditions : initial melting at 95c for 30 s , 35 pcr cycles at the following conditions : 94c for 30 s , 65c for 1 min , 72c for 1 min then , we cloned the pcr products into the instaclone pcr cloning kit ( thermo scientific ) according to the manufacturer 's instructions . the selected clones were screened for the presence of the insert by pcr and then sequenced for confirmation . the plasmid was extracted using the genejet plasmid miniprep kit ( thermo scientific ) and quantified spectrophotometrically . the copy number for 1 six successful serial dilutions ( 10,0000 , 10,000 , 1000 , 100 , and 10 copies ) of each genes were prepared . the expression ratio was given in 100 wt1/abl , and wt1 overexpression was defined in this study as 50 copies wt1/10 abl in pb sample and 250 copies wt1/10 abl in bm sample as previously recommended . a dilution series of a known concentration of abl and wt1 plasmid was used for the creation of a standard curve . the pcr conditions , primer , and probe for the detection and amplification of pml - rara , aml1-eto , cbfb - myh11 , and nup - dek samples have been described elsewhere .", "all the rt - rt - pcr reactions were performed on a 7700 abi platform . in each reaction , 5 l of cdna was amplified . each reaction contained 12.5 l of mastermix ( taqman universal pcr master mix ) , 200 nm hybridization probe ( wt1-probe : cttacagatgcacagcaggaagcacactg ) , 300 nm of each primer ( [ wt1-f : caggctgcaa taagagatattttaagct ] and [ wt1-r : gaagtcacactggtatggtttctca ] ) . the rq - pcr primers and probe for abl are as follows : forward primer 5_-tggagataacactc taagcataactaaaggt-3 , reverse primer 5_-gatgtagttgcttgggaccca-3 , taqman probe 5_-ccatttttggtttgggcttcacaccatt-3 . sterilized water to reach a final volume of 25 l 50 cycles of denaturation at 95c for 15 s followed by annealing / extension at 60c for 60", "chromosome analysis was performed on synchronized 24 h and 48 h using fdur / uridine block with cell density of 10 cells / ml . aliquots of bm aspirate were suspended in rpmi 1640 supplemented with 20% fetal calf serum , l - glutamine , and antibiotics . after 24 h incubation at 37c , colcemid was added to a final concentration of 0.05 g / ml for 30 min . the cells were exposed to a hypotonic solution ( 0.075 mol / l kcl ) for 30 min at 37c and then fixed three times in methanol : acetic acid ( 3:1 , v / v ) for 30 min each . slides were prepared and then air dried . preparations were banded with the g - banding technique . clonal karyotypic abnormalities were identified and described according to the 2013 international system of human cytogenetic nomenclature .", "whitney , student 's t - test , and anova , were applied according to data distribution and the results interpretations are described in the next section . data were reported in the form of mean standard deviation in the present study and .", "to generate a standard curve and define the sensitivity of wt1 monitoring , a dilution series of rna from the cell line k562 expressing wt1 was performed . k562 rna could be successfully detected in normal pb rna in a dilution of 1:20,000 . the mean slope of 3.3 0.3 ( correlation coefficient range : 0.9840.993 ) was close to optimal pcr reaction . drn threshold of 0.1 , the intercept of the standard curve was 40.3 0.3 , which was compatible with our defined detection limit of ct = 39 . thereby , we found our designed primers and probe suitable for wt1 quantification . in this study , we evaluated the wt1 gene expression in aml patients . in a total of 126 patients , 55.6% and 44.4% were men and women , respectively , where the patients with ages under 15 years were considered as children who were 31.7% and patients with ages above 15 years were considered as adults who were 68.3% . in this study , there were 66.7% pb samples and 33.3% bm samples . the age of patients varied from 1 to 76 years , with the median of 26 years . the wt1 gene overexpression was detected in 81% ( 104 of 126 ) of all patients , with frequency of 17.5% copies of wt1/10 abl in bm and 63.5% copies of wt1/10 abl in pb samples ( p = 0.0001 , p = 0.0001 , respectively ) . the diagnosis of aml was made according to the french american british ( fab ) and who classification . the standard giemsa banding techniques were applied in the karyotyping of leukemia . in 126 patients , ten patients were positive for aml1-eto , ten patients for cbfb - myh11 , 14 for pml - rara , and two for nup - dek . a total of seventy patients had not any of recurrent translocation , 12 patients had other cytogenetic abnormalities , and eight patients had complex aberrant karyotypes . in addition , wt1 expression levels were analyzed in 12 blood and two bm samples of healthy donors . the mean expression level of wt1 in normal bms samples was 19 ( range 1721 ) . in all ten analyzed pb samples , wt1 expression was very low and undetectable [ table 2 ] . wilms tumor 1 expression levels in the peripheral blood and bone marrow of healthy controls as compared to acute myeloblastic leukemia patients at diagnosis we also detect the median wt1 gene expression in each who classification and fab subtype [ tables 3 and 4 ] , highest levels of wt1 expression were seen first in patients with normal karyotype at diagnosis and second in cbfb - myh1 , and lowest levels were detected in patients with aml1-eto positive . in fab subtype , the highest levels of wt1 at diagnosis were assessed in the m1 subtype and the lowest levels were observed in the m6 subtype . wilms tumor 1 expression at diagnosis , according to different cytogenetic or molecular subgroups wilms tumor 1 expression according to cytomorphological subtypes", "to generate a standard curve and define the sensitivity of wt1 monitoring , a dilution series of rna from the cell line k562 expressing wt1 was performed . k562 rna could be successfully detected in normal pb rna in a dilution of 1:20,000 . the mean slope of 3.3 0.3 ( correlation coefficient range : 0.9840.993 ) was close to optimal pcr reaction . drn threshold of 0.1 , the intercept of the standard curve was 40.3 0.3 , which was compatible with our defined detection limit of ct = 39 . thereby , we found our designed primers and probe suitable for wt1 quantification . in this study , we evaluated the wt1 gene expression in aml patients . in a total of 126 patients , 55.6% and 44.4% were men and women , respectively , where the patients with ages under 15 years were considered as children who were 31.7% and patients with ages above 15 years were considered as adults who were 68.3% . in this study , there were 66.7% pb samples and 33.3% bm samples . the age of patients varied from 1 to 76 years , with the median of 26 years . the wt1 gene overexpression was detected in 81% ( 104 of 126 ) of all patients , with frequency of 17.5% copies of wt1/10 abl in bm and 63.5% copies of wt1/10 abl in pb samples ( p = 0.0001 , p = 0.0001 , respectively ) . the diagnosis of aml was made according to the french american british ( fab ) and who classification . the standard giemsa banding techniques were applied in the karyotyping of leukemia . in 126 patients , ten patients were positive for aml1-eto , ten patients for cbfb - myh11 , 14 for pml - rara , and two for nup - dek . a total of seventy patients had not any of recurrent translocation , 12 patients had other cytogenetic abnormalities , and eight patients had complex aberrant karyotypes . in addition , wt1 expression levels were analyzed in 12 blood and two bm samples of healthy donors . the mean expression level of wt1 in normal bms samples was 19 ( range 1721 ) . in all ten analyzed pb samples , wt1 expression was very low and undetectable [ table 2 ] . wilms tumor 1 expression levels in the peripheral blood and bone marrow of healthy controls as compared to acute myeloblastic leukemia patients at diagnosis we also detect the median wt1 gene expression in each who classification and fab subtype [ tables 3 and 4 ] , highest levels of wt1 expression were seen first in patients with normal karyotype at diagnosis and second in cbfb - myh1 , and lowest levels were detected in patients with aml1-eto positive . in fab subtype , the highest levels of wt1 at diagnosis were assessed in the m1 subtype and the lowest levels were observed in the m6 subtype . wilms tumor 1 expression at diagnosis , according to different cytogenetic or molecular subgroups wilms tumor 1 expression according to cytomorphological subtypes", "wt1 gene is a tumor suppressor gene that is associated with wt and other related syndromes such as wagr and denys drash . unlike other tumor suppressors such as p53 or rb1 , wt1 expression in normal adult tissues is limited to a number of mainly genitourinary system . in normal bm , progenitor cells expression of wt1 gene is very low and limited only in the beginning ; however , numerous studies suggest that increased expression of wt1 in aml , all , mds , and blastic phase of cml can be seen . the wt1 gene expression can be used as a molecular marker for hematopoietic malignancies . many studies have mentioned that using quantitative gene expression can be used to assess the exact extent of residual disease ( mrd ) , with respect to the biological role of wt1 gene expression in leukemia patients ; this gene involved in pathogenesis of leukemia as stopping cell growth and differentiation by suppressing duplication numerous studies have indicated that the prognosis in leukemia patients is inversely associated with the expression of wt1 . since the majority of aml patients express very high values of wt1 at diagnosis , the assessment of wt1 expression provides a strong method for monitoring the persistence of the disease after chemotherapy or bm transplantation or during the treatment . wt1 gene is expressed in more than 80% of patients with aml in both pb and bm samples . wt1 overexpression is used as a panleukemic marker to determine the amount of residual disease ( mrd ) and is a good marker for patients with no cytogenetic or molecular abnormalities ( about 50% ) . the overexpression of wt1 gene in this study was 81% , which our results were similar to other studies . for example , in one study , the expression of this gene were shown in more than 90% of aml patients and they mentioned wt1 can be used as a marker for mrd ; in this study , the expression of wt1 gene was performed before and after transplantation , and the results of chimerism was compared with flow cytometry and concluded that the wt1 expression in aml patients is associated with the amount of residual disease . another study conducted in 2014 indicated that wt1 expression was limited to cd34/cd38 cells and this feature makes wt1 useful as a unique marker for determining the amount of residual disease in aml patients . in another study , baba et al . conducted the level of wt1 which was significantly related to the percentage of blast in bm among mds cases , and the refractory anemia ( ra ) cases showed significantly lower wt1 level than patients with ra with excess blast and concluded that wt1 might be a good marker to differentiate low blast percentage mds and cytopenia . in our study , the expression of wt1 in aml was studied , but in other studies , the overexpression of wt1 gene was seen in 75% of acute leukemia and blastic phase of chronic myeloid . the wt1 gene had been highly expressed in most patients of aml and all and in blastic phase of cml and mds . the degree of mrna expression of wt1 gene are increased with the progression of the disease ; furthermore , wt1 gene is known as a tumor suppressor and there is evidence indicating that wt1 has oncogenic role in leukemogenesis and tumorigenesis . aml is a hematopoietic stem cells malignancy known by increasing clonal myeloid blast , which categorizes mainly into three different groups , good , moderate , and bad based on chromosomal abnormalities . about half ( 50%40% ) of aml patients with normal karyotype or normal cytogenetic classified in the medium - risk group ; however , there is a paradox in this group on how to respond to chemotherapy and prognosis for the treatment that makes it difficult to make decisions about continuing the treatment . a number of other molecular markers in response to the therapy and disease prognosis in aml with normal cytogenetics ( cn - aml ) is important such as nucleophosmin gene ( npm1 ) and flt3 gene . identification of mutations in these genes to assess how to treat and prognosis in patients with cn - aml are important . the wt1 is an important regulatory factor of normal and malignant blood cells . on the other hand , the resistance of leukemic blasts against apoptosis leads to poor clinical status of the patient , so regulating the apoptotic and antiapoptotic pathways is associated with improved treatment and survival in aml patients . in our study , we first examined the level of wt1 in 12 pb samples and two bm samples from healthy donors and determined that the wt1 expression in normal pb and bm samples were very low , these data provide a stable basis for the use of wt1 as mrd target , all aml patients were classified according to who criteria and the frequency of the most common translocations involving : t(15 ; 17 ) , inv ( 16 ) , t(8 ; 21 ) , and t(6 ; 9 ) are calculated , patients who had none of these recurrent translocations were 71.4% of the patients . in our cases , patients who had t(15 ; 17 ) had the highest frequency ( 11.1% ) , and an equal number of aml patients with t(8 ; 21 ) and inv ( 16 ) had a frequency of 7.9% and two patients had t(6 ; 9 ) . while stergaard et al . compared the wt1 expression level between patients who were positive for the selected fusion gene , the average wt1 gene copies in each of the 10 copies of the abl gene is calculated , most wt1 gene copy number was observed in the group of patients who had normal cytogenetic , and then , in patients with inv ( 16 ) and the lowest wt1 , gene copy was observed in patients with t(8 ; 21 ) . our findings are somewhat different with candoni et al . , most of the copy of the wt1 gene was observed in patients who had inv ( 16 ) with an average of 23,100 copies and then in patients who had normal cytogenetic with npm1 mutations , with an average of 14,400 copies . in another study by stergaard et al . had somewhat different results and the maximum amount of copies of the wt1 gene were in patients with t(15 ; 17 ) and the lowest amount of copies were in patients with t(8 ; 21 ) . in this study , we also examined wt1 gene copies in each of the morphological groups based on the fab classifications , maximum copy of the wt1 gene were in the m1 with an average of 403.94 and the lowest were in the m6 ; increased expression of wt1 in m1 can be explained by an increase in the number of blasts in this group . the data of patients presented in this study show that an accurate quantitative amount of the wt1 transcript provided by the rq - pcr methods allows us to distinguish between normal and abnormal expression levels of wt1 gene , we significantly observed a great variation in wt1 level in de novo aml patients , which in this study did not show clear correlations to cytogenetically prognostic subgroups .", "with the concordance between wt1 gene mrd and hematological findings in both groups of fusion transcript - negative and transcript - positive patients , our study extremely supports the use of wt1 as a strong mrd marker .", "", "" ]

[ "men , aged > 30 years , with type 2 diabetes were recruited from barnsley hospital nhs trust , barnsley , u.k . most of the subjects were recruited from the retinal screening program , which is attended by virtually all patients with diabetes in the barnsley area . subjects were given written and verbal information regarding the study , and 355 men gave their informed consent to take part . the study population comprised patients with diabetes usually managed in primary care facilities as well as secondary care patients . other measurements included blood pressure , a1c , nonfasting lipid levels , height , weight , and waist circumference . the main data from the study were published previously in diabetes care ( 2 ) . patients were seen in the morning between 8:00 and 10:00 a.m. symptoms of hypogonadism were assessed by completion of the androgen deficiency in the aging male ( adam ) questionnaire , which was validated to assess hypogonadism in aging men ( 19 ) . serum total testosterone , total estradiol , and shbg were measured by an enzyme - linked immunosorbent assay using commercially available kits ( drg diagnostics , marburg , germany ) . bioavailable testosterone was determined by a modification of the ammonium sulfate precipitation method described by tremblay and dube ( 20 ) . free testosterone was calculated from total testosterone and shbg by the formula of vermeulen et al . . these methods of assessing bioavailable and free testosterone have been used in previous studies from our research team and have determined to be reliable for the assessment of men with diabetes and vascular disease ( 17 ) . a1c was assessed using a menarini analyser ha8160 ( menarini diagnostics , florence , italy ) . serum lipid parameters were assessed by olympus analyzers ( olympus diagnostics , hamburg , germany ) . testosterone and shbg were log - normally distributed and were converted to a normal distribution to allow use of student 's t test for comparison of group means . with smaller groups , the normal distribution was assessed using single - sample kolmogorov - smirnov testing . the two - sample kolmogorov - smirnov test was used to compare groups when data did not fulfill the normal distribution . results were initially considered statistically significant at p < 0.05 . because of multiple statistical testing", "patients were seen in the morning between 8:00 and 10:00 a.m. symptoms of hypogonadism were assessed by completion of the androgen deficiency in the aging male ( adam ) questionnaire , which was validated to assess hypogonadism in aging men ( 19 ) . serum total testosterone , total estradiol , and shbg were measured by an enzyme - linked immunosorbent assay using commercially available kits ( drg diagnostics , marburg , germany ) . bioavailable testosterone was determined by a modification of the ammonium sulfate precipitation method described by tremblay and dube ( 20 ) . free testosterone was calculated from total testosterone and shbg by the formula of vermeulen et al . . these methods of assessing bioavailable and free testosterone have been used in previous studies from our research team and have determined to be reliable for the assessment of men with diabetes and vascular disease ( 17 ) . a1c was assessed using a menarini analyser ha8160 ( menarini diagnostics , florence , italy ) . serum lipid parameters were assessed by olympus analyzers ( olympus diagnostics , hamburg , germany ) .", "testosterone and shbg were log - normally distributed and were converted to a normal distribution to allow use of student 's t test for comparison of group means . with smaller groups , the normal distribution was assessed using single - sample kolmogorov - smirnov testing . the two - sample kolmogorov - smirnov test was used to compare groups when data did not fulfill the normal distribution . results were initially considered statistically significant at p < 0.05 . because of multiple statistical testing , we performed a bonferroni correction to minimize the chance of type 2 errors .", "in our cross - section of 355 men with type 2 diabetes , 186 were not treated with statins . of 169 men treated with statins , 81 were treated with atorvastatin , 66 with simvastatin , 15 with pravastatin , and 7 with other statins ( 3 with fluvastatin , 1 with cerivastatin , and 3 with unknown statin ) . patients treated with statins did not significantly differ from untreated individuals in age , waist circumference , bmi , a1c , or blood pressure ( table 1 ) . total cholesterol and ldl cholesterol levels were lower in men taking statins , but there were no significant differences in hdl cholesterol or triglyceride levels ( data not shown ) . mean sex hormone levels , measures of obesity , and cholesterol levels in men treated with any statin , atorvastatin , and simvastatin compared with untreated men p values given for student 's t test comparing treated patients with the untreated group . total testosterone was significantly lower in the statin and atorvastatin groups but not in the simvastatin group . bioavailable and free testosterone levels were not significantly lower in any group . both statins were associated with lower cholesterol levels , but none of the groups were significantly different in terms of obesity . total testosterone levels were significantly lower in men treated with statins , and there was a trend toward lower shbg levels , but this did not reach statistical significance ( table 1 ) . bioavailable testosterone , calculated free testosterone , and serum estrogen levels were not significantly different between the groups . the symptom score from the adam questionnaire was not significantly altered in those men receiving statin therapy . there were sufficient numbers of men treated with simvastatin and atorvastatin to consider these groups more closely ( tables 1 and 2 ) . these groups were not significantly different from untreated men in terms of bmi , waist circumference , blood pressure , a1c , or age . total cholesterol and ldl cholesterol levels were lower in both groups compared with those in untreated men but were not significantly different between simvastatin- and atorvastatin - treated groups . men treated with simvastatin did not have significantly different total , bioavailable , or free testosterone , estradiol , or shbg levels than untreated men ( fig . 1 and table 1 ) . in contrast , men treated with atorvastatin had an average total testosterone level 1.96 nmol / l ( 56 ng / dl ) less than that in untreated men . there was a trend toward lower shbg levels in this group ( 35.3 vs. 27.6 nmol / l , p = 0.022 ) . further analysis revealed an apparent dose - response relationship , with the lowest testosterone levels seen in men taking higher doses of atorvastatin ( table 3 ) . nmol / l ( 108 ng / dl ) less than that of untreated men ( table 3 ) , but this value did not reach statistical significance ( p = 0.017 ) . shbg was also reduced without reaching significance ( p = 0.043 ) , but free and bioavailable testosterone levels were unaltered . no significant differences were seen in sex hormone levels when the simvastatin - treated men were split into similar groups ( data not shown ) . there were no significant differences in age , bmi , waist circumference , blood pressure , or a1c in any of the atorvastatin- or simvastatin - treated subgroups . characteristics of patients untreated with statins and those treated with atorvastatin and simvastatin p values given for student 's t test . there were no significant differences in age , anthropomorphic data , glycemic control , or blood pressure . total and ldl cholesterol are lower in the statin - treated group , reflecting the primary action of the drugs . mean testosterone levels in untreated men and those treated with atorvastatin or simvastatin ; 95% cis are shown . international guidelines suggest that testosterone replacement is invariably warranted when the total testosterone level is < 8 nmol / l ( 231 ng / dl ) or the free testosterone level is < 0.18 nmol / l ( 346 ng / dl ) or a free testosterone between 0.18 and 0.25 nmol / l . * p < 0.01 ; + p < 0.05 . average testosterone , shbg , and measures of obesity in men treated with atorvastatin split into two groups : those treated with 10 mg and those treated with 20 mg or more the 10-mg atorvastatin group was compared with the no statin group with student 's t test ; significant results are shown in boldface . the 20-mg atorvastatin group was compared with the no statin group using a two - sample kolmogorov - smirnov test . there is a trend toward lower total testosterone and shbg levels in men taking the higher doses of atorvastatin , but this does not reach statistical significance .", "in our cross - section of 355 men with type 2 diabetes , 186 were not treated with statins . of 169 men treated with statins , 81 were treated with atorvastatin , 66 with simvastatin , 15 with pravastatin , and 7 with other statins ( 3 with fluvastatin , 1 with cerivastatin , and 3 with unknown statin ) .", "patients treated with statins did not significantly differ from untreated individuals in age , waist circumference , bmi , a1c , or blood pressure ( table 1 ) . total cholesterol and ldl cholesterol levels were lower in men taking statins , but there were no significant differences in hdl cholesterol or triglyceride levels ( data not shown ) . mean sex hormone levels , measures of obesity , and cholesterol levels in men treated with any statin , atorvastatin , and simvastatin compared with untreated men p values given for student 's t test comparing treated patients with the untreated group . total testosterone was significantly lower in the statin and atorvastatin groups but not in the simvastatin group . bioavailable and free testosterone levels were not significantly lower in any group . both statins were associated with lower cholesterol levels , but none of the groups were significantly different in terms of obesity . total testosterone levels were significantly lower in men treated with statins , and there was a trend toward lower shbg levels , but this did not reach statistical significance ( table 1 ) . bioavailable testosterone , calculated free testosterone , and serum estrogen levels were not significantly different between the groups . the symptom score from the adam questionnaire was not significantly altered in those men receiving statin therapy .", "there were sufficient numbers of men treated with simvastatin and atorvastatin to consider these groups more closely ( tables 1 and 2 ) . these groups were not significantly different from untreated men in terms of bmi , waist circumference , blood pressure , a1c , or age . total cholesterol and ldl cholesterol levels were lower in both groups compared with those in untreated men but were not significantly different between simvastatin- and atorvastatin - treated groups . men treated with simvastatin did not have significantly different total , bioavailable , or free testosterone , estradiol , or shbg levels than untreated men ( fig . 1 and table 1 ) . in contrast , men treated with atorvastatin had an average total testosterone level 1.96 nmol / l ( 56 ng / dl ) less than that in untreated men . there was a trend toward lower shbg levels in this group ( 35.3 vs. 27.6 nmol / l , p = 0.022 ) . further analysis revealed an apparent dose - response relationship , with the lowest testosterone levels seen in men taking higher doses of atorvastatin ( table 3 ) . nmol / l ( 108 ng / dl ) less than that of untreated men ( table 3 ) , but this value did not reach statistical significance ( p = 0.017 ) . shbg was also reduced without reaching significance ( p = 0.043 ) , but free and bioavailable testosterone levels were unaltered . no significant differences were seen in sex hormone levels when the simvastatin - treated men were split into similar groups ( data not shown ) . there were no significant differences in age , bmi , waist circumference , blood pressure , or a1c in any of the atorvastatin- or simvastatin - treated subgroups . characteristics of patients untreated with statins and those treated with atorvastatin and simvastatin p values given for student 's t test . there were no significant differences in age , anthropomorphic data , glycemic control , or blood pressure . total and ldl cholesterol are lower in the statin - treated group , reflecting the primary action of the drugs . mean testosterone levels in untreated men and those treated with atorvastatin or simvastatin ; 95% cis are shown . international guidelines suggest that testosterone replacement is invariably warranted when the total testosterone level is < 8 nmol / l ( 231 ng / dl ) or the free testosterone level is < 0.18 nmol / l ( 346 ng / dl ) or a free testosterone between 0.18 and 0.25 nmol / l . * p < 0.01 ; + p < 0.05 . average testosterone , shbg , and measures of obesity in men treated with atorvastatin split into two groups : those treated with 10 mg and those treated with 20 mg or more the 10-mg atorvastatin group was compared with the no statin group with student 's t test ; significant results are shown in boldface . the 20-mg atorvastatin group was compared with the no statin group using a two - sample kolmogorov - smirnov test . there is a trend toward lower total testosterone and shbg levels in men taking the higher doses of atorvastatin , but this does not reach statistical significance .", "this is the first study to analyze fully testosterone levels and hypogonadal symptoms in comparison with statin use in a population receiving routine medical management . those treated with atorvastatin had lower levels of total testosterone with a trend toward lower shbg compared with untreated men , whereas those treated with simvastatin were not significantly affected . statin treatment did not significantly affect the biologically active fractions of testosterone , symptoms of hypogonadism , or estradiol levels . this study demonstrates that treatment with statins in this group can be a confounding factor in the assessment of hypogonadism . total testosterone is the primary test used in the diagnosis of hypogonadism , and the effect of atorvastatin could potentially lead to misdiagnosis of the condition in men with normal free and bioavailable testosterone levels . alternatively , it is possible that reductions in total testosterone without changes in bioactive testosterone fractions have clinical effects in view of findings suggesting that shbg - bound testosterone may be biologically active ( 13 ) . the adam questionnaire failed to detect an increase in hypogonadal symptoms in groups with lower total testosterone levels , but the questionnaire does not correlate closely with testosterone levels , and men with diabetes have a high level of false - positive hypogonadal symptoms ( 2 ) such as erectile dysfunction owing to vascular and neuropathic factors , medications , and depression . atorvastatin is a more potent statin than simvastatin , thus causing a greater reduction in the total cholesterol and hence total testosterone levels . no patients in our study were treated with other potent statins such as rosuvastatin so we are unable to confirm that atorvastatin reduces testosterone and shbg levels secondary to more potent effects on cholesterol levels . indeed , cholesterol and other lipid fraction levels were not significantly different between simvastatin- and atorvastatin - treated groups . in a normal physiological state , luteinizing hormone ( lh ) promotes uptake of cholesterol by the testis and stimulates testosterone synthesis . a reduction in testosterone is sensed by the hypothalamic - pituitary axis and leads to greater lh release , which completes a negative feedback loop and maintains testosterone levels . the apparent failure of the hypothalamic - pituitary - testicular axis to respond and maintain testosterone levels in the statin - treated patients in our study may be explained by the hypogonadal - obesity - adipocytokine hypothesis ( 1 ) . the majority of the patients in our study were overweight or obese . in this population , greater production of adipocytokines such as tumor necrosis factor- , interleukin-6 , and leptin and increased estradiol from metabolism of testosterone by aromatase in adipose tissue inhibit lh release from the pituitary gland , which leads to lower circulating testosterone levels . in our study , gonadotrophin levels were only tested in men with total testosterone levels < 12 mmol / l ( 2 ) , leaving us unable to test this hypothesis . the most likely reason that bioavailable and free testosterone levels are unaltered despite lower total testosterone is a homeostatic mechanism via reduced shbg production . an alternative hypothesis is that atorvastatin causes a primary reduction in shbg with consequent reductions in total testosterone . there was a consistent trend toward low shbg levels in all groups with reduced levels of total testosterone , although these low levels did not reach statistical significance . shbg is produced in the liver , the primary site of action of the statins , but the mechanism by which statins could alter shbg is unknown . shbg levels are known to be modulated by a number of factors including downregulation by insulin resistance and upregulation by estrogens ( 21 ) . we are aware of one clinical trial assessing the effects of atorvastatin on testosterone levels in men . the results showed a nonsignificant fall in total testosterone and no change in shbg ( 4 ) . these data are insufficient to confirm or refute our findings relating to atorvastatin , and it may be that the study allowed insufficient time for changes to develop . some trials have shown that simvastatin reduces serum testosterone levels ( 911 ) , whereas others have shown no effect ( 68 ) . our data suggest that any effect of simvastatin in reducing serum testosterone levels is not clinically significant in men with type 2 diabetes . we are not aware of any previous evidence for an effect of any statin on shbg levels . nmol / l ( 231 ng / dl ) are hypogonadal , that men with total testosterone levels > 12 nmol / l ( 346 ng / dl ) do not have hypogonadism , and that men with levels between 8 and 12 nmol / l need consideration for treatment depending on their clinical picture ( 18 ) . an endocrine society clinical practice guideline suggested a diagnostic cutoff value of testosterone of < 10.4 our findings are important in this context because statin treatment was associated with lower total testosterone levels of 11.9 nmol / l ( 340 ng / dl ) ( versus 13.4 nmol / l [ 384 ng / dl ] ) . men treated with 20 mg / day atorvastatin had an average total testosterone level of only 9.6 nmol / l ( 275 ng / dl ) , which is 3.8 nmol / l ( 109 ng / dl ) lower than that of men not treated with statins . thus , statin treatment may lead to reductions in total testosterone levels to < 12 or 10.4 nmol / l in many men but will not significantly alter bioavailable or free testosterone levels or hypogonadal symptoms . we recommend a low threshold for measuring or calculating bioavailable or free testosterone in men receiving statin therapy . it has now been confirmed that reductions in total testosterone are accompanied by similar changes in free and bioavailable testosterone and a high prevalence of hypogonadal symptoms ( 2 ) . furthermore , short - term studies in small numbers of hypogonadal diabetic men have shown improvements in glycemic control , central obesity , and serum leptin during testosterone replacement therapy ( 23,24 ) . other short - term studies have shown beneficial effects on further cardiovascular risk factors including total cholesterol levels ( 25 ) . in this context , the assessment of hypogonadism in men with type 2 diabetes is likely to increase in frequency . assessment of the clinical syndrome of hypogonadism can be challenging in this group because of the confounding effects of vascular disease , psychological factors , and medications on symptoms such as erectile dysfunction . this assessment is complicated by low shbg levels , which have long been associated with insulin resistance , leading to suggestions that low testosterone levels in type 2 diabetes are due to low shbg rather than to reductions in bioactive testosterone fractions . this suggestion has been refuted by studies showing low free and bioavailable testosterone levels in men with type 2 diabetes ( 2 ) and meta - analysis data suggesting relatively small changes in shbg in men with diabetes ( 22 ) . the realization that statin treatment may reduce total testosterone and shbg levels in this patient group serves to refocus attention to a subgroup who are particularly likely to have low shbg levels with the potential for a misdiagnosis of hypogonadism . in summary , this large data set is the first to suggest a significant effect of statins in lowering total testosterone and shbg levels in a population of men with type 2 diabetes . the findings have important implications for the diagnosis of hypogonadism in men receiving statin treatment . the opportunity to conduct similar studies of men with type 2 diabetes , comparing men treated with statins to untreated men , has now probably passed owing to the almost ubiquitous use of statins in this group . limitations of this study are its observational nature and the resultant inability to prove causality . statin - treated men did not differ from other men in terms of age , blood pressure , obesity , or glycemic control , but unidentified confounders can not be excluded . therefore further longitudinal or interventional studies are also needed to assess the effects of statins on androgen status in various patient groups and could include assessment of gonadotrophins and prolactin , which were not measured here . researchers should also investigate mechanisms that lead to changes in shbg and total testosterone in this context ." ]

[ "techniques involving solid supports play crucial roles in the development of genomics , proteomics , and in molecular biology . however , solid - phase tools have been employed to a much lesser extent in glycobiology and glycomics . there are a number of classical methods for immobilization of mono- and oligosaccharides to commercially available matrices and supports . these methods have , for example , been used for the preparation of affinity columns with specific ligands . increased attention has been given to the development and application of magnetic separation techniques , which employ small magnetic particles . antibodies , dna / rna / oligonucleotide / aptamer binding proteins , albumin , hemoglobin , and enzymes have been purified by magnetic techniques . in our laboratory fe3o4 magnetite particles prepared by coprecipitating fe2 and fe3 with either dacron or a network of polysiloxane - polyvinyl alcohol , magnetic particles containing levan , a homopolysaccharide of fructose residues in 2 , 6-glycosidic linkage , are proposed to purify lectins . the latter glycoproteins and/or oligomeric proteins are found in a diverse assortment of organisms and have the extraordinary property of binding specifically , reversibly , and noncovalently to carbohydrates . lectin - carbohydrate interactions are extensively studied in different scientific disciplines , from basic to applied natural and clinical sciences . such inter- and multidisciplinarity corroborates the importance to develop new methodologies for the study of lectin - saccharide interactions and the potential applications in clinical diagnostics . in the present work a composite of the carbohydrate levan and magnetite lectins complexed specifically to the composite were separated from other contaminant proteins by washing with a high ionic strength solution and obtained from composite with specific monosaccharide . the washing procedures were facilitated by the magnetic field and all process can be automated . the seed lectins from cratylia mollis ( camaratu bean ) , cramoll [ 9 , 10 ] and canavalia ensiformis ( con a ) were used as models . con a and potato lectin from solanum tuberosum have already been purified by magnetic techniques using dextran and chitosan as ligands , respectively . the aim of this work was to evaluate the use of zimomonas mobilis levans insolubilized and ferromagnetized ( fmzag-12l ) , to purify fructose / specific lectins using lectin preparations of c. mollis seeds .", "cramoll 1 , 4 and cramoll 1 were obtained through a previously established protocol from a c. mollis seed extract ( 10% , w / v ) that was ammonium sulfate fractionated ; fraction ( f ) 40 to 60% saturated ( f4060 ) was affinity chromatographed in sephadex g-75 ( cramoll 1 , 4 ) followed by ion exchange chromatography in cm - cellulose ( cramoll 1 and cramoll 4 ) . cramoll 3 was also obtained from the above mentioned seed extract through a previously described protocol ; the 0 to 40% ammonium sulfate fraction ( f040 ) was molecular exclusion chromatographed in sephadex g-100 . levan ( l ) was produced by zimomonas mobilis strain zag-12 ( departamento de antibiticos , universidade federal de pernambuco , brazil ) and abbreviated from now on as zag-12l . a solution containing fe and fe ions in a molar ratio of 1.1 m : 0.6 m was prepared from fecl36h2o and fecl24h2o in distilled water ; 50 ml of 2% zag-12l in distilled water was then added and the ph was raised to 11.0 by adding drop wise 1 m nh4oh . mixture was then heated up to 85 3c and incubated for 30 minutes with vigorous stirring . the ferromagnetic levan obtained ( fmzag-12l ) was centrifuged 5 times to remove solid material . the product was dried for 24 hours at 50c , ground and kept at room temperature . aqueous suspensions of magnetic particles were prepared by coprecipitation of fe ( iii ) and fe ( ii ) in the presence of nh4oh and polymer . the protein content was carried out by lowry et al . using bovine serum albumin as standard , at a range of 0500 g / ml and absorbance reading at 720 nm . lectin sample solutions ( 50 l ) were serially 2-fold diluted in 0.15 m nacl , in microtiter u - plates and incubated with of a 2.5% ( v / v ) suspension of glutaraldehyde treated erythrocytes from new zealand white rabbit ( 50 l ) . the titer , defined as the lowest sample dilution which showed hemagglutination , was established after 45 minutes incubation according to correia and coelho . hemagglutinating activity ( ha ) corresponded to the reciprocal titer . the ha inhibition ( hai ) was assayed by 2-fold serial dilution of lectin sample solutions ( 50 l ) in 50 l of 200 mm levan or fructose solutions , followed by 15 minutes incubation and addition of erythrocyte suspension . h unidimensional spectra were recorded in a bruker drx 400 mhz ( bruker , germany ) with a triple resonance 5-mm probe . the lectins ( 1 ml ) con a , cramoll 1 , 4 , cramoll 3 , and f4060 were each incubated with fmzag-12l particles ( 1 ml containing 10 mg ) for 2 hours at 4c , under constant agitation . afterwards , the magnetic particles were recovered by a magnetic field ( 6 000 oe ) and supernatant was collected . the remaining unspecific bound proteins were eluted with 0.15 m nacl ( 1 ml ) by recovering the magnetic particles under the magnetic field and collecting the supernatant . finally , adsorbed lectin was eluted with either 0.3 m d - glucose ( con a and cramoll 1 , 4 ) or d - galactose ( cramoll 3 incubation ) in 0.15 m nacl ( 1 ml ) recovering the magnetic particles . the collected supernatants had their absorbancies at 280 nm and ha analyzed ; page for native and basic proteins were performed according to reisfeld et al . .", "\n c. mollis ( camaratu bean ) is a native forage from the semi - arid region of pernambuco state , northeastern of brazil , and belongs to fabaceae family , taxonomically related with c. ensiformis species from which seeds are obtained con a. c. mollis seeds have been considered an important lectin source , giving multiple cramoll molecular forms with different carbohydrate specificities : cramoll 1 , cramoll 2 , and cramoll 4 are specific for glucose / mannose whereas cramoll 3 is galactose specific . a preparation containing cramoll 1 and cramoll 4 together ( cramoll 1 , 4 ) showed a higher hemagglutinating activity ( ha ) when compared with the isolated cramoll 1 and cramoll 4 as well as con a. these lectin preparations ( cramoll 1 , cramoll 4 , and cramoll 1 , 4 ) are inhibited by different carbohydrates ( d - glucose , d - mannose , -d - methyl - mannoside , and d - fructose , among others ) in distinct concentrations . cramoll 1 , 4 and cramoll 1 were successfully used in different biological assays as well as in structural and electrochemical studies [ 1521 ] . the nmr analysis of zag-12l used in this work revealed a spectrum profile corresponding to the fructose residues protons . h nmr spectrum shows seven protons between 3.4 and 4.2 ppm indicating that the polysaccharide produced by z. mobilis was levan type with the linkage of ( 2 6 ) fructofuranoside ( figure 1 ) . no signals in the anomeric region ( 5.3 to 4.3 ppm ) levans from erwinia herbicola , acetobacter xylinum , and bacillus subtilis ( natto ) showed the same structural characteristics analyzed by nmr . hai of cramoll 1 , cramoll 1 , 4 , cramoll 3 , and con a by fructose and levan revealed that all lectins presented ha inhibited by fructose and its polymeric derivative ( table 1 ) . however , inhibition of cramoll 1 , 4 activity by the commercially acquired levan was less intensive . previous studies of this preparation specificity using different monosaccharides showed that d - fructose inhibited cramoll 1 , 4 ha at the same d - mannose proportion . mo et al . reported that con a did bind to d - fructofuranosyl groups present in plant and microorganism levans whereas banana ( musa acuminate ) lectin reacted only with microorganism levans . it is important to observe that banana lectin and con a ( structurally similar to cramoll 1 ) are both glucose / mannose specific . the inhibition of lectins by levans suggested that magnetized levan could be potentially used as an affinity matrix to investigate or purify lectins that recognize fructose . figure 2 shows the con a elution profile by using particles of ferromagnetic levan composite ( fmzag-12l ) . proteins unspecifically bound to the particles were completely washed out with 0.15 m nacl from the 1st to the 8th washes ( 8 ml ) and a second peak emerged after 0.3 m glucose addition at the 10 - 11th fractions . it is worthwhile to draw attention to the fact that equal profile was attained four times indicating its reproducibility and the reuse of the particles . this preparation containing both lectin isoforms was previously purified from c. mollis seed extract by ammonium sulfate fractionation and affinity chromatography in sephadex g-75 . the particles washed with 0.15 m nacl again showed that from the 1st to 8th fraction ( 8 ml of washes ) all unspecifically bound proteins were removed and a second peak emerged after 0.3 m glucose introduction . similar to con a purification this procedure was four times reproduced using the same fmzag-12l . the protein peak eluted at the 14th fraction showed two bands ( cramoll 1 and cramoll 4 ) by polyacrylamide electrophoresis to basic and native proteins ( figure 3(b ) ) similar to previously reported pattern . none specific binding to fmzag-12l was detected when cramoll 3 was used ( data not shown ) . recently , the importance of protein - protein interaction has been pointed out in certain oligomeric lectins since differences among their quaternary organizations appear to be directly related to those among their functions . lectin binding sites have been deeply characterized by many workers to understand carbohydrate interaction of these versatile proteins [ 2729 ] . the evaluation of fmzag-12l to purify cramoll lectins from f4060 preparation is presented in figure 4(a ) . three different concentrations of the ammonium sulfate preparation per 10 mg of fmzag-12l were used : 1.8 mg / mg , 1 mg / mg , and 0.5 mg / mg of protein / mg magnetic particles . all concentrations showed a second protein peak ( 9th-10th fractions ) eluted by 0.3 m glucose addition at the 8th washing with 0.15 m nacl . the polyacrylamide gel electrophoresis to basic and native proteins of the fraction ( 10th ) collected from the 10 mg f4060 purification showed only cramoll 1 protein band ( figure 4(b ) ) . furthermore , the pure lectin cramoll 1 showed ha of 256 and was inhibited by all levans ( table 1 ) . the purification of this lectin is relevant due to its several applications such as neoplastic tissue marker . cramoll 1 showed a higher intensity of staining to transformed tissues than normal ones : also , encapsulation of cramoll 1 into liposomes produced an improvement in its in vivo antitumor activity against sarcoma 180 compared with free cramoll 1 solution . the lectin purification using only the ferromagnetic particles , namely , absent of levan , did not show any protein peak after 0.3 m glucose addition ( control ) . it is interesting to notice that cramoll 4 was collected when a purified preparation was incubated with the fmzag-12l ( figure 3(b ) ) but it was not obtained when a lesser purified preparation ( f4060 ) was used ( figure 4(b ) ) . probably , higher amounts of cramoll 1 than cramoll 4 in preparation f4060 and/or different binding constant values for the magnetic levan - lectin can justify these discrepancies . furthermore , the ferromagnetic composite of levan is synthesized by a simple and inexpensive method . cramoll 1 was purified by this fast two - step procedure ( ammonium sulfate fractionation and fmzag-12l affinity binding ) instead of the laborious and time consuming three - step protocol previously described . finally , it is important to investigate if other polysaccharides could replace the levan in the composite synthesis and be used to lectin purification ." ]

[ "although the incidence of mets is known to depend on lifestyle , diet , and physical activity,1,2 it is also suggested that genetic factors may play an important role . for example , the risk for mets may be increased by the presence of common snps within the fto - associated gene , the mc4r gene , and the ppar gene . as the expression profile of the corresponding proteins is strictly dependent on the genetic information within their genes , functional implications of these three polymorphisms seem to be significant . however , their exact mechanisms of action are still not clear . the fto gene is located on chromosome 16 and encodes 2-oxoglutarate - dependent nucleic acid demethylase . the gene is expressed in many tissues , especially in the hypothalamus , responsible for the control of energy balance.3,4 increases in the hypothalamic expression of fto are associated with the regulation of energy intake but not with the feeding reward.5 few snps within fto gene were found to play a role in obesity and t2dm.69 to date , three snps ( rs9939609 , rs1121980 , and rs1558902 ) have been associated with obesity and bmi in caucasian and hispanic americans.3,6,7 the association of rs9939609 ( a > t variant ) with obesity was found to be the strongest , especially in the dominant model of inheritance.10 in addition , a link between the fto rs9939609 polymorphism and obesity and mets has been confirmed in many studied populations , including in europe.1116 the mc4r and leptin genes are essential in the hypothalamic regulation of appetite.17,18 the mc4r gene plays an essential role in the maintenance of energy balance and is stimulated by endogenous melanocortins.19 its mutations account for 2.4%4% of morbidly obese people ; the polymorphisms of this gene have also been associated with obesity.20 common variants within the mc4r gene have been reported as the second strongest association signal for common obesity in the gwas.21 in adult europeans , the mc4r rs17782313 ( c > t variant ) polymorphism has been widely studied and found to predispose to obesity.21 with regard to mets , the studied association with the mc4r rs17782313 polymorphism disappears after adjusting for wc , indicating that the association with mets is driven by the association with this factor.22 moreover , studies on males proved that the rs17782313 polymorphism is associated with lower hdl concentration23 and elevated dbp.14,24 ppars are nuclear receptors , participate in adipogenesis and lipid metabolism , regulate insulin sensitivity , and participate in transformations in the energy system.25 of the three types of ppars ( , , and ) , the best known is ppar , with two isoforms ppar1 , which is expressed in many tissues , and ppar2 , which is expressed almost exclusively in adipocytes.26 the ppar activation plays an important role in adipocyte differentiation and maturation , lipid metabolism and transport , and improving insulin sensitivity.27,28 the ppar gene is located on the short arm of chromosome 3 at 3p25 band . the most common ppar gene polymorphism is rs1801282 ( c > g variant ) , resulting from proline being replaced with alanine.29 some literature data indicate a relationship between the rs1801282 polymorphism and metabolic disorders.30 healthy nonsmoking men carrying the mutant allele of rs1801282 polymorphism are at a high risk for mets and insulin resistance.30 in a large study of the caucasians , the rs1801282 was linked to wc in patients with t2dm.31 however , it must be remembered that other researchers found no such associations.32 in addition , ppar is involved in the activation of androgen receptor ( ar ) , which may affect the action of androgens.33 literature studies on men show significant relationships between mets and hormonal changes . it is emphasized that a decrease in fts and tst promotes the development of metabolic disorders , while disorders of carbohydrate metabolism , lipid metabolism and obesity contribute to hypogonadism.3437 this indicates that these pathologies are interrelated . both cross - sectional and longitudinal epidemiological studies indicate that the level of shbg is lower in men with mets.3840 other researchers emphasize , however , that the relationships between mets and either ts or shbg are stronger in younger men.34,35 dehydroepiandrosterone does not seem to play a significant role in the development of mets in men.34,37,41 finally , the conclusions of the emas support the supposition that e2 levels in aging men are not related to the development of mets.42 despite some knowledge on the interrelationships between metabolic and hormonal disorders in men , we still do not know which factors trigger them . it remains to be solved whether they are environmental or lifestyle factors , or genetic factors , and what comes first regarding the genetic factors that with a high probability are responsible for mets and associated disorders , it seems important to find any potential links with hormonal disturbances . we hypothesized that the selected genetic polymorphisms ( fto rs9939609 , mc4r rs17782313 , and ppar rs1801282 ) may contribute to the occurrence and increase in metabolic and androgen disorders in aging men . we aimed to examine the relationships between the fto rs9939609 , mc4r rs17782313 , and ppar rs1801282 and the prevalence of mets and related disorders , such as ht , t2 dm , and obesity . in addition , we aimed to analyze the relationships between selected polymorphisms and the parameters of lipid profile , including tch , ldl , hdl , tg , sex hormones , including tst , fts , e2 , dheas , shbg , and anthropometric parameters , including bmi , wc , and abp in middle - aged and elderly men , which may contribute to increased knowledge about the mutual relationships between metabolic and sex hormone disorders in aging men .", "this study involved 272 caucasian men aged 5075 years ( mean age 626.4 years ) who voluntarily signed up after receiving information about the study from their doctors at primary health - care centers in the city of szczecin ( poland ) . the exclusion criteria in this study included cancer treatment , receiving steroids ( including t and dehydroepiandrosterone ) , thyroid disease , and receiving neuroleptics or antidepressants . the medical questionnaire showed that none of the participants exceeded a daily alcohol intake of 40 g. we excluded patients on slimming diets or showing above - average physical activity . patients participating in the study filled in an original questionnaire ( questions about lifestyle including nutritional habits , smoking , alcohol intake , demographics status , physical activity , diseases , and drug intake ) . the study was performed in accordance with the declaration of helsinki and approved by the bioethics committee of the pomeranian medical university in szczecin ( kb-0012/159/12 ) . the men in the study were informed about the details of the research project and expressed their written consent to participate in the study . surveys revealed that 150 people suffered from ht ( 55.1% ) , 50 people had t2 dm ( 18.4% ) , and statins were taken by 30 of the men ( 11.0% ) . mets was diagnosed according to the 2005 idf criteria for european men ( wc 94 cm and at least two of the following : fpg 100 mg / dl or t2 dm treatment ; abp 130/85 mmhg or ht treatment ; hdl < 40 mg / dl or dyslipidemia treatment ; and tg 150 mg / dl or dyslipidemia treatment ) . in order to accurately measure wc , a physician located patients upper hip bone and then placed a tape measure around bare stomach just above the hip bone . each time , the measuring tape was parallel to the floor and adjacent to the patient s body . during measurement , bmi was calculated ; we assumed that bmi in the range of 18.524.99 denotes normal weight , of 2529.99 indicates overweight , and of 30 means obesity . to assess the sbp and dbp , the sphygmomanometer was used . the smallest cuff size covering ~2/3 of the right upper arm and encircling the entire arm completely , was selected . bp was measured in a supine position after 15 minutes rest , and only one of the physicians performed all of the bp measurements using a standardized protocol . blood was taken from the tested men on an empty stomach from an ulnar vein , between 7.30 am and 9.00 am . for the biochemical and hormonal assays , blood was drawn into a tube with a coagulator and gel separator and then centrifuged . for the genetic assays , blood was collected into tubes with ethylenediaminetetraacetic acid ( anticoagulant ) . the sera were stored at 70c . in the blood serum , we determined tch , ldl , hdl , tg , and fpg by spectrophotometric method , with the use of reagent kits ( biolabo ; aqua - med , lodz , poland ) . mets was diagnosed according to the criteria of the idf from 2005.43 enzyme - linked immunosorbent assay was used to determine serum concentrations of dheas , tst , fts , e2 , and shbg with the use of reagent kits ( drg medtek , warsaw , poland ) . genetic investigations were carried out in a laboratory of the department of gerontobiology , pomeranian medical university , szczecin , poland . genomic dna from peripheral blood leukocytes was extracted using an extraction kit ( high pure pcr template preparation kit ; roche , mannheim , germany ) according to the manufacturer s instructions . protocols for polymorphisms fto rs9939609 , mc4r rs17782313 , and ppar rs1801282 followed previously published polymerase chain reaction - restriction fragments length polymorphism techniques,4446 which were performed in a hightech thermocycler cycler - technology for life ( sensoquest , gottingen , germany ) . the genotypes were determined by 2%3% agarose gel electrophoresis ( agarose ; sigma - aldrich , munich , germany ) stained with dna - star dye ( lonza , inc , rockland , me , usa ) . all results were found to be reliable . for each of the loci , we performed analyses in overdominant models of inheritance followed by the adopted recessive models of inheritance ( fto : aa + ta vs tt ; mc4r : cc + ct vs tt ; and ppar : gg + cg vs cc ) . statistical analysis was performed using the statview software , version 5.0 ( sas institute inc . , continuous variables ( ie , bmi , abp , tst , fts , shgb , e2 , dheas , tg , tch , ldl , hdl , and fpg ) were described by am with standard deviation , median , and range . in the description of qualitative variables ( ie , genotype , t2 dm , ht , mets , overweight and obesity , and statin treatment ) , we presented the number ( n ) , which is also expressed as a percentage . first , test was used to verify whether genotype frequencies fit to the hardy weinberg ( h w ) equilibrium . then , an analysis of variance test was used to assess the associations between the genotypes fto rs9939609 , mc4r rs17782313 , and ppar rs1801282 polymorphisms and the anthropometric indicators , hormonal and metabolic parameters . in the next step , the assessment of relationships between genotypes and the qualitative variables was performed using a test of independence . to evaluate whether the studied polymorphisms determined any of the anthropometric and metabolic indices , which were found to be significant in previous analyses , we used the logistic regression analysis for the determination of odds ratio ( or ) and 95% confidence intervals .", "this study involved 272 caucasian men aged 5075 years ( mean age 626.4 years ) who voluntarily signed up after receiving information about the study from their doctors at primary health - care centers in the city of szczecin ( poland ) . the exclusion criteria in this study included cancer treatment , receiving steroids ( including t and dehydroepiandrosterone ) , thyroid disease , and receiving neuroleptics or antidepressants . the medical questionnaire showed that none of the participants exceeded a daily alcohol intake of 40 g. we excluded patients on slimming diets or showing above - average physical activity . patients participating in the study filled in an original questionnaire ( questions about lifestyle including nutritional habits , smoking , alcohol intake , demographics status , physical activity , diseases , and drug intake ) . the study was performed in accordance with the declaration of helsinki and approved by the bioethics committee of the pomeranian medical university in szczecin ( kb-0012/159/12 ) . the men in the study were informed about the details of the research project and expressed their written consent to participate in the study . surveys revealed that 150 people suffered from ht ( 55.1% ) , 50 people had t2 dm ( 18.4% ) , and statins were taken by 30 of the men ( 11.0% ) . mets was diagnosed according to the 2005 idf criteria for european men ( wc 94 cm and at least two of the following : fpg 100 mg / dl or t2 dm treatment ; abp 130/85 mmhg or ht treatment ; hdl < 40 mg / dl or dyslipidemia treatment ; and tg 150 mg / dl or dyslipidemia treatment ) .", "in order to accurately measure wc , a physician located patients upper hip bone and then placed a tape measure around bare stomach just above the hip bone . each time , the measuring tape was parallel to the floor and adjacent to the patient s body . during measurement , bmi was calculated ; we assumed that bmi in the range of 18.524.99 denotes normal weight , of 2529.99 indicates overweight , and of 30 means obesity . to assess the sbp and dbp , the sphygmomanometer was used . the smallest cuff size covering ~2/3 of the right upper arm and encircling the entire arm completely , was selected . bp was measured in a supine position after 15 minutes rest , and only one of the physicians performed all of the bp measurements using a standardized protocol .", "blood was taken from the tested men on an empty stomach from an ulnar vein , between 7.30 am and 9.00 am . for the biochemical and hormonal assays , blood was drawn into a tube with a coagulator and gel separator and then centrifuged . for the genetic assays , blood was collected into tubes with ethylenediaminetetraacetic acid ( anticoagulant ) . the sera were stored at 70c . in the blood serum , we determined tch , ldl , hdl , tg , and fpg by spectrophotometric method , with the use of reagent kits ( biolabo ; aqua - med , lodz , poland ) . mets was diagnosed according to the criteria of the idf from 2005.43 enzyme - linked immunosorbent assay was used to determine serum concentrations of dheas , tst , fts , e2 , and shbg with the use of reagent kits ( drg medtek , warsaw , poland ) .", "genetic investigations were carried out in a laboratory of the department of gerontobiology , pomeranian medical university , szczecin , poland . genomic dna from peripheral blood leukocytes was extracted using an extraction kit ( high pure pcr template preparation kit ; roche , mannheim , germany ) according to the manufacturer s instructions . protocols for polymorphisms fto rs9939609 , mc4r rs17782313 , and ppar rs1801282 followed previously published polymerase chain reaction - restriction fragments length polymorphism techniques,4446 which were performed in a hightech thermocycler cycler - technology for life ( sensoquest , gottingen , germany ) . the genotypes were determined by 2%3% agarose gel electrophoresis ( agarose ; sigma - aldrich , munich , germany ) stained with dna - star dye ( lonza , inc , rockland , me , usa ) . all results were found to be reliable . for each of the loci , we performed analyses in overdominant models of inheritance followed by the adopted recessive models of inheritance ( fto : aa + ta vs tt ; mc4r : cc + ct vs tt ; and ppar : gg + cg vs cc ) .", "statistical analysis was performed using the statview software , version 5.0 ( sas institute inc . , cary , nc , usa ) . continuous variables ( ie , bmi , abp , tst , fts , shgb , e2 , dheas , tg , tch , ldl , hdl , and fpg ) were described by am with standard deviation , median , and range . in the description of qualitative variables ( ie , genotype , t2 dm , ht , mets , overweight and obesity , and statin treatment ) , we presented the number ( n ) , which is also expressed as a percentage . first , test was used to verify whether genotype frequencies fit to the hardy weinberg ( h w ) equilibrium . then , an analysis of variance test was used to assess the associations between the genotypes fto rs9939609 , mc4r rs17782313 , and ppar rs1801282 polymorphisms and the anthropometric indicators , hormonal and metabolic parameters . in the next step , the assessment of relationships between genotypes and the qualitative variables was performed using a test of independence . to evaluate whether the studied polymorphisms determined any of the anthropometric and metabolic indices , which were found to be significant in previous analyses , we used the logistic regression analysis for the determination of odds ratio ( or ) and 95% confidence intervals .", "the characteristics of the study group and descriptive analysis of the metabolic and hormonal parameters are listed in table 1 . normal body weight was found in 65 patients ( 23.9% ) , overweight was found in 130 patients ( 47.8% ) , and obesity was found in 77 ( 28.3% ) . we found no associations between fto rs9939609 , mc4r rs17782313 , and ppar rs1801282 polymorphisms and the qualitative variables ( mets , t2 dm , ht , obesity , and overweight ) , and also in the overdominant and recessive models of inheritance ( table 3 ) . in the case of continuous variables , we found that fto rs9939609 polymorphism inherited only in the recessive pattern , which was associated with ldl concentration ; the difference in ldl concentration was statistically significant ( aa + at : 136.1851.57 mg / dl vs tt : 153.0462.48 mg / dl ; p=0.03 ) . we also found that the presence of two mutant alleles was associated with higher tch level ( tt : 223.0764.94 mg / dl and aa + at : 207.354.9 mg / dl ; p=0.05 ) . there was no other evidence of links between the analyzed continuous variables and the fto rs9939609 polymorphism in any of the analyzed models of inheritance . however , the association between the recessive genotype of rs9939609 polymorphism and sbp was close to statistical significance ( p=0.07 ) . analyzing the relationship between the continuous variables and the mc4r rs17782313 polymorphism , we demonstrated that men with the cc and ct genotypes had a significantly greater wc ( cc + ct : 103.9112.61 cm vs tt : 99.7710.88 cm ; p=0.005 ) ( table 4 ) . for other continuous variables , we found no statistically significant relationships with the mc4r rs17782313 polymorphism in both models of inheritance . this study showed no connection between the ppar ( rs1801282 ) polymorphism and the studied continuous variables . in the final step of our experiments , we aimed to establish whether recessive genotypes of the polymorphisms determined any of the clinical conditions ( t2 dm , mets , ht , overweight , and obesity ) , or continuous variables anthropometric , hormonal , and metabolic indices by means of logistic regression . we found no statistical significance with regard to the relationship between fto rs9939609 , mc4r rs17782313 , and ppar ( rs1801282 ) polymorphisms and any of the clinical conditions mets , t2 dm , ht , overweight , and obesity ( p>0.05 ) . on the other hand , two mutant alleles of fto rs9939609 polymorphism were found to be related to a minimal elevation of ldl , and the recessive genotype ( tt homozygotes ) of mc4r rs17782313 polymorphism was associated with a reduction in wc . the remaining anthropometric and biochemical parameters showed no statistical significance in the logistic regression model .", "in this study , we found no relationship between the presence of fto rs9939609 , mc4r rs17782313 , and ppar rs1801282 polymorphisms and the incidence of t2 dm , ht , mets , and obesity in caucasian men aged 5075 years , living in the city of szczecin ( poland ) . we also found no links between the presence of these polymorphisms and the levels of the tested hormones ( tst , fts , e2 , and dheas ) and shbg . with regard to biochemical parameters , we found a statistically significant association between the levels of tch and ldl and the fto rs9939609 polymorphism in the recessive model of inheritance . we proved that mutant homozygotes had higher tch and ldl concentrations in comparison to other genotypes . in the group of anthropometric parameters , possessing two mutant alleles was found to be associated with lower wc in comparison to wild - type homozygotes and heterozygotes for the analyzed snp . our results on the fto rs9939609 polymorphism stand in contrast to a study in which non - caucasian subjects demonstrated links between the fto rs9939609 polymorphism and the occurrence of mets.47 moreover , that study also reported that an increased risk for mets , especially in men , is associated with the presence of at least one wild - type allele . this regularity is also mentioned in a meta - analysis by freathy et al,48 where allele a frequency correlated with lower hdl and higher tg concentrations and other components of mets , but after adjusting for bmi , this relationship became statistically insignificant . in this study , we found no statistically significant relationships between either hdl or tg level and the fto rs9939609 polymorphism . however , we did observe a relationship between the presence of the fto rs9939609 polymorphism and both ldl and tch concentrations . our results indicated that the men with at least one allele of wild type had significantly lower levels of tch and ldl compared to the men with the tt ( mutant ) genotype . probably , lipid concentrations result primarily from the lifestyle of middle - aged and older men , including a high - calorie diet and low physical activity . carlos et al15 concluded that rs9939609 variant predisposes to obesity in portuguese population aged 1850 years . woehning et al16 found that the polymorphism is linked to initial body weight , based on the results of their cross - sectional study in adults aged 1872 years . liguori et al49 proved that in a population of obese subjects of italian origin , ta heterozygotes of rs9939609 are more prone to develop mets ( or 2.53 ) . a study by jacobsson et al50 finds no relationship between the fto rs9939609 polymorphism and bmi in elderly men from sweden , indicating that its contribution to the incidence of obesity decreases with age . zavatarri et al51 showed no association between the fto rs9939609 polymorphism and the parameters of lipid metabolism and stressed that aa homozygotes are particularly predisposed to obesity . population studies conducted by gustavsson et al52 on gothenburg residents confirmed that aa and ta genotypes have a greater wc and a higher bmi compared to tt genotype . all the aforementioned results stand in contrast to our findings , showing the lack of relationship between metabolic parameters and the fto rs9939609 polymorphism . it may have been due to the relatively small size of the group and the differences in selection of the participants in terms of age and gender . our male population was aged between 50 and 75 years , while there is evidence that in people aged > 65 years , the relationship between the fto rs9939609 polymorphism and obesity is reduced , especially in men.53 with respect to the mc4r rs17782313 polymorphism , some researchers emphasize the role of c ( wild - type ) allele being associated with a higher risk for insulin resistance , t2 dm , and ht incidence , independently of bmi.54 the relation between the mc4r rs17782313 polymorphism and obesity was also described by xi et al.55 with regard to mets , the association with the mc4r rs17782313 polymorphism disappears after adjusting for wc , indicating that the association with mets is driven by the link with this factor,13 which shows that c allele may predispose to abdominal obesity . this is confirmed by our results where men with at least one c allele had a significantly higher wc , in addition to a higher bmi , although that difference was not statistically significant . therefore , it can be assumed that the wild - type homozygous and heterozygous genotypes of mc4r rs17782313 polymorphism promote the accumulation of visceral fat . on the other hand , marcadenti et al14 found that mc4r rs17782313 is positively associated with neck circumference and bmi in women and negatively associated with bp in men . however , the study was conducted in non - caucasians , which makes the comparisons complicated . in this study , we found no statistically significant associations between the ppar rs1801282 polymorphism and mets , t2 dm , ht , overweight , obesity , and anthropometric and biochemical parameters in men aged between 50 and 75 years . on the other hand , tellechea et al30 found that in men from argentina , with the exception of caucasians , the rs1801282 polymorphism showed a relation with the occurrence of mets diagnosed using the criteria of the national cholesterol education program / adult treatment panel iii and with insulin resistance , especially in nonsmokers . however , those studies were conducted among younger men , so it can be assumed that environmental influences were lower . as in this study , milewicz et al56 did not observe any association between the studied ppar rs1801282 polymorphism and mets and metabolic parameters in postmenopausal women from poland . also studies conducted on an ethnically diverse group of people ( caucasian , south asian , and african american ) did not show any association between the ppar rs1801282 polymorphism and mets.32 dytfeld and horst - sikorska29 highlighted the role of diet in metabolic disorders in patients with the ppar rs1801282 polymorphism and modification of the genotype by environmental factors , which can lead to diverse phenotypes . on the other hand , kruzliak et al31 conducted analyses in a group of > 1000 caucasians with t2 dm and proved that the homozygous slovene females with wild - type alleles had lower wc in comparison with homozygous females with mutated alleles . all in all , these findings were not replicated in this study , probably due to gender and age differences . in this study on men , we found no relationship between the fto rs9939609 polymorphism and the concentration of hormones dheas , e2 , tst , fts , and shbg . in the available literature , we found no reports on the relationships between the fto rs9939609 and mc4r rs17782313 polymorphisms and the levels of sex hormones in men . in this study , we also found no such relations . hainerov et al,57 based on the results of studies in young obese men with hypogonadism and g181d mutation in the mc4r gene , reported that obesity caused by the mutation in the mc4r rs17782313 polymorphism indirectly contributes to hormonal changes , as the adipose tissue is an active endocrine organ . in this study , we found no association between the ppar rs1801282 polymorphism and tst , fts , e2 , dheas , and shbg concentrations , but the study included men aged > 50 years , in whom metabolic disorders are mainly the result of lifestyle . studies of park et al58 in men have shown that the ppar polymorphisms play a significant role in tumorigenesis as a tumor suppressor and ppar agonists may have a beneficial effect in the treatment of prostate cancer . it is , therefore , necessary to conduct further studies on the possible associations between the ppar rs1801282 polymorphism and hypogonadism , prostatic hyperplasia , and prostate cancer . some studies59,60 have demonstrated the importance of dietary factors and physical activity level for the development of mets . lifestyle modification is effective in resolving mets and reducing the severity of related abnormalities ( fpg , wc , sbp , dbp , and tg ) in patients with mets.59 although it does not necessarily influence any given risk factor as much as dedicated drugs , its benefit lies in a moderate reduction in all the metabolic risk factors . genetic factors in mets are still under investigation . our results and other researchers findings show that metabolic disorders in middle - aged and elderly people , including mets and its components , are mainly the effect of lifestyle , including many years of improper eating habits and low physical activity , while genetic predisposition plays a much less significant role . also in case of a singular snp within the gene , it may be difficult to fully explain the risk for metabolic disorders and related traits.61 this phenomenon may be linked to potential gene gene interactions . in case of singular snp , other modest - risk variants may be the origin of the risk or control the expression of the particular risk factor.62 on the other hand , if an snp may be an independent risk factor for a given clinical event , its effect can be observed with the passage of time . in complex diseases such as metabolic disorders , the effect of biallelic polymorphisms is most visible in the elderly , as the majority of independent environmental factors ( eg , eating habits ) remain at relatively stable levels . that is why this period of life is the most appropriate to observe the direct influence of genetic variation on the value of a given clinical parameter . patients aged > 50 years , ie , those we studied in this research , are therefore the optimal group in this context . however , it must be remembered that this study had significant limitations , as we included patients who reported voluntarily and we did not exclude patients with extreme obesity . due to the multitude of statistically insignificant results , we performed a post hoc power analysis using the g * power software.63 the power of tests , which showed no statistical significance , was below the recommended level of 0.8.64 on the other hand , tests showing statistical significance had an acceptable power , reaching as high as 0.84 . in our opinion , the small power of tests may be responsible for the great number of statistically insignificant results of the analysis . in order to increase the power of the tests , the sizes of the study groups would have to increase significantly . besides , in a genetic association study , a reliable assessment of the prevalence of alleles increases with sample size ( which means a greater number of alleles at a given locus ) . one should also take into account additional factors , such as the adopted model of inheritance , and especially the frequency of risk alleles at a given locus and the risk for the disease in a given population . in conclusion , a limited number of statistically significant results in this study may have been caused by the insufficient number of patients in the study , and thus the low power of statistical tests .", "the fto rs9939609 and mc4r rs17782313 gene polymorphisms have little significant relationships with metabolic health problems ( t2 dm , ht , overweight and obesity , and lipid disorders ) and do not result in androgen disorders in aging men . however , our results extend the knowledge on genotype susceptibility for metabolic disturbances in relation to a specific geographical area of residence ." ]

[ "since the breakthrough discovery of the obligatory role of the vascular endothelial cells by furchgott and zawadzki in 1980 , endothelial pathophysiology has been intensely investigated , and the term \" endothelial dysfunction \" has been referred to in the scientific literature over 50,000 times ( pubmed search , may 2012 ) . it is well known that the endothelial dysfunction is associated with aging , hypertension , atherosclerosis , and numerous other physiological and pathophysiological processes . nitric oxide ( no ) , prostacyclin , and endothelium - derived hyperpolarizing factor ( epoxyeicosatrienoic acid ) are the three major substances involved in the endothelium - dependent vasodilator pathways . the mechanism of endothelial dysfunction is largely due to the reduced bioavailability of endothelium - derived no by oxidative stress . accordingly , the hallmark of endothelial dysfunction is impaired endothelium - dependent vasodilation , which is mediated by no . a free radical is defined as any species that contains one or more unpaired electrons . reactive oxygen species ( ros ) is a collective term that includes both oxygen free radicals , such as superoxide ( o2 ) , hydroxyl ( oh ) , peroxyl ( roo ) , and hydroperoxyl ( ho2 ) radicals , and certain non - radical oxidizing agents , such as hydrogen peroxide ( h2o2 ) , hypochlorous acid ( hocl ) , and ozone ( o3 ) , that can be readily converted to free radicals . no and peroxynitrite ( onoo ) are the most relevant reactive nitrogen species in the cardiovascular system . many studies have demonstrated that angiotensin - converting enzyme ( ace ) inhibitors have induced many beneficial effects on the endothelial function in animal models and humans , have improved the endothelial function in hypertension , and have reduced the risk associated with cardiovascular disease . there have been numerous attempts to decrease the major complications associated with cardiac surgery , and there is increasing evidence that ace inhibitors hold promise as protective cardiovascular agents for cardiac surgery patients . the mechanisms of the protective effects of ace inhibitors involve multiple factors , including those relating to their antioxidant effects . in several experimental studies , only sulfhydryl ( sh)-containing ace inhibitors such as captopril and zofenopril exerted the endothelium protective effect , but in other studies , the non - sh - containing ace inhibitor also showed similar effects . therefore , the present study was designed to evaluate the antioxidant effects of ace inhibitors with or without a sh group ( captopril and enalapril , respectively ) and to identify the involved mechanisms .", "all of the animal procedures were approved by the animal care and use committee of hanyang university . twenty - five male new zealand white rabbits ( koatech , pyeongtaek , korea ) weighing between 2.0 and 2.5 kg were anesthetized with 3% to 5% sevoflurane in 4 l / min of 100% oxygen in a restraint chamber . the marginal ear vein was cannulated , and heparin ( 1,000 iu / kg ) was administered intravenously . after 10 minutes , the rabbit was sacrificed by exsanguination from the carotid artery . the infrarenal abdominal aorta was carefully excised and placed in a petri dish filled with 4 krebs - henseleit solution of the following composition ( mm ) : nacl 120.0 , nahco3 25.0 , kcl 5.0 , nah2po4 1.4 , mgso4 1.2 , cacl2 2.5 , and glucose 11.0 . the vessel was cleaned of fat and connective tissue with extreme caution not to damage the endothelium or smooth muscle . the vessel rings were mounted between two l - shaped steel hooks in water - jacketed ( 370.5 ) organ baths filled with 5 ml of krebs - henseleit solution . the medium was continuously gassed with a mixture of 95% of o2 and 5% of co2 throughout the experiment . the lower hook was fixed to the organ chamber , and the upper hook to the force transducer ( tsd125c ; biopac systems inc . , the isometric tension was continuously recorded on a personal computer with a data acquisition system ( mp100 system , biopac systems inc . ) via a transducer amplifier ( da100c , biopac systems inc . ) . all the vessels were first equilibrated for 90 minutes , and the resting tension was set to 2 g gradually . during the equilibration period , the chamber medium was exchanged every 15 minutes . after the equilibration period , the endothelium integrity was assessed by precontracting the aortic ring with 10 m of norepinephrine ( ne ) and a subsequent relaxation with cumulative concentrations ( 310 , 10 , 310 , and 10 m ) of acetylcholine ( ach ) . an aortic ring with an endothelial function ( relaxation ) greater than or equal to 80% was considered to have an intact endothelium , and was included in the experiment . a constant current of 15 ma was applied for 35 seconds using two circular platinum wire electrodes ( each 7 mm in length ) located at the bottom of the organ baths . the vessel ring was mounted over 1 cm apart from the electrodes to avoid direct electrical injury . at 15 minutes of equilibration after the pretest and medium exchange , various concentrations ( 10 , 310 , 10 , and 310 m ) of captopril or enalapril were added and incubated for 15 minutes . after exposure to ros generated by electrolysis , the medium was exchanged again . the contraction and relaxation curves changes of the aortic tone by ach were expressed as percentages , and they were used as the experimental values . cu / zn superoxide dismutase ( sod ) and catalase , the two important antioxidant enzymes , were inhibited to investigate the mechanism of the antioxidant activity of captopril and enalapril . diethyldithiocarbamate ( detca ) was used for cu / zn sod inhibition , and 3-amino-1,2,4-triazole ( 3at ) for catalase inhibition . after the pretest and equilibration period ( 15 minutes ) , the vessels were pre - incubated with 0.5 mm of detca for 30 minutes or 50 mm of 3at for 60 minutes . captopril ( 310 m ) or enalapril ( 310 m ) was added and incubated during the last 15 minutes of pre - incubation , and the vessel rings were then exposed to electrolysis - induced ros . after refreshing the medium , ne - induced contraction and the series of ach applications were then repeated . ne , ach , captopril , enalapril , detca , and 3at were purchased from sigma - aldrich , inc . the responses to ach are expressed as the percentage of the ach - induced relaxation , in the same vessel , during the pretest . when appropriate , the student t - test or one - way analysis of variance ( anova ) followed by a post test for linear trend and the dunnett test were performed . all of the curve fittings and statistical analyses were performed using prism ver . 5.0 ( graphpad software inc . , san diego , ca , usa ) . a p - value less than 0.05", "twenty - five male new zealand white rabbits ( koatech , pyeongtaek , korea ) weighing between 2.0 and 2.5 kg were anesthetized with 3% to 5% sevoflurane in 4 l / min of 100% oxygen in a restraint chamber . the marginal ear vein was cannulated , and heparin ( 1,000 iu / kg ) was administered intravenously . after 10 minutes , the rabbit was sacrificed by exsanguination from the carotid artery . the infrarenal abdominal aorta was carefully excised and placed in a petri dish filled with 4 krebs - henseleit solution of the following composition ( mm ) : nacl 120.0 , nahco3 25.0 , kcl 5.0 , nah2po4 1.4 , mgso4 1.2 , cacl2 2.5 , and glucose 11.0 . the vessel was cleaned of fat and connective tissue with extreme caution not to damage the endothelium or smooth muscle . the vessel rings were mounted between two l - shaped steel hooks in water - jacketed ( 370.5 ) organ baths filled with 5 ml of krebs - henseleit solution . the medium was continuously gassed with a mixture of 95% of o2 and 5% of co2 throughout the experiment . the lower hook was fixed to the organ chamber , and the upper hook to the force transducer ( tsd125c ; biopac systems inc . , goleta , ca , usa ) . the isometric tension was continuously recorded on a personal computer with a data acquisition system ( mp100 system , biopac systems inc . ) via a transducer amplifier ( da100c , biopac systems inc . ) . all the vessels were first equilibrated for 90 minutes , and the resting tension was set to 2 g gradually . during the equilibration period , the chamber medium was exchanged every 15 minutes .", "after the equilibration period , the endothelium integrity was assessed by precontracting the aortic ring with 10 m of norepinephrine ( ne ) and a subsequent relaxation with cumulative concentrations ( 310 , 10 , 310 , and 10 m ) of acetylcholine ( ach ) . an aortic ring with an endothelial function ( relaxation ) greater than or equal to 80%", "a constant current of 15 ma was applied for 35 seconds using two circular platinum wire electrodes ( each 7 mm in length ) located at the bottom of the organ baths . the vessel ring was mounted over 1 cm apart from the electrodes to avoid direct electrical injury .", "at 15 minutes of equilibration after the pretest and medium exchange , various concentrations ( 10 , 310 , 10 , and 310 m ) of captopril or enalapril were added and incubated for 15 minutes . after exposure to ros generated by electrolysis , the medium was exchanged again . the contraction and relaxation curves changes of the aortic tone by ach were expressed as percentages , and they were used as the experimental values .", "cu / zn superoxide dismutase ( sod ) and catalase , the two important antioxidant enzymes , were inhibited to investigate the mechanism of the antioxidant activity of captopril and enalapril . diethyldithiocarbamate ( detca ) was used for cu / zn sod inhibition , and 3-amino-1,2,4-triazole ( 3at ) for catalase inhibition . after the pretest and equilibration period ( 15 minutes ) , the vessels were pre - incubated with 0.5 mm of detca for 30 minutes or 50 mm of 3at for 60 minutes . captopril ( 310 m ) or enalapril ( 310 m ) was added and incubated during the last 15 minutes of pre - incubation , and the vessel rings were then exposed to electrolysis - induced ros . after refreshing the medium , ne - induced contraction and the series of ach applications were then repeated .", "ne , ach , captopril , enalapril , detca , and 3at were purchased from sigma - aldrich , inc .", "the responses to ach are expressed as the percentage of the ach - induced relaxation , in the same vessel , during the pretest . when appropriate , the student t - test or one - way analysis of variance ( anova ) followed by a post test for linear trend and the dunnett test were performed . all of the curve fittings and statistical analyses were performed using prism ver . 5.0 ( graphpad software inc . , san diego , ca , usa ) . a p - value less than 0.05", "in a dose - dependent manner , the captopril - treated vessel rings preserved ach - induced endothelium - dependent relaxation against the ros attack ( fig . 1 ) . at the highest concentration ( 10 m ) of ach , the 10 , 310 , 10 , and 310 m captopril treated groups showed a relaxation rate of 1.9%1.2% , 81.2%1.9% , 86.0%2.1% , and 89.1%0.8% , respectively ( n=15 for each group ; anova and post test for linear trend ; both p<0.0001 ) . the treatment of enalapril showed a similar effect ( fig . the 10 , 310 , 10 , and 310 m enalapril - treated groups had relaxation rates of 1.8%1.2% , 10.0%2.1% , 73.9%5.7% , and 89.1%0.8% , respectively ( n , 13 to 15 ; anova and post test for linear trend ; both p<0.0001 ) . the relaxation rate of the detca+captopril group was significantly lower than the control ( captopril - only ) group after the ros attack ( 73.0%2.4% vs. 86.8%1.1% ; n=15 ; p<0.0001 ) ( fig . detca exerted the same effect with enalapril ( 73.0%2.4% vs. 86.8%1.1% ; n=15 ; p<0.0001 ) ( fig . , 3at pretreatment did not alter the relaxation rate of the captopril - treated group nor the enalapril - treated group ( fig .", "in a dose - dependent manner , the captopril - treated vessel rings preserved ach - induced endothelium - dependent relaxation against the ros attack ( fig . 1 ) . at the highest concentration ( 10 m ) of ach , the 10 , 310 , 10 , and 310 m captopril treated groups showed a relaxation rate of 1.9%1.2% , 81.2%1.9% , 86.0%2.1% , and 89.1%0.8% , respectively ( n=15 for each group ; anova and post test for linear trend ; both p<0.0001 ) . the treatment of enalapril showed a similar effect ( fig . the 10 , 310 , 10 , and 310 m enalapril - treated groups had relaxation rates of 1.8%1.2% , 10.0%2.1% , 73.9%5.7% , and 89.1%0.8% , respectively ( n , 13 to 15 ; anova and post test for linear trend ; both p<0.0001 ) .", "the relaxation rate of the detca+captopril group was significantly lower than the control ( captopril - only ) group after the ros attack ( 73.0%2.4% vs. 86.8%1.1% ; n=15 ; p<0.0001 ) ( fig . detca exerted the same effect with enalapril ( 73.0%2.4% vs. 86.8%1.1% ; n=15 ; p<0.0001 ) ( fig . , 3at pretreatment did not alter the relaxation rate of the captopril - treated group nor the enalapril - treated group ( fig .", "in the present study , both captopril and enalapril exerted an antioxidant effect against the electrolysis - induced ros in the rabbit aortic rings . this antioxidant effect was partially reduced by detca pretreatment , but it was not affected by 3at pretreatment . ach - induced vasorelaxation requires the integrity of the vascular endothelium , thus \" endothelium - dependent \" relaxation . ach binds to the muscarinic receptor of the endothelial cell , and the intracellular calcium level increases , which leads the endothelial nitric oxide synthase ( enos ) to produce no . the produced no diffuses to the vascular smooth muscle cell , and it activates the soluble guanylyl cyclase , which eventually converts the guanosine triphosphate to cyclic guanosine monophosphate ( gmp ) inducing smooth muscle relaxation . in addition , the cyclooxygenase ( cox ) pathway producing prostacyclin is also related to the endothelium - dependent vasorelaxation . the endothelium is a major regulator of vascular homeostasis that maintains the balance between vasodilation and vasoconstriction , inhibition and promotion of the proliferation and migration of smooth muscle cells , prevention and stimulation of the adhesion and aggregation of platelets , as well as thrombogenesis and fibrinolysis . upsetting this balance leads to endothelial dysfunction and damage to the arterial wall . these homeostatic effects are largely mediated by no , a pivotal endothelium - derived substance . no is a diffusible substance with a half - life of a few seconds , and it is formed from l - arginine by oxidation of the guanidine - nitrogen terminal . vascular endothelial cells normally generate ros as \" second messengers \" that might regulate endothelial cell growth and proliferation , endothelial barrier function , vasorelaxation , and vascular remodeling . ros production has been known to occur in the endothelium , but also within the media and adventitia , all of which may impair no signaling within vascular tissue to endothelium - dependent and endothelium - independent vasodilators . superoxide anion can be generated by various enzymes such as nicotinamide adenine dinucleotide phosphate oxidase , xanthine oxidase , cox , no synthase , lipoxygenase , cytochrome p450 monooxygenases , and enzymes of the mitochondrial respiratory chain . superoxide anion and transition metals such as iron and copper react with hydrogen peroxide to form highly reactive hydroxyl radicals through the fenton reaction ( fe+h2o2fe+oh+oh ) and the haber - weiss reaction ( o2+h2o2oh+oh+o2 ) . no and superoxide anion rapidly interact to form peroxynitrite , a potent oxidant also capable of oxidizing sh groups and thioethers , as well as nitrating and hydroxylating aromatic groups , including tyrosine , tryptophan , and guanine . at high concentrations , peroxynitrite is cytotoxic and may cause oxidative damage to proteins , lipids , and dna . oxidative stress , however , may cause endothelial dysfunction or cell death through various pathways . superoxide anions reduce the bioavailability of no and directly inhibit its main target : soluble guanylyl cyclase . the major target of ros is no , but the resultant formation of peroxynitrite also causes endothelial dysfunction by oxidation of the zn - thiolate complexes within enos and the essential cofactor tetrahydrobiopterin ( bh4 ) . as a result of the oxidation of bh4 , enos becomes \" uncoupled \" and produces ros rather than no . in addition , peroxynitrite inhibits guanylyl cyclase , inactivates the prostacyclin synthase by tyrosine nitration , and further enhances oxidative stress by inhibiting sod . hydroxyl radicals , another ros , can induce cell damage through the peroxidation of lipids and sh groups . on the other hand , oxidative stress can also induce apoptosis of endothelial cells by activation of apoptosis signal - regulating kinase 1 and c - jun n - terminal kinase . in the present study , we used the buffer solution electrolysis method to produce the oxidative stress to the vascular rings . the ros generation system by electrolysis of a physiological salt solution has the advantage that a wide range of ros are produced without addition of enzymes or chemicals , which themselves may influence the experiment . furthermore , the short duration of exposure to ros allows the measurement of responses to various drugs , without the continuous inactivation of no or the possible oxidation of drugs by ros . this electrolysis system generates superoxide anions , hydroxyl radicals , hydrogen peroxide , singlet oxygen , and hypochlorite . the endothelium - dependent vasorelaxation is almost completely abolished by exposure to ros . in the present study , endothelium - dependent vasorelaxation was severely compromised in the aortic rings with low concentrations of captopril or enalapril pretreatment . the vasoconstrictor response to 1 adrenoceptor stimulation is impaired by exposure to ros . because we used ne for preconstriction of the vessels in the present experiment , we applied a duration and intensity ( 35 seconds and direct current 15 ma , respectively ) of constant current electrolysis that compromised endothelium - dependent vasorelaxation but did not affect ne - induced vasoconstriction . the predominant isoform cu / zn sod is inhibited by the cu chelator detca . in the present study , this represents that superoxide anion scavenging activity is related to the mechanism of the antioxidant effect of captopril and enalapril . hydrogen peroxide is scavenged by catalase , and this enzyme is inhibited by 3at . in the present experiment , pretreatment with 3at did not affect the antioxidant effect of captopril and enalapril , suggesting that their endothelium protective effect is not associated with hydrogen peroxide scavenging action . many researchers have reported that only sh - containing ace inhibitors possess an antioxidant effect [ 10,24 - 26 ] . the sh moiety easily undergoes oxidation and disulfide exchange reactions and can be converted into disulfides through the interaction with free radicals . by this process , it can serve as a free radical scavenger , thereby protecting the endothelial function . on the other hand , some investigators have reported that non - sh - containing ace inhibitors also exerted an endothelium protective effect against free radical injury . it was reported that ramiprilat , a non - sh - containing ace inhibitor , protects against free radical injury in isolated working rat hearts . the investigators explained that ramiprilat inhibits free radical - induced damages mainly by stimulation of prostacyclin synthesis and/or release , because their data showed that the addition of indomethacin ( 5 mol / l ) completely abolished the protective effects of ramiprilat . this interpretation seems confusing , however , because in a later study it was demonstrated that cox inhibitors , such as indomethacin , possess antioxidant properties . in another experiment concerning this issue by fujita et al . , they found that quinaprilat , a non - sh - containing ace inhibitor , could ameliorate both apoptosis and necrosis through the up - regulation of constitutive enos via an increase of bradykinin , with the resulting increase of nitric oxide in the cultured human aortic endothelial cells . the b2 receptor is constitutively expressed , but the b1 receptor is normally absent and is only induced under inflammatory conditions in humans . rabbit blood vasculature , however , is rich in b1 receptor sites ; hence , this difference between species should be considered when interpreting the results . one limitation of the present study is that the amount of ros generated by electrolysis could not be measured due to the lack of methodologies . a device that can measure the real - time amount of ros in the vicinity of the electrodes would be beneficial . this method may offer clues for elucidating the exact ros composition ratio in the electrolyzed buffer solution . it remains to be investigated whether other ace inhibitors , with or without a sh group , also protect endothelium against ros . further studies on prostacyclin inhibition without any interactions with ros may clarify the relevance of prostacyclin in the endothelium protective effects of ace inhibitors . performing these studies would more clearly explain the exact mechanism of the known beneficial effects of ace inhibitors in cardiac surgery patients .", "both captopril ( a sh - containing ace inhibitor ) and enalapril ( a non - sh - containing ace inhibitor ) protect endothelium against free radical injury in a dose - dependent manner in isolated rabbit abdominal aortas ." ]

[ "rehabilitation nutrition is a combination of both rehabilitation and nutrition care management , and this concept is used with international classification of functioning , disability and health guidelines to evaluate nutrition status and to maximize functionality in the elderly and other people with disability . rehabilitation nutrition may further improve physical and mental function , activities of daily living , and quality of life . the term rehabilitation nutrition is quite different from that of nutritional rehabilitation . in contrast , rehabilitation nutrition not only refers to nutritional improvement but also to rehabilitation in people with disability [ 1 , 2 ] . the key aims of rehabilitation nutrition assessment are to assess the following : ( 1 ) the presence and cause of malnutrition ; ( 2 ) the presence and cause of sarcopenia ; ( 3 ) the presence and cause of dysphagia ; ( 4 ) the adequacy of nutrition care management with prediction of future nutritional status ; and ( 5 ) whether rehabilitation for functional improvement , such as resistance training and endurance training , can be conducted . the prevalence of malnutrition in rehabilitation settings is high . in elderly patients hospitalized for rehabilitation , the prevalence of compromised nutrition status was estimated to be 4967 % . in australia , 33 and 51.5 % of patients admitted to rehabilitation hospitals were classified as malnourished and at nutritional risk using the mini nutritional assessment ( mna ) and the mna short - form ( mna - sf ) . one study using pooled mna data found that the prevalence of malnutrition in elderly people was highest in rehabilitation settings ( rehabilitation , 50.5 % ; hospital , 38.7 % ) . another study using the mna - sf revealed a 40.8 % prevalence of malnutrition in rehabilitation settings . a systematic review found that malnutrition in older adults admitted for rehabilitation has a negative effect on functional recovery and quality of life following discharge to the community . furthermore , rehabilitation outcome has been shown to be poor in malnourished patients with stroke , hip fracture , hospital - associated deconditioning [ 10 , 11 ] , and a variety of other diseases . the prevalence of sarcopenia in rehabilitation settings is also high : 1030 % in community - dwelling elderly and 40 % in ambulatory rehabilitation facility - dwelling elderly 60 years and older . another study revealed that 46.5 % patients admitted to a subacute geriatric care unit who underwent a rehabilitation intervention met the diagnostic criteria for sarcopenia . the european working group on sarcopenia in older people categorized sarcopenia into primary sarcopenia ( age - related sarcopenia ) and secondary sarcopenia ( i.e. , activity- , disease- , or nutrition - related sarcopenia ) . assessment of the multifactorial causes of primary and secondary sarcopenia is indispensable because rehabilitation nutrition for sarcopenia differs depending on its etiology . treatment of age - related sarcopenia includes resistance training , protein and amino acid supplementation , smoking cessation , and pharmaceutical therapies [ 16 , 17 ] . pharmaceutical therapy of sarcopenia is likely to advance in the near future because our understanding of the role of regulators in sarcopenia has increased [ 18 , 19 ] . early ambulation , exercise , and avoiding bed rest are important for preventing and treating activity - related sarcopenia . treatment of disease - related sarcopenia includes therapies for advanced organ failure , inflammatory disease , malignancy , and endocrine disease , while treatment of nutrition - related sarcopenia includes appropriate nutrition management to increase muscle mass [ 16 , 17 ] . in cases of age- , activity- , disease- , and nutrition - related sarcopenia , stroke , hip fracture , and hospital - associated deconditioning are major causes of disability in inpatient rehabilitation facilities . in the usa , the six largest diagnostic impairment categories receiving inpatient rehabilitation include stroke , lower extremity fracture , lower extremity joint replacement , debility , neurologic disorders , and brain dysfunction . hip fracture is a leading cause of disability in lower extremity fracture patients , and debility is synonymous with hospital - associated deconditioning . in japan , common causes of inpatient rehabilitation in convalescent rehabilitation wards are stroke ( 47.9 % ) ; orthopedic diseases , including hip fracture ( 35.2 % ) ; disuse syndrome ( 10.5 % ) ; and traumatic brain and spinal cord injury ( 5.4 % ) . these data indicate that management of patients with stroke , hip fracture , and hospital - associated deconditioning is an important part of inpatient rehabilitation . the term sarcopenic dysphagia refers to difficulty swallowing due to sarcopenia of generalized skeletal muscles and swallowing muscles [ 22 , 23 ] . age - related loss of the tongue and geniohyoid muscle mass has been studied in the elderly [ 24 , 25 ] . sarcopenic dysphagia is an important current and future public health issue , because it is common in the elderly and can lead to aspiration pneumonia , the prevalence of which is increasing with the aging of society . therefore , we review rehabilitation nutrition for stroke , hip fracture , hospital - associated deconditioning , and sarcopenic dysphagia , and then assess the level of research interest in rehabilitation nutrition .", "more than 60 % of patients remain disabled , 50 % of patients suffer from hemiparesis , and 30 % remain unable to walk without assistance . as the benefits of rehabilitation are beyond doubt , rehabilitation strategies play center stage in optimizing functional recovery after stroke [ 27 , 28 ] . both malnutrition and obesity are nutritional problems in stroke . according to a recent systematic review , malnutrition and dysphagia respectively occur in 8.249.0 % and 24.352.6 % of subjects following stroke . in subgroup analysis , the odds of malnutrition were significantly increased during the rehabilitation stage ( odds ratio ( or ) , 2.445 ; 95 % confidence interval ( ci ) , 1.0095.925 ) . tissue wasting , sarcopenia , and cachexia may impair and delay poststroke rehabilitation and worsen the prognosis , and increasing evidence suggests that patients who are overweight and mildly obese may actually have a better outcome . analysis of data from the china national stroke registry on patients grouped according to their body mass index ( bmi ) into underweight ( < 18.5 kg / m ) , normal weight ( 18.522.9 kg / m ) , overweight ( 2327.4 kg / m ) , obese ( 27.532.4 kg / m ) , or severely obese ( 32.5 kg / m ) found that overweight was independently associated with favorable 3-month functional recovery ( or , 1.24 ; 95 % ci , 1.121.38 ) , but severe obesity was independently associated with higher 3-month mortality ( or , 2.01 ; 95 % ci , 1.103.69 ) . in stroke patients admitted to a rehabilitation hospital , the underweight group had the lowest functional independence measure ( fim ) efficiency , followed by the obese and normal - weight subgroups . the overweight group had the highest fim efficiency ( p = 0.05 ) when compared with the obese subgroup . these results indicate that outcome is better in overweight stroke patients than in underweight stroke patients . skeletal muscles are the main effector organs impacted by disability in stroke , but little attention is paid to structural , metabolic , and functional alterations of muscle tissue after stroke [ 27 , 28 ] . stroke - induced sarcopenia is difficult to differentiate from hemiparesis in terms of evaluating muscle strength and physical performance . therefore , diagnosis of stroke - induced sarcopenia is a challenging task . in a systematic review of loss of skeletal muscle mass after stroke , lean tissue mass was significantly less in the paretic than the nonparetic lower limb ( median , 342.3 g ; 95 % ci , 247.0437.6 g ) and upper limb ( median , 239.9 g ; 95 % ci , 181.7298.2 g ) , and midthigh muscle cross - sectional area ( median , 15.4 cm ; 95 % ci , 13.816.9 cm ) was significantly less in individuals at least 6 months poststroke . mechanisms of muscle wasting in stroke - related sarcopenia include disuse atrophy , spasticity , inflammation , denervation , reinnervation , impaired feeding , and intestinal absorption . a randomized study comparing intensive nutritional supplementation to routine nutritional supplementation was performed in 116 undernourished stroke inpatients . compared with those on standard nutritional supplements , patients receiving intensive nutritional supplementation improved more on measures of motor function ( total fim , fim motor subscore , 2 and 6-min timed walk tests , p < 0.002 ) . in a randomized , controlled trial comparing routine care with individualized , nutritional care aiming to prevent weight loss in acute stroke patients at nutritional risk , 20.7 % of the intervention group lost 5 % weight compared with 36.4 % of the control group ( p = 0.055 ) at follow - up . the intervention group had a significantly higher increase in qol score ( p = 0.009 ) and in handgrip strength ( p = 0.002 ) . in a cochrane database of systematic review , nutritional supplementation in acute and subacute stroke was associated with reduced frequency of pressure sores ( or : 0.56 ; 95 % ci : 0.320.96 ) , and increased energy intake ( mean differences ( md ) , 430.18 kcal / day ; 95 % ci , 141.61718.75 ) and protein intake ( md , 17.28 g / day ; 95 % ci , 1.9932.56 ) . these results indicate that nutrition support for stroke rehabilitation patients at malnutrition or nutritional risk seems to improve nutrition intake and rehabilitation outcome .", "hip fractures are associated with more disability , health care costs , and mortality than all other osteoporotic fractures combined . in 2005 , hip fractures in the usa were estimated to account for 14 % of total fractures but 72 % of total fracture - related health care costs . compared with its pre - fracture level , post - fracture function is deteriorated in 60 % of patients with hip fracture . the demographic trend worldwide is that more and more people are suffering from hip fracture . the number of hip fractures is expected to rise from 1.6 million in 2000 up to 6.3 million in 2050 . malnutrition prevalence was lowest when assessed by bmi ( 13 % ) , followed by mna - sf ( 27 % ) , international classification of disease , 10th revision , australian modification ( icd10-am ) ( 48 % ) , albumin ( 53 % ) , and geriatrician individualized assessment ( 55 % ) . malnutrition prevalence in hip fracture was 37.5 % using icd10-am criteria in another study . nutrition status assessed by mna in one hip fracture study revealed that 8.8 % of elderly patients were undernourished , 43.7 % at risk of malnutrition , and 47.5 % well - nourished . nutrition status in another hip fracture study revealed that 11.6 % were malnourished , 44.2 % at risk of malnutrition , and 44.2 % were well - nourished . serum albumin level ( p = 0.0004 ; or , 5.8541 ) and bmi ( p = 0.0192 ; or , 1.1693 ) significantly influenced mortality after hip fracture . malnutrition and being at risk for malnutrition are common in patients with hip fracture and seem to affect rehabilitation outcome . the prevalence of sarcopenia in patients with hip fracture is high . in the sarcopenia and hip fracture study , another study in women with hip fracture revealed that 58 % were sarcopenic . using normative data from the new mexico elder health study , 64.0 % of female hip fracture inpatients and 95.0 % of male hip fracture inpatients admitted to rehabilitation wards had sarcopenia . analysis of other data revealed that 21.8 % of female hip fracture patients and 86.7 % of male hip fracture patients had sarcopenia . in 357 japanese patients immediately after hip fracture , 44.7 % of women and 81.1 % of men had sarcopenia , and the presence of sarcopenia was independently associated with the occurrence of hip fracture . on the other hand , only 4 of the 71 hip fracture patients ( 5.6 % ) a cochrane database systematic review of nutritional supplementation in elderly patients with hip fracture found weak evidence for the effectiveness of protein and energy supplements . one trial of multinutrient intravenous feeding followed by oral supplements found a reduction in the number of participants with complications ( rr , 0.21 ; 95 % ci , 0.100.46 ) , but not in mortality rate ( rr , 0.11 ; 95 % ci , 0.012.00 ) . a controlled prospective cohort study in patients with hip fracture found a significant association of multidisciplinary postoperative nutritional care with a decline in the number of malnourished patients and a decline in the euroqol ( p = 0.004 ) after 3 months of the intervention . in a randomized , controlled study , nutritional support actively supervised by a dietician and guided by repeated measurements of resting energy requirements was achievable and improved outcomes in geriatric patients following surgery for hip fractures . multidisciplinary nutritional care reduced nutritional deterioration during admission ( 5.4 vs. 20.5 % ; p = 0.049 ) , and increased the rate of discharge directly back to the community ( 48.0 vs. 17.6 % ; p = 0.012 ) in a pragmatic intervention study . a high - protein nutritional intervention - based study on -hydroxy--methylbutyrate , vitamin d3 , and calcium in obese and lean aged patients with hip fractures and sarcopenia will be implemented . these results indicate that nutrition support for hip fracture patients may improve nutrition status and rehabilitation outcome .", "hospital - associated deconditioning is characterized by the functional decline that occurs during acute hospitalization due to illness or injury , or both , and is unrelated to a specific neurological or orthopedic insult , or both . several concepts have been proposed to explain the consequences of inactivity and disuse in the hospital , and include debility , disuse syndrome [ 10 , 21 ] , hospital - associated deconditioning [ 11 , 55 ] , hospitalization - associated disability , and post - hospital syndrome . during hospitalization , patients are commonly deprived of sleep , experience disruption of normal circadian rhythms , are nourished poorly , have pain and other discomfort , confront a baffling array of mentally challenging situations , receive medications that can alter cognition and physical function , and become deconditioned by bed rest or inactivity . hospitalization - associated disability occurs in approximately one - third of patients older than 70 years of age and may be triggered even when the illness that necessitated the hospitalization is successfully treated . malnutrition is associated with poor rehabilitation outcome in hospital - associated deconditioning . in an acute rehabilitation setting , obese patients with deconditioning show greater improvement in fim scores , compared with patients whose bmi is in the normal range or lower ( bmi 18.5 ) . this lower bmi group shows the smallest increase in fim motor scores with rehabilitation . in elderly patients with deconditioning , admission norton scale scores were correlated with discharge walking fim scores ( r = 0.32 ; p = 0.003 ) , discharge transfer fim scores ( r = 0.30 ; p = 0.005 ) , and length of rehabilitation ( r = 0.37 ; p < 0.0001 ) . in our previous prospective cohort study , 87.6 % of patients were malnourished , 12.4 % were at risk for malnutrition , and there were none with normal nutritional status . in multiple regression analysis , the mna - sf score , albumin level , and cachexia status were significantly associated with the barthel index score at discharge . these results indicated that patients with hospital - associated deconditioning may experience not only activity - related sarcopenia but also nutrition - related and disease - related sarcopenia . nutrition management and sarcopenia treatment in patients with hospital - associated deconditioning may lead to improvement of disability , although further studies are required .", "sarcopenic dysphagia is characterized by the loss of swallowing muscle mass and function associated with generalized loss of skeletal muscle mass and function . the prevalence of dysphagia has been reported to be 11.438 % in community - dwelling elderly individuals [ 6064 ] and 4068 % in nursing home residents [ 6567 ] . dysphagia management is important because dysphagia is common in the elderly and increases the risk of related complications such as aspiration pneumonia , choking , dehydration , malnutrition , and a lower quality of life following the loss of the joy of eating . furthermore , sarcopenic dysphagia is not only the result of aspiration pneumonia , but also an important cause of recurrent aspiration pneumonia . age - related loss of swallowing muscles has been studied [ 24 , 25 ] . swallowing muscles include the intrinsic muscle of the tongue and the mimic , masticatory , suprahyoid , infrahyoid , palatal , pharyngeal , and esophageal muscles . tamura et al . evaluated thickness of the central part of the tongue in the elderly using ultrasonography and showed mid - arm muscle area and age were associated independently with tongue thickness . these results indicate that tongue muscle mass is associated with generalized skeletal muscle mass and aging . a decrease in the cross - sectional area of the geniohyoid muscle has been shown to occur with increasing age , with this area being significantly smaller in aspirators compared with non - aspirators , but only in older men . these findings suggest that geniohyoid muscle atrophy may be a component of decreased swallowing safety and aspiration in older adults with presbyphagia or frailty of swallowing . mid - upper arm circumference and calf circumference were correlated with dysphagia [ 22 , 68 ] . the circumference of the mid - upper arm in older japanese adults with suspected swallowing disorders was correlated significantly with swallowing function . it is likely that the general reduction in lean body mass , including the swallowing muscle mass , is responsible for the association between mid - upper arm circumference and swallowing function , and indicates the presence of sarcopenic dysphagia . another study revealed that swallowing measures had significant correlations with the functional and nutritional measures including serum albumin levels , mid - upper arm circumference , and calf circumference but not with age . given that sarcopenia is exacerbated by disease , inactivity , and malnutrition , sarcopenia involving the swallowing muscle mass and its function may account for this result . malnutrition results in both increased adductor pollicis muscle fatigability and an altered pattern of muscle contraction and relaxation which are reversible by nutritional supplementation . however , deglutition muscles that have a moderate to high percentage of type ii fibers may be among the first to atrophy at malnutrition because malnutrition affects type ii muscle fibers to a much greater extent than it does type i fibers [ 69 , 70 ] . furthermore , malnutrition was associated with dysphagia and head lifting strength which reflects the strength of the suprahyoid muscles in frail older adults . therapy for sarcopenic dysphagia includes dysphagia rehabilitation , treatment of sarcopenia , and nutrition improvement . the core components of dysphagia rehabilitation are oral health care , rehabilitative techniques , and food modification . therefore , nutrition management to increase muscle mass is indispensable for sarcopenic dysphagia rehabilitation , and the concept of rehabilitation nutrition is useful . further research on sarcopenic dysphagia is required , although consensus diagnostic criteria for sarcopenic dysphagia have been proposed .", "we searched seven major rehabilitation journals cited in the article publishing in physical and rehabilitation medicine and indexed by pubmed . these rehabilitation journals were the archives of physical medicine and rehabilitation , clinical rehabilitation , journal of rehabilitation medicine , the european journal of physical and rehabilitation medicine , the american journal of physical medicine and rehabilitation , disability and rehabilitation , and international journal of rehabilitation research . of 24,214 pubmed entries for these seven journals , 185 ( 0.8 % ) and 8 ( 0.03 % ) , respectively , contained the words nutrition and sarcopenia on 25 april 2014 ( table 1 ) . four articles ( one editorial and three reviews ) published in the european journal of physical and rehabilitation medicine contained the word sarcopenia and were about sarcopenia and muscular modifications in disabling pathologies [ 7477 ] . though the importance of nutrition in rehabilitation was already recognized in the 1940s , interest in nutrition and sarcopenia in rehabilitation medicine has remained very low.table 1number of pubmed entries retrieved in a search of seven rehabilitation journals for the terms nutrition and sarcopenia . accessed on 25 april 2014 from www.pubmed.gov \n journal nametotal no . of entriesnutritionsarcopeniaarchives of physical medicine and rehabilitation11,856962clinical rehabilitation1,768101journal of rehabilitation medicine1,49960european journal of physical and rehabilitation medicine52355american journal of physical medicine and rehabilitation3,123300disability and rehabilitation3,638270international journal of rehabilitation research1,807110total24,214185 ( 0.8 % ) 8 ( 0.03 % ) number of pubmed entries retrieved in a search of seven rehabilitation journals for the terms nutrition and sarcopenia . accessed on 25 april 2014 from www.pubmed.gov \n in japan , interest in rehabilitation nutrition has increased in recent years . using the japan medical abstracts society database , we searched for articles in four major japanese rehabilitation journals including the japanese journal of rehabilitation medicine , sogo rihabiriteshon , journal of clinical rehabilitation , and medical rehabilitation . of the 38,898 entries of these four journals , 1092 ( 2.8 % ) and 55 ( 0.1 % ) , respectively , contained the words nutrition and sarcopenia on 25 april 2014 ( table 2 ) . when the search was limited to entries after 2010 , 4.4 and 0.7 % , respectively , contained the words nutrition and sarcopenia.table 2number of japan medical abstracts society database entries retrieved in a search of four japanese rehabilitation journals for the words nutrition and sarcopenia . accessed on 25 april 2014 from http://www.jamas.or.jp/about/english.html \n entire periodfrom 2010journal nametotalnutritionsarcopeniatotalnutritionsarcopeniathe japanese journal of rehabilitation medicine24,457545174,41913615sogo rihabiriteshon7,75913681,100315journal of clinical rehabilitation4,6021809839538medical rehabilitation2,080231217789720total38,8981,092 ( 2.8 % ) 55 ( 0.1 % ) 7,136317 ( 4.4 % ) 48 ( 0.7 % ) number of japan medical abstracts society database entries retrieved in a search of four japanese rehabilitation journals for the words nutrition and sarcopenia . accessed on 25 april 2014 from http://www.jamas.or.jp/about/english.html \n we established the japanese association of rehabilitation nutrition in 2011 ; its membership in april 2014 had increased to more than 3300 people and included physical therapists , registered dietitians , speech - language - hearing therapists , etc . moreover , 629 people attended the 3rd congress of the japanese association of rehabilitation nutrition held in 2013 . interest in rehabilitation nutrition is increasing in japan because of the emergence of a rapidly aging society , high number of convalescent rehabilitation beds , and high number of nutrition support teams in hospitals . the aging rate in japan is the highest in the world ( i.e. , 25.1 % in october 2013 ) . the number of convalescent rehabilitation beds available under the japanese medical insurance system has increased since 2000 to 68,316 in march 2014 . these data suggest that the number of disabled elderly with malnutrition and sarcopenia is increasing at an accelerated pace . the number of hospitals that have nutrition support teams certified by the japan council for nutritional therapy was 1001 in 2013 . many physical therapists , occupational therapists , and speech - language - hearing therapists are actively involved in nutrition support teams and interested in nutrition care management . collaborative studies of rehabilitation nutrition have been undertaken by the japanese association of rehabilitation nutrition . furthermore , the japanese society for sarcopenia , cachexia and wasting disorders was established in 2014 . further , more focused , research on rehabilitation nutrition will be needed because the number of elderly with disability is expected to increase in developed countries as the population ages [ 79 , 80 ] .", "the prevalence of malnutrition and sarcopenia in physically disabled elderly patients who undergo rehabilitation is high . in contrast , the amount of research focused on nutrition and sarcopenia in rehabilitation medicine is very low . the major causes of disability in inpatients of rehabilitation facilities , including stroke , hip fracture , and hospital - associated deconditioning , are often complicated by malnutrition and sarcopenia . sarcopenic dysphagia is common in the elderly population and is not only the result of aspiration pneumonia , but also an important cause of recurrent aspiration pneumonia . because primary and secondary sarcopenia often coexist in people with disability , rehabilitation nutrition can be used to improve their functionality ( fig . 1 ) . further studies on rehabilitation nutrition are important in a rapidly aging society , where the number of elderly with disability is expected to increase.fig . frail elderly with stroke or hip fracture becomes sarcopenia with disability because of hemiparesis , dysphagia , immobilization , catabolism due to acute inflammation , and undernutrition . rehabilitation for hemiparesis , dysphagia , immobilization , and nutrition care management for catabolism due to acute inflammation and undernutrition are usually provided separately . sarcopenia with disability induces sarcopenic dysphagia which is characterized by the loss of swallowing muscle mass and function associated with generalized loss of skeletal muscle mass and function . rehabilitation nutrition can be used to improve functionality in people with sarcopenic dysphagia and sarcopenia with disability mechanism of sarcopenia with disability in frail elderly with stroke and hip fracture . frail elderly with stroke or hip fracture becomes sarcopenia with disability because of hemiparesis , dysphagia , immobilization , catabolism due to acute inflammation , and undernutrition . rehabilitation for hemiparesis , dysphagia , immobilization , and nutrition care management for catabolism due to acute inflammation and undernutrition are usually provided separately . sarcopenia with disability induces sarcopenic dysphagia which is characterized by the loss of swallowing muscle mass and function associated with generalized loss of skeletal muscle mass and function . rehabilitation nutrition can be used to improve functionality in people with sarcopenic dysphagia and sarcopenia with disability" ]

[ "presentations vary , complications differ and yet , management remains the same , which is removal . nothing galvanizes the team as when the code for a foreign body ( fb ) is communicated , especially if the case is a kid where such situation is usually encountered . presentation is acute in vegetable foreign body aspiration , especially in kids of age group 1 - 3 years , with new onset wheeze , breathlessness or fever . it tends to be less dramatic in non - organic foreign bodies unless there is lung collapse or involvement of trachea . occasionally non - organic fb can be retained for years with bizarre presentation , which can be mistaken for endobronchial tumors or bronchiectasis . such fb is a cause for a significant heartburn to both the patient and treating physician as unless it is removed it causes chronic symptoms and leads to irreversible damage . the case of interest is one such with the diagnosis missed for over 14 years .", "a 16-year - old male was diagnosed with bronchial asthma since childhood , had recurrent hospital admissions with exacerbations . patient reported a recent worsening of symptoms for the last year for which he was evaluated and chest radiology revealed left lower lobe collapse . he was taken up for a bronchoscopy , which revealed a web - like stenosis of distal left main stem bronchus with a residual lumen of about 4 mm [ figure 1 ] and in view of small residual lumen an ultrathin pediatric bronchoscope ( olympus bf type 3c160 ) was used . bronchoscope could be negotiated past the stenotic segment and to our surprise found a freely mobile object moving between upper and lower lobes with each breath [ figure 2 ] . patient was questioned after the procedure regarding history of aspiration and he denied recollecting any incident . whistle was blown when the patient 's father said that the patient had aspirated a whistle or part of one when he was about 2 years of age . he had a violent bout of cough for which he was evaluated and suspected whistle was removed . now with the diagnosis clear , patient was taken up for rigid bronchoscopy , intubated with size 6 ventilating tracheobronchosope and bevel was positioned at distal left main bronchus . flexible bronchoscope was introduced through this conduit and mercedes benz like peripheral cuts given using eletrocautery knife to the web like stenosis [ figure 3 ] . serial balloons introduced across the stenotic segment and gradually dilated up to 10 mm , bronchoscope negotiated beyond to visualize the foreign body . the fb was extracted using cryoprobe introduced through the channel of flexible bronchoscope [ figures 4 and 5 ] . the fb turned out to be a piece of plastic probably part of the whistle aspirated 14 years back [ figure 6 ] . stenosis at distal left main stem bronchus foreign body beyond stenosis electrocautery knife to make radial incisions cryo - extraction of foreign body from bronchus foreign body being taken into rigid barrel plastic foreign body after removal", "retained non - organic foreign bodies are great masqueraders presenting with non - specific symptoms and high propensity of being missed unless index of suspicion is high . the longest duration of retained fb in english literature is 39 years , a case of wooden chip reported from japan . history of fb is the first clue to making a diagnosis but is unfortunately forthcoming only in few of the cases that too in retrospect . evaluation should be undertaken even if fb was removed previously and patient has symptoms as part of it could have been retained as it was in our case . symptoms range from none to chronic cough , wheezing , hemoptysis and recurrent episodes of chest infections . in our country profile of symptoms are generally non specific but documented episodes restricted to one side or lobe warrant evaluation for endobronchial lesions . chest x - ray is the next step in assessing these patients ; it has a high sensitivity for detecting metallic foreign bodies and can also reveal subtle signs like lobar collapse or hyperinflation . chest x - ray has been shown to reveal the fb as opacity in only 14 - 20% among both adults and pediatric population . this has been the case in all reports of retained fb of over 10 years in english literature including ours . flexible bronchoscopy should be undertaken if radiology reveals or suspects fb ; also in cases of unexplained longstanding non - specific symptoms with negative radiology and no alternate diagnosis . luminal appearance of fb after years of residence is rarely clear , especially if one is unsure of what they are looking for . granulation tissue can be exuberant and mimic tumor in appearance , attempts to biopsy it can result in significant bleeding which can further compromise vision . stenosis of bronchus like the one seen in our patient is a relatively uncommon complication seen in about 8% of cases as against 62.9 - 76.5% incidence of granulations in two large series . even among patients with stenosis only minority require management of the same and in our case was required due to presence of tight stricture in the main stem bronchus . there is consensus regarding rigid bronchoscopy for management of fb in pediatric patients as these patients are sicker , hypoxemic , can not cooperate , have poor reserve and flexible bronchoscope lacks robust instruments for retrieval due to small working channel . further , flexible bronchoscopy is useful in only confirming the presence of fb in stable pediatric patients , thus avoiding a negative rigid bronchoscopy . flexible versus rigid bronchoscopy for management in adults is a long - standing argument with various operators having different points of view . rigid bronchoscopy is the preferred modality for either long - standing fb or in case of failed attempt with flexible bronchoscope . long - standing fb is also notorious for failure of rigid bronchoscopy due to excessive granulation , which then requires bronchotomy and/or lobectomy for retrieval . in our case rigid bronchoscopy was done in view of long - standing fb and presence of web - like stenosis that required dilatation .", "long - standing fb is a challenge both to diagnose and manage , needs a high index of suspicion and low threshold for detailed evaluation . management requires personnel with adequate experience and availability of appropriate instruments both flexible as well as rigid . there should be seamless switch over to rigid if flexible is not successful in recovery of fb .", "", "" ]