Datasets:

tomekkorbak

/

detoxify-pile-chunk3-50000-100000

like 0

[ "Q:\n\nCrashed when pressed date/ime picker, combined with background processing\n\nI try to combine 2 programs with copy and paste, that are date/time picker with asynch task background processing.", "\nWith this code:\n@Override\npublic void onClick(View v) {\nnew PostComment().execute();\n\nthat executes asynch task with background processing.", "\nIf I put the above execute code on: \npublic class AddComment extends Activity implements OnClickListener{ \n\nand when I pressed date/time picker button, the program crashed.", "\nIf I put the above execute code on just above of: \nclass PostComment extends AsyncTask<String, String, String> {\n\nI can do entry of date/time picker correctly, but when I pressed \"submit\" button to save the all entries, there is no response at all.", "\nI thought the problem is related to the position and additional coding of the 'execute' line coding above. ", " \nCould any one help with this?", "\nMy android code is below :\npublic class AddComment extends Activity implements OnClickListener{\n\nEditText fdate; \nEditText tdate;\nEditText ftime;\nEditText ttime;\n\nprivate EditText custbranch;\nprivate EditText custname;\nprivate EditText custaddr;\nprivate EditText custcity;\nprivate EditText note;\n\nButton btnDate1;\nButton btnDate2;\nButton btnTime1;\nButton btnTime2;\n\nprivate Button mSubmit;\n\n// Progress Dialog\n\nprivate ProgressDialog pDialog;\n\n// JSON parser class\n\nJSONParser jsonParser = new JSONParser();\n\n//testing on Emulator:\n\nprivate static final String POST_COMMENT_URL = \"http://192.168.0.245 \n// Variable for storing current date and time\n\nprivate int mYear, mMonth, mDay, mHour, mMinute;\n\n//ids\n\nprivate static final String TAG_SUCCESS = \"success\";\nprivate static final String TAG_MESSAGE = \"message\";\n\n@Override\nprotected void onCreate(Bundle savedInstanceState) {\n// TODO Auto-generated method stub\nsuper.onCreate(savedInstanceState);\nsetContentView(R.layout.add_comment);\n\nbtnDate1 = (Button) findViewById(R.id.btnDate1);\nbtnDate2 = (Button) findViewById(R.id.btnDate2);\n\nbtnTime1 = (Button) findViewById(R.id.btnTime1);\nbtnTime2 = (Button) findViewById(R.id.btnTime2);\n\nfdate = (EditText) findViewById(R.id.fdate);\ntdate = (EditText) findViewById(R.id.tdate);\nftime = (EditText) findViewById(R.id.ftime);\nttime = (EditText) findViewById(R.id.ttime);\n\nbtnDate1.setOnClickListener(this);\nbtnDate2.setOnClickListener(this);\nbtnTime1.setOnClickListener(this);\nbtnTime2.setOnClickListener(this);\n\nmSubmit = (Button) findViewById(R.id.submit);\nmSubmit.setOnClickListener(this);\n}\n\n@Override\npublic void onClick(View v) {\n\n if (v == btnDate1) {\n\n // Process to get Current Date\n final Calendar c = Calendar.getInstance();\n mYear = c.get(Calendar.", "YEAR);\n mMonth = c.get(Calendar.", "MONTH);\n mDay = c.get(Calendar.", "DAY_OF_MONTH);\n\n // Launch Date Picker Dialog\n DatePickerDialog dpd1 = new DatePickerDialog(this,\n new DatePickerDialog.", "OnDateSetListener() {\n\n @Override\n public void onDateSet(DatePicker view, int year,\n int monthOfYear, int dayOfMonth) {\n // Display Selected date in textbox\n fdate.setText(dayOfMonth + \"-\"\n + (monthOfYear + 1) + \"-\" + year);\n\n }\n }, mYear, mMonth, mDay);\n dpd1.show();\n}\nif (v == btnDate2) {\n\n // Process to get Current Date\n final Calendar c = Calendar.getInstance();\n mYear = c.get(Calendar.", "YEAR);\n mMonth = c.get(Calendar.", "MONTH);\n mDay = c.get(Calendar.", "DAY_OF_MONTH);\n\n // Launch Date Picker Dialog\n DatePickerDialog dpd2 = new DatePickerDialog(this,\n new DatePickerDialog.", "OnDateSetListener() {\n\n @Override\n public void onDateSet(DatePicker view, int year,\n int monthOfYear, int dayOfMonth) {\n // Display Selected date in textbox\n tdate.setText(dayOfMonth + \"-\"\n + (monthOfYear + 1) + \"-\" + year);\n\n }\n }, mYear, mMonth, mDay);\n dpd2.show();\n }\n\n if (v == btnTime1) {\n\n // Process to get Current Time\n final Calendar c = Calendar.getInstance();\n mHour = c.get(Calendar.", "HOUR_OF_DAY);\n mMinute = c.get(Calendar.", "MINUTE);\n\n // Launch Time Picker Dialog\n TimePickerDialog tpd1 = new TimePickerDialog(this,\n new TimePickerDialog.", "OnTimeSetListener() {\n\n @Override\n public void onTimeSet(TimePicker view, int hourOfDay,\n int minute) {\n // Display Selected time in textbox\n ftime.setText(hourOfDay + \":\" + minute);\n }\n }, mHour, mMinute, false);\n tpd1.show();\n }\n if (v == btnTime2) {\n\n // Process to get Current Date\n final Calendar c = Calendar.getInstance();\n mYear = c.get(Calendar.", "YEAR);\n mMonth = c.get(Calendar.", "MONTH);\n mDay = c.get(Calendar.", "DAY_OF_MONTH);\n\n // Launch Time Picker Dialog\n TimePickerDialog tpd2 = new TimePickerDialog(this,\n new TimePickerDialog.", "OnTimeSetListener() {\n\n @Override\n public void onTimeSet(TimePicker view, int hourOfDay,\n int minute) {\n // Display Selected time in textbox\n ttime.setText(hourOfDay + \":\" + minute);\n }\n }, mHour, mMinute, false);\n tpd2.show();\n }\n\ncustbranch = (EditText)findViewById(R.id.custbranch);\ncustname = (EditText)findViewById(R.id.custname);\ncustaddr = (EditText)findViewById(R.id.custaddr);\ncustcity = (EditText)findViewById(R.id.custcity);\nnote = (EditText)findViewById(R.id.note);\n\nmSubmit = (Button)findViewById(R.id.submit);\nmSubmit.setOnClickListener(this);\n\n}\n\npublic void onClickbtnSubmit(View v) {\n\nnew PostComment().execute();\n\n}\n\nclass PostComment extends AsyncTask<String, String, String> {\n\n@Override\nprotected void onPreExecute() {\n super.onPreExecute();\n pDialog = new ProgressDialog(AddComment.this);\n pDialog.setMessage(\"Posting Comment...\");\n pDialog.setIndeterminate(false);\n pDialog.setCancelable(true);\n pDialog.show();\n}\n\n@Override\nprotected String doInBackground(String... args) {\n // TODO Auto-generated method stub\n // Check for success tag\n int success;\n String post_fdate = fdate.getText().toString();\n String post_tdate = tdate.getText().toString();\n String post_ftime = ftime.getText().toString();\n String post_ttime = ttime.getText().toString();\n String post_custbranch = custbranch.getText().toString();\n String post_custname = custname.getText().toString();\n String post_custaddr = custaddr.getText().toString();\n String post_custcity = custcity.getText().toString();\n String post_note = note.getText().toString();\n\n //We need to change this:\n SharedPreferences sp = \n preferenceManager.getDefaultSharedPreferences\n (AddComment.this);\n String post_username = sp.getString(\"username\", \"anon\");\n\n try {\n // Building Parameters\n List<NameValuePair> params = new ArrayList<NameValuePair>();\n params.add(new BasicNameValuePair(\"username\", post_username));\n params.add(new BasicNameValuePair(\"fdate\", post_fdate));\n params.add(new BasicNameValuePair(\"tdate\", post_tdate));\n params.add(new BasicNameValuePair(\"ftime\", post_ftime));\n params.add(new BasicNameValuePair(\"ttime\", post_ttime));\n params.add(new BasicNameValuePair(\"custbranch\",post_custbranch));\n params.add(new BasicNameValuePair(\"custname\", post_custname));\n params.add(new BasicNameValuePair(\"custaddr\", post_custaddr));\n params.add(new BasicNameValuePair(\"custcity\", post_custcity));\n params.add(new BasicNameValuePair(\"note\", post_note));\n\n Log.d(\"request!\", \"", "starting\");\n\n //Posting user data to script \n JSONObject json = jsonParser.makeHttpRequest(\n POST_COMMENT_URL, \"POST\", params);\n\n // full json response\n Log.d(\"Post Comment attempt\", json.toString());\n\n // json success element\n success = json.getInt(TAG_SUCCESS);\n if (success == 1) {\n Log.d(\"Comment Added!\", ", "json.toString()); \n finish();\n return json.getString(TAG_MESSAGE);\n }else{\n Log.d(\"Comment Failure!\", ", "json.getString(TAG_MESSAGE));\n return json.getString(TAG_MESSAGE);\n\n }\n } catch (JSONException e) {\n e.printStackTrace();\n }\n\n return null;\n\n}\n\nprotected void onPostExecute(String file_url) {\n // dismiss the dialog once product deleted\n pDialog.dismiss();\n if (file_url !", "= null){\n Toast.makeText(AddComment.this,file_url,\n Toast.", "LENGTH_LONG).show(); \n }\n\n}\n\n}\n}\n\nThis is the logcat when crashed, when pressed date/time picker button.", "\n\n08-04 15:22:19.480: E/AndroidRuntime(30627): FATAL EXCEPTION:\n AsyncTask #2 08-04 15:22:19.480: E/AndroidRuntime(30627):\n java.lang.", "RuntimeException: An error occured while executing\n doInBackground() 08-04 15:22:19.480: E/AndroidRuntime(30627): at\n android.os.", "AsyncTask$3.done(AsyncTask.java:299) 08-04 15:22:19.480:\n E/AndroidRuntime(30627): at\n java.util.concurrent.", "FutureTask.finishCompletion(FutureTask.java:352)\n 08-04 15:22:19.480: E/AndroidRuntime(30627): at\n java.util.concurrent.", "FutureTask.setException(FutureTask.java:219)\n 08-04 15:22:19.480: E/AndroidRuntime(30627): at\n java.util.concurrent.", "FutureTask.run(FutureTask.java:239) 08-04\n 15:22:19.480: E/AndroidRuntime(30627): at\n android.os.", "AsyncTask$SerialExecutor$1.run(AsyncTask.java:230) 08-04\n 15:22:19.480: E/AndroidRuntime(30627): at\n java.util.concurrent.", "ThreadPoolExecutor.runWorker(ThreadPoolExecutor.java:1080)\n 08-04 15:22:19.480: E/AndroidRuntime(30627): at\n java.util.concurrent.", "ThreadPoolExecutor$Worker.run(ThreadPoolExecutor.java:573)\n 08-04 15:22:19.480: E/AndroidRuntime(30627): at\n java.lang.", "Thread.run(Thread.java:838) 08-04 15:22:19.480:\n E/AndroidRuntime(30627): Caused by: java.lang.", "NullPointerException\n 08-04 15:22:19.480: E/AndroidRuntime(30627): at\n com.lm.vciwhereabout.", "AddComment$PostComment.doInBackground(AddComment.java:244)\n 08-04 15:22:19.480: E/AndroidRuntime(30627): at\n com.lm.vciwhereabout.", "AddComment$PostComment.doInBackground(AddComment.java:1)\n 08-04 15:22:19.480: E/AndroidRuntime(30627): at\n android.os.", "AsyncTask$2.call(AsyncTask.java:287) 08-04 15:22:19.480:\n E/AndroidRuntime(30627): at\n java.util.concurrent.", "FutureTask.run(FutureTask.java:234) 08-04\n 15:22:19.480: E/AndroidRuntime(30627): ... 4 more 08-04 15:22:21.400:\n E/WindowManager(30627): Activity com.lm.vciwhereabout.", "AddComment has\n leaked window\n com.android.internal.policy.impl.", "PhoneWindow$DecorView{42b26020\n V.E..... R......D 0,0-684,192} that was originally added here 08-04\n 15:22:21.400: E/WindowManager(30627): android.view.", "WindowLeaked:\n Activity com.lm.vciwhereabout.", "AddComment has leaked window\n com.android.internal.policy.impl.", "PhoneWindow$DecorView{42b26020\n V.E..... R......D 0,0-684,192} that was originally added here 08-04\n 15:22:21.400: E/WindowManager(30627): at\n android.view.", "ViewRootImpl.(ViewRootImpl.java:494) 08-04\n 15:22:21.400: E/WindowManager(30627): at\n android.view.", "WindowManagerGlobal.addView(WindowManagerGlobal.java:218)\n 08-04 15:22:21.400: E/WindowManager(30627): at\n android.view.", "WindowManagerImpl.addView(WindowManagerImpl.java:74)\n 08-04 15:22:21.400: E/WindowManager(30627): at\n android.app.", "Dialog.show(Dialog.java:322) 08-04 15:22:21.400:\n E/WindowManager(30627): at\n com.lm.vciwhereabout.", "AddComment$PostComment.onPreExecute(AddComment.java:232)\n 08-04 15:22:21.400: E/WindowManager(30627): at\n android.os.", "AsyncTask.executeOnExecutor(AsyncTask.java:586) 08-04\n 15:22:21.400: E/WindowManager(30627): at\n android.os.", "AsyncTask.execute(AsyncTask.java:534) 08-04 15:22:21.400:\n E/WindowManager(30627): at\n com.lm.vciwhereabout.", "AddComment.onClick(AddComment.java:112) 08-04\n 15:22:21.400: E/WindowManager(30627): at\n android.view.", "View.performClick(View.java:4336) 08-04 15:22:21.400:\n E/WindowManager(30627): at\n android.view.", "View$PerformClick.run(View.java:17853) 08-04\n 15:22:21.400: E/WindowManager(30627): at\n android.os.", "Handler.handleCallback(Handler.java:800) 08-04\n 15:22:21.400: E/WindowManager(30627): at\n android.os.", "Handler.dispatchMessage(Handler.java:100) 08-04\n 15:22:21.400: E/WindowManager(30627): at\n android.os.", "Looper.loop(Looper.java:194) 08-04 15:22:21.400:\n E/WindowManager(30627): at\n android.app.", "ActivityThread.main(ActivityThread.java:5469) 08-04\n 15:22:21.400: E/WindowManager(30627): at\n java.lang.reflect.", "Method.invokeNative(Native Method) 08-04\n 15:22:21.400: E/WindowManager(30627): at\n java.lang.reflect.", "Method.invoke(Method.java:525) 08-04 15:22:21.400:\n E/WindowManager(30627): at\n com.android.internal.os.", "ZygoteInit$MethodAndArgsCaller.run(ZygoteInit.java:857)\n 08-04 15:22:21.400: E/WindowManager(30627): at\n com.android.internal.os.", "ZygoteInit.main(ZygoteInit.java:624) 08-04\n 15:22:21.400: E/WindowManager(30627): at\n dalvik.system.", "NativeStart.main(Native Method)\n\nA:\n\nThe problem related to the sqllite db data definition .", "\nProblem solved, after changed the format of the date on data base from dd-mm-yy to yy-mm-dd. ", "It's cause NPE before. ", "\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.0007250343332998455, 0.0008164272294379771, 0.0009168939432129264, 0.0006248617428354919, 0.0006176228635013103, 0.0006991785485297441, 0.0012473452370613813, 0.0034930543042719364, 0.0011183976894244552, 0.0016377822030335665, 0.0009085706551559269, 0.0034930543042719364, 0.0011183976894244552, 0.0016224393621087074, 0.000942674872931093, 0.0010228840401396155, 0.001379897934384644, 0.0009096382418647408, 0.0034930543042719364, 0.0011183976894244552, 0.0013607153668999672, 0.0032647140324115753, 0.0007999368826858699, 0.0066771553829312325, 0.02856604941189289, 0.00416079955175519, 0.0010042646899819374, 0.0007659835973754525, 0.0006592510617338121, 0.000710874970536679, 0.0007058655028231442, 0.0007127722492441535, 0.0006917326827533543, 0.000829009513836354, 0.00078529620077461, 0.0008422505343332887, 0.0007180387037806213, 0.0009116854635067284, 0.0008802836528047919, 0.000745840254239738, 0.0007026188541203737, 0.0008529586484655738, 0.0009370596962980926, 0.0007293385569937527, 0.0017365043750032783, 0.0009370596962980926, 0.0007194359786808491, 0.0007249197224155068, 0.0007639468531124294, 0.0006887518102303147, 0.0007081992807798088, 0.0008678573067300022, 0.0007642974378541112, 0.000815674546174705, 0.0007492375443689525, 0.0006963000050745904, 0.0007517897756770253, 0.0007637012167833745, 0.0007008984102867544, 0.0007614799542352557, 0.0007342149037867785, 0.0006635961472056806, 0.0007387286750599742, 0.001006765873171389, 0.0007112798630259931, 0.0030839822720736265, 0.0007347229984588921, 0.0011689389357343316, 0.001995444530621171 ]

[ "waldorfmama shop\n\nwaldorfmama patterns\n\nwaldorf education\n\nwaldorfmama bookshelf\n\n22 March 2010\n\nwelcoming spring...\n\ndespite the fact that it snowed on the first day of spring here in texas (an unprecedented second time this winter no less), we've been enjoying many days outside exploring nature and the passing of winter. ", "looking closely at the changing season around us and gathering a bit more of mother nature's treasures...\n\nComments\n\nwelcoming spring...\n\ndespite the fact that it snowed on the first day of spring here in texas (an unprecedented second time this winter no less), we've been enjoying many days outside exploring nature and the passing of winter. ", "looking closely at the changing season around us and gathering a bit more of mother nature's treasures..." ]

{ "pile_set_name": "Pile-CC" }

[ 0.0007191216573119164, 0.0005686951335519552, 0.0006201834767125547 ]

[ "Q:\n\nWho names the powers of Mangekyō Sharingan?", "\n\nConsidering that Obito, Kakashi and Madara all knew the name of Kamui without someone telling them, can we conclude that those who have the Mangekyō Sharingan know the name of its exclusive power? (", "Obito's Kamui, Shisui's Kotoamatsukami, Itachi's Amaterasu and Tsukuyomi, Sasuke's Amaterasu and Blaze Release: Kagutsuchi, and everyone's Susanoo)\n\nA:\n\nYes, only the ones with the Mangekyō Sharingan know the names of their techniques. ", "\nTaking an example, Obito and Kakashi had Obito's Mangekyō Sharingan. ", "And they had the same Mangekyō technique (Kamui). ", "Considering that Kakashi and Obito never saw each other or trained together after they awakened the Mangekyō, it is not a coincidence that both call their technique \"Kamui\". ", "\nIn raw terms (sorry for the bad example), consider the Mangekyō Sharingan as a system, and it has two processes: A.exe and B.exe (the Mangekyō techniques). ", "The two processes are already named, installed and stored in the system. ", "And for the user to access it, all it needs is the fulfilment of the system requirements (loss of a loved one). ", "So, when the uses has access to the processes, they naturally will know what to call it, since its already named and stored. ", "\nI hope this answers how the users know the names of their MS techniques. ", "Nothing can be said about how the MS techniques are named because the current level of evidence is inconclusive.", "\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.001047978992573917, 0.0007259597769007087, 0.0009551956900395453, 0.0010693386429920793, 0.0009325218270532787, 0.000766754790674895, 0.0008394726901315153, 0.0005775457248091698, 0.0008610778604634106, 0.0005779914790764451, 0.0005652614054270089, 0.000644915271550417, 0.001995444530621171 ]

[ "Using action research in nursing practice with older people: democratizing knowledge.", "\nThis paper reports on an action research study which raised some questions about the processes of developing a sense of shared ownership in action research in a research environment which does not always have the appropriate mechanisms to support and sustain action research. ", "Action research has gained popularity in nursing and healthcare research, offering a way of developing practice-based knowledge, which can assist in changing practice and democratizing inquiry. ", "There are other organizational constraints on action research which arise at different levels, and which also require discussion. ", "These can be issues about communication and ownership at a practice level and issues of funding and project management procedures. ", "This paper reports on a study in which these issues came to the fore, and offers some thoughts on how they can affect the processes of action research. ", "While the principles of action research appear to offer much towards the development of a practice-rooted body of knowledge for nursing, unless some of the issues of ownership are resolved, it is unlikely to move beyond academic rhetoric. ", "If nursing is to engage in action research, this must be done critically and reflectively and careful attention paid to developing an inclusive and collaborative approach to knowledge and practice development. ", "Furthermore, to develop in nursing and health care research, it must find ways to meet the requirements of funding bodies." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.000606026325840503, 0.000543666013982147, 0.0005736871971748769, 0.0005489638424478471, 0.0005632409011013806, 0.0005209920345805585, 0.0005427030264399946, 0.0005305327940732241, 0.0005589834763668478 ]

[ "The long-range goals of this project are to study the involvement of brain catecholamine systems in mental health. ", "Dopaminergic systems have been implicated in schizophrenia, and noradrenergic systems have been implicated in depression. ", "One common feature of both catecholaminergic systems is the initial, rate-limiting enzyme in their biosynthesis-tyrosine hydroxylase. ", "The activity of tyrosine hydroxylase (TH) is regulated by a number processes which include, in the short-term, protein phosphorylation/dephosphorylation and, in the long-term, induction of enzyme synthesis. ", "In humans, the possibility of an additional level of regulation also exists. ", "Human TH mRNA (mRNAHTH) undergoes alternative splicing, and two different species of mRNAHTH have been identified in post-mortem human brain samples. ", "From work on TH in the applicant's laboratory, the products of the two forms of mRNAHTH present in brain are predicted to possess different substrate specificities for protein kinases. ", "Thus, in humans, changes in alternative splicing may also contribute to the regulation of TH activity. ", "To date, studies published on multiple forms of human TH have analyzed only the nucleic acids and recombinant products therefrom. ", "The present application proposes to determine the presence and regional distribution of the different forms of TH protein per se in post-mortem human brain samples. ", "Antibodies will be raised to synthetic peptides representing the unique amino acid sequences created by the alternative splicing. ", "Selective recognition of the different forms of TH will be tested against immunogens and against human TH holoenzymes produced from recombinant vectors. ", "As necessary, preadsorption with the heteroimmunogens will be used to produce monospecific antibodies. ", "Quantitative Western blot analyses will be developed to analyze the levels and distribution of the different HTH forms in post-mortem human brain. ", "Immunocytochemistry will be used to analyze the regional, cellular and subcellular distribution of HTH forms in brain. ", "Alternative splicing is predicted to change the phosphorylation of serine 31 from that of being nerve growth factor and phorbol ester sensitive to that of being a substrate for calcium/calmodulin-dependent protein kinase II. ", "Site-specific phosphorylation of recombinant HTH in AtT-20 cells, of HTH in LA-N human neuroblastoma cells, of HTH in intact post-mortem human tissues (synaptosomes from corpus striatum and nucleus accumbens, chromaffin cells from adrenal medullae), and of HTH in cells isolated from human pheochromocytoma (as available) will be investigated." ]

{ "pile_set_name": "NIH ExPorter" }

[ 0.001169224618934095, 0.0010295254178345203, 0.0008312417776323855, 0.000660500954836607, 0.0005741920322179794, 0.000780375674366951, 0.0006272263126447797, 0.0006053696852177382, 0.0006768448511138558, 0.0006148421671241522, 0.0005557378754019737, 0.0008164860191754997, 0.0006690861191600561, 0.0006813804502598941, 0.0008265289361588657, 0.0007922062068246305, 0.0008884501876309514 ]

[ "The Times | Oct 15, 2008\n\nGraham Keeley in Barcelona\n\nWinston Churchill authorised millions of dollars in bribes to stop General Franco from entering the Second World War on the side of Germany, a new book claims.", "\n\nThe British wartime leader persuaded Juan March, a Spanish banker, to act as a secret agent, organising payments of millions of dollars to the generals. ", "In return the generals persuaded Franco not to side with Hitler.", "\n\nThe plot was revealed by the historian Pere Ferrer in Juan March: The Most Mysterious Man in the World, after researching papers in British and US archives.", "\n\nIn the summer of 1940 Churchill was convinced that Spain would enter the war on the side of Hitler after receiving reports that Franco and the Germans were planning to invade Gibraltar. ", "Ferrer has claimed that a British officer, Alan Hillgarth, came up with a plan to bribe the generals, believing that Franco’s high command was corrupt and, because they were not paid much, would be open to bribery.", "\n\nA letter from Lieutenant-Colonel Robert Solborg, a US agent in Portugal, to J. Donovan, the head of strategic services, read: “The Spaniard selected to be the main internal instrument to acquire the political favours of these generals was the rich financier Juan March.”", "\n\nMarch, who earned a fortune during the First World War dealing in contraband tobacco, seemed an unlikely ally because during the Spanish Civil War he sided with Franco.", "\n\nFerrer said that questions remained as to whether March was a double agent. ", "He claimed that documents suggested March may have stayed in the pay of the Germans while working for the British. ", "When he was approached by the British in 1940, however, March accepted the role. ", "He approached 30 generals who had fought in the Spanish Civil War. ", "Though their sympathies had been with the Nazis they switched sides.", "\n\nThe $10 million bribe money was deposited in a bank account in New York in 1940 but the plot nearly fell apart a year later when the US Treasury thought that March was using the money to support Hitler.", "\n\nThe British Ambassador in Washington convinced President Roosevelt that British military interests depended on the account being unfrozen. ", "The Americans relented and in 1942 alone the generals received between $3 million and $5 million.", "\n\nThe book said that some generals were not simply bought off by bribes – many loathed Franco. ", "In a reference to Franco, General Alfredo Kindelan wrote in his memoirs: “You could sense vertigo in him above all else because, like climbers who go higher than they are able, he felt dizzy from having reached such heights with limited abilities.”", "\n\nAfter the Second World War March returned to the sedate life of finance, dying in 1962 aged 82.", "\n\nFranco and Hitler\n\n— General Franco’s rise to power, leading the Nationalist armies to victory against the Loyalists in the Spanish Civil War, was supported by Hitler’s Germany and Mussolini’s Italy during the 1930s\n\n— Franco’s only meeting with Hitler took place in October 1940. ", "Hitler refused to offer Franco French colonial possessions in return for Spain’s support in the war. ", "After their meeting, Hitler remarked that he would “as soon have three or four teeth pulled out” as barter with Franco again\n\n— Franco did allow Hitler to use Spanish naval bases during the Second World War. ", "German U-boats were resupplied at its ports and Italian bombers refuelled at its airfields, while Spain helped to build observation posts around Gibraltar for German spies\n\n— Spain declared complete neutrality in 1943, allowing Franco, right, to retain power until 1975, when he died in his bed" ]

{ "pile_set_name": "OpenWebText2" }

[ 0.0008408656576648355, 0.0006529039819724858, 0.004880477674305439, 0.0005816310876980424, 0.011807510629296303, 0.0012701594969257712, 0.0006169601692818105, 0.0008785043028183281, 0.0009470869554206729, 0.0009433923405595124, 0.0005789922433905303, 0.0006913540419191122, 0.05371161177754402, 0.0010437533492222428, 0.0007421166519634426, 0.0006812541396357119, 0.01416266243904829, 0.0006361084524542093, 0.015227227471768856, 0.0015117019647732377, 0.020357858389616013, 0.01604587398469448, 0.006138147320598364 ]

[ "Because there's no other reason than that for Zack Ryder not appearing on RAW.", "\n\nWe all know the following Ryder has amassed amongst the Internet. ", "We all want him to have a bigger role. ", "That want has spread, at least in his home area of Long Island. ", "While he hasn't latched on in other areas, he was popular on the Island. ", "He got several chants. ", "And what did he get? ", "A broken promise to appear on RAW. ", "Another rib. ", "Great job. ", "The last rib that McMahon pulled off pissed off only one wrestler and paying customers. ", "It was a stupid gambit, and now, he went and pissed off his employees too. ", "Dolph Ziggler came with the boldest of the backlash:\n\nYou didnt rib 'the kid' tonight, you ribbed the fans, Long Island & the boys in the back! ", "AND kicked him in the nuts! #", "RyderOrRiot\n\nSeriously, more than just Ryder are presumably pissed at this.", "\n\nAgain, it goes without saying that Alvarez could be getting worked here. ", "The circumstantial evidence is there, but again, it's circumstantial, and it would be inadmissible in court if this were a trial by law. ", "Still, it's baffling why Vince would refuse to put a star over who made himself. ", "I mean, isn't this the mantra from every single \"old-time\" star? ", "Didn't Warrior spend a good sidebar on his Randy Savage tribute talking about how in the old days, guys made their own way? ", "Didn't Steve Austin spend a good amount of Tough Enough telling guys that they wouldn't have their hands held? ", "Brandon Stroud actually had a rant from his latest Best and Worst of RAW column about that:\n\nRaw on Long Island comes and goes for the second time without an appearance from Zack Ryder, more or less proving that WWE doesn’t give a ripe shit how hard you work to get yourself over, and all that stuff Austin says on Tough Enough about making your own chances is a horse’s anus. ", "Hey Austin, you know how you keep telling people how when you first got to WWE you were the Ringmaster and how terrible that was? ", "Guess what? ", "You spent the five f**king years before that on television having awesome matches with Brian Pillman and Ricky Steamboat and Dustin Rhodes and being part of the Dangerous Alliance, which is unarguably the best thing in the history of wrestling. ", "You were a multiple-time champion, and you got fired just in time to show up in ECW during that one time period when getting fired and showing up in ECW was the coolest thing you could do. ", "Then they made you King of the Ring and put you in a feud with Bret Hart.", "\n\nHow many of those things happened to Big Andy? ", "How many of them happened to Matt Cross? ", "F**king none of them. ", "Andy got put on a wrestling reality show. ", "Matt Cross spent five years wrestling Josh f**king Abercrombie. ", "You didn’t make your chances, Austin, WCW and the WWF did. ", "You just happened to be extremely talented at pro wrestling. ", "Funny how that turned out, right?", "\n\nYep. ", "Co-sign all of that.", "\n\nThis isn't some pedantic plea to get a guy more airtime. ", "Not at all. ", "Ryder is legitimately talented and has legitimately connected with a significant portion of the fanbase. ", "This isn't 1998 anymore. ", "It's 2011. ", "The Internet matters, or else the WWE wouldn't mandate its wrestlers, announcers and air personnel be on Twitter or create a bunch of Facebook like pages or pimp the Internet achievements in their bullshit fluff \"Did You Know\" segments. ", "Now, are the stereotypical \"Internet\" fans a majority group now? ", "No, but there's gotta be a higher percentage of the audience that is plugged in the way we've always been in the last ten years. ", "Ryder has become an especial star in this era of Internet. ", "Sixteen of seventeen of his Z! ", "True Long Island Story videos have garnered over 100K views. ", "He has 37K+ subscribers. ", "He has 123K+ followers on Twitter. ", "As a reference, he's only 20K behind the current United States Champion. ", "He has more than the challenger to that US Championship. ", "More than the guy challenging for the WWE Championship. ", "More than Rey Mysterio, i.e., arguably the company's second biggest draw.", "\n\nDespite that success with the new media, Ryder remains ignored. ", "Why? ", "Whether it's because Vince hates the Internet like Alvarez's nebulous source says or because he didn't get over because of the Vince hype machine or because Vince just doesn't understand the new media, I'm not sure. ", "I'm not sure I care either. ", "It's bad not to even explore whether Ryder can make some kind of dent. ", "No matter what the reason is.", "\n\nAdmittedly, I did come off nonchalant about the whole thing after the show. ", "I didn't need Ryder to enjoy the show, as it was a good RAW. ", "Plus, he probably got more of a chance to shine, albeit on a smaller stage, in a more meaningful way. ", "That being said, this was something that meant a lot to Ryder. ", "It meant a lot to his colleagues. ", "It meant a lot to his fans. ", "And yeah, if he did appear on RAW, I probably would have marked out too. ", "No, scratch that. ", "I know I would have marked out.", "\n\nSo yeah, here we sit, for whatever reason, Vince McMahon wants to continue to ignore a guy who has made himself. ", "So when Ezekiel Jackson, he of almost no heat, wins the Intercontinental Championship on Sunday to absolutely no crowd reaction (and I like Big Zeke, but let's not sugarcoat this, the crowd is dead for him), and he wonders why, well, I hope he at least starts to get it.", "\n\nI doubt it though.", "\n\nRemember you can contact TH and ask him questions about wrestling, life or anything else. ", "Please refer to this post for contact information. ", "He always takes questions!" ]

{ "pile_set_name": "Pile-CC" }

[ 0.0009070764062926173, 0.000595367921050638, 0.0006732287001796067, 0.0007628981256857514, 0.0005699152243323624, 0.0007555712363682687, 0.0012063742615282536, 0.0013136275811120868, 0.0008669812232255936, 0.0007102295639924705, 0.195498526096344, 0.8572969436645508, 0.007660215254873037, 0.8657091856002808, 0.18533138930797577, 0.0005600228323601186, 0.0006499936571344733, 0.005005757790058851, 0.000649519613943994, 0.0011195414699614048, 0.0009112513507716358, 0.5369806289672852, 0.0028529015835374594, 0.0008850092999637127, 0.7408933639526367, 0.013954208232462406, 0.015463043935596943, 0.0010484902886673808, 0.0010984239634126425, 0.9928489923477173, 0.002527248580008745, 0.9677987694740295, 0.0007851393893361092, 0.0006000509602017701, 0.0006590132834389806, 0.014514808543026447, 0.000688029162120074, 0.028387296944856644, 0.0010190526954829693, 0.0006164422957226634, 0.0008615826372988522, 0.00077039998723194, 0.7077543139457703, 0.0008365002577193081, 0.0006068919319659472, 0.0007844752981327474, 0.0047082602977752686, 0.0006233316380530596, 0.0008030181634239852, 0.0007931654690764844, 0.0008295856532640755, 0.0007685957825742662, 0.0011692262487486005, 0.0008462769910693169, 0.0006712256581522524, 0.0009686383418738842, 0.0022226052824407816, 0.052670709788799286, 0.0009605551022104919, 0.0013071283465251327, 0.0016707098111510277, 0.0006533010746352375, 0.0005635158158838749, 0.0005830337177030742, 0.0006018345011398196, 0.0006202993681654334, 0.0008397611090913415, 0.0010416677687317133, 0.0005913811037316918, 0.0020909858867526054, 0.0007623995770700276, 0.0006633191951550543, 0.0006778841488994658, 0.0005147033953107893, 0.0009864822495728731 ]

[ "The consequence of peroxidase overexpression in transgenic plants on root growth and development.", "\nTransgenic tobacco plants that overproduce the tobacco anionic peroxidase wilt upon reaching maturity, although having functional stomata and normal vascular anatomy and physiology. ", "These plants were examined further to determine the cause for wilting, and thus better understand how the anionic peroxidase functions in plant growth and development. ", "Shoots from young peroxidase overproducing plants were grafted onto wild-type tobacco root stock to determine if the roots could absorb and transmit sufficient water to maintain leaf turgidity. ", "These grafted plants never wilted when grown in the greenhouse though shoot peroxidase activity remained ten-fold greater than in control plants, thus indicating that wilting is a consequence of peroxidase expression in the roots. ", "Close examination of root systems revealed considerably less root mass in the transformed plant, primarily exhibited through a decrease in branching. ", "At flowering, root growth rate and total root mass in transformed plants were less than 50% of control plants although shoot mass and growth rate were unchanged. ", "This is in contrast to root growth in young seedlings where transformed plants performed equivalently to controls. ", "Root hydraulic conductivity was measured to evaluate the effect of elevated peroxidase expression on water absorption and transport; however, no significant change in hydraulic conductivity was found in transformed plants. ", "The consequence of anionic peroxidase overexpression on indoleacetic acid (IAA) metabolism was also examined. ", "No significant difference in IAA levels was observed; however, root elongation in plants overexpressing peroxidase was insensitive to exogenous IAA. ", "It can be concluded that the overexpression of the tobacco anionic peroxidase in transformed plants results in diminished root mass from fewer root branches, which contributes to the wilting phenomenon seen in these plants. ", "Further, this developmental change in transformed plants may be a consequence of the metabolism of IAA by the anionic peroxidase." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.000672955415211618, 0.0011355294845998287, 0.0008721664198674262, 0.0010616366053000093, 0.0008051099139265716, 0.0005431374884210527, 0.0006040610605850816, 0.0006468336214311421, 0.0005588085041381419, 0.0013410232495516539, 0.0007870758417993784, 0.0009010590729303658, 0.0032543514389544725 ]

[ "Menu\n\nThe criticism of the iPad before its release was basically: what do I need it for? ", "Having used it for a little while, I’m honestly not sure… Don’t get me wrong, I like my iPad, but I haven’t seen the (or even a) killer app for the iPad yet.", "\n\nI’m generally using my iPad for things I used to do on my iPhone/iPod touch or laptop. ", "I use it for email, web browsing, showing photos and videos, I brought it to a bar to show a fellow developer a system diagram1 – all useful things sure. ", "However all things I would have done with my laptop/iPhone/iPod touch previously.", "\n\nI think the answer is that there isn’t a killer app or killer activity for the iPad2 – it’s just a different way of computing. ", "For many people, a device similar to the iPad will be their next computer. ", "Like me, they will be able to do a number of things on it that they used to do on their old laptop or desktop – but they will enjoy it more on the more limited, focused and user-friendly device.", "\n\nThat was really hard actually, pulling up a PDF on the iPad is non-trivial – Safari ended up working best. [", "back]" ]

{ "pile_set_name": "Pile-CC" }

[ 0.00069815618917346, 0.0007589863962493837, 0.0006225325050763786, 0.0006556297885254025, 0.0005987951881252229, 0.000717063550837338, 0.0006285611307248473, 0.0005763815133832395, 0.0006126378430053592, 0.0008486954611726105 ]

[ "F & C 44 for sale. ", "WINTER was built by Alberto Cibils in Buenos Aires to a design by German Frers in 1983.The Frers & Cibils 44 has been known for years as a high quality, serious offshore yacht. ", "WINTER is a fast and sea kindly boat, with the added benefit of having shoal draft due to its lifting keel. ", "With a balanced ketch rig, these boats have proven themselves time and time again in ocean crossings or long distance races. ", "A classic passage maker. ", "Handbuilt to high standards, the fiberglass work, carpentry and stainless steel work must be seen to be fully appreciated. ", "Teak laid decks and cockpit. ", "Excellent attention to detail throughout with extensive use of quality hardwood. ", "Well cared for by her owners. ", "In the current ownership for 12 years and always stored undercover for winter whilst in the UK, which involves removal of both masts. ", "The masts were repainted in 2016 and the rigging is regularly checked.", "\n\nComplete set of unbreakable cutlery and glasswear (in fitted cupboard in saloon)\n\nSaloon:\n\nTo port is a U-shaped dinette\n\nFull sized centreline dining table with folding leaves\n\nShelf and locker storage outboard of the settee\n\nOpposite to starboard is a straight settee berth with bureau and lockers forward and a open shelf outboard and above the settee.", "\n\nAft in the saloon is a full sized aft facing chart table and nav station with dedicated navigators seat and plenty of storage for gear.", "\n\nPilot berth\n\nNavigation station\n\nChelsea brass clock\n\nChelsea brass barometer\n\nForeward cabin:\n\nForward and aft of a large anchor locker is the forward cabin with v-berth and infill to make a double.", "\n\nAft of the bunk and to starboard is a full height hanging locker with shelf storage\n\nForeward Head:\n\nOpposite and to port is the head and shower unit, plenty of storage. (", "Both showers have a gravity drain to a holding tank which is pumped out by the manual bilge pump in the Saloon)\n\nCounter and wash basin in custom stainless steel.", "\n\nSkipper 11 manual marine toilet\n\nMaster cabin:\n\nAft of the galley thru the aft bulkhead is the master stateroom\n\nLarge single bunk to port\n\nLarge, full height hanging locker\n\nOpposite and to starboard is a double berth and forward of this is the master head and shower unit with plenty of storage\n\nFrom this cabin there is also access to the aft cockpit with a companionway slightly offset to port\n\nAft Head:\n\nElectric marine toilet (2017)\n\nSink\n\nShower\n\nFrers and Cibils 44, Built by Alberto Cibil in Buenos Aires, to a design by German Frers in 1983\n\nWhite hand laid GRP hull, deck and superstructure\n\nCentreboard keel\n\nTeak laid decks\n\nTeak laid cockpit\n\nTeak laid side decks\n\nWheel Steering\n\nTopsides repainted (winter 2017-2018)\n\nMasts repainted 2016\n\nRudder removed and restored (winter 2017-2018)\n\nUnderwater hull dried and treated for osmosis (winter 2014-2015)\n\nCoppercoat antifouling (winter 2014-2015)\n\nBoat wintered under cover whilst in UK\n\nComprehensive records kept of all systems and maintenance\n\nSSR#: 123 941\n\nThis boat was #46 from a run of about 50 boats constructed between 1979 and 1983. ", "She therefore benefitted from improved design modifications carried out on the last handful of yachts. ", "Importantly these relate to revised engine position and configuration, and re- designed chain plate installation to main and mizzen masts.", "\n\nContact NYB Dartmouth\n\nDisclaimer : Dart Marine Sales t/a Network Yacht Brokers Dartmouth offers the details of this vessel for sale but cannot guarantee or warrant the accuracy of the information contained in the specification or warrant the condition of the vessel or equipment. ", "A buyer should instruct his agents, or surveyors, to investigate such details as the buyer desires validated. ", "This vessel is offered for sale subject to no prior sale, price change, or withdrawal without notice." ]

{ "pile_set_name": "Pile-CC" }

[ 0.0007764646434225142, 0.0006550067919306457, 0.0009922863682731986, 0.0006500642630271614, 0.00098306848667562, 0.0005339574418030679, 0.000719701056368649, 0.0005540879210457206, 0.0005965041927993298, 0.0006192343425936997, 0.0006137143354862928, 0.0006400475976988673, 0.0005654182168655097, 0.0006716704810969532, 0.0006700378726236522, 0.0007717265980318189, 0.0008538734982721508, 0.0006059174775145948, 0.0006672785384580493, 0.0005983816226944327, 0.0006003709859214723, 0.0006665247492492199 ]

[ "Sparkly cupcakes and glitter lattes have had their moments to shine, and now food-grade glitter products have finally infiltrated the traditionally male-dominated world of craft beer. ", "Due to prohibitively difficult nature of cleaning glitter out of brewing equipment, glitter beer may not be the next big mainstream trend, but it’s definitely gaining popularity. ", "Breweries like Ska Brewing in Durango, Colorado; Three Weavers Brewing Company in Inglewood, California; and Bold Missy Brewery in Charlotte, North Carolina are just a few of the rising number of brewhouses who have released glitter-filled elixirs .", "\n\nWho doesn’t love glitter? ", "It’s nearly impossible to get out of your cleavage after a night on the town, but it’s festive as hell. ", "And now thanks to edible glitter, your digestive system can be as sparkly as your 1990s eyeshadow palette.", "\n\n“I’ve done a few glitter beers and I’m absolutely smitten with them,” says Erica DeAnda, head brewer at Minocqua Brewing Company in Minocqua, Wisconsin. “", "I think they are fun and bring a new level of uniqueness to a beer.”", "\n\n“What better way to honor her legacy than with glitter?” ", "asked Smith. ", "It’s not her first attempt at sparkly suds; she’d previously added glitter to kegs right before serving them to minimize the flakes settling at the bottom. (", "Because of this, as well as the fact that glitter eventually dissolves and it’s nearly impossible to fully purge from a brewing system, glitter is generally added to beers in individual kegs rather than to the tank during the brewing process.)", "\n\nCat Wiest, former head brewer at Santa Cruz’s Seabright Brewery, shares the enthusiasm for glittery mixtures: “My favorite color is sparkle,” she admits before enthusiastically describing the several glitter beers she’s made over the course of her brewing career. ", "She already has four under her belt—some of which got national attention—and is already working on plans for her next one.", "\n\nNone of them can claim to be the first to brew a glitter beer. ", "DeAnda, Wiest, and Smith all credit Three Weavers brewmaster Alex Nowell’s glittery IPA (Mel’s Sparkle Pony) as the inspiration for their own glittery iterations. ", "Each one describes their giddiness at first sparkly sip, as well as Nowell’s willingness to divulge her technique to anyone interested in trying to make it themselves." ]

{ "pile_set_name": "OpenWebText2" }

[ 0.0016763285966590047, 0.0007592150359414518, 0.000741309835575521, 0.00288982386700809, 0.8304012417793274, 0.4513011872768402, 0.0008727999520488083, 0.000617496611084789, 0.0007946902187541127, 0.0012870810460299253, 0.0010030159028246999, 0.000712590292096138, 0.000567752227652818, 0.0008450811146758497, 0.008842567913234234, 0.0006692780880257487, 0.0006021839217282832 ]

[ "According to the Football Association of Finland’s website, Rasmus Schüller has been called up to the national team for Suomi’s upcoming World Cup Qualifying matches.", "\n\nThe midfielder is expected to play in the Owls’ matches against Turkey and Austria (March 24th and 28th, respectively).", "\n\n\n\nSchüller has looked good despite the rough start to the inaugural season, so he will be missed during the game in New England against the Revolution on March 25th, but this is a great opportunity for him to represent his country.", "\n\n\n\n\n\nFinland currently sits fifth of six teams in Group I of UEFA World Cup Qualifying with one point from four matches. ", "They sit one place ahead of Kosovo because of goal differential.", "\n\nWill the loss of Schüller affect an already embattled United side looking to break a dismal two-match losing streak? ", "Let us know in the comments below!" ]

{ "pile_set_name": "OpenWebText2" }

[ 0.0006484075565822423, 0.0006085269851610065, 0.0006219242932274938, 0.0007464687805622816, 0.0007385031203739345, 0.005121976602822542, 0.000612362870015204 ]

[ "“Fox News Sunday” host Chris Wallace on Sunday quizzed Republican vice presidential candidate Mike Pence on his many attempts to explain away controversial comments made by Donald Trump.", "\n\n“Are you the cleanup crew?” ", "Wallace asked Pence after playing a video of an 11-year-old boy asking the Indiana governor if it is his role in the campaign is to soften Trump’s statements.", "\n\n“I couldn’t be more honored to be campaigning shoulder to shoulder with a man who I believe is going to be the next president of the United States,” Pence said in response.", "\n\n“You do have to clean up. ", "You do have to explain some of the things he says,” Wallace then pressed.", "\n\n“Well, look, we have different styles, but as I told that little boy, we have exactly the same convictions,” Pence replied.", "\n\nThis followed an intense exchange in which Wallace grilled Pence about Trump’s comment last week that President Obama was the “founder” of the Islamic State.", "\n\n“You and he spent a day defending his remarks, saying that they were serious. ", "Now, Trump says that he was being sarcastic. ", "So, Governor, which is it?” ", "Wallace asked Pence.", "\n\n“Well, I think he was being very serious, and he was making a point that needs to be made, that there is no question that the failed policies of President Barack Obama and Secretary of State Hillary Clinton in the wider Middle East created a vacuum within Iraq in which ISIS was able to arise,” Pence replied.", "\n\nWallace then asked twice more why Trump said he was being sarcastic.", "\n\n“Well, he was making a very serious point,” Pence said. “", "Donald Trump has a way of talking to get people’s attention, and it’s drawn attention to a very important issue.”", "\n\nPence then launched into his talking points about the vacuum Obama created in the Middle East.", "\n\n“Those are all perfectly legitimate points to make, but that isn’t what Trump said,” Wallace said to Pence in response. “", "He said that Obama and Clinton were the most valuable players of ISIS, that they were the co-founders of ISIS. ", "Then he said, well, ‘I was just being sarcastic about that,’ just as he said he was just being sarcastic about inviting Russia to come in and release emails of Hillary Clinton’s. ", "Isn’t the sarcastic excuse getting a bit old?”", "\n\n“I don’t think it’s getting old at all,” Pence responded. “", "Donald Trump made his way through a very competitive primary because he spoke not like your typical politician, but just plainly like an everyday American.”", "\n\nWatch the interview via Fox:" ]

{ "pile_set_name": "OpenWebText2" }

[ 0.0007033973815850914, 0.0018013889202848077, 0.0011055340291932225, 0.0006709363078698516, 0.0025812797248363495, 0.0005746007664129138, 0.0006490994128398597, 0.0006997411837801337, 0.0006851448561064899, 0.021912243217229843, 0.0010330608347430825, 0.0014685567002743483, 0.0005992999067530036, 0.005333528388291597, 0.0007421781774610281, 0.0006419193814508617, 0.0006271094898693264, 0.0006564963841810822, 0.0007587774307467043, 0.0011549295159056783, 0.019748548045754433, 0.001028615515679121, 0.0009047341882251203, 0.0006583224749192595 ]

[ "\n431 U.S. 494 (1977)\nMOORE\nv.\nCITY OF EAST CLEVELAND, OHIO.", "\nNo. ", "75-6289.", "\nSupreme Court of United States.", "\nArgued November 2, 1976.", "\nDecided May 31, 1977.", "\nAPPEAL FROM THE COURT OF APPEALS OF OHIO, CUYAHOGA COUNTY.", "\n*495 Edward R. Stege, Jr., argued the cause for appellant. ", "With him on the brief were Francis D. Murtaugh, Jr., and Lloyd B. Snyder.", "\nLeonard Young argued the cause for appellee. ", "With him on the brief was Henry B. Fischer.[*]", "\nMR. ", "JUSTICE POWELL announced the judgment of the Court, and delivered an opinion in which MR. ", "JUSTICE BRENNAN, MR. ", "JUSTICE MARSHALL, and MR. ", "JUSTICE BLACKMUN joined.", "\nEast Cleveland's housing ordinance, like many throughout the country, limits occupancy of a dwelling unit to members *496 of a single family. § ", "1351.02.[1] But the ordinance contains an unusual and complicated definitional section that recognizes as a \"family\" only a few categories of related individuals. § ", "1341.08.[2] Because her family, living together in her home, fits none of those categories, appellant stands convicted of a criminal offense. ", "The question in this case is whether the ordinance violates the Due Process Clause of the Fourteenth Amendment.[3]\n\nI\nAppellant, Mrs. Inez Moore, lives in her East Cleveland home together with her son, Dale Moore, Sr., ", "and her two grandsons, Dale, Jr., and John Moore, Jr. The two boys are first cousins rather than brothers; we are told that John *497 came to live with his grandmother and with the elder and younger Dale Moores after his mother's death.[4]\nIn early 1973, Mrs. Moore received a notice of violation from the city, stating that John was an \"illegal occupant\" and directing her to comply with the ordinance. ", "When she failed to remove him from her home, the city filed a criminal charge. ", "Mrs. Moore moved to dismiss, claiming that the ordinance was constitutionally invalid on its face. ", "Her motion was overruled, and upon conviction she was sentenced to five days in jail and a $25 fine. ", "The Ohio Court of Appeals affirmed after giving full consideration to her constitutional claims,[5]*498 and the Ohio Supreme Court denied review. ", "We noted probable jurisdiction of her appeal, 425 U. S. 949 (1976).", "\n\nII\nThe city argues that our decision in Village of Belle Terre v. Boraas, 416 U. S. 1 (1974), requires us to sustain the ordinance attacked here. ", "Belle Terre, like East Cleveland, imposed limits on the types of groups that could occupy a single dwelling unit. ", "Applying the constitutional standard announced in this Court's leading land-use case, Euclid v. Ambler Realty Co., 272 U. S. 365 (1926),[6] We sustained the Belle Terre ordinance on the ground that it bore a rational relationship to permissible state objectives.", "\nBut one overriding factor sets this case apart from Belle Terre. ", "The ordinance there affected only unrelated individuals. ", "It expressly allowed all who were related by \"blood, adoption, or marriage\" to live together, and in sustaining the ordinance we were careful to note that it promoted \"family needs\" and \"family values.\" ", "416 U. S., at 9. ", "East Cleveland, in contrast, has chosen to regulate the occupancy of its housing by slicing deeply into the family itself. ", "This is no mere incidental result of the ordinance. ", "On its face it selects certain *499 categories of relatives who may live together and declares that others may not. ", "In particular, it makes a crime of a grandmother's choice to live with her grandson in circumstances like those presented here.", "\nWhen a city undertakes such intrusive regulation of the family, neither Belle Terre nor Euclid governs; the usual judicial deference to the legislature is inappropriate. \"", "This Court has long recognized that freedom of personal choice in matters of marriage and family life is one of the liberties protected by the Due Process Clause of the Fourteenth Amendment.\" ", "Cleveland Board of Education v. LaFleur, 414 U. S. 632, 639-640 (1974). ", "A host of cases, tracing their lineage to Meyer v. Nebraska, 262 U. S. 390, 399-401 (1923), and Pierce v. Society of Sisters, 268 U. S. 510, 534-535 (1925), have consistently acknowledged a \"private realm of family life which the state cannot enter.\" ", "Prince v. Massachusetts, 321 U. S. 158, 166 (1944). ", "See, e. g., Roe v. Wade, 410 U. S. 113, 152-153 (1973); Wisconsin v. Yoder, 406 U. S. 205, 231-233 (1972); Stanley v. Illinois, 405 U. S. 645, 651 (1972); Ginsberg v. New York, 390 U. S. 629, 639 (1968); Griswold v. Connecticut, 381 U. S. 479 (1965); id., at 495-496 (Goldberg, J., concurring); id., at 502-503 (WHITE, J., concurring); Poe v. Ullman, 367 U. S. 497, 542-544, 549-553 (1961) (Harlan, J., dissenting); cf. ", "Loving v. Virginia, 388 U. S. 1, 12 (1967); May v. Anderson, 345 U. S. 528, 533 (1953); Skinner v. Oklahoma ex rel. ", "Williamson, 316 U. S. 535, 541 (1942). ", "Of course, the family is not beyond regulation. ", "See Prince v. Massachusetts, supra, at 166. ", "But when the government intrudes on choices concerning family living arrangements, this Court must examine carefully the importance of the governmental interests advanced and the extent to which they are served by the challenged regulation. ", "See Poe v. Ullman, supra, at 554 (Harlan, J., dissenting).", "\nWhen thus examined, this ordinance cannot survive. ", "The city seeks to justify it as a means of preventing overcrowding, *500 minimizing traffic and parking congestion, and avoiding an undue financial burden on East Cleveland's school system. ", "Although these are legitimate goals, the ordinance before us serves them marginally, at best.[7] For example, the ordinance permits any family consisting only of husband, wife, and unmarried children to live together, even if the family contains a half dozen licensed drivers, each with his or her own car. ", "At the same time it forbids an adult brother and sister to share a household, even if both faithfully use public transportation. ", "The ordinance would permit a grandmother to live with a single dependent son and children, even if his school-age children number a dozen, yet it forces Mrs. Moore to find another dwelling for her grandson John, simply because of the presence of his uncle and cousin in the same household. ", "We need not labor the point. ", "Section 1341.08 has but a tenuous relation to alleviation of the conditions mentioned by the city.", "\n\nIII\nThe city would distinguish the cases based on Meyer and Pierce. ", "It points out that none of them \"gives grandmothers any fundamental rights with respect to grandsons,\" Brief for Appellee 18, and suggests that any constitutional right to live together as a family extends only to the nuclear family— essentially a couple and their dependent children.", "\nTo be sure, these cases did not expressly consider the family relationship presented here. ", "They were immediately concerned with freedom of choice with respect to childbearing, e. g., LaFleur, Roe v. Wade, Griswold, supra, or with the rights *501 of parents to the custody and companionship of their own children, Stanley v. Illinois, supra, or with traditional parental authority in matters of child rearing and education. ", "Yoder, Ginsberg, Pierce, Meyer, supra. ", "But unless we close our eyes to the basic reasons why certain rights associated with the family have been accorded shelter under the Fourteenth Amendment's Due Process Clause, we cannot avoid applying the force and rationale of these precedents to the family choice involved in this case.", "\nUnderstanding those reasons requires careful attention to this Court's function under the Due Process Clause. ", "Mr. Justice Harlan described it eloquently:\n\"Due process has not been reduced to any formula; its content cannot be determined by reference to any code. ", "The best that can be said is that through the course of this Court's decisions it has represented the balance which our Nation, built upon postulates of respect for the liberty of the individual, has struck between that liberty and the demands of organized society. ", "If the supplying of content to this Constitutional concept has of necessity been a rational process, it certainly has not been one where judges have felt free to roam where unguided speculation might take them. ", "The balance of which I speak is the balance struck by this country, having regard to what history teaches are the traditions from which it developed as well as the traditions from which it broke. ", "That tradition is a living thing. ", "A decision of this Court which radically departs from it could not long survive, while a decision which builds on what has survived is likely to be sound.[8] No formula could serve as a substitute, in this area, for judgment and restraint.", "\n\n*502 \". . . [", "T]he full scope of the liberty guaranteed by the Due Process Clause cannot be found in or limited by the precise terms of the specific guarantees elsewhere provided in the Constitution. ", "This `liberty' is not a series of isolated points pricked out in terms of the taking of property; the freedom of speech, press, and religion; the right to keep and bear arms; the freedom from unreasonable searches and seizures; and so on. ", "It is a rational continuum which, broadly speaking, includes a freedom from all substantial arbitrary impositions and purposeless restraints, . . . ", "and which also recognizes, what a reasonable and sensitive judgment must, that certain interests require particularly careful scrutiny of the state needs asserted to justify their abridgment.\" ", "Poe v. Ullman, supra, at 542-543 (dissenting opinion).", "\nSubstantive due process has at times been a treacherous field for this Court. ", "There are risks when the judicial branch gives enhanced protection to certain substantive liberties without the guidance of the more specific provisions of the Bill of Rights. ", "As the history of the Lochner era demonstrates, there is reason for concern lest the only limits to such judicial intervention become the predilections of those who happen at the time to be Members of this Court.[9] That history counsels caution and restraint. ", "But it does not counsel abandonment, nor does it require what the city urges here: cutting off any protection of family rights at the first convenient, if arbitrary boundary—the boundary of the nuclear family.", "\n*503 Appropriate limits on substantive due process come not from drawing arbitrary lines but rather from careful \"respect for the teachings of history [and] solid recognition of the basic values that underlie our society.", "\"[10]Griswold v. Connecticut, 381 U. S., at 501 (Harlan, J., concurring).[11] See generally Ingraham v. Wright, 430 U. S. 651, 672-674, and nn. ", "41, 42 (1977); Joint Anti-Fascist Refugee Committee v. McGrath, 341 U. S. 123, 162-163 (1951) (Frankfurter, J., concurring); Lochner v. New York, 198 U. S. 45, 76 (1905) (Holmes, J., dissenting). ", "Our decisions establish that the Constitution protects the sanctity of the family precisely because the institution of the family is deeply rooted in this Nation's history and tradition.[12] It is through the family that we inculcate and *504 pass down many of our most cherished values, moral and cultural.[13]\nOurs is by no means a tradition limited to respect for the bonds uniting the members of the nuclear family. ", "The tradition of uncles, aunts, cousins, and especially grandparents sharing a household along with parents and children has roots equally venerable and equally deserving of constitutional recognition.[14] Over the years millions *505 of our citizens have grown up in just such an environment, and most, surely, have profited from it. ", "Even if conditions of modern society have brought about a decline in extended family households, they have not erased the accumulated wisdom of civilization, gained over the centuries and honored throughout our history, that supports a larger conception of the family. ", "Out of choice, necessity, or a sense of family responsibility, it has been common for close relatives to draw together and participate in the duties and the satisfactions of a common home. ", "Decisions concerning child rearing, which Yoder, Meyer, Pierce and other cases have recognized as entitled to constitutional protection, long have been shared with grandparents or other relatives who occupy the same household— indeed who may take on major responsibility for the rearing of the children.[15] Especially in times of adversity, such as the death of a spouse or economic need, the broader family has tended to come together for mutual sustenance and to maintain or rebuild a secure home life. ", "This is apparently what happened here.[16]\nWhether or not such a household is established because of personal tragedy, the choice of relatives in this degree *506 of kinship to live together may not lightly be denied by the State. ", "Pierce struck down an Oregon law requiring all children to attend the State's public schools, holding that the Constitution \"excludes any general power of the State to standardize its children by forcing them to accept instruction from public teachers only.\" ", "268 U. S., at 535. ", "By the same token the Constitution prevents East Cleveland from standardizing its children—and its adults—by forcing all to live in certain narrowly defined family patterns.", "\nReversed.", "\nMR. ", "JUSTICE BRENNAN, with whom MR. ", "JUSTICE MARSHALL joins, concurring.", "\nI join the plurality's opinion. ", "I agree that the Constitution is not powerless to prevent East Cleveland from prosecuting as a criminal and jailing[1] a 63-year-old grandmother for refusing to expel from her home her now 10-year-old grandson who has lived with her and been brought up by her since his mother's death when he was less than a year old.[2] I do not question that a municipality may constitutionally zone to *507 alleviate noise and traffic congestion and to prevent overcrowded and unsafe living conditions, in short to enact reasonable land-use restrictions in furtherance of the legitimate objectives East Cleveland claims for its ordinance. ", "But the zoning power is not a license for local communities to enact senseless and arbitrary restrictions which cut deeply into private areas of protected family life. ", "East Cleveland may not constitutionally define \"family\" as essentially confined to parents and the parents' own children.[3] The plurality's opinion conclusively demonstrates that classifying family patterns in this eccentric way is not a rational means of achieving the ends East Cleveland claims for its ordinance, and further that the ordinance unconstitutionally abridges the \"freedom of personal choice in matters of . . . ", "family life [that] is one of the liberties protected by the Due Process Clause of the Fourteenth Amendment.\" ", "Cleveland Board of Education v. LaFleur, 414 U. S. 632, 639-640 (1974). ", "I write only to underscore the cultural myopia of the arbitrary boundary drawn by the East Cleveland ordinance in the light of the tradition of the American home that has been a feature of our society since our beginning as a Nation—the \"tradition\" in the plurality's words, \"of uncles, aunts, cousins, and especially grandparents sharing a household along with parents and children . . . .\" ", "Ante, at 504. ", "The line drawn by this ordinance *508 displays a depressing insensitivity toward the economic and emotional needs of a very large part of our society.", "\nIn today's America, the \"nuclear family\" is the pattern so often found in much of white suburbia. ", "J. Vander Zanden, Sociology: A Systematic Approach 322 (3d ed. ", "1975). ", "The Constitution cannot be interpreted, however, to tolerate the imposition by government upon the rest of us of white suburbia's preference in patterns of family living. ", "The \"extended family\" that provided generations of early Americans with social services and economic and emotional support in times of hardship, and was the beachhead for successive waves of immigrants who populated our cities,[4] remains not merely still a pervasive living pattern, but under the goad of brutal economic necessity, a prominent pattern—virtually a means of survival— for large numbers of the poor and deprived minorities of our society. ", "For them compelled pooling of scant resources requires compelled sharing of a household.[5]\n*509 The \"extended\" form is especially familiar among black families.[6] We may suppose that this reflects the truism that black citizens, like generations of white immigrants before them, have been victims of economic and other disadvantages that would worsen if they were compelled to abandon extended, for nuclear, living patterns.[7] Even in husband and wife households, 13% of black families compared with 3% of white families include relatives under 18 years old, in addition *510 to the couple's own children.[8] In black households whose head is an elderly woman, as in this case, the contrast is even more striking: 48% of such black households, compared with 10% of counterpart white households, include related minor children not offspring of the head of the household.[9]\nI do not wish to be understood as implying that East Cleveland's enforcement of its ordinance is motivated by a racially discriminatory purpose: The record of this case would not support that implication. ", "But the prominence of other than nuclear families among ethnic and racial minority groups, including our black citizens, surely demonstrates that the \"extended family\" pattern remains a vital tenet of our society.[10] It suffices that in prohibiting this pattern of family living as a means of achieving its objectives, appellee city has chosen a device that deeply intrudes into family associational rights that historically have been central, and today remain central, to a large proportion of our population.", "\nMoreover, to sanction the drawing of the family line at the arbitrary boundary chosen by East Cleveland would surely conflict with prior decisions that protected \"extended\" family *511 relationships. ", "For the \"private realm of family life which the state cannot enter,\" recognized as protected in Prince v. Massachusetts, 321 U. S. 158, 166 (1944), was the relationship of aunt and niece. ", "And in Pierce v. Society of Sisters, 268 U. S. 510, 534-535 (1925), the protection held to have been unconstitutionally abridged was \"the liberty of parents and guardians to direct the upbringing and education of children under their control\" (emphasis added). ", "See also Wisconsin v. Yoder, 406 U. S. 205, 232-233 (1972). ", "Indeed, Village of Belle Terre v. Boraas, 416 U. S. 1 (1974), the case primarily relied upon by the appellee, actually supports the Court's decision. ", "The Belle Terre ordinance barred only unrelated individuals from constituting a family in a single-family zone. ", "The village took special care in its brief to emphasize that its ordinance did not in any manner inhibit the choice of related individuals to constitute a family, whether in the \"nuclear\" or \"extended\" form. ", "This was because the village perceived that choice as one it was constitutionally powerless to inhibit. ", "Its brief stated: \"Whether it be the extended family of a more leisurely age or the nuclear family of today the role of the family in raising and training successive generations of the species makes it more important, we dare say, than any other social or legal institution . . . . ", "If any freedom not specifically mentioned in the Bill of Rights enjoys a `preferred position' in the law it is most certainly the family.\" (", "Emphasis supplied.) ", "Brief for Appellants in No. ", "73-191, O. T. 1973, p. 26. ", "The cited decisions recognized, as the plurality recognizes today, that the choice of the \"extended family\" pattern is within the \"freedom of personal choice in matters of . . . ", "family life [that] is one of the liberties protected by the Due Process Clause of the Fourteenth Amendment.\" ", "414 U. S., at 639-640.", "\nAny suggestion that the variance procedure of East Cleveland's Housing Code assumes special significance is without merit. ", "This is not only because this grandmother *512 was not obligated to exhaust her administrative remedy before defending this prosecution on the ground that the single-family occupancy ordinance violates the Equal Protection Clause. ", "Euclid v. Ambler Realty Co., 272 U. S. 365 (1926), the leading case in the zoning field, expressly held that one attacking the constitutionality of a building or zoning code need not first seek a variance. ", "Id., at 386. ", "Rather, the matter of a variance is irrelevant also because the municipality is constitutionally powerless to abridge, as East Cleveland has done, the freedom of personal choice of related members of a family to live together. ", "Thus, the existence of the variance procedure serves to lessen neither the irrationality of the definition of \"family\" nor the extent of its intrusion into family life-style decisions.", "\nThere is no basis for an inference—other than the city's self-serving statement that a hardship variance \"possibly with some stipulation(s) would probably have been granted\"—that this grandmother would have obtained a variance had she requested one. ", "Indeed, a contrary inference is more supportable. ", "In deciding to prosecute her in the first place, the city tipped its hand how discretion would have been exercised. ", "In any event, § 1311.02 (1965), limits the discretion of the Board of Building Code Appeals to grant variances to those which are \"in harmony with the general intent of such ordinance . . . .\" ", "If one of the legitimate objectives of the definition of \"family\" was to preserve the single (nuclear) family character of East Cleveland, then granting this grandmother a variance would be in excess of the Board's powers under the ordinance.", "\nFurthermore, the very existence of the \"escape hatch\" of the variance procedure only heightens the irrationality of the restrictive definition, since application of the ordinance then depends upon which family units the zoning authorities permit to reside together and whom the prosecuting authorities choose to prosecute. ", "The Court's disposition of the analogous situation in Roe v. Wade, 410 U. S. 113 (1973), *513 is instructive. ", "There Texas argued that, despite a rigid and narrow statute prohibiting abortions except for the purpose of saving the mother's life, prosecuting authorities routinely tolerated elective abortion procedures in certain cases, such as nonconsensual pregnancies resulting from rape or incest. ", "The Court was not persuaded that this saved the statute, THE CHIEF JUSTICE commenting that \"no one in these circumstances should be placed in a posture of dependence on a prosecutorial policy or prosecutorial discretion.\" ", "Id., at 208 (concurring opinion). ", "Similarly, this grandmother cannot be denied the opportunity to defend against this criminal prosecution because of a variance procedure that holds her family hostage to the vagaries of discretionary administrative decisions. ", "Smith v. Cahoon, 283 U. S. 553, 562 (1931). ", "We have now passed well beyond the day when illusory escape hatches could justify the imposition of burdens on fundamental rights. ", "Stanley v. Illinois, 405 U. S. 645, 647-649 (1972); Staub v. City of Baxley, 355 U. S. 313, 319 (1958).", "\nMR. ", "JUSTICE STEVENS, concurring in the judgment.", "\nIn my judgment the critical question presented by this case is whether East Cleveland's housing ordinance is a permissible restriction on appellant's right to use her own property as she sees fit.", "\nLong before the original States adopted the Constitution, the common law protected an owner's right to decide how best to use his own property. ", "This basic right has always been limited by the law of nuisance which proscribes uses that impair the enjoyment of other property in the vicinity. ", "But the question whether an individual owner's use could be further limited by a municipality's comprehensive zoning plan was not finally decided until this century.", "\nThe holding in Euclid v. Ambler Realty Co., 272 U. S. 365, that a city could use its police power, not just to abate a specific use of property which proved offensive, but also to create and implement a comprehensive plan for the use *514 of land in the community, vastly diminished the rights of individual property owners. ", "It did not, however, totally extinguish those rights. ", "On the contrary, that case expressly recognized that the broad zoning power must be exercised within constitutional limits.", "\nIn his opinion for the Court, Mr. Justice Sutherland fused the two express constitutional restrictions on any state interference with private property—that property shall not be taken without due process nor for a public purpose without just compensation—into a single standard: \"[B]efore [a zoning] ordinance can be declared unconstitutional, [it must be shown to be] clearly arbitrary and unreasonable, having no substantial relation to the public health, safety, morals, or general welfare.\" ", "Id., at 395 (emphasis added). ", "This principle was applied in Nectow v. Cambridge, 277 U. S. 183; on the basis of a specific finding made by the state trial court that \"the health, safety, convenience and general welfare of the inhabitants of the part of the city affected\" would not be promoted by prohibiting the landowner's contemplated use, this Court held that the zoning ordinance as applied was unconstitutional. ", "Id., at 188.[1]\nWith one minor exception,[2] between the Nectow decision in 1928 and the 1974 decision in Village of Belle Terre v. Boraas, 416 U. S. 1, this Court did not review the substance of any zoning ordinances. ", "The case-by-case development of the constitutional limits on the zoning power has not, therefore, taken place in this Court. ", "On the other hand, during *515 the past half century the broad formulations found in Euclid and Nectow have been applied in countless situations by the state courts. ", "Those cases shed a revelatory light on the character of the single-family zoning ordinance challenged in this case.", "\nLitigation involving single-family zoning ordinances is common. ", "Although there appear to be almost endless differences in the language used in these ordinances,[3] they contain three principal types of restrictions. ", "First, they define the kind of structure that may be erected on vacant land.[4] Second, they require that a single-family home be occupied only by a \"single housekeeping unit.", "\"[5] Third, they often *516 require that the housekeeping unit be made up of persons related by blood, adoption, or marriage, with certain limited exceptions.", "\nAlthough the legitimacy of the first two types of restrictions is well settled,[6] attempts to limit occupancy to related persons have not been successful. ", "The state courts have recognized a valid community interest in preserving the stable character of residential neighborhoods which justifies a prohibition against transient occupancy.[7] Nevertheless, in well-reasoned opinions, the courts of Illinois,[8] New York,[9] New Jersey,[10]*517 California,[11] Connecticut,[12] Wisconsin,[13] and other jurisdictions,[14] have permitted unrelated persons to occupy single-family residences notwithstanding an ordinance prohibiting, either expressly or implicitly, such occupancy.", "\n*518 These cases delineate the extent to which the state courts have allowed zoning ordinances to interfere with the right of a property owner to determine the internal composition of his *519 household. ", "The intrusion on that basic property right has not previously gone beyond the point where the ordinance defines a family to include only persons related by blood, marriage, or adoption. ", "Indeed, as the cases in the margin demonstrate, state courts have not always allowed the intrusion to penetrate that far. ", "The state decisions have upheld zoning ordinances which regulated the identity, as opposed to the number, of persons who may compose a household only to the extent that the ordinances require such households to remain nontransient, single-housekeeping units.[15]\n*520 There appears to be no precedent for an ordinance which excludes any of an owner's relatives from the group of persons who may occupy his residence on a permanent basis. ", "Nor does there appear to be any justification for such a restriction on an owner's use of his property.[16] The city has failed totally to explain the need for a rule which would allow a homeowner to have two grandchildren live with her if they are brothers, but not if they are cousins. ", "Since this ordinance has not been shown to have any \"substantial relation to the public health, safety, morals, or general welfare\" of the city of East Cleveland, and since it cuts so deeply into a fundamental right normally associated with the ownership of residential property—that of an owner to decide who may reside on his or her property—it must fall under the limited standard of review of zoning decisions which this Court preserved in *521 Euclid and Nectow. ", "Under that standard, East Cleveland's unprecedented ordinance constitutes a taking of property without due process and without just compensation.", "\nFor these reasons, I concur in the Court's judgment.", "\nMR. ", "CHIEF JUSTICE BURGER, dissenting.", "\nIt is unnecessary for me to reach the difficult constitutional issue this case presents. ", "Appellant's deliberate refusal to use a plainly adequate administrative remedy provided by the city should foreclose her from pressing in this Court any constitutional objections to the city's zoning ordinance. ", "Considerations of federalism and comity, as well as the finite capacity of federal courts, support this position. ", "In courts, as in hospitals, two bodies cannot occupy the same space at the same time; when any case comes here which could have been disposed of long ago at the local level, it takes the place that might well have been given to some other case in which there was no alternative remedy.", "\n\n(1)\nThe single-family zoning ordinances of the city of East Cleveland define the term \"family\" to include only the head of the household and his or her most intimate relatives, principally the spouse and unmarried and dependent children. ", "Excluded from the definition of \"family,\" and hence from cohabitation, are various persons related by blood or adoption to the head of the household. ", "The obvious purpose of the city is the traditional one of preserving certain areas as family residential communities.", "\nThe city has established a Board of Building Code Appeals to consider variances from this facially stringent single-family limit when necessary to alleviate \"practical difficulties and unnecessary hardships\" and \"to secure the general welfare and [do] substantial justice . . . .\" ", "East Cleveland Codified Ordinances § 1311.02 (1965). ", "The Board has power to grant variances to \"[a]ny person adversely affected by a decision of *522 any City official made in the enforcement of any [zoning] ordinance,\" so long as appeal is made to the Board within 10 days of notice of the decision appealed from. § ", "1311.03.", "\nAfter appellant's receipt of the notice of violation, her lawyers made no effort to apply to the Board for a variance to exempt her from the restrictions of the ordinance, even though her situation appears on its face to present precisely the kind of \"practical difficulties and unnecessary hardships\" the variance procedure was intended to accommodate. ", "Appellant's counsel does not claim appellant was unaware of the right to go to the Board and seek a variance, or that any attempt was made to secure relief by an application to the Board.[1] Indeed, appellant's counsel makes no claim that the failure to seek a variance was due to anything other than a deliberate decision to forgo the administrative process in favor of a judicial forum.", "\n\n(2)\nIn view of appellant's deliberate bypass of the variance procedure, the question arises whether she should now be permitted to complain of the unconstitutionality of the single-family ordinance as it applies to her. ", "This Court has not yet required one in appellant's position to utilize available state administrative remedies as a prerequisite to obtaining federal relief; but experience has demonstrated that such a requirement is imperative if the critical overburdening of federal courts at all levels is to be alleviated. ", "That burden has now become \"a crisis of overload, a crisis so serious that it threatens the capacity of the federal system to function as it should.\" *", "523 Department of Justice Committee on Revision of the Federal Judicial System, Report on the Needs of the Federal Courts 1 (1977). ", "The same committee went on to describe the disastrous effects an exploding caseload has had on the administration of justice:\n\"Overloaded courts . . . ", "mean long delays in obtaining a final decision and additional expense as court procedures become more complex in the effort to handle the rush of business. . . . [", "T]he quality of justice must necessarily suffer. ", "Overloaded courts, seeking to deliver justice on time insofar as they can, necessarily begin to adjust their processes, sometimes in ways that threaten the integrity of the law and of the decisional process.", "\n\"District courts have delegated more and more of their tasks to magistrates . . . . ", "Time for oral argument is steadily cut back . . . . [", "T]he practice of delivering written opinions is declining.", "\n.....\n\". . . ", "Courts are forced to add more clerks, more administrative personnel, to move cases faster and faster. ", "They are losing . . . ", "time for reflection, time for the deliberate maturation of principles.\" ", "Id., at 3-4.", "\nThe devastating impact overcrowded dockets have on the quality of justice received by all litigants makes it essential that courts be reserved for the resolution of disputes for which no other adequate forum is available.", "\n\nA\nThe basis of the doctrine of exhaustion of administrative remedies was simply put in Myers v. Bethlehem Shipbuilding Corp., 303 U. S. 41, 50-51 (1938), as\n\"the long settled rule of judicial administration that no one is entitled to judicial relief for a supposed or *524 threatened injury until the prescribed administrative remedy has been exhausted.\"", "\nExhaustion is simply one aspect of allocation of overtaxed judicial resources. ", "Appellant wishes to use a residential property in a manner at variance with a municipal housing code. ", "That claim could have been swiftly and inexpensively adjudicated in a municipal administrative tribunal, without engaging cumbersome federal judicial machinery at the highest level. ", "Of course, had appellant utilized the local administrative remedies and state judicial remedies to no avail, resort to this Court would have been available.[2]\nThe exhaustion principle asks simply that absent compelling circumstances—and none are claimed here—the avenues of relief nearest and simplest should be pursued first. ", "This Court should now make unmistakably clear that when state or local governments provide administrative remedial procedures, no federal forum will be open unless the claimant can show either that the remedy is inadequate or that resort to those remedies is futile.", "\nUtilization of available administrative processes is mandated for a complex of reasons. ", "Statutes sometimes provide administrative procedures as the exclusive remedy. ", "Even apart from a statutory command, it is common sense to permit the simple, speedy, and inexpensive processes of the administrative machinery to sift the facts and compile a complete record for the benefit of any reviewing courts. ", "Exhaustion avoids interruption of the administrative process and allows application of an agency's specialized experience and the broad discretion granted to local entities, such as zoning boards. *", "525 Indeed, judicial review may be seriously hampered if the appropriate agency has no chance to apply its experience, exercise its discretion, or make a factual record reflecting all aspects of the problem.", "\nMost important, if administrative remedies are pursued, the citizen may win complete relief without needlessly invoking judicial process. ", "This permits the parties to resolve their disputes by relatively informal means far less costly and time consuming than litigation. ", "By requiring exhaustion of administrative processes the courts are assured of reviewing only final agency decisions arrived at after considered judgment. ", "It also permits agencies an opportunity to correct their own mistakes or give discretionary relief short of judicial review. ", "Consistent failure by courts to mandate utilization of administrative remedies—under the growing insistence of lawyers demanding broad judicial remedies—inevitably undermines administrative effectiveness and defeats fundamental public policy by encouraging \"end runs\" around the administrative process.", "\nIt is apparent without discussion that resort to the local appeals board in this case would have furthered these policies, particularly since the exercise of informed discretion and experience by the proper agency is the essence of any housing code variance procedure. ", "We ought not to encourage litigants to bypass simple, inexpensive, and expeditious remedies available at their doorstep in order to invoke expensive judicial machinery on matters capable of being resolved at local levels.", "\n\nB\nThe suggestion is made that exhaustion of administrative remedies is not required on issues of constitutional law. ", "In one sense this argument is correct, since administrative agencies have no power to decide questions of federal constitutional law. ", "But no one has a right to a federal constitutional adjudication *526 on an issue capable of being resolved on a less elevated plane. ", "Indeed, few concepts have had more faithful adherence in this Court than the imperative of avoiding constitutional resolution of issues capable of being disposed of otherwise. ", "Mr. Justice Brandeis put it well in a related context, arguing for judicial restraint in Ashwander v. TVA, 297 U. S. 288, 347 (1936) (concurring opinion):\n\"[This] Court will not pass upon a constitutional question although properly presented by the record, if there is also present some other ground upon which the case may be disposed of. . . . ", "Thus, if a case can be decided on either of two grounds, one involving a constitutional question, the other a question of statutory construction or general law, the Court will decide only the latter.\"", "\nThis Court has frequently remanded cases for exhaustion \"before a challenge can be made in a reviewing court of the constitutionality of the basic statute, on which the agency may not pass . . . .\" ", "K. Davis, Administrative Law Text 394 (3d ed. ", "1972). ", "Indeed, exhaustion is often required precisely because there are constitutional issues present in a case, in order to avoid unnecessary adjudication of these delicate questions by giving the affected administrative agency an opportunity to resolve the matter on nonconstitutional grounds. ", "See Christian v. New York Dept. ", "of Labor, 414 U. S. 614 (1974); Public Utilities Comm'n of California v. United States, 355 U. S. 534, 539-540 (1958); Allen v. Grand Central Aircraft Co., 347 U. S. 535, 553 (1954); Aircraft & Diesel Equipment Corp. v. Hirsch, 331 U. S. 752, 766-767 (1947); Natural Gas Co. v. Slattery, 302 U. S. 300, 309-311 (1937); Fuchs, Prerequisites to Judicial Review of Administrative Agency Action, 51 Ind. L. J. 817, 883 (1976).", "\nOf course, if administrative authority fails to afford relief, further exhaustion is pointless and judicial relief may be available. ", "See Weinberger v. Salfi, 422 U. S. 749 (1975). *", "527 But so long as favorable administrative action is still possible, the policies favoring exhaustion are not mitigated in the slightest by the presence of a constitutional issue. ", "See Christian, supra. ", "To the extent that a nonconstitutional decision is possible only at the administrative level, those policies are reinforced. ", "Plainly we have here precisely such a case. ", "Appearance before the local city Board would have provided an opportunity for complete relief without forcing a constitutional ruling. ", "The posture of the constitutional issues in this case thus provides an additional reason supporting the exhaustion requirement.", "\n\nC\nIt is also said that exhaustion is not required when to do so would inflict irreparable injury on the litigant. ", "In the present case, as in others in which a constitutional claim is asserted, injury is likely to include the \"loss or destruction of substantive rights.\" ", "In such a case, \"the presence of constitutional questions, coupled with a sufficient showing of inadequacy of prescribed administrative relief and of threatened or impending irreparable injury flowing from delay . . . , ", "has been held sufficient to dispense with exhausting the administrative process before instituting judicial intervention.\" ", "Aircraft & Diesel Equipment Corp., supra, at 773.", "\nBut there is every reason to require resort to administrative remedies \"where the individual charged is to be deprived of nothing until the completion of [the administrative] proceeding.\" ", "Gibson v. Berryhill, 411 U. S. 564, 574-575 (1973); see Natural Gas Co., supra, at 309-311; Schlesinger v. Councilman, 420 U. S. 738 (1975); Aircraft & Diesel Equipment Corp., supra, at 773-774. ", "The focus must be on the adequacy of the administrative remedy. ", "If the desired relief may be obtained without undue burdens, and if substantial rights are protected as the process moves forward, no harm is done by requiring the litigant to pursue and exhaust those remedies before calling on the Constitution of *528 the United States. ", "To do otherwise trivializes constitutional adjudication.[3]\nIn this case appellant need have surrendered no asserted constitutional rights in order to pursue the local administrative remedy. ", "No reason appears why appellant could not have sought a variance as soon as notice of a claimed violation was received, without altering the living arrangements in question. ", "The notice of violation gave appellant 10 days within which to seek a variance; no criminal or civil sanctions could possibly have attached pending the outcome of that proceeding.", "\nThough timely invocation of the administrative remedy would have had no effect on appellant's asserted rights, and would have inflicted no irreparable injury, the present availability of such relief under the city ordinance is less clear. ", "But it is unrealistic to expect a municipality to hold open its administrative process for years after legal enforcement action has begun. ", "Appellant cannot rely on the current absence *529 of administrative relief either as justification for the original failure to seek it, or as a reason why accountability for that failure is unreasonable. ", "See Huffman v. Pursue, Ltd., 420 U. S. 592, 611 n. 22 (1975). ", "Any other rule would make a mockery of the exhaustion doctrine by placing no penalty on its violation.", "\n\nD\nThis is not a case where inadequate or unclear or costly remedies make exhaustion inappropriate, or where the Board's position relating to appellant's claims is so fixed that further administrative review would be fruitless. ", "There is not the slightest indication of any fixed Board policy against variances, or that a prompt application for a variance would not have been granted.[4] Nor is it dispositive that the case involves criminal rather than civil penalties. ", "The applicability of the exhaustion principle to bar challenges to the legality of prosecutions is established, even where, unlike the present case, substantial felony penalties are at stake. ", "McGee v. United States, 402 U. S. 479 (1971); Yakus v. United States, 321 U. S. 414 (1944); Falbo v. United States, 320 U. S. 549 (1944); see McKart v. United States, 395 U. S. 185 (1969). ", "There is far less reason to take into account the criminal nature of the proceedings when only misdemeanor penalties are involved.", "\n\n(3)\nThus, the traditional justifications offered in support of the exhaustion principle point toward application of the doctrine. ", "But there is a powerful additional reason why exhaustion should be enforced in this case. ", "We deal here with federal *530 judicial review of an administrative determination by a subdivision of the State of Ohio. ", "When the question before a federal court is whether to enforce exhaustion of state administrative remedies, interests of federalism and comity make the analysis strikingly similar to that appropriate when the question is whether federal courts should abstain from interference with ongoing state judicial proceedings.[5] In both situations federal courts are being requested to act in ways lacking deference to, and perhaps harmful to, important state interests in order to vindicate rights which can be protected in the state system as well as in the federal. ", "Cf. ", "Wisconsin v. Constantineau, 400 U. S. 433, 439 (1971) (BURGER, C. J., dissenting). ", "The policies underlying this Court's refusals to jeopardize important state objectives needlessly in Huffman v. Pursue, Ltd., supra; Juidice v. Vail, 430 U. S. 327 (1977); and Trainor v. Hernandez, ante, p. 434, argue strongly against action which encourages evasion and undermining of other important state interests embodied in regulatory procedures.", "\nWhen the State asserts its sovereignty through the administrative process, no less than when it proceeds judicially, \"federal courts . . . ", "should abide by standards of restraint that go well beyond those of private equity jurisprudence.\" ", "Huffman, supra, at 603; cf. ", "Younger v. Harris, 401 U. S. 37, 41 (1971). ", "A proper respect for state integrity is manifested by and, in part, dependent on, our reluctance to disrupt state *531 proceedings even when important federal rights are asserted as a reason for doing so. ", "Where, as here, state law affords an appropriate \"doorstep\" vehicle for vindication of the claims underlying those rights, federal courts should not be called upon unless those remedies have been utilized. ", "No litigant has a right to force a constitutional adjudication by eschewing the only forum in which adequate nonconstitutional relief is possible. ", "Appellant seeks to invoke federal judicial relief. ", "We should now make clear that the finite resources of this Court are not available unless the litigant has first pursued all adequate and available administrative remedies.", "\nThe doctrine of exhaustion of administrative remedies has a long history. ", "Though its salutary effects are undisputed, they have often been casually neglected, due to the judicial penchant of honoring the doctrine more in the breach than in the observance. ", "For my part, the time has come to insist on enforcement of the doctrine whenever the local or state remedy is adequate and where asserted rights can be protected and irreparable injury avoided within the administrative process. ", "Only by so doing will this Court and other federal courts be available to deal with the myriad new problems clamoring for resolution.", "\nMR. ", "JUSTICE STEWART, with whom MR. ", "JUSTICE REHNQUIST joins, dissenting.", "\nIn Village of Belle Terre v. Boraas, 416 U. S. 1, the Court considered a New York village ordinance that restricted land use within the village to single-family dwellings. ", "That ordinance defined \"family\" to include all persons related by blood, adoption, or marriage who lived and cooked together as a single-housekeeping unit; it forbade occupancy by any group of three or more persons who were not so related. ", "We held that the ordinance was a valid effort by the village government to promote the general community welfare, and that it did not violate the Fourteenth Amendment or infringe *532 any other rights or freedoms protected by the Constitution.", "\nThe present case brings before us a similar ordinance of East Cleveland, Ohio, one that also limits the occupancy of any dwelling unit to a single family, but that defines \"family\" to include only certain combinations of blood relatives. ", "The question presented, as I view it, is whether the decision in Belle Terre is controlling, or whether the Constitution compels a different result because East Cleveland's definition of \"family\" is more restrictive than that before us in the Belle Terre case.", "\nThe city of East Cleveland is a residential suburb of Cleveland, Ohio. ", "It has enacted a comprehensive Housing Code, one section of which prescribes that \"[t]he occupancy of any dwelling unit shall be limited to one, and only one, family. . . ", ".\"[1] The Code defines the term \"family\" as follows:\n\" `Family' means a number of individuals related to the nominal head of the household or to the spouse of the nominal head of the household living as a single house-keeping unit in a single dwelling unit, but limited to the following:\n\"(a) Husband or wife of the nominal head of the household.", "\n\"(b) Unmarried children of the nominal head of the household or of the spouse of the nominal head of the household, provided, however, that such unmarried children have no children residing with them.", "\n\"(c) Father or mother of the nominal head of the household or of the spouse of the nominal head of the household.", "\n\"(d) Notwithstanding the provisions of subsection (b) hereof, a family may include not more than one dependent married or unmarried child of the nominal head of the household or of the spouse of the nominal head of *533 the household and the spouse and dependent children of such dependent child. ", "For the purpose of this subsection, a dependent person is one who has more than fifty percent of his total support furnished for him by the nominal head of the household and the spouse of the nominal head of the household.", "\n\"(e) A family may consist of one individual.", "\"[2]\nThe appellant, Inez Moore, owns a 2 1/2-story frame house in East Cleveland. ", "The building contains two \"dwelling units.", "\"[3] At the time this litigation began Mrs. Moore occupied one of these dwelling units with her two sons, John Moore, Sr., ", "and Dale Moore, Sr., ", "and their two sons, John, Jr., and Dale, Jr.[4] These five persons constituted more than one family under the ordinance.", "\nIn January 1973, a city housing inspector cited Mrs. Moore for occupation of the premises by more than one family.[5] She received a notice of violation directing her to *534 correct the situation, which she did not do. ", "Sixteen months passed, during which the city repeatedly complained about the violation. ", "Mrs. Moore did not request relief from the Board of Building Code Appeals, although the Code gives the Board the explicit power to grant a variance \"where practical difficulties and unnecessary hardships shall result from the strict compliance with or the enforcement of the provisions of any ordinance . . . ", ".\"[6] Finally, in May 1974, a municipal court found Mrs. Moore guilty of violating the single-family occupancy ordinance. ", "The court overruled her motion to dismiss the charge, rejecting her claim that the ordinance's definition of \"family\" is invalid on its face under the United States Constitution. ", "The Ohio Court of Appeals affirmed on the authority of Village of Belle Terre v. Boraas, and the Ohio Supreme Court dismissed Mrs. Moore's appeal.", "\nIn my view, the appellant's claim that the ordinance in question invades constitutionally protected rights of association and privacy is in large part answered by the Belle Terre decision. ", "The argument was made there that a municipality could not zone its land exclusively for single-family occupancy because to do so would interfere with protected rights of privacy or association. ", "We rejected this contention, and held that the ordinance at issue \"involve[d] no `fundamental' right guaranteed by the Constitution, such as . . . ", "the right of association, NAACP v. Alabama, 357 U. S. 449; . . . ", "or any rights of privacy, cf. ", "Griswold v. Connecticut, 381 U. S. 479; Eisenstadt v. Baird, 405 U. S. 438, 453-454.\" ", "416 U. S., at 7-8.", "\nThe Belle Terre decision thus disposes of the appellant's contentions to the extent they focus not on her blood relationships with her sons and grandsons but on more general *535 notions about the \"privacy of the home.\" ", "Her suggestion that every person has a constitutional right permanently to share his residence with whomever he pleases, and that such choices are \"beyond the province of legitimate governmental intrusion,\" amounts to the same argument that was made and found unpersuasive in Belle Terre.", "\nTo be sure, the ordinance involved in Belle Terre did not prevent blood relatives from occupying the same dwelling, and the Court's decision in that case does not, therefore, foreclose the appellant's arguments based specifically on the ties of kinship present in this case. ", "Nonetheless, I would hold, for the reasons that follow, that the existence of those ties does not elevate either the appellant's claim of associational freedom or her claim of privacy to a level invoking constitutional protection.", "\nTo suggest that the biological fact of common ancestry necessarily gives related persons constitutional rights of association superior to those of unrelated persons is to misunderstand the nature of the associational freedoms that the Constitution has been understood to protect. ", "Freedom of association has been constitutionally recognized because it is often indispensable to effectuation of explicit First Amendment guarantees. ", "See NAACP v. Alabama ex rel. ", "Patterson, 357 U. S. 449, 460-461; Bates v. Little Rock, 361 U. S. 516, 523; Shelton v. Tucker, 364 U. S. 479; NAACP v. Button, 371 U. S. 415, 430-431; Railroad Trainmen v. Virginia Bar, 377 U. S. 1; Kusper v. Pontikes, 414 U. S. 51, 56-61; cf. ", "Edwards v. South Carolina, 372 U. S. 229. ", "But the scope of the associational right, until now, at least, has been limited to the constitutional need that created it; obviously not every \"association\" is for First Amendment purposes or serves to promote the ideological freedom that the First Amendment was designed to protect.", "\nThe \"association\" in this case is not for any purpose relating to the promotion of speech, assembly, the press, or religion. ", "And wherever the outer boundaries of constitutional protection *536 of freedom of association may eventually turn out to be, they surely do not extend to those who assert no interest other than the gratification, convenience, and economy of sharing the same residence.", "\nThe appellant is considerably closer to the constitutional mark in asserting that the East Cleveland ordinance intrudes upon \"the private realm of family life which the state cannot enter.\" ", "Prince v. Massachusetts, 321 U. S. 158, 166. ", "Several decisions of the Court have identified specific aspects of what might broadly be termed \"private family life\" that are constitutionally protected against state interference. ", "See, e. g., Roe v. Wade, 410 U. S. 113, 152-154 (woman's right to decide whether to terminate pregnancy); Loving v. Virginia, 388 U. S. 1, 12 (freedom to marry person of another race); Griswold v. Connecticut, 381 U. S. 479; Eisenstadt v. Baird, 405 U. S. 438 (right to use contraceptives); Pierce v. Society of Sisters, 268 U. S. 510, 534-535 (parents' right to send children to private schools); Meyer v. Nebraska, 262 U. S. 390 (parents' right to have children instructed in foreign language).", "\nAlthough the appellant's desire to share a single-dwelling unit also involves \"private family life\" in a sense, that desire can hardly be equated with any of the interests protected in the cases just cited. ", "The ordinance about which the appellant complains did not impede her choice to have or not to have children, and it did not dictate to her how her own children were to be nurtured and reared. ", "The ordinance clearly does not prevent parents from living together or living with their unemancipated offspring.", "\nBut even though the Court's previous cases are not directly in point, the appellant contends that the importance of the \"extended family\" in American society requires us to hold that her decision to share her residence with her grandsons may not be interfered with by the State. ", "This decision, like the decisions involved in bearing and raising children, is said *537 to be an aspect of \"family life\" also entitled to substantive protection under the Constitution. ", "Without pausing to inquire how far under this argument an \"extended family\" might extend, I cannot agree.[7] When the Court has found that the Fourteenth Amendment placed a substantive limitation on a State's power to regulate, it has been in those rare cases in which the personal interests at issue have been deemed \" `implicit in the concept of ordered liberty.' \" ", "See Roe v. Wade, supra, at 152, quoting Palko v. Connecticut, 302 U. S. 319, 325. ", "The interest that the appellant may have in permanently sharing a single kitchen and a suite of contiguous rooms with some of her relatives simply does not rise to that level. ", "To equate this interest with the fundamental decisions to marry and to bear and raise children is to extend the limited substantive contours of the Due Process Clause beyond recognition.", "\nThe appellant also challenges the single-family occupancy ordinance on equal protection grounds. ", "Her claim is that the city has drawn an arbitrary and irrational distinction between groups of people who may live together as a \"family\" and those who may not. ", "While acknowledging the city's right to preclude more than one family from occupying a single-dwelling unit, the appellant argues that the purposes of the single-family occupancy law would be equally served by an ordinance that did not prevent her from sharing her residence with her two sons and their sons.", "\nThis argument misconceives the nature of the constitutional inquiry. ", "In a case such as this one, where the challenged *538 ordinance intrudes upon no substantively protected constitutional right, it is not the Court's business to decide whether its application in a particular case seems inequitable, or even absurd. ", "The question is not whether some other ordinance, drafted more broadly, might have served the city's ends as well or almost as well. ", "The task, rather, is to determine if East Cleveland's ordinance violates the Equal Protection Clause of the United States Constitution. ", "And in performing that task, it must be borne in mind that \"[w]e deal with economic and social legislation where legislatures have historically drawn lines which we respect against the charge of violation of the Equal Protection Clause if the law be `\"reasonable, not arbitrary\"' (quoting Royster Guano Co. v. Virginia, 253 U. S. 412, 415) and bears `a rational relationship to a [permissible] state objective.' ", "Reed v. Reed, 404 U. S. 71, 76.\" ", "Village of Belle Terre v. Boraas, 416 U. S. at 8. \"[", "E]very line drawn by a legislature leaves some out that might well have been included. ", "That exercise of discretion, however, is a legislative, not a judicial, function.\" ", "Ibid. (", "footnote omitted).[8]\nViewed in the light of these principles, I do not think East Cleveland's definition of \"family\" offends the Constitution. ", "The city has undisputed power to ordain single-family residential *539 occupancy. ", "Village of Belle Terre v. Boraas, supra; Euclid v. Ambler Realty Co., 272 U. S. 365. ", "And that power plainly carries with it the power to say what a \"family\" is. ", "Here the city has defined \"family\" to include not only father, mother, and dependent children, but several other close relatives as well. ", "The definition is rationally designed to carry out the legitimate governmental purposes identified in the Belle Terre opinion: \"The police power is not confined to elimination of filth, stench, and unhealthy places. ", "It is ample to lay out zones where family values, youth values, and the blessings of quiet seclusion and clean air make the area a sanctuary for people.\" ", "416 U. S., at 9.[9]\nObviously, East Cleveland might have as easily and perhaps as effectively hit upon a different definition of \"family.\" ", "But a line could hardly be drawn that would not sooner or later become the target of a challenge like the appellant's. ", "If \"family\" included all of the householder's grandchildren there would doubtless be the hard case of an orphaned niece or nephew. ", "If, as the appellant suggests, a \"family\" must include all blood relatives, what of longtime friends? ", "The point is that any definition would produce hardships in some cases without materially advancing the legislative purpose. ", "That this ordinance also does so is no reason to hold it unconstitutional, unless we are to use our power to interpret the United States Constitution as a sort of generalized authority to correct seeming inequity wherever it surfaces. ", "It is not for us to rewrite the ordinance, or substitute our judgment for *540 the discretion of the prosecutor who elected to initiate this litigation.[10]\nIn this connection the variance provisions of East Cleveland's Building Code assume special significance, for they show that the city recognized the difficult problems its ordinances were bound to create in particular cases, and provided a means to solve at least some of them. ", "Section 1311.01 of the Code establishes a Board of Building Code Appeals. ", "Section 1311.02 then provides, in pertinent part:\n\"The Board of Building Code Appeals shall determine all matters properly presented to it and where practical difficulties and unnecessary hardships shall result from the strict compliance with or the enforcement of the provisions of any ordinance for which it is designated as *541 the Board of Appeals, such Board shall have the power to grant variances in harmony with the general intent of such ordinance and to secure the general welfare and substantial justice in the promotion of the public health, comfort, convenience, morals, safety and general welfare of the City.\"", "\nThe appellant did not request a variance under this section, although she could have done so. ", "While it is impossible to know whether such a request would have been granted, her situation appears to present precisely the kind of \"practical difficulties\" and \"unnecessary hardships\" that the variance provisions were designed to accommodate.", "\nThis is not to say that the appellant was obligated to exhaust her administrative remedy before defending this prosecution on the ground that the single-family occupancy ordinance violates the Equal Protection Clause. ", "In assessing her claim that the ordinance is \"arbitrary\" and \"irrational,\" however, I think the existence of the variance provisions is particularly persuasive evidence to the contrary. ", "The variance procedure, a traditional part of American land-use law, bends the straight lines of East Cleveland's ordinances, shaping their contours to respond more flexibly to the hard cases that are the inevitable byproduct of legislative linedrawing.", "\nFor these reasons, I think the Ohio courts did not err in rejecting the appellant's constitutional claims. ", "Accordingly, I respectfully dissent.", "\nMR. ", "JUSTICE WHITE, dissenting.", "\nThe Fourteenth Amendment forbids any State to \"deprive any person of life, liberty, or property, without due process of law,\" or to \"deny to any person within its jurisdiction the equal protection of the laws.\" ", "Both provisions are invoked in this case in an attempt to invalidate a city zoning ordinance.", "\n\n\n*542 I\nThe emphasis of the Due Process Clause is on \"process.\" ", "As Mr. Justice Harlan once observed, it has been \"ably and insistently argued in response to what were felt to be abuses by this Court of its reviewing power,\" that the Due Process Clause should be limited \"to a guarantee of procedural fairness.\" ", "Poe v. Ullman, 367 U. S. 497, 540 (1961) (dissenting opinion). ", "These arguments had seemed \"persuasive\" to Justice Brandeis and Holmes, Whitney v. California, 274 U. S. 357, 373 (1927), but they recognized that the Due Process Clause, by virtue of case-to-case \"judicial inclusion and exclusion,\" Davidson v. New Orleans, 96 U. S. 97, 104 (1878), had been construed to proscribe matters of substance, as well as inadequate procedures, and to protect from invasion by the States \" all fundamental rights comprised within the term liberty.\" ", "Whitney v. California, supra, at 373.", "\nMr. Justice Black also recognized that the Fourteenth Amendment had substantive as well as procedural content. ", "But believing that its reach should not extend beyond the specific provisions of the Bill of Rights, see Adamson v. California, 332 U. S. 46, 68 (1947) (dissenting opinion), he never embraced the idea that the Due Process Clause empowered the courts to strike down merely unreasonable or arbitrary legislation, nor did he accept Mr. Justice Harlan's consistent view. ", "See Griswold v. Connecticut, 381 U. S. 479, 507 (1965) (Black, J., dissenting), and id., at 499 (Harlan, J., concurring in judgment). ", "Writing at length in dissent in Poe v. Ullman, supra, at 543, Mr. Justice Harlan stated the essence of his position as follows:\n\"This `liberty' is not a series of isolated points pricked out in terms of the taking of property; the freedom of speech, press, and religion; the right to keep and bear arms; the freedom from unreasonable searches and seizures; *543 and so on. ", "It is a rational continuum which, broadly speaking, includes a freedom from all substantial arbitrary impositions and purposeless restraints, see Allgeyer v. Louisiana, 165 U. S. 578; Holden v. Hardy, 169 U. S. 366; Booth v. Illinois, 184 U. S. 425; Nebbia v. New York, 291 U. S. 502; Skinner v. Oklahoma, 316 U. S. 535, 544 (concurring opinion); Schware v. Board of Bar Examiners, 353 U. S. 232, and which also recognizes, what a reasonable and sensitive judgment must, that certain interests require particularly careful scrutiny of the state needs asserted to justify their abridgment. ", "Cf. ", "Skinner v. Oklahoma, supra; Bolling v. Sharpe, [347 U. S. 497 (1954)].\"", "\nThis construction was far too open ended for Mr. Justice Black. ", "For him, Meyer v. Nebraska, 262 U. S. 390 (1923), and Pierce v. Society of Sisters, 268 U. S. 510 (1925), as substantive due process cases, were as suspect as Lochner v. New York, 198 U. S. 45 (1905), Coppage v. Kansas, 236 U. S. 1 (1915), and Adkins v. Children's Hospital, 261 U. S. 525 (1923). ", "In his view, Ferguson v. Skrupa, 372 U. S. 726 (1963), should have finally disposed of them all. ", "But neither Meyer nor Pierce has been overruled, and recently there have been decisions of the same genre—Roe v. Wade, 410 U. S. 113 (1973); Loving v. Virginia, 388 U. S. 1 (1967); Griswold v. Connecticut, supra; and Eisenstadt v. Baird, 405 U. S. 438 (1972). ", "Not all of these decisions purport to rest on substantive due process grounds, compare Roe v. Wade, Supra, at 152-153, with Eisenstadt v. Baird, supra, at 453-454, but all represented substantial reinterpretations of the Constitution.", "\nAlthough the Court regularly proceeds on the assumption that the Due Process Clause has more than a procedural dimension, we must always bear in mind that the substantive content of the Clause is suggested neither by its language nor by preconstitutional history; that content is nothing more than the accumulated product of judicial interpretation of *544 the Fifth and Fourteenth Amendments. ", "This is not to suggest, at this point, that any of these cases should be overruled, or that the process by which they were decided was illegitimate or even unacceptable, but only to underline Mr. Justice Black's constant reminder to his colleagues that the Court has no license to invalidate legislation which it thinks merely arbitrary or unreasonable. ", "And no one was more sensitive than Mr. Justice Harlan to any suggestion that his approach to the Due Process Clause would lead to judges \"roaming at large in the constitutional field.\" ", "Griswold v. Connecticut, supra, at 502. ", "No one proceeded with more caution than he did when the validity of state or federal legislation was challenged in the name of the Due Process Clause.", "\nThis is surely the preferred approach. ", "That the Court has ample precedent for the creation of new constitutional rights should not lead it to repeat the process at will. ", "The Judiciary, including this Court, is the most vulnerable and comes nearest to illegitimacy when it deals with judge-made constitutional law having little or no cognizable roots in the language or even the design of the Constitution. ", "Realizing that the present construction of the Due Process Clause represents a major judicial gloss on its terms, as well as on the anticipation of the Framers, and that much of the underpinning for the broad, substantive application of the Clause disappeared in the conflict between the Executive and the Judiciary in the 1930's and 1940's, the Court should be extremely reluctant to breathe still further substantive content into the Due Process clause so as to strike down legislation adopted by a State or city to promote its welfare. ", "Whenever the Judiciary does so, it unavoidably pre-empts for itself another part of the governance of the country without express constitutional authority.", "\n\nII\nAccepting the cases as they are and the Due Process Clause as construed by them, however, I think it evident that the *545 threshold question in any due process attack on legislation, whether the challenge is procedural or substantive, is whether there is a deprivation of life, liberty, or property. ", "With respect to \"liberty,\" the statement of Mr. Justice Harlan in Poe v. Ullman, quoted supra, at 504, most accurately reflects the thrust of prior decisions—that the Due Process Clause is triggered by a variety of interests, some much more important than others. ", "These interests have included a wide range of freedoms in the purely commercial area such as the freedom to contract and the right to set one's own prices and wages. ", "Meyer v. Nebraska, supra, at 399, took a characteristically broad view of \"liberty\":\n\"While this Court has not attempted to define with exactness the liberty thus guaranteed, the term has received much consideration and some of the included things have been definitely stated. ", "Without doubt, it denotes not merely freedom from bodily restraint but also the right of the individual to contract, to engage in any of the common occupations of life, to acquire useful knowledge, to marry, establish a home and bring up children, to worship God according to the dictates of his own conscience, and generally to enjoy those privileges long recognized at common law as essential to the orderly pursuit of happiness by free men.\"", "\nAs I have said, Meyer has not been overruled nor its definition of liberty rejected. ", "The results reached in some of the cases cited by Meyer have been discarded or undermined by later cases, but those cases did not cut back the definition of liberty espoused by earlier decisions. ", "They disagreed only, but sharply, as to the protection that was \"due\" the particular liberty interests involved. ", "See, for example, West Coast Hotel Co. v. Parish, 300 U. S. 379 (1937), overruling Adkins v. Children's Hospital, 261 U. S. 525 (1923).", "\nJust a few years ago, we recognized that while \"the range of interests protected by procedural due process is not infinite,\" *546 and while we must look to the nature of the interest rather than its weight in determining whether a protected interest is at issue, the term \"liberty\" has been given broad meaning in our cases. ", "Board of Regents v. Roth, 408 U. S. 564, 570-571 (1972). \"", "In a Constitution for a free people, there can be no doubt that the meaning of `liberty' must be broad indeed. ", "See, e. g., Bolling v. Sharpe, 347 U. S. 497, 499-500; Stanley v. Illinois, 405 U. S. 645.\" ", "Id., at 572.", "\nIt would not be consistent with prior cases to restrict the liberties protected by the Due Process Clause to those fundamental interests \"implicit in the concept of ordered liberty.\" ", "Ante, at 537. ", "Palko v. Connecticut, 302 U. S. 319 (1937), from which this much-quoted phrase is taken, id., at 325, is not to the contrary. ", "Palko was a criminal case, and the issue was thus not whether a protected liberty interest was at stake but what protective process was \"due\" that interest. ", "The Court used the quoted standard to determine which of the protections of the Bill of Rights was due a criminal defendant in a state court within the meaning of the Fourteenth Amendment. ", "Nor do I think the broader view of \"liberty\" is inconsistent with or foreclosed by the dicta in Roe v. Wade, 410 U. S., at 152, and Paul v. Davis, 424 U. S. 693, 713 (1976). ", "These cases at most assert that only fundamental liberties will be given substantive protection; and they may be understood as merely identifying certain fundamental interests that the Court has deemed deserving of a heightened degree of protection under the Due Process Clause.", "\nIt seems to me that Mr. Justice Douglas was closest to the mark in Poe v. Ullman, 367 U. S., at 517, when he said that the trouble with the holdings of the \"old Court\" was not in its definition of liberty but in its definition of the protections guaranteed to that liberty—\"not in entertaining inquiries concerning the constitutionality of social legislation but in applying the standards that it did.\"", "\n*547 The term \"liberty\" is not, therefore, to be given a crabbed construction. ", "I have no more difficulty than MR. ", "JUSTICE POWELL apparently does in concluding that appellant in this case properly asserts a liberty interest within the meaning of the Due Process Clause. ", "The question is not one of liberty vel non. ", "Rather, there being no procedural issue at stake, the issue is whether the precise interest involved— the interest in having more than one set of grandchildren live in her home—is entitled to such substantive protection under the Due Process Clause that this ordinance must be held invalid.", "\n\nIII\nLooking at the doctrine of \"substantive\" due process as having to do with the possible invalidity of an official rule of conduct rather than of the procedures for enforcing that rule, I see the doctrine as taking several forms under the cases, each differing in the severity of review and the degree of protection offered to the individual. ", "First, a court may merely assure itself that there is in fact a duly enacted law which proscribes the conduct sought to be prevented or sanctioned. ", "In criminal cases, this approach is exemplified by the refusal of courts to enforce vague statutes that no reasonable person could understand as forbidding the challenged conduct. ", "There is no such problem here.", "\nSecond is the general principle that \"liberty may not be interfered with, under the guise of protecting the public interest, by legislative action which is arbitrary or without reasonable relation to some purpose within the competency of the State to effect.\" ", "Meyer v. Nebraska, 262 U. S., at 399-400. ", "This means-end test appears to require that any statute restrictive of liberty have an ascertainable purpose and represent a rational means to achieve that purpose, whatever the nature of the liberty interest involved. ", "This approach was part of the substantive due process doctrine *548 prevalent earlier in the century, and it made serious inroads on the presumption of constitutionality supposedly accorded to state and federal legislation. ", "But with Nebbia v. New York, 291 U. S. 502 (1934), and other cases of the 1930's and 1940's such as West Coast Hotel Co. v. Parish, supra, the courts came to demand far less from and to accord far more deference to legislative judgments. ", "This was particularly true with respect to legislation seeking to control or regulate the economic life of the State or Nation. ", "Even so, \"while the legislative judgment on economic and business matters is `well-nigh conclusive' . . . , ", "it is not beyond judicial inquiry.\" ", "Poe v. Ullman, supra, at 518 (Douglas, J., dissenting). ", "No case that I know of, including Ferguson v. Skrupa, 372 U. S. 726 (1963), has announced that there is some legislation with respect to which there no longer exists a means ends test as a matter of substantive due process law. ", "This is not surprising, for otherwise a protected liberty could be infringed by a law having no purpose or utility whatsoever. ", "Of course, the current approach is to deal more gingerly with a state statute and to insist that the challenger bear the burden of demonstrating its unconstitutionality; and there is a broad category of cases in which substantive review is indeed mild and very similar to the original thought of Munn v. Illinois, 94 U. S. 113, 132 (1877), that \"if a state of facts could exist that would justify such legislation,\" it passes its initial test.", "\nThere are various \"liberties,\" however, which require that infringing legislation be given closer judicial scrutiny, not only with respect to existence of a purpose and the means employed, but also with respect to the importance of the purpose itself relative to the invaded interest. ", "Some interests would appear almost impregnable to invasion, such as the freedoms of speech, press, and religion, and the freedom from cruel and unusual punishments. ", "Other interests, for example, the right of association, the right to vote, and various *549 claims sometimes referred to under the general rubric of the right to privacy, also weigh very heavily against state claims of authority to regulate. ", "It is this category of interests which, as I understand it, MR. ", "JUSTICE STEWART refers to as \" `implicit in the concept of ordered liberty.' \" ", "Ante, at 537. ", "Because he would confine the reach of substantive due process protection to interests such as these and because he would not classify in this category the asserted right to share a house with the relatives involved here, he rejects the due process claim.", "\nGiven his premise, he is surely correct. ", "Under our cases, the Due Process Clause extends substantial protection to various phases of family life, but none requires that the claim made here be sustained. ", "I cannot believe that the interest in residing with more than one set of grandchildren is one that calls for any kind of heightened protection under the Due Process Clause. ", "To say that one has a personal right to live with all, rather than some, of one's grandchildren and that this right is implicit in ordered liberty is, as my Brother STEWART says, \"to extend the limited substantive contours of the Due Process Clause beyond recognition.\" ", "Ibid. ", "The present claim is hardly one of which it could be said that \"neither liberty nor justice would exist if [it] were sacrificed.\" ", "Palko v. Connecticut, 302 U. S., at 326.", "\nMR. ", "JUSTICE POWELL would apparently construe the Due Process Clause to protect from all but quite important state regulatory interests any right or privilege that in his estimate is deeply rooted in the country's traditions. ", "For me, this suggests a far too expansive charter for this Court and a far less meaningful and less confining guiding principle than MR. ", "JUSTICE STEWART would use for serious substantive due process review. ", "What the deeply rooted traditions of the country are is arguable; which of them deserve the protection of the Due Process Clause is even more debatable. ", "The suggested view would broaden enormously the horizons of *550 the Clause; and, if the interest involved here is any measure of what the States would be forbidden to regulate, the courts would be substantively weighing and very likely invalidating a wide range of measures that Congress and state legislatures think appropriate to respond to a changing economic and social order.", "\nMrs. Moore's interest in having the offspring of more than one dependent son live with her qualifies as a liberty protected by the Due Process Clause; but, because of the nature of that particular interest, the demands of the Clause are satisfied once the Court is assured that the challenged proscription is the product of a duly enacted or promulgated statute, ordinance, or regulation and that it is not wholly lacking in purpose or utility. ", "That under this ordinance any number of unmarried children may reside with their mother and that this number might be as destructive of neighborhood values as one or more additional grandchildren is just another argument that children and grandchildren may not constitutionally be distinguished by a local zoning ordinance.", "\nThat argument remains unpersuasive to me. ", "Here the head of the household may house himself or herself and spouse, their parents, and any number of their unmarried children. ", "A fourth generation may be represented by only one set of grandchildren and then only if born to a dependent child. ", "The ordinance challenged by appellant prevents her from living with both sets of grandchildren only in East Cleveland, an area with a radius of three miles and a population of 40,000. ", "Brief for Appellee 16 n.1. ", "The ordinance thus denies appellant the opportunity to live with all her grandchildren in this particular suburb; she is free to do so in other parts of the Cleveland metropolitan area. ", "If there is power to maintain the character of a single-family neighborhood, as there surely is, some limit must be placed on the reach of the \"family.\" ", "Had it been our task to legislate, we *551 might have approached the problem in a different manner than did the drafters of this ordinance; but I have no trouble in concluding that the normal goals of zoning regulation are present here and that the ordinance serves these goals by limiting, in identifiable circumstances, the number of people who can occupy a single household. ", "The ordinance does not violate the Due Process Clause.", "\n\nIV\nFor very similar reasons, the equal protection claim must fail, since it is not to be judged by the strict scrutiny standard employed when a fundamental interest or suspect classification is involved, see, e. g., Dunn v. Blumstein, 405 U. S. 330 (1972), and Korematsu v. United States, 323 U. S. 214 (1944), or by the somewhat less strict standard of Craig v. Boren, 429 U. S. 190 (1976), Califano v. Webster, 430 U. S. 313 (1977), Reed v. Reed, 404 U. S. 71 (1971), and Royster Guano Co. v. Virginia, 253 U. S. 412, 415 (1920). ", "Rather, it is the generally applicable standard of McGowan v. Maryland, 366 U. S. 420, 425 (1961):\n\"The constitutional safeguard [of the Equal Protection Clause] is offended only if the classification rests on grounds wholly irrelevant to the achievement of the State's objective. ", "State legislatures are presumed to have acted within their constitutional power despite the fact that, in practice, their laws result in some inequality. ", "A statutory discrimination will not be set aside if any state of facts reasonably may be conceived to justify it.\"", "\nSee also Dandridge v. Williams, 397 U. S. 471 (1970); Massachusetts Bd. ", "of Retirement v. Murgia, 427 U. S. 307 (1976). ", "Under this standard, it is not fatal if the purpose of the law is not articulated on its face, and there need be only a rational relation to the ascertained purpose.", "\n*552 On this basis, as already indicated, I have no trouble in discerning a rational justification for an ordinance that permits the head of a household to house one, but not two, dependent sons and their children.", "\nRespectfully, therefore, I dissent and would affirm the judgment.", "\nNOTES\n[*] Melvin L. Wulf and Benjamin Sheerer filed a brief for the American Civil Liberties Union et al. ", "as amici curiae.", "\n[1] All citations by section number refer to the Housing Code of the city of East Cleveland, Ohio.", "\n[2] Section 1341.08 (1966) provides:\n\n\" `Family' means a number of individuals related to the nominal head of the household or to the spouse of the nominal head of the household living as a single housekeeping unit in a single dwelling unit, but limited to the following:\n\"(a) Husband or wife of the nominal head of the household.", "\n\"(b) Unmarried children of the nominal head of the household or of the spouse of the nominal head of the household, provided, however, that such unmarried children have no children residing with them.", "\n\"(c) Father or mother of the nominal head of the household or of the spouse of the nominal head of the household.", "\n\"(d) Notwithstanding the provisions of subsection (b) hereof, a family may include not more than one dependent married or unmarried child of the nominal head of the household or of the spouse of the nominal head of the household and the spouse and dependent children of such dependent child. ", "For the purpose of this subsection, a dependent person is one who has more than fifty percent of his total support furnished for him by the nominal head of the household and the spouse of the nominal head of the household.", "\n\"(e) A family may consist of one individual.\"", "\n[3] Appellant also claims that the ordinance contravenes the Equal Protection Clause, but it is not necessary for us to reach that contention.", "\n[4] Brief for Appellant 4, 25. ", "John's father, John Moore, Sr., ", "has apparently been living with the family at least since the time of trial. ", "Whether he was living there when the citation was issued is in dispute. ", "Under the ordinance his presence too probably would be a violation. ", "But we take the case as the city has framed it. ", "The citation that led to prosecution recited only that John Moore, Jr., was in the home in violation of the ordinance.", "\n[5] The dissenting opinion of THE CHIEF JUSTICE suggests that Mrs. Moore should be denied a hearing in this Court because she failed to seek discretionary administrative relief in the form of a variance, relief that is no longer available. ", "There are sound reasons for requiring exhaustion of administrative remedies in some situations, but such a requirement is wholly inappropriate where the party is a criminal defendant in circumstances like those present here. ", "See generally McKart v. United States, 395 U. S. 185 (1969). ", "Mrs. Moore defends against the State's prosecution on the ground that the ordinance is facially invalid, an issue that the zoning review board lacks competency to resolve. ", "In any event, this Court has never held that a general principle of exhaustion could foreclose a criminal defendant from asserting constitutional invalidity of the statute under which she is being prosecuted. ", "See, e. g., Yakus v. United States, 321 U. S. 414, 446-447 (1944).", "\n\nMoreover, those cases that have denied certain nonconstitutional defenses to criminal defendants for failure to exhaust remedies did so pursuant to statutes that implicitly or explicitly mandated such a holding. ", "See, e. g., Falbo v. United States, 320 U. S. 549 (1944); Yakus v. United States, supra; McGee v. United States, 402 U. S. 479 (1971). ", "Because of the statutes the defendants were on notice that failure to pursue available administrative relief might result in forfeiture of a defense in an enforcement proceeding. ", "But here no Ohio statute or ordinance required exhaustion or gave Mrs. Moore any such warning. ", "Indeed, the Ohio courts entertained all her claims, perceiving no denigration of state administrative process in according full judicial review.", "\n[6] Euclid held that land-use regulations violate the Due Process Clause if they are \"clearly arbitrary and unreasonable, having no substantial relation to the public health, safety, morals, or general welfare.\" ", "272 U. S., at 395. ", "See Nectow v. Cambridge, 277 U. S. 183, 188 (1928). ", "Later cases have emphasized that the general welfare is not to be narrowly understood; it embraces a broad range of governmental purposes. ", "See Berman v. Parker, 348 U. S. 26 (1954). ", "But our cases have not departed from the requirement that the government's chosen means must rationally further some legitimate state purpose.", "\n[7] It is significant that East Cleveland has another ordinance specifically addressed to the problem of overcrowding. ", "See United States Dept. ", "of Agriculture v. Moreno, 413 U. S. 528, 536-537 (1973). ", "Section 1351.03 limits population density directly, tying the maximum permissible occupancy of a dwelling to the habitable floor area. ", "Even if John, Jr., and his father both remain in Mrs. Moore's household, the family stays well within these limits.", "\n[8] This explains why Meyer and Pierce have survived and enjoyed frequent reaffirmance, while other substantive due process cases of the same era have been repudiated—including a number written, as were Meyer and Pierce, by Mr. Justice McReynolds.", "\n[9] Lochner v. New York, 198 U. S. 45 (1905). ", "See North Dakota Pharmacy Bd. ", "v. Snyder's Drug Stores, Inc., 414 U. S. 156, 164-167 (1973); Griswold v. Connecticut, 381 U. S. 479, 514-527 (1965) (Black, J., dissenting); Ferguson v. Skrupa, 372 U. S. 726 (1963); Baldwin v. Missouri, 281 U. S. 586, 595 (1930) (Holmes, J., dissenting); G. Gunther, Cases and Materials on Constitutional Law 550-596 (9th ed. ", "1975).", "\n[10] A similar restraint marks our approach to the questions whether an asserted substantive right is entitled to heightened solicitude under the Equal Protection Clause because it is \"explicitly or implicitly guaranteed by the Constitution,\" San Antonio Independent School Dist. ", "v. Rodriguez, 411 U. S. 1, 33-34 (1973), and whether or to what extent a guarantee in the Bill of Rights should be \"incorporated\" in the Due Process Clause because it is \"necessary to an Anglo-American regime of ordered liberty.\" ", "Duncan v. Louisiana, 391 U. S. 145, 149-150, n. 14 (1968); see Johnson v. Louisiana, 406 U. S. 356, 372 n. 9 (1972) (opinion of POWELL, J.).", "\n[11] For a recent suggestion that the holding in Griswold is best understood in this fashion, see Pollak, Comment, 84 Yale L. J. 638, 650-653 (1975). \"[", "I]n due course we will see Griswold as a reaffirmation of the Court's continuing obligation to test the justifications offered by the state for state-imposed constraints which significantly hamper those modes of individual fulfillment which are at the heart of a free society.\" ", "Id., at 653.", "\n[12] In Wisconsin v. Yoder, 406 U. S. 205 (1972), the Court rested its holding in part on the constitutional right of parents to assume the primary role in decisions concerning the rearing of their children. ", "That right is recognized because it reflects a \"strong tradition\" founded on \"the history and culture of Western civilization,\" and because the parental role \"is now established beyond debate as an enduring American tradition.\" ", "Id., at 232. ", "In Ginsberg v. New York, 390 U. S. 629 (1968), the Court spoke of the same right as \"basic in the structure of our society.\" ", "Id., at 639. ", "Griswold v. Connecticut, supra, struck down Connecticut's anti contraception statute. ", "Three concurring Justices, relying on both the Ninth and Fourteenth Amendments, emphasized that \"the traditional relation of the family\" is \"a relation as old and as fundamental as our entire civilization.\" ", "381 U. S., at 496 (Goldberg, J., joined by Warren, C. J., and BRENNAN, J., concurring). ", "Speaking of the same statute as that involved in Griswold, Mr. Justice Harlan wrote, dissenting in Poe v. Ullman, 367 U. S. 497, 551-552 (1961): \"[H]ere we have not an intrusion into the home so much as on the life which characteristically has its place in the home. . . . ", "The home derives its pre-eminence as the seat of family life. ", "And the integrity of that life is something so fundamental that it has been found to draw to its protection the principles of more than one explicitly granted Constitutional right.\"", "\n\nAlthough he agrees that the Due Process Clause has substantive content, MR. ", "JUSTICE WHITE in dissent expresses the fear that our recourse to history and tradition will \"broaden enormously the horizons of the Clause.\" ", "Post, at 549-550. ", "To the contrary, an approach grounded in history imposes limits on the judiciary that are more meaningful than any based on the abstract formula taken from Palko v. Connecticut, 302 U. S. 319 (1937), and apparently suggested as an alternative. ", "Cf. ", "Duncan v. Louisiana, supra, at 149-150, n. 14 (rejecting the Palko formula as the basis for deciding what procedural protections are required of a State, in favor of a historical approach based on the Anglo-American legal tradition). ", "Indeed, the passage cited in MR. ", "JUSTICE WHITE'S dissent as \"most accurately reflect[ing] the thrust of prior decisions\" on substantive due process, post, at 545, expressly points to history and tradition as the source for \"supplying. . . ", "content to this Constitutional concept.\" ", "Poe v. Ullman, supra, at 542 (Harlan, J., dissenting).", "\n[13] See generally Wilkinson & White, Constitutional Protection for Personal Lifestyles, 62 Cornell L. Rev. 563, 623-624 (1977).", "\n[14] See generally B. Yorburg, The Changing Family (1973); Bronfenbrenner, The Calamitous Decline of the American Family, Washington Post, Jan. 2, 1977, p. C1. ", "Recent census reports bear out the importance of family patterns other than the prototypical nuclear family. ", "In 1970, 26.5% of all families contained one or more members over 18 years of age, other than the head of household and spouse. ", "U. S. Department of Commerce, 1970 Census of Population, vol. ", "1, pt. ", "1, Table 208. ", "In 1960 the comparable figure was 26.1%. ", "U. S. Department of Commerce, 1960 Census of Population, vol. ", "1, pt. ", "1, Table 187. ", "Earlier data are not available.", "\n[15] Cf. ", "Prince v. Massachusetts, 321 U. S. 158 (1944), which spoke broadly of family authority as against the State, in a case where the child was being reared by her aunt, not her natural parents.", "\n[16] We are told that the mother of John Moore, Jr., died when he was less than one year old. ", "He, like uncounted others who have suffered a similar tragedy, then came to live with the grandmother to provide the infant with a substitute for his mother's care and to establish a more normal home environment. ", "Brief for Appellant 25.", "\n[1] This is a criminal prosecution which resulted in the grandmother's conviction and sentence to prison and a fine. ", "Section 1345.99 permits imprisonment of up to six months, and a fine of up to $1,000, for violation of any provision of the Housing Code. ", "Each day such violation continues may, by the terms of this section, constitute a separate offense.", "\n[2] Brief for Appellant 4. ", "In addition, we were informed by appellant's counsel at oral argument that\n\n\"application of this ordinance here would not only sever and disrupt the relationship between Mrs. Moore and her own son, but it would disrupt the relationship that is established between young John and young Dale, which is in essence a sibling type relationship, and it would most importantly disrupt the relationship between young John and his grandmother, which is the only maternal influence that he has had during his entire life.\" ", "Tr. ", "of Oral Arg. ", "16.", "\nThe city did not dispute these representations, and it is clear that this case was argued from the outset as requiring decision in this context.", "\n[3] The East Cleveland ordinance defines \"family\" to include, in addition to the spouse of the \"nominal head of the household,\" the couple's childless unmarried children, but only one dependent child (married or unmarried) having dependent children, and one parent of the nominal head of the household or of his or her spouse. ", "Thus an \"extended family\" is authorized in only the most limited sense, and \"family\" is essentially confined to parents and their own children. ", "Appellant grandmother was charged with violating the ordinance because John, Jr., lived with her at the same time her other grandson, Dale, Jr., was also living in the home; the latter is classified as an \"unlicensed roomer\" authorized by the ordinance to live in the house.", "\n[4] See Report of the National Advisory Commission on Civil Disorders 278-281 (1968); Kosa & Nash, Social Ascent of Catholics, 8 Social Order 98-103 (1958); M. Novak, The Rise of the Unmeltable Ethnics 209-210 (1972); B. Yorburg, The Changing Family 106-109 (1973); Kosa, Rachiele, & Schommer, Sharing the Home with Relatives, 22 Marriage and Family Living 129 (1960).", "\n[5] See, e. g., H. Gans, The Urban Villagers 45-73, 245-249 (1962).", "\n\n\"Perhaps the most important—or at least the most visible—difference between the classes is one of family structure. ", "The working class subculture is distinguished by the dominant role of the family circle. . . .", "\n\"The specific characteristics of the family circle may differ widely— from the collateral peer group form of the West Enders, to the hierarchical type of the Irish, or to the classical three-generation extended family. . . . ", "What matters most—and distinguishes this subculture from others—is that there be a family circle which is wider than the nuclear family, and that all of the opportunities, temptations, and pressures of the larger society be evaluated in terms of how they affect the ongoing way of life that has been built around this circle.\" ", "Id., at 244-245 (emphasis in original).", "\n[6] Yorburg, supra, n. 4, at 108. \"", "Within the black lower-class it has been quite common for several generations, or parts of the kin, to live together under one roof. ", "Often a maternal grandmother is the acknowledged head of this type of household which has given rise to the term `matrifocal' to describe lower-class black family patterns.\" ", "See J. Scanzoni, The Black Family in Modern Society 134 (1971); see also Anderson, The Pains and Pleasures of Old Black Folks, Ebony 123, 128-130 (Mar. 1973). ", "See generally E. Frazier, The Negro Family in the United States (1939); Lewis, The Changing Negro Family, in E. Ginzberg, ed., ", "The Nation's Children 108 (1960).", "\n\nThe extended family often plays an important role in the rearing of young black children whose parents must work. ", "Many such children frequently \"spend all of their growing-up years in the care of extended kin. . . . ", "Often children are `given' to their grandparents, who rear them to adulthood. . . . ", "Many children normally grow up in a three-generation household and they absorb the influences of grandmother and grandfather as well as mother and father.\" ", "J. Ladner, Tomorrow's Tomorrow: The Black Woman 60 (1972).", "\n[7] The extended family has many strengths not shared by the nuclear family.", "\n\n\"The case histories behind mounting rates of delinquency, addiction, crime, neurotic disabilities, mental illness, and senility in societies in which autonomous nuclear families prevail suggest that frequent failure to develop enduring family ties is a serious inadequacy for both individuals and societies.\" ", "D. Blitsten, The World of the Family 256 (1963).", "\nExtended families provide services and emotional support not always found in the nuclear family:\n\"The troubles of the nuclear family in industrial societies, generally, and in American society, particularly, stem largely from the inability of this type of family structure to provide certain of the services performed in the past by the extended family. ", "Adequate health, education, and welfare provision, particularly for the two nonproductive generations in modern societies, the young and the old, is increasingly an insurmountable problem for the nuclear family. ", "The unrelieved and sometimes unbearably intense parent-child relationship, where childrearing is not shared at least in part by others, and the loneliness of nuclear family units, increasingly turned in on themselves in contracted and relatively isolated settings, is another major problem.\" ", "Yorburg, supra, n. 4, at 194.", "\n[8] R. Hill, The Strengths of Black Families 5 (1972).", "\n[9] Id., at 5-6. ", "It is estimated that at least 26% of black children live in other than husband-wife families, \"including foster parents, the presence of other male or female relatives (grandfather or grandmother, older brother or sister, uncle or aunt), male or female nonrelatives, [or with] only one adult (usually mother) present . . . .\" ", "Scanzoni, supra, n. 6, at 44.", "\n[10] Novak, supra, n. 4; Hill, supra, at 5-6; N. Glazer & D. Moynihan, Beyond the Melting Pot 50-53 (2d ed. ", "1970); L. Rainwater & W. Yancey, The Moynihan Report and the Politics of Controversy 51-60 (1967).", "\n[1] The Court cited Zahn v. Board of Public Works, 274 U. S. 325. ", "The statement of the rule in Zahn remains viable today:\n\n\"The most that can be said [of this zoning ordinance] is that whether that determination was an unreasonable, arbitrary or unequal exercise of power is fairly debatable. ", "In such circumstances, the settled rule of this court is that it will not substitute its judgment for that of the legislative body charged with the primary duty and responsibility of determining the question.\" ", "Id., at 328.", "\n[2] Goldblatt v. Town of Hempstead, 369 U. S. 590.", "\n[3] See, for example, the various provisions quoted or paraphrased in Brady v. Superior Court, 200 Cal. ", "App. ", "2d 69, 80-81, n. 3, 19 Cal. ", "Rptr. ", "242, 249 n. 3 (1962).", "\n[4] As this Court recognized in Euclid, even residential apartments can have a negative impact on an area of single-family homes.", "\n\n\"[O]ften the apartment house is a mere parasite, constructed in order to take advantage of the open spaces and attractive surroundings created by [a single-family dwelling area] . . . . [", "T]he coming of one apartment house is followed by others, interfering by their height and bulk with the free circulation of air and monopolizing the rays of the sun which otherwise would fall upon the smaller homes, and bringing, as their necessary accompaniments, the disturbing noises incident to increased traffic and business, and the occupation, by means of moving and parked automobiles, of larger portions of the streets, thus detracting from their safety and depriving children of the privilege of quiet and open spaces for play, enjoyed by those in more favored localities,—until, finally, the residential character of the neighborhood and its desirability as a place of detached residences are utterly destroyed. ", "Under these circumstances, apartment houses, which in a different environment would be not only entirely unobjectionable but highly desirable, come very near to being nuisances.\" ", "272 U. S., at 394-395.", "\n[5] Limiting use to single-housekeeping units, like limitations on the number of occupants, protects the community's interest in minimizing overcrowding, avoiding the excessive use of municipal services, traffic control, and other aspects of an attractive physical environment. ", "See Village of Belle Terre v. Boraas, 416 U. S. 1, 9.", "\n[6] See nn. ", "4 and 5, supra, and also Professor N. Williams' discussion of the subject in his excellent treatise on zoning law, 2 American Land Planning Law 349-361 (1974).", "\n[7] Types of group living which have not fared well under single-family ordinances include fraternities, Schenectady v. Alumni Assn., ", "5 App. ", "Div. ", "2d 14, 168 N. Y. S. 2d 754 (1957); sororities, Cassidy v. Triebel, 337 Ill. App. ", "117, 85 N. E. 2d 461 (1948); a retirement home designed for over 20 people, Kellog v. Joint Council of Women's Auxiliaries Welfare Assn., ", "265 S. W. 2d 374 (Mo. 1954); and a commercial therapeutic home for emotionally disturbed children, Browndale International v. Board of Adjustment, 60 Wis. 2d 182, 208 N. W. 2d 121 (1973). ", "These institutional uses are not only inconsistent with the single-housekeeping-unit concept but include many more people than would normally inhabit a single-family dwelling.", "\n[8] In City of Des Plaines v. Trottner, 34 Ill. 2d 432, 216 N. E, 2d 116 (1966), the Illinois Supreme Court faced a challenge to a single-family zoning ordinance by a group of four unrelated young men who occupied a dwelling in violation of the ordinance which provided that a \" `family' consists of one or more persons each related to the other by blood (or adoption or marriage) . . . .\" ", "Id., at 433, 216 N. E. 2d, at 117. ", "In his opinion for the court, Justice Schaefer wrote:\n\n\"When other courts have been called upon to define the term `family' they have emphasized the single housekeeping unit aspect of the term, rather than the relationship of the occupants. [", "Citing cases.]", "\n.....\n\"In terms of permissible zoning objectives, a group of persons bound together only by their common desire to operate a single housekeeping unit, might be thought to have a transient quality that would affect adversely the stability of the neighborhood, and so depreciate the value of other property. ", "An ordinance requiring relationship by blood, marriage or adoption could be regarded as tending to limit the intensity of land use. ", "And it might be considered that a group of unrelated persons would be more likely to generate traffic and parking problems than would an equal number of related persons.", "\n\"But none of these observations reflects a universal truth. ", "Family groups are mobile today, and not all family units are internally stable and well-disciplined. ", "Family groups with two or more cars are not unfamiliar. ", "And so far as intensity of use is concerned, the definition in the present ordinance, with its reference to the `respective spouses' of persons related by blood, marriage or adoption, can hardly be regarded as an effective control upon the size of family units.", "\n\"The General Assembly has not specifically authorized the adoption of zoning ordinances that penetrate so deeply as this one does into the internal composition of a single housekeeping unit. ", "Until it has done so, we are of the opinion that we should not read the general authority that it has delegated to extend so far.\" ", "Id., at 436-438, 216 N. E. 2d, at 119-120.", "\n[9] In White Plains v. Ferraioli, 34 N. Y. 2d 300, 313 N. E. 2d 756 (1974), the Court of Appeals of New York refused to apply an ordinance limiting occupancy of single-family dwellings to related individuals to a \"group home\" licensed by the State to care for abandoned and neglected children. ", "The court wrote:\n\n\"Zoning is intended to control types of housing and living and not the genetic or intimate internal family relations of human beings.", "\n\"Whether a family be organized along ties of blood or formal adoptions, or be a similarly structured group sponsored by the State, as is the group home, should not be consequential in meeting the test of the zoning ordinance. ", "So long as the group home bears the generic character of a family unit as a relatively permanent household, and is not a framework for transients or transient living, it conforms to the purpose of the ordinance . . . .\" ", "Id., at 305-306, 313 N. E. 2d, at 758.", "\n[10] In Kirsch Holding Co. v. Borough of Manasquan, 59 N. J. 241, 252, 281 A. 2d 513, 518 (1971), the Supreme Court of New Jersey reviewed a complex single-family zoning ordinance designed to meet what the court recognized to be a pressing community problem. ", "The community, a seaside resort, had been inundated during recent summers by unruly groups of summer visitors renting seaside cottages. ", "To solve the problems of excessive noise, overcrowding, intoxication, wild parties, and immorality that resulted from these group rentals, the community passed a zoning ordinance which prohibited seasonal rentals of cottages by most groups other than \"families\" related by blood or marriage. ", "The court found that even though the problems were severe, the ordinance \"preclude[d] so many harmless dwelling uses\" that it became \"sweepingly excessive, and therefore legally unreasonable.\" ", "Ibid. ", "The court quoted, id., at 252, 281 A. 2d, at 519, the following language from Gabe Collins Realty, Inc. v. Margate City, 112 N. J. Super. ", "341, 349, 271 A. 2d 430, 434 (1970), in a similar case as \"equally applicable here\":\n\n\"Thus, even in the light of the legitimate concern of the municipality with the undesirable concomitants of group rentals experienced in Margate City, and of the presumption of validity of municipal ordinances, we are satisfied that the remedy here adopted constitutes a sweepingly excessive restriction of property rights as against the problem sought to be dealt with, and in legal contemplation deprives plaintiffs of their property without due process.\"", "\nThe court in Kirsch Holding Co., supra, at 251 n. 6, 281 A. 2d., ", "at 518 n. 6, also quoted with approval the following statement from Marino v. Mayor & Council of Norwood, 77 N. J. Super. ", "587, 594, 187 A. 2d 217, 221 (1963):\n\"Until compelled to do so by a New Jersey precedent squarely in point, this court will not conclude that persons who have economic or other personal reasons for living together as a bona fide single housekeeping unit and who have no other orientation, commit a zoning violation, with possible penal consequences, just because they are not related.\"", "\n[11] A California appellate court in Brady v. Superior Court, 200 Cal. ", "App. ", "2d, at 81, 19 Cal. ", "Rptr., ", "at 250, allowed use of a single-family dwelling by two unrelated students, noting:\n\n\"The erection or construction of a `single family dwelling,' in itself, would imply that any building so constructed would contain a central kitchen, dining room, living room, bedrooms; that is, constitute a single housekeeping unit. ", "Consequently, to qualify as a `single family dwelling' an erected structure need only be used as a single housekeeping unit.\"", "\n[12] The Supreme Court of Connecticut allowed occupancy of a large summer home by four related families because the families did \"not occupy separate quarters within the house, [but used] the lodging, cooking and eating facilities [as] common to all.\" ", "Neptune Park Assn. ", "v. Steinberg, 138 Conn. 357, 360, 84 A. 2d 687, 689 (1951).", "\n[13] The Supreme Court of Wisconsin, noting that \"the letter killeth but the spirit giveth life,\" 2 Corinthians 3:6, held that six priests and two lay brothers constituted a \"family\" and that their use, for purely residential purposes of a single-family dwelling did not violate a single-family zoning ordinance. ", "Missionaries of Our Lady of LaSalette v. Whitefish Bay, 267 Wis. 609, 66 N. W. 2d 627 (1954).", "\n[14] Carroll v. Miami Beach, 198 So. ", "2d 643 (Fla. App. ", "1967); Robertson v. Western Baptist Hospital, 267 S. W. 2d 395 (Ky. App. ", "1954); Women's Kansas City St. Andrew Soc. ", "v. Kansas City, 58 F. 2d 593 (CA8 1932); University Heights v. Cleveland Jewish Orphans' Home, 20 F. 2d 743 (CA6 1927).", "\n[15] Village of Belle Terre v. Boraas, 416 U. S. 1, is consistent with this line of state authority. ", "Chief Judge Breitel in White Plains v. Ferraioli, supra, at 304-305, 313 N. E. 2d, at 758, cogently characterized the Belle Terre decision upholding a single-family ordinance as one primarily concerned with the prevention of transiency in a small, quiet suburban community. ", "He wrote:\n\n\"The group home [in White Plains] is not, for purposes of a zoning ordinance, a temporary living arrangement as would be a group of college students sharing a house and commuting to a nearby school (cf. ", "Village of Belle Terre v. Boraas . . .). ", "Every year or so, different college students would come to take the place of those before them. ", "There would be none of the permanency of community that characterizes a residential neighborhood of private homes.\"", "\n[16] Of course, a community has other legitimate concerns in zoning an area for single-family use including prevention of overcrowding in residences and prevention of traffic congestion. ", "A community which attacks these problems by restricting the composition of a household is using a means not reasonably related to the ends it seeks to achieve. ", "See Des Plaines v. Trottner, 34 Ill. 2d, at 435-436, 216 N. E. 2d, at 118. ", "To prevent overcrowding, a community can certainly place a limit on the number of occupants in a household, either in absolute terms or in relation to the available floor space. ", "Indeed, the city of East Cleveland had on its books an ordinance requiring a minimum amount of floor space per occupant in every dwelling. ", "See Nolden v. East Cleveland City Comm'n, 12 Ohio Misc. ", "205, 232 N. E. 2d 421 (Com. ", "Pl. ", "Ct., ", "Cuyahoga Cty. ", "1966). ", "Similarly, traffic congestion can be reduced by prohibiting on-street parking. ", "To attack these problems through use of a restrictive definition of family is, as one court noted, like \"burn[ing] the house to roast the pig.\" ", "Larson v. Mayor, 99 N. J. Super. ", "365, 374, 240 A. 2d 31, 36 (1968). ", "More narrowly, a limitation on which of the owner's grandchildren may reside with her obviously has no relevance to these problems.", "\n[1] Counsel for appellant candidly admitted at oral argument that \"Mrs. Moore did not seek a variance in this case\" but argued that her failure to do so is constitutionally irrelevant. ", "Tr. ", "of Oral Arg. ", "20. ", "Thus, this was not an unpublicized administrative remedy of which appellant remained unaware until after it became unavailable. ", "Such a case would, of course, present materially different considerations. ", "Cf. ", "Lambert v. California, 355 U. S. 225 (1957).", "\n[2] Exhaustion does not deny or limit litigants' rights to a federal forum \"because state administrative agency determinations do not create res judicata or collateral estoppel effects. ", "The exhaustion of state administrative remedies postpones rather than precludes the assertion of federal jurisdiction.\" ", "Comment, Exhaustion of State Administrative Remedies in Section 1983 Cases, 41 U. Chi. ", "L. Rev. 537, 551 (1974).", "\n[3] This analysis explains those cases in which this Court has allowed persons subject to claimed unconstitutional restrictions on their freedom of expression to challenge that restriction without first applying for a permit which, if granted, would moot their claim. ", "E. g., Hynes v. Mayor of Oradell, 425 U. S. 610 (1976); Shuttlesworth v. Birmingham, 394 U. S. 147 (1969); Staub v. City of Baxley, 355 U. S. 313 (1958). ", "In each instance the permit procedure was itself an unconstitutional infringement on First Amendment rights. ", "Thus, in those cases irreparable injury—the loss or postponement of precious First Amendment rights—was a concomitant of the available administrative procedure.", "\n\nSimilarly explicable are those cases in which challenge is made to the constitutionality of the administrative proceedings themselves. ", "See Freedman v. Maryland, 380 U. S. 51 (1965); Public Utilities Comm'n of California v. United States, 355 U. S. 534, 540 (1958). ", "But see Christian v. New York Dept. ", "of Labor, 414 U. S. 614, 622 (1974), where appellants' constitutional due process challenge to administrative procedures was deferred pending agency action. ", "Exhaustion in those situations would similarly risk infringement of a constitutional right by the administrative process itself.", "\n[4] To be adequate for exhaustion purposes, an administrative remedy need not guarantee the litigant success on the merits in advance. ", "What is required is a forum with the power to grant relief, capable of hearing the case with objectivity and dispatch. ", "There is no reason to doubt that appellant would have received a fair hearing before the Board.", "\n[5] See Parisi v. Davidson, 405 U. S. 34, 37, 40 n. 6 (1972); Public Utilities Comm'n v. United Fuel Co., 317 U. S. 456 (1943); Natural Gas Co. v. Slattery, 302 U. S. 300, 311 (1937); Prentis v. Atlantic Coast Line, 211 U. S. 210, 229 (1908); First Nat. ", "Bank v. Board of County Comm'rs, 264 U. S. 450 (1924); cf. ", "Schlesinger v. Councilman, 420 U. S. 738, 756-757 (1975). ", "See generally L. Jaffe, Judicial Control of Administrative Action 437-438 (1965); Fuchs, Prerequisites to Judicial Review of Administrative Agency Action, 51 Ind. L. J. 817, 861-862 (1976); Comment, Exhaustion of State Administrative Remedies Under the Civil Rights Act, 8 Ind. L. Rev. 565 (1975).", "\n[1] East Cleveland Housing Code § 1351.02 (1964).", "\n[2] East Cleveland Housing Code § 1341.08 (1966).", "\n[3] The Housing Code defines a \"dwelling unit\" as \"a group of rooms arranged, maintained or designed to be occupied by a single family and consisting of a complete bathroom with toilet, lavatory and tub or shower facilities; one, and one only, complete kitchen or kitchenette with approved cooking, refrigeration and sink facilities; approved living and sleeping facilities. ", "All of such facilities shall be in contiguous rooms and used exclusively by such family and by any authorized persons occupying such dwelling unit with the family.\" § ", "1341.07.", "\n[4] There is some suggestion in the record that the other dwelling unit in the appellant's house was also occupied by relatives of Mrs. Moore. ", "A notice of violation dated January 16, 1973, refers to \"Ms. Carol Moore and her son, Derik,\" as illegal occupants in the other unit, and at some point the illegal occupancy in one of the units allegedly was corrected by transferring one occupant over to the other unit.", "\n[5] Mrs. Moore, as the owner of the house, was responsible for compliance with the Housing Code. ", "East Cleveland Housing Code § 1343.04 (1966). ", "The illegal occupant, however, was identified by the city as John Moore, Jr., Mrs. Moore's grandson. ", "The record suggests no reason why he was named, rather than Dale Moore, Jr. The occupancy might have been legal but for one of the two grandsons. ", "One of Mrs. Moore's sons, together with his son, could have lived with Mrs. Moore under § 1341.08 (d) of the Code if they were dependent on her. ", "The other son, provided he was \"unmarried,\" could have been included under § 1341.08 (b).", "\n[6] East Cleveland Building Code § 1311.02 (1965).", "\n[7] The opinion of MR. ", "JUSTICE POWELL and MR. ", "JUSTICE BRENNAN'S concurring opinion both emphasize the traditional importance of the extended family in American life. ", "But I fail to understand why it follows that the residents of East Cleveland are constitutionally prevented from following what MR. ", "JUSTICE BRENNAN calls the \"pattern\" of \"white suburbia,\" even though that choice may reflect \"cultural myopia.\" ", "In point of fact, East Cleveland is a predominantly Negro community, with a Negro City Manager and City Commission.", "\n[8] The observation of Mr. Justice Holmes quoted in the Belle Terre opinion, 416 U. S., at 8 n. 5, bears repeating here.", "\n\n\"When a legal distinction is determined, as no one doubts that it may be, between night and day, childhood and maturity, or any other extremes, a point has to be fixed or a line has to be drawn, or gradually picked out by successive decisions, to mark where the change takes place. ", "Looked at by itself without regard to the necessity behind it the line or point seems arbitrary. ", "It might as well or nearly as well be a little more to one side or the other. ", "But when it is seen that a line or point there must be, and that there is no mathematical or logical way of fixing it precisely, the decision of the legislature must be accepted unless we can say that it is very wide of any reasonable mark.\" ", "Louisville Gas Co. v. Coleman, 277 U. S. 32, 41 (dissenting opinion).", "\n[9] The appellant makes much of East Cleveland Housing Code § 1351.03 (1966), which prescribes a minimum habitable floor area per person; she argues that because the municipality has chosen to establish a specific density control the single-family ordinance can have no role to play. ", "It is obvious, however, that § 1351.03 is directed not at preserving the character of a residential area but at establishing minimum health and safety standards.", "\n[10] MR. ", "JUSTICE STEVENS, in his opinion concurring in the judgment, frames the issue in terms of the \"appellant's right to use her own property as she sees fit.\" ", "Ante, at 513. ", "Focusing on the householder's property rights does not substantially change the constitutional analysis. ", "If the ordinance is invalid under the Equal Protection Clause as to those classes of people whose occupancy it forbids, I should suppose it is also invalid as an arbitrary intrusion upon the property owner's rights to have them live with her. ", "On the other hand, if the ordinance is a rational attempt to promote \"the city's interest in preserving the character of its neighborhoods,\" Young v. American Mini Theaters, 427 U. S. 50, 71 (opinion of STEVENS, J.), it is consistent with the Equal Protection Clause and a permissible restriction on the use of private property under Euclid v. Ambler Realty Co., 272 U. S. 365, and Nectow v. Cambridge, 277 U. S. 183.", "\n\nThe state cases that MR. ", "JUSTICE STEVENS discusses do not answer this federal constitutional issue. ", "For the most part, they deal with state-law issues concerning the proper statutory construction of the term \"family,\" and they indicate only that state courts have been reluctant to extend ambiguous single-family zoning ordinances to nontransient, single-housekeeping units. ", "By no means do they establish that narrow definitions of the term \"family\" are unconstitutional.", "\nFinally, MR. ", "JUSTICE STEVENS calls the city to task for failing \"to explain the need\" for enacting this particular ordinance. ", "Ante, at 520. ", "This places the burden on the wrong party.", "\n" ]

{ "pile_set_name": "FreeLaw" }

[ 0.0007775749545544386, 0.0013785817427560687, 0.0009095052373595536, 0.0010046785464510322, 0.0006648096023127437, 0.0006630808929912746, 0.0009293765760958195, 0.0006811340572312474, 0.0007045643869787455, 0.0007428776589222252, 0.0006325425347313285, 0.001441933331079781, 0.000631470640655607, 0.0007968225399963558, 0.0007977525237947702, 0.0008591223740950227, 0.0006469655781984329, 0.0005943821743130684, 0.0013768111821264029, 0.0007187051232904196, 0.0008738895994611084, 0.003189770970493555, 0.0012490043882280588, 0.024804461747407913, 0.0006589574040845037, 0.0005914216744713485, 0.0005930286715738475, 0.0007266110624186695, 0.0005881237448193133, 0.0005962745635770261, 0.0006603540387004614, 0.0007387842633761466, 0.0007200923864729702, 0.0006376155652105808, 0.0007084145327098668, 0.0007055652677081525, 0.0009307261207140982, 0.0006677944911643863, 0.0006395875243470073, 0.0007331451051868498, 0.0005816823686473072, 0.0006872420781292021, 0.000809783348813653, 0.0010986515553668141, 0.0006524443160742521, 0.0006360345287248492, 0.0007049948908388615, 0.0005719226319342852, 0.0006846977048553526, 0.0006036434788256884, 0.000764082302339375, 0.0006483136676251888, 0.0011948039755225182, 0.001015351270325482, 0.0007707417826168239, 0.0005617819842882454, 0.0005623308243229985, 0.000892037816811353, 0.0005553690134547651, 0.0007779937004670501, 0.0008687935187481344, 0.0005592022207565606, 0.0005701844347640872, 0.0005771107389591634, 0.000589750416111201, 0.0005581201985478401, 0.000577375350985676, 0.0007201308035291731, 0.0005787141271866858, 0.0010051357094198465, 0.000905508641153574, 0.0009703863761387765, 0.0007631907938048244, 0.0006335703074000776, 0.0007968046702444553, 0.0006171103450469673, 0.0005539400735870004, 0.0005946141900494695, 0.0006929506198503077, 0.0006006761104799807, 0.0006712368922308087, 0.001614230452105403, 0.00059452501591295, 0.0005812786403112113, 0.0006291634635999799, 0.0005356235196813941, 0.0007082225056365132, 0.0005782785592600703, 0.0011085463920608163, 0.0006776212831027806, 0.0008336198516190052, 0.0009353403584100306, 0.001441933331079781, 0.0007428022800013423, 0.0006119503523223102, 0.0006100001628510654, 0.0011973018990829587, 0.0009510968811810017, 0.0006604062509723008, 0.0006749430322088301, 0.0007331451051868498, 0.0006056714919395745, 0.0019017254235222936, 0.0007776630809530616, 0.0009466822957620025, 0.000676981289871037, 0.0007700997521169484, 0.0014800196513533592, 0.006370343267917633, 0.001228233682923019, 0.0016350152436643839, 0.0006850492209196091, 0.000696348084602505, 0.0007173646590672433, 0.0006473313551396132, 0.0006235160981304944, 0.0007207854650914669, 0.0005615445552393794, 0.000593897479120642, 0.0006128200329840183, 0.0005452703917399049, 0.0006163814687170088, 0.0006590349366888404, 0.000711629691068083, 0.0005612604436464608, 0.0006749430322088301, 0.000688002968672663, 0.0005810127477161586, 0.0011432573664933443, 0.0006258839275687933, 0.001609094557352364, 0.0006518065929412842, 0.0006643906817771494, 0.0012495428090915084, 0.0005968661862425506, 0.0007678691763430834, 0.0007515916950069368, 0.0006908827344886959, 0.0009273518808186054, 0.00062191067263484, 0.0034354496747255325, 0.0006594483857043087, 0.000675572024192661, 0.013133088126778603, 0.0007297014817595482, 0.000889643793925643, 0.0007157489308156073, 0.001441933331079781, 0.0006507998332381248, 0.0006803361466154456, 0.000771150691434741, 0.0008234758861362934, 0.0005874883499927819, 0.0006576677551493049, 0.0007967796409502625, 0.0007081513176672161, 0.0007020449265837669, 0.0006963169435039163, 0.0006186114042066038, 0.000657899712678045, 0.0006176361348479986, 0.000615315861068666, 0.0005364849930629134, 0.0005779818166047335, 0.0005767675465904176, 0.0006396381068043411, 0.0006411560461856425, 0.000630539667326957, 0.0005933746579103172, 0.0007614647620357573, 0.0006541655748151243, 0.0006339791580103338, 0.0005699318135157228, 0.0008788685663603246, 0.0007320375298149884, 0.0006377447280101478, 0.0005365433171391487, 0.001441933331079781, 0.0008318495820276439, 0.0005636218702420592, 0.000696806819178164, 0.0006247751298360527, 0.0006025174516253173, 0.0005671689286828041, 0.0007555772899650037, 0.0005836808704771101, 0.0006667127599939704, 0.0006127595552243292, 0.0006446688785217702, 0.0012368643656373024, 0.0006471116794273257, 0.0006585018709301949, 0.0006206808029673994, 0.0006426157196983695, 0.0010188560700044036, 0.0006015574908815324, 0.0006527632940560579, 0.0006562527851201594, 0.004196086432784796, 0.0006359248072840273, 0.0006366267334669828, 0.0011887713335454464, 0.0009050277876667678, 0.00639478350058198, 0.0006945552886463702, 0.08751141279935837, 0.0005555754760280252, 0.010969179682433605, 0.0006657594349235296, 0.0006454043905250728, 0.0005956298555247486, 0.0006333731580525637, 0.000618870893958956, 0.0006315786158666015, 0.0008547967299818993, 0.0005868107546120882, 0.0005893194465897977, 0.0005854573682881892, 0.0005618594004772604, 0.0005443359259516001, 0.0006113536655902863, 0.0006043377215974033, 0.0005640765302814543, 0.0006314023048616946, 0.001069466583430767, 0.0005877706571482122, 0.0008280144538730383, 0.0006722151301801205, 0.0006850873469375074, 0.0006359162507578731, 0.0006039243307895958, 0.0006247325800359249, 0.0005723166395910084, 0.0006378669058904052, 0.0006665253895334899, 0.0007847307133488357, 0.0005821785307489336, 0.0007931113941594958, 0.0007612460176460445, 0.0007002732018008828, 0.0006428196793422103, 0.0006839911220595241, 0.0010500052012503147, 0.0006011328077875078, 0.0006769396713934839, 0.0007133505423553288, 0.0005351254367269576, 0.0015412273351103067, 0.0006886044284328818, 0.0006972182891331613, 0.0006164951482787728, 0.0006398374680429697, 0.0007627469603903592, 0.0007090799044817686, 0.0006599387852475047, 0.0005871927714906633, 0.0007065216777846217, 0.0006353752687573433, 0.0006673869793303311, 0.0006462805904448032, 0.0005995238316245377, 0.0007788841612637043, 0.0007138164364732802, 0.0007876471499912441, 0.0008602991583757102, 0.0006118106539361179, 0.0006850420031696558, 0.0007789992960169911, 0.0007262033177539706, 0.0005820569931529462, 0.0005701037007384002, 0.000579201674554497, 0.0006873154197819531, 0.0007784119225107133, 0.0008298912434838712, 0.0007053238805383444, 0.0005979554262012243, 0.0006567717646248639, 0.0007184168207459152, 0.0006700238445773721, 0.0005702730850316584, 0.0006537449080497026, 0.0014390210853889585, 0.000711338478140533, 0.0006748635787516832, 0.0006710239103995264, 0.000659297511447221, 0.0007058551418595016, 0.0007486398098990321, 0.001441933331079781, 0.0007767824572511017, 0.0008126922184601426, 0.000644595711492002, 0.0007808699738234282, 0.0006035839905962348, 0.0005926258163526654, 0.0005886171711608768, 0.0008532842621207237, 0.0013876415323466063, 0.0006060909945517778, 0.0007750275544822216, 0.0007628051098436117, 0.0007213533972389996, 0.0006322218687273562, 0.0006545824580825865, 0.0006539535825140774, 0.0007783503970131278, 0.0006410313653759658, 0.0007253449875861406, 0.0006516938447020948, 0.0006562205380760133, 0.0006238855421543121, 0.000671098125167191, 0.00072464719414711, 0.0009713571635074914, 0.0008811278967186809, 0.0006019951542839408, 0.0009173881262540817, 0.0006602174835279584, 0.0007566534331999719, 0.0006508119404315948, 0.0007408094243146479, 0.0006934216944500804, 0.0007057283655740321, 0.0006472112727351487, 0.000587579095736146, 0.000636897049844265, 0.0006374226650223136, 0.0005965303280390799, 0.0007383299525827169, 0.0009026151965372264, 0.0010157161159440875, 0.000647300505079329, 0.0006592774298042059, 0.000641742954030633, 0.0006936315330676734, 0.0007410707185044885, 0.0006162584177218378, 0.000882283435203135, 0.0005866359570063651, 0.0008496474474668503, 0.000790051999501884, 0.0005642106989398599, 0.0006827765027992427, 0.0006080652237869799, 0.000659810786601156, 0.0005808713031001389, 0.0008711340487934649, 0.0006531422841362655, 0.0007458124891854823, 0.0007630457985214889, 0.0008237027795985341, 0.0007013508002273738, 0.0006085223285481334, 0.0007950295694172382, 0.0007528905989602208, 0.0006953317788429558, 0.0006805199664086103, 0.0005807757843285799, 0.0006400909624062479, 0.0006818683468736708, 0.0005821521626785398, 0.0015722636599093676, 0.000657996570225805, 0.0008034685743041337, 0.0006234917673282325, 0.0058450596407055855, 0.0005295213777571917, 0.0006242670933715999, 0.00066663435427472, 0.0005906246369704604, 0.0005837306380271912, 0.0006008592899888754, 0.0006873878883197904, 0.0005892144399695098, 0.0006605091621167958, 0.0006561132613569498, 0.0005757308681495488, 0.0005964143201708794, 0.0007643094868399203, 0.0008143941522575915, 0.0006221955409273505, 0.000689074513502419, 0.0006061866297386587, 0.001441933331079781, 0.0008546900935471058, 0.001449169241823256, 0.000588012975640595, 0.000662239093799144, 0.0005950028426013887, 0.0008103800937533379, 0.0006819424452260137, 0.0007487076218239963, 0.0006296424544416368, 0.0006848167977295816, 0.0006701640086248517, 0.0006972492556087673, 0.0007455339655280113, 0.0007784119225107133, 0.0007508801063522696, 0.001263369806110859, 0.0007208985043689609, 0.0007246251334436238, 0.0007058130577206612, 0.0006445376202464104, 0.0006394150550477207, 0.0007168021402321756, 0.0006292393081821501, 0.0008137425757013261, 0.0006131661939434707, 0.0005946865421719849, 0.0006450237706303596, 0.0007080990471877158, 0.0005735893500968814, 0.0006304200505837798, 0.0005867984145879745, 0.0005929266335442662, 0.0006117923767305911, 0.0005838875658810139, 0.0009197964100167155, 0.0006200720672495663, 0.0006314835627563298, 0.0005917856469750404, 0.0006351685733534396, 0.0005437948275357485, 0.0007167831063270569, 0.0006188747356645763, 0.0007159389206208289, 0.0016233433270826936, 0.000618632067926228, 0.0015840468695387244, 0.0007111784652806818, 0.001406115829013288, 0.0006159618496894836, 0.0006825185264460742, 0.0005859165103174746, 0.0006837342516519129, 0.0006844308809377253, 0.0008746156236156821, 0.000656921707559377, 0.0012101895408704877, 0.000777214125264436, 0.0005605280166491866, 0.0006575417937710881, 0.0006632025470025837, 0.0007886550738476217, 0.0006789545295760036, 0.0007340084994211793, 0.0006523277261294425, 0.0006529014790430665, 0.0007443466456606984, 0.0005977214896120131, 0.0007613265188410878, 0.0005958396359346807, 0.0008247830555774271, 0.0006092131952755153, 0.0007118311477825046, 0.0006132439011707902, 0.0005579545395448804, 0.0007375726127065718, 0.0006413971423171461, 0.0006592366262339056, 0.0006182995857670903, 0.0015840468695387244, 0.000626805005595088, 0.00062037562020123, 0.0006017553387209773, 0.0005859460798092186, 0.0007459255866706371, 0.000775543216150254, 0.0007870281697250903, 0.0006650881841778755, 0.001441933331079781, 0.000630023016128689, 0.0006114166462793946, 0.0005768137634731829, 0.0005712783895432949, 0.0005911540356464684, 0.0007658259128220379, 0.0007935280445963144, 0.000754775945097208, 0.0008594229002483189, 0.0006663707317784429, 0.0006595203885808587, 0.0006976886070333421, 0.0006870276411063969, 0.0005893860361538827, 0.0006575189181603491, 0.0007135990890674293, 0.0006760344840586185, 0.0007085573743097484, 0.0007160620880313218, 0.0006332261837087572, 0.0006352287600748241, 0.0006699085352011025, 0.0006079223821870983, 0.000780029222369194, 0.0005871740868315101, 0.0006425553583540022, 0.0020535930525511503, 0.0005966434837318957, 0.0005920237163081765, 0.0007750275544822216, 0.0007628051098436117, 0.0007274681702256203, 0.0006322218687273562, 0.0006453081732615829, 0.0006504060584120452, 0.0006402944563888013, 0.0007492221775464714, 0.0006464890902861953, 0.0006298747612163424, 0.0007599757518619299, 0.0005601543816737831, 0.0005678821471519768, 0.0006631732103414834, 0.0006069213850423694, 0.0006531326798722148, 0.0007320040604099631, 0.00072985899168998, 0.0006618093466386199, 0.0006849780911579728, 0.0007110819569788873, 0.0007123309187591076, 0.0009480607113800943, 0.0006546058575622737, 0.0007957416819408536, 0.0006515808054246008, 0.0006233634194359183, 0.0006002640002407134, 0.0006738747470080853, 0.0006267987191677094, 0.0006599277839995921, 0.0007680141134187579, 0.0007185349822975695, 0.0006575339939445257, 0.0006581129273399711, 0.0006053252145648003, 0.000830198114272207, 0.0006909904186613858, 0.0008426430867984891, 0.0007700997521169484, 0.000674853625241667, 0.00069726153742522, 0.0006626866525039077, 0.0005741053028032184, 0.000795265194028616, 0.0031544743105769157, 0.0008094731019809842, 0.0005767284892499447, 0.04298542067408562, 0.0006675116601400077, 0.012230555526912212, 0.0019238806562498212, 0.0005961518036201596, 0.0006451817462220788, 0.000829107069876045, 0.000776202417910099, 0.0006456375122070312, 0.0005783025408163667, 0.0006493472028523684, 0.0006824398296885192, 0.0006172186112962663, 0.0007784119225107133, 0.0006492977263405919, 0.0006406728643923998, 0.0006254530744627118, 0.0005705587682314217, 0.0008373352466151118, 0.0005916297668591142, 0.0007907614344730973, 0.0005666704382747412, 0.0008017809595912695, 0.0006416615797206759, 0.0008260568720288575, 0.0007296013063751161, 0.0006514706183224916, 0.000646932574454695, 0.0008260568720288575, 0.0007172152400016785, 0.0006229019491001964, 0.0007645797450095415, 0.0006929057999514043, 0.003911702893674374, 0.003533383831381798, 0.0006209174753166735, 0.0060871620662510395, 0.0009009984787553549, 0.000850416487082839, 0.000628685753326863, 0.0005717147141695023, 0.0008378815837204456, 0.00112725340295583, 0.0011094417423009872, 0.0005576865514740348, 0.0005989481578581035, 0.0006280991365201771, 0.0010014045983552933, 0.0006234002648852766, 0.0006213822052814066, 0.0005727788666263223, 0.0012470756191760302, 0.0006313331541605294, 0.0007362180040217936, 0.0006452762172557414, 0.0006853208760730922, 0.01531810313463211, 0.0018399233231320977, 0.0037614647299051285, 0.00868833065032959, 0.0007518145139329135, 0.04406111687421799, 0.004781660158187151, 0.0023053018376231194, 0.0010517832124605775, 0.026667287573218346, 0.0006264615803956985, 0.0009857992408797145, 0.000652652292046696, 0.0005683521158061922, 0.0008649370283819735, 0.0011506342561915517, 0.0007388913654722273, 0.005990270525217056, 0.0009709649020805955, 0.020768899470567703, 0.0007397677982226014, 0.0007100945804268122, 0.0006839874549768865, 0.0007067890255711973, 0.0005587701452895999, 0.0006023053429089487, 0.07201522588729858, 0.0008929486502893269, 0.0006601602071896195, 0.000847632298246026, 0.0008601659792475402, 0.0012920480221509933, 0.00076448725303635, 0.0006258267094381154, 0.003266767831519246, 0.0012041161535307765, 0.000880968407727778, 0.0006696684868074954, 0.0005861538811586797, 0.0006736397626809776, 0.0007085326942615211, 0.0006050792871974409, 0.0010122691746801138, 0.000922592356801033, 0.0008487396407872438, 0.0010726915206760168, 0.0009916594717651606, 0.001202487270347774, 0.0006063429173082113, 0.0008281149785034359, 0.0012048445641994476, 0.0005742191569879651, 0.0006080832099542022, 0.0005650747334584594, 0.0006171559798531234, 0.0006379468250088394, 0.0006823474541306496, 0.00065854680724442, 0.0007347040809690952, 0.0005971412756480277, 0.0005485364818014205, 0.0005616419948637486, 0.0009436021209694445, 0.0019678776152431965, 0.000658476201351732, 0.000590306066442281, 0.0005955035449005663, 0.000865368521772325, 0.0006607213290408254, 0.0010894378647208214, 0.0008270905818790197, 0.0007724561146460474, 0.000775543216150254, 0.0007761705783195794, 0.0006031026132404804, 0.0008495243382640183, 0.0006576483719982207, 0.0006712861359119415, 0.0006941860192455351, 0.000847632298246026, 0.0008145284955389798, 0.0010247373720631003, 0.000656044518109411, 0.0006097662262618542, 0.0006349236937239766, 0.29689285159111023, 0.000819877372123301, 0.0022014763671904802, 0.0006923598702996969, 0.0007791321258991957, 0.0008311831625178456, 0.0007209998439066112, 0.0011941019911319017, 0.0014901061076670885, 0.0006945731583982706, 0.0006712448666803539, 0.0005950962076894939, 0.0006814948283135891, 0.0006175772869028151, 0.0007859093020670116, 0.0005667406949214637, 0.0008604557369835675, 0.0007866378873586655, 0.0006068418151699007, 0.0006658505299128592, 0.0009506384958513081, 0.0007951712468639016, 0.0008074339712038636, 0.0009016807889565825, 0.0026676154229789972, 0.0007654334185644984, 0.0006501330644823611, 0.14774908125400543, 0.0011291163973510265, 0.0006995848380029202, 0.0006338290986604989, 0.0005885162390768528, 0.0008378815837204456, 0.00112725340295583, 0.0012712616007775068, 0.0006638779304921627, 0.0006066203932277858, 0.0007784119225107133, 0.0006819733534939587, 0.0007622920675203204, 0.0006777807720936835, 0.000695480965077877, 0.0006718695512972772, 0.0006421259604394436, 0.0006992601556703448, 0.0006611509597860277, 0.0007598117226734757, 0.0006770567269995809, 0.0006849264609627426, 0.0007260611746460199, 0.0006665882538072765, 0.000606540881562978, 0.000576931401155889, 0.0006046906928531826, 0.0006530277896672487, 0.0008157048723660409, 0.0008144904277287424, 0.0008389908471144736, 0.0006610582931898534, 0.0006219598581083119, 0.0006367538589984179, 0.0006814655498601496, 0.0006436444818973541, 0.0013049410190433264, 0.0006117176963016391, 0.0006189629202708602, 0.0006209014682099223, 0.0006311601609922945, 0.0011662035249173641, 0.0005947264726273715, 0.0006978728342801332, 0.0006784435245208442, 0.000638430065009743, 0.0006647444097325206, 0.0007978517096489668, 0.0005763908848166466, 0.0007393175037577748, 0.0009549786918796599, 0.042304929345846176, 0.0006075629498809576, 0.0005467181908898056, 0.0006080921157263219, 0.0008428161381743848, 0.0005644939374178648, 0.0008935992955230176, 0.0005882038967683911, 0.0006030190270394087, 0.0008710888214409351, 0.0006906539783813059, 0.0019182603573426604, 0.0005837762146256864, 0.0011101113632321358, 0.0006660345243290067, 0.0007795747369527817, 0.0007007848471403122, 0.0005652953404933214, 0.0006831240025348961, 0.0010824657510966063, 0.0006909857620485127, 0.002207079902291298, 0.0010231375927105546, 0.001995444530621171 ]

[ "Richard P. Smiraglia\n\nRichard P. Smiraglia is an American information scientist and prominent figure in the field of knowledge organization. ", "Smiraglia is currently a full professor in the School of Information Studies at the University of Wisconsin–Milwaukee. ", "He is editor-in-chief of the journal Knowledge Organization and a cataloging theorist perhaps best known for his work concerning two concepts pertaining to bibliographic control, information retrieval, and knowledge organization: a definition of the meaning of a “work” derived from empirical and semiotic analysis, and “instantiation,” the phenomenon of an information object realized in time.", "\n\nSmiraglia, a one-time flautist who holds a B.A. in music from Lewis & Clark College (1973), is also known for his work concerning music description and music information storage and retrieval He earned a Masters of Divinity from The General Theological Seminary of the Episcopal Church (1997) as well and is an Episcopalian priest. ", "Currently Professor and member of the Information Organization Research Group at the University of Wisconsin–Milwaukee, Smiraglia has taught at Long Island University (1993-2009), Columbia University (1987-1993), and University of Illinois at Urbana-Champaign (1974-1986).", "\n\nA Work \nIn The Nature of “A Work”: Implications for the Organization of Knowledge, published in 2001, Smiraglia provides a history of the treatment and role of works (as in literary works, musical works, etc. – ", "intellectual or artistic creations) in catalogs and a survey of empirical research into the work phenomenon. ", "Traditional modern library catalogs, Smiraglia observes, were designed to “inventory (first) and retrieve (second) specific documents,” and were built “on an assumption that there was a correspondence between a book and the work it contained – one item, one work, and vice versa.\" ", "Works don’t equal documents (in book form or otherwise), however; Smiraglia delineates between these two concepts and that of “text”:\n\n“A text is the set of words that constitute a writing. ", "A text is not the same as a document, which is the physical container (an item) on which the text is recorded… A work is the set of ideas created probably by an author or perhaps a composer, or other artist, set into a document using text, with the intention of being communicated to a receiver… A work may have many texts and may appear in many different documents.”", "\n\nThe problems with assuming a one-to-one document/work correspondence started to become apparent by the middle of the twentieth century when an explosion of information in the century’s first half and the publishing industry together yielded a “multiplicity of editions of major works.” ", "The idea began to take hold that a work – a set of abstract ideational content – is greater than a single a book or document and is actually a collection of sporadically varying instantiations of that ideational content.", "\n\nMany attempts followed to define work and the relationships between it and the various instances and forms in which it appears. ", "One of the best known is the FRBR entity-relationship model, which Smiraglia credits with providing “the separate identification, for the first time in the history of bibliographic control, of ‘the work’ as an essential and distinct bibliographic entity.” ", "In the FRBR model, a work is a distinct intellectual or artistic creation (for instance, Shakespeare’s Romeo and Juliet); an expression is an intellectual or artistic realization of a work (the original language text of the play); a manifestation physically embodies a work’s expression (a 2007 edition of the First Quarto of Romeo and Juliet from Cambridge University Press); and an item is a single exemplar of a manifestation (a single copy of the edition of Romeo and Juliet just mentioned).", "\n\nThrough empirical and semiotic analysis of the work phenomenon, Smiraglia derives a somewhat more complex definition: “A work is a signifying, concrete set of ideational conceptions that finds realization through semantic or symbolic expression.” ", "In this conception, the work is not a purely abstract entity; it still represents abstract intellectual or artistic content, but it can only be perceived and considered through instances of its realization – the texts in which it finds expression. ", "Works and texts, the ideational content and semantic content, are inextricably linked. ", "Smiraglia finds an analogy in linguistics and semiotics. ", "Much as with Saussure’s linguistic sign, in which the signified (concept) and signifier (sound-images) combine to form a linguistic object, ideational content (concepts) couples with semantic content (text or symbolic images) to form an object of cultural communication. ", "And just as linguistic signifiers evolve over time, subject to the vicissitudes of the culture in which they occur and the changing perceptions of their receivers, the texts that express a work are likewise volatile and subject to the same vicissitudes, making the work and its cultural signification similarly mutable.", "\n\nInstantiation \nClosely tied to this definition of work is the concept of instantiation, which could be understood as “version,” “edition,” or “manifestation”; Smiraglia selects instantiation over those other terms, however, since the word denotes temporality: “an instantiation is essentially a manifestation at a specific point in time.” ", "And for Smiraliga, there is no intermediate expression level, as in the FRBR model, between work and instantiation (manifestation). ", "There are only different types of instantiations.", "\n\nA work may find realization in a variety of different texts or other forms of semantic or symbolic expression, and this typically occurs once the work has acquired cultural significance and enters the canon. ", "Romeo and Juliet, for instance, has spawned countless editions, an opera, several films, adaptations like West Side Story, and so forth. (", "And 30% to 60% of works in the general bibliographic population have generated families or networks of such related instantiations.) ", "Some forms of instantiation are merely derivative, with the ideational and semantic content of the work remaining unchanged; these include simultaneous and successive editions, amplifications, and extractions. ", "In other forms, such as translations, adaptations, and performances, ideational and semantic content experiences mutation. ", "A mutation represents a work as a collaborative entity originating from the reaction of a culture (situated in a particular time and place) to that work. ", "As the network of instantiations stemming from a work mutates over time, the work’s cultural meaning changes accordingly.", "\n\nNotes\n\nExternal links\nSmiraglia's faculty website\n\nCategory:University of Wisconsin–Milwaukee faculty\nCategory:Living people\nCategory:1952 births" ]

{ "pile_set_name": "Wikipedia (en)" }

[ 0.0007919544004835188, 0.0006739489617757499, 0.0006497025606222451, 0.0006769148167222738, 0.0006088042864575982, 0.0005734876031056046, 0.0005644126795232296, 0.0006134321447461843, 0.0007506611873395741, 0.0006066545029170811, 0.0006344035500660539, 0.0006376113742589951, 0.0005583852180279791, 0.0005824771360494196, 0.0006238837377168238, 0.0005645138444378972, 0.0005724396905861795, 0.0005622777971439064, 0.0006410206551663578, 0.000713891233317554, 0.0005713559803552926, 0.0005679673631675541, 0.0006243123207241297, 0.0006295377970673144, 0.0005460073589347303, 0.0005911285988986492, 0.0006464613834396005, 0.0006092321127653122, 0.000552064913790673, 0.0005424643750302494, 0.0005887860897928476, 0.0005960160051472485 ]

[ "Q:\n\nFirebase with java (non-android) retrieve information\n\nI have been trying to get my data for firebase database using java code(non-android). ", "I used same method how I retrieved in android app. ", "But its not getting data.", "\n Firebase firebase = new Firebase(\"https://------.firebaseIO.com\");\n firebase.addValueEventListener(new ValueEventListener(){\n @Override\n public void onDataChange(DataSnapshot ds) {\n long i = ds.child(\"Users\").getChildrenCount();\n userlist = new String[(int)i];\n int j = 0;\n for( DataSnapshot each_ds : ds.getChildren() ){\n userlist[j] = each_ds.child(\"username\").getValue().toString();\n System.out.println(userlist[j]);\n j++;\n }\n }\n\n @Override\n public void onCancelled(FirebaseError fe) {\n throw new UnsupportedOperationException(\"Not supported yet.\"); ", "//To change body of generated methods, choose Tools | Templates.", "\n }\n });\n\nA:\n\nThe Firebase client makes its connection to the server in a separate thread and starts listening for data there. ", "The main thread of your program continues and exits when there is no more code to execute, which often happens before Firebase gets its first data back (which may take a few seconds).", "\nSo you'll have to wait for the data to come back. ", "For test programs I usually do this by inserting a simple Thread.sleep() at the end of my program:\nThread.sleep(20000);\n\nBut in a real program you'd probably want to figure out a better exit condition. ", "For example, here we use a CountDownLatch to make the main code wait until the operation is completed:\nfinal CountDownLatch sync = new CountDownLatch(1);\nref.push().setValue(\"new value\")\n .addOnCompleteListener(new OnCompleteListener<Void>() {\n public void onComplete(Task<Void> task) {\n sync.countDown();\n }\n });\nsync.await();\n\nDon't use this approach in Android by the way, as it will block the main/UI thread and leave the app unresponsive.", "\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.0006117667071521282, 0.0005746253882534802, 0.0007477328763343394, 0.0012091697426512837, 0.0006525947828777134, 0.0006380507838912308, 0.0006304276175796986, 0.0008859635563567281, 0.0005867924774065614, 0.0011506583541631699, 0.001995444530621171 ]

[ "1. ", "Field of the Invention\nThe present invention relates generally to a value-added information-exchanging network service, and in particular, by way of example but not limitation, to a Business-to-Business (B2B) engine capable of interfacing with both a telecommunications network and a service provider for facilitating information interexchange therebetween.", "\n2. ", "Background and Objects of the Present Invention\nThe growing accessibility of information on the Internet has made a great variety of content available. ", "Typically, users access this content at a fixed home or office site through an Internet Service Provider (ISP). ", "Content providers on the Internet forward their content, along with advertisements or other commercial information, through the ISP directly to the user. ", "Whereas, some ISPs currently maintain cache, e.g., Yahoo and America On Line (AOL) by providing additional content, most ISPs are purely conduits of information, and as such are not expected to have increased value as this technology and service matures.", "\nA concurrent, more recent development is wireless Internet access by mobile phone users. ", "Due to the convergence of telecommunications and the Internet, a growing variety of devices are becoming multipurpose and are now available to access the Internet wirelessly, e.g., cell phones, personal data assistants (PDAs) or other communications devices. ", "As with ISPs, however, Internet content providers are using existing telecommunications equipment as a mere conduit for passing information therethrough, thereby marginalizing the perceived value of these physical connections owned by the telecommunications operators. ", "This paradigm of operation is illustrated in FIG. ", "1 and is generally designated therein by the reference numeral 100, where a number of content providers, e.g., restaurant information 105, weather information 110 and other such portals 115, channel the respective data through a xe2x80x9cpipexe2x80x9d, i.e., the telecom operators\"\" equipment 120, to a realtime user.", "\nIn view of the high cost of telecommunications network infrastructure and the need to avoid perceived obsolescence, telecommunications system operators must restructure the interface between the content provider and user to better exploit advantages in the technological convergence. ", "In particular, a system and methodology offering an alternative paradigm avoiding the marginalization of the telecommunications infrastructure and services and avoiding loss of identity is needed. ", "In addition, the paradigm 100 of FIG. ", "1 fails to make use of any realtime information which is inherently provided within a serving telecommunications network, such as location status, pertaining to the mobile subscriber, an area which will be critical in numerous future applications.", "\nExemplary prior art methods related to the location and information provided to and from a mobile station includes U.S. Pat. ", "No. ", "5,559,520 which generally describes tracking the location change of a user using a GPS system and providing information from a dispatcher to the user regarding a vehicle\"\"s geographic coordinates.", "\nU.S. Pat. ", "No. ", "5,926,108 generally describes providing movie information to a pager. ", "The pager first request information from the system, which in turn determines the pager\"\"s location and sends movie information based on his location and optionally reserve tickets for the pager user.", "\nU.S. Pat. ", "No. ", "6,131,028 generally describes providing a specific predefined feature based on a user geographic location. ", "These features could be location-based call forwarding or predefined business establishment directions.", "\nU.S. Pat. ", "No. ", "5,930,699 generally describes providing information about a business based on a location of a mobile station. ", "The cell identity is determined by the system and information regarding a business in that area is sent to the mobile station.", "\nU.S. Pat. ", "No. ", "6,091,956 generally describes a system that provides services about places and events a mobile computer encounters in their current location or potential destinations. ", "The mobile computer is informed of events related to places the user is willing to visit. ", "Based on this information, the mobile computer may respond, avoid entirely, communicate with other people, or modify his plans in view of such events.", "\nU.S. Pat. ", "No. ", "6,108,533 generally describes providing a mobile station with ability to search, using keywords, information in a database. ", "Such information might require the knowledge of the location of the mobile station and search for the keyword provided by the mobile station in that area location database.", "\nU.S. Pat. ", "No. ", "6,115,611 generally describes having an information center connected to a plurality of mobile terminals. ", "The mobile terminals accessing location information as well as other information helpful to the mobile terminal user from the information center. ", "The information center is used for accumulating information and/or services from the mobile terminals and providing information to the mobile terminal related to the mobile terminal location information.", "\nIt is, therefore, an object of certain embodiment(s) of the present invention to provide a new system, scheme, and/or methodology for mobile Internet usage, which offer more value to the telecommunications network operators and better exploit technological advantages of the network.", "\nIt is a further object that the system, scheme, and/or methodology of certain embodiment(s) of the present invention better utilize the realtime information available in telecommunications networks about mobile subscribers and the content available, thereby leveraging the network capabilities to generate revenue.", "\nIt is another object of certain embodiment(s) of the present invention that an enabler described herein leverage the realtime capabilities of a telecommunications network.", "\nIt is an additional object of certain embodiment(s) of the present invention that an enabler be capable of better personalizing services based upon user situation, e.g., user location, user status, etc.", "\nMethods, systems, and arrangements facilitate information interexchange between a telecommunications network and an information service provider. ", "For example, in accordance with certain embodiment(s), a business-to-business (B2B) engine includes one or more logic modules for interfacing with the telecommunications network and with the information service provider. ", "The B2B engine facilitates the reporting of, e.g., realtime information from the telecommunications network to the information service provider. ", "This realtime information may include subscriber unit location that is proactively sent by the subscriber unit to the B2B engine for forwarding to the information service provider. ", "To avoid possibly congesting the telecommunications network, the B2B engine is empowered to monitor the number of proactively-transmitted location messages and to limit them if they exceed a defined threshold. ", "For example, the B2B engine may monitor them on a location area level and compare the total number of such location messages to an adjustable threshold. ", "If the total number exceeds the threshold, then the B2B engine selects one or more subscriber units using any of a number of criteria to receive an order to lower the number of location messages being transmitted from those subscriber units. ", "In this manner, a finite resource such as a control channel can be ensured to be available for telecommunications services." ]

{ "pile_set_name": "USPTO Backgrounds" }

[ 0.0009391900966875255, 0.0005550065543502569, 0.001185585861094296, 0.0005515931406989694, 0.0005999319837428629, 0.0005523749277926981, 0.0006229550926946104, 0.0005828847060911357, 0.0005757418693974614, 0.0006471314700320363, 0.00064722856041044, 0.0005827036802656949, 0.0006272493628785014, 0.0006436939584091306, 0.0006505795754492283, 0.0006639342755079269, 0.0005911136395297945, 0.0013785817427560687, 0.0005687422817572951, 0.0010884626535698771, 0.0013785817427560687, 0.0006058493163436651, 0.0006488322396762669, 0.0010884626535698771, 0.0013785817427560687, 0.0005706833326257765, 0.0005936840898357332, 0.0010884626535698771, 0.0013785817427560687, 0.0005525798187591136, 0.0005382474628277123, 0.0010884626535698771, 0.0013785817427560687, 0.0006223702221177518, 0.0005617485730908811, 0.0006047756760381162, 0.0010884626535698771, 0.0013785817427560687, 0.0005611355300061405, 0.0005575749091804028, 0.0010884626535698771, 0.0013785817427560687, 0.000547484727576375, 0.0005549655761569738, 0.0006062808097340167, 0.0005715853185392916, 0.0005792577285319567, 0.0006188387051224709, 0.0006014695391058922, 0.0005516664823517203, 0.0005726835806854069, 0.0005521494313143194, 0.0005545795429497957, 0.0006616362952627242, 0.0005660927854478359, 0.0006326781585812569, 0.000546314986422658 ]

[ "Area Moment of Inertia Section Properties: Hexagon Shape Calculator\n\nArea Moment of Inertia Section Properties of Hexagon Shape Feature Calculator and Equations. ", "This engineering calculator will determine the section modulus for the given cross-section. ", "This engineering data is often used in the design of structural beams or structural flexural members." ]

{ "pile_set_name": "Pile-CC" }

[ 0.0009933199035003781, 0.0028127788100391626, 0.0005605561309494078 ]

[ "/*\n * Lips3.h\n * Copyright 1999-2000 Y.Takagi. ", "All Rights Reserved.", "\n */\n#ifndef __LIPS3_H\n#define __LIPS3_H\n\n\n#include \"GraphicsDriver.h\"\n\n\nclass Halftone;\n\n\nclass LIPS3Driver : public GraphicsDriver {\npublic:\n\t\t\t\t\t\tLIPS3Driver(BMessage* msg, PrinterData* printer_data,\n\t\t\t\t\t\t\tconst PrinterCap* printer_cap);\n\nprotected:\n\tvirtual\tbool\t\tStartDocument();\n\tvirtual\tbool\t\tStartPage(int page);\n\tvirtual\tbool\t\tNextBand(BBitmap *bitmap, BPoint *offset);\n\tvirtual\tbool\t\tEndPage(int page);\n\tvirtual\tbool\t\tEndDocument(bool success);\n\nprivate:\n\t\t\tvoid\t\t_Move(int x, int y);\n\t\t\tvoid\t\t_BeginTextMode();\n\t\t\tvoid\t\t_JobStart();\n\t\t\tvoid\t\t_SoftReset();\n\t\t\tvoid\t\t_SizeUnitMode();\n\t\t\tvoid\t\t_SelectSizeUnit();\n\t\t\tvoid\t\t_PaperFeedMode();\n\t\t\tvoid\t\t_SelectPageFormat();\n\t\t\tvoid\t\t_DisableAutoFF();\n\t\t\tvoid\t\t_SetNumberOfCopies();\n\t\t\tvoid\t\t_MemorizedPosition();\n\t\t\tvoid\t\t_MoveAbsoluteHorizontal(int x);\n\t\t\tvoid\t\t_CarriageReturn();\n\t\t\tvoid\t\t_MoveDown(int dy);\n\t\t\tvoid\t\t_RasterGraphics(int size, int widthbyte, int\theight,\n\t\t\t\t\t\t\tint compression_method, const uchar* buffer);\n\t\t\tvoid\t\t_FormFeed();\n\t\t\tvoid\t\t_JobEnd();\n\n\t\t\tint\t\t\tfCurrentX;\n\t\t\tint\t\t\tfCurrentY;\n\t\t\tHalftone*\tfHalftone;\n};\n\n#endif // __LIPS3_H\n" ]

{ "pile_set_name": "Github" }

[ 0.0017982919234782457, 0.0006133938441053033, 0.0056089009158313274 ]

[ "/** @file\n * Definition of SVC Helper Process control routines.", "\n */\n\n/*\n * Copyright (C) 2006-2010 Oracle Corporation\n *\n * This file is part of VirtualBox Open Source Edition (OSE), as\n * available from http://www.virtualbox.org. ", "This file is free software;\n * you can redistribute it and/or modify it under the terms of the GNU\n * General Public License (GPL) as published by the Free Software\n * Foundation, in version 2 as it comes in the \"COPYING\" file of the\n * VirtualBox OSE distribution. ", "VirtualBox OSE is distributed in the\n * hope that it will be useful, but WITHOUT ANY WARRANTY of any kind.", "\n */\n\n#include \"svchlp.h\"\n\n//#include \"HostImpl.h\"\n#include \"Logging.h\"\n\n#include <VBox/err.h>\n\nint netIfNetworkInterfaceHelperServer (SVCHlpClient *aClient,\n SVCHlpMsg::Code aMsgCode);\n\nusing namespace com;\n\nenum { PipeBufSize = 1024 };\n\n////////////////////////////////////////////////////////////////////////////////\n\n/**\n * GetLastError() is known to return NO_ERROR even after the Win32 API\n * function (i.e. Write() to a non-connected server end of a pipe) returns\n * FALSE... This method ensures that at least VERR_GENERAL_FAILURE is returned\n * in cases like that. ", "Intended to be called immediately after a failed API\n * call.", "\n */\nstatic inline int rtErrConvertFromWin32OnFailure()\n{\n DWORD err = GetLastError();\n return err == NO_ERROR ? ", "VERR_GENERAL_FAILURE\n : RTErrConvertFromWin32 (err);\n}\n\n////////////////////////////////////////////////////////////////////////////////\n\nSVCHlpClient::SVCHlpClient()\n : mIsOpen (false), mIsServer (false)\n , mReadEnd (NULL), mWriteEnd (NULL)\n{\n}\n\nSVCHlpClient::~SVCHlpClient()\n{\n close();\n}\n\nint SVCHlpClient::create(const char *aName)\n{\n AssertReturn(aName, VERR_INVALID_PARAMETER);\n\n if (mIsOpen)\n return VERR_WRONG_ORDER;\n\n Bstr pipeName = Utf8StrFmt(\"\\\\\\\\.\\\\pipe\\\\%s\", aName);\n\n HANDLE pipe = CreateNamedPipe(pipeName.raw(),\n PIPE_ACCESS_DUPLEX | FILE_FLAG_FIRST_PIPE_INSTANCE,\n PIPE_TYPE_BYTE | PIPE_READMODE_BYTE | PIPE_WAIT,\n 1, // PIPE_UNLIMITED_INSTANCES,\n PipeBufSize, PipeBufSize,\n NMPWAIT_USE_DEFAULT_WAIT,\n NULL);\n\n if (pipe == INVALID_HANDLE_VALUE)\n rtErrConvertFromWin32OnFailure();\n\n mIsOpen = true;\n mIsServer = true;\n mReadEnd = pipe;\n mWriteEnd = pipe;\n mName = aName;\n\n return VINF_SUCCESS;\n}\n\nint SVCHlpClient::open(const char *aName)\n{\n AssertReturn(aName, VERR_INVALID_PARAMETER);\n\n if (mIsOpen)\n return VERR_WRONG_ORDER;\n\n Bstr pipeName = Utf8StrFmt(\"\\\\\\\\.\\\\pipe\\\\%s\", aName);\n\n HANDLE pipe = CreateFile(pipeName.raw(),\n GENERIC_READ | GENERIC_WRITE,\n 0,\n NULL,\n OPEN_EXISTING,\n 0,\n NULL);\n\n if (pipe == INVALID_HANDLE_VALUE)\n rtErrConvertFromWin32OnFailure();\n\n mIsOpen = true;\n mIsServer = false;\n mReadEnd = pipe;\n mWriteEnd = pipe;\n mName = aName;\n\n return VINF_SUCCESS;\n}\n\nint SVCHlpClient::connect()\n{\n if (!", "mIsOpen || !", "mIsServer)\n return VERR_WRONG_ORDER;\n\n BOOL ok = ConnectNamedPipe (mReadEnd, NULL);\n if (!", "ok && GetLastError() !", "= ERROR_PIPE_CONNECTED)\n rtErrConvertFromWin32OnFailure();\n\n return VINF_SUCCESS;\n}\n\nint SVCHlpClient::close()\n{\n if (!", "mIsOpen)\n return VERR_WRONG_ORDER;\n\n if (mWriteEnd !", "= NULL && mWriteEnd !", "= mReadEnd)\n {\n if (!", "CloseHandle (mWriteEnd))\n rtErrConvertFromWin32OnFailure();\n mWriteEnd = NULL;\n }\n\n if (mReadEnd !", "= NULL)\n {\n if (!", "CloseHandle (mReadEnd))\n rtErrConvertFromWin32OnFailure();\n mReadEnd = NULL;\n }\n\n mIsOpen = false;\n mIsServer = false;\n mName.setNull();\n\n return VINF_SUCCESS;\n}\n\nint SVCHlpClient::write (const void *aVal, size_t aLen)\n{\n AssertReturn(aVal !", "= NULL, VERR_INVALID_PARAMETER);\n AssertReturn(aLen !", "= 0, VERR_INVALID_PARAMETER);\n\n if (!", "mIsOpen)\n return VERR_WRONG_ORDER;\n\n DWORD written = 0;\n BOOL ok = WriteFile (mWriteEnd, aVal, (ULONG)aLen, &written, NULL);\n AssertReturn(!ok || written == aLen, VERR_GENERAL_FAILURE);\n return ok ? ", "VINF_SUCCESS : rtErrConvertFromWin32OnFailure();\n}\n\nint SVCHlpClient::write (const Utf8Str &aVal)\n{\n if (!", "mIsOpen)\n return VERR_WRONG_ORDER;\n\n /* write -1 for NULL strings */\n if (aVal.isEmpty())\n return write ((size_t) ~0);\n\n size_t len = aVal.length();\n\n /* write string length */\n int vrc = write (len);\n if (RT_SUCCESS(vrc))\n {\n /* write string data */\n vrc = write (aVal.c_str(), len);\n }\n\n return vrc;\n}\n\nint SVCHlpClient::write (const Guid &aGuid)\n{\n Utf8Str guidStr = aGuid.toString();\n return write (guidStr);\n}\n\nint SVCHlpClient::read (void *aVal, size_t aLen)\n{\n AssertReturn(aVal !", "= NULL, VERR_INVALID_PARAMETER);\n AssertReturn(aLen !", "= 0, VERR_INVALID_PARAMETER);\n\n if (!", "mIsOpen)\n return VERR_WRONG_ORDER;\n\n DWORD read = 0;\n BOOL ok = ReadFile (mReadEnd, aVal, (ULONG)aLen, &read, NULL);\n AssertReturn(!ok || read == aLen, VERR_GENERAL_FAILURE);\n return ok ? ", "VINF_SUCCESS : rtErrConvertFromWin32OnFailure();\n}\n\nint SVCHlpClient::read (Utf8Str &aVal)\n{\n if (!", "mIsOpen)\n return VERR_WRONG_ORDER;\n\n size_t len = 0;\n\n /* read string length */\n int vrc = read (len);\n if (RT_FAILURE(vrc))\n return vrc;\n\n /* length -1 means a NULL string */\n if (len == (size_t) ~0)\n {\n aVal.setNull();\n return VINF_SUCCESS;\n }\n\n aVal.reserve(len + 1);\n aVal.mutableRaw()[len] = 0;\n\n /* read string data */\n vrc = read (aVal.mutableRaw(), len);\n\n return vrc;\n}\n\nint SVCHlpClient::read (Guid &aGuid)\n{\n Utf8Str guidStr;\n int vrc = read (guidStr);\n if (RT_SUCCESS(vrc))\n aGuid = Guid (guidStr.c_str());\n return vrc;\n}\n\n////////////////////////////////////////////////////////////////////////////////\n\nSVCHlpServer::SVCHlpServer ()\n{\n}\n\nint SVCHlpServer::run()\n{\n int vrc = VINF_SUCCESS;\n SVCHlpMsg::Code msgCode = SVCHlpMsg::Null;\n\n do\n {\n vrc = read (msgCode);\n if (RT_FAILURE(vrc))\n return vrc;\n\n /* terminate request received */\n if (msgCode == SVCHlpMsg::Null)\n return VINF_SUCCESS;\n\n switch (msgCode)\n {\n case SVCHlpMsg::CreateHostOnlyNetworkInterface:\n case SVCHlpMsg::RemoveHostOnlyNetworkInterface:\n case SVCHlpMsg::EnableDynamicIpConfig:\n case SVCHlpMsg::EnableStaticIpConfig:\n case SVCHlpMsg::EnableStaticIpConfigV6:\n case SVCHlpMsg::DhcpRediscover:\n {\n#ifdef VBOX_WITH_NETFLT\n vrc = netIfNetworkInterfaceHelperServer(this, msgCode);\n#endif\n break;\n }\n default:\n AssertMsgFailedReturn((\"Invalid message code %d (%08lX)\\n\", msgCode, msgCode),\n VERR_GENERAL_FAILURE);\n }\n\n if (RT_FAILURE(vrc))\n return vrc;\n }\n while (1);\n\n /* we never get here */\n AssertFailed();\n return VERR_GENERAL_FAILURE;\n}\n" ]

{ "pile_set_name": "Github" }

[ 0.0006963849300518632, 0.0006184577941894531, 0.00068995903711766, 0.0006845574826002121, 0.0025088521651923656, 0.0006549203535541892, 0.0024371615145355463, 0.03403586894273758, 0.002820545108988881, 0.008190988563001156, 0.0022146611008793116, 0.0023382685612887144, 0.0018966980278491974, 0.051560789346694946, 0.0014996477402746677, 0.028401320800185204, 0.016079215332865715, 0.01502341777086258, 0.005978369154036045, 0.0020775787997990847, 0.0018737297505140305, 0.0022648198064416647, 0.006171763874590397, 0.005978369154036045, 0.0020775787997990847, 0.001454671612009406, 0.0014700419269502163, 0.0069816745817661285 ]

[ "How do you put a dollar value on the worth of a public official? ", "Attorneys working full time for the LSU Health Sciences Center are asking to be paid more than $400,000 a year. ", "So how do you justify such large increases? ", "How about this idea? ", "Shouldn’t receiving such large salaries be based on results?", "\n\nLSU football coach Ed Orgeron will pocket some four million dollars this year, making him one of the highest-paid football coaches in the nation. ", "He received such an enormous salary package based on results. ", "It’s the old adage that you get what you pay for, and with Orgeron, LSU ended the season with a top ten ranking.", "\n\nThe Times Picayune reported last week that the New Orleans Saints may ask the state to pay for a $350 million upgrade to the Superdome before the 2024 Super bowl. ", "That’s a huge taxpayer commitment for a state that can’t even fund education at all levels and basic healthcare for hundreds of thousands of its citizens. ", "So how should any upgrade be paid for?" ]

{ "pile_set_name": "Pile-CC" }

[ 0.0009474038379266858, 0.0006072723190300167, 0.000712152395863086, 0.0007957936613820493, 0.0011071496410295367, 0.0007989068981260061, 0.0006734603666700423, 0.008417227305471897, 0.0006642092484980822, 0.0008937487727962434, 0.0010403655469417572 ]

[ "package org.gradle;\n\npublic interface CategoryB extends CategoryA{\n}\n" ]

{ "pile_set_name": "Github" }

[ 0.0007082495139911771 ]

[ "1. ", "Introduction {#sec1}\n===============\n\nMalacoplakia is an acquired granulomatous disorder first described by Michaelis and Gutmann in 1902 \\[[@B1]\\]. ", "It\\'s believed to be caused by an alteration of the bacterial phagocytic system \\[[@B2]\\]. ", "Malacoplakia has been described in numerous anatomic locations, most commonly in the genitourinary tract. ", "The gastrointestinal system, especially the colon, is a second common site for the occurrence of malacoplakia \\[[@B3]\\]. ", "Clinically, it can mimic a neoplasm that occurs in the form of a mass \\[[@B4]\\]. ", "The diagnosis is exclusively based on histology. ", "The cardinal finding is the presence of numerous histiocytes with pathognomonic intracellular and extracellular Michaelis-Gutmann bodies \\[[@B5]\\].", "\n\n2. ", "Case Report {#sec2}\n==============\n\nA 9-year-old girl presented with history of abdominal pain, prolonged diarrhea, and rectal bleeding. ", "She presented cutaneous leishmaniasis at 3-year-old, diffuse verruca vulgaris, recurrent skin, and respiratory infections.", "\n\nShe was hospitalised two years ago for pneumonia. ", "Physical examination found hepatosplenomegaly and cervical adenopathy. ", "The only abnormal laboratory test was an increase of *γ*-globulin count at 26,9 g/L. Inflammatory and infectious biological tests were normal. ", "The humoral and cellular immunity was normal.", "\n\nUltrasonography and computed tomographic scan of the chest and abdomen showed numerous mesenteropelvic and inguinal gonglions and homogenous hepatosplenomegaly. ", "The liver and the spleen had a size of 19 cm and 12 cm respectively.", "\n\nBiopsy of an adenopathy showed a non specific mixed follicular and paracortical hyperplasia, with by place eosinophil\\'s infiltration. ", "The liver biopsy was normal.", "\n\nThe patient was lost to followup, and she was rehospitalized after two years. ", "The physical examination revealed a pale, cachectic girl whose spleen was palpable 2 cm below the left costal margin and the liver had a size of 12 cm. ", "She had a numerous superficial lymph nodes measuring 1 cm. ", "The rectal examination ached and revealed some blood.", "\n\nThe laboratory workup showed a normal leukocyte count at 9700/mm^3^ with hypereosinophilia at 1700/mm^3^. The haemoglobin and the platelet counts were normal. ", "The erythrocyte sedimentation rate was 26 mm/hour, and the *γ*-globulin was increased to 26,5 g/L. The biologic hepatic and renal functions were normal.", "\n\nWe completed during this hospitalization the exploration with endoscopic examinations. ", "The gastroscopy revealed a normal stomach, multiple polypoid lesions measuring 0.2 cm, and friable mucosa in duodenum. ", "Multiple biopsy specimens were taken. ", "Microscopic examination showed lymphoid hyperplasia.", "\n\nThe colonoscopy and rectoscopy revealed an extended colitis with superficial ulcerations, friable mucosa, and bleeding rectal polyps measuring 2 cm ([Figure 1(a)](#fig1){ref-type=\"fig\"} and 1(b)).", "\n\nThe histopathological study showed a diffuse infiltration of the colonic mucosa by numerous histiocytes with cytoplasmic inclusions ([Figure 2(a)](#fig2){ref-type=\"fig\"}), which stain positively with periodic acid-Schiff, Von Kossa, and Prussian blue stains ([Figure 2(b)](#fig2){ref-type=\"fig\"}). ", "Histiocytes had characteristic Michaelis-Gutmann bodies. ", "The final diagnosis was malacoplakia with primary involvement of the gastrointestinal system.", "\n\nThe patient was treated with oral fluoroquinolone (Ciprofloxacin) 10 mg/Kg × 2/day. ", "The patient\\'s course was uneventful, and she was followed well (5 months after starting treatment). ", "Diarrhea and rectal bleeding had stopped and hepatosplenomegaly decreased. ", "The colonoscopy was controlled after two years of antibiotic treatment; we found that infiltration and ulceration of intestinal mucosa had decreased with a normal rectum ([Figure 3](#fig3){ref-type=\"fig\"}). ", "The histologic examination showed a non specific inflammation without Michaelis-Gutmann bodies.", "\n\nActually, the patient has a normal growth. ", "The hepatosplenomegaly was present with normal biologic tests. ", "The follow up is of a three-year period.", "\n\n3. ", "Comments {#sec3}\n===========\n\nMalacoplakia is a rare, histologically unique, chronic inflammatory reaction of various organs such as the urinary tract and gastrointestinal system \\[[@B3], [@B4]\\]. ", "The term \"malacoplakia\", meaning \"soft\" and \"plaque\" in Greek, was coined by Von Hansemann in 1903 to describe yellowish tumor-like lesion in the urinary bladder \\[[@B3], [@B6]\\]. ", "Since 1902, approximately 400 cases of malacoplakia have been reported in the literature \\[[@B7]\\].", "\n\nThere is a bimodal age incidence, with one peak for children below 13 years and second peak for middle-aged adults \\[[@B5]\\]. ", "The mean age at diagnosis was around the fifth decade of age \\[[@B2]\\]. ", "Malacoplakia is rare in children and usually involves the gastrointestinal tract, and is associated with significant additional systemic disease \\[[@B8]\\]. ", "A female-to-male preponderance of 4 : 1 is reported when the disease affects genitourinary system \\[[@B2], [@B7]\\]. ", "In the other locations, male and female patients were equally affected \\[[@B7]\\].", "\n\nSome authors emphasize the correlation between immunosuppression and malacoplakia, because an increasing number of cases in immunodeficient individuals and in patients receiving chemotherapy, has been reported \\[[@B5], [@B6]\\]. ", "Furthermore, malacoplakia has been correlated with malignant neoplasms, systemic diseases, mycotic infections, liver diseases, sarcoidosis, ulcerative colitis, cachexia, and drug addiction \\[[@B5]\\]. ", "In our case, the patient presented in her clinical history a cutaneous leishmaniasis, diffuse verruca vulgaris with recurrent skin, and respiratory infections, but the humoral and cellular immunity were normal.", "\n\nThe malacoplakia may affect many organs, but frequently involves the urinary tract in 75% of cases \\[[@B3], [@B4]\\]. ", "Other locations were also described including the gastrointestinal system, skin, soft tissue lung, bone, retroperitoneum, spleen, pancreas, lymph nodes, brain, and liver \\[[@B4], [@B5], [@B7]\\]. ", "The gastrointestinal tract being the second most frequent location outside the urogenital tract; gastrointestinal and retroperitoneal sites were each identified in 12% of cases \\[[@B5]\\]. ", "In the majority of cases, the colorectum was the commonly involved part \\[[@B7]\\]. ", "Colonic malacoplakia was first described by Terner and Lattes in 1965 \\[[@B4], [@B5]\\]. ", "The descending colon, sigmoid, and rectum are common sites and can also involve the upper tract \\[[@B4]\\]. ", "In our case, the entire colon, the rectum, and the duodenum were involved.", "\n\nClinical manifestations of colonic malacoplakia are nonspecific; rectal bleeding, diarrhea, abdominal pain, and fever are the usual presenting symptoms \\[[@B5], [@B9]\\]. ", "The endoscopy can reveal three different gross morphologic patterns reported in cases of gastrointestinal malacoplakia; unifocal mucosal, widespread multinodular or polypoid, and large mass involving adjacent organs \\[[@B3]\\]. ", "In the present case, the endoscopy revealed superficial ulcerations, friable mucosa, and bleeding rectal and duodenal polyps.", "\n\nClinical presentation and endoscopic lesions, such unifocal nodules and polypoidal or mass lesions, can often mimics a mistaken diagnosis of ulcerative colitis and carcinoma \\[[@B3], [@B4]\\]. ", "The definitive diagnosis is exclusively based on histopathologic examination; the cardinal finding is the presence of numerous histiocytes with pathognomonic intracellular and extracellular Michaelis-Gutmann bodies. ", "Theses bodies stain positively with periodic acid-schiff, von Kossa, and Prussian blue stains \\[[@B3], [@B5]\\].", "\n\nEven after a century since the lesion was first described, the pathogenesis of malacoplakia remains unclear \\[[@B4]\\]. ", "The condition may result from incomplete bacterial killing and digestion by phagocytic mononuclear cells, which leads to accumulation of mononuclear cells or \"Von Hansemann cells\" containing partially digested bacterial fragments \\[[@B10], [@B11]\\]. ", "Incomplete bacterial killing and phagolysosomes with subsequent deposits of iron and calcium constitutes inclusions known as Michaelis-Gutmann bodies \\[[@B9], [@B12]\\].", "\n\nThe microorganisms most commonly cultured from malacoplakia are gram-negative rods *(Escherichia Coli, Klebsiella*, and *Enterobacter*) and gram-positive cocci *(Staphylococcus aureus*, *Enterococcus, and*several varieties of *Streptococcus*) \\[[@B13]\\]. ", "This postinfectious hypothesis was based on constatation that 90% of malacoplakia involving genitor-urinary tract were associated with coliform infection, and in 72% of cases the microorganism was an *Escherichia Coli* \\[[@B14]\\].", "\n\nIt has been suggested that there is an abnormal macrophage response with defective lysosomal function \\[[@B4]\\]. ", "Some studies have demonstrated low levels of cyclic guanosine monophosphate in the monocytes of these patients \\[[@B5]\\]. ", "This decreased level may interfere with microtubular and lysosomal activity, leading to incomplete elimination of bacteria from macrophages \\[[@B4]\\]. ", "In conclusion, the pathogenesis of malacoplakia includes two factors: bacterial infection and disorder of immunologic system. ", "In the present case, the patient had a history of cutaneous leishmaniasis and recurrent infections, but the immunity exploration was normal.", "\n\nBecause malacoplakia of the gastrointestinal tract is rare, treatment is based mainly on anecdotal reports. ", "Therapy has been both pharmacologic and surgical \\[[@B3]\\]. ", "Medical therapy consists of treatment with antibiotics, using drugs that easily permeate the macrophage and destroy undigested bacteria such as quinolones, rifampicin, and trimethoprim-sulfamethoxasole \\[[@B4], [@B15], [@B16]\\]. ", "Actually, Ciprofloxacin is preferred with approximately 90% of success versus 10% with trimethoprim-sulfamethoxazole \\[[@B5], [@B6]\\]. ", "Cholinergic agents, such as bethanechol, were used in order to raise intracellular levels of cyclic guanosine monophosphate in macrophages. ", "This conservator treatment is indicated when the involved organ has been not definitively undamaged.", "\n\nAlthough the response to therapy is unpredictable, patients may respond if the treatment is continued on a long-term basis, in order to prevent the recurrence and the extension of diseases \\[[@B6]\\]. ", "In our case, the child was treated with oral fluoroquinolone with a clinical and histological improvement after two years of treatment. ", "In cases of progressive lesion or no response to medical treatment, the surgical resection may be the other choice of treatment \\[[@B4]--[@B6]\\].", "\n\n4. ", "Conclusion {#sec4}\n=============\n\nMalacoplakia is rarely reported in children and usually involves the gastrointestinal tract in this age. ", "This disease does not have any specific clinical or laboratory signs and the diagnosis is exclusively based on histology. ", "The intestinal malacoplakia may be more common than usually suspected, especially in immunodeficient patients. ", "It must be ruled out in every patient having chronic bloody and mucous diarrhea.", "\n\nThe authors declare that there is no conflict of interests.", "\n\n{#fig1}\n\n{#fig2}\n\n{#fig3}\n\n[^1]: Academic Editors: T. Joh and J. F. Mayberry\n" ]

{ "pile_set_name": "PubMed Central" }

[ 0.0009391900966875255, 0.0019413428381085396, 0.0017612064257264137, 0.0006308486335910857, 0.0007035841117613018, 0.001014694687910378, 0.0006580580375157297, 0.0008263540803454816, 0.001185585861094296, 0.12483912706375122, 0.0018621190683916211, 0.00084322300972417, 0.0009539683233015239, 0.0009037710260599852, 0.0006739197415299714, 0.0019452187698334455, 0.0011216962011530995, 0.001192491385154426, 0.0008468746673315763, 0.0006099966703914106, 0.0012993860291317105, 0.022209113463759422, 0.02284283936023712, 0.0025910891126841307, 0.0009591348934918642, 0.0005975714302621782, 0.021573930978775024, 0.0006084666238166392, 0.005276318173855543, 0.008928991854190826, 0.000856742262840271, 0.0013679880648851395, 0.0008026318391785026, 0.001026294194161892, 0.0005859961383976042, 0.22178390622138977, 0.008325732313096523, 0.0006254265899769962, 0.0006955339340493083, 0.0010226248996332288, 0.0005845805280841887, 0.00117425003554672, 0.009338338859379292, 0.0020586014725267887, 0.0006823874427936971, 0.0013427166268229485, 0.0005904191639274359, 0.0023750464897602797, 0.007896693423390388, 0.0009296701173298061, 0.0007231020135805011, 0.0017902078106999397, 0.000806448224466294, 0.003455133643001318, 0.00272515625692904, 0.001864423742517829, 0.0017562428256496787, 0.0006633036537095904, 0.07048903405666351, 0.15357322990894318, 0.00842843297868967, 0.0013134973123669624, 0.04078523814678192, 0.001335735316388309, 0.0006824423908255994, 0.0010287478799000382, 0.0008286561351269484, 0.0023506516590714455, 0.00151389732491225, 0.0009779758984223008, 0.0011419120710343122, 0.0047102319076657295, 0.0006600463530048728, 0.0012687377166002989, 0.0007427672389894724, 0.0008768581319600344, 0.0006773881614208221, 0.0028787984047085047, 0.0027456798125058413, 0.000912344257812947, 0.0011426361743360758, 0.0006922829779796302, 0.0006598730687983334, 0.0009890515357255936, 0.0008861328242346644, 0.0012900278670713305, 0.0070090871304273605, 0.0008215971756726503, 0.0009988314704969525, 0.14103128015995026, 0.0006104352651163936, 0.0012068506330251694, 0.013447396457195282, 0.004072883166372776, 0.0010634713107720017 ]

[ "Q:\n\nWhat is the proper way to get the real recorded date/time of a video stream?", "\n\nI have a complete video-streaming mechanism of my own at the moment (except GDCL Mux/Demux filters). ", "Structure is like this.", "\nStreamer Graph:\nFile Source Filter -> GDCL MP4 Demuxer -> My RTP Network Renderer\n\nReceiver Graph:\nMy RTP Network Listener -> GDCL MP4 Muxer -> My Video Renderer\n\nI don't use RTSP protocol and pass required startup parameters by some custom methods. ", "I stream segmented files continuously. ", "To do that, i create a new Streamer Graph for the next file each time end of file is reached. ", "But keep using the same UDP port at the next Streamer Graph. ", "So, My RTP Network Listener keeps listening and continues to stream as soon as the new Streamer Graph is built and started running.", "\nI don't use another communication method like RTCP at the moment. ", "Audio streaming is incomplete, so I don't have audio-video syncing problems (yet!).", "\nHere comes the important part\nAll I want is to get the real recorded date/time information from the stream. ", "MP4 filenames are in date/time format. ", "So, I know when exactly the file recording has started. ", "I know I can calculate the recording date/time using:\nRecording Start Date/Time Value + Media TimeStamp Value Of The Stream\n\nBut what if there is a gap between two recorded files? ", "When I build a new Streamer Graph, timestamps will start counting from zero again, right?", "\nHere comes the question\nSo, what is the proper way to handle this kind of situations? ", "I know RTCP is being used for audio-video syncing. ", "Can it also be used for my case as well? ", "Or do I need to use a second UDP port (just like RTCP) and send some custom date/time information messages?", "\nI can think of more than one solution to fix my problem. ", "But if there is a usual and more proper way, I don't want to use an ugly solution for this.", "\n\nA:\n\nI used an additional UDP port to send date/time information (4 bytes unix timestamp). ", "It works fine, my player counts the timer correctly and all date/time information is received with the video stream at the same time. ", "I still think there should be a better, industry standard way but since no one has decided to answer my question, I wanted to share my own solution.", "\nPort Offset : RTP Video Stream\nPort Offset+1 : Date/Time Information (Unix TimeStamp)\n\nCalculation of unix timestamp (seconds):\nFile Recording Start DataTime + Seek Time + (Media TimeStamp / 100000)\n\nHope 1: It helps someone with a similar case in the future.", "\nHope 2: Someone answers this question advicing a better method.", "\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.0006941668689250946, 0.000583078945055604, 0.0006591574638150632, 0.0008487925515510142, 0.0005948616890236735, 0.0006418157136067748, 0.000668021384626627, 0.0006394887459464371, 0.0006513588596135378, 0.0006493821274489164, 0.0005802291561849415, 0.0006312588229775429, 0.0005862446851097047, 0.0006241213995963335, 0.0008213400724343956, 0.0006494502886198461, 0.0006179640768095851, 0.0006497734575532377, 0.0006299483356997371, 0.0007877785246819258, 0.001388577395118773, 0.0006098633166402578, 0.0006307587609626353, 0.0005229216767475009, 0.0005510311457328498, 0.0005867776926606894, 0.001995444530621171 ]

[ "On Working with the Thunder\n\nWhat do you enjoy most about being the team's athletic trainer? ", "How's it been going?", "\n\nThe organization here as a whole is amazing – there are a lot of hard working, committed people doing whatever they can to keep hockey in Glens Falls. ", "Everyone has a different role, but we all work hard to do our part to give the team the best chance to succeed. ", "The staff has always focused on bringing in great hockey players that are also good people – team culture is very important to us and that is one of the best aspects of working with the Thunder. ", "I have great support on the medical side as well - we have great team physicians and other healthcare providers that are involved in maintaining the health and wellness of our players. ", "It’s great to be surrounded by such wonderful people who genuinely care about them as people, not just as athletes.", "\n\nAre there any particular challenges that come with the role?", "\n\nSometimes it’s challenging to be both the athletic trainer and strength coach – it can be a little overwhelming some days if there are a lot of injuries and treatments to do, and then trying to find time to plan the workouts for the team. ", "But I have great interns and helpers who do whatever they can to take some tasks off my plate so I can focus on the important stuff. ", "Our players are also awesome – they understand that everyone in our organization wears many hats, and they are great about being patient and letting you prioritize what needs to be done first.", "\n\nThe travel in this league can also be very exhausting at times. ", "We all do our best to stay positive and balance work and rest but I’d be lying if I said it wasn’t challenging! ", "Lots of late nights and naps on the bus when we can.", "\n\nWe understand that you're one of two female athletic trainers in the ECHL. ", "We think that's awesome! ", "What are your thoughts on that?", "\n\nTara Guilliland-Smith with Brampton and I are the 2 female athletic trainers in our league. ", "While it still may not be a common thing to see female athletic trainers working with mens professional teams, it’s been really positive to see female Athletic Trainers in the other big sporting leagues recently –the NFL, MLB and NBA all have teams that have had female Athletic Trainers on staff. ", "The number of women getting into athletic training now outnumbers men, so things will have to change based solely on the math. ", "As cliché as it may sound, I think you just have to do the work - work hard, do your job well, and show that women can do just as great a job as men can. ", "That’s the only way for us to prove that we belong and open doors for other women to get opportunities as well.", "\n\nI’ve been very fortunate – every team and organization that I have worked with has treated me just like any staff member regardless of gender. ", "There are some awkward situations that arise, but we’re all professionals and when the players trust you and know you’re going to do the right thing by them I don’t think they really care what gender you are – they just want someone who does a good job, knows their stuff, and cares.", "\n\nWhat are some of the most frequent injuries that you encounter?", "\n\nTons of contusions from blocking shots and body contact. ", "We see a lot of lacerations as well. ", "Shoulders, hips, and wrists are very common areas for hockey injuries. ", "It’s a long season and a physical league, so there are a lot of wear and tear type injuries that build up over time too.", "\n\nAny advice you would offer anyone aspiring to be an athletic trainer?", "\n\nAlways be prepared- you’ll save yourself a lot of angst if you make sure you have what you need, and appearing efficient just makes you look good.", "\n\nRegardless of what sport you think you want to work in, work as many different sports as you can when you’re a student. ", "You’ll see a variety of different injuries and that makes you a more well-rounded healthcare professional.", "\n\nSometimes in this role you have to make difficult decisions that aren’t always easy to make, and you can’t please everyone. ", "But you’ll never regret doing the right thing. ", "If you can look at yourself in the mirror each night and know you did what was best for your athletes – you’re on the right track.", "\n\nIt’s also really important to remember that your needs matter too – those of us that spend our lives caring for others need to remember that. ", "I always start my day with a workout before the players arrive – when things get challenging and you get pulled in different directions, it’s a good feeling to know that you did something for yourself first.", "\n\nOn a Typical Day with the Thunder\n\nA typical practice or home game day for me starts pretty early. ", "I’m usually the first one to get to the arena around 6:30am so I can get a workout in before our staff meeting at 7:30am. ", "The coaches, equipment manager Alex Mann and I meet most days to go over the injury report, the line ups, roadtrips – basically just making sure the staff is on the same page. ", "After that, I spend my time getting ready for practice and the day before the players arrive – I put workouts on the board for the team, prepare for treatments, set the bench up for practice. ", "I have interns that help us with the preparations as well. ", "If we are hosting a visiting team, Alex and I will get their locker rooms set up and make sure they have all the supplies they need. ", "I’ll do treatments both before and after practice depending on what injuries we have going on and where players are at in their recovery. ", "During practice you’ll find me on the bench making sure everyone is safe. ", "After practice I’ll wrap up treatments, check in with our physicians and provide any updates they may need, set up any appointments for players that need to be made, injury documenting and workers compensation updates, and then clean-up for the next day.", "\n\nIf it’s a gameday, we’ll take a break for a couple of hours and come back in the afternoon for another round of set up and treatments before the game. ", "I’m on the bench for warms ups and during the game to take care of any injuries that occur, and during intermissions we stay ready for anything the players may need.", "\n\nOn the road, the routine can change a lot depending on our travel schedule – there’s less set up and more heavy lifting. ", "But for me, it still centers around treatments and making sure the players get what they need to be ready for the game." ]

{ "pile_set_name": "OpenWebText2" }

[ 0.000640505226328969, 0.0006507634534500539, 0.0006570211844518781, 0.0005603765603154898, 0.0005980602581985295, 0.0005590450018644333, 0.0005415930645540357, 0.0006831008940935135, 0.0005254247807897627, 0.0006447625928558409, 0.0009942789329215884, 0.0005488343304023147, 0.000705475453287363, 0.002468257676810026, 0.005617569666355848, 0.0007016790914349258, 0.0006744427373632789, 0.001143625588156283, 0.0005906310398131609, 0.0008795344620011747, 0.08308486640453339, 0.0226718932390213, 0.0005614118417724967, 0.004178748466074467, 0.0009592327405698597, 0.15935105085372925, 0.000578681065235287, 0.0005942386342212558, 0.0008009390439838171, 0.0006212184089235961, 0.08013871312141418, 0.0016095954924821854, 0.0005557682598009706, 0.0009802791755646467, 0.0010975756449624896, 0.0008275880827568471, 0.0008309765253216028, 0.0007305025937967002, 0.000905571214389056, 0.0006734128692187369, 0.0005383552052080631, 0.0006364968721754849, 0.0005451093311421573, 0.0005883129197172821, 0.0006134351133368909, 0.0008673840784467757, 0.0005792574374936521, 0.0006712586618959904, 0.0006219865754246712, 0.0006451193476095796, 0.0005515978555195034 ]

[ "1. ", "Field of the Invention\nThe present invention relates to a non-contact feeder system, and more particularly, to a non-contact feeder system in which a phase and a direction of an AC current of a feeding cable are controlled or a connection structure of the feeding cable is improved, thereby decreasing a space to mount the non-contact feeder system and improving an efficiency of a power supply.", "\n2. ", "Description of the Related Art\nTo carry products or determine positions of the products on a production line or a distribution system, a moving system having a moving object, such as a carrier, is generally used. ", "To supply an electrical power to the moving object and operate the moving object, a power cable has been connected to the moving object, which causes noise and dust because the power cable is dragged together with the moving object. ", "Further, the power cable may be damaged or cut because the power cable is repeatedly bent while being dragged.", "\nTo solve the above problem, a non-contact feeder system supplies the electrical power to a moving object without contacting a power cable to the moving object. ", "In the non-contact feeder system, a feeding cable, through which an AC current flows, is prepared along a moving direction of the moving object, and an induced current is generated from a magnetic field formed around the AC current flowing through the feeding cable and is supplied to the moving object.", "\nAs shown in FIG. ", "1, a conventional non-contact feeder system comprises an AC power supply 121 to supply an AC current, a parallel round cable 111 arranged along a moving direction of a moving object 160, which moves back and forth with respect to the parallel round cable 111, and a pick-up part 131 moving together with the moving object 160 and inducing an induced current from a magnetic field formed around an AC current flowing through the parallel round cable 111.", "\nAs an electrical capacity required for the moving object 160 increases, as shown in FIG. ", "2, a non-contact feeder system having two AC power supplies 121 and 122 and two parallel round cables 111 and 112 connected to corresponding ones of the AC power supplies 121 and 122 has been used to supply an electrical power to the moving object 160.", "\nHowever, in the conventional non-contact feeder system, if AC currents are supplied to the two parallel round cables 111 and 112 by using the two AC power supplies 121 and 122, the pick-up parts 131 and 132 covering each of the parallel round cables 111 and 112 should be spaced apart from each other at a predetermined interval “d” as shown in FIG. ", "3. ", "This is required because each of the AC power supplies 121 and 122 is separately controlled and a phase and a direction of an AC current supplied from each of the AC power supplies 121 and 122 to each of the corresponding parallel round cables 111 and 112 are separately determined. ", "Thus, a direction of a magnetic field formed around one of the parallel round cables 111 and 112 is formed independently from the other one of the parallel round cables 111 and 112. ", "If each AC current has a direction as shown in FIG. ", "3, the magnetic fields formed around the parallel round cables 111 and 112 destructively interfere with each other, thereby decreasing an efficiency of the induced current.", "\nThus, in the conventional non-contact feeder system, if more than two parallel round cables 111 and 112 are prepared to supply the AC currents from more than two AC power supplies 121 and 122 to the moving object, the parallel round cables 111 and 112 should be spaced apart from each other at predetermined intervals, thereby decreasing the efficiency of the induced current." ]

{ "pile_set_name": "USPTO Backgrounds" }

[ 0.0009391900966875255, 0.0005865833954885602, 0.001185585861094296, 0.0005756584578193724, 0.0008211397216655314, 0.0009146546362899244, 0.0007160627865232527, 0.0006325988797470927, 0.0006297628278844059, 0.0006466084159910679, 0.0005969842313788831, 0.0006647355039604008, 0.0005927226739004254, 0.00117425003554672, 0.0006047310307621956, 0.0006084820488467813, 0.0005902776028960943, 0.0006689649890176952, 0.0006222625379450619 ]

[ "/*\n Copyright 1999-2018 ImageMagick Studio LLC, a non-profit organization\n dedicated to making software imaging solutions freely available.", "\n \n You may not use this file except in compliance with the License.", "\n obtain a copy of the License at\n \n https://www.imagemagick.org/script/license.php\n \n Unless required by applicable law or agreed to in writing, software\n distributed under the License is distributed on an \"AS IS\" BASIS,\n WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.", "\n See the License for the specific language governing permissions and\n limitations under the License.", "\n\n MagickCore token methods.", "\n*/\n#ifndef MAGICKCORE_TOKEN_H\n#define MAGICKCORE_TOKEN_H\n\n#if defined(__cplusplus) || defined(c_plusplus)\nextern \"C\" {\n#endif\n\n/*\n Typedef declarations.", "\n*/\ntypedef struct _TokenInfo\n TokenInfo;\n\nextern MagickExport int\n Tokenizer(TokenInfo *,const unsigned int,char *,const size_t,const char *,\n const char *,const char *,const char *,const char,char *,int *,char *);\n\nextern MagickExport MagickBooleanType\n GlobExpression(const char *,const char *,const MagickBooleanType);\n\nextern MagickExport TokenInfo\n *AcquireTokenInfo(void),\n *DestroyTokenInfo(TokenInfo *);\n\nextern MagickExport void\n GetNextToken(const char *,const char **,const size_t,char *);\n\n#if defined(__cplusplus) || defined(c_plusplus)\n}\n#endif\n\n#endif\n" ]

{ "pile_set_name": "Github" }

[ 0.0006127945962361991, 0.0006242965464480221, 0.0006019687280058861, 0.0005530848284251988, 0.0007745266193524003, 0.0009205727255903184, 0.00959318783134222 ]

[ "vision\n\nSustainable development is a mind set !", "\nIt is about breaking down assumptions about how things are done.", "\nIt is about collaboration & sharing ideas & innovative concepts.", "\nIt is about being creative in re-thinking our business processes in ways that make us not only more efficient but also more environmentally and socially responsible. « ", "Don’t destroy what you came to enjoy »\n\nObjectives\n\nProtect our playgrounds, the mountain and the wave\n\nMeasure and reduce the environmental footprint of our products\n\nOptimize our process\n\nTrain all employees about sustainability issues linked with their job\n\nInform and help raise sustainability awareness of our clients and consumers\n\nCommitment projects\n\nQuiksilver Campus\n\nThe campus illustrates Quiksilver’s commitment to eco-construction and to sustainable development in general. ", "It is designed to meet high environmental quality standards, and symbolizes the union ofarchitecture and nature.", "\n\n1. ", "A site in harmony with the environment:\n\n- The buildings are perfectly integrated into their surroundings\n\n- The forest has been restored on the hillside, with 600 trees replanted and a new orchard using old varieties of fruits trees.", "\n\n2. ", "Carefull y selected products, systems and construction processes\n\n- «Cabin» offices were designed to blend into the forest. ", "They have been built using Douglas pine, sourced from a sustainable, managed and replanted European forest.", "\nThe construction is made up of prefabricated elements; the assembly of the elements is done without using any water. ", "Wood was the material of choice, not just architecturally but also for ecological reasons, as it is carbon neutral.", "\n\n3. ", "Energy management\n\n- Optimized energy use: 85 kWh/m2/yr and with a low CO 2 footprint when in use: 3 kg of C02 eq/m2/yr The building has large windows and is open to nature. ", "The work areas are submerged with light, but are protected from excessive exposure to the sun by high quality glass, generously overhanging roofs and movable solar protective devices.", "\n\n- A special approach has been introduced to monitor and improve the building’s energy performance. ", "It aims to encourage personnel to act responsibly and show awareness in their use of lighting, air-conditioning and heating in the building, in order to save energy wherever possible. ", "Through the use of natural, user-controlled ventilation and innovative technologies such as phase-change materials, the complex should come close to achieving a BBC (Low Energy Building) level of performance.", "\n\n- An energy check-up will then be done to verify the energy efficiency of the installations and optimize the energy budget.", "\n\n4. ", "Waste Management\n\n- Plan for a composter to process natural waste from the green areas and the restaurant\n\n- Waste sorting spots spread across the campus\n\n« Patrick Arotcharen managed to created a place that is just like us, the reflection of our lifestyle, a brilliant tool that will accompany Quiksilver’s growth in the years ahead and we are delighted that the Campus has been honoured with this new distinction » Pierre Agnes (President Quiksilver Europe)\n\nIn March 2011 Patrick Arotcharen, Quiksilver’s respected architect, was the award winner of the Prix Amo 2010 “Working place, Architecture and Environment” for the design and construction of the Quiksilver Campus. ", "Created in 1983, this prize rewards the architect who has designed and conceived a structure which stands out for its architectural and environmental qualities, as well as its eco-construction and sustainable development.", "\n\n« The aim was to create a place which offered a close relationship with nature, a reflection of the surfer’s culture of living outdoors and playing with the energy of the wave or the effects of sliding down the snowy slopes and enjoying every moment. » ", "Patrick Arotcharen (Architect)" ]

{ "pile_set_name": "Pile-CC" }

[ 0.0007322569144889712, 0.0006884391186758876, 0.0005805303226225078, 0.0005789122078567743, 0.0010067515540868044, 0.0006345341098494828, 0.0009391900966875255, 0.0005645555211231112, 0.001185585861094296, 0.0005734559381380677, 0.0007084659300744534, 0.000728779355995357, 0.0005850560264661908, 0.00117425003554672, 0.0006016939296387136, 0.0006694688345305622, 0.000531115394551307, 0.0005327266990207136, 0.0005829253350384533, 0.0005454671336337924, 0.0012900278670713305, 0.0007621838594786823, 0.0005570289213210344, 0.0005984454182907939, 0.0007059852941893041 ]

[ "Ethics and dentistry: 2. ", "Ethics and risk management.", "\nThe previous paper explored the meaning of ethics, especially its relationship to dentistry. ", "Here, we examine a practical application for solving ethical problems. ", "Together, the two articles should provide dentists with a core of relevant knowledge about ethics and a ready guide to the daily relevance of ethics." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.0006013167439959943, 0.0006243840325623751, 0.0005294645670801401, 0.0005471000331453979, 0.0005227592191658914 ]

[ "Category Archives: Feminist Posts\n\nBeing feminist doesn’t mean that you believe that women need to be babied or that women are better than men. ", "That isn’t the least bit true at all. ", "Being a feminist means that you believe that women should have the same social status, same pay, same rights as men. ", "In my state in the US, Men get paid annually a little over $61,000 a year, while women get paid $50,000 a year (AAUW table for 2015 reports). ", "Why is this a problem you ask yourself? ", "It is a problem because women are just as capable of doing the work men do. ", "Women should not have this social and intellectual standard. ", "They shouldn’t be expected to clean the house and take after the kids and not have a job. ", "In this day in age, it’s almost impossible to do that with the amount of money needed to support a family. ", "But why must there be a page gap? ", "If women are doing the same amount of work as men, shouldn’t they be paid the same?", "\n\nI believe also, that all women have the right to contraception and birth control pills. ", "Being on birth control doesn’t mean that you don’t want to have kids period. ", "It means that you’re smart enough to know that the possibility of pregnancy isn’t a risk you’re willing to take at that point in your life. ", "It’s called being RESPONSIBLE. ", "Yes, you can always not have sex and reduce the risk all together, but for some, birth control is a safe, preferred form of protection.", "\n\nFeminism isn’t about making women look like they’re attention seekers (although some are #sorrynotsorry). ", "Feminism is about empowering women and making women feel like they have a voice. ", "Here are some links to great TedX Talks, commercials and books that discuss feminism and explain what it’s really about.", "\n\nI really hope this helped you to understand feminism more and that you have a better understanding of it! ", "If your opinions don’t match mine, that’s totally fine! ", "Just be yourself and stay strong in your morals and that’s all that matters to me!" ]

{ "pile_set_name": "Pile-CC" }

[ 0.0566733255982399, 0.001016015070490539, 0.04528631269931793, 0.0009120621834881604, 0.0011437846114858985, 0.06864947825670242, 0.28298258781433105, 0.02581680379807949, 0.0007918902556411922, 0.0007511585135944188, 0.03935178369283676, 0.15564943850040436, 0.19941522181034088, 0.00231462181545794, 0.0008536099339835346, 0.03649952635169029, 0.06850167363882065, 0.02407364919781685, 0.0005930020706728101, 0.0006024562753736973, 0.0008147567277774215, 0.049308646470308304 ]

[ "UiO linguist makes sensational claim: English is a Scandinavian language\n\nContrary to popular belief, the British did not 'borrow' words and concepts from the Norwegian and Danish Vikings and their descendants. ", "What we call English is actually a form of Scandinavian.", "\n\nThe sentence structure in Middle English - and thus also Modern English - is Scandinavian and not Western Germanic. (", "Illustration: Hanne Utigard)\n\n\"Have you considered how easy it is for us Norwegians to learn English?\" ", "asks Jan Terje Faarlund, professor of linguistics at the University of Oslo. \"", "Obviously there are many English words that resemble ours. ", "But there is something more: its fundamental structure is strikingly similar to Norwegian. ", "We avoid many of the usual mistakes because the grammar is more or less the same.", "\n\nFaarlund and his colleague Joseph Emmonds, visiting professor from Palacký University in the Czech Republic, now believe they can prove that English is in reality a Scandinavian language, in other words it belongs to the Northern Germanic language group, just like Norwegian, Danish, Swedish, Icelandic and Faroese. ", "This is totally new and breaks with what other language researchers and the rest of the world believe, namely that English descends directly from Old English. ", "Old English, or Anglo-Saxon, is a West Germanic language, which the Angles and Saxons brought with them from Northern Germany and Southern Jylland when they settled in the British Isles in the fifth century.", "\n\nOld English died out\n\n\"Modern English is a direct descendant of the language of Scandinavians who settled in the British Isles in the course of many centuries, before the French-speaking Normans conquered the country in 1066,\" says Faarlund. ", "He points out that Old English and Modern English are two very different languages. ", "Why?", "\n\n\"We believe it is because Old English quite simply died out while Scandinavian survived, albeit strongly influenced of course by Old English,\" he says.", "\n\nThe 'cohabitation' between the British and the Scandinavians was largely hostile. ", "Both fought for political hegemony. ", "The descendants of the Vikings gained control of the eastern and northern parts of the country. ", "The Danelaw was under the control of Scandinavian chiefs for half a century.", "\n\nLike most colonists, the Scandinavian-speaking inhabitants found no reason to switch to the language of the country they had arrived in.", "\n\"One especially important, geographic point in our study is that the East Midlands region, where the spoken language later developed into Modern English, coincides almost exactly with the densely populated, southern part of the Danelaw,\" says the professor.", "\n\nThe language changed a great deal in the period after the Normans arrived. ", "The miserable conditions people lived in at the time resulted in a complete merger of the two previously separate groups of people – the Old English speakers and the Scandinavian speakers - and out of this came Middle English - the predecessor of Modern English.", "\n\nAdopted words they already had\n\nThe language adopted many words from the Danelaw's inhabitants who were of Norwegian and Danish descent. ", "For example, all the lexical words in this sentence are Scandinavian: He took the knife and cut the steak. ", "Only he, the and and come from Old English.", "\n\n\"What is particularly interesting is that Old English adopted words for day-to-day things that were already in the language. ", "Usually one borrows words and concepts for new things. ", "In English almost the reverse is true – the day-to-day words are Scandinavian, and there are many of them,\" says Faarlund.", "\n\nThe researchers believe that Old English already had 90 per cent of these concepts in its own vocabulary.", "\n\nTook over the grammar\n\nBut the Scandinavian element was not limited to the vocabulary, which is normal when languages come into contact with each other. ", "Even though a massive number of new words are on their way into a language, it nevertheless retains its own grammar. ", "This is almost a universal law.", "\n\"But in England grammatical words and morphemes - in other words the smallest abstract, meaningful linguistic unit - were also adopted from Scandinavian and survive in English to this day.\"", "\n\nScandinavian syntax\n\nThe two researchers show that the sentence structure in Middle English - and thus also Modern English - is Scandinavian and not Western Germanic.", "\n\"It is highly irregular to borrow the syntax and structure from one language and use it in another language. ", "In our days the Norwegians are borrowing words from English, and many people are concerned about this. ", "However, the Norwegian word structure is totally unaffected by English. ", "It remains the same. ", "The same goes for the structure in English: it is virtually unaffected by Old English.\"", "\n\n\"How can you illustrate this?\"", "\n\n\"We can show that wherever English differs syntactically from the other Western Germanic languages - German, Dutch, Frisian – it has the same structure as the Scandinavian languages.\" ", "Here are some examples:\n\n* Word order: In English and Scandinavian the object is placed after the verb:\nI have read the book.", "\nEg har lese boka.", "\nGerman and Dutch (and Old English) put the verb at the end.", "\nIch habe das Buch gelesen.", "\n\n* English and Scandinavian can have a preposition at the end of the sentence.", "\nThis we have talked about.", "\nDette har vi snakka om.", "\n\n* English and Scandinavian can have a split infinitive, i.e. we can insert a word between the infinitive marker and the verb.", "\nI promise to never do it again.", "\nEg lovar å ikkje gjera det igjen.", "\n\n\"All of this is impossible in German or Dutch, and these kinds of structures are very unlikely to change within a language. ", "The only reasonable explanation then is that English is in fact a Scandinavian language, and a continuation of the Norwegian-Danish language which was used in England during the Middle Ages.\"", "\n\n\"But why the inhabitants of the British Isles chose the Scandinavian grammar is something we can only speculate on,\" says Jan Terje Faarlund." ]

{ "pile_set_name": "Pile-CC" }

[ 0.0007958963979035616, 0.0007151819881983101, 0.0006228286074474454, 0.0008102526189759374, 0.0006638415507040918, 0.0006231801235117018, 0.0005896610673516989, 0.0006409440538845956, 0.0006769767496734858, 0.0008425712585449219, 0.0009116932633332908, 0.0010124915279448032, 0.0007409111130982637, 0.0009686383418738842, 0.0006496629794128239, 0.0008085508015938103, 0.003567424602806568, 0.0008859411464072764, 0.0006977421580813825, 0.0006117107113823295, 0.0005628560320474207, 0.0006404854357242584, 0.0013276884565129876, 0.0006137912860140204, 0.009884572587907314, 0.0012250073486939073, 0.0005540752317756414, 0.0005849367007613182, 0.0006202097865752876, 0.0006560035399161279, 0.0006293898914009333, 0.0006946364301256835, 0.0006854596431367099, 0.0006065492634661496, 0.0006002634181641042, 0.0005456384969875216, 0.0006330406758934259, 0.0005730480770580471, 0.0006371694034896791, 0.0005869365413673222, 0.0008441893733106554, 0.0006391676724888384, 0.0005497382371686399, 0.032874926924705505, 0.0007723482558503747, 0.2141924649477005, 0.0006052560056559741, 0.0005580109427683055, 0.017207074910402298, 0.0007044798112474382, 0.002781395800411701, 0.4333905279636383, 0.0005781124345958233, 0.0006413005176000297, 0.0006175710004754364 ]

[ "Russia, Spain sign energy deal, smoothing investments\n\nWednesday, March 4, 2009, 08:14\n\nRussia and Spain signed an energy agreement on Tuesday that will give Spanish companies greater access to Russian fields and could smooth the path for Russian firms to buy stakes in Spanish energy companies.", "\n\nThe framework deal which was unveiled at a joint press conference between Spanish Prime Minister Jose Luis Rodriguez Zapatero and Russian President Dmitry Medvedev covers the development of oil and natural gas as well as its transport and sale, including liquefied natural gas (LNG).", "\n\nZapatero was keen to point out the agreement also included renewable energy, where several Spanish companies hold major positions including wind turbine maker Gamesa, and Iberdrola, the world’s largest wind energy producer.", "\n\n“(This agreement) opens the door to collaboration between our country and one of the biggest energy players in the world,” Zapatero told a news conference in Madrid. “", "The memorandum means greater security in Spain’s energy supplies and it guarantees better access for our companies to Russian energy reserves.”", "\n\nZapatero said Spain would make building energy ties with Russia a top priority when it takes over the European Union presidency in 2010.", "\n\nRussian-EU energy relations deteriorated after a three-week spat with Ukraine in January over pricing and payment disrupted gas supplies to many countries in Europe, calling into question Russia’s reliability as an EU supplier.", "\n\nThe Russian president played down recent rumors that talks between Sacyr and Russia’s LUKoil over the sale of the Spanish builder’s 20% stake in Repsol had been shelved due to price differences, saying “no one has closed the door on those talks.” ", "Zapatero added the question of whether or not talks continued between LUKoil and Repsol “is going to depend on the companies.”", "\n\nGAZPROM, GAS NATURAL STRIKE DEAL\n\nConcrete business deals arising from Medvedev’s official visit to Spain were limited to a gas supply agreement between Russia’s Gazprom and Spain’s Gas Natural to export Russian gas to Spain.", "\n\n“Thanks to the swap operations, these supplies will start in the near future, initially in small volumes. ", "We will develop the project involving the Shtokman field, which will be launched in 2014,” Miller said.", "\n\nGazprom’s CEO Alexei Miller told reporters in Madrid his company was also in talks with Spanish oil major Repsol over the development of Russia’s Yamal gas field and the participation of Repsol in LNG-related projects.", "\n\n“We will consider the possibility of Spanish companies taking part in Russian projects, including Yamal. ", "Gazprom is in talks about such participation with companies including Repsol,” Miller said.", "\n\nSpain’s lberdrola said on Tuesday it has signed a deal with leading Russian electricity dealer Inter Rao, to study opportunities in the Russian Federation, the EU and Latin America. (", "Reuters)\n\nRelated articles\n\nHungary will make an early repayment of EUR 78.2 million previously drawn for financing the upgrade of the Paks Nuclear Power Plant, Minister for National Economy Mihály Varga told Tuesdayʼs issue of business daily Világgazdaság.", "\n\nChina became the largest outside investor in the Central, Southeast and East European countries in 2017, according to a report published by consulting companies CMS and EMIS. ", "China increased the value of its investments in the region by 78% to EUR 7.7 billion. ", "The U.S. remained the busiest investor in terms of the number of deals.", "\n\nThe ongoing U.S. investigations regarding alleged Russian interference in last year’s American presidential election have suddenly revealed a link to Hungary, albeit a very tenuous one. ", "Carter Page, a former campaign adviser on Russia to Donald Trump, has admitted he traveled to Budapest, but apart from that, not much else.", "\n\nHungary will soon start accessing funds from a EUR 10 billion loan from the state of Russia to upgrade the Paks Nuclear Power Plant, the state secretary responsible for the investment said at a conference in Budapest on Tuesday.", "\n\nInfrastructure does not leave much room for maneuver for Hungary regarding gas imports. ", "The only solution after 2021 is still buying gas from Russia, Minister of Foreign Affairs and Trade Péter Szijjártó said yesterday.", "\n\nIn the latest of an international series, a conference entitled “Russia and Europe: Topical Issues of Contemporary International Journalism” will be held in Budapest on October 5, organized by International Affairs magazine with the support of the Hungarian Ministry of Foreign Affairs and Trade and the Federal Agency for Press and Mass Media (Rospechat) of the Russian Federation.", "\n\nConstruction work at the Paks Nuclear Power Plant could start at the beginning of next year with supplementary buildings and support facilities indispensable for building the new reactors, Attila Aszódi, state secretary in charge of maintaining the power plantʼs capacity, was reported as saying by state news wire MTI Wednesday.", "\n\nRussian President Vladimir Putin will visit Budapest for the opening of the 2017 World Judo Championships on Monday, at the invitation of Hungarian Prime Minister Viktor Orbán, the PMʼs Press Chief Bertalan Havasi said Thursday.", "\n\nBusinesses in Hungarian agriculture are not expecting market mayhem due to the Russian embargo on EU food products extended until the end of next year, as new channels have been established for selling their goods, Hungarian government-friendly daily Magyar Idők reports." ]

{ "pile_set_name": "Pile-CC" }

[ 0.000535684812348336, 0.0005446276045404375, 0.0005223029875196517, 0.000539062253665179, 0.0005188597715459764, 0.0005683859926648438, 0.0005431651370599866, 0.0006345441215671599, 0.0005822689272463322, 0.0006004794267937541, 0.0005282419151626527, 0.000588875322137028, 0.0006147089297883213, 0.0005602454766631126, 0.0006453185924328864, 0.0005216567078605294, 0.0005782003281638026, 0.0005486230365931988, 0.0005992770893499255, 0.0005478582461364567, 0.0005835693445987999, 0.0005790891009382904, 0.0005415210616774857, 0.000571768672671169, 0.0007798560545779765, 0.000522920920047909, 0.000575327139813453, 0.0005777702899649739, 0.0006225211545825005 ]

[ "Q:\n\nnull pointer exception while working on maps (Newbie) But actually am Not pointing to any null\n\nplease help me with this code iam getting this following error iam a newbie\n--------- beginning of crash\n07-08 05:12:32.223 2990-2990/com.parkaspot.najeeb.project E/AndroidRuntime: FATAL EXCEPTION: main\nProcess: com.parkaspot.najeeb.project, PID: 2990\njava.lang.", "NullPointerException: Attempt to invoke virtual method 'java.lang.", "String java.lang.", "Double.toString()' on a null object reference\n at com.parkaspot.najeeb.project.", "RecentAdapter$1.onClick(RecentAdapter.java:76)\n at android.view.", "View.performClick(View.java:5637)\n at android.view.", "View$PerformClick.run(View.java:22429)\n at android.os.", "Handler.handleCallback(Handler.java:751)\n at android.os.", "Handler.dispatchMessage(Handler.java:95)\n at android.os.", "Looper.loop(Looper.java:154)\n at android.app.", "ActivityThread.main(ActivityThread.java:6119)\n at java.lang.reflect.", "Method.invoke(Native Method)\n at com.android.internal.os.", "ZygoteInit$MethodAndArgsCaller.run(ZygoteInit.java:886)\n at com.android.internal.os.", "ZygoteInit.main(ZygoteInit.java:776)\n\ni can send the whole project or the required files please help me with it And this is my program\n`package com.parkaspot.najeeb.project;\nimport android.", "Manifest;\nimport android.content.", "Context;\nimport android.content.", "Intent;\nimport android.content.pm.", "PackageManager;\nimport android.location.", "Location;\nimport android.location.", "LocationManager;\n import android.support.v4.app.", "ActivityCompat;\n import android.support.v7.widget.", "CardView;\n import android.support.v7.widget.", "RecyclerView;\n import android.view.", "LayoutInflater;\n import android.view.", "View;\n import android.view.", "ViewGroup;\n import android.widget.", "TextView;\n\n import com.github.ivbaranov.mli.", "MaterialLetterIcon;\n\n import java.util.", "ArrayList;\n import java.util.", "Random;\n\npublic class RecentAdapter extends RecyclerView.", "Adapter<RecentAdapter.", "ViewHolder>{\nprivate Context context;\nprivate ArrayList<RecentData> mArrayList;\nprivate LayoutInflater inflater;\nprivate int[] mMaterialColors;\nLocation networkLocation;\nDouble lati,lngi;\nprivate static final Random RANDOM = new Random();\n\npublic RecentAdapter(Context context, ArrayList<RecentData> list) {\n this.context = context;\n this.mArrayList = list;\n inflater = LayoutInflater.from(context);\n mMaterialColors = context.getResources().getIntArray(R.array.colors);\n LocationManager locationManager = (LocationManager) context.getSystemService(Context.", "LOCATION_SERVICE);\n\n boolean networkEnabled = locationManager.isProviderEnabled(LocationManager.", "NETWORK_PROVIDER);\n\n if (networkEnabled) {\n if (ActivityCompat.checkSelfPermission(context, Manifest.permission.", "ACCESS_FINE_LOCATION) !", "= PackageManager.", "PERMISSION_GRANTED && ActivityCompat.checkSelfPermission(context, Manifest.permission.", "ACCESS_COARSE_LOCATION) !", "= PackageManager.", "PERMISSION_GRANTED) {\n return;\n }\n networkLocation = locationManager.getLastKnownLocation(LocationManager.", "NETWORK_PROVIDER);\n }\n\n if (networkLocation!=null){\n lati = networkLocation.getLatitude();\n lngi = networkLocation.getLongitude();\n }\n\n}\n\n@Override\npublic ViewHolder onCreateViewHolder(ViewGroup parent, int viewType) {\n View view = inflater.inflate(R.layout.parking_lots_list,parent,false);\n return new ViewHolder(view);\n}\n\n@Override\npublic void onBindViewHolder(ViewHolder holder, final int position) {\n\n holder.name.setText(mArrayList.get(position).getName());\n holder.lotTotal.setText(mArrayList.get(position).getFilled()+\"/\"+ mArrayList.get(position).getTotal());\n holder.lotService.setText(mArrayList.get(position).getService()+\"\"+\" Wheeler\");\n\n holder.nameIcon.setShapeColor(mMaterialColors[RANDOM.nextInt(mMaterialColors.length)]);\n holder.nameIcon.setLetter(mArrayList.get(position).getName());\n\n holder.cardView.setOnClickListener(new View.", "OnClickListener() {\n @Override\n public void onClick(View view) {\n Intent i = new Intent(context,MainRouteActivity.class);\n i.putExtra(\"OriginLatt\",lati.toString()); //this line shows error\n i.putExtra(\"OriginLong\",lngi.toString());\n i.putExtra(\"destinLat\",mArrayList.get(position).getLat());\n i.putExtra(\"destinLong\",mArrayList.get(position).getLng());\n i.putExtra(\"bank\",mArrayList.get(position).getName());\n context.startActivity(i);\n\n }\n });\n}\n\n@Override\npublic int getItemCount() {\n return mArrayList.size();\n}\n\npublic class ViewHolder extends RecyclerView.", "ViewHolder {\n TextView name,lotTotal,lotService;\n MaterialLetterIcon nameIcon;\n CardView cardView;\n\n public ViewHolder(View itemView) {\n super(itemView);\n\n nameIcon = itemView.findViewById(R.id.icon);\n nameIcon.setLetterSize(20);\n nameIcon.setShapeType(MaterialLetterIcon.", "Shape.", "CIRCLE);\n nameIcon.setLettersNumber(3);\n nameIcon.setInitialsNumber(3);\n\n name = itemView.findViewById(R.id.name);\n lotTotal = itemView.findViewById(R.id.lot_total);\n lotService = itemView.findViewById(R.id.lot_service);\n\n cardView = itemView.findViewById(R.id.card_view);\n\n }\n}\n}`\n\nEmulator Pic App stop null pointer\nbrothers please help me ive been spending 3 days to solve this problem but iam unable to iam new to android programmking and doing a college project please help me fix it\n\nA:\n\nWhy im seeing is that your gps won't get your location, and with that you always receive the null pointer, \nthis is the class that i use when i wanna obtain the geolocation\nLocationDetector.kt\nclass LocationDetector(val context: Context) {\n\n val fusedLocationClient: FusedLocationProviderClient = FusedLocationProviderClient(context)\n var locationListener: LocationListener? ", "= null\n\n interface LocationListener {\n fun locationFound(location: Location)\n fun locationNotFound(reason: String)\n }\n\n fun detectLocation() {\n\n //create request\n val locationRequest = LocationRequest()\n locationRequest.interval = 0L\n\n // check for permission\n val permissionResult = ContextCompat.checkSelfPermission(context, android.", "Manifest.permission.", "ACCESS_FINE_LOCATION)\n\n // if have permission, try to get location within 10 seconds\n if (permissionResult == android.content.pm.", "PackageManager.", "PERMISSION_GRANTED) {\n val timer = Timer()\n\n val locationCallback = object : LocationCallback() {\n override fun onLocationResult(locationResult: LocationResult) {\n fusedLocationClient.removeLocationUpdates(this)\n timer.cancel()\n // return location\n locationListener?.locationFound(locationResult.locations.first())\n }\n }\n\n timer.schedule(timerTask {\n fusedLocationClient.removeLocationUpdates(locationCallback)\n locationListener?.locationNotFound(\"Timeout\")\n }, 10 * 1000) //10 seconds\n\n // make request\n fusedLocationClient.requestLocationUpdates(locationRequest, locationCallback, null)\n } else {\n // if no permission\n locationListener?.locationNotFound(\"No permission given\")\n }\n }\n\nand the way that you'll neeed\nclass MainActivity : AppCompatActivity(), LocationDetector.", "LocationListener {\n var isGPSRunning = false\n override fun locationFound(location: Location) {\n AppPreferencesSingleton(applicationContext).put(AppPreferencesSingleton.", "Key.latitude,location.latitude.toString())\n AppPreferencesSingleton(applicationContext).put(AppPreferencesSingleton.", "Key.longitude,location.longitude.toString())\n}\n\noverride fun locationNotFound(reason: String) {\n when(isGPSEnabled()){\n true -> {\n println(\"Waiting for GPS fix\")\n }\n false -> {\n if (!", "isGPSRunning) {\n isGPSRunning = true\n startActivity(Intent(Settings.", "ACTION_LOCATION_SOURCE_SETTINGS))\n }\n }\n }\n}\n\nfun isGPSEnabled() = (getSystemService(Context.", "LOCATION_SERVICE) as LocationManager).isProviderEnabled(LocationManager.", "GPS_PROVIDER)\n\nThis is in KOTLIN but the adaptation is simple to do, please remember to set in your manifest the required permissions: \n<uses-permission android:name=\"android.permission.", "ACCESS_FINE_LOCATION\" />\n <uses-permission android:name=\"android.permission.", "ACCESS_COARSE_LOCATION\" />\n <uses-permission android:name=\"android.permission.", "INTERNET\" />\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.0008685853099450469, 0.0010690622730180621, 0.0007488335249945521, 0.0008303619106300175, 0.0007891395362094045, 0.000770431593991816, 0.0008709530811756849, 0.00084920838708058, 0.0007594639318995178, 0.0008510779589414597, 0.0007646704907529056, 0.0006871353834867477, 0.0010866164229810238, 0.0008739441400393844, 0.0006886900519020855, 0.0006739765522070229, 0.0008034823695197701, 0.0007489527342841029, 0.0007400851463899016, 0.0008272301638498902, 0.0008867266005836427, 0.0006921919411979616, 0.0008178194402717054, 0.0007882415084168315, 0.0008398619247600436, 0.0008206957718357444, 0.000991081353276968, 0.0008630682132206857, 0.0008217337890528142, 0.000694551388733089, 0.0007315758848562837, 0.0007572626345790923, 0.0008970393100753427, 0.000650661182589829, 0.000759604386985302, 0.001023197895847261, 0.0006593230064027011, 0.0008451740723103285, 0.001023197895847261, 0.0009189107222482562, 0.0023735295981168747, 0.0011305855587124825, 0.0007042707875370979, 0.0008013437618501484, 0.0008649489609524608, 0.0009211786091327667, 0.0007139837834984064, 0.0007537886849604547, 0.0017523784190416336, 0.0009051609667949378, 0.0011686221696436405, 0.0006913807010278106, 0.0010279773268848658, 0.0011797453043982387, 0.0011273317504674196, 0.0008169416687451303, 0.0006224529352039099, 0.0007487989496439695, 0.0007521832594648004, 0.0008519442053511739 ]

[ "Manchester United extended their unbeaten run in all competitions to 11 games and took a small step closer to the Champions League places with the draw against Liverpool on Sunday.", "\n\nJose Mourinho is desperate to strengthen his squad and rebuild it in his image and, according to the Mirror, he has made Nemanja Matic a priority signing.", "\n\nUnited banked £22m for the sale of Morgan Schneiderlin to Everton last week and want to reinvest it in Matic, who Mourinho sees as Michael Carrick’s successor.", "\n\nHe reportedly sees signing Matic as equally important to his plans as signing Atletico Madrid superstar Antoine Griezmann – who will be his main summer target – and plans to play him alongside Ander Herrera.", "\n\nAnother midfield target on United’s radar is 20-year-old Franck Kessie, according to Sky Italia.", "\n\nThe Ivory Coast international is a target for several Premier League sides after impressing in his performances for Atalanta in Serie A.\n\nPremier League top scorers: Race for Golden Boot heats up\n\nChelsea and Liverpool have both been keeping tabs on Kessie, but United have stolen a march on their rivals, with Mourinho a big fan of the £22m-rated midfielder.", "\n\nMourinho is also moving quickly to keep goalkeeper David De Gea pleased by triggering a one-year extension in his contract, according to The Sun.", "\n\nManchester United vs Liverpool player ratings Show all 22 1 /22 Manchester United vs Liverpool player ratings Manchester United vs Liverpool player ratings David de Gea: 6 The Spaniard had little to do, and thus there is little praise to offer him. ", "He couldn't do much to stop Bailly's own goal, which cruelly slipped inside his near post. ", "Getty Manchester United vs Liverpool player ratings Antonio Valencia: 7 Found Mane a difficult opposite number as Liverpool looked to exploit the left flank after Ashley Young proved to be an immovable object. ", "Kept to his task well, though. ", "Manchester United vs Liverpool player ratings Chris Smalling: 6 Lost van Dijk twice from corners and on another day he could well have been punished. ", "But he got away with it, and helped United see the game through. ", "Manchester United vs Liverpool player ratings Eric Bailly: 7 An unfortunate own goal marred an otherwise solid display. ", "United look far more assured with him in the side Getty Manchester United vs Liverpool player ratings Ashley Young: 9 He used all of his winger pedigree to stifle one of the best players in the division. ", "Salah did not get a sniff. ", "Manchester United vs Liverpool player ratings Nemanja Matic 8 Another solid dsplay marshalling United's rearguard action.", "Ran proceedings from the heart of midfield. ", "Manchester United vs Liverpool player ratings Scott McTominay 7 A quiet but effective performance from the Scot alongside Matic. ", "Manchester United vs Liverpool player ratings Juan Mata: 6 Could have written his name into United folklore with an overhead kick in the first half, but it wsan't to be. ", "Solid defensively and creative going forward. ", "Manchester United vs Liverpool player ratings Alexis Sanchez: 6 Another anonymous display. ", "Effective pressing and important in link play, but yet to make his mark for United. ", "The wait for the breakthrough moment goes on. ", "Manchester United vs Liverpool player ratings Marcus Rashford: 9 An outstanding display for the academy product. ", "Two crucial goals on his first start since boxing day. ", "Manchester United vs Liverpool player ratings Romelu Lukaku: 8 Isolated in the second half as United sat deep, but his hold-up play was crucial to United's first half double. ", "Manchester United vs Liverpool player ratings Lorius Karius: 6 Little he could about both goals which were expertly taken. ", "Relatively untroubled thereafter. ", "AFP/Getty Images Manchester United vs Liverpool player ratings Trent Alexander-Arnold: 5 A tough afternoon for the youngster, who met his match in Marcus Rashford. ", "Man Utd via Getty Images Manchester United vs Liverpool player ratings Dejan Lovren: 5 Completely dominated by Lukaku, especially in the first period. ", "Grew into the game, but questions will remain about who should partner van Dijk. ", "REUTERS Manchester United vs Liverpool player ratings Virgil van Dijk: 5 Missed two big chances from corners, but defensively found himself unstuck as Liverpool struggled to deal Lukaku and Rashford. ", "Liverpool FC via Getty Images Manchester United vs Liverpool player ratings Andy Robertson: 7 The Scottish full back put in a solid display and was effective going forward. ", "Liverpool's best defensive performer. ", "Liverpool FC via Getty Images Manchester United vs Liverpool player ratings Emre Can: 6 Struggled against McTominay and Matic in an otherwise unremarkable display. ", "Getty Images Manchester United vs Liverpool player ratings James Milner: 6 Creativity is not normally an issue for Liverpool but they lacked it in midfield. ", "United's defensive performance played a part, but for Milner, it was a game to forget. ", "Getty Images Manchester United vs Liverpool player ratings Alex Oxlade-Chamberlain 5 : A frustrating afternoon for Oxlande Chamberlain. ", "Booked early on for a foul on McTominay, and never really got going. ", "He was unsurprisingly subbed just after the hour mark. ", "AFP/Getty Images Manchester United vs Liverpool player ratings Sadio Mane: 7 A threat with his direct running and caused Valencia a number of problems. ", "His cross led to Liverpool's goal, a meritable return on a frustrating afternoon. ", "Liverpool FC via Getty Images Manchester United vs Liverpool player ratings Mohamed Salah: 5 He won't have found Ashley Young's pocked a comfortable place to reside. ", "A frustrating afternoon for the Egyptian, who revealed himself to be human after all. ", "Getty Images Manchester United vs Liverpool player ratings Roberto Firmino: 6 The Brazilian offered a link between midfield and attack but didn't have any opportunities of note. ", "A stifled afternoon for the former Hoffenheim man. ", "Getty Images\n\nThe move will see De Gea secure a bumper pay rise, increasing his wages from a reported £180,000-a-week to more than £200,000-a-week, in a bid to keep him away from the clutches of Real Madrid, whom he nearly joined in 2015.", "\n\nOne player who could leave Old Trafford this month, albeit on loan, is Marcus Rashford, with La Liga-chasing Sevilla keen to take him on, say The Sun." ]

{ "pile_set_name": "OpenWebText2" }

[ 0.0007922337390482426, 0.0009408111218363047, 0.0008609260548837483, 0.0007445896626450121, 0.0009160374174825847, 0.0009373159846290946, 0.0006041071028448641, 0.0006732033216394484, 0.007774651981890202, 0.00072062062099576, 0.0008673617267049849, 0.000945073610637337, 0.0007615601643919945, 0.0007561802631244063, 0.002172084990888834, 0.02796730026602745, 0.0007137500797398388, 0.00067070999648422, 0.001863660872913897, 0.0007797449361532927, 0.0006648714188486338, 0.0006579661858268082, 0.0007521548541262746, 0.0006594524602405727, 0.0006379891419783235, 0.0007417108281515539, 0.0007924794917926192, 0.0007295276154763997, 0.0006142427446320653, 0.000667071552015841, 0.0006462322198785841, 0.0007156056817620993, 0.0009011788060888648, 0.0006568669341504574, 0.000723548699170351, 0.0006769589963369071, 0.0006530527025461197, 0.0014748561661690474, 0.0006605564267374575, 0.004798142239451408, 0.0006636887555941939, 0.0011463894043117762, 0.0009364491561427712, 0.0006854772800579667, 0.00124054541811347, 0.0005800477811135352, 0.000694969785399735, 0.000623420113697648, 0.0007006006198935211 ]

[ "Q:\n\n¿Problemas para solucionar error en Python: \"NameError: name 'QtWidgets' is not defined\" en PyQt5?", "\n\nEl error completo sería el siguiente:\n\"Traceback (most recent call last):\n File \"C:\\Projects\\VB a Python\\Ejercicio 2\\descuentos.pyw\", line 25, in <module>\n mi_app=Ventana()\n File \"C:\\Projects\\VB a Python\\Ejercicio 2\\descuentos.pyw\", line 7, in __init__\n QtWidgets.", "QWidget.__init__(self, parent)\nNameError: name 'QtWidgets' is not defined\n>>> \"\n\nPor en cuanto al código, es el siguiente:\nimport sys\nfrom descuentos import *\nfrom PyQt5.QtWidgets import *\n\nclass Ventana(QWidget):\n def __init__(self, parent=None):\n QtWidgets.", "QWidget.__init__(self, parent)\n self.ui=Ui_Frm2()\n self.ui.setupUi(self)\n self.ui.", "BtnAceptar.clicked.connect(self.", "Aceptar)\n\ndef Aceptar(self):\n sueldo=self.ui.", "TxtSueldo.toPlainText()\n extra=self.ui.", "TxtExtra.toPlainText()\n sueldo=int(sueldo)\n extra=int(extra)\n neto= sueldo\n self.ui.", "TxtNeto.setText(str(neto))\n\nif __name__== \"__main__\":\n mi_aplicacion=QApplication(sys.argv)\n mi_app=Ventana()\n mi_app.show()\n sys.exit(mi_aplicacion.exec_())\n\nYa lo he revisado un montón y sin embargo, no encuentro dónde está el error. ", "Supongo que se encuentra dentro del primer bloque, pero ya lo he visto y reescrito varias veces y sigue sin efecto. :((", "\n\nA:\n\nPasa porque no importas QtWidgets e intentas usar el Namespace en:\nQtWidgets.", "QWidget.__init__(self, parent) \n\nTu importas QtWidget y un montón de cosas más (todo los nombres de PyQt5.QtWidgets) usando wildcard en:\nfrom PyQt5.QtWidgets import *\n\npero no al propio QtWidgets en si. ", "La solución sería cambiar la llamada al inicializador de la clase padre por:\nQWidget.__init__(self, parent) \n\no mejor usa super:\nsuper().__init__(parent)\n\nTe recomiendo no usar wildcard para importar, es un mala práctico casi siempre porque es usado para lo que no se pensó, las razones son varias:\n\nImportas al espacio de nombres actual todos los nombres del espacio importado, muchos de ellos ni los vas a usar.", "\nHace el código mucho menos legible al no conocer de forma explicita la procedencia de cada nombre. ", "En Python la legibilidad cuenta y mucho.", "\nPermite el solapamiento de nombres entre espacios de nombres de forma inadvertida, ocasionando errores a veces silentes o difíciles de depurar.", "\n\nLa gente tiende a usarlo igual que el famoso using naamespace std; de C++ para ahorrarse unos caracteres al escribir. ", "Esto no justifica su uso en absoluto, primero es más el tiempo que se pierde en depurar errores o leer el código que lo que se pierde en hacer referencia explícita al namespace en IDEs modernos con autocompletado. ", "Además podemos usar alias (import foooooooo as fo) o importar un nombre de forma explícita con from modulo import foo. ", "\nimport sys\n\nfrom PyQt5 import QtWidgets\n\nimport descuentos\n\nclass Ventana(QtWidgets.", "QWidget):\n def __init__(self, parent=None):\n super().__init__(self, parent)\n self.ui = descuentos.", "Ui_Frm2()\n self.ui.setupUi(self)\n self.ui.", "BtnAceptar.clicked.connect(self.aceptar)\n\n def aceptar(self):\n sueldo = self.ui.", "TxtSueldo.toPlainText()\n extra = self.ui.", "TxtExtra.toPlainText()\n neto = int(sueldo) + int(extra)\n self.ui.", "TxtNeto.setText(str(neto))\n\nif __name__ == \"__main__\":\n mi_aplicacion = QtWidgets.", "QApplication(sys.argv)\n mi_app = Ventana()\n mi_app.show()\n sys.exit(mi_aplicacion.exec_())\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.0006972820847295225, 0.0009813481010496616, 0.0008520956034772098, 0.0009152417187578976, 0.0007860171026550233, 0.000808470998890698, 0.000672730675432831, 0.0007594357011839747, 0.00599337462335825, 0.05043192207813263, 0.0008123298175632954, 0.0013282163999974728, 0.022204671055078506, 0.04336943477392197, 0.0014779260382056236, 0.025405215099453926, 0.1211220920085907, 0.014345834031701088, 0.05839082598686218, 0.001223739585839212, 0.0009702990646474063, 0.0006939270533621311, 0.00077698944369331, 0.000672730675432831, 0.0007135354680940509, 0.0006958486046642065, 0.0007046053651720285 ]

[ "Characterization of NADE, NRIF and SC-1 gene expression during mouse neurogenesis.", "\nThe p75 neurotrophin receptor (p75NTR) is a member of the tumor necrosis factor receptor superfamily. ", "p75NTR signaling events have been implicated in both cell cycle arrest and apoptosis depending on which effector molecules are associated with its intracellular domain after ligand binding. ", "Two such effector proteins, p75NTR-associated cell death executor (NADE) and neurotrophin receptor interacting factor (NRIF) promote p75NTR-mediated apoptosis, whereas Schwann cell factor-1 (SC-1) mediates neurotrophin-dependent withdrawal from the cell cycle. ", "An understanding of the expression profiles of these three interacting proteins and p75NTR during embryogenesis is critical for addressing whether these effector proteins might function outside of p75NTR-mediated signaling events. ", "The distribution of NADE, NRIF and SC-1 mRNAs during murine development suggests that the action of these genes is in fact not limited to regions of p75NTR expression. ", "Specifically, a detailed comparison of the spatial and temporal expression domains of NADE, NRIF and SC-1 during brain development revealed regions of co-expression with p75NTR but also illustrates a distinct and discordant spatial and temporal expression. ", "These results yield novel insights into the unique developmental characteristics of the three p75NTR-interacting proteins, thus revealing their diverse signaling potential during embryonic development." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.00070901436265558, 0.005177774466574192, 0.0006238180212676525, 0.0020053409971296787, 0.000550346914678812, 0.0006120976759120822, 0.000569167488720268, 0.0005396493361331522 ]

[ "SugerKrystal doesn't have any Goodies to view right now.", "\n\nHey Boys, Are you looking for a real fun time? ", "Do you want to share your dirty little secrets or do you want me to share mine? ", "Is there a fantasy to raunch for your other half and you need it to be played out. ", "Any thing goes with me. ", "Tell me your dreams desires your fantasys lets make them a reality. ", "xoxoxo Suger Krystal." ]

{ "pile_set_name": "Pile-CC" }

[ 0.0015713268658146262, 0.0008221614407375455, 0.21154071390628815, 0.04579897224903107, 0.0007237792597152293, 0.0024251933209598064, 0.6318413615226746 ]

[ "February 27, 2008\n\njereon allart.", "\n\nI love these paintings by jeroen allart so much it's almost hard to breath. ", "I love their flatness, their color, their subject matter, their composition. ", "That's all I have to say. ", "Love, pure and simple." ]

{ "pile_set_name": "Pile-CC" }

[ 0.0007480212370865047, 0.0008120446582324803, 0.0006582039059139788, 0.0010767437051981688, 0.0006658999482169747 ]

[ "An anonymous tip last month reportedly led to the seizure of more than 20 ounces of cocaine, 12 ounces of marijuana, various prescription pills, ecstasy, five firearms and more than $30,000 in west Savannah.", "\n\nAfter learning of the tip during their monthly Chatham-Savannah Counter Narcotics Team briefing on Friday, Chatham County Commissioners praised the citizen’s contribution to public safety.", "\n\nNow some of the commissioners are looking for the city of Savannah to make its own contribution to the agency — in the form of money.", "\n\nThe fact that Chatham fully funds the drug squad has become a common topic for some commissioners. ", "Commissioners Lori Brady, Dean Kicklighter, Yusuf Shabazz and Helen Stone have all expressed concerns regarding the agency’s costs — amounting to about $4.4 million this year — because a majority of the drug-related arrests occur within Savannah’s boundaries.", "\n\nAccording to the most recent report issued, agents have spent 5,558 hours working within the city of Savannah through March this year, while the second highest amount of time was worked was in Garden City, where agents logged 546 hours.", "\n\nConsidering the disproportionate share of activity in Savannah, the county should consider getting Savannah to help cover the tab, Brady said.", "\n\n“I think it is a conversation we need to have,” she said.", "\n\nKicklighter said he is concerned about the costs also, especially considering the budget challenges ahead. ", "In addition, Chatham recently received a share of local option sales tax funds that does not fairly compensate the county for the services it provides, Kicklighter said.", "\n\nCommissioner Tony Center said the sales-tax negotiations have led him and other commissioners to reevaluate all the countywide services the county provides.", "\n\nAlthough he has not concluded Savannah should be chipping in for the narcotics team, he is taking a closer look at all intergovernmental agreements to make sure the county is getting its fair share, Center said.", "\n\nCounty Manager Russ Abolt has defended the arrangement, stating the drug agency was created in 1994 in response to what was previously a fragmented drug fighting effort.", "\n\nThe countywide agency, consisting of officers loaned from other jurisdictions, was created to centralize the organization, improve communications and recognize that narcotics distribution is not confined within municipal boundaries, Abolt said.", "\n\n“Crime may be done in one jurisdiction, but the source may be in others,” Abolt said.", "\n\nAbolt said he does not agree that the cities should share in the cost of the agency. ", "Residents are already contributing to the costs through the county-wide property taxes, he said.", "\n\nThe issue stems back to previous discussions in years past between the city and council officials regarding whether the merged Savannah-Chatham police department should have more control over the narcotics team.", "\n\nChairman Al Scott said he prefers the drug squad retain its independence from the police department.", "\n\nIf the city is asked to start contributing funding — in addition to the property taxes residents already pay — city officials may obtain more influence over its operation, Scott said.", "\n\n“Then you may lose the ability to work as well as you do with the other departments and agencies,” he said.", "\n\nBoth the city and county agreed that the appropriate way to fund this cost center is through the county’s maintenance and operations budget, which is paid for by taxpayers countywide — the majority of whom are city of Savannah residents, said city spokesman Bret Bell.", "\n\nUnfortunately, the fact that city residents are county residents tends to get lost in these discussions, Bell said.", "\n\nSince the narcotics team primarily targets high-level drug operations, Bell said the city intends to start funding a Savannah-Chatham police drug unit this year that will target street-level operations." ]

{ "pile_set_name": "Pile-CC" }

[ 0.001839403179474175, 0.0005352157750166953, 0.0006402410217560828, 0.0006137993768788874, 0.0005928596947342157, 0.0005500621628016233, 0.0005579701974056661, 0.0006477232091128826, 0.0006289278389886022, 0.0006043783505447209, 0.0005950547638349235, 0.0005576044204644859, 0.0006531980470754206, 0.0006056224810890853, 0.0006852872320450842, 0.0006381186540238559, 0.0007257785182446241, 0.0005998890846967697, 0.0008519868133589625, 0.0005732064601033926, 0.001015685498714447, 0.0005614575929939747, 0.0006445951294153929, 0.0005747363320551813 ]

[ "\n388 F.Supp.2d 652 (2004)\nUNITED STATES of America,\nv.\nRajul RUHBAYAN, Defendant.", "\nNo. ", "CRIM.A. 2:02CR29.", "\nUnited States District Court, E.D. Virginia, Norfolk Division.", "\nFebruary 3, 2004.", "\n*653 *654 *655 Joseph Barry McCracken, Norfolk, VA, for Rajul Ruhbayan.", "\nJames Ashford Metcalfe, U.S. Attorneys, Norfolk, VA, for United States of America.", "\n\nOPINION AND ORDER\nREBECCA BEACH SMITH, District Judge.", "\nThis matter comes before the court on defendant's motions for judgment of acquittal and for a new trial. ", "For the reasons set forth below, the court DENIES the motions.", "\n\nI. Factual and Procedural History\nDefendant was indicted on February 12, 2002, for five offenses relating to allegedly perjured testimony given in his trial in this court, August 30 through September 5, 2000, in criminal case number 2:00cr86. ", "The five offenses are (1) conspiracy to commit perjury and obstruction of justice, in violation of 18 U.S.C. § 371; (2) corruptly influencing and attempting to influence the testimony of a witness, in violation of 18 U.S.C. § 1512(b)(1); (3) perjury in a court proceeding, in violation of 18 U.S.C. § 1623; (4) subornation of perjury, in violation of 18 U.S.C. § 1622; and (5) obstruction of justice, in violation of 18 U.S.C. § 1503. ", "Defendant was represented at the instant trial by J. Barry McCracken. ", "Evidence and argument lasted four days. ", "The jury deliberated for several hours on Friday, October 24, 2003, and on Monday, October 27, 2003, before returning guilty verdicts on all counts.", "\nThe charges in the instant trial arose out of the activities surrounding defendant's trial in 2000 on five counts of drug and firearm offenses, including being a felon in possession of a firearm and ammunition, in violation of 18 U.S.C. § 922(g)(1). ", "Defendant testified at his 2000 trial, admitting that he was a convicted felon, but denying that he was a drug dealer or that he had possessed or used guns. ", "More specifically, defendant denied possessing a pistol which police had found hidden between the cushions in the back of his van.", "\nDefendant also called Yolanda Goodman to testify on his behalf at the 2000 trial. ", "Goodman testified that she was defendant's girlfriend, that she had often been to his home, and that she had never seen him with either drugs or firearms. ", "She also testified that without defendant's knowledge, she had placed the pistol in his van. ", "On September 5, 2000, the jury convicted defendant only of two lesser included offenses, simple possession and conspiracy to possess crack cocaine.", "\nBased on her claims at defendant's 2000 trial, Goodman was indicted by the government, and charged with being a felon in possession of a firearm and ammunition in case number 2:01cr23. ", "After she was indicted, however, Goodman represented that she had nothing to do with the gun, and had testified falsely at defendant's behest to assist his defense. ", "Goodman provided the government with more than fifty letters that defendant had written to her as evidence that defendant had concocted a scheme to offer false testimony in his trial on drug and firearms offenses. ", "She subsequently pled guilty on May 9, 2001, to a criminal information charging her with obstruction of justice, in violation of 18 U.S.C. § 1503.", "\nOn February 12, 2002, defendant was indicted in the instant case on the basis of the testimony of Yolanda Goodman and the letters that she produced. ", "Defendant filed a number of pretrial motions, including a motion to dismiss the indictment on the basis of collateral estoppel. ", "On April 10, 2002, the court heard argument on several *656 of defendant's motions, ruling against defendant. ", "On April 18, 2002, defendant filed a notice of appeal, and on May 20, 2002, this court stayed all further proceedings pending the result of defendant's appeal. ", "On April 7, 2003, the court of appeals affirmed the judgment of this court regarding defendant's claim of collateral estoppel. ", "United States v. Ruhbayan, 325 F.3d 197, 205 (4th Cir.), ", "cert. ", "denied, 540 U.S. 899, 124 S.Ct. ", "252, 157 L.Ed.2d 180 (2003). ", "This court then held a hearing on defendant's remaining pretrial motions on June 25, 2003.", "\nAt trial, the government introduced the testimony on direct examination of seven witnesses, and the rebuttal testimony of six witnesses. ", "The defendant called one witness and also took the stand in his own defense. ", "The court admitted into evidence more than ninety exhibits, including stipulations.", "\nWithout question, the government's most important evidence was the testimony of Yolanda Goodman and the letters written to her by defendant. ", "Goodman testified that defendant had pushed her to find a non-felon to claim possession of the gun found in defendant's van. ", "When she was unable to locate such an individual, Goodman testified, defendant encouraged her to claim the gun herself, and provided instructions on how to approach his lawyer and testify.", "\nAmong the statements in defendant's letters[1] were the following:\nFor me to get out of here is so simple. ", "1 person who does not have a [Blank] is whats needed. ", "it's that simple....\n... [O]nce the right person is found to claim the gun then the law[y]er can really guide us. ", "It's that simple.", "\n(Ex. ", "L-1 at 3.)", "\nWe need to find a person for the gun, Think who would or could be possibilities, find out who doesn't have felonies. ", "Its that simple....\nThose who you think could work Talk to me First, before acting out. ", "Okay? ", "Follow my guidance (commands & do not go above them), simply fulfill them. ", "Okay?", "\n(Id. at 8.)", "\n... I need a non-felon. ", "I need it now. ", "There are thousands upon thousands of people in Suffolk without felons.", "\n(Ex. ", "L-3 at 2.)", "\nBaby all I really have ag[a]inst me is a gun. ", "Once you claim the gun; then we go to court. ", "On the court date; they will drop the charges against me. & ", "may [or] may not pick them up on you.", "\n(Ex. ", "L-4 at 1.)", "\nTell my lawyer that you are calling for Rajul Ruhbayan. ", "That you would like to confess to the gun found in my van stuffed between the rear seat back cushions. ", "That the gun is all black & that it did have some bullets in it.", "\n\n. . . . .", "\n... [W]hen you talk to my lawyer, don't tell him any more or less than I've put in this letter. ", "This is a command from your king! ", "Submitt!", "\n(Ex. ", "L-5 at 6-7.)", "\nAs for the gun. ", "Since I had no knowledge of it being in the van or you having it you are basically free to say what you want on how you got it.", "\n\n. . . . .", "\nI want cross you up on the gun & your story. (", "Ex. ", "L-9 at 8-9.)", "\nMe doing 5 to 8 years doesn't help. ", "You doing 18 months shows your real.", "\n(Ex. ", "L-12 at 6.)", "\nDefendant filed these motions for judgment of acquittal and for a new trial on *657 November 4, 2003.[2] The government filed a consolidated response on November 14, 2003. ", "Both motions are now ripe for review.", "\n\nII. ", "Analysis\nA. Motion for Judgment of Acquittal\n\"[T]he court on the defendant's motion must enter a judgment of acquittal of any offense for which the evidence is insufficient to sustain a conviction.\" ", "Fed.", "R.Crim.", "P. 29(a). ", "A defendant may move for a judgment of acquittal within seven days after a guilty verdict. ", "Fed.", "R.Crim.", "P. 29(c).", "\nDefendant's motion raises three arguments: (1) judgment of acquittal should be entered as to all counts of the indictment based on insufficiency of the evidence; (2) judgment of acquittal should be entered as to Count 1 because the judgment of conviction is barred by Wharton's Rule; and (3) judgment of acquittal should be entered as to Count 2 and Count 4 because they duplicate Count 5.", "\n1. ", "Sufficiency of the Evidence\nIn reviewing the sufficiency of the evidence supporting a conviction, \"the relevant question is whether, after viewing the evidence in the light most favorable to the prosecution, any rational trier of fact could have found the essential elements of the crime beyond a reasonable doubt.\" ", "Jackson v. Virginia, 443 U.S. 307, 319, 99 S.Ct. ", "2781, 61 L.Ed.2d 560 (1979) (emphasis omitted). ", "Under this standard, the evidence presented was sufficient for a rational jury to find the essential elements of each offense of conviction. ", "Rather than scrutinize all of the government's evidence, the court will limit its discussion to the testimony of Yolanda Goodman and the letters written by defendant, as they are more than sufficient to address this claim.", "\nDefendant argues that Goodman's testimony was not credible because she was an alleged accomplice and cooperating witness for the government, she made statements inconsistent with her testimony at prior proceedings, and she has been convicted of offenses involving dishonesty. ", "The jury was instructed on each of these points, and defendant cross-examined Goodman as to both bias and inconsistent statements. ", "Moreover, \"the testimony of a defendant's accomplices, standing alone and uncorroborated, can provide an adequate basis for conviction.\" ", "United States v. Burns, 990 F.2d 1426, 1439 (4th Cir.1993). ", "A rational jury could credit the testimony of Yolanda Goodman and find it sufficient to support defendant's conviction.", "\nDefendant also argues that the letters submitted to the jury were \"ambiguous at best and subject to varied interpretations.\" (", "Mem. ", "in Supp. ", "of Mot. ", "for Acquittal at 2.) ", "The jury heard the testimony of defendant and Yolanda Goodman and the argument of counsel on the meaning of the letters. ", "A rational jury could determine that the letters were not ambiguous and find them, combined with the testimony of Yolanda Goodman, sufficient to support defendant's conviction.[3]\n*658 2. ", "Wharton's Rule\nWharton's Rule is a judicially-devised doctrine that \"an agreement by two persons to commit a particular crime cannot be prosecuted as a conspiracy when the crime is of such a nature as to necessarily require the participation of two persons for its commission.\" ", "United States v. Rashwan, 328 F.3d 160, 164 (4th Cir.2003) (quoting Iannelli v. United States, 420 U.S. 770, 774 n. 5, 95 S.Ct. ", "1284, 43 L.Ed.2d 616 (1975) (citation omitted)). ", "Wharton's Rule is aimed at crimes where the \"parties to the agreement are the only persons who participate in [the] commission of the substantive offense, and the immediate consequences of the crime rest on the parties themselves rather than on society at large.\" ", "Id. (quoting Iannelli, 420 U.S. at 783, 95 S.Ct. ", "1284). ", "Thus, the \"classic\" Wharton's Rule offenses are adultery, incest, bigamy, and dueling. ", "Iannelli, 420 U.S. at 782, 95 S.Ct. ", "1284.", "\nDefendant claims that his conviction of Count 1, conspiracy to commit perjury and obstruction of justice, is barred by his convictions on the other counts. ", "Defendant argues that, to the extent that the evidence presented at trial established a conspiracy, it was a conspiracy between only defendant and Goodman. ", "Without passing on whether the evidence at trial demonstrated the participation of any other co-conspirators, the court observes that the immediate consequences of perjury and obstruction of justice do not fall primarily on the actors, but on society at large and the criminal justice system. ", "See Rashwan, 328 F.3d at 164-65 (denying the application of Wharton's Rule because, among other reasons, the consequences of a scheme to commit immigration fraud \"fell not on the actors themselves, but instead on the government that they were attempting to defraud\"). ", "Consequently, Wharton's Rule does not apply to the conviction on Count 1.", "\n3. ", "Multiplicity\nMultiplicity is \"the charging of a single offense in several counts.\" ", "United States v. Burns, 990 F.2d 1426, 1438 (4th Cir.1993) (quoting 1 Charles A. Wright, Federal Practice and Procedure § 142, at 469 (2d ed.1982)). ", "Prior to trial, defendant sought to dismiss Count 2, corruptly influencing the testimony of a witness, in violation of 18 U.S.C. § 1512(b)(1), on the ground that it duplicated Count 5, obstructing justice, in violation of 18 U.S.C. § 1503. ", "The court heard argument and determined that the issue was controlled by United States v. Kenny, 973 F.2d 339 (4th Cir.1992), which held that\n[t]he fact that § 1512 more specifically addresses improper conduct involving a witness does not preclude application of § 1503. ", "The existence of a more narrowly tailored statute does not necessarily prevent prosecution under a broader statute, so long as the defendant is not punished under both statutes for the same conduct.", "\nId. at 342.", "\nRuling from the bench, the court concluded that while Kenny did not require the pretrial dismissal of a count of the indictment, \"defendant's argument might be compelling at a sentencing stage and could be rebrought at sentencing.\" (", "Apr. 10, 2002, Tr. ", "at 35.)[4] As defendant cannot be punished for the same conduct under both § 1512 and § 1503, Kenny, 973 F.2d at 342, and a \"second conviction, even if it results in no greater sentence, is an impermissible punishment,\" Ball v. United States, 470 U.S. 856, 865, 105 S.Ct. ", "1668, *659 84 L.Ed.2d 740 (1985), either Count 2 or Count 5 must be vacated if they are based on the same conduct. ", "Defendant now claims that Count 4, subornation of perjury, in violation of 18 U.S.C. § 1622, is also duplicated by the Count 5 obstruction of justice charge, and moves for judgment of acquittal on Count 4 as well. ", "Defendant does not explain why judgment of acquittal on both Counts 2 and 4 would be a more appropriate remedy than judgment of acquittal only on Count 5. ", "The court finds no reason to so grant judgment of acquittal on Count 4. ", "At sentencing, the court will consider vacating the conviction on Count 5 pursuant to its earlier pretrial rulings and Kenny.[5]\nB. Motion for a New Trial\nUpon the defendant's motion, the court may vacate any judgment and grant a new trial \"if the interest of justice so requires.\" ", "Fed.", "R.Crim.", "P. 33(a). \"", "Any motion for a new trial grounded on any reason other than newly discovered evidence must be filed within 7 days after the verdict or finding of guilty.\" ", "Fed.", "R.Crim.", "P. 33(b)(1).", "\nDefendant addresses seven grounds in support of his motion for a new trial: (1) the admission of evidence which he claims should have been barred by collateral estoppel; (2) the admission of evidence under Federal Rule of Evidence 404(b); (3) the admission of the testimony and records of defendant's counsel from his trial on drug and firearms charges; (4) the admission of evidence of specific instances of defendant's conduct; (5) the alleged loss by government agents of letters corroborating defendant's version of events; (6) evidentiary issues regarding tax returns and a portion of a prior trial transcript; and (7) vindictive prosecution.", "\n1. ", "Collateral Estoppel\nThe doctrine of collateral estoppel provides that \"when an issue of ultimate fact has once been determined by a valid and final judgment, that issue cannot again be litigated between the same parties in any future lawsuit.\" ", "Ashe v. Swenson, 397 U.S. 436, 443, 90 S.Ct. ", "1189, 25 L.Ed.2d 469 (1970). ", "Collateral estoppel bars the admission of evidence in a criminal case when a prior acquittal determined an ultimate issue in the present case. ", "Dowling v. United States, 493 U.S. 342, 348, 110 S.Ct. ", "668, 107 L.Ed.2d 708 (1990).", "\nDefendant argues that the court improperly admitted evidence regarding issues litigated in his previous trial that are barred by the doctrine of collateral estoppel. ", "The court has already ruled, however, that the ultimate issues in the present case were not determined in defendant's prior trial (Apr. 10, 2002, Tr. ", "at 35), and to the extent that this ruling was appealed, the court of appeals has affirmed.[6]United States v. Ruhbayan, 325 F.3d 197, 203 (4th Cir.), ", "cert. ", "denied, 540 U.S. 899, 124 S.Ct. *", "660 252, 157 L.Ed.2d 180 (2003). ", "As the ultimate issues in the present trial were not determined by defendant's prior acquittal, collateral estoppel does not apply to prevent the admission of the challenged evidence.", "\n2. ", "404(b) Evidence\nDefendant argues that evidence of other crimes was admitted at his trial in violation of Federal Rule of Evidence 404(b), which provides that evidence of prior crimes or bad acts may be admissible for purposes other than \"to prove the character of a person in order to show action in conformity therewith.\" ", "Such purposes include \"proof of motive, opportunity, intent, preparation, plan, knowledge, identity, or absence of mistake or accident.\" ", "Fed.", "R.Evid. ", "404(b). ", "Defendant also argues that even if the evidence admitted fits within Rule 404(b), it should have been excluded under Rule 403, which provides that \"evidence may be excluded if its probative value is substantially outweighed by the danger of unfair prejudice.\"", "\nThe court first considered these claims at a hearing on June 25, 2003, at which the court heard argument on and denied defendant's motion to preclude introduction of evidence of other crimes. ", "The court then ruled on similar evidentiary objections at trial. ", "Moreover, the court specifically instructed the jury on the purposes for which it could legitimately consider evidence of other crimes. ", "The court finds no error in the admission of the challenged evidence and stands by its prior rulings on this issue.", "\n3. ", "Testimony and Records of James Melton\nDefendant argues that the testimony of James Melton (\"Melton\"), defendant's counsel for his prior trial, and records from Attorney Melton's files[7] were admitted in violation of the attorney-client privilege recognized in Federal Rule of Evidence 501 and the attorney work-product privilege.", "\nThe court originally addressed this issue before trial on motions by both defendant and Melton to quash the government's subpoena of Melton. ", "After briefing, the court ruled that the crime-fraud exception to the asserted privileges applied. ", "United States v. Ruhbayan, 201 F.Supp.2d 682, 686 (E.D.Va.2002). ", "The court concluded that the government had established a prima facie case, which defendant did not rebut, that defendant had used Melton to engage in fraudulent or criminal activity by tricking Melton into providing Yolanda Goodman's perjured testimony to the jury. ", "Id. The court concluded that \"[b]y doing so, defendant vitiated any attorney-client privilege or work-product privilege which existed\" for conversations between Melton and defendant in the course of this conduct, and for the work done by Melton in preparation for Goodman's testimony at trial. ", "Id. The evidence presented at trial does not alter the court's conclusion that the crime-fraud exception to the attorney-client and work-product privileges applies, and that the evidence in question was properly admitted.", "\n4. ", "Evidence of Specific Instances of Defendant's Conduct\nFederal Rule of Evidence 608(b) prohibits the use of extrinsic evidence to impeach a witness' credibility. ", "Generally, \"[a] cross-examiner may inquire into specific incidents of conduct, but does so at the peril of not being able to rebut the witness' denials.\" ", "United States v. Bynum, *661 3 F.3d 769, 772 (4th Cir.1993). ", "The purpose of this rule is \"to prohibit things from getting too far afield — to prevent the proverbial trial within a trial.\" ", "Id. However, evidence that would be prohibited by Rule 608(b) may still be admitted if meets the requirements of Rule 404(b). ", "United States v. Smith Grading & Paving, Inc., 760 F.2d 527, 531 (4th Cir.1985). ", "Thus, extrinsic evidence which impeaches a witness' credibility may be admitted if the evidence is also \"proof of motive, opportunity, intent, preparation, plan, knowledge, identity, or absence of mistake or accident.\" ", "Fed.", "R.Evid. ", "404(b).", "\nDefendant argues that the court erred in permitting the government to call Terrance Goodman, Michael Grey, Dan Miller, and Donte Jordan to rebut defendant's answers to questions about specific instances of drug dealing or firearm use. ", "Although this testimony did reflect on the credibility of the defendant, it also served as proof of defendant's motive to lie in his trial on drug and firearm charges, and as proof that defendant's allegedly false testimony in that trial was not made by mistake or accident. ", "As the challenged testimony was admissible under Rule 404(b), its admission at trial did not violate Rule 608(b). ", "Moreover, the court found at the time, and still finds, that the testimony in question was more probative than prejudicial. ", "Fed.", "R.Evid. ", "403.", "\nDefendant claims error on the same basis in the use at trial of one of defendant's income tax returns. ", "For the same reasons, the court finds that the evidence was properly admitted under Rules 404(b) and 403.", "\n5. ", "Loss of Defendant's Letters\nAt trial, defendant testified that letters from Yolanda Goodman written to him contemporaneously with those offered by the government were lost by government agents while transferring him between jail and the federal penitentiary. ", "Defendant has offered nothing more than his own assertions on this point.[8] Defendant claims that these letters corroborated his version of the events underlying this trial, and argues that this testimony \"reflects that the Defendant was denied access to evidence potentially vital to his defense by at least the negligent, if not[] intentional[,] acts of government officials.\" (", "Mot. ", "for a New Trial at 7.)", "\nHowever, \"when the issue is preservation of potentially exculpatory evidence, the defendant must show bad faith on the part of the government to prevail on a violation of due process claim.\" ", "Holdren v. Legursky, 16 F.3d 57, 60 (4th Cir.1994). ", "The challenged evidence \"must ... possess an exculpatory value that was apparent before the evidence was destroyed.\" ", "California v. Trombetta, 467 U.S. 479, 489, 104 S.Ct. ", "2528, 81 L.Ed.2d 413 (1984). ", "Even if, as defendant alleged at trial, letters belonging to him were lost in transferring him from jail to the federal penitentiary,[9] there has been no showing that the government agents effecting the transfer would have had any reason to consider the letters of evidentiary value in the defendant's case, or that they acted in bad faith in any way. ", "Defendant's allegation does not provide grounds for a new trial.", "\n6. ", "Tax Returns and Trial Transcript\nDefendant claims that the government should not have been permitted to *662 question him at trial about whether he filed tax returns over a period of years. ", "Defendant's failure to file returns, however, supports the evidence that defendant's income during this period was derived from illegal drug sales, and therefore that defendant committed perjury at his trial on drug and firearms charges.[10] The court found at trial, and still finds, that this evidence is more probative than prejudicial for purposes of Rule 403.", "\nOn the same basis, defendant argues that the admission of a portion of a prior trial transcript reflecting his conviction for a manslaughter involving a firearm was more prejudicial than probative under the standards of Federal Rule of Evidence 609(a). ", "This evidence was highly probative, however, as defendant's theory of defense at trial rested in part on his claim that he did not use guns. ", "The court found then, and still finds, that the probative value of this evidence outweighed any potential prejudice.", "\n7. ", "Vindictive Prosecution\nA motion alleging a defect in instituting the prosecution must be raised before trial. ", "Fed.", "R.Crim.", "P. 12(b)(3). \"", "To establish prosecutorial vindictiveness, a defendant must show, through objective evidence, that (1) the prosecutor acted with genuine animus toward the defendant and (2) the defendant would not have been prosecuted but for that animus.\" ", "United States v. Wilson, 262 F.3d 305, 314 (4th Cir.2001). \"", "If the defendant is unable to prove an improper motive with direct evidence, he may still present evidence of circumstances from which an improper vindictive motive may be presumed.\" ", "Id.\nDefendant raised prosecutorial vindictiveness for the first time in this motion, rather than before trial as required by Rule 12(b)(3). ", "Defendant concedes that he cannot demonstrate actual vindictiveness, but argues that the \"unique facts of this case\" support an inference of vindictiveness. (", "Mot. ", "for a New Trial at 10.) ", "The record of this case, however, does not bear out defendant's claim.", "\nThis prosecution was not commenced because of animus, but because of more than fifty letters produced by Yolanda Goodman evidencing that defendant had committed perjury, corruptly influenced the testimony of a witness, suborned perjury, obstructed justice, and conspired to do the same. ", "The court does not find even an inference of vindictiveness, but even if there were such an inference, it would be conclusively rebutted by the government's possession of substantial evidence that defendant had in fact committed these crimes. ", "Defendant's untimely claim of prosecutorial vindictiveness provides no grounds for a new trial.", "\n\nIII. ", "Conclusion\nFor the reasons stated above, the court DENIES the defendant's motions for judgment of acquittal and for a new trial in all respects.", "\nThe Clerk is DIRECTED to forward a copy of this Opinion and Order to all parties.", "\nIT IS SO ORDERED.", "\nNOTES\n[1] Defendant agreed that he was the author of the letters in question.", "\n[2] The government comments in footnote 1 of its response that \"[i]t appears that defendant's motions were untimely by one day.\" ", "If this were in fact the case, these motions would be moot. ", "See Carlisle v. United States, 517 U.S. 416, 433, 116 S.Ct. ", "1460, 134 L.Ed.2d 613 (1996) (\"We conclude that the District Court had no authority to grant petitioner's motion for judgment of acquittal filed one day outside the time limit prescribed by Rule 29(c).\"). ", "However, in computing a filing deadline for a period of time of fewer than eleven days, intermediate Saturdays and Sundays are excluded. ", "Fed.", "R.Crim.", "P. 45(a)(2). ", "Defendant's motions were in fact timely filed by one day.", "\n[3] It is clear from the jury's verdict that they did not find defendant's testimony to be credible.", "\n[4] The government's brief on defendant's pretrial motion also candidly admitted that \"if convicted on both, defendant may have a compelling argument that he may not be sentenced on both.\" (", "Mem. ", "in Resp. ", "to Def.", "'s Mots. ", "at 38.)", "\n[5] The government has argued that Count 2, corruptly influencing the testimony of a witness, in violation of 18 U.S.C. § 1512(b)(1), and Count 5, obstructing justice, in violation of 18 U.S.C. § 1503, are not multiplicitous because they involve different conduct. ", "The whole of the government's argument is that \"a close reading of the indictment shows that each count addressed a separate portion of defendant's actions and required separate elements.\" (", "Gov't Resp. ", "at 3.) ", "It appears to the court that the conduct in each count is the same: persuading Yolanda Goodman to give false testimony. ", "However, the government will be given an opportunity at sentencing to argue that the conduct in these counts is different, to which defendant may respond in argument.", "\n[6] \"On appeal, Ruhbayan initially contended that all five counts of the Indictment were barred by collateral estoppel. ", "At oral argument, however, he narrowed the scope of his appeal, challenging only the Perjury Charge and the Subornation Charge.\" ", "United States v. Ruhbayan, 325 F.3d 197, 201 n. 1 (4th Cir.2003).", "\n[7] The records admitted consisted of three redacted letters from Melton to defendant and a computer print-out of a section of the United States Code which had been attached to one letter.", "\n[8] No inventories, records, or other evidence support that defendant had letters from Goodman when he was being transferred between jails.", "\n[9] See supra note 8.", "\n[10] Moreover, failure to file tax returns on legitimate income is illegal and is probative of one's honesty.", "\n" ]

{ "pile_set_name": "FreeLaw" }

[ 0.0008417178178206086, 0.0013785817427560687, 0.001224737847223878, 0.0007119515212252736, 0.0007281621219590306, 0.0008141183643601835, 0.0006245399708859622, 0.0007467053364962339, 0.0008825192344374955, 0.0006224325043149292, 0.000568162533454597, 0.009969892911612988, 0.0007419564644806087, 0.0006585451774299145, 0.0007204798748716712, 0.0007779358420521021, 0.0019575729966163635, 0.0008151243673637509, 0.0006506673526018858, 0.0012793994974344969, 0.0012369556352496147, 0.013302127830684185, 0.0008155244868248701, 0.0007362408214248717, 0.0007367198122665286, 0.001108462456613779, 0.0005565746105276048, 0.0007400124450214207, 0.0006588509422726929, 0.0006529770325869322, 0.0006758035742677748, 0.0008396643097512424, 0.0010973613243550062, 0.0007360177114605904, 0.0007081317598931491, 0.0006412959774024785, 0.0005875877686776221, 0.0007835982250981033, 0.0006009581265971065, 0.0005543372826650739, 0.0015578912571072578, 0.0006580338813364506, 0.0008534334483556449, 0.0006569335237145424, 0.012561180628836155, 0.0007442977512255311, 0.0008051923359744251, 0.0006898544379509985, 0.0039486950263381, 0.0011462626280263066, 0.0007917541079223156, 0.0005549690104089677, 0.0007917541079223156, 0.0007886543171480298, 0.1731792837381363, 0.0007559302030131221, 0.044420793652534485, 0.0008051923359744251, 0.000693841720931232, 0.043900296092033386, 0.005134898237884045, 0.0008835588814690709, 0.0007381481700576842, 0.0008051923359744251, 0.0006763937999494374, 0.0022404820192605257, 0.006933704949915409, 0.005532057955861092, 0.007178720086812973, 0.030319608747959137, 0.013416453264653683, 0.0010175087954849005, 0.0008051923359744251, 0.0006544358911924064, 0.000818566360976547, 0.0006567908567376435, 0.007178720086812973, 0.0017326484667137265, 0.0009988500969484448, 0.000683407299220562, 0.0010127013083547354, 0.012769185937941074, 0.0008051923359744251, 0.0006989727262407541, 0.0006826248718425632, 0.0006320028332993388, 0.0011519683757796884, 0.0021853414364159107, 0.0022228865418583155, 0.0009907849598675966, 0.0007109168800525367, 0.0009331124019809067, 0.0022228865418583155, 0.0009907849598675966, 0.0007066105608828366, 0.000813639082480222, 0.0009391900966875255, 0.0005944325821474195, 0.0008619760046713054, 0.000626104068942368, 0.0006236839690245688, 0.00074577092891559, 0.0008808727143332362, 0.0005668689263984561, 0.0005825081607326865, 0.0008865529089234769, 0.0006188977276906371, 0.0005305170780047774, 0.0012243026867508888, 0.0009658289491198957, 0.002989633474498987, 0.0008720517507754266, 0.0005972104263491929, 0.0006417331169359386, 0.0007191535551100969, 0.000800045148935169, 0.0006486442289315164, 0.0006277071661315858, 0.0009216070175170898, 0.0008251045946963131, 0.027930866926908493, 0.0007618360104970634, 0.0009116673027165234, 0.0022166408598423004, 0.000624869775492698, 0.0007305660401470959, 0.0006145884981378913, 0.0006615054444409907, 0.00117425003554672, 0.001015815301798284, 0.0007127057178877294, 0.0012048946227878332, 0.0008599967695772648, 0.000616104225628078, 0.005169257987290621, 0.0005696293083019555, 0.0006736487266607583, 0.0008531553903594613, 0.000674510607495904, 0.002904935972765088, 0.0007165078422985971, 0.000938957033213228, 0.0006599306361749768, 0.0022228865418583155, 0.0009907849598675966, 0.0006813976797275245, 0.0007917050388641655, 0.0022228865418583155, 0.0009907849598675966, 0.0007132207392714918, 0.0007415171712636948, 0.0009391900966875255, 0.0007068453123793006, 0.0010135363554582, 0.0007423171773552895, 0.000748670834582299, 0.0011602162849158049, 0.0007009609253145754, 0.0006890150252729654, 0.0006069960072636604, 0.0006793729844503105, 0.0010973613243550062, 0.0007090450380928814, 0.0007028067484498024, 0.0006821728311479092, 0.001185585861094296, 0.0006162275676615536, 0.0006902809254825115, 0.0022228865418583155, 0.000813621620181948, 0.000650915433652699, 0.0006416536634787917, 0.0006012190133333206, 0.0006819876143708825, 0.0006331302574835718, 0.000685247709043324, 0.00117425003554672, 0.0005997581756673753, 0.0006238787318579853, 0.0006618103361688554, 0.0009966481011360884, 0.0007817753357812762, 0.0007387286750599742, 0.000766193144954741, 0.0012900278670713305, 0.0007262393482960761, 0.0010577403008937836, 0.0008698235615156591, 0.0014224388869479299, 0.0006089267553761601, 0.0008168509812094271, 0.0007771248929202557, 0.0022228865418583155, 0.000813621620181948, 0.000650915433652699, 0.0006521315663121641, 0.0007156779756769538, 0.000647266220767051, 0.0006521343602798879, 0.0022228865418583155, 0.000813621620181948, 0.0008169696666300297, 0.0006298747612163424, 0.0005757328472100198, 0.0013671480119228363, 0.000666743260808289, 0.0006788251339457929, 0.011451034806668758, 0.0006191800348460674, 0.0006490094237960875, 0.0007143138791434467, 0.0006916199345141649, 0.001274407492019236, 0.0007331815431825817, 0.0006428995984606445, 0.000724981480743736, 0.001202064217068255, 0.0006654225871898234, 0.0008052368648350239, 0.000634379917755723, 0.0007582089165225625, 0.0006832066574133933, 0.0013101339573040605, 0.0007586198044009507, 0.0022228865418583155, 0.0009907849598675966, 0.0006907883216626942, 0.0006136051961220801, 0.0007029410917311907, 0.000660875637549907, 0.0007364422199316323, 0.0006055606645531952, 0.011451034806668758, 0.0006259838119149208, 0.0006333412020467222, 0.0008749510743655264, 0.0006795827648602426, 0.0033311727456748486, 0.0012429648777469993, 0.0006710257730446756, 0.0006335615180432796, 0.0009106098441407084, 0.0005484784487634897, 0.0007473553414456546, 0.0009008748456835747, 0.0007776371785439551, 0.0007152405451051891, 0.0005733302677981555, 0.0022228865418583155, 0.0009907849598675966, 0.0007097526104189456, 0.0006562377093359828, 0.0007004374056123197, 0.0005883154808543622, 0.0012243026867508888, 0.000686870189383626, 0.010609518736600876, 0.03285325691103935, 0.0007469580159522593, 0.0009353609057143331, 0.0005850122543051839, 0.0008380732615478337, 0.000696648727171123, 0.001297818380407989, 0.0005645749042741954, 0.0006879474967718124, 0.000771819322835654, 0.0007459503831341863, 0.0005827361601404846, 0.0007207755115814507, 0.0007121188100427389, 0.001421594643034041, 0.001995444530621171 ]

[ "Degenerative mitral valve regurgitation: understanding basic concepts and new developments.", "\nChronic degenerative mitral regurgitation is the most common valvular disease in the United States. ", "The objective of this review article is to impart a balanced understanding of the basic concepts and new developments in assessment and management of patients with severe degenerative mitral regurgitation. ", "Etiologic, epidemiologic, pathologic, and physiopathologic concepts are discussed, as well as the importance of surgical mitral valve repair as the current gold standard treatment. ", "Research efforts in \"decoding\" the natural history and prognosis of patients with severe degenerative mitral regurgitation have produced important insights into the surgical timing of patients with asymptomatic mitral regurgitation, and the concept of early restorative surgery has emerged." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.0006127952365204692, 0.0021738300565630198, 0.0005820173537358642, 0.0007042639772407711, 0.0006943378248251975 ]

[ "In order to find the date of the most recent common ancestor (MRCA) of all the people living today, Chang started out by constructing a simple mathematical model of population mixing. (", "See here for some background to this post.)", "\n\nHe assumed that the population is constant over time at some value N. He assumed that the generations are discrete and non-overlapping (i.e. mating took place only between males and females of the same generation). ", "He also assumed that mating was random. ", "In words, that there was equal probability of any one male in a generation to breed with any female of that same generation.", "\n\n\n\nOf course, none of these assumptions is realistic. ", "The size of a population changes with time for a variety of reasons. ", "People also do not mate at random, being more likely to choose from those nearby, and from people within their same groupings whether those be economic, social, cultural, class, religion, etc. ", "And cross-generational matings are not uncommon.", "\n\nBut for the purposes of mathematical simplicity, and to get a rough idea of the timescales involved, Chang’s simple model is worth looking at because it enables him to do a rigorous mathematical calculation for the date of the MRCA. ", "What Chang found, to everyone’s surprise, was that the date of existence of the MRCA of all the humans living today was very recent. ", "He found that the number of generations that one has to go back to get an MRCA was log(2,N), which stands for the logarithm to base 2 of the population size N. He further found that even though this was a statistical calculation, the result was very sharply peaked about this value, meaning that it was highly unlikely that the MRCA date would differ by even 1% from this value.", "\n\nIf you take a population N of size one million, the number of generations you have to go back is only 20 to get to our MRCA. ", "If you take a population of one billion, our MRCA existed about 30 generations ago, or around 1100 CE (for an average generation span of 30 years).", "\n\nSo in Chang’s model, our MCRA lived far more recently than anyone had imagined, and way less than Mitochondrial Eve (~140,000 years ago) or Homo erectus (~250,000 to one million years ago). ", "It is kind of fascinating to think that every one of us living today share at least one ancestor who was living in the Middle Ages. ", "I have been wondering who that person was, and where he or she lived, and what he or she was like.", "\n\nBut that was not the only surprising thing that Chang found. ", "Once you get an MRCA, then that person’s parents are also common ancestors for all of us, as are his/her grandparents and great-grandparents, and so on. ", "In fact, just as the number of our ancestors increase rapidly as we go back generations, so do the number of our common ancestors once we go further back than our MRCA.", "\n\nChang found that if you go far enough back, you reach a point when every single person living at that time is either the ancestor of all of us or none of us (i.e., that person’s line went extinct). ", "In other words, there is no one who lived at that time who is the ancestor of just some of us. ", "It is an all-or-nothing situation with an 80% chance of the former and 20% chance of the latter. ", "To be perfectly clear about this (because it is an important point), at one particular time in the past, 20% of the people who lived at that time have no descendants alive today. ", "Each one of the remaining 80% of the people has the entire world’s population today as descendants.", "\n\nSo all of us have the identical entire set of ancestors who lived at that time. ", "Chang calls that time the IA (standing for ‘identical ancestors’) time.", "\n\nUsing the same assumptions as before, Chang’s calculations for the number of generations to reach the IA date is 1.77log(2,N), which means that for a billion people, it amounts to about 53 generations ago. ", "This works out to 675 CE for a generation span of 25 years and 410 CE for 30 years.", "\n\nIt seems amazing (to me at least) that all of us living right now have identical ancestors that lived so recently, roughly around the period when the Prophet Muhammad lived (570-632 BCE). ", "In fact Mark Humphrys, a professor of computer science at Dublin City University in Ireland using a different technique estimates that “Muhammad, the founder of Islam, appears on the family tree of every person in the Western world.” (", "Thanks to commenter Steve Lubot for this link.) ", "But it is important to realize that there is nothing special about Muhammad or about the Western world.", "\n\nSo taking Chang’s results at face value, all the people who fight over religion today are highly likely to be descendants of each and every religious leader who lived from the time of the Prophet Mohammed and earlier. ", "So in a very real sense, they are killing their own cousins.", "\n\nOf course, Chang’s results were based on a highly simplified mathematical model. ", "In the next posting in this series, we’ll see what happens when we create more realistic scenarios of population changes and mating patterns.", "\n\nPOST SCRIPT: Clouds\n\nFlying to Los Angeles last week, I saw some beautiful cloud formations from above. ", "But none of them matched the beauty of those shown here." ]

{ "pile_set_name": "OpenWebText2" }

[ 0.0005568393389694393, 0.0005523309810087085, 0.0006764569552615285, 0.000747046316973865, 0.0015178576577454805, 0.0008493669447489083, 0.0005787594127468765, 0.0008683234918862581, 0.000601043167989701, 0.000540242763236165, 0.0006719136727042496, 0.0006570424884557724, 0.0015081986784934998, 0.0005987141630612314, 0.0009309097076766193, 0.0005604861071333289, 0.000627238885499537, 0.0006670210277661681, 0.0006682551465928555, 0.0006504878401756287, 0.0007178895175457001, 0.000738617149181664, 0.0008769867708906531, 0.0005561487632803619, 0.0008812261512503028, 0.0006805640878155828, 0.0006337345694191754, 0.0005689028184860945, 0.0005849119042977691, 0.0005494218203239143, 0.0006793419015593827, 0.0005874682101421058, 0.0007009846158325672, 0.0006744677666574717, 0.5565736293792725, 0.0006087955553084612, 0.0005369855789467692, 0.0005534977535717189, 0.0007751239463686943 ]

[ "AICAR and phlorizin reverse the hypoglycemia-specific defect in glucagon secretion in the diabetic BB rat.", "\nIndividuals with type 1 diabetes demonstrate a hypoglycemia-specific defect in glucagon secretion. ", "To determine whether intraislet hyperinsulinemia plays a role in the genesis of this defect, glucagon-secretory responses to moderate hypoglycemia induced by either insulin or a novel combination of the noninsulin glucose-lowering agents 5-aminoimidazole-4-carboxamide (AICAR) and phlorizin were compared in diabetic BB rats (an animal model of type 1 diabetes) and nondiabetic BB rats. ", "The phlorizin-AICAR combination was able to induce moderate and equivalent hypoglycemia in both diabetic and nondiabetic BB rats in the absence of marked hyperinsulinemia. ", "Diabetic BB rats demonstrated impaired glucagon and epinephrine responses during insulin-induced hypoglycemia compared with nondiabetic rats. ", "In contrast, both glucagon (9- to 10-fold increase) and epinephrine (5- to 6-fold increase) responses were markedly improved during phlorizin-AICAR hypoglycemia. ", "Combining phlorizin, AICAR, and insulin attenuated the glucagon response to hypoglycemia by 70% in the diabetic BB rat. ", "Phlorizin plus AICAR had no effect on counterregulatory hormones under euglycemic conditions. ", "We conclude that alpha-cell glucagon secretion in response to hypoglycemia is not defective if intraislet hyperinsulinemia is prevented. ", "This suggests that exogenous insulin plays a pivotal role in the etiology of this defect." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.07252545654773712, 0.014422277919948101, 0.0008692191331647336, 0.002099050674587488, 0.03566589578986168, 0.00120251823682338, 0.04546165093779564, 0.0007882853969931602, 0.003640415146946907, 0.0006114839925430715 ]

[ "House of Flying Daggers\n\nAt its height, the Tang Dynasty was one of the most enlightened empires in Chinese history. ", "But in 859AD, the Dynasty is in decline. ", "The Emperor is incompetent and the government is corrupt. ", "Unrest is spreading throughout the land, and many rebel armies are forming in protest. ", "The largest, and most prestigious, is an underground alliance called the 'House of Flying Daggers'.", "\n\nThe House operates mysteriously, stealing from the rich to give to the poor. ", "Thus, they earned the support and admiration of the people and expanded quickly. ", "Based in Feng Tian County, close to the Imperial Capital, the House of Flying Daggers has long been a thorn in the side of their hated rivals, the local deputies.", "To the fury of the deputies, even after they fought and killed the leader of the House of Flying Daggers, the House continues to thrive. ", "Under the leadership of a mysterious New Leader, the House of Flying Daggers grows ever more powerful. ", "Feng Tian County's two local captains, Leo (ANDY LAU TAK WAH) and Jin (TAKESHI KANESHIRO) are ordered to capture the new leader within ten days.", "\n\nCaptain Leo suspects that Mei (ZHANG ZIYI), the beautiful new dancer at the local Peony Pavilion is actually the daughter of the old leader, and hatches a plan to arrest her and bring her in for questioning. ", "When Mei refuses to divulge any information on the House of Flying Daggers, the two captains set up another plan. ", "This time, Captain Jin will pretend to be a lone warrior called Wind and rescue Mei from prison, earning her trust and escorting her to the secret headquarters of the House of Flying Daggers. ", "The plan works, and on their long journey to the House, Jin and Mei warm to each other. ", "Before long, Mei has developed feelings for her enigmatic protector, Wind. ", "For his part, Jin is surprised to find himself falling for Mei's headstrong charm. ", "Both struggle to contain their feelings, but under the starry night, their irrepressible desire is almost beyond their control.", "\n\nWhat lies ahead for Jin and Mei, these star-crossed lovers? ", "If this is true love, then why are there plots in their heads...and secrets in their hearts?" ]

{ "pile_set_name": "Pile-CC" }

[ 0.0006437595002353191, 0.0008349215495400131, 0.7424430847167969, 0.0019593765027821064, 0.0006131076952442527, 0.06029023602604866, 0.0005383767420426011, 0.0013274450320750475, 0.0012191886780783534, 0.000843111309222877, 0.0006972322589717805, 0.002460113726556301, 0.0007084996905177832, 0.0008979277918115258, 0.0005450945463962853, 0.0007056570029817522, 0.000741310534067452, 0.0018753374461084604, 0.0007622237899340689, 0.0007471154094673693 ]

[ "---\nabstract: 'It is shown how a quantum cellular automaton can describe very precisely the Dirac evolution, without requiring Lorentz covariance. ", "The automaton is derived with the only assumptions of minimal dimension and parity and time-reversal invariance. ", "The automaton extends the Dirac field theory to the Planck and ultrarelativistic scales. ", "The Dirac equation is recovered in the usual particle physics scale of inertial mass and momenta. ", "In this first paper the simplest case of one space dimension is analyzed. ", "We provide a technique to derive an analytical approximation of the evolution of the automaton in terms of a momentum-dependent Schrödinger equation. ", "Such approximation works very well in all regimes, including ultrarelativistic and Planckian, for the typical smooth quantum states of field theory with limited bandwidth in momentum. ", "Finally we discuss some thought experiments for falsifying the existence of the automaton at the Planck scale.'", "\nauthor:\n- Alessandro\n- Giacomo Mauro\n- Alessandro\nbibliography:\n- 'bibliography.bib'\ntitle: |\n Quantum Field as a Quantum Cellular Automaton I:\\\n the Dirac free evolution in one dimension\n---\n\nIntroduction\n============\n\nQuantum Field Theory (QFT) is the most detailed description of the dynamics of physical systems available. ", "Its predictions are extremely accurate, and have been tested in a countless number of experiments. ", "Despite its impressive predictive power, QFT is affected by a number of conceptually relevant issues, including all problems arising from the continuum, localizability, causality violation, and quantization (for a review, see Refs. [", "@sep-quantum-field-theory; @cao1993conceptual; @teller1997interpretive; @auyang1995quantum; @cao2004conceptual]). ", "The main framework is made of recipes that are validated a posteriori, e.g. the quantization rules, both the canonical and the Feynman’s path integral, the former being affected by the ordering issue, the latter being based on a mathematically undefined notion. ", "In practice a quantized theory is first formulated, and then checked a posteriori if it is renormalizable, otherwise it is discarded. ", "This process has been one of the main theory-sieve in the formulation of the so-called Standard Model [@cottingham2007introduction], the worldwide collaborative effort that succeeded in explaining a wide variety of experimental results, to the extent of being regarded as a “theory of almost everything”. ", "However, the price to pay is the limited validity of the theory, which does not accomodate gravity.", "\n\nThe issue of localizability [@reeh1961bemerkungen; @sep-quantum-field-theory] in QFT–the essential ingredient of the particle concept–is widely considered one of the most severe, since it prevents the formulation of a rigorous quantum theory of measurement for fields. ", "It is also the main hallmark of the unsolvable tension between relativity and quantum theory, as for e.g. the boost-induced delocalization of Newton-Wigner states [@fleming-Butterfield]. ", "This is also another side of the causality violation due to the Hamiltonian description, which leads to the wave-function superluminal tails [@thaller1992dirac].", "\n\nThere is no easy way for curing all the issues plaguing QFT, if not through a reconsideration of its very foundations. ", "It is common opinion that the continuum description of space-time is the source of the problem, and that at some very small scale–the Planck scale–the description should be taken discrete. ", "This is the mainstream philosophy of the approaches to quantum space-time [@connes1991particle; @snyder1947quantized], of loop quantum-gravity [@rovelli1990loop; @rovelli1995discreteness; @ashtekar1992weaving], and, in some way, of the causal set approach [@bombelli1987space]. ", "The discreteness of the Planck-scale has also the consequence that Lorentz covariance and all symmetries of QFT are no longer valid, and are recovered at the Fermi scale [@amelino2001planck1; @amelino2001planck; @magueijo2003generalized]. ", "Recently, potential experimental tests of Planck-scale phenomenology have been proposed by several authors [@Moyer:2012ws; @Hogan:2012ik; @pikovski2011probing; @amelino2009constraining].", "\n\nA description of the quantum field as a quantum cellular automaton (QCA) represents a logically coherent way of tackling the Planck scale discreteness with minimal assumptions. ", "Compared to other approaches, the QCA is motivated by a list of reasons. ", "First: it relaxes the tension between quantum theory and relativity, since it does not need relativity, which in turn is emergent from the former. ", "Second: it is quantum [*ab-initio*]{}, without the need of quantization rules. ", "Third: it is free from all the problems arising from the continuum, and doesn’t suffer violations of causality.", "\n\nA first classical automaton description for the Dirac field evolution is hidden in the nonstandard analysis formulation of the path-integral of Nakamura [@nakamura1991nonstandard], where the “infinitesimal” plays the role of the Planck length. ", "Then, the word “automaton” first appeared in relation to relativistic field-theory in the pioneering work of Bialynicki-Birula [@bialynicki1994weyl], where the automaton describes a discretization of the Weyl differential equation. ", "The automaton is synthesized by a unitary matrix, but it is still a classical one, representing an updating rule on a lattice of classical variables. ", "The possibility of using automata for describing the evolution of classical relativistic fields also emerged in the context of lattice-gas simulations, especially in the seminal work of Meyer [@meyer1996quantum], where a notion of “field automaton” first appeared, and in the papers of Yepez [@Yepez:2006p4406]. ", "In all cases, however, the automata are classical ones, and are devised as simulation tools for a discretized path-integral approach.", "\n\nRecently the quantum cellular automaton has been proposed as a minimal-assumption extension to the Planck and ultrarelativistic scales of QFT [@darianovaxjo2010; @darianovaxjo2011; @darianopla; @darianovaxjo2012]. ", "A Dirac automaton in one-dimension has been derived without imposing Lorentz covariance, starting from principles of information-theoretical nature (for a nontechnical review see Ref.[@darianosaggiatore]). ", "As we will see in this paper, the automaton is described by a simple $2\\times 2$ matrix: however, despite its simplicity, the QCA describes a very rich physical phenomenology, leading to unexpected interesting predictions, e.g. it anticipates an upper bound to the inertial mass of the Dirac field [@darianopla], as a simple consequence of unitarity of quantum evolution, without invoking black-hole arguments from general-relativity. ", "Moreover, the automaton framework even allows to redefine fundamental physical notions and physical constants in an informational way [@darianovaxjo2011; @darianovaxjo2012].", "\n\nThe quantum cellular automaton represents an extension of QFT, in the sense that it describes also localized states and measurements that are not manageable by QFT, giving a unified description of the field dynamics at all scales, ranging from the Planck, ultrarelativistic to the usual particle-physics scale.", "\n\nIn this work we provide a thorough study of the physics emerging from the Dirac automaton in one space-dimension of Ref. [", "@darianopla], showing how the Dirac dynamics is perfectly recovered at the Fermi scale, though relativistic covariance and other symmetries are violated at the Planck and ultrarelativistic ones (a Dirac quantum automaton has also been derived recently for space dimension $d=2,3$, and will be the object of the next publication [@DP] of this series).", "\n\nThe QCA generalizes the notion of cellular automaton of von Neumann [@neumann1966theory] to the quantum case. ", "The earliest appearance of the notion of QCA in the literature dates back to 1982 from R. Feynman [@feynman1982simulating]. ", "The first QCA as we know it nowadays has been introduced in Ref. [", "@grossing1988quantum]. ", "In the following literature the QCA has been mostly a computer-science object of investigation, especially in the field of quantum information, with interesting general mathematical results [@schumacher2004reversible; @arrighi2011unitarity; @gross2012index]. ", "However, the QCA has never been used as a theoretical framework for physics, as e.g. field theory, as we will do in this paper.", "\n\nThe classical cellular automaton consists of a regular lattice, whose sites can be in a finite number of states (e.g. on and off) along with a rule that updates the state from “time” $t$ to $t+1$ . ", "This rule must be *local*, namely the state at site $x$ at time $t+1$ depends only on the states of a finite set of neighbouring sites at time $t$. In the quantum version, the sites of the lattice are quantum systems interacting unitarily with a finite set of neighbouring systems. ", "In the present context, the lattice is a Planck scale version of the notion of space. ", "The metric corresponds tocounting systems along the lattice, and the conversion from counting to the usual metric is given by a unit length which is equal to the Planck length $\\ell_P$. In a similar way the counting of the updating steps corresponds to time, with the conversion factor given by the Planck time $\\tau_P$. Specifically as a framework for QFT the quantum systems are field evaluations on the lattice, and a priori it can be taken Bosonic or Fermionic.", "\n\nAfter reviewing the one-dimensional Dirac automaton, in Sect. ", "\\[s:Dirac\\] we show how the automaton recovers precisely the Dirac dynamics in the limit of small masses and momenta. ", "Then in Sect \\[s:analytic\\] we present an analytical approximation method for evaluating the automaton evolution for single-particle states smooth in momentum and with limited bandwidth–the typical quantum states of field theory. ", "In this way we derive a momentum-dependent Schrödinger equation, which works very well in all regimes, including ultrarelativistic and Planckian. ", "We compare computer simulations with the analytic approximation, and provide the leading order corrections to the Dirac equation. ", "After discussing thought experiments for falsifying the existence of the automaton at the Planck scale in Sect.\\[s:test\\], we conclude the paper with future perspectives.", "\n\nThe one-dimensional Dirac automaton {#s:Dirac}\n===================================\n\nIn this section we review the one-dimensional Dirac automaton of Ref. [", "@darianopla], which is the focus of the present paper. ", "Then we show how the Dirac dynamics is recovered for low momenta and masses.", "\n\nDerivation of the Dirac Automaton\n---------------------------------\n\nIn QFT the unitary evolution of a field $\\v\\psi(x)$ with $\\Lambda$ internal degrees of freedom is given by $$\\begin{aligned}\n\\v{\\psi}(t+1)=U^\\dag\\v{\\psi}(t)U,\\quad \\v\\psi(x)=\\{\\psi_\\lambda(x)\\}_{\\lambda=1,\\ldots,\\Lambda}.\\end{aligned}$$ The QCA corresponding to the one-step update of the field can be described by a unitary matrix $\\v{U}$ acting linearly on the field operator $\\v\\psi$ $$\\label{eq:1}\n \\v{\\psi}(t+1)=\\v{U}\\v\\psi(t),\\quad \\v{\\psi}(t) := \n \\begin{pmatrix}\n \\dots \\\\\n \\v{\\psi}(x,t) \\\\\n \\v{\\psi}(x+1,t) \\\\\n \\dots\n \\end{pmatrix}$$ where we use the symbols $x\\in\\mathbb{Z}$ and $t\\in\\mathbb{Z}$ for the adimensional numbering of the lattice sites and time steps respectively. ", "A pictorial representation of the automaton $\\v{U}$ is shown in Fig.\\[fig:automaton\\] where the light cones depict the local structure of the evolution, and at every site $x\\in\\mathbb{Z}$ of the lattice there are $\\Lambda$ systems corresponding to the internal components of the field.", "\n\nWhen the lattice dimension is one, the most general translational invariant QCA with next-neighbouring interaction is given by $$\\begin{aligned}\n\\label{eq:Translation_invariance}\n\\v{U}=\\v{R}S+\\v{L}S^\\dag+\\v{M},\\end{aligned}$$ where $S$ denotes the shift operator $$\\begin{aligned}\nS\\v{\\psi}(x) :=\\v{\\psi}(x+1), \\end{aligned}$$ and $\\v{R},\\v{L}$ and $\\v{M}$ are $\\Lambda\\times \\Lambda$ matrixes which do not depend on the lattice site, due to translation invariance. ", "The unitarity of $\\v{U}$ implies $$\\label{eq:unitarity}\n\\begin{split}\n\\v{R}\\v{R}^\\dag+\\v{L}\\v{L}^\\dag+\\v{M}\\v{M}^\\dag=I\\,,\\\\\n \\v{M}\\v{R}^\\dag+\\v{L}\\v{M}^\\dag=0\\,,\\qquad\\v{L}\\v{R}^\\dag=0\\;.", "\n\\end{split}$$ We now derive the Dirac automaton as the minimal-dimension QCA, satisfying the following requirements\n\ni. Unitarity of the evolution;\n\nii. ", "Homogeneity of the interaction topology;\n\niii. ", "\\[tt\\] Invariance under time-reversal $t\\mapsto -t$;\n\niv. ", "\\[xx\\] Invariance under parity $x\\mapsto -x$;\n\nv. \\[minimal\\] Minimal dimension for a non-identical evolution.", "\n\nThe first two assumptions are already contained in the definition itself of QCA. ", "Assumptions \\[tt\\] and \\[xx\\] are the symmetries of the pure topology of the causal network (in Fig. ", "\\[fig:net3\\]), corresponding to considering the network as undressed. ", "The next-neighbouring interaction is not an assumption by itself, since it is always possible to reduce to such a case by grouping a periodic pattern of the network into a single node of the automaton. ", "Therefore, the only assumption is the minimality one \\[minimal\\]. ", "In equations, assumptions \\[tt\\] and \\[xx\\] correspond to $$\\begin{aligned}\n\\label{eq:timerev}\\v{T}\\v{U}\\v{T}^\\dag=\\v{U}^\\dag,\\\\\n\\label{eq:parity}\\v{P}\\v{U}\\v{P}^\\dag=\\v{R}S^\\dag+\\v{L}S+\\v{M},\\end{aligned}$$ where $\\v{T}$ is the anti-unitary operator associated to the time reversal transformation, and $\\v{P}$ is the unitary operator of the lattice reflection. ", "Notice that $\\v{P}\\v{U}\\v{P}^\\dag$ is the same as $\\v{U}$ with $S$ exchanged with $S^\\dag$. For $\\Lambda=1$ the only translational invariant QCA satisfying parity invariance is the identical one $\\v{U}=I$. Next, we have the case $\\Lambda=2$. Eq. ", "shows that $\\v{R}$ and $\\v{L}$ are unitarily equivalent, whence, from Eq it follows that they are both rank one. ", "Thus we can choose the basis where $$\\begin{aligned}\n\\label{eq:R}\n\\v{R}=\\begin{pmatrix}\na_1&a_2\\\\0&0\n\\end{pmatrix},\\quad\n\\v{\\psi}(x) :=\n \\begin{pmatrix}\n\\psi_R(x) \\\\\n\\psi_L(x) \\\\\n\\end{pmatrix},\\end{aligned}$$ naming the two components of the field $\\psi_R$ and $\\psi_L$ [ *right*]{} and [*left*]{} modes. ", "We now require $\\v{P}$ and $\\v{T}$ to be represented in such basis as $$\\begin{aligned}\n\\label{eq:repr}\n\\v{P}=\\begin{pmatrix}\n0&1\\\\1&0\n\\end{pmatrix},\\qquad\n\\v{T}=\\v{C}\\begin{pmatrix}\n0&1\\\\1&0\n\\end{pmatrix},\\end{aligned}$$ where $\\v{C}$ is the anti-unitary operator denoting complex conjugation in the representation (\\[eq:R\\]). ", "With this choice of basis the parity invariance , which implies $\\v{P}\\v{R}\\v{P}^\\dag=\\v{L}$ and $\\v{P}\\v{M}\\v{P}^\\dag=\\v{M}$, gives $$\\begin{aligned}\n\\v{R}=\\begin{pmatrix}\na_1&a_2\\\\0&0\n\\end{pmatrix}\\quad\n\\v{L}=\\begin{pmatrix}\n0&0\\\\a_2&a_1\n\\end{pmatrix}\\quad\n\\v{M}=\\begin{pmatrix}\na_3&a_4\\\\a_4&a_3\n\\end{pmatrix}\\end{aligned}$$ with $a_i\\in\\mathbb{C}$ for $i=1,\\ldots, 4$. From the time time-reversal invariance , that is $\\v{T}\\v{R}\\v{T}^\\dag=\\v{L}^\\dag$ and $\\v{T}\\v{M}\\v{T}^\\dag=\\v{M}^\\dag$, it follows $a_2=a_3=0$. Finally, using the unitarity of $\\v{U}$ we get $|a_1|^2+|a_4|^2=1$ and $\\Re(a_1\\bar{a}_4)=0$ which, up to a global phase, give the unique automaton $$\\label{eq:U}\n\\v{U}=\\begin{pmatrix}\n n S &-im\\\\\n -im & n S^\\dag\n\\end{pmatrix},\\quad n^2+m^2=1\\,.$$\n\n![", "Illustration of a one-dimensional quantum cellular automaton unitary step. ", "Each site of the lattice $x$ corresponds to a quantum field evaluation $\\v{\\psi}(x)$. The field operator at site $x$ interacts with the field $\\v{\\psi}(x\\pm 1)$ at neighbouring sites. ", "In the case of the Dirac automaton the field operator has two components (see text).[]{data-label=\"fig:automaton\"}](dirac_automaton.pdf){width=\".4\\textwidth\"}\n\n![", "Schematic of the three time steps causal network corresponding to a one-dimensional quantum cellular automaton with next-neighbouring interaction. ", "The topology of the network is left invariant by the mappings $t\\mapsto -t$ and $x\\mapsto -x$ and the dynamics of the automaton is assumed to be time reversal ($\\v{T}$) and parity ($\\v{P}$) invariant (see Eqs. ", "and ).[]{data-label=\"fig:net3\"}](net3.pdf){width=\".35\\textwidth\"}\n\nThe constants $n$ and $m$ in the last equation can be chosen positive (the relative sign corresponds to take the left-mode redefined with a minus sign). ", "The unitarity constraint $ n^2+m^2=1$ in Eq. (", "\\[eq:U\\]) forces the parameter $m$ to be $m\\in[0,1]$. As we will see in the following, $m$ plays the role of an adimensional inertial mass, whereas $n$ is the inverse of a refraction index of vacuum. ", "Thus, the inertial mass of the field is bounded from above [@darianopla], as mentioned in the introduction. ", "In the digital-analog conversion from the automaton to the usual dimensional Dirac equation, we take the Planck length $\\ell_P$ and the Planck time $\\tau_P$ as conversion factors for space and time respectively, whereas the mass conversion factor is taken equal to the Planck mass $m_P$. The maximal speed of local-state propagation in the dimensional case is then $c=\\ell_P/\\tau_P$, corresponding to the speed of light. ", "$\\ell_P$, $\\tau_P$, and $m_P$ are tree fundamental universal constants defining the measure for dimensions $[L]$ $[T]$ $[M]$, and from them one can derive any other universal constant, e.g. $\\hbar=m_P\\ell_P c$ [@darianovaxjo2012]. ", "The automaton for $m=0$ corresponds to the Weyl equation, and will be refereed as Weyl automaton.", "\n\nIn Fig. ", "\\[fig:Plot3D1\\] we give two computer evaluations of the automaton evolution for a localized state not describable by QFT, and for a smooth state of the kind used in QFT (for more details see the following).", "\n\n![(", "Colors online) The automaton ($m=0.92$) evolution for a localized state (top) and a smooth state (bottom). ", "The localized state cannot be described by QFT, whereas the smooth state is a typical QFT state (for more details see text). ", "The localized state is given by $\\ket{30}\\otimes\\tfrac{1}{\\sqrt{2}}(1,1)$. The smooth state is given by $\\sum_x g(x)\n e^{i k x}\\ket{x}\\otimes\\ket{+}_{k}$ with $g(x)$ Gaussian with mean value $x_0=30$ and width $\\hat\\sigma=3$. $\\ket{+}_{k}$ is a one particle eigenstate of the Dirac automaton with momentum $k=0.3\\pi$ (see text).[]{data-label=\"fig:Plot3D1\"}](Plot3DLocal.pdf \"fig:\"){width=\"45.00000%\"} ![(", "Colors online) The automaton ($m=0.92$) evolution for a localized state (top) and a smooth state (bottom). ", "The localized state cannot be described by QFT, whereas the smooth state is a typical QFT state (for more details see text). ", "The localized state is given by $\\ket{30}\\otimes\\tfrac{1}{\\sqrt{2}}(1,1)$. The smooth state is given by $\\sum_x g(x)\n e^{i k x}\\ket{x}\\otimes\\ket{+}_{k}$ with $g(x)$ Gaussian with mean value $x_0=30$ and width $\\hat\\sigma=3$. $\\ket{+}_{k}$ is a one particle eigenstate of the Dirac automaton with momentum $k=0.3\\pi$ (see text).[]{data-label=\"fig:Plot3D1\"}](Plot3DGauss.pdf \"fig:\"){width=\"45.00000%\"}\n\nThe same Dirac automaton of is also derived in Ref. [", "@DP], by recovering the Weyl automaton for $d=3$ as the unique minimal QCA, whereas the Dirac automaton is then the only possible local coupling of two Weyl automata (the only possible automata that can be coupled are a pair of reciprocally inverse automata). ", "In this way one obtains a two-spinor automaton, which for $d= 1$ splits into two identical automata of the form given in Eq . ", "Originally the automaton of has been derived heuristically as the one describing the free flow of quantum information [@darianopla].", "\n\nRecovering the Dirac dynamics\n-----------------------------\n\nHere we show how the Dirac QCA recovers, for low momenta and masses, the dynamics of the Dirac equation which is $$\\label{eq:dirac-equation1}\n i\\hbar\\partial_t\\v\\psi(x,t)=\\begin{pmatrix}\n -i\\hbar c\\partial_x&mc^2\\\\\n mc^2&i\\hbar c\\partial_x\n\\end{pmatrix}\\v\\psi(x,t).$$ The digital version of the equation corresponds to using adimensional $x$, $t$, and $m$ (corresponding to Planck units), with $\\hbar=c=1$. For convenience, as usual in the literature ([@ambainis2001one; @knight2004propagating; @valcarcel2010tailoring; @ahlbrecht2011asymptotic; @reitzner2011quantum]), we study the dynamics of the automaton in the momentum representation. ", "For the field operator we have $$\\begin{aligned}\n\\v\\psi(k):=\\n\\sum_{x\\in\\Z} e^{-ikx}\\v\\psi(x),\\quad k\\in[-\\pi,\\pi],\\end{aligned}$$ where with little abuse of notation we utilize the variable name $k$ to denote the Fourier transform of any function of $x$. Notice that the automaton model is naturally band-limited $k\\in[-\\pi,\\pi]$ ($k\\in[-\\pi/\\ell_P,\\pi/\\ell_P]$ in usual units) and periodic in momenta due to the discreteness of the lattice. ", "Correspondingly, for the unitary matrix $\\v{U}$ in Eq. ", "we have $$\\begin{aligned}\n\\label{eq:automaton-Uk}\n\\v{U}=\n\\int_{\\minus \\pi}^{\\pi} dk\\, \\v{U}(k),\\quad \\v{U}(k) =\n\\begin{pmatrix}\n n e^{ik} & -i m\\\\\n-i m & n e^{-ik}\n\\end{pmatrix}.\\end{aligned}$$ By taking a real power of the unitary matrix, we define an abstract Hamiltonian that describes the automaton evolution for continuous times, interpolating between time-steps, namely $\\v{U}^t=\n\\exp(-i\\v{H}t)$. Upon diagonalizing the matrix $\\v{U}(k)$ in Eq. (", "\\[eq:automaton-Uk\\]), one obtains $$\\begin{aligned}\n\\label{Hunp}\n& \\v{H}=\\int_{-\\pi}^\\pi dk\\, \\v{H}(k),\\\\\n \\v{H}(k)=& \\frac {\\omega}{\\sin(\\omega)} \\begin{pmatrix}\n -n\\sin(k)&m\\\\\n m& n\\sin(k)\n\\end{pmatrix},\\end{aligned}$$ where $\\omega(k,m)$ is the dispersion relation of the automaton $$\\label{eq:disp}\n\\omega(k,m)=\\arccos(\\sqrt{1-m^2}\\cos(k)).$$ Notice that the Hamiltonian $\\v{H}$ is unphysical, as is unphysical the continuous process between two following time-steps. ", "Indeed, one could easily see that the Hamiltonian (\\[Hunp\\]) involves interactions between all systems, including those very far apart (the “local” Hamiltonian corresponding to the finite-difference form of the usual Dirac field Hamiltonian is given by the imaginary part of $\\v{U}$ [@darianovaxjo2011]).", "\n\nWe now expand $\\v{H}(k)$ near $k =0$ and $m=0$, in order to recover the Dirac equation for the quantum field, along with the first corrections. ", "One has $$\\begin{aligned}\n\\label{eq:power-expansion}\n \\v{H}(k)&=\\sum_{i,j=0}^{\\infty}\\frac{1}{i!j!}", "\n \\left.\\frac{\\partial{\\v{H}(k)}}{\\partial k^{i}\\partial\n m^{j}}\\right |_{k,m=0}k^{i}m^{j}\\end{aligned}$$ and collecting all terms with the same overall order in $m$ and $k$, we find $$\\begin{aligned}\n\\label{eq:power-expansion2}\n \\begin{split}\n \\v{H}(k) = \\v{H}_{\\rm D}(k)&+\\frac{m}{3}\n \\begin{pmatrix}\n mk&\\tfrac{1}{2}(k^2+m^2)\\\\\n \\tfrac{1}{2}(k^2+m^2)&-mk\n \\end{pmatrix} \\\\\n &+ O(m^p k^q) \\qquad \\mbox{where } p+q = 5\n\\end{split}\\end{aligned}$$ where $\\v{H}_{\\rm D}(k)$ is the adimensional Dirac Hamiltonian of Eq. ", "in the momentum representation $$\\label{eq:dirac-hamiltonian}\n \\v{H}_{\\rm D}(k)=\\begin{pmatrix}\n -k&m\\\\\n m&k\n\\end{pmatrix}.$$ The Hamiltonian (\\[eq:dirac-hamiltonian\\]) identifies the parameters $k$ and $m$ of the automaton with the momentum and the mass of the Dirac field, respectively. ", "With the automaton operating at the Planck scale the maximal mass must coincide with the Planck mass $m_P$. Remembering the value $m_P$ in usual units $m_P= 2.17651(13) \\times 10^{-8}$kg = $1.2209 \\times 10^{28}$eV/$c^2$, a particle having rest mass $100$ GeV/$c^2$ as e.g. the Higg’s boson corresponds to an adimensional mass $m\\approx 10^{-17}$ (for the electron and the proton one would have $m_e\\approx 10^{-23}$ and $m_p\\approx 10^{-19}$, respectively). ", "Similarly a momentum of $10^{20}$eV/c, the highest ever observed for Ultra-High Energy Cosmic Rays (UHECRs, see for example [@takeda1998extension]), corresponds in Planckian units to $k_{CR}\\approx 10^{-8}$ (a high energy momentum of $1$Tev in reachable in a LHC experiments corresponds to $k_{LHC}\\approx 10^{-16}$). ", "Therefore, the relativistic approximation works very well in particle physics experiments.", "\n\nDispersion relation\n-------------------\n\nThe eigenvalues and the eigenvectors of the unitary matrix $\\v{U}(k)$ in Eq. (", "\\[eq:automaton-Uk\\]) are given by $$\\begin{aligned}\n\\label{eq:eigenstates}\nu_k(s)=e^{-is\\omega},\\;\\;\\ket{s}_k:=\\tfrac{1}{\\sqrt{2}}\n\\begin{bmatrix}\n\\sqrt{1-sv}\\\\s\\sqrt{1+sv}\n\\end{bmatrix},\\quad s=\\pm,\\end{aligned}$$ in terms of the automaton dispersion relation (\\[eq:disp\\]) and the group velocity $v=\\partial_k\\omega$.\n\nIn Fig. ", "\\[fig:3D-disp-rel\\] the automaton dispersion relation $\\omega$ is compared with the Dirac one $$\\begin{aligned}\n\\label{eq:disp-relation-dirac}\n \\omega_{\\rm D} := \\omega_{\\rm D}(k,m) = \\sqrt{k^2 + m^2}.\\end{aligned}$$ The dispersion relations show an overlap vs $k$ around $k=0$ for small $m$ corresponding to the typical particle-physics regime. ", "Analytically, the leading term correction to the Dirac dispersion is given by $$\\begin{aligned}\n\\label{eq:Dirac-approx}\n \\omega=\\omega_D\\left(1-\\frac{m^2}{6}\\frac{k^2-m^2}{k^2+m^2}\\right).\\end{aligned}$$ Notice that the smallest non zero value of the mass $m=0.3$ reported in Fig. ", "\\[fig:3D-disp-rel\\] is huge compared to any particle mass, and still is possible to find a sector in the momentum space around $k=0$ where the automaton dispersion relation well overlaps the Dirac one. ", "This means that for $m$ sufficiently small it is possible to fix a cutoff in the momenta $|k|\\leq\\bar{k}<\\pi$ such that in that regime the Dirac automaton and the usual Dirac evolution are very similar. ", "The zone-border value $k=\\pi$ describes the Planck-scale behaviour, whereas smaller $k$ correspond to look at the automaton at larger scales. ", "We emphasize the conceptual difference between the large scale limit analyzed here $|k|\\leq\\bar k<\\pi$ with $\\ell=l_P,\\:\\tau=t_P$, and the continuum limit $\\ell\\to 0,\\:\\tau\\to 0$ considered in Refs. [", "@bialynicki1994weyl; @meyer1996quantum].", "\n\n![(", "Colors online) Comparison between the dispersion relations $\\omega(k,m)$ of the Dirac automaton and of the Dirac equation, in Eqs (\\[eq:disp\\]) and (\\[eq:disp-relation-dirac\\]), respectively. ", "In the top figure the dispersion relation is plotted versus the adimensional mass $m\\in[0,1]$ and momentum $k\\in[-\\pi,\\pi]$ ($m=1$ corresponds to the Planck mass). ", "The green surface represent the automaton, whereas the blue the Dirac one. ", "In the bottom figures $\\omega(k,m)$ is plotted versus $k$ for four values of $m$ (the red line corresponds to the automaton, whereas the black one is the Dirac’s). ", "We can see that the two dispersion relations coincide for small masses and momenta, and the larger the mass the smaller the overlap region around $k=0$.[]{data-label=\"fig:3D-disp-rel\"}](3Ddisprel_AD.pdf \"fig:\"){width=\".46\\textwidth\"} ![(", "Colors online) Comparison between the dispersion relations $\\omega(k,m)$ of the Dirac automaton and of the Dirac equation, in Eqs (\\[eq:disp\\]) and (\\[eq:disp-relation-dirac\\]), respectively. ", "In the top figure the dispersion relation is plotted versus the adimensional mass $m\\in[0,1]$ and momentum $k\\in[-\\pi,\\pi]$ ($m=1$ corresponds to the Planck mass). ", "The green surface represent the automaton, whereas the blue the Dirac one. ", "In the bottom figures $\\omega(k,m)$ is plotted versus $k$ for four values of $m$ (the red line corresponds to the automaton, whereas the black one is the Dirac’s). ", "We can see that the two dispersion relations coincide for small masses and momenta, and the larger the mass the smaller the overlap region around $k=0$.[]{data-label=\"fig:3D-disp-rel\"}](disp_rel11.pdf \"fig:\"){width=\".23\\textwidth\"} ![(", "Colors online) Comparison between the dispersion relations $\\omega(k,m)$ of the Dirac automaton and of the Dirac equation, in Eqs (\\[eq:disp\\]) and (\\[eq:disp-relation-dirac\\]), respectively. ", "In the top figure the dispersion relation is plotted versus the adimensional mass $m\\in[0,1]$ and momentum $k\\in[-\\pi,\\pi]$ ($m=1$ corresponds to the Planck mass). ", "The green surface represent the automaton, whereas the blue the Dirac one. ", "In the bottom figures $\\omega(k,m)$ is plotted versus $k$ for four values of $m$ (the red line corresponds to the automaton, whereas the black one is the Dirac’s). ", "We can see that the two dispersion relations coincide for small masses and momenta, and the larger the mass the smaller the overlap region around $k=0$.[]{data-label=\"fig:3D-disp-rel\"}](disp_rel21.pdf \"fig:\"){width=\".23\\textwidth\"} ![(", "Colors online) Comparison between the dispersion relations $\\omega(k,m)$ of the Dirac automaton and of the Dirac equation, in Eqs (\\[eq:disp\\]) and (\\[eq:disp-relation-dirac\\]), respectively. ", "In the top figure the dispersion relation is plotted versus the adimensional mass $m\\in[0,1]$ and momentum $k\\in[-\\pi,\\pi]$ ($m=1$ corresponds to the Planck mass). ", "The green surface represent the automaton, whereas the blue the Dirac one. ", "In the bottom figures $\\omega(k,m)$ is plotted versus $k$ for four values of $m$ (the red line corresponds to the automaton, whereas the black one is the Dirac’s). ", "We can see that the two dispersion relations coincide for small masses and momenta, and the larger the mass the smaller the overlap region around $k=0$.[]{data-label=\"fig:3D-disp-rel\"}](disp_rel31.pdf \"fig:\"){width=\".23\\textwidth\"} ![(", "Colors online) Comparison between the dispersion relations $\\omega(k,m)$ of the Dirac automaton and of the Dirac equation, in Eqs (\\[eq:disp\\]) and (\\[eq:disp-relation-dirac\\]), respectively. ", "In the top figure the dispersion relation is plotted versus the adimensional mass $m\\in[0,1]$ and momentum $k\\in[-\\pi,\\pi]$ ($m=1$ corresponds to the Planck mass). ", "The green surface represent the automaton, whereas the blue the Dirac one. ", "In the bottom figures $\\omega(k,m)$ is plotted versus $k$ for four values of $m$ (the red line corresponds to the automaton, whereas the black one is the Dirac’s). ", "We can see that the two dispersion relations coincide for small masses and momenta, and the larger the mass the smaller the overlap region around $k=0$.[]{data-label=\"fig:3D-disp-rel\"}](disp_rel41.pdf \"fig:\"){width=\".23\\textwidth\"}\n\nParticle states\n---------------\n\nThe QCA automaton $\\v{U}$ generally operates on the vector field $\\v\\psi$ which describes an arbitrary number of particles. ", "The vacuum state for the automaton is defined as the state $\\ket{\\Omega}$ such that $$\\begin{aligned}\n \\psi_s(k)\\ket{\\Omega}=0\\qquad\\forall s=\\pm,\\quad\\forall k\\in[-\\pi,\\pi].\\end{aligned}$$ Up to now, we have not specified the nature Fermionic/Bosonic of the field, and indeed the same automaton could be used to describe both cases (along with anyons and parastatistics): the relation spin-statistics will be considered for the the automaton with $d=3$ space-dimensions [@DP]. ", "Here we will focus only on the Fermionic case of anticommuting field. ", "A $N$-particle state can be obtained by acting with the field operator on the vacuum as follows $$|N,\\v{k},\\v{s}\\>=\\left(\\prod_{i=1}^N\\psi_{s_i}^\\dag(k_i)\\right)\\ket{\\Omega}.$$ Specifically, for $N=1$ particle eigenstates of $\\v{U}$, we write $$\\psi^\\dag_s(k)\\ket{\\Omega}=\\ket{s}_k|k\\>,$$ whereas for $N=2$ we have $$\\psi^\\dag_{s_1}(k_1)\\psi^\\dag_{s_2}(k_2)\\ket{\\Omega}=\\ket{s_1}_{k_1}\\ket{s_1}_{k_2}|k_1,k_2\\>$$ where $|k_1,k_2\\>=-|k_2,k_1\\>$, and so forth for $N>2$. The corresponding eigenvalues of the (logarithm of ) $\\v{U}$ are $$\\begin{aligned}\n \\omega(N,\\v{k},\\v{s})=\\sum_{i=1}^{N}s_i\\,\\omega(k_i,m).\\end{aligned}$$\n\nThe quantum-field limit of the Automaton {#s:analytic}\n========================================\n\nThe ultimate aim of this approach to QFT is clearly the connection to phenomenology. ", "In the last section we will provide a bound from an optimization over all possible experimental setups of the probability of discriminating between the Dirac automaton and usual Dirac evolution. ", "This is a powerful result, both from the theoretical and the phenomenological point of view, since it allows to verify the theoretical discriminability between the two theories, giving insights on the most suitable experimental scenario where searching for violations of the usual Dirac evolution. ", "However, the huge class of experimental setups considered in the derivation of the bound includes also configurations non realizable with the present technology.", "\n\nIn this section we explore the behaviour of the Dirac QCA for the one-particle states of quantum field theory. ", "We consider initial states whose momentum distribution is smoothly peaked around some $k_0$, namely $$\\label{eq:smoothstate}\n\\ket{\\v{\\psi} (0) } = \\int_{-\\pi}^{\\pi}\\frac{dk}{\\sqrt{2\\pi}} \ng(k,0) \\ket{s}_k \\ket{k}, \\qquad s=\\pm,$$ where $g(k,0)\\in C^\\infty_0[-\\pi,\\pi]$ is a smooth function satisfying the bound $$\\label{eq:smoothstate2}\n\\frac{1}{2\\pi}\\int_{k_0-\\sigma}^{k_0+\\sigma} dk \\,\n| g(k,0) |^2 \\geq 1-\\epsilon,\n\\quad \\sigma , \\epsilon >0.$$ where the two-component vector $|s\\>_k$ is defined in Eq. (", "\\[eq:eigenstates\\]).", "\n\nAt time $t$ and in the position representation, the state in Eq. ", "can be written as $$\\begin{aligned}\n&\\ket{\\psi(t)} = \\sum_x \\ket{\\psi (x,t) } \\ket{x}\n\\nonumber\\\\\n&\\ket{\\psi (x,t) } := e^{i(k_0 x - s\\, \\omega_0 t) } \\ket{{\\phi}(x,t)} \n\\nonumber\\\\\n&\\ket{{\\phi}(x,t)} := \\int_{-\\pi}^{\\pi}\\frac{dk}{\\sqrt{2\\pi}} \ne^{i(Kx-s\\Omega(k,m)t) }g(k,0) \\ket{s}_k \n\\label{eq:smoothstatetimet}\\end{aligned}$$ where we posed $$\\begin{split}\n&K = k-k_0,\\\\\n&\\Omega(k,m) = \\omega(k,m)-\\omega_0,\\quad\\omega_0 = \\omega(k_0,m).", "\n\\end{split}$$\n\nThe $k$-dependent Schrödinger equation\n--------------------------------------\n\nIt is convenient to take $x,t$ to be real-valued continuous variable by extending the Fourier transform in Eq. (", "\\[eq:smoothstatetimet\\]) to real $x,t$. We derive the integral in Eq. (", "\\[eq:smoothstatetimet\\]) with respect to $t$, and expand $\\Omega$ vs $k$ around $k_0$ up to the second order. ", "Then, taking the resulting derivatives with respect to $x$ out of the integral (using the dominated derivative theorem), we obtain the following $k$-dependent Schrödinger equation with drift $$\\label{eq:dscvs}\ni\\partial_t \\ket{\\tilde{\\phi}(x,t)}= s\\left(i v\n \\frac{\\partial}{\\partial x} -\\frac{1}{2}D \\frac{\\partial\n ^2}{\\partial x^2} \\right) \\ket{\\tilde{\\phi}(x,t)},$$ with the drift constant $v$ and the diffusion constant $D$ depending on $k$ and $m$ as follows $$\\begin{aligned}\n\\label{eq:drift}\n&v:=\\sqrt{\\frac{1-m^2}{1+m^2\\cot^2(k_0)}},\\\\\n\\label{eq:diffusion}\n&D:=\\frac{\\sqrt{1-m^2}m^2\\cos{(k_0)}}{(\\sin^2(k_0)+m^2\n \\cos^2(k_0))^{\\frac32}},\\end{aligned}$$ and with the identification of the initial condition $$\\ket{\\tilde{\\phi}(x,0)} = \\ket{{\\phi}(x,0)}.$$ The drift and diffusion coefficients are obtained as derivatives of the dispersion relation as $v=\\omega_{k_0}^{(1)}$ and $D=\\omega^{(2)}_{k_0} $, where $$\\omega^{(n)}_{k_0} = \\left.\\frac{\\partial^n \\omega(k,m)}{\\partial k^n}\\right|_{k_0}.$$ For $|\\psi(x,0)\\>$ satisfying Eq. (", "\\[eq:smoothstate2\\]), Eq. ", "provides the approximation of the state of the particle $|\\tilde\\psi(x,t)\\>=e^{i(k_0x-s\\,\\omega_0t)}|\\tilde\\phi(x,t)\\>$, corresponding to $$\\begin{aligned}\n \\label{eq:approxstate}\n \\ket{\\tilde{\\psi}(t)} = \\int_{-\\pi}^{\\pi}\\frac{dk}{\\sqrt{2\\pi}} \ne^{-is(\\omega_0+vk -\\frac12 D k^2 )t }g(k,0) \\ket{s}_k \\ket{k}.\\end{aligned}$$\n\nAccuracy of the approximation\n-----------------------------\n\n{width=\"\\textwidth\"}\n\nThe accuracy of this approximation can be quantified in terms of the parameters $\\sigma$ and $\\epsilon$ of the initial state by evaluating (see Appendix \\[a:accuracy\\]) the overlap between the states and $$|\\braket{\\tilde{\\psi}(t)}{{\\psi}(t)}|\\geq 1 - \\epsilon -\\gamma\\sigma^3 t - {\\cal\n O}(\\sigma^5)t.\\label{eq:accuracy}$$ where $$\\begin{aligned}\n\\gamma= \\frac{ \\omega^{(3)}_{k_0}}{2 \\pi} \\int_{k_0-\\sigma}^{k_0+\\sigma} dk \\, |g(k,0)|^2.", "\n \\nonumber\\end{aligned}$$ Notice that the choice of smooth function $g(k,t)$ corresponds to a two-component vector $|\\psi(x,t)\\>$ that is Schwartz on the real line, as for the field of QFT. ", "We are thus evaluating the asymptotic field-limit of the QCA.", "\n\nThe approximation works well in all regimes, namely for any mass $m$ and momentum $k$. We can test the accuracy of the approximation by comparing $|\\tilde\\psi(x,t)\\>$ with the automaton simulation for given initial state. ", "In Fig. ", "\\[fig:Hermite\\] we show an example in the Planckian ultrarelativistic regime. ", "Here the Schwartz-class field state is a superposition of Hermite functions (the polynomials $H_j(x)$ multiplied by the Gaussian) peaked around a very high momentum $k_0=3\\pi/10$ and for inertial mass $m=0.6$. The mean value moves at the group velocity given by the drift coefficient $v$. One can notice how the approximation remains accurate even for small position spreads of few Planck lengths. ", "For a spread $\\hat\\sigma$ of the order of a Fermi as in a typical particle physics scenario, the time $t$ needed for a significant departure would be comparable to many universe life-times.", "\n\nThe relativistic regime {#s:rel}\n-----------------------\n\nIn the relativistic regime for $k,m\\ll 1$ and $k/m\\gg 1$, the $k$-dependent Schrödinger equation (\\[eq:dscvs\\]) approaches the Dirac equation. ", "The leading order and the corrections to the drift and diffusion coefficients introduced by the automaton evolution are $$\\begin{aligned}\n &v=\\frac{k}{\\sqrt{k^2+m^2}}\\label{eq:drift-expansion}\n \\left(1-\\frac{1}{3}m^2+\\frac{1}{6}\\frac{m^2k^2}{k^2+m^2}\\right),\n \\\\\n &D=\\frac{m^2}{\\sqrt{(k^2+m^2)^3}}\\left(1+\n \\frac{1}{3}m^2k^2-\\frac{1}{2}\\frac{m^2k^4}{k^2+m^2}\\right).\\label{eq:drift-expansion2}\\end{aligned}$$ The leading order in $v$ and $D$ correspond to the Dirac equation.", "\n\nThe non relativistic regime {#s:nonrel}\n---------------------------\n\nIn the non relativistic regime, $k,m \\ll 1$ and $k/m\\ll 1$ the usual Schrödinger drift and diffusion coefficients are recovered with the following corrections $$\\begin{aligned}\n &v=\\frac{k}{m} \\left(1+\\frac{1}{3}m^2\\right),\n \\\\\n &D=\\frac{1}{m}\\left(1+\\frac{5}{6}k^2\\right).\\end{aligned}$$ Notice that the leading terms are just the usual group-velocity and diffusion coefficient of the Schrödinger equation.", "\n\nTesting the quantum automaton {#s:test}\n=============================\n\nIn this section we consider an elementary thought experiment for testing the granularity of the quantum automaton based on particle flying-time, and compare it with the theoretical optimal in-principle testing. ", "As we will see, the latter needs time duration of the order of an hour, whereas the former requires a time comparable to the age of the universe. ", "Other experiments could be devised e.g. using quantum interferometry and/or ultra-cold atoms as in Refs. [", "@Moyer:2012ws; @Hogan:2012ik; @pikovski2011probing; @amelino2009constraining]: these will be considered in a forthcoming publication on the three-dimensional Dirac automaton.", "\n\nDiscrimination via particle flying-time {#ss:flytime}\n---------------------------------------\n\nThe $k$-dependent Schrödinger equation (\\[eq:dscvs\\]) along with the leading terms in the relativistic and non relativistic regimes in subsections \\[s:rel\\] and \\[s:nonrel\\] provide a unique analytic tool for evaluating the macroscopic evolution of the automaton, which otherwise would not be computable in practice. ", "As a thought experiment for an experimental falsification of a quantum automaton evolution at the Planck scale we consider a measurement of fly time of a particle. ", "As for order of magnitude, we consider numerical values corresponding to ultra high energy cosmic rays (UHECR) [@takeda1998extension]).", "\n\nConsider then a proton UHECR with $m_p\\approx 10^{-19}$ and momentum peaked around $k_{CR}\\approx 10^{-8}$ in Planck units, with a spread $\\sigma$. We ask what is the minimal time $t_{CR}$ for observing a complete spatial separation between the trajectory predicted by the cellular automaton model and the one described by the usual Dirac equation. ", "Thus we require the separation between the two trajectories to be greater than $\\hat\\sigma=\\sigma^{-1}$ the initial proton’s width in the position space. ", "Notice that UHECR still belong to the relativistic regime $m_p,k_{CR}\\ll 1$ (see Subsect. ", "\\[s:rel\\]), where the automaton well approximates the usual Dirac evolution.", "\n\nWe describe the state evolution of the wavepacket of the proton using the $k$-dependent Schrödinger equation (\\[eq:dscvs\\]) with initial Gaussian state. ", "The Dirac evolution is very precisely given by the Schrödinger equation (\\[eq:dscvs\\]) just the leading-order terms in Eqs. (", "\\[eq:drift-expansion\\]) and (\\[eq:drift-expansion2\\]), whereas the automaton is described in this regime by the full expansion. ", "The time required to have a separation $\\hat\\sigma$ between the automaton and the Dirac particle can be easily calculated using the power expansion in Eq. ", "$$\\begin{aligned}\n\\label{eq:flying-time1}\n t\\approx \\hat\\sigma\\left|\\frac{6\\sqrt{(k^2+m^2)^3}}{m^2k^2(2m^2+k)}\\right|,\\end{aligned}$$ which, since it is $m_p/k_{CR}\\ll 1$ further simplifies as follows $$\\begin{aligned}\n\\label{eq:flying-time2}\nt_{CR}\\approx 6\\frac{\\hat\\sigma}{m_p^2}.\\end{aligned}$$ In order to be visible the separation $\\hat\\sigma$, the overall broadening $\\hat\\sigma_{br}(t)$ of the two packets must be much smaller than $\\hat\\sigma$. Using Eq. (", "\\[eq:drift-expansion2\\]) one has $$\\begin{aligned}\n \\begin{split}\\nonumber\n \\hat\\sigma_{br}(t)&=\\hat\\sigma\\left(\\sqrt{1+\\left(\\frac{D}{2\\hat\\sigma^2}t\\right)^2}+\n \\sqrt{1+\\left(\\frac{D_{\\rm D}}{2\\hat\\sigma^2}t\\right)^2}-2\\right)\\\\\n &\\approx\n 2\\hat\\sigma\\left(\\sqrt{1+\\frac{m_p^4}{4\\hat\\sigma^4k_{CR}^6}t^2}-1\\right)\n \\end{split}\\end{aligned}$$ where $D_{{\\rm D}}=m^2(k^2+m^2)^{-3/2}$ and we used $m_p/k_{CR}\\ll 1$. Using Eq. (", "\\[eq:flying-time2\\]) we see that $\\hat\\sigma\\gg\\hat\\sigma_{br}$ when $$\\begin{aligned}\n\\hat\\sigma\\gg (k_{CR})^{-3}=10^{22}\\;\\text{Planck lengths}=10^2{\\rm fm},\\end{aligned}$$ a physical result, considering a reasonable width for the proton packet of the order of a Fermi or bigger. ", "With $\\hat\\sigma=10^2\\text{fm}$ the flying time request for complete separation between the two trajectories is $$\\begin{aligned}\nt_{CR}\\approx 6\\times 10^{60}\\;\\text{Planck times}\\;\\approx 10^{17}s, \\end{aligned}$$ comparable with the universe age. ", "In Subsec. ", "\\[s:large-scale\\] we will evaluate the minimal theoretical time required for discriminating perfectly between the automaton and the Dirac evolution using UHECR.", "\n\nTheoretically optimal discrimination {#s:large-scale}\n------------------------------------\n\nThe problem of discriminating optimally between two different dynamics is what is usually refereed to as “discrimination between two black boxes”. ", "An experimentalist is given a black box that can be either the automaton (box $\\rm A$) or Dirac equation (box $\\rm D$) with equal probability, and is asked to guess which box. ", "The box discrimination is a two-outcome experiment, with outcomes $\\rm A$ and $\\rm D$. The correct answer is given with some probability, and the challenge is to minimize the probability error (wrong guess) $$\\begin{aligned}\n \\label{eq:proberr}\n p_{e} = \\tfrac12 \\left[ p(\\rm A|\\rm D) + p(\\rm D|\\rm A) \\right]\\end{aligned}$$ where $p(\\rm X|\\rm Y)$ is the probability of getting outcome $\\rm X$ when the black box is $\\rm Y$. We want now to minimize $p_e$ over all the possible experiments. ", "The optimal discrimination between the two black boxes is a special case of discrimination between quantum channels, namely the discrimination between the two unitary evolutions described by $U_{\\rm A}$ and $U_{\\rm D}$. Generally, the optimization between quantum channels needs entangled states [@d2001using], but for the case of two unitary evolutions with a single copy of each box, the optimal error probability $\\bar{p}_e$ is given by [@d2001using] $$\\bar{p}_e=\\tfrac{1}{2} -\\tfrac{1}{2}|\\!|U_{\\rm A}-U_{\\rm D}|\\!|.$$ However, such a probability with no restriction on the input states would be vanishingly small in the case of large dimension for the Hilbert space. ", "We thus consider the physical bounds on the number of particles $N\\leq\\bar{N}$ and their momentum $k\\leq\\bar{k}$. In such case the old Helstrom’s result gives [@helstrom1976quantum]\n\n$$\\label{eq:supoverstate}\n \\bar{p}_e= \\tfrac{1}{2} -\\tfrac{1}{2}\n \\sup_{\\rho\\in{\\mathcal {T}_{\\bar{k},\\bar{N}}}}|\\!|U_{\\rm A}\\rho U_{\\rm A}^\\dag\n -U_{\\rm D}\\rho U_{\\rm D}^\\dag|\\!|_1,$$\n\nwhere $\\mathcal {T}_{\\bar{k},\\bar{N}}$ denotes the set of physically restricted states $$\\label{eq:termostate}\n\\rho\\in \\mathcal {T}_{\\bar{k},\\bar{N}}\\text{ iff }\n{\\mathop{\\mathrm{Tr}}}[\\rho N_{\\bar{k}}] ={\\mathop{\\mathrm{Tr}}}[\\rho P_{\\bar{N}}]=0$$ where $P_{\\bar{N}}$ is the projector on the $N>\\bar{N}$-particles sector and $N_{\\bar{k}}$ is the operator that counts the number of particles with momentum $|k|>\\bar{k}$, i.e $N_{\\bar{k}}=\\int_{|k|>\n \\bar{k}} dk \\, \\v{\\psi}^{\\dagger}(k)\\v{\\psi}(k)$. In Appendix \\[a:large-scale\\] we evaluate a lower bound for the optimal probability of error, which is given by $$\\begin{aligned}\n \\label{eq:ilboundperpe}\n \\bar{p}_e\\geq \\tfrac12 - \\tfrac12\n \\sqrt{1-\\cos^2(g(\\bar{k},m,\\bar{N},t))}\\end{aligned}$$ where $$\\begin{split}\n & g(\\bar{k},m,\\bar{N},t):= \\bar{N}\\arccos\\left(\n \\cos({\\bar{\\alpha}}t) -{\\bar{\\beta}} \\right)\\label{eq:gfunction}\\\\\n &\\bar{\\alpha}:= \\max_{k \\in\\{0,\\bar{k}\\}} |\\omega_{\\rm D} - \\omega|, \\\\\n &\\bar{\\beta}:= \\max_{k \\in\\{0,\\bar{k}\\}} \\left|\\frac12 \\left( 1 - v v_{\\rm D} -\n \\sqrt{(1-v^2)(1-v_{\\rm D}^2)} \\right)\\right|\n\\end{split}$$ and $v$ (see Eq. ) ", "and $v_{\\rm D}=k/\\sqrt{k^2+m^2}$ the automaton and the Dirac drift coefficients.", "\n\nA simplified version of the bound in the typical particle physics regime, namely $k,m\\ll 1$ is obtained by expanding in series the function $g$ in Eq. ", "near $m = \\bar{k} =\n0$. Truncating the expansion at the leading order and neglecting a small constant term we have $$\\begin{aligned}\n \\label{eq:5}\n g(m,\\bar{k},\\bar{N},t) \\approx \\frac{1}{6} m^2 \\bar{k} \\,\n \\bar{N} \\, t.\\end{aligned}$$ By putting $\\bar{p}_e=0$, corresponding to $g(m,\\bar{k},\\bar{N},t)=\\pi/2$, we obtain the minimum time required for discriminating perfectly between the automaton and the Dirac evolution $$\\begin{aligned}\n\\label{eq:time-scale}\n t_{min}(m,\\bar{k},\\bar{N})\\approx 3\\pi\\frac{1}{m^2\\bar{k}\\bar{N}}.\\end{aligned}$$ Notice that this is an in-principle optimal result, without any specification of the actual apparatus needed to achieve it. ", "For a proton UHECR with $\\bar{k}=k_{CR}\\approx\n10^{-8}$ we have $$\\begin{aligned}\n t_{min}(m_p,k_{CR},1)\\approx 3\\pi 10^{46}\\:\\text{Planck\n times}\\:\\approx 10^3s,\\end{aligned}$$ which is many orders of magnitude smaller than the time in the flying-time experiment of Subsect. ", "\\[ss:flytime\\].", "\n\nConclusions\n===========\n\nIn this paper, based only on the parity and time-reversal invariance and without requiring Lorentz covariance, we have derived a QCA that describes the Dirac evolution. ", "The automaton extends the Dirac field theory to the Planck and ultrarelativistic scales. ", "The Dirac equation is recovered for small $m$ and $k$.\n\nWe have provided a technique to derive an analytical approximation of the evolution of the automaton in terms of a momentum-dependent Schrödinger equation. ", "The approximation works very well for quantum states typical of QFT having limited bandwidth in momentum, and gives precise estimation of the automaton behaviour in all regimes, including ultrarelativistic and Planckian.", "\n\nWe have then presented a thought experiment for testing the automaton using a fly-time discrimination between the automaton state and the Dirac one, for the typical UHECR scale. ", "However, this leads to a time-duration of the experiment that is comparable to the universe life-time. ", "We have then considered the in-principle discrimination between the Dirac and the automaton evolution, optimizing over all measurement apparata and preparation available according to quantum theory, and providing the general discrimination formula. ", "For the case of UHECR we got an experiment duration of the order of $10^3$ s.\n\nThe present preliminary analysis of the QCA extension of QFT to the Planck scale has proved very effective in evaluating experimentable phenomenology, and this motivates pursuing investigation of more general QCAs, with possible correspondence to the theory of fundamental interactions, and including a theory quantum gravity. ", "This, in consideration of the simplicity of the automaton, of the principles at the basis of the QCA, and of all motivations that we expressed in the introduction, namely the fact that the Lorentz covariance is not assumed a priori but is recovered as emergent, the fact that the QCA is quantum [*ab-initio*]{}, the fact that it doesn’t suffer violations of causality, and is free from all the problems arising from the continuum.", "\n\nNext steps in the QCA research will be the Dirac Equation in $3+1$ dimensions [@DP], and the corresponding $k$-dependent Schrödinger equation. ", "The $3+1$ dimensional case is particularly relevant in view of the spin-statistics connection. ", "At least for the Dirac automaton, also in $3+1$ dimensions the automaton is derived with minimal assumptions, as in the present case, and the usual Dirac equation with two spinors emerges for small $m$ and $k$. As regards gauge-invariance the QCA has a very natural embedded quantum gauge-invariance, through the choice of a local unitary operator on each system of the quantum lattice, and this opens a route to the interacting QFTs. ", "One of the problems that are still open is the possibility of achieving the automaton by qubits on the lattice, a problem that dates back to the famous work of Feynman [@feynman1982simulating]. ", "In the present $1$-dimensional case the simple Jordan-Wigner transform achieves the transformation from local qubits to nonlocal Fermi fields [@darianopla]. ", "The extension to higher dimensions of the Jordan-Wigner is straightforward, however, it is still not clear if it is possible to map local field interactions to local interactions between qubits. ", "It seems that a possible solution requires auxiliary fields of the Majorana kind [@verstraete2005mapping; @darianovaxjo2011; @DTnotes]. ", "The possible solution of the Feynman problem may shade light on the intimate difference between the Fermionic and the Bosonic natures.", "\n\nAcknowledgments\n===============\n\nWe thank Paolo Perinotti for interesting discussions and suggestions. ", "A. Bisio and A. Tosini acknowledge useful discussion with Daniel Reitzner.", "\n\nDerivation of Eq. (", "\\[eq:accuracy\\]) {#a:accuracy}\n===================================\n\nHere we evaluate the overlap between the exact automaton evolution $\\ket{\\psi(t)}$ and the $k$-dependent Schrödinger approximation $\\ket{\\tilde\\psi(t)}$ $$\\begin{aligned}\n &|\\braket{\\tilde{\\psi}(t)}{{\\psi}(t)}| = \\left|\n \\int_{-\\pi}^{\\pi}\\frac{dk}{2\\pi} e^{-i( \\omega^{(3)}_{k_0}k^3 +{\\cal O}(k^4) )t }|g(k,0)|^2 \\right|\n \\geq \\nonumber\\\\\n &\\geq \\left|\\frac{1}{2\\pi} \\int_{k_0-\\sigma}^{k_0+\\sigma} dk \\, e^{-i( \\omega^{(3)}_{k_0}k^3 + {\\cal O}(k^4) \n )t }|g(k,0)|^2 \\right|\n +\\nonumber\\\\\n &- \\left|\\frac{1}{2\\pi} \\int_{ |k-k_0 |\\geq \\sigma} \\!\\!\\!\\!\\!", "\n \\!\\!\\!\\!\\! \\!\\!\\!\\!\\! ", "dk \\, e^{-i( \\omega^{(3)}_{k_0}k^3 + {\\cal O}(k^4)\n )t }|g(k,0)|^2 \\right| \\geq\n \\nonumber\\\\\n &\\left| 1 - i t \\frac{ \\omega^{(3)}_{k_0} \\sigma^3}{2 \\pi}\n \\int_{k_0-\\sigma}^{k_0+\\sigma} dk \\,\n |g(k,0)|^2\n - {\\cal O}(\\sigma^5)t \\right|- \\epsilon \\geq\\nonumber\\\\\n &\\geq 1 - \\epsilon -\\gamma\\sigma^3 t - {\\cal O}(\\sigma^5)t\\nonumber\\end{aligned}$$ with the constant $ \\gamma= \\frac{ \\omega^{(3)}_{k_0}}{2 \\pi}\n\\int_{k_0-\\sigma}^{k_0+\\sigma} dk \\, |g(k,0)|^2$.\n\nProof of the bound {#a:large-scale}\n===================\n\nIn this appendix we detail the proof of the bound in Section \\[s:large-scale\\] which provides the probability of optimal error probability in discriminating the Dirac automaton and the usual Dirac evolution. ", "The discrimination experiment can have a generic duration $t$ and the unitary operators to be discriminated are explicitly given by\n\n$$\\begin{aligned}\n\\label{eq:unitaryautom}\n\\begin{split}\n\\v{U}^t(k)=\\exp({-i\\v{H}(k)t})=\\\\\n=\\begin{pmatrix} \\cos(\\omega t) + i \\frac{\\sin(\\omega t)}{\\omega} a &\n - i b\n \\frac{\\sin(\\omega t)}{\\omega} \\\\\n - i b \\frac{\\sin(\\omega t)}{\\omega} &\n \\cos(\\omega t) - i \\frac{\\sin(\\omega t)}{\\omega} a \\\\\n\\end{pmatrix}\n\\end{split}\\end{aligned}$$\n\n$$\\begin{aligned}\n\\label{eq:unitarydirac}\n\\begin{split}\n\\v{U}^t_{\\rm D}(k)=\\exp{(-i\\v{H}_{\\rm D}(k)t})=\\\\\n=\\begin{pmatrix} \\cos(\\lambda t) + i \\frac{\\sin(\\lambda t)}{\\lambda} k\n & - i m\n \\frac{\\sin(\\lambda t)}{\\lambda} \\\\\n - i m \\frac{\\sin(\\lambda t)}{\\lambda} &\n \\cos(\\lambda t) - i \\frac{\\sin(\\lambda t)}{\\lambda} k \\\\\n \\end{pmatrix}.", "\n\\end{split}\\end{aligned}$$\n\nas can be easily verified by direct computation using the Hamiltonians in Eqs. ", "and . ", "The proof of the bound goes through the following three Lemmas.", "\n\n\\[l:bound1\\] Let $\\v{U}^t_{\\rm D}(k)$ and $\\v{U}^{t\\dagger}(k)$ be defined according to Eqs. , ", "and let us define $\\v{V}(k,t) = \\v{U}^t_{\\rm D}(k) \\v{U}^{t\\dagger}(k)$ Let $e^{ i\n \\mu(k,m,t)}$ be an eigenvalue of $\\v{V}(k,t)$. Then the following bound holds: $$\\begin{aligned}\n \\label{eq:12}\n \\cos(\\mu(k,m,t)) \\geq \\cos(\\alpha t) -\\beta\n \\end{aligned}$$ where $$\\begin{aligned}\n \\begin{split}\n \\alpha(k,m) := \\omega_{\\rm D} - \\omega& \\\\\n \\beta(k,m) \n:= \\frac12 \\left( 1 - vv_{\\rm D} -\n \\sqrt{(1-v^2)(1-v_{\\rm D}^2)} \\right)&\\,. ", "\n \\end{split}\\label{eq:alphabeta}\\end{aligned}$$\n\nSince both $\\v{U}^t_{\\rm D}(k)$ and $\\v{U}^{t\\dagger}(k)$ are $SU(2)$ matrices, we have that $\\v{V}(k,t)$ is an $SU(2)$ matrix and its eigenvalues must be of the form $e^{ i \\mu(k,m,t)}$ and $e^{- i \\mu(k,m,t)}$. This implies the equality $ \\cos(\\mu(k,m,t)) = \\frac12 {\\mathop{\\mathrm{Tr}}}[\\v{V}(k,t)] $ which by direct computation gives $$\\begin{aligned}\n \\cos(\\mu(k,m,t)) = \\left(1-\\frac{\\beta}{2} \\right)\\cos(\\alpha t) +\n \\frac{\\beta}{2} \\cos(\\gamma t) \n\\label{eq:cosenomu}\\end{aligned}$$ where $\\alpha$ and $\\beta$ are defined accordingly with Eq. ", "and $\\gamma := \\omega + \\omega_{\\rm D}$. Finally, from Eq. ", "one has the bound $\\cos(\\mu(k,m,t)) \\geq \\cos(\\alpha t) -\\beta$\n\nThe second Lemma shows the monotonicity of the two functions $\\alpha,\\beta$ in Lemma \\[l:bound1\\]:\n\nLet $\\alpha(k,m)$ and $\\beta(k,m)$ be defined as in Eq. ", "and $0 \\leq \\bar{k} < \\pi$ Then we have $$\\begin{aligned}\n \\begin{split}\n \\bar{\\alpha}:= \\max_{k \\in [-\\bar{k}, \\bar{k}]} |\\alpha| =\n \\max_{k \\in \\{0, \\bar{k}\\}} |\\alpha|\\\\\n \\bar{\\beta}:= \\max_{k \\in [-\\bar{k}, \\bar{k}]} |\\beta| =\n \\max_{k \\in \\{0, \\bar{k}\\}} |\\beta|\n \\end{split}\n\\qquad\\forall m \\in [0,1]\\,. ", "\\label{eq:alphabetagrow}\\end{aligned}$$\n\nSince both $\\omega$ and $\\omega_{\\rm D}$ are even function of $k$, from Eq. ", "we have that also $\\alpha$ and $\\beta$ are even function of $k$. For this reason we can restrict to $k\\in[0,\\bar{k}] $. ", "The equality can be proved by showing that $\\alpha$ and $\\beta$ are nondecreasing function of $k$ for $k\\in[0,\\bar{k}] $.", "\n\nSince $\\partial_k\\alpha=v_{\\rm D}-v$, clearly $v_{\\rm D}^2 -v^2\\geq 0$ for $k\\in[0,\\pi)$ implies $\\partial_k\\alpha \\geq 0$ in the same interval. ", "By direct computation one can verify that $$\\begin{aligned}\n (v_{\\rm D})^2 -(v)^2 = \\frac{x(k,m)} {y(k,m)}& \\\\\nx(k,m) := k^2- \\sin^2(k)(1-m^2)&\\\\\ny(k,m):= (k^2 +m^2)(\\sin^2(k) + m^2 \\cos^2(k))&\\,.\\end{aligned}$$ Clearly we have $y(k,m) \\geq 0$ and since $k \\geq \\sin(k)$ for $0 \\leq\nk < \\pi$, the thesis is proved.", "\n\nAgain the monotonicity of $ \\beta$ for $k \\in [0,\\pi )$ follows from $\\partial_k\\beta\\geq 0$ in the same interval. ", "By elementary computation we have $$\\begin{aligned}\n \\partial_k\\beta=x(k,m)y(k,m)z(k,m)\\\\\nx(k,m):=\\frac{m^2}{\\omega_{\\rm D}\\sin^2(\\omega)}\\\\\ny(k,m):=(n\\sin(k)-k)\\\\\nz(k,m):=\\frac{n\\cos(k)}{\\sin^2(\\omega)}-\\frac{1}{\\omega_{\\rm D}^2}\\end{aligned}$$ Clearly $x(k,m)y(k,m)\\leq 0$ for $k\\in[0,\\pi)$ and we just have to verify that $z(k,m)\\leq 0$ in that interval, namely $$\\begin{aligned}\n\\label{eq:dis1} \nm^2\\cos^2(k)+\\sin^2(k)-n \\cos(k)\\omega_{\\rm D}^2\\geq 0\\,. ", "\\end{aligned}$$ The last equation is clearly satisfied for $k\\in[\\pi/2,\\pi]$ therefore we restrict to $k\\in[0,\\pi/2]$. This allows to divide the left side of Eq. ", "by $\\cos(k)$ achieving $$\\begin{aligned}\nm^2\\cos(k)+\\frac{\\sin^2(k)}{\\cos(k)}-n\\omega_{\\rm D}^2\\geq 0 \\end{aligned}$$ which is satisfied if $$\\begin{aligned}\nw(k,m):=m^2\\cos(k)+\\sin^2(k)-n\\omega_{\\rm D}^2 \\geq 0\\,.\\end{aligned}$$ It is easy to see that, for any $m\\in[0,1]$, we have $\\left(\\partial^{(i)}_kw(k,m)\\right)_{k=0}=0$ for $i=0,1$, while $\\partial^{(2)}_kf(k,m)\\geq 0$ for any $k\\in[0,\\pi/2]$, which gives the monotonicity of $\\beta$.\n\n\\[l:cruciale\\] Let $0 \\leq \\bar{k} < \\pi$, $N$ be a positive integer number, and $\\bar{\\alpha}$, $\\bar{\\beta}$ be defined as in Eq. . ", "If $\\bar{\\beta} \\leq 1- \\cos\n (\\frac{\\pi}{2N})$ and $t \\leq f(\\bar{k},m,N)$ where $$\\begin{aligned}\n f(\\bar{k},m,N) := \\frac{\\arccos(\\cos\\left( \\frac{\\pi}{2N}\\right) +\n \\bar{\\beta})}{\\bar{\\alpha}}\n \\end{aligned}$$ then $$\\begin{aligned}\n \\label{eq:2}\n N \\mu(k,m,t)) \\leq g(\\bar{k},m,N,t) \\leq \\frac{\\pi}{2} \\end{aligned}$$ where $g(\\bar{k},m,N,t):= N\\arccos\\left( \\cos({\\bar{\\alpha}}t)\n -{\\bar{\\beta}} \\right)$.\n\nThe conditions $t \\leq f(\\bar{k},m,N)$ and $\\bar{\\beta} \\leq 1-\n\\cos (\\frac{\\pi}{2N})$ imply $$\\begin{aligned}\n0 \\leq \\bar{\\alpha}t \\leq \\arccos(\\cos\\left(\n \\frac{\\pi}{2N}\\right) + \\bar{\\beta}) \\Rightarrow \\nonumber \\\\\n\\Rightarrow\n1 \\geq \\cos(\\bar{\\alpha}t) -\\bar{\\beta} \\geq \\cos\\left(\n \\frac{\\pi}{2N}\\right)\n\\Rightarrow \\nonumber\\\\\n\\Rightarrow\n \\cos({\\alpha}t) -{\\beta} \\geq \\cos(\\bar{\\alpha}t)\n-\\bar{\\beta} \\geq\\cos\\left(\n \\frac{\\pi}{2N}\\right)\\,. ", "\\label{eq:incubocoseni}\\end{aligned}$$ By exploiting the bound into Eq. ", "we have $$\\begin{aligned}\n\\begin{split}\n \\cos(\\mu(k,m,t)) \\geq \\cos({\\bar{\\alpha}}t) -{\\bar{\\beta}} \\geq \\cos\\left(\n \\frac{\\pi}{2N}\\right) \\Rightarrow \\\\\n\\Rightarrow\nN \\mu(k,m,t) \\leq N\\arccos\\left( \\cos({\\bar{\\alpha}}t) -{\\bar{\\beta}} \\right) \\leq\n\\frac{\\pi}{2}\\,.", "\n\\end{split}\\end{aligned}$$\n\nWe are now ready to prove the bound\n\nLet $U^{t}$ and $U_{\\rm D}^{t}$ be the unitary evolution given by the Dirac QCA and by the Dirac equation respectively. ", "If the hypothesis of Lemma \\[l:cruciale\\] hold we have $$\\begin{aligned}\n \\label{eq:ilverobound}\n \\sup_{\\rho \\in \\mathcal{T}_{\\bar{k},\\bar{N}}} || (U^{t}\\rho U^{t\n \\dagger} - U_{\\rm D}^{t} \\rho U_{\\rm D}^{t\\dagger}) ||_1 \\leq\n \\sqrt{1-\\cos^2(g(\\bar{k},m,\\bar{N},t))}.\\end{aligned}$$\n\nFirst we notice that thanks to the convexity of the trace distance we can without loss of generality consider $\\rho$ to be pure. ", "If $\\rho$ is a pure state $\\ketbra{\\chi}{\\chi}$ the trace distance becomes $ \\sqrt{1-|\\bra{\\chi} U^{t}U_{\\rm D}^{t \\dagger} \\ket{\\chi} |^2}=\n\\sqrt{1-|\\bra{\\chi} V(t) \\ket{\\chi} |^2}$. If we expand $\\ket{\\chi}$ on a basis of eigenstates of $V$, i.e. $\\ket{\\chi} =\n\\sum_{N,\\v{k},\\v{s}} \\sqrt{p_{N,\\v{k},\\v{s}}} \\ket{N,\n \\v{k},\\v{s}}$, we have $$\\begin{aligned}\n &|\\bra{\\chi} V(t) \\ket{\\chi} | = \n\\left|\n\\sum_{N,\\v{k},\\v{s}} p_{N,\\v{k},\\v{s}}\n \\exp \\left( i \\sum_{j=0}^{\\bar{N}} s_j \\mu(k_j,m,t) \\right)\n\\right| \\geq \\nonumber \\\\\n&\\geq\\left|\\sum_{N,\\v{k},\\v{s}} p_{N,\\v{k},\\v{s}} \\cos\\left(\\sum_{j=0}^{\\bar{N}} s_j\\mu(k_j,m,t) \\right) \n \\right|.\\label{Eq.boundnorm}\\end{aligned}$$ By exploiting the bound into Eq. ", "we have $$\\begin{aligned}\n \\left|\\sum_{N,\\v{k},\\v{s}} p_{N,\\v{k},\\v{s}}\n \\cos\\left(\\sum_{j=0}^{\\bar{N}} s_j\\mu(k_j,m,t) \\right)\n \\right|^2 \\geq \\cos^2(g(\\bar{k},m,\\bar{N},t))\\end{aligned}$$ which finally implies $$\\begin{aligned}\n \\sqrt{1-|\\bra{\\chi} V(t) \\ket{\\chi} |^2} \\leq \n\\sqrt{1-\\cos^2(g(\\bar{k},m,\\bar{N},t))}\\,.\\end{aligned}$$ Inserting the bound into Eq. ", "we finally have the bound .", "\n" ]

{ "pile_set_name": "ArXiv" }

[ 0.0006059943116270006, 0.000663833983708173, 0.0006845803000032902, 0.0006394345546141267, 0.0005652802647091448, 0.0005986550822854042, 0.000627621600870043, 0.0007533387979492545, 0.0006243691896088421, 0.0005664018099196255, 0.0005349992425180972, 0.000849591160658747, 0.000581050175242126, 0.0005965254968032241, 0.0006639899802394211, 0.0011789241107180715, 0.0006842222064733505, 0.0005963995354250073, 0.0006959590245969594, 0.0006711549940519035, 0.0005479692481458187, 0.0008094535442069173, 0.0007483412628062069, 0.0006564500508829951, 0.0005799322389066219, 0.0006149104447104037, 0.0006323137786239386, 0.0007111133891157806, 0.0007589097949676216, 0.0005905339494347572, 0.0006503406912088394, 0.000591850490309298, 0.0005655004060827196, 0.0006101086619310081, 0.0006523211486637592, 0.0005812467425130308, 0.0006839001434855163, 0.0006282338290475309, 0.0006070503732189536, 0.0005633879918605089, 0.0006028072675690055, 0.000658762757666409, 0.0006278363289311528, 0.0005764059606008232, 0.0011725528165698051, 0.0005784957902505994, 0.0005810833536088467, 0.0006558928871527314, 0.0006320980610325933, 0.000599184597376734, 0.0006309397285804152, 0.0007083028904162347, 0.00068708072649315, 0.0006608101539313793, 0.0006170339183881879, 0.0005795854958705604, 0.0005992343067191541, 0.0007745129987597466, 0.0006030520889908075, 0.0006333616911433637, 0.0035137617960572243, 0.0007862365455366671, 0.0010704593732953072, 0.028053846210241318, 0.0007405105279758573, 0.0006842183065600693, 0.001264947815798223, 0.0007622626144438982, 0.000630070164334029, 0.0010352253448218107, 0.0006971183465793729, 0.0006212397129274905, 0.0008909505559131503, 0.004135748837143183, 0.008664239197969437, 0.0010925958631560206, 0.0011090756161138415, 0.002447577891871333, 0.010942832566797733, 0.0006110292160883546, 0.000738044735044241, 0.0007031470886431634, 0.000643703737296164, 0.0012239323696121573, 0.0007130820886231959, 0.0011596858967095613, 0.001978253247216344, 0.0006143867503851652, 0.000654707255307585, 0.0025609463918954134, 0.0006615098682232201, 0.0006813188083469868, 0.0006018663407303393, 0.0012068506330251694, 0.0006086308276280761, 0.0005801204824820161, 0.0031915849540382624, 0.0006086308276280761, 0.0005801204824820161, 0.002447313629090786, 0.000692189612891525, 0.0008367769187316298, 0.0006143329082988203, 0.00101542379707098, 0.0016380052547901869, 0.0008992098737508059, 0.0026858451310545206, 0.005063410382717848, 0.0006951247924007475, 0.0007836336735635996, 0.006281476002186537, 0.0319988876581192, 0.000891564937774092, 0.0008513242355547845, 0.0006964243948459625, 0.0005891133332625031, 0.0010312427766621113, 0.0036131434608250856, 0.0009003583109006286, 0.0009027851046994328, 0.0008129648049362004, 0.001080023474059999, 0.0006884883041493595, 0.0014476038049906492, 0.00279853492975235, 0.0012068506330251694, 0.0006374979857355356, 0.0007985769771039486, 0.0006734966300427914, 0.000850576558150351, 0.0006698201759718359, 0.0006374979857355356, 0.0007985769771039486, 0.0006734966300427914, 0.000850576558150351, 0.0006675087497569621, 0.0006374979857355356, 0.0007985769771039486, 0.0006734966300427914, 0.000850576558150351, 0.0006669355207122862, 0.0006374979857355356, 0.0007985769771039486, 0.0006734966300427914, 0.000850576558150351, 0.0006634358433075249, 0.0006374979857355356, 0.0007985769771039486, 0.0006734966300427914, 0.000850576558150351, 0.000659781217109412, 0.0010617640800774097, 0.0007088339771144092, 0.019710944965481758, 0.0006037508719600737, 0.0005885397549718618, 0.0005927269230596721, 0.0005574891110882163, 0.003897037822753191, 0.0009272219031117857, 0.004427450709044933, 0.03757820278406143, 0.001318500260822475, 0.0007428234675899148, 0.0008525227312929928, 0.008305591531097889, 0.0010613600024953485, 0.014932861551642418, 0.0020359463524073362, 0.0010484823724254966, 0.0007102552917785943, 0.0007092971936799586, 0.0006813188083469868, 0.0006843307637609541, 0.0009095680434256792, 0.00162322202231735, 0.000907188281416893, 0.0030359653756022453, 0.0013180708047002554, 0.0006353962235152721, 0.0005842438549734652, 0.0005656313733197749, 0.0006749543244950473, 0.0008017817744985223, 0.0008857036591507494, 0.0005468458984978497, 0.0006640636711381376, 0.0007539632497355342, 0.001027749152854085, 0.0007647470338270068, 0.0008674059063196182, 0.0006476534181274474, 0.0007261767750605941, 0.0007995619089342654, 0.0033646465744823217, 0.015034718438982964, 0.0011890698224306107, 0.0010731371585279703, 0.0007220961851999164, 0.0006664422107860446, 0.0017147158505395055, 0.0009524458437226713, 0.0021931545343250036, 0.002219387562945485, 0.03699248284101486, 0.0015265303663909435, 0.0007485745591111481, 0.004123989958316088, 0.0009986002696678042, 0.0008496041991747916, 0.0006082031759433448, 0.0006845803000032902, 0.0006573002319782972, 0.0006521682371385396, 0.0005772804142907262, 0.0005671121762134135, 0.0005580782308243215, 0.0005726008675992489, 0.0006301857647486031, 0.0006346048903651536, 0.0005686251679435372, 0.0006245938711799681, 0.0007190328906290233, 0.0006234754109755158, 0.0005867041763849556, 0.0006432121735997498, 0.0006715776398777962, 0.0005821213708259165, 0.0006137087475508451, 0.0006235829787328839, 0.05027392506599426, 0.0479554645717144, 0.028245175257325172, 0.10693789273500443, 0.0007414878346025944, 0.001052332459948957, 0.0009346454171463847, 0.017680801451206207, 0.011188470758497715, 0.01978182978928089, 0.0012804667931050062, 0.005526991561055183, 0.0408155582845211, 0.0036188384983688593, 0.0032239779829978943, 0.004070912953466177, 0.006119593046605587, 0.0018514266703277826, 0.002802696079015732, 0.006761807482689619, 0.0012149254325777292, 0.023115620017051697, 0.20851163566112518, 0.0013239129912108183, 0.02426319010555744, 0.0011033366899937391, 0.00593319209292531, 0.060753583908081055, 0.021432004868984222, 0.0007292607333511114, 0.001995444530621171 ]

[ "His mission seems to be to bring new digital jobs to cities that have been left behind by technology and that therefore have massive unemployment. ", "The city he seems most focussed on is Cleveland, but we can all think of many others, most obviously Detroit.", "\n\nI am sure he is right that the next wave of jobs will have to be fundamentally digital. (", "There will also be Punk Manufacturing and Local Farming, but both of those also need digital infrastructure). ", "And that cannot happen without dirt cheap massive bandwidth everywhere. ", "I can envisage entrepreneurs moving to places that are really cheap – longer runway to Ramen profitability – as long as there is massive bandwidth everywhere.", "\n\nAnd massive bandwidth everywhere is so ridiculously cheap to do compared to all the big budget-busters in government spending. ", "Korea did this and you can see the payoff there.", "\n\nI can envisage American politicians bloviating about this – massive bandwidth everywhere enables a chicken in every pot – but sadly my faith in politicians (apart from a few Mayors) is at an all time low. ", "So this has to be a private sector initiative.", "\n\nI think big tech companies WILL fund this. ", "Quest seems to be doing something to sponsor Marc’s mission. ", "But the real biggies – Google, Microsoft, Facebook, Amazon, Intel, IBM – all stand to benefit massively from this and they could get this off the ground by investing a rounding error in their monthly P&L.\n\nYes, I know, these big companies are now global and they will prosper if the big emerging markets bring new consumers into the global economy, as they will, even if unemployment in America sucks. ", "But even if you assume that the leaders of these big companies don’t care about their home country (I am not that cynical, I think they do care, they are also busy and have an overriding responsibility to shareholders), they need the American economy to recover faster. ", "The emerging markets won’t pick up the slack fast enough. ", "And America has always had the most innovative consumers and that really matters.", "\n\nAnd in this social media age the blurring lines between consumers, audience and workers means that the biggies cannot prosper if the reality for a big % of the population sucks badly.", "\n\nThere is a massive disconnect that I see every day. ", "On the one side I am seeing the old “war for talent” coming back and I know first hand how tough it is to hire for certain skill sets. ", "On the other hand, that unemployment rate seems stuck at 9% (yes I know that is the headline/official figure and the real number is much higher). ", "Last year (actually just a few days ago) I penned this very bullish post on Read Write Web about the coming tech/media IPO boom in 2011. ", "Kid Mercury points out in comments that unless the consumer economy recovers all this tech/media boom will evaporate. ", "I think he is right. ", "But I also think that unemployment will improve, so the macroeconomics are still on the mend. ", "I don’t know where the jobs will come from but I am confident that America has a very dynamic economy and the jobs will come.", "\n\nThe problem – and it is a very big and ugly problem – is that it is taking far longer than usual to create those jobs and huge numbers of people will be totally left behind and won’t ever find good jobs. ", "That is a helluva lot of blighted lives and that is very, very sad. ", "Yep, the New Year celebrations are over and the world still has a lot of things that suck!", "\n\nSo I really believe that those of us in the good tech/media jobs have a responsibility to try and do something about this. ", "Marc Canter is clearly trying.", "\n\nMarc is totally right to focus on massive bandwidth everywhere. ", "It would be like aiming for better sanitation without working on plumbing.", "\n\nBut I think that massive bandwidth everywhere alone is not enough. ", "The big missing piece, the elephant in the room, is basic education. ", "Without really good basic education that massive bandwidth everywhere will simply be used to CONSUME videos and games. ", "The health of the economy depends on a reasonable balance of CREATORS as well as CONSUMERS.", "\n\nI have been involved in a very small way with basic education in my area with the Rhinebeck Science Foundation (my wife, Julia Spiegel, is a founder). ", "Among other initiatives, this Foundation works with Project Lead The Way, which already has a lot of tech industry validation and backing.", "\n\nMarc’s initiative that I saw today triggered memories of something I was thinking about a couple of years ago but sadly did not make the time/energy to do anything about. ", "Shame on me.", "\n\nHere are my notes from about 2 years ago, although the original inspiration was more like 3 years ago. ", "I left it unedited:\n\nThis is about one idea that has been bugging me for ages and I have not had the time to get off the ground. ", "I have tested it on a few friends/family who think I am nuts but that it might have something worth pursuing.", "\n\nI call it the Fleischmanns plan, after this sad little poster child for rural poverty in America. ", "I found this place by accident while going skiing at a nearby resort. ", "The contrast between the skiing place and this village – only a few miles away – was stunning and saddening. ", "All shops/cinema boarded up. ", "Houses with caved in roof. ", "Only one place open – a coffee shop – totally empty at 10am on a Sunday.", "\n\nI have often wondered why one village is prosperous and another one is not. ", "I think that there are 3 aspects (not in any order of importance, all are needed)\n\nBandwidth. ", "Young creative/tech people will move to a cheap beautiful area if there is mega fast bandwidth. ", "We have the technology for this (Wimax etc). ", "That brings new money and cachet to the area. ", "It used to be that hippies and gays were the pioneers in new areas – follow them and make money in real estate was a simple formula. ", "Today that rule is follow the creative/tech workers who can be distant independent. ", "Methinks Intel and other interested big tech vendors might be donors of equipment.", "\n\nK-12 School. ", "If the school is no good, people leave when they want to start a family. ", "That makes the initial young singles entry unsustainable. ", "This is where I have come up with a rather more wild idea. ", "This idea came from seeing a lot of public and private schools for my now 8 year old son. ", "We saw one public school in downtown Manhattan that was superb, better than most private schools. ", "Run by a real leader. ", "The property prices in the area had risen big time as families moved to the area for the school – we nearly did that ourselves. ", "It kept bugging me that the school principal and teachers did not benefit from the rise in poperty prices. ", "More on that later.", "\n\nBranding. ", "Lots of local people would benefit from “location branding” (think Champagne from France, or any number of examples from Europe). ", "This drives tourism and e-commerce. ", "My work as an advisor to this venture helped me see this. ", "Not just food – any artisanal products. ", "The incoming young creative/tech people would be naturals to drive this.", "\n\nThe idea of linking teacher pay to rise in property prices is the most radical. ", "Think of a young teacher saying “let me invest years to build a really great school in this area and let me see some upside from that investment”. ", "Talent does tend to follow money. ", "Here are some of the pieces – this a bit short-hand:\n\n501c3 that invests in real estate within a school district\n\nrun by a local realtor who is paid a bonus based on profit\n\nAn evergreen fund – profits/rents are re-invested\n\nStartup school – teachers and head gets bonus based on profits from the real estate fund\n\nSchool can be private or charter – but has to be outside the public school system\n\nNeed a fund to enable everybody’s kids to attend (as it will be outside the public school system).", "\n\nChoose school district with these criteria:\n\n* low property prices for low end houses (ie excl 2nd home market)\n* failing public school (don’t want to go in with a private initiative to ruin a public school that is OK and trying hard to be better)\n* natural beauty, sports, lifestyle\n* good college fairly nearby\n\nRandom notes:\n\nProfits from real estate fund plus seperate endowments (eg Gates) to give scholarships to enough kids to close the public school\n\nWork to reduce property tax as no need to fund school\n\nHouse in village and land for investment/future house\n\nLocal tax incentives for start-up biz.", "\n\nFleischmanBitFactory – nerds artists and writers – do as llc with coop ownership\n\nMarc Canter is working on cities. ", "My thoughts were on rural. ", "That is just a lifestyle choice, the poverty/unemployment problems are dire in both.", "\n\nFocussing on cities is smart. ", "Young singles can move to cities and don’t care about schools, that only comes later when/if they have kids. ", "But methinks a real flourishing local economy needs all types to be motivated to stay, so the married with kids crowd need to feel good about the area as well. ", "But at least you can get started with massive bandwidth everywhere and young singles and the education and kids stuff can come later.", "\n\nSo what can I do about this? ", "Well I will start by writing this and getting some link love from friends in the media. ", "I will also ask Marc what help he needs." ]

{ "pile_set_name": "Pile-CC" }

[ 0.008233040571212769, 0.0005675379652529955, 0.0006433299276977777, 0.0006501975003629923, 0.042662400752305984, 0.000753183732740581, 0.008539730682969093, 0.0009783449349924922, 0.004691397771239281, 0.000608708243817091, 0.0006107718218117952, 0.0006392051582224667, 0.02877446450293064, 0.0007550554582849145, 0.0007610127795487642, 0.0005647726939059794, 0.4548974335193634, 0.0006592548452317715, 0.0008827610872685909, 0.0007823517662473023, 0.00487939827144146, 0.0006354943034239113, 0.0006854077219031751, 0.000972580979578197, 0.0006974891293793917, 0.029940422624349594, 0.028120730072259903, 0.9515760540962219, 0.0005632757674902678, 0.0009279435616917908, 0.000879512750543654, 0.0005600759177468717, 0.0009153268183581531, 0.00633671460673213, 0.0010526106925681233, 0.0005507139721885324, 0.0005405716365203261, 0.000534660299308598, 0.0005489041795954108, 0.18386492133140564, 0.0005904590943828225, 0.0007109433063305914, 0.0006934351986274123, 0.001488301670178771, 0.0006053082179278135, 0.0008046420407481492, 0.000720406707841903, 0.0009636351023800671, 0.0018905434990301728, 0.0005572914960794151, 0.0005713696009479463, 0.0008534648222848773, 0.0005833866307511926, 0.0005932038766331971, 0.1526753455400467, 0.0006154381553642452, 0.0005713219870813191, 0.0013683874858543277, 0.0011651813983917236, 0.0005761724896728992, 0.0006451252265833318, 0.0013360432349145412, 0.0005960796261206269, 0.002604422392323613, 0.0005778914783149958, 0.001901192357763648, 0.0006214556051418185, 0.000790257821790874, 0.0005018145893700421, 0.0006934408447705209, 0.0005405950942076743, 0.0008432262111455202, 0.0005968656041659415, 0.0009458493441343307, 0.0006675539771094918, 0.0006844158633612096, 0.0008300363551825285, 0.0019004850182682276, 0.00323638622649014, 0.0005915744695812464, 0.0007796802674420178, 0.0007724502356722951, 0.0025592478923499584, 0.0005835573538206518, 0.0007489720592275262, 0.0007458946201950312, 0.0005369159625843167, 0.0005766741232946515 ]

[ "Then-President-elect Barack Obama and President George W. Bush, Nov. 10, 2008. (", "Getty Images/Gary Fabiano-Pool)\n\n(CNSNews.com) - The federal government spent $1,822,712,000,000 in the first five months of fiscal 2019, the most it has spent in the first five months of any fiscal year since 2009, which was the fiscal year that outgoing President George W. Bush signed a $700-billion law to bailout the banking industry and incoming President Barack Obama signed a $787-billion law to stimulate an economy then in recession.", "\n\nAt the same time that federal spending was hitting this ten-year high, federal tax revenues in the first five months of the fiscal year were hitting a four-year low of $1,278,482,000,000.", "\n\nAccording to the Monthly Treasury Statement for February, the Treasury spent $1,822,712,000,000 in the five months from October 2018 through February 2019, the first five months of the federal fiscal year.", "\n\nThe last time the Treasury spent more than that in the first five months of a fiscal year—in inflation-adjusted constant February 2019 dollars—was fiscal 2009. ", "That year, the Treasury spent $1,936,268,470,000.", "\n\nFiscal 2009 started with President Bush signing the Troubled Asset Relief Program into law on Oct. 3, 2008; it continued with President Obama, after his January inaugural, signing the American Recovery and Reinvestment Act on Feb. 17, 2009.", "\n\nAt the time, the Bush bank bailout and Obama stimulus were perceived as the two of the biggest emergency spending bills in the nation’s history.", "\n\n“With evidence mounting that the nation faces a sharp economic downturn, Congress yesterday gave final approval to what may be the biggest government bailout in American history, authorizing the Bush administration to spend $700 billion to try to thaw frozen credit markets and prevent a deep recession,” the Washington Post reported when Bush signed the bank bailout.", "\n\nThe reporting on Obama’s stimulus was similar.", "\n\n“Warning that its passage into law ‘does not mark the end of our economic troubles,' President Obama on Tuesday signed the $787 billion stimulus package, a measure he called the most sweeping financial legislation enacted in the nation's history,” the Washington Post reported on Feb. 17, 2009.", "\n\nThe Congressional Budget Office said this about the impact the stimulus (H.R. 1) would have on federal deficits: “CBO estimates that enacting the conference agreement for H.R. 1 would increase federal budget deficits by $185 billion over the remaining months of fiscal year 2009, by $399 billion in 2010, by $134 billion in 2011, and by $787 billion over the 2009-2019 period.”", "\n\nAfter federal spending hit an all-time high of $1,936,268,470,000 (in constant February 2019 dollars) in the first five months of fiscal 2009, it eventually dropped to $1,595,941,280,000 in the first five months of fiscal 2014. ", "That was the lowest level for the first five months of any fiscal year in the last ten.", "\n\nFederal spending climbed from $1,702,631,750,000 (in constant February 2019 dollars) in the first five months of fiscal 2018 to $1,822,712,000,000 in the first five months of fiscal 2019.", "\n\nWhile spending has gone up this year, federal tax receipts have declined.", "\n\nTotal federal tax revenues through February dropped from $1,305,723,550,000 (in constant February 2019 dollars) in fiscal 2018 to $1,278,482,000,000 this year.", "\n\nThe last time, total federal tax revenues were lower through February than they were this year was fiscal 2015, when they were $1,276,806,230,000 (in constant February 2019 dollars).", "\n\nStanding alone, individual income tax receipts also hit a four-year low of $626,592,000,000.", "\n\nCorporation income taxes through February hit their lowest level in eight years--$59,194,000,000. ", "That was down from $74,658,920,000 through February in fiscal 2018.", "\n\nThe last time federal corporation income taxes were lower through February than they were this year was fiscal 2011, when they were $43,607,510,000 (in constant February 2019 dollars).", "\n\nIn the month of February alone, corporations paid a net negative in federal income taxes, according to the Monthly Treasury Statement.", "\n\nDuring the month, according to the statement, corporations paid a net negative of $669,000,000 in income taxes.", "\n\nIt is not unusual for corporations to pay a net negative in income taxes in the month of February, according to historical data from the Monthly Treasury Statements. ", "In the last 20 fiscal years (2000 through 2019), corporations have paid net negative income taxes in 10 Februaries (2001, 2002, 2003, 2008, 2009, 2011, 2015, 2016, 2018, 2019).", "\n\nIn fact, the net negative $669 million in income taxes paid by corporations this February was less than the net negative income taxes paid by corporations in any of the other nine years over the past 20 that corporations paid net negative income taxes.", "\n\nThe highest level of net negative income taxes paid by corporations over the past 20 years occurred in fiscal 2016, when corporations paid a net negative $3,685,390,000 in income taxes (in constant February 2019 dollars).", "\n\nAsked about the decline in corporation income tax revenues, a senior Treasury Department official told CNSNews.com that the Tax Cuts and Jobs Act signed by President Trump in December 2017 was understood to be frontloaded in that corporations early on would take advantage of the new expensing rules to build their businesses.", "\n\nA paper by the Tax Foundation explains: “The provision allows businesses to immediately deduct the full cost of short-lived investments, similar to the treatment of other business expenses, rather than stretching the deductions over many years.”", "\n\n[Below is the summary of receipts from the February 2019 Monthly Treasury Statement.]", "\n\n(Dollars amounts in this story were adjusted to constant February 2019 values using the Bureau of Labor Statistics inflation calculator.)", "\n\nThe business and economic reporting of CNSNews.com is funded in part with a gift made in memory of Dr. Keith C. Wold." ]

{ "pile_set_name": "OpenWebText2" }

[ 0.0006085489876568317, 0.000588136026635766, 0.0010994237381964922, 0.0005964211886748672, 0.0006628243718296289, 0.0006669441354461014, 0.0005837158532813191, 0.0010145308915525675, 0.0006756550865247846, 0.000635772361420095, 0.0006677671335637569, 0.0006039876607246697, 0.0006606256356462836, 0.0009087295038625598, 0.0006142635247670114, 0.0007744210888631642, 0.000707824423443526, 0.0006791289197281003, 0.000996797694824636, 0.0015651419525966048, 0.0006558769382536411, 0.0006942673935554922, 0.0006236845511011779, 0.0007658916292712092, 0.000616060511674732, 0.0006160899065434933, 0.00091483851429075, 0.0006466588820330799, 0.0005817505298182368, 0.0005507641471922398, 0.0005609462386928499, 0.0007005001534707844, 0.0005766675458289683 ]

[ "Calls for Highway Code to be taught in schools\n\nAn insurance firm is calling on schools to teach the Highway Code after a survey showed more than 80 per cent of drivers don’t recognise basic road signs.", "\n\nIn a quiz posted on the ingenie website, 82 per cent of those who participated failed to correctly identify national road rules and signs, with more than a third of people getting less than 50 per cent right.", "\n\nAs a result of the findings, ingenie is calling for parents and schools to introduce under-17s to the Highway Code, along with hazard perception and driving theory, to give them a head start with their grasp of road knowledge.", "\n\nRichard King, ingenie CEO, said: “It’s worrying that even experienced drivers aren’t showing basic Highway Code knowledge, which every driver should have to keep themselves and other road users safe. ", "If schools introduce the Highway Code and hazard perception to pupils before they even reach driving age, we can build an entire generation of better, safer drivers.”", "\n\nIngenie filmed two drivers taking the quiz in an online social experiment, 20 years after passing their driving theory tests.", "\n\nTracey, aged 45, and Lester, aged 51, failed the road quiz, with neither able to answer questions regarding the National Speed Limit or the tread depth of a tyre.", "\n\nDo you think you could pass? ", "Try ingenie’s road signs quiz at www.ingenie.com/road-signs-quiz.", "\n\nThe experiment marks the second of the five gears in ingenie’s Parent Manifesto; a robust series of activities that aims to educate parents on how to get more involved when their child is learning to drive, in order to complement the learning process and promote safer driving amongst young people.", "\n\nThe manifesto will be made up of five stages released over the next few months – with each stage aiming to educate parents on another way they can help their child drive safely and save money.", "\n\nFor more information about how to help a young driver get on the road safely, visit www.ingenie.com/parent-manifesto.", "\n\nDon’t miss out on all the latest breaking news where you live.", "\n\nHere are four ways you can be sure you’ll be amongst the first to know what’s going on." ]

{ "pile_set_name": "Pile-CC" }

[ 0.0007816386641934514, 0.000727966777049005, 0.0007144918781705201, 0.0009099832968786359, 0.0007358978618867695, 0.0007472332217730582, 0.0008041939581744373, 0.0015066476771607995, 0.0012285740813240409, 0.0006978724850341678, 0.0005983650335110724, 0.0006372142815962434, 0.03406081348657608, 0.0010414146818220615 ]

[ "During vertebrate neural development, generation of cellular diversity depends upon activation of signal transduction pathways and expression of genes encoding transcription factors that regulate the formation of neurons and glia from multipotent progenitor cells. ", "Many cell-autonomous factors involved in neuronal cell fate specification have been described; however, determinants of astrocyte lineage development from mutipotent precursors are poorly understood. ", "Several lines of evidence indicate roles for Epidermal Growth Factor Receptor (EGFR)-mediated signaling in this process, and activating mutations of EGFR are implicated in the progression from low-grade astrocytoma to high-grade glial brain tumors in humans. ", "This proposal will test the hypothesis that common mechanisms may underlay aspects of astrocyte development and tumorigenesis. ", "In preliminary work, we have established an in vitro model of astrocyte development from multipotent neural stem cells (NSC). ", "We show that exogenous EGFR proteins can stimulate mature astrocytes to re-enter the cell cycle efficiently in the setting of INK4a deficiency, a mutation commonly found in high-grade human brain tumors. ", "These preliminary results together with previously published data suggest that EGFR signaling is a powerful regulator of astrocyte differentiation that may act in concert with other synergistic genetic aberrations in the generation of transformed glia. ", "Specific Aim 1 is to determine roles for EGFR signaling in survival, proliferation and differentiation along the neural stem cell (NSC)-to-astrocyte axis in wild type and INK4a deficient genetic backgrounds. ", "Specific Aim 2 is to determine molecular consequences of EGFR activation along the NSC-astrocyte axis using biochemical and expression profiling approaches. ", "Specific Aim 3 is to use genetic profiling information from Aims 1 and 2 to identify transcription factors with functional roles during astrocyte lineage development in the mammalian CNS. ", "In Specific Aim 4, genes identified in Projects 1-3 will be subjected to a functional screen to identify factors involved in glial cell cycle regulation and transformation in vitro and in vivo." ]

{ "pile_set_name": "NIH ExPorter" }

[ 0.0006186373648233712, 0.0006206518155522645, 0.0007972767343744636, 0.000598750717472285, 0.0005572928348556161, 0.0007663508877158165, 0.0007334082620218396, 0.0006080217426642776, 0.0006509762606583536, 0.000561551540158689, 0.0006459597498178482 ]

[ "Our Client Testimonials\n\nMy wife and I are very pleased that we were able to have Mr. Page work with us remodeling my wife’s bathroom. ", "The bathroom that she lived with for 30 years in green became a beautiful bathroom. ", "With Mr. Page’s suggestions the green tub became a custom walk in shower. ", "Taken back to the studs and remodeled the correct way. ", "He did not cut corners nor get in a hurry but took his time and in doing so showed his craftsmanship and pride in his work. ", "We would gladly hire Mr. Page again for another project and highly recommend him to others looking for a quality job.", "\n\nJim and Terry Warner\n\nMaurice Page’s projects display workmanship of the highest quality. ", "For example, on built-in cabinets he made for us, both the inside and outside corners of large moldings meet perfectly. ", "He is very detail-oriented. ", "Maurice is a problem-solver he doesn’t just tell you “We have an issue here,” he offers solutions.", "Maurice is knowledgeable in all aspects of construction and renovation, and has creative solutions when “surprises” surface. ", "He works in a professional manner, and the work site is tidy in process and cleaned up when the work is done. ", "Unlike some other companies, where the owner comes to do and estimate and then workers show up who seem to have no idea of the particulars of the project, there is no such lack of continuity with Maurice, He is involved in all aspects of the project.", "\n\nSerge and Lois Asensio\n\nWe are happy with our decision to have Page Construction complete the remodeling of two bathrooms. ", "Former clients had recommended Maurice to us, and we join them in expressing satisfaction in the quality of work he performs. ", "Not only was Maurice easy to work with, he was patient and careful in making sure he understood exactly what we wanted, design-wise. ", "He willingly met with us as needed, shopped with us, and assisted us in the selection of materials and colors that would fit our plan and budget. ", "In fact, he was extremely helpful in building our decision regarding the appearance and durability of products and finishes. ", "We love our final remodeled rooms, and when the time comes for future projects, we will not hesitate to call Maurice!", "\n\nKell and Karen Mason\n\nI recently used Maurice Page of Page Construction to do some major renovating in my home which included properly taking down and reinforcing a load bearing wall, installing a new kitchen and bathroom cabinet adding a new bathroom, finishing and painting, and the necessary plumbing and electrical involved with all the above. ", "He also installed new doors and windows in my basement. ", "I have been very happy with the finished work. ", "Its beautiful! ", "He shows up every day, works hard, stays focused and does not waste time. ", "I would highly recommend him for any remodeling needs.", "\n\nNancy Blankenship - Lynchburg\n\nMy husband and I were introduced to Maurice Page with Page Construction in 2011, when beginning the total remodel of our home. ", "Since that time, Maurice has redone our kitchen, two bathrooms a bedroom, living room and built a garage. ", "He has consistently impressed us with his creativity and craftsmanship. ", "The quality of the work was outstanding. ", "We have appreciated the friendly business relationship we’ve had with Maurice and look forward to a continuing relationship with Page Construction into the future.", "\n\nAnn and Bill Bellany\n\nHoliday baking and meal preparation for my family was more enjoyable this year thanks to the recent renovation of our kitchen by Page Construction. ", "Maurice Page and his son did a fantastic job of completing my dream kitchen. ", "Maurice listened to my ideas and wishes and offered alternative suggestions to arrive at the look I was hoping for.", "\n\nFrom cabinet and hardwood floor installation to electrical and plumbing improvements, Page Construction did it all. ", "The job was completed in a reasonable amount of time and with very little clutter to live with. ", "My only regret is that I did not contact Page Construction earlier. ", "We will definitely call for future renovations in our home.", "\n\nTanner\n\nPage Construction is dedicated to meeting the needs of your upcoming project. ", "If you would like to schedule a consultation, please fill out the form and we will contact you with more information. ", "Or call today to get started with a consultation! ", "We look forward to working with you." ]

{ "pile_set_name": "Pile-CC" }

[ 0.0009516847203485668, 0.0007516282494179904, 0.0014534357469528913, 0.0006324343266896904, 0.0006691001472063363, 0.0005487579619511962, 0.000654927862342447, 0.0006066117202863097, 0.0006679619546048343, 0.006121629849076271, 0.000550866243429482, 0.0005790826980955899, 0.000593899458181113, 0.0006062518805265427, 0.0005095577798783779, 0.00057922926498577, 0.0005193536053411663, 0.0005661178729496896, 0.0005652640829794109, 0.0005925687728449702, 0.002557955216616392, 0.000530121847987175, 0.0010114865144714713, 0.0007862306083552539, 0.0005978730623610318, 0.0006249177386052907, 0.0012099473970010877, 0.0005314331501722336, 0.0005575406248681247, 0.0004986893618479371, 0.0005746281240135431, 0.0006000131834298372, 0.0005277424352243543, 0.000591750955209136, 0.0008137232507579029, 0.0007496267789974809, 0.0005745550151914358, 0.0005953001091256738, 0.000548012088984251, 0.0008159151184372604, 0.0005655515706166625 ]

[ "Still can't find anything?", "\nHave us write a brand new example essay for your Shakespeare assignment!", "\n\nReasons To Use Us\n\n1) U.S. Based Writers\n\n2) Free Revisions\n\n3) Plagiarism Free\n\n4) 24/7 Tele Support\n\n5) Several Hour Rushes Available\n\nTestimonials\n\nJennifer, Hawaii\n\nI’m glad that my roommate told me about your site. ", "I was a member to another site, but I felt like I was being ripped off paying month after month for a membership. ", "Your site saved me thirty dollars a month.", "\n\nJermaine, New York\n\n‘to be or not to be\"… This site is TO BE. ", "Great Shakespeare site guys! ", "I ordered two papers and both of them were very well written. ", "Kudos.", "\n\nImportant Shakespeare Links\n\nAbout Shakespeare Papers\n\nWe guarantee that you’ll locate a well written essay or term paper on your William Shakespeare topic, or we’ll write a brand new essay as quickly as today! ", "First: complete a general search in our database for an exemplary paper. ", "We are pleased to send you a free excerpt of any essay to read over our work before ordering. ", "If you still haven’t found a paper closely related, simply order a brand new essay to be written!" ]

{ "pile_set_name": "Pile-CC" }

[ 0.0007761269807815552, 0.0009099476155824959, 0.000662627920974046, 0.006920842919498682, 0.0009091270039789379, 0.0010889159748330712, 0.001937870983965695, 0.0006028452189639211, 0.018519587814807892, 0.0005880446406081319, 0.000552511541172862, 0.000536328530870378, 0.0008825886761769652 ]

[ "Foreclosure News\n\nBuying a Foreclosed Home\n\nAre you looking for an affordably priced home or are you looking for a home that you can turn into an investment property? ", "If you are, you will want to take the time to examine foreclosed homes. ", "Although you will find some variances, foreclosed homes are typically more affordable that other properties listed on the real estate market.", "Read More »" ]

{ "pile_set_name": "Pile-CC" }

[ 0.0008408039575442672, 0.0005870213499292731, 0.0005656802095472813, 0.0007952656014822423 ]

[ "Introduction\n============\n\nEarly diagnosis of ovarian cancers is a critical factor in improving the survival rate of patients. ", "Several factors impact the carcinogenesis and prognosis ([@B01]) of ovarian cancer. ", "The pathogenesis of ovarian cancer is closely related to ARID1A (AT-rich interactive domain-containing protein 1A), which is present in up to 57% of patients ([@B02]) and acts as a tumor suppressor in various cancers ([@B03]). ", "Patients with ovarian clear cell carcinomas commonly respond poorly to standard platinum-based chemotherapy ([@B04]). ", "Loss of ARID1A expression has also been associated with a shorter progression-free survival ([@B05]). ", "Dysfunction of ARID1A can lead to abnormal chromatin remodeling, resulting in the carcinogenesis of ovarian and gynecologic cancers. ", "Earlier studies reported that ARID1A mRNA expression was lower in endometriosis tissues than that in normal endometrial tissues. ", "Low expression levels of ARID1A gene may contribute to the tumor\\'s tendency to transform malignantly ([@B06]). ", "Currently, growing evidence has indicated that ARID1A may have a widespread role in the suppression of various tumors. ", "The comprehensive study of ARID1A gene can provide a basis for earlier diagnosis and effective molecular target therapy ([@B07]).", "\n\nPhosphatase and tensin homolog (PTEN) is a novel anti-oncogene ([@B08]) that, as a tumor suppressor gene, plays important roles in suppressing cancer and regulating apoptosis, enhancing the sensitivity of cancer cells to anticancer agents ([@B09]). ", "Expression of PTEN in ovarian cancer tissue is negatively associated with clinical stage and differentiation degree. ", "Expression of PTEN mRNA was significantly downregulated in blood plasma of epithelial ovarian cancer (EOC) patients compared to the ovarian tumor patients ([@B09]). ", "Therefore, the overall survival of patients with PTEN positive expression was significantly longer than that of those with PTEN negative expression ([@B10]).", "\n\nFollicle-stimulating hormone (FSH) promotes the rapid growth and survival of EOC cells, and facilitates entry into the carcinogenesis process. ", "FSH also inhibits apoptosis of ovarian cancer cells. ", "FSH exerts its functions via binding to its cognate receptor (FSHR) expressed in ovarian cancers and gynecologic malignancies ([@B01]). ", "FSHR overexpression may be associated with enhanced levels of potential oncogenic pathways and increased proliferation in EOC cells. ", "Therefore, inhibition of FSHR overexpression may be beneficial for suppressing the carcinogenesis and progression of EOC. ", "However, whether FSHR plays a role in ovarian cancer development is still uncertain ([@B11]).", "\n\nFSH receptor binding inhibitor-8 (FRBI-8), a non-steroidal antagonist for FSH, was identified from sheep and human ovarian follicular fluid ([@B12],[@B13]). ", "FRBI not only blocked the binding of FSH to FSHR, but also altered FSH actions ([@B14]). ", "Our initial study revealed that the addition of 10 to 40 μg/mL FRBI into *in vitro* maturation (IVM) medium reduced the maturation rate, enhanced the apoptosis rate, and decreased the proliferation capacity of sheep cumulus-oocyte complex. ", "Additionally, FRBI decreased FHS concentrations and increased estradiol (E~2~) concentrations in the IVM medium ([@B15]). ", "Currently, there is scarce information about effects of FRBI on the gene levels associated with ovarian cancers in humans and animals ([@B16]). ", "Little is known about whether FRBI modulates ARID1A and PTEN levels in normal ovarian and cancerous tissues ([@B17],[@B18]).", "\n\nBased on the previous research, we hypothesized that FRBI impacts the expression levels and production of ARID1A, PTEN, and FSHR, which are associated with carcinogenesis and progression of ovarian cancer. ", "The present study aimed to evaluate the effects of FRBI on the levels of ARID1A and PTEN genes in ovarian tissues and blood, to determine the regulating effects of FRBI on expressions of FSHR genes and proteins as well as phosphorylation of FSHR in the ovarian tissues. ", "Additionally, we aimed to investigate the correlation between these factors, to further explore the signal pathway and molecular mechanism of FRBI actions. ", "We expect to find a novel preventive and therapeutic agent for ovarian cancers.", "\n\nMaterial and Methods\n====================\n\nAnimal treatment\n----------------\n\nFSH receptor binding inhibitor peptide (FRBI, an 8-peptide including H-Ter-Glu-Asn-Leu-Glu-Pro-Asn-Gly-Glu-Gly-NH~2~) of 99.9% purity was synthesized by Nanjing Peptide Biotech Co. Ltd., China (CAS: 163973-98-6) referring to initial reports ([@B13]) and characterized before using. ", "FRBI solution was prepared according to the method established in our laboratory ([@B19]). ", "The concentration of FRBI was 1 mg/mL.\n\nOne hundred and eighty pre-puberty Kunming female mice (*Mus musculus*) were purchased from Experiment Animal Center, Lanzhou University (License No. ", "SCXK (Gansu) 2005-0007). ", "Mice were utilized in experiments at 21 days of age and body weight of 22.3±1.52 g after they acclimatized for 10 days prior to experiments. ", "All mice were randomized into FRBI, FSH, and control groups (CG) (n=30). ", "Mice of the FRBI group were again divided into FRBI-10, FRBI-20, FRBI-30, and FRBI-40 groups. ", "They were intramuscularly injected with FRBI at the doses of 10, 20, 30, and 40 mg/kg, respectively, once a day for five consecutive days. ", "Mice in the FSH group were intramuscularly injected with 10 IU FSH once a day for five consecutive days, which was used as a positive control group. ", "Mice in the control group (CG) were injected intramuscularly with 0.2 mL saline once a day for five consecutive days. ", "Injections were made in the morning (at 8 to 9 AM) each day.", "\n\nAll mice were weighed each day using an electronic scale, and were raised as a group kept in cages (5 mice per cage), equipped with automatic water dispensers in a room maintained at 22--24°C and 30--50% relative humidity. ", "The light cycle in the room provided 12 h light/day. ", "Mice received a commercial diet (Lanzhou Taihua Feed Co. Ltd., China). ", "Water was provided *ad libitum*. ", "All procedures referring to animal treatment were approved by the Experimental Animal Care and Use Committee of Gansu Province, the People\\'s Republic of China.", "\n\nSample collections and measurements\n-----------------------------------\n\nFive mice from each group were sacrificed by cervical dislocation on days 0, 7, 10, 15, 20, and 30 after they were anesthetized by injecting 0.1 mg/kg xylazine intramuscularly. ", "Bilateral ovaries were aseptically harvested. ", "The weight of each ovary was recorded immediately on an electronic scale. ", "The average value was calculated based on the left and right ovaries of each mouse. ", "Blood samples were also collected at each sampling time-point as described above. ", "Serum was separated and stored at --20°C.", "\n\nDetection of protein concentrations in ovarian tissues\n------------------------------------------------------\n\nProtein concentrations in ovarian tissues were detected using a BCA Protein Assay Kit (Yeze Biotechnology Co., Ltd., China) according to the kit protocol. ", "Analytical sensitivities were 0.025 mg/mL.\n\nWestern blots of ARID1A and PTEN, and FSHR proteins in mouse ovaries\n--------------------------------------------------------------------\n\nTo evaluate the expression levels of ARID1A and PTEN genes and proteins in mice ovaries, western blot was carried out according to our previous report ([@B19]). ", "The polyclonal antibodies of rabbit anti-ARID1A antibody-C-terminal (Ab176395; 1:2000), anti-PTEN antibody (Ab170941, Abcam Trade Co., China; 1:2000), and anti-FSHR antibody (BOSTER Biological Technology Co. Ltd, China; 1:1000) were utilized. ", "They were diluted and incubated at 4°C overnight, followed by 1 h incubation at room temperature with the appropriate secondary antibody (goat-anti mouse IgG; 1:20000). ", "Anti-β-actin mouse monoclonal antibody (Ab8226, Abcam Trade Co.) was diluted at 1:8000 for sample loading control. ", "Blots were further developed using a chemiluminescence reagent (SuperSignal West Pico, USA). ", "The integrated optical density (IOD) of the scanned band images and relative level of each protein was determined using Quantity One software (Bio-Rad Company, USA). ", "The relative concentrations of ARID1A and PTEN proteins are reported as the ratio between gray values of ARID1A and PTEN proteins divided by that of β-actin. ", "A negative control was performed without a primary antibody. ", "Assays were executed in triplicate.", "\n\nReal-time RT-PCR of FSHR mRNAs\n------------------------------\n\n### Primer design\n\nPrimers specific for FSHR (GenBank accession number: NM-013523.3) were designed with Beacon Designer 7.0 software (Premier Biosoft International, USA) according to manufacturer\\'s guidelines, and Primer-BLAST (NCBI-NIH, USA). ", "Mouse GAPDH gene (GenBank accession number: NM-008084.2) was selected as the reference gene for normalizing expression levels of target genes. ", "The primer sequences were as follows: FSHR, forward 5′-CGTCCTGATGAGCAAGTTTGG-3′ with 20 bp length, and reverse, 5′-TGGGCTGATTGACTTAGAGGG-3′; GAPDH, forward, 5′-CTTCAACAGCGACACTCACTCT-3′ and reverse, 5′-CCACCACCCTGTTGCTGTA-3′. Primers were synthesized by Beijing AoKeDingSheng Biotechnology Co. Ltd., China. ", "The 100, 200, 300, and 500 nM concentrations were evaluated.", "\n\nThe constancy of GADPH was evaluated using geNorm. ", "GAPDH level of CG on day 0 was used to normalize other gene expressions. ", "Only those primer concentrations that showed dimmer-free reactions were used for the further analysis.", "\n\n### RNA extraction and cDNA synthesis\n\nTotal RNA was extracted from ovarian samples using the TRIzol reagent (Invitrogen, China), according to the manufacturer\\'s instructions.", "\n\n### Fluorescence quantitative RT-PCR (qRT-PCR)\n\nThe expression levels of FSHR mRNAs were determined using qRT-PCR. ", "Gene amplifications were performed using a SLAN thermocycler (Hongshi, China). ", "Each 25-μL reaction volume in a 96-well plate comprised 4 μL of 50× diluted cDNA template and 1 μL of each primer pair at 10 μM. Plates were sealed with adhesive optical film (Promega, China) and, after an initial denaturation step of 15 min at 95°C, 44 cycles of amplification were performed according to the following thermocycling profiles: denaturation for 30 s at 95°C, annealing for 20 s at 60°C, and extension for 20 s at 72°C. ", "Fluorescence data were acquired during the last step. ", "A dissociation protocol with a gradient from 65 to 97°C was used to investigate the specificity of the qRT-PCR reaction and the presence of primer dimers. ", "Gene expression levels were recorded as threshold cycle (C~T~) values that corresponded to the number of cycles at which the fluorescence signal can be detected above a threshold value, arbitrarily set to 0.3. ", "GAPDH was used as an endogenous control. ", "The relative amount of each mRNA was determined by the 2^--ΔΔ(Ct)^ method and normalized to the endogenous reference gene GAPDH, of CG on day 0. ", "The samples were run in triplicate.", "\n\nDetection of serum concentrations of ARID1A and PTEN\n----------------------------------------------------\n\nSerum concentrations of ARID1A and PTEN were determined using the specific ELISA kit for mice (Shanghai Chenlie Biotech Co., Ltd., China) according to the kit protocol. ", "Analytical sensitivities were 0.01 pg/mL. The intra- and inter-experimental coefficients of variation were less than 6%. ", "The correlation coefficient of the standard curve was 0.9996. ", "All samples were tested in duplicate in the same assay. ", "The detailed operation steps are presented in our initial research ([@B19]).", "\n\nStatistical analysis\n--------------------\n\nStatistical analysis was done using SPSS v. 21.0 (IBM, USA). ", "For each group, all parameters (including ovarian cortex thickness, maximum longitudinal diameter, maximum transversal diameter, levels of ERβ and FSHR, serum E~2~, and FSH) were calculated based on the data of 5 mice in each subgroup. ", "Data from each time-point were analyzed separately and are reported as means±SE. ", "All variables complied with the assumptions for a one-way ANOVA. ", "When significant differences were identified, supplementary Tukey\\'s *post hoc* tests were performed to determine the pairwise differences. ", "Pearson\\'s correlation analysis was used to determine relationships between FRBI doses and other indexes in CG and the four FRBI groups on day 20. ", "P\\<0.05 was considered significant.", "\n\nResults\n=======\n\nExpression levels of ARID1A and PTEN in ovaries\n-----------------------------------------------\n\nWestern blotting assay showed clear bands of ARID1A and PTEN proteins ([Figure 1A](#f01){ref-type=\"fig\"}), indicating that they were expressed in mice ovaries at the different levels. ", "Expression levels of ARID1A proteins were slightly increased after FRBI treatment ([Figure 1B](#f01){ref-type=\"fig\"}). ", "ARID1A protein level of the FRBI-30 group was higher than that in CG on days 20 and 30 (P\\<0.05), and higher than in the FSH group on day 20 (P\\<0.05). ", "These findings indicated that 30 mg/kg FRBI treatment could promote the expression level of ARID1A proteins in mouse ovaries.", "\n\n{#f01}\n\nAs presented in [Figure 1C](#f01){ref-type=\"fig\"}, expression levels of PTEN proteins in the four FRBI groups were increased after treatment. ", "The maximum increment was found in the FRBI-30 group. ", "The PTEN level of the FRBI-30 group was higher than that in the CG on days 20 and 30 (P\\<0.01), and it was higher than the FRBI-40 group on day 30 (P\\<0.01). ", "Meanwhile, PTEN level of the FRBI-20 group was higher than CG on day 30 (P\\<0.05). ", "These findings indicated that 30 and 40 mg/kg FRBI treatment could enhance the expressions of PTEN proteins in the ovarian tissues of mice.", "\n\nSerum concentrations of ARID1A and PTEN\n---------------------------------------\n\nSerum ARID1A concentrations of FRBI-treated groups were increased along with the increase of FRBI doses ([Figure 2A](#f02){ref-type=\"fig\"}). ", "ARID1A concentration of the FRBI-40 group was higher than that of CG and FSH groups on days 15, 20, and 30 (P\\<0.05). ", "These results demonstrated that a high dose of FRBI improved production of ARID1A gene.", "\n\n{#f02}\n\nSerum PTEN concentrations changed similarly with concentrations of ARID1A ([Figure 2B](#f02){ref-type=\"fig\"}). ", "PTEN concentrations of FRBI groups were gradually enhanced along with the increase of FRBI doses. ", "PTEN concentration of FRBI-40 group was higher than that of FSH group on day 30 (P\\<0.05). ", "However, there was no significant difference between the four FRBI groups and CG. ", "These findings demonstrated that a high dose of FRBI (40 mg/kg) accelerated PTEN production and raised the serum concentrations of PTEN in mice.", "\n\nExpression levels of FSHR mRNA and proteins in ovaries\n------------------------------------------------------\n\nAs shown in [Figure 3](#f03){ref-type=\"fig\"}, expression levels of FSHR mRNA of the four FRBI groups gradually declined in a dose-dependent manner, with a minimum value for the FRBI-40 group. ", "FSHR mRNA level of the FRBI-40 group was less than that of CG and FSH groups on days 10 and 20 (P\\<0.05 or P\\<0.01). ", "Meanwhile, FSHR mRNA levels of FRBI-20 and FRBI-30 groups were also lower than those of CG and FSH groups on day 15 (P\\<0.05 or P\\<0.01). ", "The outcomes demonstrated that FRBI administration *in vivo* suppressed levels of FSHR mRNAs in mouse ovaries.", "\n\n{#f03}\n\nExpression levels of FSHR proteins were gradually increased in FSH-treated mice from day 7 after treatment ([Figure 4](#f04){ref-type=\"fig\"}). ", "However, expression levels of FSHR proteins of all FRBI groups were dose-dependently reduced, with a maximum reduction in the FRBI-40 group. ", "FSHR protein levels of FRBI-30 and FRBI-40 groups were lower than those of CG and FSH groups on days 15 and 20 (P\\<0.05 or P\\<0.01). ", "These results revealed that a high dose of FRBI (30 or 40 mg/kg) could attenuate expression levels of FSHR proteins in mouse ovaries.", "\n\n{#f04}\n\nTotal protein concentrations of ovarian tissues\n-----------------------------------------------\n\nTotal protein concentrations in the ovarian tissues of FRBI-treated groups were slightly decreased compared to CG on days 20 and 30 (data not shown). ", "However, there was no significant difference among all groups. ", "The results indicated that FRBI treatment did not affect the total protein concentrations in ovarian tissues of mice.", "\n\nPhosphorylation levels of FSHR proteins in serum and ovarian tissues\n--------------------------------------------------------------------\n\nCompared to CG, serum concentration of FSHR phosphorylation in the FSH group was slightly decreased in the experiment ([Figure 5A](#f05){ref-type=\"fig\"}). ", "On day 30, concentration of FSHR phosphorylation in the FSH group was less than that of the FRBI-40 group (P\\<0.05). ", "Contrarily, serum concentrations of FSHR phosphorylation in all FRBI groups were dose-dependently increased during the experiment. ", "However, there was no significant difference between FRBI groups and CG. ", "Ovarian concentrations of FSHR phosphorylation had no significant difference among groups during the whole experiment ([Figure 5B](#f05){ref-type=\"fig\"}). ", "These results showed that FRBI treatment had no influence on the phosphorylation of FSHR protein in serum and ovarian tissues of mice.", "\n\n{#f05}\n\nPearson\\'s correlation analyses\n-------------------------------\n\nFRBI doses had significant positive correlations with levels of ARID1A and PTEN proteins (P\\<0.05; [Table 1](#t01){ref-type=\"table\"}) and negative correlations with levels of FSHR mRNAs and proteins (P\\<0.05 or P\\<0.01). ", "Additionally, ARID1A and PTEN had negative correlations with FSHR mRNA and protein levels (P\\<0.05 or P\\<0.01). ", "These findings indicated that administration of FRBI had promoting effects on expression of ARID1A and PTEN in ovarian tissues.", "\n\nTable 1.Pearson\\'s correlation coefficients for all indexes on day 20.IndexesFRBI doseTPARID1APTENFSHRmFSHRpp-FSHRTP-0.758ARID1A0.944\\*-0.928\\*PTEN0.934\\*-0.5710.829FSHRm-0.993\\*\\*0.827-0.976\\*\\*-0.911\\*FSHRp-0.937\\*0.501-0.788-0.984\\*\\*0.898\\*p-FSHR0.881\\*-0.4570.7420.966\\*\\*-0.848-0.968\\*\\*IP3-0.438-0.105-0.172-0.4150.3410.553-0.395[^2]\n\nDiscussion\n==========\n\nOvarian cancer (oophoroma), especially EOC, is a highly lethal gynecologic malignancy mostly because of delayed diagnosis ([@B01]). ", "The early diagnosis of EOC is a key factor in improving the survival rate of patients. ", "Thus, it is urgently necessary to search for novel diagnostic and prognostic biomarkers ([@B10]).", "\n\nFSH acts via its cognate receptor (FSHR) expressed by granulosa cells in the follicles. ", "FRBI blocked the binding of FSH to FSHR and altered FSH action. *", "In vivo* administration of FRBI impairs the proliferation of granulosa cells ([@B11]).", "\n\nThe identification of molecules and genes involved in the carcinogenesis of ovarian cancer has provided new insights into the molecular basis for anticancer therapy ([@B20]). ", "ARID1A and PTEN are important tumor suppressors in various cancers. ", "Their expression levels are correlated to carcinogenesis of ovarian and gynecologic cancers ([@B06]). ", "There is little information regarding the influence of FRBI on ARID1A, PTEN, and FSHR associated with ovarian cancers ([@B21],[@B22]) and no quantitative research has been reported about the correlation between ovarian carcinogenesis and levels of ARID1A and PTEN in humans and animals ([@B01],[@B23]).", "\n\nThis study indicated that FRBI (30 or 40 mg/kg) increased the expression levels of both ARID1A and PTEN proteins in the ovaries. ", "Our results were consistent with an earlier report ([@B09]). ", "Therefore, FRBI, as a novel biomarker, could be utilized for early diagnosis and therapy of ovarian cancers ([@B22]). ", "The actual effects of FRBI on anticancer activity and progression of ovarian cancers will need to be thoroughly investigated in the future ([@B01]).", "\n\nOverexpression of FSHR increases proliferation in EOC cells. ", "Inhibition of FSHR overexpression suppresses the tumorigenesis and progression of EOC ([@B01]). ", "Moreover, whether the phosphorylation levels of FSHR proteins are implicated with the tumorigenesis is not well known ([@B01],[@B24]). ", "Our present results provided a solid foundation for decreasing the progression of ovarian cancer in patients through inhibiting FSHR overexpression in cancer tissues ([@B25]).", "\n\nProtein phosphorylation plays an important role in the process of cell signal transduction, cell growth and development, and cancer mechanisms ([@B26],[@B27]). ", "Numerous studies in cancer cells and tissues resulted in identification of key differences from healthy tissues and cells at the protein level ([@B28]). ", "Aberrant regulation of phosphorylation in signaling pathways contributes to carcinogenesis ([@B29]). ", "Our findings preliminarily supported this opinion.", "\n\nOur findings concerning serum concentrations of FSHR phosphorylation in FRBI groups and CG indicated that FRBI had no obvious influence on the phosphorylation level of FSHR in serum and ovarian tissues of mice. ", "The main reasons may be that the dosage of FRBI was low and the age of experimental animals. ", "Our results still need to be tested in other animals and humans.", "\n\nConclusions\n===========\n\nWe concluded that FRBI treatment could increase the expression levels of ARID1A and PTEN proteins in mouse ovaries and serum, with a maximum increment in the FRBI-30 group (30 mg/kg). ", "FRBI administration (30 or 40 mg/kg) decreased expression levels of FSHR mRNA and protein levels in mouse ovaries. ", "FRBI doses had significant positive correlations to levels of ARID1A and PTEN proteins. ", "However, FRBI had no influence on the total protein concentration and phosphorylation of FSHR. ", "Our results provided new insights into the molecular foundation of FRBI and a potential novel medication for ovarian cancer ([@B30]).", "\n\nWe thankfully acknowledge Nanjing Peptide Biotech Co. Ltd. (China) for amino acid analysis of FRBI peptide, the Project of National Key Research and Development Program of China in 13th Five-year Plan (2016 YFC0502601), the Reproductive Biotechnology Innovation Team of Animals of Colleges and Universities of Gansu Province of China (Grant No. ", "2017C-01), the Innovative Team Development Project of Ministry of Education of China (IRT-17R88), and National Natural Science Foundation of the People\\'s Republic of China (Grant Nos. ", "41671041, 31460684).", "\n\n[^1]: \\*These authors are co-first authors and contributed equally to this work.", "\n\n[^2]: FRBI: FSH receptor binding inhibitor; TP: total proteins in ovarian tissue; ARID1A: AT-rich interactive domain-containing protein 1A; PTEN: phosphatase and tensin homolog; FSHRm: follicle-stimulating hormone cognate receptor mRNAs; FSHRp: FSHR proteins; p-FSHR: ovarian phosphorylated-FSHR; IP3: inositol trisphosphate. ", "\\*P\\<0.05; \\*\\*P\\<0.01.", "\n" ]

{ "pile_set_name": "PubMed Central" }

[ 0.001315313158556819, 0.0046792118810117245, 0.0008451273897662759, 0.0013254142832010984, 0.0006761675467714667, 0.004338948521763086, 0.0007304211612790823, 0.0007236013771034777, 0.0005770903662778437, 0.0005414501065388322, 0.0011379210045561194, 0.0013473486760631204, 0.0007839126628823578, 0.0006817234680056572, 0.0015286176931113005, 0.12231992930173874, 0.001907098339870572, 0.0009393409709446132, 0.0007740362780168653, 0.0025279063265770674, 0.003422281239181757, 0.0027110979426652193, 0.0012759305536746979, 0.0005972440703772008, 0.0007711763610132039, 0.0014502998674288392, 0.00090769276721403, 0.001053221058100462, 0.0005116915563121438, 0.005390776786953211, 0.0008176530827768147, 0.0005615437985397875, 0.0012058543507009745, 0.0009506435017101467, 0.0006387347239069641, 0.000667785236146301, 0.0008371677249670029, 0.0006551890983246267, 0.0011458790395408869, 0.0009840392740443349, 0.0006167070241644979, 0.0006510671810247004, 0.0006070157396607101, 0.000654286821372807, 0.02714885212481022, 0.0005890022148378193, 0.0006844745948910713, 0.030138203874230385, 0.0006090494571253657, 0.007475159130990505, 0.0005624348414130509, 0.0005845524137839675, 0.0007491233409382403, 0.0014739190228283405, 0.0006534666754305363, 0.000990644795820117, 0.0006314390921033919, 0.0008168214117176831, 0.0005534663796424866, 0.000636611832305789, 0.0006844259914942086, 0.009036832489073277, 0.0006221104995347559, 0.0005894469795748591, 0.004227753728628159, 0.0006139787728898227, 0.0008152537629939616, 0.0007679507252760231, 0.0005815742770209908, 0.0006676338380202651, 0.0006850789068266749, 0.0006096723955124617, 0.0006431564106605947, 0.0006190345739014447, 0.0005369192804209888, 0.0006007836782373488, 0.000690220098476857, 0.0006061381427571177, 0.0006432876107282937, 0.0006256200140342116, 0.0006969227106310427, 0.0006385502638295293, 0.0005790399736724794, 0.000529472716152668, 0.0006035115220583975, 0.0005965934251435101, 0.0005889457534067333, 0.0006760950782336295, 0.0006073273252695799, 0.0006112249684520066, 0.0006307446165010333, 0.003537968499585986, 0.0005653977277688682, 0.0008715816074982285, 0.006717342417687178, 0.0019055769080296159, 0.023978764191269875, 0.0016782431630417705, 0.009448809549212456, 0.000625911692623049, 0.0020813983865082264, 0.0005971546634100378, 0.0007790661184117198, 0.0008017084328457713, 0.0012041350128129125, 0.0006575612351298332, 0.0008330211276188493, 0.0006627368275076151, 0.0019055769080296159, 0.0007953986641950905, 0.000625911692623049, 0.0021733916364610195, 0.0005804899847134948, 0.0008851648890413344, 0.0006774711655452847, 0.0006345846340991557, 0.0012150024995207787, 0.000979914446361363, 0.0009949180530384183, 0.035012681037187576, 0.0019055769080296159, 0.011396973393857479, 0.000625911692623049, 0.001218606368638575, 0.0006604430382139981, 0.0010666146408766508, 0.01175761315971613, 0.0019055769080296159, 0.007531548850238323, 0.000625911692623049, 0.0021217763423919678, 0.0006166849634610116, 0.0013319249264895916, 0.0008321282803080976, 0.0011414840118959546, 0.0007947395206429064, 0.0007399228634312749, 0.0009207464754581451, 0.001237507676705718, 0.0019055769080296159, 0.004236162640154362, 0.000625911692623049, 0.0009274379699490964, 0.001678602653555572, 0.0008205010672099888, 0.0008296394371427596, 0.003882314544171095, 0.03666592761874199, 0.0006040700245648623, 0.000551742734387517, 0.028516707941889763, 0.05263659358024597, 0.0007145637064240873, 0.0007709930650889874, 0.000988036161288619, 0.0028034639544785023, 0.0007978919893503189, 0.0035732516553252935, 0.0005661735194735229, 0.001391525729559362, 0.0006921942695043981, 0.0012832125648856163, 0.000694445101544261, 0.0006893444224260747, 0.0007798943552188575, 0.0006280248635448515, 0.0005473991623148322, 0.0007060458301566541, 0.0005749724805355072, 0.0008398015052080154, 0.0006739904056303203, 0.0008529099868610501, 0.0008336007595062256, 0.014959488064050674, 0.0005968277691863477, 0.0009766480652615428, 0.0015092466492205858, 0.0005356439505703747, 0.0005890198517590761, 0.0008342945366166532, 0.0006321871769614518, 0.0027893546503037214, 0.037003643810749054, 0.001995444530621171 ]

[ "Review: Battleship\n\n'Battleship is to chicken burritos what The Avengers was to shawarma.'", "\n\nIt’s safe to say we all had our expectations going into Battleship. ", "It’s based on a board game, for Christ’s sake, and the trailers made it look noisy, dumb and plotless, with Liam Neeson barely showing up to collect an easy paycheck. ", "And while every single one of those things turned out to be true, they don’t make a lot of difference once the lights are down and Peter Berg starts pummeling the audience with awesome action sequences. ", "It’s still stupid as hell, but clearly, none of us had Battleship pegged.", "\n\nIn the most chicken burrito-centric opening in film history (Battleship is to chicken burritos what The Avengers was to shawarma), the movie introduces us to our hero, Alex Hopper, played by John Carter’s Taylor Kitsch. ", "Alex has no discipline whatsoever, so what’s a guy to do but join the Navy with his big brother, played by “True Blood’s” Alexander Skarsgård? ", "Several years after what will eventually be known as “the burrito incident,” in which Hopper tried to prove his worth to Brooklyn Decker by breaking into a liquor store, he’s somehow been promoted and allowed to command his own Destroyer, even though he’s a maverick renegade. ", "He’s just one misstep away from court martial though, so it sure was nice of aliens to invade the Earth just to teach him a valuable lesson.", "\n\nNo kidding, that’s the whole plot of Battleship. ", "Hundreds if not thousands of lives are lost, and the only positive thing to come out of it is that Taylor Kitsch learned some discipline. ", "Some of the supporting cast makes a tiny impression, but their characters all fall under easy labels like “Sassy Chick” or “Funny Guy.” ", "In place of an actual story, Battleship just gives you a string of ridiculous action spectacles that director Peter Berg shoots with bombastic glee. ", "Judged purely on those merits, Battleship is a fun film, entertaining and lively despite its many shortcomings.", "\n\nBut about those shortcomings. ", "Or rather, one shortcoming that drove me completely nuts.", "\n\nI remain pretty convinced that these aliens, who are never even named, aren’t really the bad guys. ", "The logic that labels them as “bad guys” stems from the questionable observation that they arrived in “battle formation.” ", "Which assumes, rather obliquely, that this alien species has adopted the exact same battle formations humans have despite the obvious light years separating our technological advancements. ", "One of the first plot points involves the aliens’ communications vessel crashing on arrival, which raises the valid question of whether they planned to communicate with us directly, but were then forced into a defensive position when diplomacy was taken off the table. ", "The aliens don’t even attack us first, unless you count a very loud noise similar to the ones at the end of Close Encounters, which seems rather suspect. ", "More to the point, they consistently refuse to attack any human who doesn’t pose an immediate threat. ", "These are not the actions of a purely hostile race. ", "They’re clearly a species with some moral values, but we learn nothing at all about them, and instead of making any attempt to establish a dialogue, the heroes just kill them all. ", "There’s no twist at the end to explain their non-hostile behavior, so unless they’re saving some big revelation for the sequel, somebody, somehow, must have forgotten to make the bad guys actually “bad.” ", "Either way, I remain frustrated, and you should too.", "\n\nBut while there are other complaints – like a theater-shakingly hilarious climactic plot point which makes the Buzz Aldrin cameo in Transformers 3 look subtle – none of that actually matters in the long run. ", "Battleship is clearly intended to be popcorn fun, and as popcorn fun (and only popcorn fun) it succeeds. ", "I’ll leave it to the naval-gazers to sink this Battleship. ", "Go have a good time and don’t worry yourselves about pesky little details like good storytelling." ]

{ "pile_set_name": "Pile-CC" }

[ 0.001017737085931003, 0.0005326444515958428, 0.06233924254775047, 0.0013034919975325465, 0.5988732576370239, 0.0008690349059179425, 0.00824178196489811, 0.0051827700808644295, 0.011371520347893238, 0.001123491209000349, 0.000893950171303004, 0.0017493856139481068, 0.017512919381260872, 0.0008829381549730897, 0.0008219334995374084, 0.05093983933329582, 0.0011138316476717591, 0.0007844368228688836, 0.0006367492605932057, 0.0006057295249775052, 0.0009209307027049363, 0.005432837642729282, 0.0014995042001828551, 0.09651067852973938, 0.0009980186587199569, 0.013939865864813328, 0.000849083298817277, 0.0006456993869505823, 0.0016376941930502653, 0.0009770529577508569 ]

[ "Introduction {#s1}\n============\n\nThe interaction of cells with foreign materials takes place via the adsorbed layer of proteins such as fibronectin (FN), vitronectin, and fibrinogen, representing the soluble matrix proteins in the biological fluids [@pone.0019610-Grinnell1]. ", "Cells primarily interact with these proteins via integrins, a family of transmembrane cell adhesion receptors [@pone.0019610-Hynes1]. ", "Integrin-mediated adhesion is a complex process that involves integrin association with the actin cytoskeleton and clustering into focal adhesions: supramolecular complexes that contain structural proteins (vinculin, talin, tensin, etc.) ", "and signaling molecules (focal adhesion kinase -- FAK, etc.) [", "@pone.0019610-Hynes1], [@pone.0019610-Garca1]. ", "FAK is a nonreceptor protein-tyrosine kinase that becomes activated in response to cell-matrix adhesion. ", "FAK is a key signaling protein contributing to integrin control of cell motility, invasion, survival, and proliferation [@pone.0019610-Mitra1].", "\n\nThe cell-material interaction is a complex bi-directional and dynamic process that mimics to a certain extent the natural interactions of cells with the extracellular matrix [@pone.0019610-Spie1], [@pone.0019610-Griffin1]. ", "Cells in the tissues are constantly accepting information from their environment from cues in the extracellular matrix ECM [@pone.0019610-Altankov1] and, at the same time, cells are producing and frequently remodeling their matrix [@pone.0019610-Grinnell1], [@pone.0019610-Hynes1], [@pone.0019610-Avnur1]. ", "Therefore, it is not surprising that many cells cannot adapt and poorly survive *in vitro* and, conversely, when a foreign material is implanted in the body, the adjacent tissue cells do not interact properly because of lack of their ECM.", "\n\nA line of previous investigations has shown that cells tend to rearrange adsorbed matrix proteins at the material interface, such as FN, fibrinogen and collagen [@pone.0019610-Altankov2]--[@pone.0019610-Altankov3], in a fibril-like pattern. ", "Using model surfaces -- mostly self-assembled monolayers (SAMs) -- it has been shown that this cellular activity is abundantly dependent on the surface properties of materials, such as wettability [@pone.0019610-Altankov2], surface chemistry and charge [@pone.0019610-Pompe1]. ", "This evidence raises the possibility that tissue compatibility of such materials may be connected with the allowance of cells to remodel surface associated proteins presumably as an attempt to form their own matrix. ", "Much is known about the interactions between different ECM proteins, but surprisingly less is our knowledge about the ECM composition, organization, and stability at the materials interface.", "\n\nECM remodeling is a dynamic process which consists of two opposite events: assembly and degradation. ", "These processes are mostly active during development and regeneration of tissues but, when miss-regulated, can contribute to diseases such as atherosclerosis, fibrosis, ischemic injury and cancer [@pone.0019610-Heyman1]--[@pone.0019610-Carino1]. ", "The proteolytic cleavage of ECM components represents a main mechanism for ECM degradation and removal [@pone.0019610-Koblinski1], [@pone.0019610-Mohamed1]. ", "The major enzymes that degrade ECM and cell surface associated proteins are matrix metalloproteinases (MMPs). ", "MMPs are a family (24 members) of zinc dependent endopeptidases, which together with adamalysin-related membrane proteinases that contain disintegrin and metalloproteinase domains (ADAMs or MDCs), such as thrombin, tissue plasminogen activator (tPA), urokinase (uPA) and plasmin are involved in the degradation of ECM proteins. ", "MMPs are either secreted or anchored to the cell membrane by a transmembrane domain or by their ability to bind directly uPA receptor (uPAR) and integrin α~v~β~3~ [@pone.0019610-Buck1].", "\n\nThe role of MMPs in both development and diseases has been recently extensively studied and reviewed [@pone.0019610-PageMcCaw1] because it is tightly linked with the mechanisms for tumor invasion and metastasis [@pone.0019610-Mohamed1]. ", "Also, MMPs regulate cell behavior through finely tuned and tightly controlled proteolytic processing of a large variety of signaling molecules that can also trigger beneficial effects in disease resolution [@pone.0019610-Rodrguez1].", "\n\nThis work investigates matrix protein dynamics on FN-coated mixed self-assembled monolayers (SAMs) of --OH and --CH~3~ terminated alkanethiols, which constitute an excellent model to vary surface wettability in a broad range while maintaining controlled and simple surface chemistry. ", "SAMs are model organic surfaces that provide defined chemical functionalities and well-controlled surface properties [@pone.0019610-Raynor1], [@pone.0019610-Keselowsky1]. ", "FN adsorption was investigated (adsorbed surface density, distribution and conformation) and correlated to cell behavior. ", "Cell adhesion and signaling on FN-coated SAMs were characterized via the formation of focal adhesions, integrin expression and phosphorylation of FAKs. ", "The reorganization and secretion of FN was linked to the activity of FN after adsorption on the different chemistries. ", "Finally, the expression (gene and protein) of MMP2 and MMP9 metalloproteinases was used to follow matrix degradation. ", "This work provides a broad overview of matrix remodeling at the cell-material interface, establishing correlations between surface chemistry, FN adsorption, cell adhesion and signaling, matrix reorganization and degradation.", "\n\nResults {#s2}\n=======\n\nFibronectin adsorption {#s2a}\n----------------------\n\nThe SAMs prepared in this work have been extensively used and characterized in previous studies making use of XPS, FTIR and ellipsometry [@pone.0019610-Martins1], [@pone.0019610-Rodrigues1]. ", "As a routine control, we have measured the water contact angle (WCA) to assess that is in accordance with published results. ", "WCA decreases as the fraction of hydroxy groups increases from 115° on the methyl terminated SAM to 20° on the hydroxyl terminated one ([Figure 1a](#pone-0019610-g001){ref-type=\"fig\"}).", "\n\n{#pone-0019610-g001}\n\nThe surface density of adsorbed FN was quantified by western blot analyzing the amount of protein remaining in the supernatant after adsorption on the material surface. ", "A calibration curve was built loading gels with known amounts of FN and the resulting bands were quantified by image analysis making use of the Otsu\\'s algorithm to systematically identify the band borders [@pone.0019610-Rico1]. ", "Each experiment of FN adsorption on SAMs included the loading in the gel of two known amounts of FN (reference points) that correspond to points included in the calibration curve so that the position of the whole calibration curve could be verified for each adsorption experiment [@pone.0019610-Rico1]. [", "Figure 1b](#pone-0019610-g001){ref-type=\"fig\"} shows the surface density of FN on the different SAMs after adsorption from a solution of concentration 20 µg/mL. The amount of adsorbed protein diminishes monotonically as the --OH density increases from 225 ng/cm^2^ on the methyl terminated SAM to 50 ng/cm^2^ on the hydroxyl terminated one.", "\n\nThe availability of the cell adhesion domains in the adsorbed FN was evaluated by ELISA with monoclonal antibodies, which is a well established method to probe for structural or conformational changes in adsorbed proteins [@pone.0019610-Ugarova1], [@pone.0019610-McClary1]. ", "The antibody used (HFN7.1) was directed against the flexible linker between the 9^th^ and 10^th^ type III repeats of FN [@pone.0019610-Schoen1]. ", "It has been previously demonstrated that HFN7.1 is a receptor-mimetic probe for integrin binding and cell adhesion [@pone.0019610-Schoen1]. ", "HFN7.1 antibody binding is similar on the different SAMs regardless the composition of the surface after FN adsorption from a solution of concentration 20 µg/mL ([Figure 1c](#pone-0019610-g001){ref-type=\"fig\"}). ", "However, taking into account that the amount of adsorbed FN differs among SAMs, the availability of the HFN7.1 antibody was obtained by normalizing to the total amount of adsorbed FN on each surface ([Figure 1d](#pone-0019610-g001){ref-type=\"fig\"}). ", "This magnitude increases as the fraction of hydroxyl groups on the surface does.", "\n\nThe molecular distribution of FN upon adsorption on the different SAMs can be obtained by AFM. [", "Figure 2](#pone-0019610-g002){ref-type=\"fig\"} shows the organization of FN on three of the surfaces (CH~3~, OH and the surface with 70% OH, that display qualitatively different WCA) after FN adsorption from solutions of different concentrations. ", "FN fibrils are found on the methyl-terminated SAM after adsorption from a solution of 2 µg/mL (average thickness of the fiber is approximately 13±5 nm), less organized molecules are observed on the 70% OH surface that became isolated globular-like molecules on the hydroxyl terminated SAM (average size of the globular aggregates 20±4 nm). ", "Increasing the concentration of the FN solution results in a dense network-like structure of FN on the methyl terminated surface and large molecular aggregates that cover the whole surface for the more hydrophilic surfaces ([Figure 2](#pone-0019610-g002){ref-type=\"fig\"}). [", "Figures S1](#pone.0019610.s001){ref-type=\"supplementary-material\"}, [S2](#pone.0019610.s002){ref-type=\"supplementary-material\"}, [S3](#pone.0019610.s003){ref-type=\"supplementary-material\"} show AFM images for FN adsorption on the different substrates at different magnifications for the sake of completeness. ", "The fibrillar nature of the adsorbed FN on the methyl-terminated SAM and the globular distribution on the other two surfaces is clearly grasped from this [Figures S1](#pone.0019610.s001){ref-type=\"supplementary-material\"}, [S2](#pone.0019610.s002){ref-type=\"supplementary-material\"}, [S3](#pone.0019610.s003){ref-type=\"supplementary-material\"}.", "\n\n{#pone-0019610-g002}\n\nCell adhesion and signaling {#s2b}\n---------------------------\n\nThe organization of proteins involved in the formation of focal adhesion complexes provides an opportunity to learn more about the effectiveness of cell-to-substrate interactions. [", "Figure 3](#pone-0019610-g003){ref-type=\"fig\"} shows the distribution of vinculin in cells adhering on the different model substrates. ", "Well-defined focal adhesions were found only on the more hydrophilic substrates (OH- terminated and 70% OH). ", "Even if vinculin is expressed also in cells on the more hydrophobic substrates, it is not afterwards organized into focal contacts but randomly distributed throughout the cell. ", "Likewise, the formation of prominent F-actin fibers terminating in well-developed focal adhesion complexes occurs on the hydroxyl-terminated surfaces. ", "More dispersed actin distribution (either lacking stress fiber formation or mostly peripheral staining) is observed as the fraction of OH groups on the surface diminishes ([Figure 3](#pone-0019610-g003){ref-type=\"fig\"}).", "\n\n{#pone-0019610-g003}\n\nFocal adhesion kinase (FAK) localizes to focal adhesions to activate multiple signaling pathways that regulate cell migration, survival, proliferation, and differentiation [@pone.0019610-Ilic1]--[@pone.0019610-Thannickal1]. ", "We examined the phosphorylation of Y-397, the autophosphorylation site in FAK and a binding site for Src and PI-3 kinases [@pone.0019610-Schaller1], [@pone.0019610-Reiske1]. ", "According to [Figure 4](#pone-0019610-g004){ref-type=\"fig\"} the level of FAK remains constant (both as obtained by analysis of western-blot and PCR bands). ", "By contrast, the ratio between phosphorylated and total FAKs on the different mixed SAMs decreases as the fraction of hydroxyl - terminated groups diminishes ([Figure 4c](#pone-0019610-g004){ref-type=\"fig\"}). ", "That is to say, the phosphorylation of specific sites in FAKs depends monotonically on the hydroxyl content of the surface. ", "Likewise, gene expression for FAK as obtained by RT-PCR shows no difference among the different surfaces, while integrin (β~1~) gene expression increases as the fraction of OH on the SAMs does ([Figure S4](#pone.0019610.s004){ref-type=\"supplementary-material\"}).", "\n\n{#pone-0019610-g004}\n\nFibronectin reorganization and secretion {#s2c}\n----------------------------------------\n\n[Figure 5](#pone-0019610-g005){ref-type=\"fig\"} shows the cellular reorganization of adsorbed FN after 2.5 h of culture on the different SAMs. ", "It is observed that cells are able to reorganize FN on the hydroxyl-terminated and the 70%-OH SAMs, as it is shown by movements of the adsorbed FN layer with dark zones in the pericellular area, mostly coincident with focal adhesion plaques. ", "Late FN matrix formation was studied for longer times on the different SAMs ([Figure S5](#pone.0019610.s005){ref-type=\"supplementary-material\"}). ", "It is observed that matrix production increases as time goes by on every substrate. ", "However, cells are able to synthesize and deposit FN matrix more abundantly and better organized into fibrillar networks on the hydroxyl terminated and the 70%-OH SAMs surfaces.", "\n\n{#pone-0019610-g005}\n\nMatrix degradation {#s2d}\n------------------\n\nThe ability of cells to degrade ECM was investigated by characterizing the expression of two different matrix metalloproteinases (MMPs) and correlated with Runx2 expression. [", "Figure 6](#pone-0019610-g006){ref-type=\"fig\"} shows characteristic western blot bands for Runx2, MMP2 and MMP9 as well as their relative quantification after 1 day of culture. ", "MMP9 and Runx2 expression increases as the fraction of hydroxyl terminated groups in the surface does. ", "However, MMP2 remain constant regardless the hydroxyl/methyl composition of the material surface.", "\n\n{#pone-0019610-g006}\n\nTo gain further insights, we investigated gene expression by RT-PCR ([Figure 7](#pone-0019610-g007){ref-type=\"fig\"}). ", "Similar levels of MMP2 are found on the different surfaces. ", "By contrast, MMP9 and Runx2 expressions are highly dependent on surface chemistry and with enhanced level on the hydrophilic surfaces. ", "Further, immunofluorescence was used to spatially locate MMP2 and MMP9 during cell culture ([Figure S6](#pone.0019610.s006){ref-type=\"supplementary-material\"}).", "\n\n{#pone-0019610-g007}\n\nDiscussion {#s3}\n==========\n\nThere is a lack of understanding of the cell-material interaction from an integrated point of view that includes the amount and state of the adsorbed layer of proteins on the material surface, cell adhesion - including integrin expression and focal adhesion formation - cell signaling, matrix reorganization, secretion and degradation, i.e. matrix protein dynamics at the cell-material interface. ", "Some efforts have been devoted in the literature to correlate the material surface properties, especially surface chemistry, to protein adsorption and cell adhesion [@pone.0019610-Shin1]--[@pone.0019610-Palacio1]. ", "Here we present results that provide a link between surface chemistry and cell-mediated matrix protein remodeling (including reorganization, secretion and degradation) on a family of model surfaces (SAMs) with controlled ratio of methyl/hydroxyl groups. ", "From a mechanistic point of view, it is known that the influence of surface chemistry on cell behavior is a consequence of the intermediate layer of proteins adsorbed on the material surface. ", "That is to say, cells interact with synthetic material surfaces via the previously deposited layer of FN. ", "The sequence of events would be the following: FN is a macromolecule that display a globular conformation in solution; upon adsorption on a particular surface chemistry, interactions between the chemical groups of the surface and the FN domains triggers changes in the conformation of the protein that might lead to complete unfolding and exposure of groups that were hidden in solution. ", "Consequently, the effect of the material surface chemistry is indirectly received by cells via the adsorbed layer of FN.", "\n\nThe amount of adsorbed FN on the mixed CH~3~/OH surfaces is lower as the fraction of hydroxyl terminated chains increases ([Figure 1b](#pone-0019610-g001){ref-type=\"fig\"}). ", "This is in agreement with results obtained on this family of SAMs by radiolabeling the protein [@pone.0019610-Barrias1]. ", "That is to say, it is known that FN is adsorbed in higher amount on hydrophobic (CH~3~) surfaces than hydrophilic ones (OH) [@pone.0019610-Keselowsky1]. ", "Our results established the existence of a linear correlation between surface wettability ([Figure 1a](#pone-0019610-g001){ref-type=\"fig\"}) and the density of adsorbed FN ([Figure 1b](#pone-0019610-g001){ref-type=\"fig\"}) for this family of mixed SAMs. ", "By contrast, the activity of FN after adsorption is higher as the fraction of OH groups on SAMs increased due to the better availability of cell adhesion domains of FN, as it is proved by the HFN7.1 antibody directed to the flexible linker between the 9^th^ and 10^th^ type III repeats of FN [@pone.0019610-Schoen1]. ", "That the activity of FN upon adsorption on SAMs was greater on OH terminated SAMs than CH~3~ terminated ones was previously assessed [@pone.0019610-Keselowsky1], [@pone.0019610-Michael1], and our results confirm the finely tuned chemistry-mediated conformation of FN that leads to a monotonically dependence of FN activity on surface composition, as the CH~3~/OH balance on the surface is altered ([Figure 1d](#pone-0019610-g001){ref-type=\"fig\"}). ", "It is known that FN has a compact folded structure in physiological buffer that is stabilized through ionic interactions between arms [@pone.0019610-Aota1]. ", "FN interactions with chemical groups of the substrate (CH~3~) give rise to conformational changes in the molecule that must lead to the occlusion of the cell binding domains (III~9--10~). ", "It is likely that FN orients at the CH~3~ surface, so that its hydrophobic segments interact with the methyl groups in PEA, maybe throughout the heparin-binding fragment [@pone.0019610-Gugutkov1]. ", "Different supramolecular organization of the protein at the material interface is also reflected in protein distribution on the material surface, as directly observed with AFM images in [Figure 2](#pone-0019610-g002){ref-type=\"fig\"} and [Figures S1](#pone.0019610.s001){ref-type=\"supplementary-material\"}, [S2](#pone.0019610.s002){ref-type=\"supplementary-material\"}, [S3](#pone.0019610.s003){ref-type=\"supplementary-material\"}: globular aggregates on the hydrophilic surfaces and fibrillar-like structures on the methyl terminated SAMs.", "\n\nDifferences in the availability of FN adhesion domains on the different SAMs influence the initial cell-material interaction, as determined by focal adhesion formation and F-actin cytoskeleton development ([Figure 3](#pone-0019610-g003){ref-type=\"fig\"}). ", "Gene expression of β~1~ integrin subunit increases with the fraction of OH groups in the sample ([Figure S4](#pone.0019610.s004){ref-type=\"supplementary-material\"}), which leads to the development of vinculin plaques and actin fibers only on those SAMs on which FN adsorption occurs with the most favorable conformation, i.e. on those chemistries with the highest fraction of OH groups ([Figure 3](#pone-0019610-g003){ref-type=\"fig\"}). ", "The influence of surface chemistry on FN conformation and cell adhesion has been established for SAMs based on different chemical groups. ", "In particular, differences in integrin binding and focal adhesion assembly between OH and CH~3~ SAMs most likely resulted from surface chemistry dependent differences in the functional presentation of adsorbed FN, whose major integrin-binding RGD domain is particularly sensitive to the underlying chemistry [@pone.0019610-Barrias1], [@pone.0019610-Keselowsky2]. ", "Likewise, it was previously found that the number of cells on FBS-coated CH~3~/OH mixed SAMs increases as the fraction of OH groups does; up to 80% OH and then it remains constant [@pone.0019610-Arima1].", "\n\nPhosphorylation of FAK has been shown to be sensitive to surface chemistry [@pone.0019610-Keselowsky2]. ", "In our case, increasing the fraction of hydroxyl groups on the sample leads to similar FAK levels (both for gene and protein expression, [Figure 4](#pone-0019610-g004){ref-type=\"fig\"}) but with higher and higher levels of phosphorylation of Y-397, the autophosphorylation site in FAK and a binding site for Src and PI-3 kinases [@pone.0019610-Schaller2], which suggests a stepwise activation of signaling cascades as a function of hydroxyl groups on the surface increases. ", "That is to say, activation of signaling pathways is directly related to integrin binding and focal adhesion formation, which are regulated by the availability of binding domains in FN upon adsorption on different chemistries ([Figures 1](#pone-0019610-g001){ref-type=\"fig\"}, [2](#pone-0019610-g002){ref-type=\"fig\"}, [3](#pone-0019610-g003){ref-type=\"fig\"}). ", "It has been demonstrated that FAK regulates cell adhesion strengthening via integrin activation and binding [@pone.0019610-Michael2]. ", "Moreover, our results are consistent with the role Y-397 autophosphorylation site plays in adhesion strengthening and integrin binding rate. ", "Mutation or blocking of the Y-397 autophosphorylation site blocked FAK-mediated adhesive responses, cell migration and spreading [@pone.0019610-Michael2]--[@pone.0019610-Webb1].", "\n\nAfter initial cell adhesion, cells tend to reorganize the adsorbed layer of proteins at the material interface before secreting their own matrix. ", "In this way, FN synthesized by cells assembles into a network of fibrils. ", "During this assembly, however, FN needs to undergo distinct conformational changes, which on adsorption to the substrate can be limited. ", "This may explain why materials surfaces affect FN matrix formation [@pone.0019610-Altankov4], [@pone.0019610-Altankov5]. ", "After 2.5 h, cells are able to reorganize the adsorbed layer of FN on the most hydrophilic surfaces ([Figure 5](#pone-0019610-g005){ref-type=\"fig\"}) and this ability decreases as the fraction of CH~3~ groups on the surface increases. ", "It has been suggested that the ability of cells to reorganize the adsorbed layer of proteins at the material interface must be a consequence of the strength of interaction between the ECM proteins and the material surface, e.g. materials that bind proteins loosely will support the organization of a provisional ECM [@pone.0019610-Altankov3], [@pone.0019610-Altankov4]--[@pone.0019610-Tzoneva2]. ", "However, additional reasons must be considered when seeking the molecular origin of this fact, which must also be a consequence of the following sequence of events: i) the availability of cell adhesion domains after FN adsorption on the SAM surface is higher in the samples with higher OH content ([Figure 1](#pone-0019610-g001){ref-type=\"fig\"}); ii) integrin expression and focal adhesion formation is enhanced on the more hydrophilic surfaces ([Figure 3](#pone-0019610-g003){ref-type=\"fig\"}, [Figure S4](#pone.0019610.s004){ref-type=\"supplementary-material\"}); iii) phosphorylation of FAK is enhanced on the SAMs with higher OH contents ([Figure 4](#pone-0019610-g004){ref-type=\"fig\"}). ", "To reorganize the adsorbed layers of proteins, cells must develop mechanical forces on the substrate through a contractile mechanism. ", "Contractility results from dynamic interactions between actin filaments and myosin, which are regulated via phosphorylation of myosin light chain (MLC). ", "Rho GTPases control the formation of stress fibers and focal adhesion assembly by modulating MLC phosphorylation and generating actin-myosin contractility [@pone.0019610-Kaibuchi1]. ", "It is well known that inhibitors of contractility also down-regulated tyrosine phosphorylation of FAK [@pone.0019610-ChrzanowskaWodnicka1]--[@pone.0019610-Wozniak1]; more recently it has been shown that contractility-mediated cell forces also require FAK phosphorylation [@pone.0019610-Dumbauld1], a fact that supports our reorganization patterns in dependence of the fraction of OH groups: FN is better reorganized on those substrates on which FAK phosphorylation occurs more efficiently ([Figures 4](#pone-0019610-g004){ref-type=\"fig\"}, [5](#pone-0019610-g005){ref-type=\"fig\"}).", "\n\nThe dynamics of FN secretion and formation of a fibrillar matrix (late matrix) occurs preferentially on the samples with the higher contents of OH groups ([Figure S5](#pone.0019610.s005){ref-type=\"supplementary-material\"}); see e.g. the 70%-OH SAM in [Figure S5](#pone.0019610.s005){ref-type=\"supplementary-material\"}, where the presence of defined FN fibrils of higher fluorescence intensity can be observed. ", "SAMs that promote FN secretion are precisely the substrates on which FN reorganization takes place more intensively ([Figure 5](#pone-0019610-g005){ref-type=\"fig\"}). ", "These results support the hypothesis that late matrix formation is in need not only of cell adhesion on the substrate, but some cell movements, in the range of the size of the focal adhesion plaques, must take place so matrix deposition occurs normally [@pone.0019610-GonzlezGarca1]. ", "Late matrix formation has been related to the ability of cells to rearrange the initially adsorbed protein layer, especially when comparing cell adhesion on hydrophilic and hydrophobic substrates [@pone.0019610-Altankov4]--[@pone.0019610-Altankov6].", "\n\nExcept organization, the ECM undergoes proteolytic degradation, which is a mechanism for the removal of the excess ECM usually approximated with remodeling. ", "Matrix remodeling is a subject of an extensive biomedical research, but how it relates to the biocompatibility of materials remains unclear. ", "The importance of the proteolytic activity of cells has been already considered in the design of biomaterials by incorporating MMP sensitive sequences, which have shown to be mandatory in tissue regeneration in 3D, including cell proliferation, migration and angiogenesis [@pone.0019610-Bott1]--[@pone.0019610-Schneider1]. ", "Nevertheless, the effect of material chemistry on the proteolytic activity of cells has not been addressed so far.", "\n\nExpressions of MMP2 and MMP9 have been observed in MC3T3-E1 cells cultured on tissue culture polystyrene dishes [@pone.0019610-Uchida1]. ", "Our results show that the activation of proteolytic routes in these cells is an MMP-dependent phenomenon sensitive to surface chemistry. ", "MMP2 has FN type II repeats inserted into the catalytic domain [@pone.0019610-PageMacCaw1] and it has been found to cleavage FN and vitronectin into small fragments *in vivo*, which leads to increased cell adhesion and migration [@pone.0019610-PageMacCaw1], [@pone.0019610-Kenny1]. ", "In this sense, MMP2 expression was constant on every FN-coated surface, regardless the underlying chemistry ([Figure 6](#pone-0019610-g006){ref-type=\"fig\"}, [7](#pone-0019610-g007){ref-type=\"fig\"}). ", "By contrast, MMP9 expression increases as the fraction of OH groups in the sample does ([Figures 6](#pone-0019610-g006){ref-type=\"fig\"}, [7](#pone-0019610-g007){ref-type=\"fig\"}), which suggests a direct relationship between FN activity at the cell-material interface and MMP9 expression, as a consequence of a sequence of events that include integrin expression ([Figure S4](#pone.0019610.s004){ref-type=\"supplementary-material\"}), focal adhesion formation ([Figure 3](#pone-0019610-g003){ref-type=\"fig\"}), matrix reorganization ([Figure 5](#pone-0019610-g005){ref-type=\"fig\"}) and FAK phosphorylation ([Figure 4](#pone-0019610-g004){ref-type=\"fig\"}). ", "While mechanical strain is known to be able to enhance MMP expression [@pone.0019610-Yang1], only a few examples in the literature have related the use of synthetic materials on the transcription and activity of MMPs [@pone.0019610-Wan1]--[@pone.0019610-Ducy1], which we make explicit here by using SAMs with controlled ratio of methyl/hydroxyl groups.", "\n\nRunx2 is a key transcription factor in regulation of bone development and osteoblast differentiation. ", "The consequence of interfering with endogenous Runx2 is a defect in normal osteoblast development or function [@pone.0019610-Ducy1]. ", "It has been reported a direct relationship between MMP activity and osteblasts markers [@pone.0019610-Hayami1]. ", "In this sense, MMP9 is a direct target of Runx2 in bone tissue, suggesting a regulatory link between Runx2, the expression of MMP9, and cell migration [@pone.0019610-Pratap1], [@pone.0019610-Hess1]. [", "Figures 6](#pone-0019610-g006){ref-type=\"fig\"} and [7](#pone-0019610-g007){ref-type=\"fig\"} also suggest a correlation between Runx2 and MMP9 activation on every surface chemistry. ", "That is to say, [Figures 6](#pone-0019610-g006){ref-type=\"fig\"} and [7](#pone-0019610-g007){ref-type=\"fig\"} show that both protein and gene expression levels of Runx2 and MMP9 are directly correlated, with low values on the CH~3~-rich SAMs, that increases as the OH content in the surface does. ", "This result supports the idea that surface chemistry-mediated activation of MMP9 occurs in a physiological-like way, as its activation at the cell-material interface involves also the upregulation of its direct target Runx2, as occurs in vivo.", "\n\nOverall, surface chemistry modulates FN dynamics at the cell-material interface. ", "The ratio CH~3~/OH in mixed SAMs modulates FN adsorption (in terms of the adsorbed density and conformation), cell adhesion (integrin expression and focal adhesion formation), matrix reorganization and secretion. ", "Further, our results demonstrate that surface chemistry is an external parameter able to trigger proteolytic routes in cells in an MMP-dependent manner. ", "Our results demonstrate the ability of synthetic biomaterials as new tools to direct matrix degradation, which must provide the field with new strategies to investigate fundamental aspects of the phenomenon, as well as the inclusion of parameters to take into account during the design of scaffolds for regenerative medicine, aiming at controlling matrix protein dynamics at the cell-material interface.", "\n\nMaterials and Methods {#s4}\n=====================\n\nPreparation of SAMs {#s4a}\n-------------------\n\nSAM surfaces were prepared and characterized as described elsewhere [@pone.0019610-Keselowsky1] from alkanethiols 1-dodecanethiol (HS-(CH~2~)~11~-CH~3~), 11-mercapto-1-undecanol (HS-(CH~2~)~11~-OH) (Sigma). ", "Au-coated glass coverslips (Fisher Scientific) were prepared by deposition of thin films of Ti (150 Å) followed by Au (150 Å) using a high vacuum evaporator (Polaron E6100) at a deposition rate of 2 Å/s and a chamber base-pressure of 2·10^−6^ Torr. ", "Glass coverslips were cleaned with 70% H~2~SO~4~ and 30% H~2~O~2~ at room temperature for 1 h, rinsed with deionized H~2~O, rinsed with 95% ethanol, and dried under a stream of N~2~ prior to metal deposition.", "\n\nFreshly prepared Au-coated surfaces were immersed in alkanethiol solutions (1 mM in absolute ethanol) with different ratios (CH~3~/OH), and SAMs were allowed to assemble overnight. ", "SAMs were rinsed in 95% ethanol, dried under N~2~ and allowed to equilibrate in DPBS prior to incubation in FN solutions. ", "Surfaces were validated by water contact angle measurements (Dataphysics OCA).", "\n\nAtomic force microscopy, AFM {#s4b}\n----------------------------\n\nAFM experiments were performed using a Multimode AFM equipped with NanoScope IIIa controller from Veeco (Manchester, UK) operating in tapping mode in air; the Nanoscope 5.30r2 software version was used. ", "Si-cantilevers from Veeco (Manchester, UK) were used with force constant of 2.8 N/m and resonance frequency of 75 kHz. ", "The phase signal was set to zero at a frequency 5--10% lower than the resonance one. ", "Drive amplitude was 600 mV and the amplitude setpoint *A~sp~* was 1.8 V. The ratio between the amplitude setpoint and the free amplitude *A~sp~/A~0~* was kept equal to 0.8.", "\n\nProtein adsorption {#s4c}\n------------------\n\nFN from human plasma (Sigma) was adsorbed from solutions of concentrations of 2, 5 and 20 µg/mL in PBS. ", "After adsorption, samples were rinsed in PBS to eliminate the non-adsorbed protein. ", "AFM was performed in the tapping mode immediately after sample preparation.", "\n\nSeparation of FN adsorbed on different samples was performed using 5%-SDS PAGE and denaturing standard conditions as described elsewhere [@pone.0019610-Rico1]. ", "Proteins were transferred to a PVDF membrane (GE Healthcare) using a semidry transfer cell system (Biorad), and blocked by immersion in 5% skimmed milk in PBS. ", "The blot was incubated with rabbit anti-human FN polyclonal antibody (Sigma, 1∶500) in PBS/0.1% Tween-20/2% skimmed milk for 1 h at room temperature and washed with PBS/0.1% Tween-20. ", "The blot was subsequently incubated in HRP-conjugated secondary antibody (GE Healthcare) diluted 1∶20000 in PBS/0.1% Tween-20/2% skimmed milk. ", "The enhanced chemiluminescence detection system (GE Healthcare) was used prior to exposing the blot to X-ray. ", "Image analysis of the western bands was done using in house software [@pone.0019610-Rico1].", "\n\nAntibody assay for FN conformation {#s4d}\n----------------------------------\n\nAfter FN adsorption, surfaces were rinsed in PBS and blocked in 1% BSA/DPBS. ", "Primary monoclonal antibody HFN7.1 (Developmental Hybridoma, Inc., Iowa City, IA) directed against the flexible linker between the 9^th^ and 10^th^ type III repeat was used. ", "Substrates were incubated in primary antibody (1∶4000) for 1 h at 37°C. ", "After washing (0.5% Tween 20/DPBS), substrates were incubated in alkaline phosphatase conjugated secondary antibody (1∶5000) for 1 h at 37°C and incubated in 4-methylumbelliferyl phosphate (4-MUP) (Sigma) for 45 min at 37°C. ", "Reaction products were quantified using a fluorescence plate reader (Victor III, PerkinElmer) at 365 m /465 nm.", "\n\nCell culture {#s4e}\n------------\n\nMC3T3-E1 cells were obtained from the RIKEN Cell Bank (Japan). ", "Prior to seeding on FN-coated substrates, cells were maintained in DMEM medium supplemented with 10% foetal bovine serum and 1% penicillin-streptomycin and passaged twice a week using standard procedures. ", "Sample disks placed in a 24-well tissue culture plate were coated with a solution of FN 20 µg/mL. Then, 3·10^3^ cells per substrate were seeded and maintained at 37°C in a humidified atmosphere under 5% CO~2~ for 3 h. Each experiment was performed in triplicate.", "\n\nImmunofluorescence (FAKs, MMP, FN) {#s4f}\n----------------------------------\n\nAfter 3 h of culture, MC3T3-E1 cells were washed in DPBS (Gibco) and fixed in 10% formalin solution (Sigma) at 4°C. ", "Cells were incubated with permeabilizing buffer (103 g/L sucrose, 2.92 g/L NaCl, 0.6 g/L MgCl2, 4.76 g/L HEPES buffer, 5 mL/L Triton X-100, pH 7.2) for 5 min, blocked in 1% BSA/DPBS and incubated with primary antibody against vinculin (Sigma, 1∶400), MMP2 (abcam, 2 µg/mL;) or MMP9 (abcam, 1∶100). ", "Samples were then rinsed in 0.5% Tween-20/DPBS. ", "Cy3-conjugated secondary antibody in 1% BSA/DPBS (Invitrogen) and BODIPY FL phallacidin (Invitrogen) were used. ", "Finally, samples were washed and mounted in Vectashield containing DAPI (Vector Laboratories). ", "A Leica DM6000B fluorescent microscope was used for cellular imaging.", "\n\nThe ability of cells to reorganize adsorbed FN (i.e., early matrix) was monitored by coating all samples with 20 µg/mL solution prior seeding in serum containing medium. ", "The evolution of FN in the ECM was followed by immunofluorescence after different culture times and following the same procedure as described before. ", "Samples were incubated with anti-FN antibody (1∶400, Sigma) and Cy3-conjugated secondary antibody before washed and mounted with Vectashield containing DAPI.", "\n\nProtein expression analysis {#s4g}\n---------------------------\n\nTotal protein extraction was performed lysing the cells with RIPA buffer (50 mM Tris-HCl pH 7.4, 1% nonidet p-40, 0.25% Na-deoxycholate, 150 mM NaCl and 1 mM EDTA) supplemented with protease inhibitor cocktail tablets (Roche). ", "The lysates were concentrated with Microcon YM-30 Centrifugal Filters units (Millipore) and separated in 7%--10%-SDS PAGE under denaturing conditions. ", "To analyze the different expression patterns of FAKs, p-FAKs, MMPs and Runx2 a conventional Western blot procedure was done as previously described. ", "The blots were incubated separately with primary antibody against FAK (abcam, 400 ng/ml), pFAKs (abcam, 1 µg/mL), MMP2, MMP9 and Runx2 (abcam, 1 µg/mL). ", "In all cases the secondary antibody was HRP linked and the dilutions used were: 1∶50000 for FAKs, 1∶10000 for p-FAKs and 1∶20000 for MMP2, MMP9 and Runx2.", "\n\nThe Supersignal West Femto Maximum Sensitivity Substrate (Pierce) was used prior to exposing the blot to X-ray film.", "\n\nGene expression analysis {#s4h}\n------------------------\n\nGene expression (mRNA) of β~1~ integrin, Runx2, FAKs, MMP2 and MMP9 was analyzed after 24 h of culture. ", "Total RNA was extracted from cells using RNAeasy Mini Kit (Qiagen). ", "The quantity and integrity of the RNA was measured with NanoDrop (ThermoScientific) and used 3 µg RNA as template for SuperScript III RT (Invitrogen) and oligo(dT)~12--18~ (Invitrogen) as specific primer for amplification of mRNA. ", "PCR reactions were performed with Ampli Taq Gold 360 DNA polymerase (Invitrogen). ", "The oligonucleotides sequence used for PCR reactions are listed in [Table 1](#pone-0019610-t001){ref-type=\"table\"}. ", "All reactions were done at least per triplicate and RNA template was obtained from independent experiments.", "\n\n10.1371/journal.pone.0019610.t001\n\n###### Primer sequences used in gene expression analysis.", "\n\n![](", "pone.0019610.t001){#pone-0019610-t001-1}\n\n Gen Sequence (5′-3′) References\n -------------- -------------------------- -------------------------\n β-actin F TTCTACAATGAGCTGCGTGTG M_007393.3\n β-actin R GGGGTGTTGAAGGTCTAAA \n Gapdh F GTGTGAACGGATTTGGCCGT NM_008084.2\n Gadph R TTGATGTTAGTGGGGTCTCG \n β integrin F GGAGGAATGTAACACGACTG [@pone.0019610-Rouahi1]\n β integrin R TGCCCACTGCTGACTTAGGAATC \n FAK F GGAGTTTTCAGGGTCCGACTG [@pone.0019610-Rouahi1]\n FAK R CATTTTCATATACCTTGTCATTGG \n Runx2 F GTGCTCTAACCACAGTCCATGCAG NM_001146038.1\n Runx2 R GTCGGTGCGGACCAGTTCGG \n MMP2 F TGGTGTGGCACCACCGAGGA NM_008610.2\n MMP2 R GCATCGGGGGAGGGCCCATA \n MMP9 F AGCACGGCAACGGAGAAGGC NM_013599.2\n MMP9 R AGCCCAGTGCATGGCCGAAC \n\nStatistical analysis {#s4i}\n--------------------\n\nAll experiments were performed at least three times in triplicate unless otherwise noted. ", "Data are reported as mean ± standard error. ", "Results were analyzed by one-way ANOVA using SYSTAT 8.0 (SPSS). ", "If treatment level differences were determined to be significant, pair-wise comparisons were performed using a Tukey post hoc test. ", "A 95% confidence level was considered significant.", "\n\nSupporting Information {#s5}\n======================\n\n###### \n\nFibronectin distribution on the different substrates as observed by the phase magnitude in AFM at different magnifications. ", "The protein was adsorbed for 10 min from a solution of concentration 20 µg/mL.\n\n(PDF)\n\n###### \n\nClick here for additional data file.", "\n\n###### \n\nFibronectin distribution on the different substrates as observed by the phase magnitude in AFM at different magnifications. ", "The protein was adsorbed for 10 min from a solution of concentration 5 µg/mL.\n\n(PDF)\n\n###### \n\nClick here for additional data file.", "\n\n###### \n\nFibronectin distribution on the different substrates as observed by the phase magnitude in AFM at different magnifications. ", "The protein was adsorbed for 10 min from a solution of concentration 2 µg/mL.\n\n(PDF)\n\n###### \n\nClick here for additional data file.", "\n\n###### \n\nβ~1~ integrin expression increases with the percentage of OH groups in SAMs. ", "A) Representative bands for gene expression (RT-PCR) of integrin β~1~. B) Image quantification of RT-PCR bands on the different surfaces.", "\n\n(PDF)\n\n###### \n\nClick here for additional data file.", "\n\n###### \n\nCellular reorganization of adsorbed FN and synthesized FN fibrils on the different surfaces after 2.5 h, 5 h, 1 d and 3 d of culture. ", "The technique employed in these figures is immunofluorescence with anti-FN antibody. ", "It is shown the adsorbed FN on the material surface (red bottom) and the way cells rearrange this layer of FN resulting in black-dark areas as well as enhanced intensity of the fluorescence as a consequence of the formation of FN fibrils by cells. ", "It is shown a broad cell population (20--30 cells per image) after different culture times, so that not only FN reorganization is observed but also FN secretion can be accounted for. ", "The adsorbed FN (red bottom) superimposed with cell-secreted FN fibrils on some SAMS (e.g. 70%).", "\n\n(PDF)\n\n###### \n\nClick here for additional data file.", "\n\n###### \n\nImmunofluorescence for matrix metalloproteinases MMP2 and MMP9 after 1 day of culture on the FN-coated SAMs (identified by the percentage of OH groups). ", "Fluorescence distribution and intensity is in agreement with protein expression displayed in [Figure 6](#pone-0019610-g006){ref-type=\"fig\"}. ", "The corresponding image for F-actin is also included for the sake of cell identification. ", "The scale bar is 50 µm.", "\n\n(PDF)\n\n###### \n\nClick here for additional data file.", "\n\nAFM was performed under the technical guidance of the Microscopy Service at the Universidad Politécnica de Valencia, whose advice is greatly appreciated.", "\n\n**Competing Interests:**The authors have declared that no competing interests exist.", "\n\n**Funding:**The support of the Spanish Ministry of Science and Innovation through project MAT2009-14440-C02-01 is acknowledged. ", "CIBER-BBN is an initiative funded by the VI National R&D&i Plan 2008--2011, Iniciativa Ingenio 2010, Consolider Program, CIBER Actions and financed by the Instituto de Salud Carlos III with assistance from the European Regional Development Fund. ", "This work was supported by funds for research in the field of Regenerative Medicine through the collaboration agreement from the Conselleria de Sanidad (Generalitat Valenciana), and the Instituto de Salud Carlos III. ", "The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.", "\n\n[^1]: Conceived and designed the experiments: PR MS-S. Performed the experiments: VL-H PR JB-B MS-S. Analyzed the data: VL-H PR JB-B MS-S. Contributed reagents/materials/analysis tools: DM. ", "Wrote the paper: VL-H PR MS-S.\n" ]

{ "pile_set_name": "PubMed Central" }

[ 0.0006609896081499755, 0.0007185311405919492, 0.0009546484798192978, 0.014079464599490166, 0.0010712348157539964, 0.035698119550943375, 0.014767782762646675, 0.000634266878478229, 0.0006371168419718742, 0.0007366089266724885, 0.0006513120024465024, 0.0006230361177586019, 0.0005702252383343875, 0.0005336384638212621, 0.0006460336735472083, 0.0008541828137822449, 0.000647225824650377, 0.0008601074223406613, 0.0009536325233057141, 0.0007505020475946367, 0.0005965218297205865, 0.0005692840786650777, 0.0006178769399411976, 0.0007368299993686378, 0.0006026101764291525, 0.019308622926473618, 0.0006704173283651471, 0.0005912514170631766, 0.0005386382690630853, 0.00079339713556692, 0.000549810822121799, 0.0006090016104280949, 0.0019055769080296159, 0.0008073532371781766, 0.0006100943428464234, 0.0008521966519765556, 0.0007137089851312339, 0.000608176167588681, 0.0006501881871372461, 0.0006303852424025536, 0.0007741303415969014, 0.0006934884586371481, 0.0006478151772171259, 0.0006811055354773998, 0.0008235948625952005, 0.0006313502672128379, 0.0006346415029838681, 0.0007715071551501751, 0.0006402520230039954, 0.0006753741181455553, 0.0007347100763581693, 0.0019055769080296159, 0.0006887196796014905, 0.0006084399647079408, 0.0007026065140962601, 0.0006075348937883973, 0.0006448037456721067, 0.0006457535782828927, 0.000622271210886538, 0.0006445483886636794, 0.0019055769080296159, 0.0008575328974984586, 0.0005847830907441676, 0.0008011081954464316, 0.007493003737181425, 0.0025708668399602175, 0.012047789990901947, 0.007863503880798817, 0.022904209792613983, 0.009059295989573002, 0.0019055769080296159, 0.011047850362956524, 0.008703448809683323, 0.1962529867887497, 0.022136878222227097, 0.0007718442939221859, 0.0007513811578974128, 0.0005755539750680327, 0.0005640491144731641, 0.0007760404259897768, 0.0019055769080296159, 0.0007684276788495481, 0.0010967139387503266, 0.0005996855907142162, 0.0007356302812695503, 0.0006582161295227706, 0.0007016069139353931, 0.0006249135476537049, 0.0019055769080296159, 0.0006416254909709096, 0.0012342669069766998, 0.0006745221326127648, 0.0005868831067346036, 0.0006147033418528736, 0.0006360939587466419, 0.0005908089224249125, 0.0019055769080296159, 0.000652426213491708, 0.0006117716548033059, 0.0006596812163479626, 0.0005703988717868924, 0.000643459614366293, 0.0005640158196911216, 0.0005561871803365648, 0.0006014457321725786, 0.0006560629117302597, 0.0006167907849885523, 0.0006429609493352473, 0.0007488456321880221, 0.0006299441447481513, 0.0008798119961284101, 0.0006440510624088347, 0.0007653222419321537, 0.0007194078643806279, 0.0005600543227046728, 0.0006135856383480132, 0.0007062447257339954, 0.0006244131946004927, 0.0005851775640621781, 0.0005831862217746675, 0.0005773984594270587, 0.0006439709686674178, 0.0007197174709290266, 0.012999983504414558, 0.0014615962281823158, 0.0006052762037143111, 0.01293235458433628, 0.0006596277817152441, 0.01335722766816616, 0.0006699861260131001, 0.0034356932155787945, 0.0005954005173407495, 0.0006509148515760899, 0.0007750142831355333, 0.0005721633788198233, 0.0008629094809293747, 0.0006944656488485634, 0.0009848886402323842, 0.0011456409702077508, 0.008950351737439632, 0.0006199488416314125, 0.0008122822619043291, 0.0005823580431751907, 0.0006535797729156911, 0.0006221786607056856, 0.0005589872016571462, 0.0005708726239390671, 0.0005727234529331326, 0.0006516568828374147, 0.000586113368626684, 0.000835002341773361, 0.0006380590493790805, 0.0009862910956144333, 0.0005902574048377573, 0.0015391140477731824, 0.002416613046079874, 0.0008655982092022896, 0.0007030948181636631, 0.0006376908859238029, 0.0006276445928961039, 0.0005869502201676369, 0.000573311117477715, 0.0006979469326324761, 0.0006125213112682104, 0.000537340878508985, 0.0008128436165861785, 0.000702447141520679, 0.0008250573882833123, 0.0005692629492841661, 0.0008028796873986721, 0.0005535801174119115, 0.000611704308539629, 0.0006524274940602481, 0.0006486520287580788, 0.0006950180977582932, 0.0006253756582736969, 0.0006276003550738096, 0.0005906701553612947, 0.0006074844859540462, 0.0006363209686242044, 0.0013103162636980414, 0.0016227198066189885, 0.0006518606678582728, 0.0005803422536700964, 0.000982146942988038, 0.00061916618142277, 0.0006100554019212723, 0.0013240794651210308, 0.0005804996471852064, 0.0005992159713059664, 0.0007474333397112787, 0.0006038777064532042, 0.02014581672847271, 0.0008662475738674402, 0.0010635432554408908, 0.0010098731145262718, 0.0005700053879991174, 0.0006333834608085454, 0.0006729663000442088, 0.0006136721931397915, 0.0007922755321487784, 0.0006237954366952181, 0.00071017409209162, 0.026776358485221863, 0.021401962265372276, 0.1084919422864914, 0.0007782736211083829, 0.0033460729755461216, 0.000781655078753829, 0.000593207310885191, 0.0005890934262424707, 0.0005887159495614469, 0.0005380392540246248, 0.0007202039123512805, 0.0012735376367345452, 0.11484311521053314, 0.0005924571887589991, 0.0005871239700354636, 0.0006128536188043654, 0.0005473428755067289, 0.0007139640511013567, 0.0005508376052603126, 0.0007068648119457066, 0.0005514214863069355, 0.0007068648119457066, 0.000553131802007556, 0.0007489070412702858, 0.0006002802983857691, 0.000674129172693938, 0.0026887317653745413, 0.0009934386471286416, 0.0008713859715498984, 0.0006169101689010859, 0.002170735504478216, 0.000674129172693938, 0.0006976404110901058, 0.0005890442407689989, 0.0005802465020678937, 0.0007358283619396389, 0.000674129172693938, 0.0005109702469781041, 0.0006150376866571605, 0.0005247876397334039, 0.0005935718072578311, 0.0005617980496026576, 0.0006049359799362719, 0.0007385858916677535, 0.0007091734441928566 ]

[ "Exome sequencing identifies novel compound heterozygous mutations in SPG11 that cause autosomal recessive hereditary spastic paraplegia.", "\nHereditary spastic paraplegia (HSP) is a neurodegenerative disease characterized by progressive weakness and spasticity of the lower limbs, in complicated forms, with additional neurological signs. ", "To identify the genotype and characterize the phenotype in a Chinese HSP family, ten subjects from the family were examined through detailed clinical evaluations, auxiliary examinations and genetic tests. ", "Using a combined approach of whole-exome sequencing and candidate mutation validation, we identified novel compound heterozygous mutations in the SPG11 gene of the patients as follows: a nonsense mutation c.6856C>T (p.R2286X) in exon 38 and a deletion mutation c.2863delG (p.Glu955Lysfs*8) in exon 16. ", "Both mutations co-segregated with the phenotype in this family and were absent in 100 normal Chinese individuals. ", "Our finding suggests that the novel compound heterozygous mutations in SPG11 are associated with HSP. ", "We were able to assess the future risk of HSP in healthy younger family members using genetic detection, and provide prenatal diagnoses for the family members. ", "Furthermore, to some extent, this new finding enriches the information on SPG11 and may provide a new basis for the genetic diagnosis of HSP." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.0029950477182865143, 0.005496007855981588, 0.0005549608031287789, 0.0006714221090078354, 0.0007886374369263649, 0.0007317393901757896, 0.0006279024528339505, 0.0005689808749593794 ]

[ "Unconventional morphologies of CoO nanocrystals via controlled oxidation of cobalt oleate precursors.", "\nWe report an 'oxidation state' regulating method for the synthesis of anisotropic wurtzite CoO nanocrytals (NCs) with various shapes, including ultrathin nanosheets and a core-antenna structure for the first time. ", "We show that the decomposition process of precursors was altered by their oxidation, which played a significant role in the unconventional growth." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.0007134603802114725, 0.0005561728612519801, 0.0005186066846363246 ]

[ "{-# LANGUAGE DeriveDataTypeable #-}\n{-# LANGUAGE DeriveGeneric #-}\n{-# LANGUAGE NoImplicitPrelude #-}\n{-# LANGUAGE OverloadedStrings #-}\n{-# LANGUAGE RecordWildCards #-}\n\n{-# OPTIONS_GHC -fno-warn-unused-binds #-}\n{-# OPTIONS_GHC -fno-warn-unused-imports #-}\n\n-- |\n-- Module : Network.", "Google.", "ReplicaPoolUpdater.", "Types.", "Product\n-- Copyright : (c) 2015-2016 Brendan Hay\n-- License : Mozilla Public License, v. 2.0.", "\n-- Maintainer : Brendan Hay <brendan.g.hay@gmail.com>\n-- Stability : auto-generated\n-- Portability : non-portable (GHC extensions)\n--\nmodule Network.", "Google.", "ReplicaPoolUpdater.", "Types.", "Product where\n\nimport Network.", "Google.", "Prelude\nimport Network.", "Google.", "ReplicaPoolUpdater.", "Types.", "Sum\n\n--\n-- /See:/ 'operationWarningsItemDataItem' smart constructor.", "\ndata OperationWarningsItemDataItem =\n OperationWarningsItemDataItem'\n { _owidiValue :: !(", "Maybe Text)\n , _owidiKey :: !(", "Maybe Text)\n }\n deriving (Eq, Show, Data, Typeable, Generic)\n\n\n-- | Creates a value of 'OperationWarningsItemDataItem' with the minimum fields required to make a request.", "\n--\n-- Use one of the following lenses to modify other fields as desired:\n--\n-- * 'owidiValue'\n--\n-- * 'owidiKey'\noperationWarningsItemDataItem\n :: OperationWarningsItemDataItem\noperationWarningsItemDataItem =\n OperationWarningsItemDataItem' {_owidiValue = Nothing, _owidiKey = Nothing}\n\n\n-- | [Output Only] Metadata value for this warning.", "\nowidiValue :: Lens' OperationWarningsItemDataItem (Maybe Text)\nowidiValue\n = lens _owidiValue (\\ s a -> s{_owidiValue = a})\n\n-- | [Output Only] Metadata key for this warning.", "\nowidiKey :: Lens' OperationWarningsItemDataItem (Maybe Text)\nowidiKey = lens _owidiKey (\\ s a -> s{_owidiKey = a})\n\ninstance FromJSON OperationWarningsItemDataItem where\n parseJSON\n = withObject \"OperationWarningsItemDataItem\"\n (\\ o ->\n OperationWarningsItemDataItem' <$>\n (o .:? \"", "value\") <*> (o .:? \"", "key\"))\n\ninstance ToJSON OperationWarningsItemDataItem where\n toJSON OperationWarningsItemDataItem'{..}\n = object\n (catMaybes\n [(\"value\" .=) <$> _owidiValue,\n (\"key\" .=) <$> _owidiKey])\n\n-- | The following represents a resource describing a single update (rollout)\n-- of a group of instances to the given template.", "\n--\n-- /See:/ 'rollingUpdate' smart constructor.", "\ndata RollingUpdate =\n RollingUpdate'\n { _ruStatus :: !(", "Maybe Text)\n , _ruProgress :: !(", "Maybe (Textual Int32))\n , _ruInstanceGroupManager :: !(", "Maybe Text)\n , _ruKind :: !", "Text\n , _ruError :: !(", "Maybe RollingUpdateError)\n , _ruInstanceTemplate :: !(", "Maybe Text)\n , _ruUser :: !(", "Maybe Text)\n , _ruSelfLink :: !(", "Maybe Text)\n , _ruStatusMessage :: !(", "Maybe Text)\n , _ruCreationTimestamp :: !(", "Maybe Text)\n , _ruId :: !(", "Maybe Text)\n , _ruPolicy :: !(", "Maybe RollingUpdatePolicy)\n , _ruActionType :: !(", "Maybe Text)\n , _ruOldInstanceTemplate :: !(", "Maybe Text)\n , _ruDescription :: !(", "Maybe Text)\n , _ruInstanceGroup :: !(", "Maybe Text)\n }\n deriving (Eq, Show, Data, Typeable, Generic)\n\n\n-- | Creates a value of 'RollingUpdate' with the minimum fields required to make a request.", "\n--\n-- Use one of the following lenses to modify other fields as desired:\n--\n-- * 'ruStatus'\n--\n-- * 'ruProgress'\n--\n-- * 'ruInstanceGroupManager'\n--\n-- * 'ruKind'\n--\n-- * 'ruError'\n--\n-- * 'ruInstanceTemplate'\n--\n-- * 'ruUser'\n--\n-- * 'ruSelfLink'\n--\n-- * 'ruStatusMessage'\n--\n-- * 'ruCreationTimestamp'\n--\n-- * 'ruId'\n--\n-- * 'ruPolicy'\n--\n-- * 'ruActionType'\n--\n-- * 'ruOldInstanceTemplate'\n--\n-- * 'ruDescription'\n--\n-- * 'ruInstanceGroup'\nrollingUpdate\n :: RollingUpdate\nrollingUpdate =\n RollingUpdate'\n { _ruStatus = Nothing\n , _ruProgress = Nothing\n , _ruInstanceGroupManager = Nothing\n , _ruKind = \"replicapoolupdater#rollingUpdate\"\n , _ruError = Nothing\n , _ruInstanceTemplate = Nothing\n , _ruUser = Nothing\n , _ruSelfLink = Nothing\n , _ruStatusMessage = Nothing\n , _ruCreationTimestamp = Nothing\n , _ruId = Nothing\n , _ruPolicy = Nothing\n , _ruActionType = Nothing\n , _ruOldInstanceTemplate = Nothing\n , _ruDescription = Nothing\n , _ruInstanceGroup = Nothing\n }\n\n\n-- | [Output Only] Status of the update. ", "Possible values are: -\n-- \\\"ROLLING_FORWARD\\\": The update is going forward. - ", "\\\"ROLLING_BACK\\\":\n-- The update is being rolled back. - ", "\\\"PAUSED\\\": The update is temporarily\n-- paused (inactive). - ", "\\\"ROLLED_OUT\\\": The update is finished, all\n-- instances have been updated successfully. - ", "\\\"ROLLED_BACK\\\": The update\n-- is finished, all instances have been reverted to the previous template.", "\n-- - \\\"CANCELLED\\\": The update is paused and no longer can be resumed,\n-- undefined how many instances are running in which template.", "\nruStatus :: Lens' RollingUpdate (Maybe Text)\nruStatus = lens _ruStatus (\\ s a -> s{_ruStatus = a})\n\n-- | [Output Only] An optional progress indicator that ranges from 0 to 100.", "\n-- There is no requirement that this be linear or support any granularity\n-- of operations. ", "This should not be used to guess at when the update will\n-- be complete. ", "This number should be monotonically increasing as the\n-- update progresses.", "\nruProgress :: Lens' RollingUpdate (Maybe Int32)\nruProgress\n = lens _ruProgress (\\ s a -> s{_ruProgress = a}) .", "\n mapping _Coerce\n\n-- | Fully-qualified URL of an instance group manager being updated. ", "Exactly\n-- one of instanceGroupManager and instanceGroup must be set.", "\nruInstanceGroupManager :: Lens' RollingUpdate (Maybe Text)\nruInstanceGroupManager\n = lens _ruInstanceGroupManager\n (\\ s a -> s{_ruInstanceGroupManager = a})\n\n-- | [Output Only] Type of the resource.", "\nruKind :: Lens' RollingUpdate Text\nruKind = lens _ruKind (\\ s a -> s{_ruKind = a})\n\n-- | [Output Only] Errors that occurred during the rolling update.", "\nruError :: Lens' RollingUpdate (Maybe RollingUpdateError)\nruError = lens _ruError (\\ s a -> s{_ruError = a})\n\n-- | Fully-qualified URL of an instance template to apply.", "\nruInstanceTemplate :: Lens' RollingUpdate (Maybe Text)\nruInstanceTemplate\n = lens _ruInstanceTemplate\n (\\ s a -> s{_ruInstanceTemplate = a})\n\n-- | [Output Only] User who requested the update, for example:\n-- user\\'example.com.", "\nruUser :: Lens' RollingUpdate (Maybe Text)\nruUser = lens _ruUser (\\ s a -> s{_ruUser = a})\n\n-- | [Output Only] The fully qualified URL for the resource.", "\nruSelfLink :: Lens' RollingUpdate (Maybe Text)\nruSelfLink\n = lens _ruSelfLink (\\ s a -> s{_ruSelfLink = a})\n\n-- | [Output Only] An optional textual description of the current status of\n-- the update.", "\nruStatusMessage :: Lens' RollingUpdate (Maybe Text)\nruStatusMessage\n = lens _ruStatusMessage\n (\\ s a -> s{_ruStatusMessage = a})\n\n-- | [Output Only] Creation timestamp in RFC3339 text format.", "\nruCreationTimestamp :: Lens' RollingUpdate (Maybe Text)\nruCreationTimestamp\n = lens _ruCreationTimestamp\n (\\ s a -> s{_ruCreationTimestamp = a})\n\n-- | [Output Only] Unique identifier for the resource; defined by the server.", "\nruId :: Lens' RollingUpdate (Maybe Text)\nruId = lens _ruId (\\ s a -> s{_ruId = a})\n\n-- | Parameters of the update process.", "\nruPolicy :: Lens' RollingUpdate (Maybe RollingUpdatePolicy)\nruPolicy = lens _ruPolicy (\\ s a -> s{_ruPolicy = a})\n\n-- | Specifies the action to take for each instance within the instance\n-- group. ", "This can be RECREATE which will recreate each instance and is\n-- only available for managed instance groups. ", "It can also be REBOOT which\n-- performs a soft reboot for each instance and is only available for\n-- regular (non-managed) instance groups.", "\nruActionType :: Lens' RollingUpdate (Maybe Text)\nruActionType\n = lens _ruActionType (\\ s a -> s{_ruActionType = a})\n\n-- | Fully-qualified URL of the instance template encountered while starting\n-- the update.", "\nruOldInstanceTemplate :: Lens' RollingUpdate (Maybe Text)\nruOldInstanceTemplate\n = lens _ruOldInstanceTemplate\n (\\ s a -> s{_ruOldInstanceTemplate = a})\n\n-- | An optional textual description of the resource; provided by the client\n-- when the resource is created.", "\nruDescription :: Lens' RollingUpdate (Maybe Text)\nruDescription\n = lens _ruDescription\n (\\ s a -> s{_ruDescription = a})\n\n-- | Fully-qualified URL of an instance group being updated. ", "Exactly one of\n-- instanceGroupManager and instanceGroup must be set.", "\nruInstanceGroup :: Lens' RollingUpdate (Maybe Text)\nruInstanceGroup\n = lens _ruInstanceGroup\n (\\ s a -> s{_ruInstanceGroup = a})\n\ninstance FromJSON RollingUpdate where\n parseJSON\n = withObject \"RollingUpdate\"\n (\\ o ->\n RollingUpdate' <$>\n (o .:? \"", "status\") <*> (o .:? \"", "progress\") <*>\n (o .:? \"", "instanceGroupManager\")\n <*>\n (o .:? \"", "kind\" .!= \"replicapoolupdater#rollingUpdate\")\n <*> (o .:? \"", "error\")\n <*> (o .:? \"", "instanceTemplate\")\n <*> (o .:? \"", "user\")\n <*> (o .:? \"", "selfLink\")\n <*> (o .:? \"", "statusMessage\")\n <*> (o .:? \"", "creationTimestamp\")\n <*> (o .:? \"", "id\")\n <*> (o .:? \"", "policy\")\n <*> (o .:? \"", "actionType\")\n <*> (o .:? \"", "oldInstanceTemplate\")\n <*> (o .:? \"", "description\")\n <*> (o .:? \"", "instanceGroup\"))\n\ninstance ToJSON RollingUpdate where\n toJSON RollingUpdate'{..}\n = object\n (catMaybes\n [(\"status\" .=) <$> _ruStatus,\n (\"progress\" .=) <$> _ruProgress,\n (\"instanceGroupManager\" .=) <$>\n _ruInstanceGroupManager,\n Just (\"kind\" .= _ruKind), (\"error\" .=) <$> _ruError,\n (\"instanceTemplate\" .=) <$> _ruInstanceTemplate,\n (\"user\" .=) <$> _ruUser,\n (\"selfLink\" .=) <$> _ruSelfLink,\n (\"statusMessage\" .=) <$> _ruStatusMessage,\n (\"creationTimestamp\" .=) <$> _ruCreationTimestamp,\n (\"id\" .=) <$> _ruId, (\"policy\" .=) <$> _ruPolicy,\n (\"actionType\" .=) <$> _ruActionType,\n (\"oldInstanceTemplate\" .=) <$>\n _ruOldInstanceTemplate,\n (\"description\" .=) <$> _ruDescription,\n (\"instanceGroup\" .=) <$> _ruInstanceGroup])\n\n-- | [Output Only] Errors that occurred during the rolling update.", "\n--\n-- /See:/ 'rollingUpdateError' smart constructor.", "\nnewtype RollingUpdateError =\n RollingUpdateError'\n { _rueErrors :: Maybe [RollingUpdateErrorErrorsItem]\n }\n deriving (Eq, Show, Data, Typeable, Generic)\n\n\n-- | Creates a value of 'RollingUpdateError' with the minimum fields required to make a request.", "\n--\n-- Use one of the following lenses to modify other fields as desired:\n--\n-- * 'rueErrors'\nrollingUpdateError\n :: RollingUpdateError\nrollingUpdateError = RollingUpdateError' {_rueErrors = Nothing}\n\n\n-- | [Output Only] The array of errors encountered while processing this\n-- operation.", "\nrueErrors :: Lens' RollingUpdateError [RollingUpdateErrorErrorsItem]\nrueErrors\n = lens _rueErrors (\\ s a -> s{_rueErrors = a}) .", "\n _Default\n . _", "Coerce\n\ninstance FromJSON RollingUpdateError where\n parseJSON\n = withObject \"RollingUpdateError\"\n (\\ o ->\n RollingUpdateError' <$> (o .:? \"", "errors\" .!= mempty))\n\ninstance ToJSON RollingUpdateError where\n toJSON RollingUpdateError'{..}\n = object (catMaybes [(\"errors\" .=) <$> _rueErrors])\n\n-- | Contains a list of Operation resources.", "\n--\n-- /See:/ 'operationList' smart constructor.", "\ndata OperationList =\n OperationList'\n { _olNextPageToken :: !(", "Maybe Text)\n , _olKind :: !", "Text\n , _olItems :: !(", "Maybe [Operation])\n , _olSelfLink :: !(", "Maybe Text)\n , _olId :: !(", "Maybe Text)\n }\n deriving (Eq, Show, Data, Typeable, Generic)\n\n\n-- | Creates a value of 'OperationList' with the minimum fields required to make a request.", "\n--\n-- Use one of the following lenses to modify other fields as desired:\n--\n-- * 'olNextPageToken'\n--\n-- * 'olKind'\n--\n-- * 'olItems'\n--\n-- * 'olSelfLink'\n--\n-- * 'olId'\noperationList\n :: OperationList\noperationList =\n OperationList'\n { _olNextPageToken = Nothing\n , _olKind = \"replicapoolupdater#operationList\"\n , _olItems = Nothing\n , _olSelfLink = Nothing\n , _olId = Nothing\n }\n\n\n-- | [Output Only] A token used to continue a truncate.", "\nolNextPageToken :: Lens' OperationList (Maybe Text)\nolNextPageToken\n = lens _olNextPageToken\n (\\ s a -> s{_olNextPageToken = a})\n\n-- | [Output Only] Type of resource. ", "Always replicapoolupdater#operationList\n-- for OperationList resources.", "\nolKind :: Lens' OperationList Text\nolKind = lens _olKind (\\ s a -> s{_olKind = a})\n\n-- | [Output Only] The Operation resources.", "\nolItems :: Lens' OperationList [Operation]\nolItems\n = lens _olItems (\\ s a -> s{_olItems = a}) . _", "Default\n . _", "Coerce\n\n-- | [Output Only] The fully qualified URL for the resource.", "\nolSelfLink :: Lens' OperationList (Maybe Text)\nolSelfLink\n = lens _olSelfLink (\\ s a -> s{_olSelfLink = a})\n\n-- | [Output Only] Unique identifier for the resource; defined by the server.", "\nolId :: Lens' OperationList (Maybe Text)\nolId = lens _olId (\\ s a -> s{_olId = a})\n\ninstance FromJSON OperationList where\n parseJSON\n = withObject \"OperationList\"\n (\\ o ->\n OperationList' <$>\n (o .:? \"", "nextPageToken\") <*>\n (o .:? \"", "kind\" .!= \"replicapoolupdater#operationList\")\n <*> (o .:? \"", "items\" .!= mempty)\n <*> (o .:? \"", "selfLink\")\n <*> (o .:? \"", "id\"))\n\ninstance ToJSON OperationList where\n toJSON OperationList'{..}\n = object\n (catMaybes\n [(\"nextPageToken\" .=) <$> _olNextPageToken,\n Just (\"kind\" .= _olKind), (\"items\" .=) <$> _olItems,\n (\"selfLink\" .=) <$> _olSelfLink,\n (\"id\" .=) <$> _olId])\n\n-- | Response returned by ListInstanceUpdates method.", "\n--\n-- /See:/ 'instanceUpdateList' smart constructor.", "\ndata InstanceUpdateList =\n InstanceUpdateList'\n { _iulNextPageToken :: !(", "Maybe Text)\n , _iulKind :: !", "Text\n , _iulItems :: !(", "Maybe [InstanceUpdate])\n , _iulSelfLink :: !(", "Maybe Text)\n }\n deriving (Eq, Show, Data, Typeable, Generic)\n\n\n-- | Creates a value of 'InstanceUpdateList' with the minimum fields required to make a request.", "\n--\n-- Use one of the following lenses to modify other fields as desired:\n--\n-- * 'iulNextPageToken'\n--\n-- * 'iulKind'\n--\n-- * 'iulItems'\n--\n-- * 'iulSelfLink'\ninstanceUpdateList\n :: InstanceUpdateList\ninstanceUpdateList =\n InstanceUpdateList'\n { _iulNextPageToken = Nothing\n , _iulKind = \"replicapoolupdater#instanceUpdateList\"\n , _iulItems = Nothing\n , _iulSelfLink = Nothing\n }\n\n\n-- | A token used to continue a truncated list request.", "\niulNextPageToken :: Lens' InstanceUpdateList (Maybe Text)\niulNextPageToken\n = lens _iulNextPageToken\n (\\ s a -> s{_iulNextPageToken = a})\n\n-- | [Output Only] Type of the resource.", "\niulKind :: Lens' InstanceUpdateList Text\niulKind = lens _iulKind (\\ s a -> s{_iulKind = a})\n\n-- | Collection of requested instance updates.", "\niulItems :: Lens' InstanceUpdateList [InstanceUpdate]\niulItems\n = lens _iulItems (\\ s a -> s{_iulItems = a}) .", "\n _Default\n . _", "Coerce\n\n-- | [Output Only] The fully qualified URL for the resource.", "\niulSelfLink :: Lens' InstanceUpdateList (Maybe Text)\niulSelfLink\n = lens _iulSelfLink (\\ s a -> s{_iulSelfLink = a})\n\ninstance FromJSON InstanceUpdateList where\n parseJSON\n = withObject \"InstanceUpdateList\"\n (\\ o ->\n InstanceUpdateList' <$>\n (o .:? \"", "nextPageToken\") <*>\n (o .:? \"", "kind\" .!=\n \"replicapoolupdater#instanceUpdateList\")\n <*> (o .:? \"", "items\" .!= mempty)\n <*> (o .:? \"", "selfLink\"))\n\ninstance ToJSON InstanceUpdateList where\n toJSON InstanceUpdateList'{..}\n = object\n (catMaybes\n [(\"nextPageToken\" .=) <$> _iulNextPageToken,\n Just (\"kind\" .= _iulKind),\n (\"items\" .=) <$> _iulItems,\n (\"selfLink\" .=) <$> _iulSelfLink])\n\n--\n-- /See:/ 'rollingUpdateErrorErrorsItem' smart constructor.", "\ndata RollingUpdateErrorErrorsItem =\n RollingUpdateErrorErrorsItem'\n { _rueeiLocation :: !(", "Maybe Text)\n , _rueeiCode :: !(", "Maybe Text)\n , _rueeiMessage :: !(", "Maybe Text)\n }\n deriving (Eq, Show, Data, Typeable, Generic)\n\n\n-- | Creates a value of 'RollingUpdateErrorErrorsItem' with the minimum fields required to make a request.", "\n--\n-- Use one of the following lenses to modify other fields as desired:\n--\n-- * 'rueeiLocation'\n--\n-- * 'rueeiCode'\n--\n-- * 'rueeiMessage'\nrollingUpdateErrorErrorsItem\n :: RollingUpdateErrorErrorsItem\nrollingUpdateErrorErrorsItem =\n RollingUpdateErrorErrorsItem'\n {_rueeiLocation = Nothing, _rueeiCode = Nothing, _rueeiMessage = Nothing}\n\n\n-- | [Output Only] Indicates the field in the request that caused the error.", "\n-- This property is optional.", "\nrueeiLocation :: Lens' RollingUpdateErrorErrorsItem (Maybe Text)\nrueeiLocation\n = lens _rueeiLocation\n (\\ s a -> s{_rueeiLocation = a})\n\n-- | [Output Only] The error type identifier for this error.", "\nrueeiCode :: Lens' RollingUpdateErrorErrorsItem (Maybe Text)\nrueeiCode\n = lens _rueeiCode (\\ s a -> s{_rueeiCode = a})\n\n-- | [Output Only] An optional, human-readable error message.", "\nrueeiMessage :: Lens' RollingUpdateErrorErrorsItem (Maybe Text)\nrueeiMessage\n = lens _rueeiMessage (\\ s a -> s{_rueeiMessage = a})\n\ninstance FromJSON RollingUpdateErrorErrorsItem where\n parseJSON\n = withObject \"RollingUpdateErrorErrorsItem\"\n (\\ o ->\n RollingUpdateErrorErrorsItem' <$>\n (o .:? \"", "location\") <*> (o .:? \"", "code\") <*>\n (o .:? \"", "message\"))\n\ninstance ToJSON RollingUpdateErrorErrorsItem where\n toJSON RollingUpdateErrorErrorsItem'{..}\n = object\n (catMaybes\n [(\"location\" .=) <$> _rueeiLocation,\n (\"code\" .=) <$> _rueeiCode,\n (\"message\" .=) <$> _rueeiMessage])\n\n-- | An operation resource, used to manage asynchronous API requests.", "\n--\n-- /See:/ 'operation' smart constructor.", "\ndata Operation =\n Operation'\n { _oTargetId :: !(", "Maybe (Textual Word64))\n , _oStatus :: !(", "Maybe Text)\n , _oInsertTime :: !(", "Maybe Text)\n , _oProgress :: !(", "Maybe (Textual Int32))\n , _oStartTime :: !(", "Maybe Text)\n , _oKind :: !", "Text\n , _oError :: !(", "Maybe OperationError)\n , _oHTTPErrorMessage :: !(", "Maybe Text)\n , _oZone :: !(", "Maybe Text)\n , _oWarnings :: !(", "Maybe [OperationWarningsItem])\n , _oHTTPErrorStatusCode :: !(", "Maybe (Textual Int32))\n , _oUser :: !(", "Maybe Text)\n , _oSelfLink :: !(", "Maybe Text)\n , _oName :: !(", "Maybe Text)\n , _oStatusMessage :: !(", "Maybe Text)\n , _oCreationTimestamp :: !(", "Maybe Text)\n , _oEndTime :: !(", "Maybe Text)\n , _oId :: !(", "Maybe (Textual Word64))\n , _oOperationType :: !(", "Maybe Text)\n , _oRegion :: !(", "Maybe Text)\n , _oTargetLink :: !(", "Maybe Text)\n , _oClientOperationId :: !(", "Maybe Text)\n }\n deriving (Eq, Show, Data, Typeable, Generic)\n\n\n-- | Creates a value of 'Operation' with the minimum fields required to make a request.", "\n--\n-- Use one of the following lenses to modify other fields as desired:\n--\n-- * 'oTargetId'\n--\n-- * 'oStatus'\n--\n-- * 'oInsertTime'\n--\n-- * 'oProgress'\n--\n-- * 'oStartTime'\n--\n-- * 'oKind'\n--\n-- * 'oError'\n--\n-- * 'oHTTPErrorMessage'\n--\n-- * 'oZone'\n--\n-- * 'oWarnings'\n--\n-- * 'oHTTPErrorStatusCode'\n--\n-- * 'oUser'\n--\n-- * 'oSelfLink'\n--\n-- * 'oName'\n--\n-- * 'oStatusMessage'\n--\n-- * 'oCreationTimestamp'\n--\n-- * 'oEndTime'\n--\n-- * 'oId'\n--\n-- * 'oOperationType'\n--\n-- * 'oRegion'\n--\n-- * 'oTargetLink'\n--\n-- * 'oClientOperationId'\noperation\n :: Operation\noperation =\n Operation'\n { _oTargetId = Nothing\n , _oStatus = Nothing\n , _oInsertTime = Nothing\n , _oProgress = Nothing\n , _oStartTime = Nothing\n , _oKind = \"replicapoolupdater#operation\"\n , _oError = Nothing\n , _oHTTPErrorMessage = Nothing\n , _oZone = Nothing\n , _oWarnings = Nothing\n , _oHTTPErrorStatusCode = Nothing\n , _oUser = Nothing\n , _oSelfLink = Nothing\n , _oName = Nothing\n , _oStatusMessage = Nothing\n , _oCreationTimestamp = Nothing\n , _oEndTime = Nothing\n , _oId = Nothing\n , _oOperationType = Nothing\n , _oRegion = Nothing\n , _oTargetLink = Nothing\n , _oClientOperationId = Nothing\n }\n\n\n-- | [Output Only] Unique target id which identifies a particular incarnation\n-- of the target.", "\noTargetId :: Lens' Operation (Maybe Word64)\noTargetId\n = lens _oTargetId (\\ s a -> s{_oTargetId = a}) .", "\n mapping _Coerce\n\n-- | [Output Only] Status of the operation. ", "Can be one of the following:\n-- \\\"PENDING\\\", \\\"RUNNING\\\", or \\\"DONE\\\".", "\noStatus :: Lens' Operation (Maybe Text)\noStatus = lens _oStatus (\\ s a -> s{_oStatus = a})\n\n-- | [Output Only] The time that this operation was requested. ", "This is in RFC\n-- 3339 format.", "\noInsertTime :: Lens' Operation (Maybe Text)\noInsertTime\n = lens _oInsertTime (\\ s a -> s{_oInsertTime = a})\n\noProgress :: Lens' Operation (Maybe Int32)\noProgress\n = lens _oProgress (\\ s a -> s{_oProgress = a}) .", "\n mapping _Coerce\n\n-- | [Output Only] The time that this operation was started by the server.", "\n-- This is in RFC 3339 format.", "\noStartTime :: Lens' Operation (Maybe Text)\noStartTime\n = lens _oStartTime (\\ s a -> s{_oStartTime = a})\n\n-- | [Output Only] Type of the resource. ", "Always replicapoolupdater#operation\n-- for Operation resources.", "\noKind :: Lens' Operation Text\noKind = lens _oKind (\\ s a -> s{_oKind = a})\n\n-- | [Output Only] If errors occurred during processing of this operation,\n-- this field will be populated.", "\noError :: Lens' Operation (Maybe OperationError)\noError = lens _oError (\\ s a -> s{_oError = a})\n\noHTTPErrorMessage :: Lens' Operation (Maybe Text)\noHTTPErrorMessage\n = lens _oHTTPErrorMessage\n (\\ s a -> s{_oHTTPErrorMessage = a})\n\n-- | [Output Only] URL of the zone where the operation resides.", "\noZone :: Lens' Operation (Maybe Text)\noZone = lens _oZone (\\ s a -> s{_oZone = a})\n\noWarnings :: Lens' Operation [OperationWarningsItem]\noWarnings\n = lens _oWarnings (\\ s a -> s{_oWarnings = a}) .", "\n _Default\n . _", "Coerce\n\noHTTPErrorStatusCode :: Lens' Operation (Maybe Int32)\noHTTPErrorStatusCode\n = lens _oHTTPErrorStatusCode\n (\\ s a -> s{_oHTTPErrorStatusCode = a})\n . ", "mapping _Coerce\n\noUser :: Lens' Operation (Maybe Text)\noUser = lens _oUser (\\ s a -> s{_oUser = a})\n\n-- | [Output Only] The fully qualified URL for the resource.", "\noSelfLink :: Lens' Operation (Maybe Text)\noSelfLink\n = lens _oSelfLink (\\ s a -> s{_oSelfLink = a})\n\n-- | [Output Only] Name of the resource.", "\noName :: Lens' Operation (Maybe Text)\noName = lens _oName (\\ s a -> s{_oName = a})\n\n-- | [Output Only] An optional textual description of the current status of\n-- the operation.", "\noStatusMessage :: Lens' Operation (Maybe Text)\noStatusMessage\n = lens _oStatusMessage\n (\\ s a -> s{_oStatusMessage = a})\n\n-- | [Output Only] Creation timestamp in RFC3339 text format.", "\noCreationTimestamp :: Lens' Operation (Maybe Text)\noCreationTimestamp\n = lens _oCreationTimestamp\n (\\ s a -> s{_oCreationTimestamp = a})\n\noEndTime :: Lens' Operation (Maybe Text)\noEndTime = lens _oEndTime (\\ s a -> s{_oEndTime = a})\n\n-- | [Output Only] Unique identifier for the resource; defined by the server.", "\noId :: Lens' Operation (Maybe Word64)\noId\n = lens _oId (\\ s a -> s{_oId = a}) . ", "mapping _Coerce\n\noOperationType :: Lens' Operation (Maybe Text)\noOperationType\n = lens _oOperationType\n (\\ s a -> s{_oOperationType = a})\n\n-- | [Output Only] URL of the region where the operation resides.", "\noRegion :: Lens' Operation (Maybe Text)\noRegion = lens _oRegion (\\ s a -> s{_oRegion = a})\n\n-- | [Output Only] URL of the resource the operation is mutating.", "\noTargetLink :: Lens' Operation (Maybe Text)\noTargetLink\n = lens _oTargetLink (\\ s a -> s{_oTargetLink = a})\n\noClientOperationId :: Lens' Operation (Maybe Text)\noClientOperationId\n = lens _oClientOperationId\n (\\ s a -> s{_oClientOperationId = a})\n\ninstance FromJSON Operation where\n parseJSON\n = withObject \"Operation\"\n (\\ o ->\n Operation' <$>\n (o .:? \"", "targetId\") <*> (o .:? \"", "status\") <*>\n (o .:? \"", "insertTime\")\n <*> (o .:? \"", "progress\")\n <*> (o .:? \"", "startTime\")\n <*> (o .:? \"", "kind\" .!= \"replicapoolupdater#operation\")\n <*> (o .:? \"", "error\")\n <*> (o .:? \"", "httpErrorMessage\")\n <*> (o .:? \"", "zone\")\n <*> (o .:? \"", "warnings\" .!= mempty)\n <*> (o .:? \"", "httpErrorStatusCode\")\n <*> (o .:? \"", "user\")\n <*> (o .:? \"", "selfLink\")\n <*> (o .:? \"", "name\")\n <*> (o .:? \"", "statusMessage\")\n <*> (o .:? \"", "creationTimestamp\")\n <*> (o .:? \"", "endTime\")\n <*> (o .:? \"", "id\")\n <*> (o .:? \"", "operationType\")\n <*> (o .:? \"", "region\")\n <*> (o .:? \"", "targetLink\")\n <*> (o .:? \"", "clientOperationId\"))\n\ninstance ToJSON Operation where\n toJSON Operation'{..}\n = object\n (catMaybes\n [(\"targetId\" .=) <$> _oTargetId,\n (\"status\" .=) <$> _oStatus,\n (\"insertTime\" .=) <$> _oInsertTime,\n (\"progress\" .=) <$> _oProgress,\n (\"startTime\" .=) <$> _oStartTime,\n Just (\"kind\" .= _oKind), (\"error\" .=) <$> _oError,\n (\"httpErrorMessage\" .=) <$> _oHTTPErrorMessage,\n (\"zone\" .=) <$> _oZone,\n (\"warnings\" .=) <$> _oWarnings,\n (\"httpErrorStatusCode\" .=) <$> _oHTTPErrorStatusCode,\n (\"user\" .=) <$> _oUser,\n (\"selfLink\" .=) <$> _oSelfLink,\n (\"name\" .=) <$> _oName,\n (\"statusMessage\" .=) <$> _oStatusMessage,\n (\"creationTimestamp\" .=) <$> _oCreationTimestamp,\n (\"endTime\" .=) <$> _oEndTime, (\"id\" .=) <$> _oId,\n (\"operationType\" .=) <$> _oOperationType,\n (\"region\" .=) <$> _oRegion,\n (\"targetLink\" .=) <$> _oTargetLink,\n (\"clientOperationId\" .=) <$> _oClientOperationId])\n\n-- | Update of a single instance.", "\n--\n-- /See:/ 'instanceUpdate' smart constructor.", "\ndata InstanceUpdate =\n InstanceUpdate'\n { _iuStatus :: !(", "Maybe Text)\n , _iuError :: !(", "Maybe InstanceUpdateError)\n , _iuInstance :: !(", "Maybe Text)\n }\n deriving (Eq, Show, Data, Typeable, Generic)\n\n\n-- | Creates a value of 'InstanceUpdate' with the minimum fields required to make a request.", "\n--\n-- Use one of the following lenses to modify other fields as desired:\n--\n-- * 'iuStatus'\n--\n-- * 'iuError'\n--\n-- * 'iuInstance'\ninstanceUpdate\n :: InstanceUpdate\ninstanceUpdate =\n InstanceUpdate'\n {_iuStatus = Nothing, _iuError = Nothing, _iuInstance = Nothing}\n\n\n-- | Status of the instance update. ", "Possible values are: - \\\"PENDING\\\": The\n-- instance update is pending execution. - ", "\\\"ROLLING_FORWARD\\\": The\n-- instance update is going forward. - ", "\\\"ROLLING_BACK\\\": The instance\n-- update is being rolled back. - ", "\\\"PAUSED\\\": The instance update is\n-- temporarily paused (inactive). - ", "\\\"ROLLED_OUT\\\": The instance update is\n-- finished, the instance is running the new template. - ", "\\\"ROLLED_BACK\\\":\n-- The instance update is finished, the instance has been reverted to the\n-- previous template. - ", "\\\"CANCELLED\\\": The instance update is paused and no\n-- longer can be resumed, undefined in which template the instance is\n-- running.", "\niuStatus :: Lens' InstanceUpdate (Maybe Text)\niuStatus = lens _iuStatus (\\ s a -> s{_iuStatus = a})\n\n-- | Errors that occurred during the instance update.", "\niuError :: Lens' InstanceUpdate (Maybe InstanceUpdateError)\niuError = lens _iuError (\\ s a -> s{_iuError = a})\n\n-- | Fully-qualified URL of the instance being updated.", "\niuInstance :: Lens' InstanceUpdate (Maybe Text)\niuInstance\n = lens _iuInstance (\\ s a -> s{_iuInstance = a})\n\ninstance FromJSON InstanceUpdate where\n parseJSON\n = withObject \"InstanceUpdate\"\n (\\ o ->\n InstanceUpdate' <$>\n (o .:? \"", "status\") <*> (o .:? \"", "error\") <*>\n (o .:? \"", "instance\"))\n\ninstance ToJSON InstanceUpdate where\n toJSON InstanceUpdate'{..}\n = object\n (catMaybes\n [(\"status\" .=) <$> _iuStatus,\n (\"error\" .=) <$> _iuError,\n (\"instance\" .=) <$> _iuInstance])\n\n-- | Errors that occurred during the instance update.", "\n--\n-- /See:/ 'instanceUpdateError' smart constructor.", "\nnewtype InstanceUpdateError =\n InstanceUpdateError'\n { _iueErrors :: Maybe [InstanceUpdateErrorErrorsItem]\n }\n deriving (Eq, Show, Data, Typeable, Generic)\n\n\n-- | Creates a value of 'InstanceUpdateError' with the minimum fields required to make a request.", "\n--\n-- Use one of the following lenses to modify other fields as desired:\n--\n-- * 'iueErrors'\ninstanceUpdateError\n :: InstanceUpdateError\ninstanceUpdateError = InstanceUpdateError' {_iueErrors = Nothing}\n\n\n-- | [Output Only] The array of errors encountered while processing this\n-- operation.", "\niueErrors :: Lens' InstanceUpdateError [InstanceUpdateErrorErrorsItem]\niueErrors\n = lens _iueErrors (\\ s a -> s{_iueErrors = a}) .", "\n _Default\n . _", "Coerce\n\ninstance FromJSON InstanceUpdateError where\n parseJSON\n = withObject \"InstanceUpdateError\"\n (\\ o ->\n InstanceUpdateError' <$> (o .:? \"", "errors\" .!= mempty))\n\ninstance ToJSON InstanceUpdateError where\n toJSON InstanceUpdateError'{..}\n = object (catMaybes [(\"errors\" .=) <$> _iueErrors])\n\n-- | Parameters of the update process.", "\n--\n-- /See:/ 'rollingUpdatePolicy' smart constructor.", "\ndata RollingUpdatePolicy =\n RollingUpdatePolicy'\n { _rupMinInstanceUpdateTimeSec :: !(", "Maybe (Textual Int32))\n , _rupInstanceStartupTimeoutSec :: !(", "Maybe (Textual Int32))\n , _rupMaxNumFailedInstances :: !(", "Maybe (Textual Int32))\n , _rupAutoPauseAfterInstances :: !(", "Maybe (Textual Int32))\n , _rupMaxNumConcurrentInstances :: !(", "Maybe (Textual Int32))\n }\n deriving (Eq, Show, Data, Typeable, Generic)\n\n\n-- | Creates a value of 'RollingUpdatePolicy' with the minimum fields required to make a request.", "\n--\n-- Use one of the following lenses to modify other fields as desired:\n--\n-- * 'rupMinInstanceUpdateTimeSec'\n--\n-- * 'rupInstanceStartupTimeoutSec'\n--\n-- * 'rupMaxNumFailedInstances'\n--\n-- * 'rupAutoPauseAfterInstances'\n--\n-- * 'rupMaxNumConcurrentInstances'\nrollingUpdatePolicy\n :: RollingUpdatePolicy\nrollingUpdatePolicy =\n RollingUpdatePolicy'\n { _rupMinInstanceUpdateTimeSec = Nothing\n , _rupInstanceStartupTimeoutSec = Nothing\n , _rupMaxNumFailedInstances = Nothing\n , _rupAutoPauseAfterInstances = Nothing\n , _rupMaxNumConcurrentInstances = Nothing\n }\n\n\n-- | The minimum amount of time that the updater spends to update each\n-- instance. ", "Update time is the time it takes to complete all update\n-- actions (e.g. Stop call on Instance resource in Rolling Reboot), reboot,\n-- and initialize. ", "If the instance update finishes early, the updater\n-- pauses for the remainder of the time before it starts the next instance\n-- update.", "\nrupMinInstanceUpdateTimeSec :: Lens' RollingUpdatePolicy (Maybe Int32)\nrupMinInstanceUpdateTimeSec\n = lens _rupMinInstanceUpdateTimeSec\n (\\ s a -> s{_rupMinInstanceUpdateTimeSec = a})\n . ", "mapping _Coerce\n\n-- | The maximum amount of time that the updater waits for a HEALTHY state\n-- after all of the update steps are complete. ", "If the HEALTHY state is not\n-- received before the deadline, the instance update is considered a\n-- failure.", "\nrupInstanceStartupTimeoutSec :: Lens' RollingUpdatePolicy (Maybe Int32)\nrupInstanceStartupTimeoutSec\n = lens _rupInstanceStartupTimeoutSec\n (\\ s a -> s{_rupInstanceStartupTimeoutSec = a})\n . ", "mapping _Coerce\n\n-- | The maximum number of instance updates that can fail before the group\n-- update is considered a failure. ", "An instance update is considered failed\n-- if any of its update actions (e.g. Stop call on Instance resource in\n-- Rolling Reboot) failed with permanent failure, or if the instance is in\n-- an UNHEALTHY state after it finishes all of the update actions.", "\nrupMaxNumFailedInstances :: Lens' RollingUpdatePolicy (Maybe Int32)\nrupMaxNumFailedInstances\n = lens _rupMaxNumFailedInstances\n (\\ s a -> s{_rupMaxNumFailedInstances = a})\n . ", "mapping _Coerce\n\n-- | Number of instances to update before the updater pauses the rolling\n-- update.", "\nrupAutoPauseAfterInstances :: Lens' RollingUpdatePolicy (Maybe Int32)\nrupAutoPauseAfterInstances\n = lens _rupAutoPauseAfterInstances\n (\\ s a -> s{_rupAutoPauseAfterInstances = a})\n . ", "mapping _Coerce\n\n-- | The maximum number of instances that can be updated simultaneously. ", "An\n-- instance update is considered complete only after the instance is\n-- restarted and initialized.", "\nrupMaxNumConcurrentInstances :: Lens' RollingUpdatePolicy (Maybe Int32)\nrupMaxNumConcurrentInstances\n = lens _rupMaxNumConcurrentInstances\n (\\ s a -> s{_rupMaxNumConcurrentInstances = a})\n . ", "mapping _Coerce\n\ninstance FromJSON RollingUpdatePolicy where\n parseJSON\n = withObject \"RollingUpdatePolicy\"\n (\\ o ->\n RollingUpdatePolicy' <$>\n (o .:? \"", "minInstanceUpdateTimeSec\") <*>\n (o .:? \"", "instanceStartupTimeoutSec\")\n <*> (o .:? \"", "maxNumFailedInstances\")\n <*> (o .:? \"", "autoPauseAfterInstances\")\n <*> (o .:? \"", "maxNumConcurrentInstances\"))\n\ninstance ToJSON RollingUpdatePolicy where\n toJSON RollingUpdatePolicy'{..}\n = object\n (catMaybes\n [(\"minInstanceUpdateTimeSec\" .=) <$>\n _rupMinInstanceUpdateTimeSec,\n (\"instanceStartupTimeoutSec\" .=) <$>\n _rupInstanceStartupTimeoutSec,\n (\"maxNumFailedInstances\" .=) <$>\n _rupMaxNumFailedInstances,\n (\"autoPauseAfterInstances\" .=) <$>\n _rupAutoPauseAfterInstances,\n (\"maxNumConcurrentInstances\" .=) <$>\n _rupMaxNumConcurrentInstances])\n\n-- | [Output Only] If errors occurred during processing of this operation,\n-- this field will be populated.", "\n--\n-- /See:/ 'operationError' smart constructor.", "\nnewtype OperationError =\n OperationError'\n { _oeErrors :: Maybe [OperationErrorErrorsItem]\n }\n deriving (Eq, Show, Data, Typeable, Generic)\n\n\n-- | Creates a value of 'OperationError' with the minimum fields required to make a request.", "\n--\n-- Use one of the following lenses to modify other fields as desired:\n--\n-- * 'oeErrors'\noperationError\n :: OperationError\noperationError = OperationError' {_oeErrors = Nothing}\n\n\n-- | [Output Only] The array of errors encountered while processing this\n-- operation.", "\noeErrors :: Lens' OperationError [OperationErrorErrorsItem]\noeErrors\n = lens _oeErrors (\\ s a -> s{_oeErrors = a}) .", "\n _Default\n . _", "Coerce\n\ninstance FromJSON OperationError where\n parseJSON\n = withObject \"OperationError\"\n (\\ o ->\n OperationError' <$> (o .:? \"", "errors\" .!= mempty))\n\ninstance ToJSON OperationError where\n toJSON OperationError'{..}\n = object (catMaybes [(\"errors\" .=) <$> _oeErrors])\n\n--\n-- /See:/ 'operationErrorErrorsItem' smart constructor.", "\ndata OperationErrorErrorsItem =\n OperationErrorErrorsItem'\n { _oeeiLocation :: !(", "Maybe Text)\n , _oeeiCode :: !(", "Maybe Text)\n , _oeeiMessage :: !(", "Maybe Text)\n }\n deriving (Eq, Show, Data, Typeable, Generic)\n\n\n-- | Creates a value of 'OperationErrorErrorsItem' with the minimum fields required to make a request.", "\n--\n-- Use one of the following lenses to modify other fields as desired:\n--\n-- * 'oeeiLocation'\n--\n-- * 'oeeiCode'\n--\n-- * 'oeeiMessage'\noperationErrorErrorsItem\n :: OperationErrorErrorsItem\noperationErrorErrorsItem =\n OperationErrorErrorsItem'\n {_oeeiLocation = Nothing, _oeeiCode = Nothing, _oeeiMessage = Nothing}\n\n\n-- | [Output Only] Indicates the field in the request that caused the error.", "\n-- This property is optional.", "\noeeiLocation :: Lens' OperationErrorErrorsItem (Maybe Text)\noeeiLocation\n = lens _oeeiLocation (\\ s a -> s{_oeeiLocation = a})\n\n-- | [Output Only] The error type identifier for this error.", "\noeeiCode :: Lens' OperationErrorErrorsItem (Maybe Text)\noeeiCode = lens _oeeiCode (\\ s a -> s{_oeeiCode = a})\n\n-- | [Output Only] An optional, human-readable error message.", "\noeeiMessage :: Lens' OperationErrorErrorsItem (Maybe Text)\noeeiMessage\n = lens _oeeiMessage (\\ s a -> s{_oeeiMessage = a})\n\ninstance FromJSON OperationErrorErrorsItem where\n parseJSON\n = withObject \"OperationErrorErrorsItem\"\n (\\ o ->\n OperationErrorErrorsItem' <$>\n (o .:? \"", "location\") <*> (o .:? \"", "code\") <*>\n (o .:? \"", "message\"))\n\ninstance ToJSON OperationErrorErrorsItem where\n toJSON OperationErrorErrorsItem'{..}\n = object\n (catMaybes\n [(\"location\" .=) <$> _oeeiLocation,\n (\"code\" .=) <$> _oeeiCode,\n (\"message\" .=) <$> _oeeiMessage])\n\n--\n-- /See:/ 'instanceUpdateErrorErrorsItem' smart constructor.", "\ndata InstanceUpdateErrorErrorsItem =\n InstanceUpdateErrorErrorsItem'\n { _iueeiLocation :: !(", "Maybe Text)\n , _iueeiCode :: !(", "Maybe Text)\n , _iueeiMessage :: !(", "Maybe Text)\n }\n deriving (Eq, Show, Data, Typeable, Generic)\n\n\n-- | Creates a value of 'InstanceUpdateErrorErrorsItem' with the minimum fields required to make a request.", "\n--\n-- Use one of the following lenses to modify other fields as desired:\n--\n-- * 'iueeiLocation'\n--\n-- * 'iueeiCode'\n--\n-- * 'iueeiMessage'\ninstanceUpdateErrorErrorsItem\n :: InstanceUpdateErrorErrorsItem\ninstanceUpdateErrorErrorsItem =\n InstanceUpdateErrorErrorsItem'\n {_iueeiLocation = Nothing, _iueeiCode = Nothing, _iueeiMessage = Nothing}\n\n\n-- | [Output Only] Indicates the field in the request that caused the error.", "\n-- This property is optional.", "\niueeiLocation :: Lens' InstanceUpdateErrorErrorsItem (Maybe Text)\niueeiLocation\n = lens _iueeiLocation\n (\\ s a -> s{_iueeiLocation = a})\n\n-- | [Output Only] The error type identifier for this error.", "\niueeiCode :: Lens' InstanceUpdateErrorErrorsItem (Maybe Text)\niueeiCode\n = lens _iueeiCode (\\ s a -> s{_iueeiCode = a})\n\n-- | [Output Only] An optional, human-readable error message.", "\niueeiMessage :: Lens' InstanceUpdateErrorErrorsItem (Maybe Text)\niueeiMessage\n = lens _iueeiMessage (\\ s a -> s{_iueeiMessage = a})\n\ninstance FromJSON InstanceUpdateErrorErrorsItem where\n parseJSON\n = withObject \"InstanceUpdateErrorErrorsItem\"\n (\\ o ->\n InstanceUpdateErrorErrorsItem' <$>\n (o .:? \"", "location\") <*> (o .:? \"", "code\") <*>\n (o .:? \"", "message\"))\n\ninstance ToJSON InstanceUpdateErrorErrorsItem where\n toJSON InstanceUpdateErrorErrorsItem'{..}\n = object\n (catMaybes\n [(\"location\" .=) <$> _iueeiLocation,\n (\"code\" .=) <$> _iueeiCode,\n (\"message\" .=) <$> _iueeiMessage])\n\n-- | Response returned by List method.", "\n--\n-- /See:/ 'rollingUpdateList' smart constructor.", "\ndata RollingUpdateList =\n RollingUpdateList'\n { _rulNextPageToken :: !(", "Maybe Text)\n , _rulKind :: !", "Text\n , _rulItems :: !(", "Maybe [RollingUpdate])\n , _rulSelfLink :: !(", "Maybe Text)\n }\n deriving (Eq, Show, Data, Typeable, Generic)\n\n\n-- | Creates a value of 'RollingUpdateList' with the minimum fields required to make a request.", "\n--\n-- Use one of the following lenses to modify other fields as desired:\n--\n-- * 'rulNextPageToken'\n--\n-- * 'rulKind'\n--\n-- * 'rulItems'\n--\n-- * 'rulSelfLink'\nrollingUpdateList\n :: RollingUpdateList\nrollingUpdateList =\n RollingUpdateList'\n { _rulNextPageToken = Nothing\n , _rulKind = \"replicapoolupdater#rollingUpdateList\"\n , _rulItems = Nothing\n , _rulSelfLink = Nothing\n }\n\n\n-- | A token used to continue a truncated list request.", "\nrulNextPageToken :: Lens' RollingUpdateList (Maybe Text)\nrulNextPageToken\n = lens _rulNextPageToken\n (\\ s a -> s{_rulNextPageToken = a})\n\n-- | [Output Only] Type of the resource.", "\nrulKind :: Lens' RollingUpdateList Text\nrulKind = lens _rulKind (\\ s a -> s{_rulKind = a})\n\n-- | Collection of requested updates.", "\nrulItems :: Lens' RollingUpdateList [RollingUpdate]\nrulItems\n = lens _rulItems (\\ s a -> s{_rulItems = a}) .", "\n _Default\n . _", "Coerce\n\n-- | [Output Only] The fully qualified URL for the resource.", "\nrulSelfLink :: Lens' RollingUpdateList (Maybe Text)\nrulSelfLink\n = lens _rulSelfLink (\\ s a -> s{_rulSelfLink = a})\n\ninstance FromJSON RollingUpdateList where\n parseJSON\n = withObject \"RollingUpdateList\"\n (\\ o ->\n RollingUpdateList' <$>\n (o .:? \"", "nextPageToken\") <*>\n (o .:? \"", "kind\" .!=\n \"replicapoolupdater#rollingUpdateList\")\n <*> (o .:? \"", "items\" .!= mempty)\n <*> (o .:? \"", "selfLink\"))\n\ninstance ToJSON RollingUpdateList where\n toJSON RollingUpdateList'{..}\n = object\n (catMaybes\n [(\"nextPageToken\" .=) <$> _rulNextPageToken,\n Just (\"kind\" .= _rulKind),\n (\"items\" .=) <$> _rulItems,\n (\"selfLink\" .=) <$> _rulSelfLink])\n\n--\n-- /See:/ 'operationWarningsItem' smart constructor.", "\ndata OperationWarningsItem =\n OperationWarningsItem'\n { _owiData :: !(", "Maybe [OperationWarningsItemDataItem])\n , _owiCode :: !(", "Maybe Text)\n , _owiMessage :: !(", "Maybe Text)\n }\n deriving (Eq, Show, Data, Typeable, Generic)\n\n\n-- | Creates a value of 'OperationWarningsItem' with the minimum fields required to make a request.", "\n--\n-- Use one of the following lenses to modify other fields as desired:\n--\n-- * 'owiData'\n--\n-- * 'owiCode'\n--\n-- * 'owiMessage'\noperationWarningsItem\n :: OperationWarningsItem\noperationWarningsItem =\n OperationWarningsItem'\n {_owiData = Nothing, _owiCode = Nothing, _owiMessage = Nothing}\n\n\n-- | [Output only] Metadata for this warning in key:value format.", "\nowiData :: Lens' OperationWarningsItem [OperationWarningsItemDataItem]\nowiData\n = lens _owiData (\\ s a -> s{_owiData = a}) . _", "Default\n . _", "Coerce\n\n-- | [Output only] The warning type identifier for this warning.", "\nowiCode :: Lens' OperationWarningsItem (Maybe Text)\nowiCode = lens _owiCode (\\ s a -> s{_owiCode = a})\n\n-- | [Output only] Optional human-readable details for this warning.", "\nowiMessage :: Lens' OperationWarningsItem (Maybe Text)\nowiMessage\n = lens _owiMessage (\\ s a -> s{_owiMessage = a})\n\ninstance FromJSON OperationWarningsItem where\n parseJSON\n = withObject \"OperationWarningsItem\"\n (\\ o ->\n OperationWarningsItem' <$>\n (o .:? \"", "data\" .!= mempty) <*> (o .:? \"", "code\") <*>\n (o .:? \"", "message\"))\n\ninstance ToJSON OperationWarningsItem where\n toJSON OperationWarningsItem'{..}\n = object\n (catMaybes\n [(\"data\" .=) <$> _owiData, (\"code\" .=) <$> _owiCode,\n (\"message\" .=) <$> _owiMessage])\n" ]

{ "pile_set_name": "Github" }

[ 0.0012156523298472166, 0.0009281968814320862, 0.0007585236453451216, 0.0007488196133635938, 0.00066308060195297, 0.0006111471448093653, 0.0009281968814320862, 0.0007585236453451216, 0.0007488196133635938, 0.0006663075182586908, 0.0009281968814320862, 0.000645437918137759, 0.0009281968814320862, 0.0007585236453451216, 0.0007488196133635938, 0.0009357142844237387, 0.0020524412393569946, 0.0007930815336294472, 0.0006671504233963788, 0.0011691872496157885, 0.0007560512749478221, 0.002138715935871005, 0.0007367426296696067, 0.000822996546048671, 0.0006862403824925423, 0.0008025552961044014, 0.0009493495454080403, 0.0007157605141401291, 0.0008034854545257986, 0.0008213517721742392, 0.0008281994378194213, 0.000735116598661989, 0.0006793803768232465, 0.0006811409257352352, 0.0008180750883184373, 0.0007206116570159793, 0.0007723457529209554, 0.0009435010724700987, 0.0007160252425819635, 0.0009025167091749609, 0.0006986120715737343, 0.000614338438026607, 0.0018774118507280946, 0.0006078945589251816, 0.0007934001623652875, 0.0005994478706270456, 0.0006215536850504577, 0.0006770325708203018, 0.0006304708658717573, 0.000583637214731425, 0.0005890459869988263, 0.000669054570607841, 0.0005903974524699152, 0.0007946270052343607, 0.0006069819210097194, 0.0007876363233663142, 0.0006939875893294811, 0.0007474476005882025, 0.0006519141024909914, 0.000594119424931705, 0.0007065725512802601, 0.0005809706635773182, 0.000605317996814847, 0.0007220383849926293, 0.0006214171298779547, 0.0007473371806554496, 0.000603308726567775, 0.0006479902658611536, 0.0006337747327052057, 0.0006286684074439108, 0.000879401748534292, 0.0007947081467136741, 0.0006947824149392545, 0.0007034520385786891, 0.0006704249535687268, 0.0009200751082971692, 0.000826769566629082, 0.0008750236011110246, 0.0007165371789596975, 0.0008029480814002454, 0.0006799057009629905, 0.0007746521732769907, 0.0007463870570063591, 0.0021907160989940166, 0.0006984799401834607, 0.0007147444994188845, 0.0007411434780806303, 0.0006917708669789135, 0.0009095277637243271, 0.0007170659373514354, 0.0008115058881230652, 0.0009333080379292369, 0.0016437818994745612, 0.000775569467805326, 0.002356813522055745, 0.00130518211517483, 0.0006574713042937219, 0.0008612317033112049, 0.0007855634321458638, 0.0008481215336360037, 0.0007405560463666916, 0.0007092947489582002, 0.0006144288927316666, 0.0009603501530364156, 0.0006503923796117306, 0.0006314143538475037, 0.0006444320315495133, 0.0007042908691801131, 0.000702661054674536, 0.0006503768963739276, 0.0006504726479761302, 0.0009038656135089695, 0.000730526284314692, 0.0008100171689875424, 0.0009545919601805508, 0.0006799057009629905, 0.0007868976681493223, 0.0006619500345550478, 0.0011802539229393005, 0.000875169993378222, 0.0008735399460420012, 0.0007799597806297243, 0.0006162672070786357, 0.0009027304477058351, 0.000731203646864742, 0.0006106455693952739, 0.0007553185569122434, 0.000775569467805326, 0.0006503768963739276, 0.0010486106621101499, 0.000730526284314692, 0.0008666834328323603, 0.0009545919601805508, 0.0007990755839273334, 0.0017281570471823215, 0.0007257885881699622, 0.0007702436414547265, 0.0006735229981131852, 0.0009552043629810214, 0.0007662902353331447, 0.0008208698127418756, 0.000706603517755866, 0.0018965257331728935, 0.0006769725587219, 0.0007547109271399677, 0.000805160088930279, 0.0006742171244695783, 0.0009410101920366287, 0.0007585305138491094, 0.0007547015557065606, 0.001323316595517099, 0.0008433355251327157, 0.0008211580570787191, 0.0010254140943288803, 0.0021835349034518003, 0.0006968306843191385, 0.0007357961148954928, 0.0012063489994034171, 0.0006722996477037668, 0.0007723656017333269, 0.000747375946957618, 0.0007849811809137464, 0.0008961235289461911, 0.0007711877697147429, 0.0007180482498370111, 0.0006620523054152727, 0.0007223674328997731, 0.0006999019533395767, 0.000724068726412952, 0.0006202186341397464, 0.006709686014801264, 0.0007716023246757686, 0.0006129441899247468, 0.0006348281167447567, 0.0006452315719798207, 0.000653009454254061, 0.0011306394590064883, 0.0006113300914876163, 0.000626727647613734, 0.0007860882324166596, 0.0006313722115010023, 0.0006402839790098369, 0.0019158890936523676, 0.0007651223568245769, 0.000775569467805326, 0.004472983535379171, 0.0006501042516902089, 0.0006919439765624702, 0.0006135349976830184, 0.0006621491047553718, 0.0008825424592941999, 0.0007208170718513429, 0.0006983258645050228, 0.0006529180100187659, 0.000983877689577639, 0.0007408306119032204, 0.0007034520385786891, 0.0007685174350626767, 0.0006704249535687268, 0.0006975249852985144, 0.0008346956456080079, 0.0008750236011110246, 0.0011042834958061576, 0.0007966300472617149, 0.0018969272496178746, 0.0009620063938200474, 0.0008029480814002454, 0.0006799057009629905, 0.0006973217241466045, 0.0007746521732769907, 0.0007463870570063591, 0.000756767694838345, 0.0021907160989940166, 0.0007537161582149565, 0.0006855188403278589, 0.0006910227239131927, 0.0012430973583832383, 0.0006830188794992864, 0.0010758133139461279, 0.0007988860015757382, 0.0010568046709522605, 0.0006149775581434369, 0.0008112635114230216, 0.0005863762926310301, 0.0006496752612292767, 0.0007143965340219438, 0.000621708866674453, 0.0007222734275273979, 0.0006475546979345381, 0.0007040559430606663, 0.0006780069670639932, 0.0007762563182041049, 0.0008505150326527655, 0.0007034520385786891, 0.0008750236011110246, 0.0009604251245036721, 0.0007147289579734206, 0.0010938758496195078, 0.0011144822929054499, 0.00565148564055562, 0.000775569467805326, 0.003946744836866856, 0.001199147431179881, 0.0007148797158151865, 0.0010557706700637937, 0.0006677369237877429, 0.0006787132006138563, 0.0007281700964085758, 0.0006656512268818915, 0.0006214455352164805, 0.0011154742678627372, 0.0007176258368417621, 0.0005829836591146886, 0.0008005091804079711, 0.0005695622530765831, 0.0009496549610048532, 0.0007123115356080234, 0.00116509641520679, 0.0007399539463222027, 0.0007720539579167962, 0.0006625243695452809, 0.0010194717906415462, 0.0005854381015524268, 0.0005687398370355368, 0.0007820805185474455, 0.001313111511990428, 0.0009038011194206774, 0.001553900889120996, 0.0008736748713999987, 0.0008800807408988476, 0.0009274437325075269, 0.000721246877219528, 0.0009374646469950676, 0.0010085366666316986, 0.0028155995532870293, 0.000775569467805326, 0.003920029848814011, 0.0014032537583261728, 0.004721716046333313, 0.0009403922013007104, 0.0010681221028789878, 0.0006690089358016849, 0.0023054268676787615, 0.0007662902353331447, 0.0012432329822331667, 0.0008957710233516991, 0.005571600049734116, 0.0006769725587219, 0.0007547109271399677, 0.001247950247488916, 0.0034280773252248764, 0.0007809592643752694, 0.0007938641356304288, 0.0006725636194460094, 0.001220481819473207, 0.0007662902353331447, 0.001023067394271493, 0.0007630635518580675, 0.005200349260121584, 0.0006769725587219, 0.0007547109271399677, 0.001057984190993011, 0.0006540078320540488, 0.0009936753194779158, 0.0008466956205666065, 0.0008802643860690296, 0.0007497303886339068, 0.0006189369596540928, 0.0008458303054794669, 0.0007675004890188575, 0.0006429933710023761, 0.0006838160916231573, 0.000775569467805326, 0.0006503768963739276, 0.0008555968524888158, 0.000730526284314692, 0.0008254199638031423, 0.0009545919601805508, 0.0007549011497758329, 0.0016601629322394729, 0.002223277697339654, 0.0009344661375507712, 0.0006571499397978187, 0.0009669150458648801, 0.0011752279242500663, 0.000702661054674536, 0.0006902572349645197, 0.0006818065885454416, 0.00228255451656878, 0.0009028268395923078, 0.0007547109271399677, 0.001106372568756342 ]

[ "In iOS 13, the Home app has received a few notable updates that will make it easier than ever to control and identify your HomeKit devices.", "\n\nThe main Home app screens are the same in iOS 13, but the control options for specific ‌HomeKit‌ devices have been revamped and streamlined. ", "Available controls vary by device, but in general, the change makes options you check or use frequently (such as various light colors) easier to access.", "\n\n\n\nWith ‌HomeKit‌ lights, for example, there's a main display with brightness controls front and center (as it was before), but now, if lights have multiple colors, you'll see a selection of favorites at the bottom rather than having to tap on the color button at the bottom. ", "Settings have also been hidden away a bit and are now accessible from the corner.", "\n\nSmall changes like these have been made for all device types, putting the information that you need at the forefront. ", "There are also several new icons for different ‌HomeKit‌ types such as water sensors, motion sensors, and air quality sensors, making it easier to identify what's what at a glance.", "\n\n\n\nCertain devices, such as the Hue Motion Sensor, will display more information in one place rather than splitting up information. ", "In iOS 12, for example, there are separate ‌HomeKit‌ entries for the motion sensing portion of the Hue sensor, the light measurement, and the temperature measurement, which is confusing and clutters up your Home app. ", "In iOS 13, these are all combined into one.", "\n\n\n\nControls for your ‌HomeKit‌ devices are also now shown in a card-style view so you can swipe them away to get back to the main Home app screen, which is an improvement over the full screen view in iOS 12.", "\n\nNotably, your AirPlay 2 devices can be used in ‌HomeKit‌ Scenes and Automations for the first time in iOS 13, a major change from what's possible in iOS 12.", "\n\n\n\nWith automations support, your ‌AirPlay‌ 2 devices like the HomePod can be set to do things like play music when you arrive home, or turn off when you leave. ", "You can also have music come on when a ‌HomeKit‌ sensor detects something like motion, or at a specific time of day.", "\n\nIn scenes, ‌HomePod‌ and other ‌AirPlay‌ 2 devices can be paired with other ‌HomeKit‌ devices, so you can do something like have your ‌HomePod‌ and lights come on all with one button press or Siri command.", "\n\n\n\nControls for speakers in Scenes and Automations include Play Audio, Pause Audio, Resume Audio, Don't Change What's Playing, Use Current Volume, and Set Custom Volume.", "\n\n\n\nThese new controls for ‌AirPlay‌ 2 devices will apply to everything from ‌HomePod‌ and Apple TV to HomeKit-enabled third-party TV sets and speakers, providing new ways to integrate audio devices into your home.", "\n\nApple also announced other HomeKit-related changes that are worth noting. ", "In-home security cameras are becoming increasingly important, but these introduce privacy concerns related to unauthorized access. ", "Apple has a solution -- a new Secure Video feature.", "\n\nSecure Video is a new ‌HomeKit‌ API that offers on-device video analysis, sending an encrypted stream to iCloud, so you can be sure that no one is spying on your in-home security cameras. ", "Companies like Logitech and Arlo plan to release cameras that use this technology.", "\n\nApple is also adding ‌HomeKit‌ support to routers from companies like Linksys, Eero, and Charter/Spectrum for the first time in iOS 13. ", "With ‌HomeKit‌ controls, users will be able to prevent accessories from accessing their entire home networks.", "\n\n\n\nAll of these ‌HomeKit‌ and Home app features will be available in iOS 13, which is limited to developers right now. ", "Apple plans to release a public beta in July, and the software will see an official launch in the fall." ]

{ "pile_set_name": "OpenWebText2" }

[ 0.0005747982067987323, 0.0005863282131031156, 0.0005695419386029243, 0.0005819762591272593, 0.0005801370716653764, 0.0005450571188703179, 0.0005508019239641726, 0.0005725883529521525, 0.0006133195711299777, 0.0005960753769613802, 0.0006716102943755686, 0.0006043812609277666, 0.0006990693509578705, 0.0006398414261639118, 0.0006882973830215633, 0.0006232490413822234, 0.0006045218324288726, 0.0005767197581008077, 0.0005674619460478425, 0.0006819167756475508, 0.0007750357035547495, 0.0006482827011495829, 0.0006393306539393961, 0.000640680780634284, 0.0005923171993345022, 0.0006092413677833974 ]

[ "Q:\n\nMultiple Comment Forms on One Page in One Template - Django\n\nI have researched this and many answers out there touch on it (formsets, prefixes, etc), but none is exactly what I'm after...\nI have an application that allows users to post cards to a board and each card can have zero or more comments. ", "I have the database relationships set up so if I manually add board, card, or comment objects I can display them in the template just fine.", "\nThe card form is also working, so this is not an issue. ", "But now I want to display a comment textarea with a click event (which I have working with jQuery). ", "The problem is, the form is not displaying the field. ", "Here is the form code:\nclass AddCommentForm(ModelForm):\n class Meta:\n model = Comment\n fields = ['message']\n\n message = forms.", "CharField(\n widget=forms.", "Textarea(\n attrs={\n 'class': 'form-control comment-input'\n 'name': 'message',\n 'placeholder': 'Comment away...'\n }\n ),\n required=False,\n )\n\nRight off the bat, there is a problem in that when Django renders a form, it uses an id. In this case, it ends up being id_message or message (depending on whether I specify in form class). ", "Of course, in HTML, this is no good. ", "I confirmed this in the shell:\n>>> import django; import project\n>>> from apps.board.forms import AddCommentForm\n>>> comment_form = AddCommentForm(); print(comment_form)\n<tr><th><label for=\"message\">Message:</label></th><td><textarea class=\"form-control comment-input\" cols=\"40\" id=\"message\" name=\"message\" placeholder=\"Comment away...\" rows=\"10\">\n</textarea></td></tr>\n\nSo I thought of using formsets but it seems not quite right, because as I understand them, they are for several forms inside one form tag. ", "My case is different, in that each card has zero or more comments and the flow of the HTML dictates that there should be several form elements.", "\nAnother challenge is that I need to have two views: one to process the cards and one to process each comment. ", "I'm currently using different action values to accomplish this and it seems to work.", "\nIt seems like my use case is not so strange, and I can think of several cases where this kind of situation would occur: Twitter replies, comments on blog posts, etc. ", "I just can't get Django to work with this.", "\nI should also note that I can manually make this work with this:\n<label>\n <textarea class=\"form-control comment-input\" name=\"message\"></textarea>\n <button type=\"submit\"></button>\n</label>\n\nUPDATE\nHere is a view segment:\nclass AddCommentView(View):\n\n model = Comment\n form_class = AddCommentForm\n template_name = 'somedir/template.html'\n\n @method_decorator(login_required)\n def get(self, request):\n\n comment_form = self.form_class()\n\n return render(request, self.template_name, {\n 'comment_form': comment_form\n })\n\nIf the form is working (from snippet above and shell test), I would expect this to show it on the page.", "\nThe URLConf is here:\nurl(r'^comment/add/$', AddCommentView.as_view(), name='add_comment_view'),\nIn writing this out, I see a confusing piece. ", "My URL for the view is /comment/add/ but I want the form to be rendered at /dashboard/. The problem is that there is another view at that URL already.", "\nIf I build the form without Django forms, then post data to /comment/add/ the comment is created and saved in the database. ", "So I guess I'm still trying to figure out how to use two views in one template with multiple forms. ", "@Daniel Roseman points out the use of prefix and I guess this is worth exploring more.", "\nUPDATE 2\nSo I got this to work using prefixes by removing the URL for that view and combining the views into one view. ", "Two forms, one view, one template. ", "But...\nThe source still shows replicate ids. ", "I ended up not putting the id in the form attribute list. ", "Since this is invalid HTML, what is best way to get around this?", "\nIn my view:\ncard_model = Card\ncomment_model = Comment\n\ncard_form_class = AddCardForm\ncomment_form_class = AddCommentForm\n. . .", "\n@method_decorator(login_required)\ndef get(self, request):\n\n card_form = self.card_form_class(prefix='card')\n comment_form = self.comment_form_class(prefix='comment')\n . . .", "\n\nUPDATE 3\nI have found a solution to this problem. ", "To instantiate the form, you need to add auto_id=False to prevent multiple, replicate ids:\ncomment_form = self.comment_form_class(prefix='comment', auto_id=False)\n\nA:\n\nWhile using the Django form prefix was partially correct (thanks @ Daniel Roseman), the assertion that it doesn't matter how many form elements I have is not quite correct. ", "It does matter, because by default the prefix was meant to be used in one form (as it creates multiple replicate ids). ", "To use it in multiple forms, you also need auto_id=False. ", "This prevents the id from being generated by the Django form.", "\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.0005710035329684615, 0.0005400859517976642, 0.0006772667984478176, 0.0005817763740196824, 0.0010438831523060799, 0.0006645923713222146, 0.0007564486586488783, 0.0007461121422238648, 0.0007505488465540111, 0.0006174357258714736, 0.0006143952487036586, 0.0005652511608786881, 0.0005658303271047771, 0.000569206546060741, 0.0007237745448946953, 0.0006277277716435492, 0.0007572153117507696, 0.0007183076813817024, 0.000615781347732991, 0.0005587317864410579, 0.0005683642812073231, 0.0006213789456523955, 0.0006639301427640021, 0.0006452460074797273, 0.0009452452650293708, 0.0006976483855396509, 0.0008637893479317427, 0.0007667796453461051, 0.0006451971712522209, 0.0006721894606016576, 0.0006273703766055405, 0.0008374605095013976, 0.0007102928939275444, 0.001995444530621171 ]

[ "// Copyright Louis Dionne 2013-2017\n// Distributed under the Boost Software License, Version 1.0.", "\n// (See accompanying file LICENSE.md or copy at http://boost.org/LICENSE_1_0.txt)\n\n#include <boost/hana/assert.hpp>\n#include <boost/hana/core/make.hpp>\n#include <boost/hana/equal.hpp>\n#include <boost/hana/integral_constant.hpp>\n#include <boost/hana/product.hpp>\n#include <boost/hana/range.hpp>\nnamespace hana = boost::hana;\n\n\nint main() {\n BOOST_HANA_CONSTANT_CHECK(hana::equal(\n hana::product<>(hana::make_range(hana::int_c<-3>, hana::int_c<-3>)),\n hana::int_c<1>\n ));\n BOOST_HANA_CONSTANT_CHECK(hana::equal(\n hana::product<>(hana::make_range(hana::int_c<-3>, hana::int_c<-2>)),\n hana::int_c<-3>\n ));\n BOOST_HANA_CONSTANT_CHECK(hana::equal(\n hana::product<>(hana::make_range(hana::int_c<-3>, hana::int_c<-1>)),\n hana::int_c<-3 * -2>\n ));\n BOOST_HANA_CONSTANT_CHECK(hana::equal(\n hana::product<>(hana::make_range(hana::int_c<-3>, hana::int_c<0>)),\n hana::int_c<-3 * -2 * -1>\n ));\n BOOST_HANA_CONSTANT_CHECK(hana::equal(\n hana::product<>(hana::make_range(hana::int_c<-3>, hana::int_c<1>)),\n hana::int_c<-3 * -2 * -1 * 0>\n ));\n BOOST_HANA_CONSTANT_CHECK(hana::equal(\n hana::product<>(hana::make_range(hana::int_c<-3>, hana::int_c<2>)),\n hana::int_c<-3 * -2 * -1 * 0 * 1>\n ));\n BOOST_HANA_CONSTANT_CHECK(hana::equal(\n hana::product<>(hana::make_range(hana::int_c<-3>, hana::int_c<3>)),\n hana::int_c<-3 * -2 * -1 * 0 * 1 * 2>\n ));\n\n BOOST_HANA_CONSTANT_CHECK(hana::equal(\n hana::product<>(hana::make_range(hana::int_c<1>, hana::int_c<1>)),\n hana::int_c<1>\n ));\n BOOST_HANA_CONSTANT_CHECK(hana::equal(\n hana::product<>(hana::make_range(hana::int_c<1>, hana::int_c<2>)),\n hana::int_c<1>\n ));\n BOOST_HANA_CONSTANT_CHECK(hana::equal(\n hana::product<>(hana::make_range(hana::int_c<1>, hana::int_c<3>)),\n hana::int_c<1 * 2>\n ));\n BOOST_HANA_CONSTANT_CHECK(hana::equal(\n hana::product<>(hana::make_range(hana::int_c<1>, hana::int_c<4>)),\n hana::int_c<1 * 2 * 3>\n ));\n BOOST_HANA_CONSTANT_CHECK(hana::equal(\n hana::product<>(hana::make_range(hana::int_c<1>, hana::int_c<5>)),\n hana::int_c<1 * 2 * 3 * 4>\n ));\n\n BOOST_HANA_CONSTANT_CHECK(hana::equal(\n hana::product<>(hana::make_range(hana::int_c<3>, hana::int_c<3>)),\n hana::int_c<1>\n ));\n BOOST_HANA_CONSTANT_CHECK(hana::equal(\n hana::product<>(hana::make_range(hana::int_c<3>, hana::int_c<4>)),\n hana::int_c<3>\n ));\n BOOST_HANA_CONSTANT_CHECK(hana::equal(\n hana::product<>(hana::make_range(hana::int_c<3>, hana::int_c<5>)),\n hana::int_c<3 * 4>\n ));\n BOOST_HANA_CONSTANT_CHECK(hana::equal(\n hana::product<>(hana::make_range(hana::int_c<3>, hana::int_c<6>)),\n hana::int_c<3 * 4 * 5>\n ));\n BOOST_HANA_CONSTANT_CHECK(hana::equal(\n hana::product<>(hana::make_range(hana::int_c<3>, hana::int_c<7>)),\n hana::int_c<3 * 4 * 5 * 6>\n ));\n}\n" ]

{ "pile_set_name": "Github" }

[ 0.0006981206242926419, 0.0006985185318626463 ]

[ "<?xml version=\"1.0\" encoding=\"utf-8\"?", ">\n<ScadaDataDictionaries>\n <Dictionary key=\"Common\">\n <Phrase key=\"InfoCaption\">Інформація</Phrase>\n <Phrase key=\"QuestionCaption\">Запитання</Phrase>\n <Phrase key=\"ErrorCaption\">Помилка</Phrase>\n <Phrase key=\"WarningCaption\">Попередження</Phrase>\n <Phrase key=\"ErrorWithColon\">Помилка:</Phrase>\n <Phrase key=\"UnhandledException\">Необроблене виключення</Phrase>\n <Phrase key=\"SaveSettingsConfirm\">Налаштування були змінені. ", "Зберегти зміни?</Phrase>\n <Phrase key=\"FileNotFound\">Не знайдений файл.</Phrase>\n <Phrase key=\"DirNotExists\">Директорія не існує.</Phrase>\n <Phrase key=\"NamedFileNotFound\">Файл {0} не знайдений.</Phrase>\n <Phrase key=\"NamedDirNotExists\">Директорія {0} не існує.</Phrase>\n <Phrase key=\"BaseDATDir\">Директорія бази конфігурації в форматі DAT</Phrase>\n <Phrase key=\"BaseDATDirNotExists\">Директорія бази конфігурації в форматі DAT не існує.</Phrase>\n <Phrase key=\"ChooseBaseDATDir\">Выберіть директорію бази конфігурації в форматі DAT</Phrase>\n <Phrase key=\"LoadAppSettingsError\">Помилка при завантаженні налаштувань програми</Phrase>\n <Phrase key=\"SaveAppSettingsError\">Помилка при збереженні налаштувань програми</Phrase>\n <Phrase key=\"LoadCommSettingsError\">Помилка при завантаженні налаштувань з'єднання з сервером</Phrase>\n <Phrase key=\"SaveCommSettingsError\">Помилка при збереженні налаштувань з'єднання з сервером</Phrase>\n <Phrase key=\"GridDataError\">Помилка при роботі з даними</Phrase>\n <Phrase key=\"IntegerRequired\">Необхідне ціле число.</Phrase>\n <Phrase key=\"IntegerRangingRequired\">Необхідне ціле число в діапазоні від {0} до {1}.</Phrase>\n <Phrase key=\"RealRequired\">Необхідне число з плаваючою комою.</Phrase>\n <Phrase key=\"NonemptyRequired\">Необхідне непусте значення.</Phrase>\n <Phrase key=\"DateTimeRequired\">Необхідні дата і година.</Phrase>\n <Phrase key=\"LineLengthLimit\">Довжина стрічки повинна бути не більше {0} символів.</Phrase>\n <Phrase key=\"NotNumber\">&quot;{0}&quot; не є числом.</Phrase>\n <Phrase key=\"LoadImageError\">Помилка при завантаженні зображення із файлу:&#13;&#10;{0}</Phrase>\n <Phrase key=\"LoadHyperlinkError\">Помилка при завантаженні гіперпосилання із файлу:&#13;&#10;{0}</Phrase>\n <Phrase key=\"IncorrectFileFormat\">Некоректний формат файлу.</Phrase>\n <Phrase key=\"NoData\">Немає даних</Phrase>\n <Phrase key=\"NoRights\">Недостатньо прав.</Phrase>\n <Phrase key=\"IncorrectXmlNodeVal\">Некоректне значення XML-вузла &quot;{0}&quot;.</Phrase>\n <Phrase key=\"IncorrectXmlAttrVal\">Некоректне значення XML-атрибуту &quot;{0}&quot;.</Phrase>\n <Phrase key=\"IncorrectXmlParamVal\">Некоректне значення параметра &quot;{0}&quot;.</Phrase>\n <Phrase key=\"XmlNodeNotFound\">XML-вузол &quot;{0}&quot; не знайдений всередині вузла &quot;{1}&quot;.</Phrase>\n <Phrase key=\"EventAck\">Так</Phrase>\n <Phrase key=\"EventNotAck\">Ні</Phrase>\n <Phrase key=\"CmdTypeTable\">Типи команд</Phrase>\n <Phrase key=\"CmdValTable\">Значення команд</Phrase>\n <Phrase key=\"CnlTypeTable\">Типи каналів</Phrase>\n <Phrase key=\"CommLineTable\">Лінії зв'язку</Phrase>\n <Phrase key=\"CtrlCnlTable\">Канали управління</Phrase>\n <Phrase key=\"EvTypeTable\">Типи подій</Phrase>\n <Phrase key=\"FormatTable\">Формати чисел</Phrase>\n <Phrase key=\"FormulaTable\">Формули</Phrase>\n <Phrase key=\"InCnlTable\">Вхідні канали</Phrase>\n <Phrase key=\"InterfaceTable\">Інтерфейс</Phrase>\n <Phrase key=\"KPTable\">КП</Phrase>\n <Phrase key=\"KPTypeTable\">Типи КП</Phrase>\n <Phrase key=\"ObjTable\">Об'єкти</Phrase>\n <Phrase key=\"ParamTable\">Величини</Phrase>\n <Phrase key=\"RightTable\">Права</Phrase>\n <Phrase key=\"RoleTable\">Ролі</Phrase>\n <Phrase key=\"UnitTable\">Розмірності</Phrase>\n <Phrase key=\"UserTable\">Користувачі</Phrase>\n <Phrase key=\"ContinuePendingSvcState\">очікує продовження</Phrase>\n <Phrase key=\"PausedSvcState\">пауза</Phrase>\n <Phrase key=\"PausePendingSvcState\">очікує паузи</Phrase>\n <Phrase key=\"RunningSvcState\">працює</Phrase>\n <Phrase key=\"StartPendingSvcState\">очікує запуску</Phrase>\n <Phrase key=\"StoppedSvcState\">зупинена</Phrase>\n <Phrase key=\"StopPendingSvcState\">очікує зупинки</Phrase>\n <Phrase key=\"NotInstalledSvcState\">не зупинена</Phrase>\n <Phrase key=\"DataSentSuccessfully\">Дані відправлені успішно.</Phrase>\n <Phrase key=\"EventSentSuccessfully\">Події відправлені успішно.</Phrase>\n <Phrase key=\"EventCheckSentSuccessfully\">Команда квітування події відправлена успішно.</Phrase>\n <Phrase key=\"CmdSentSuccessfully\">Команда відправлена успішно.</Phrase>\n </Dictionary>\n <Dictionary key=\"KeyGen\">\n <Phrase key=\"StringIsNotHex\">Стрічка не є 16-вим записом.</Phrase>\n <Phrase key=\"CompCodeWithError\">Код комп'ютера містить записи про помилку.</Phrase>\n <Phrase key=\"DecodeCompCodeError\">Помилка при розшифруванні коду комп'ютера</Phrase>\n <Phrase key=\"RetrieveKeyInfoError\">Помилка при добуванні інформації реєстраційного ключа</Phrase>\n <Phrase key=\"IncorrectKeyLength\">Некоректна довжина реєстраційного ключа.</Phrase>\n <Phrase key=\"IncorrectKeyInfo\">Некоректна інформація реєстраційного ключа.</Phrase>\n <Phrase key=\"ValidKeyStatus\">Реєстраційний ключ дійсний</Phrase>\n <Phrase key=\"ValidWithWarnKeyStatus\">Реєстраційний ключ дійсний. ", "Дата закінчення {0}</Phrase>\n <Phrase key=\"NotValidKeyStatus\">Реєстраційний ключ не дійсний</Phrase>\n <Phrase key=\"ExpiredKeyStatus\">Реєстраційний ключ закінчився {0}</Phrase>\n <Phrase key=\"EmptyKeyStatus\">Реєстраційний ключ пустий</Phrase>\n <Phrase key=\"KeyWithErrorStatus\">Реєстраційний ключ містить записи про помилку</Phrase>\n <Phrase key=\"IncorrectKeyStatus\">Реєстраційний ключ некоректний</Phrase>\n <Phrase key=\"KeyFileNotFoundError\">Файл реєстраційного ключа {0} не знайдений.</Phrase>\n <Phrase key=\"LoadCompCodeError\">Помилка при завантаженні коду комп'ютера</Phrase>\n <Phrase key=\"SaveCompCodeError\">Помилка при збереженні коду комп'ютера</Phrase>\n <Phrase key=\"LoadKeyError\">Помилка при завантаженні реєстраційного ключа</Phrase>\n <Phrase key=\"SaveKeyError\">Помилка при збереженні реєстраційного ключа</Phrase>\n <Phrase key=\"CheckRegistration\">Перевірка реєстрації &quot;{0}&quot;:</Phrase>\n <Phrase key=\"CompCodeIs\">Код комп'ютера: {0}</Phrase>\n <Phrase key=\"RegistrationFailed\">Помилка реєстрації.</Phrase>\n </Dictionary>\n <Dictionary key=\"KeyGen.", "UI\">\n <Phrase key=\"lblCompCode\">Код комп'ютера</Phrase>\n <Phrase key=\"lblCompCodeTip\">Перезапустіть службу, щоб отримати код комп'ютера.</Phrase>\n <Phrase key=\"lblRegKey\">Реєстраційний ключ</Phrase>\n <Phrase key=\"llblGetPermanentKey\">Замовити постійний ключ</Phrase>\n <Phrase key=\"llblGetTrialKey\">Отримати пробний ключ</Phrase>\n <Phrase key=\"lblKeyStatus\">Статус ключа</Phrase>\n </Dictionary>\n</ScadaDataDictionaries>\n" ]

{ "pile_set_name": "Github" }

[ 0.0006572942947968841, 0.0008421535021625459, 0.005988340359181166, 0.006514683831483126, 0.0018951443489640951 ]

[ "\"Can you recommend an eye cream?\" \"", "Has anyone tried retinol?\" \"", "WTF is an epidermis?\"", "\n\nOver the past year, I've noticed my group chats with both friends and female colleagues have started to centre on a particular topic: skincare.", "\n\nI'm clueless about creams and serums, so I've been soaking up their first-hand recommendations. ", "And when it comes to favouring first-hand reviews, I'm not alone.", "\n\nSkin influencers, or skinfluencers, have become hot property in the online space, with vloggers and Instagrammers gaining cult followings for road-testing products and sharing information, opinions and advice. ", "But not all content makers are transparent about brand sponsorships and product endorsements, and some spout information that is factually incorrect.", "\n\nSo, is it ever safe to trust online influencers about something as individual as skin? ", "And when should we seek out an expert?", "\n\nWe spoke to a dermatologist, a skin Instagrammer who uses her science degree to help her navigate the skin care world and a serious skin-thusiast about where they draw the line, and the essential tips they'd like you to know.", "\n\nFrom teen acne to busting beauty myths\n\nHannah English's fascination with face-based products stemmed from teenage acne.", "\n\n\"I was given one of the books by Paula Begoun,\" recalls the 31-year-old Melbournian.", "\n\n\"It explained that there are lots of claims [from skincare companies], but often the ingredients don't back them up. ", "That's when I started being a bit more sceptical of the science behind things.\"", "\n\nAfter obliterating her teen acne, Hannah completed a pharmaceutical science degree. ", "Today she works as a clinical researcher doing trials for new drugs.", "\n\n\"Skincare ingredients work the same as drugs, they're substances that change the way your body works,\" she points out.", "\n\n\"So, I was applying all of my knowledge from uni to my skincare and I started recording my routine on Instagram with notes … and [my profile] kind of grew from there.\"", "\n\nHannah isn't a skincare professional, but she says her \"sciencey\" posts are founded in data.", "\n\n\"I've still got university access to journal articles, so I do tend to use that or a textbook,\" she says.", "\n\n\"There is some precision in the language, but generally I try to think about it like I'm speaking to my younger self or one of my girlfriends.\"", "\n\nWhere do you take your skincare advice from: experts, online influencers or friends? ( ", "Unsplash: Chris Knight )\n\nAnd through her Instagram presence, she's trying to bust some beauty myths, like the notion that \"natural is better\".", "\n\n\"It's a logical fallacy — uranium is natural,\" she says.", "\n\n\"I guess people are afraid of what they don't know, and they think that if something comes from a plant or is minimally processed that means it's healthier, but often, we can refine a plant extract through chemistry and only pull out the most effective parts.", "\n\n\"Resveratrol, for example, is a strong antioxidant that comes from grapes, but if you just put a grape [in a product] it's not going to do anything. ", "If you pull out the molecule that's doing all the work, you'll create a more effective product.\"", "\n\nHannah believes that the cost and accessibility (or lack thereof) of visiting a dermatologist deters people from making appointments, especially when it comes to cosmetic concerns. ", "But she says there can be downsides to only accessing info online.", "\n\n\"If you can google something and find the answer — great. ", "I think a lot of people don't necessarily know how to discern the information, though,\" she says.", "\n\nWhile some skinfluencers are informed, others are less than concerned with the accuracy or ethicality of their content.", "\n\n\"I do see a lot of people repeating misinformation,\" Hannah says.", "\n\n\"I try and politely comment, but people don't like being told [they're wrong] either.", "\n\n\"So, I just try and focus that energy on fact-checking what I do.\"", "\n\nWhile Hannah often helps followers answer skincare queries, she recommends that people visit a dermatologist for medical skin problems, questions about prescription products, such as higher-dose retinoids, or if they're looking to transform their skincare regime.", "\n\nSeeking out the science\n\nChantelle Peterson says she consumes skincare videos for pleasure and education. ( ", "Supplied: Chantelle Peterson )\n\nLike Hannah, medical scientist Chantelle Peterson sought out professional help in her teens to combat acne. ", "Today though, she prefers to get her skincare knowledge from YouTube.", "\n\n\"It's enabled me to be in control of that research, rather than someone in a store telling me.\"", "\n\nChantelle says transparency is a key factor in why she follows certain skinfluencers.", "\n\n\"There are times when they say, 'This product is not necessarily worth your money, you can find things that do the same thing but for less'.\"", "\n\nUnderstanding the application of ingredients is another drawcard.", "\n\n\"[Through watching skincare vloggers] I've learned about things that enhance your skin, like Vitamin C for extra sun protection, that there are different types of retinoids, and why some products should have certain ingredients to help repair and retain the skin barrier.\"", "\n\nOf course, having studied medical science at university, Chantelle has a much stronger grasp of technical-sounding skincare terms than the average Australian. ", "And while she doesn't necessarily follow influencers with dermatology credentials, she does look for content makers with a clear understanding of the science.", "\n\nLike a group chat filled with tips from trusted friends, Chantelle says first-hand anecdotes from skinfluencers are the reason their content resonates.", "\n\n\"They'll just talk about their experiences and the rest is really up to the [viewer], which I really like and appreciate,\" she says.", "\n\n\"Yes, textbooks and a doctor might tell you information, but hearing, 'This is my experience of [a product]' is truly valuable.\"", "\n\nABC Life in your inbox Get our newsletter for the best of ABC Life each week Your information is handled in accordance with the ABC Privacy Collection Statement Email address Subscribe\n\nRemember, there are things you need a dermatologist for\n\nSydney-based dermatologist Dr Nina Wines says it can be risky to trust what we read, or hear, online.", "\n\n\"Beauty bloggers aren't bound by the legalities of evidence-based medicine,\" she points out.", "\n\n\"They often can say things that are not necessarily accurate because they don't have the medical knowledge to know what they're saying is wrong. ", "Whereas, as doctors, we're bound by ethics and law to ensure that what we say is accurate.", "\n\n\"But, like everything, some [bloggers] are a little bit more educated than others.\"", "\n\nDr Wines explains that everyone's skin is different — another reason why product reviews can't be treated as gospel.", "\n\n\"Everyone's skin is as unique as them, we all have unique genetics, environmental exposure and sun damage,\" she says.", "\n\n\"That's why everything needs to be individualised to the specific person.\"", "\n\nFor example, Dr Wines says Vitamin-A-rich retinoids — adored by anti-ageing experts and skinfluencers alike — can damage skin if used incorrectly.", "\n\n\"Effectively, retinoids cause a slight peel effect to the skin and if over-applied they can cause irritation,\" she notes.", "\n\n\"Irritation in a white-skinned person causes redness, but irritation in a darker or olive-skinned person can actually leave pigmentation. ", "So, it really needs to be prescribed well.\"", "\n\nDr Wines says dermatology is a broad speciality, that enables her to assist clients with hair, nail and skin issues, offer anti-ageing advice and cosmetic procedures, and remove cancerous growths\n\n\"To become a dermatologist in Australia can take around 13 years,\" she says.", "\n\n\"We're trained to not only look for skin cancers and melanomas, and treat medical skin problems, such as acne, rosacea, lupus … if you have internal problems like nutritional deficiencies or internal issues going on that can present in the skin.", "\n\n\"For instance, one day a lady of mine had a nodule around her belly button and I knew she had stomach cancer.\"", "\n\nDr Wines' skincare tips:\n\nBeautiful skin requires a holistic approach: wear sunscreen, use products that are appropriate for your skin type, sleep well, eat well and don't smoke.", "\n\nBeautiful skin requires a holistic approach: wear sunscreen, use products that are appropriate for your skin type, sleep well, eat well and don't smoke. ", "Laser treatment can improve skin health at any age, but it's a complex process. ", "Make sure your practitioner is highly experienced and that they're using the right equipment. ", "For more advice on skin laser treatments, check out this government fact sheet.", "\n\nLaser treatment can improve skin health at any age, but it's a complex process. ", "Make sure your practitioner is highly experienced and that they're using the right equipment. ", "For more advice on skin laser treatments, check out this government fact sheet. ", "Don't believe everything you see: for example, there's no evidence that edible collagen bars actually benefit your skin.", "\n\nThis is general information only. ", "For detailed personal advice, you should see a qualified medical practitioner who knows your medical history." ]

{ "pile_set_name": "OpenWebText2" }

[ 0.0011774353915825486, 0.0009951749816536903, 0.8044280409812927, 0.0005358977359719574, 0.0005581869627349079, 0.0007166420691646636, 0.0008112267823889852, 0.0009012780501507223, 0.000715982576366514, 0.0007755300030112267, 0.000749653612729162, 0.025398680940270424, 0.0009280740632675588, 0.0005549507332034409, 0.000640104291960597, 0.04173201322555542, 0.0006055909907445312, 0.0007146934513002634, 0.0006039073341526091, 0.0006905240006744862, 0.000594405981246382, 0.0005571823567152023, 0.0006694679032079875, 0.0010804483899846673, 0.0010668071918189526, 0.0005960083217360079, 0.0006602354114875197, 0.0006037738057784736, 0.0007970242295414209, 0.0006330943433567882, 0.0006869536591693759, 0.000601927109528333, 0.0006879786378704011, 0.0007269740453921258, 0.0007167690200731158, 0.000601785781327635, 0.000661238853354007, 0.0007116191554814577, 0.006024132948368788, 0.0009904488688334823, 0.0005870238528586924, 0.0007563982508145273, 0.0007821128820069134, 0.0005786468391306698, 0.0006117139128036797, 0.0006355933146551251, 0.0005546987522393465, 0.0007246834575198591, 0.000529449200257659, 0.0005267754895612597, 0.0006174689624458551, 0.0007501624058932066, 0.0007104936521500349, 0.0006207139231264591, 0.0006767025915905833, 0.0006254420732147992, 0.000735475798137486, 0.000589778006542474, 0.0010807645739987493, 0.0006454326794482768, 0.0011175867402926087, 0.0005515954690054059, 0.0009791748598217964, 0.004317304585129023, 0.49769124388694763, 0.019091755151748657, 0.008410324342548847, 0.0007825993234291673, 0.0006184133235365152, 0.0005742038483731449, 0.0007825993234291673, 0.0006184133235365152, 0.0005742038483731449, 0.01725849322974682, 0.000633502088021487, 0.000592590484302491 ]

[ "Binance Lists Tezos (XTZ)\n\nFellow Binancians,\n\nBinance will list Tezos (XTZ) and open trading for XTZ/BNB, XTZ/BTC and XTZ/USDT trading pairs at 2019/09/24 11:00 AM (UTC). ", "Users can now start depositing XTZ in preparation for trading.", "\n\nXTZ Listing Fee: 0 BNB.", "\n\nDetails:\n\nRisk warning: Cryptocurrency investment is subject to high market risk. ", "Please make your investments cautiously. ", "Binance will make best efforts to choose high quality coins, but will not be responsible for your investment losses.", "\n\nThanks for your support!", "\n\nBinance Team\n\n2019/09/23\n\nFind us on\n\nTelegram: https://t.me/binanceexchange\n\nTwitter: https://twitter.com/binance\n\nFacebook: https://www.facebook.com/binance\n\nInstagram: https://www.instagram.com/binance" ]

{ "pile_set_name": "OpenWebText2" }

[ 0.0006396439275704324, 0.0006146965897642076, 0.0009292357135564089, 0.0007843882776796818, 0.0006533564883284271, 0.0005499730468727648, 0.0005628010840155184, 0.0006536239525303245 ]

[ "On the autocorrelation functions of right cylindrical particles.", "\nThe autocorrelation function of a finite particle with the shape of a right cylinder is determined by the autocorrelation function of the particle right section, whatever the latter's shape, and by the cylinder height. ", "In fact, the first function is an integral transform of the second with a simple kernel depending on the cylinder height. ", "This integral relation is solved to determine the autocorrelation function of the particle section in terms of the autocorrelation function of the full particle." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.0006286887219175696, 0.0006209473358467221, 0.0006019658758305013, 0.0006130055407993495 ]

[ "In typical fashion for an offensive lineman, Charles Leno’s big media moment was overshadowed by … just about everything Wednesday at Halas Hall.", "\n\nThe Bears’ starting left tackle signed a four-year, $38 million contract with $21.5 million guaranteed. ", "Leno made it to the interview podium adjacent to the practice fields. ", "But the Mike Glennon-Mitch Trubisky quarterback story dominated the day. ", "No surprise that Charles Leno’s deal was the 16th question asked of John Fox after practice Wednesday.", "\n\nIf Peyton Manning, visiting his former coach John Fox on Wednesday, had talked to the media, the Leno story would have been bumped down one more notch. ", "In fact, on our very own web site, Manning’s brief conversation with Trubisky was one of four Bears stories ahead of Leno’s new contract. ", "We know what people want to read.", "\n\nTiming is everything, of course. ", "When Willie Young signed a contract extension early in training camp last year, even general manager Ryan Pace made a rare media appearance to celebrate the moment. ", "That wasn’t going to happen on Wednesday, as Pace would have been bombarded with Glennon-Trubisky questions he no doubt feels it’s too early to answer.", "\n\nInstead, insight into the Leno deal was left in the incapable hands of Fox, who is almost as uncomfortable addressing good news as he is bad news. ", "With Leno — an inconsistent player in his two seasons as a starter — getting the deal prior to a contract year, the key question for Pace is: “What did the Bears see in Leno in training camp and two preseason games that told them he would be more consistently effective? ", "Fox was no help.", "\n\n“I think we all have to answer that question,” he said. “", "But at the end of the day, he’s a guy we felt good about. ", "We think we’re better with him obviously than without him. ", "And we have the [cap] space available. ", "Left tackle is a pretty critical position. ", "We all have to improve.”", "\n\nThat’s not quite the ringing endorsement you’d expect after that deal, but it does put Leno’s new contract in the proper perspective. ", "Despite Fox’s claim that “he earned every penny of it,” Leno has to be better and more consistent than he’s been to truly be worth it. ", "As much as the Bears like him, Leno generally is rated as average at best among NFL offensive tackles. ", "For what it’s worth, he ranked 44th by Pro Football Focus last season.", "\n\n“[It’s] a testament to me,” Leno said when asked about the journey from seventh-round draft pick to $21.5 million guaranteed. “", "I never was handed anything in my life. ", "I worked for everything I got. ", "And I’m going to continue to work. ", "Never going to step. ", "Just take things day-by-day, step-by-step and always continue to get better and good things will happen to you.”", "\n\nLeno’s extension isn’t mystifying. ", "He’s a starting left tackle on a team that had a 1,300-yard rusher and ranked eighth in the NFL in sacks allowed per pass play. ", "He turns 26 in October. ", "He was the only Bears offensive player to played in every snap last season — 1,011 of 1,011. ", "He’s a former seventh-round draft pick who was better in his second season as a starter than he was in his first.", "\n\nThe question is whether he’ll be better in his third season than he was in his second. ", "Leno is still the fourth or fifth best starter on the Bears’ offensive line. ", "It helps to be elite at left tackle, but you can win with Charles Leno — as long as he gets better this season and not worse.", "\n\nFollow me on Twitter @MarkPotash\n\nEmail: mpotash@suntimes.com" ]

{ "pile_set_name": "OpenWebText2" }

[ 0.0007767173810862005, 0.0009028293425217271, 0.0006743234698660672, 0.0010872331913560629, 0.0007563044782727957, 0.0006037580315023661, 0.0011838418431580067, 0.0006123398197814822, 0.0006760155083611608, 0.0005486211739480495, 0.000813295308034867, 0.0020138025283813477, 0.0008424869156442583, 0.005424423608928919, 0.000622717896476388, 0.0005765073583461344, 0.0006238814094103873, 0.000589801580645144, 0.0006310897879302502, 0.0006893586250953376, 0.0007728260825388134, 0.0015249773859977722, 0.001056147855706513, 0.0005567409098148346, 0.0007385925273410976, 0.001029142877086997, 0.000637384073343128, 0.0008306369418278337, 0.002835947321727872, 0.03537055104970932, 0.0016563932877033949, 0.010258615016937256, 0.001351318322122097, 0.0018469564383849502, 0.0011209869990125299, 0.0008780683274380863, 0.001132642850279808, 0.0008238134323619306, 0.0008305145893245935 ]

[ "great for Motor Coachby Norma from Livermore, California on March 05, 2013\n\nWe actually bought these for the motor coach to use at the auxillary seating for young teens to have for their drinks while either traveling or just chillin Love the fact that you can disengage the cup holder from the wall mounted base for easy cleaning. ", "Thinking of buying more for gifts for other family coach owners." ]

{ "pile_set_name": "Pile-CC" }

[ 0.0005978824920020998, 0.0006695638876408339 ]

[ "Introduction\n============\n\nTumor metastasis significantly affects the prognosis of patients with gastric cancer, and is the primary cause of treatment failure ([@b1-or-40-03-1287]). ", "Mechanisms of tumor metastasis are complex and the tumor microenvironment, enriched in cytokines, growth factors and tumor cell-derived vesicles, is key in its pathophysiology. ", "Receptor activator of nuclear factor-κB ligand (RANKL), an important cytokine belonging to the tumor necrosis factor (TNF) family, promotes osteoclast maturation and migration. ", "In addition to being secreted by osteoclast cells, previous studies have revealed that RANKL is secreted by infiltrating T cells; whereas RANK is expressed on the surface of various cancer cells, including breast, renal and lung cancer cells ([@b2-or-40-03-1287]--[@b6-or-40-03-1287]). ", "According to our previous study, RANK is also expressed in gastric cancer cells ([@b7-or-40-03-1287]), and infiltrating T cells have been found to be abundant in gastric cancer tissues ([@b8-or-40-03-1287],[@b9-or-40-03-1287]). ", "Collectively, these studies indicate that RANKL may also promote gastric cancer cell migration, although there is no supporting data at present.", "\n\nLipid rafts, comprised of assemblies of cholesterol, sphingolipids and certain types of proteins, form sorting platforms for targeted proteins ([@b10-or-40-03-1287]) and are essential in a variety of signaling processes, including cell migration, through the regulation of proteins located in the cell membrane ([@b11-or-40-03-1287],[@b12-or-40-03-1287]). ", "Lipid rafts are reported to be able to control human melanoma cell migration by regulating focal adhesion disassembly ([@b13-or-40-03-1287]), and promote breast cancer cell migration by restricting interactions between CD44 and ezrin ([@b14-or-40-03-1287]). ", "A previous study showed lipid rafts to be critical for RANK functions in osteoclasts ([@b15-or-40-03-1287]). ", "Based on this, it was hypothesized that lipid rafts may be involved in RANKL-induced cancer cell migration.", "\n\nCaveolin-1 (Cav-1), a pivotal component of lipid rafts, is a membrane-bound scaffolding protein that regulates signal transduction ([@b16-or-40-03-1287]). ", "The role of Cav-1 in cancer remains controversial; it can regulate a number of metastatic cancer cells, either negatively or positively. ", "Cav-1 reportedly inhibits cell migration and invasion via the suppression of epithelial-mesenchymal transition in pancreatic cancer cells ([@b17-or-40-03-1287]), and has been shown to reduce the metastatic capacity of colon cancer cells ([@b18-or-40-03-1287]). ", "By contrast, the expression of Cav-1 appears to be increased in prostate tumors, lung cancer, melanoma cells and renal cell carcinoma ([@b18-or-40-03-1287]--[@b21-or-40-03-1287]), thereby favoring tumor progression and migration ([@b22-or-40-03-1287]). ", "RANKL induces the expression of Cav-1, which is immediately conveyed to lipid rafts to promote osteoclastogenesis ([@b23-or-40-03-1287]).", "\n\nAs there has been no previous study reporting the effect of Cav-1 on RANKL-induced cell migration, the present study aimed to identify the potential roles and mechanisms of RANKL/RANK in gastric cancer cell migration and metastasis. ", "The results indicated that the proto-oncogene tyrosine-protein kinase Src (c-Src)/Cav-1 pathway and lipid raft aggregation may be the primary mechanisms involved in RANKL-induced gastric cancer cell migration.", "\n\nMaterials and methods\n=====================\n\n### Cell culture\n\nThe MGC803, BGC823 and SGC7901 (gastric cancer), H460 (lung cancer), ACHN (renal cancer) and MDA-MB-231 (breast cancer) cells were purchased from the Culture Collection of the Chinese Academy of Sciences (Shanghai, China). ", "MGC803, BGC823 and SGC7901, H460 and ACHN cells were cultured in Roswell Park Memorial Institute (RPMI)-1640 medium (Thermo Fisher Scientific, Inc., Waltham, MA, USA). ", "MDA-MB-231 cells were cultured in L15 medium (Gibco; Thermo Fisher Scientific, Inc.) RPMI-1640 and L15 media were supplemented with 10% fetal bovine serum (FBS), penicillin (100 U/ml) and streptomycin (100 mg/ml) in an atmosphere of 95% air and 5% CO~2~ at 37°C.", "\n\n### Cell treatment\n\nWe added sRANKL (PeproTech, Inc., Rocky Hill, NJ, USA) to cancer cells to final concentration of 10 µg/ml for 0, 5, 10, 30 or 60 min. ", "We added 10 µM PP2 (Sigma-Aldrich St. Louis, MO, USA) or Nystatin (50 µg/ml; cat. ", "no. ", "N3503; Sigma-Aldrich; Merck KGaA, Darmstadt, Germany and/or its affiliates) 1 h prior to sRANKL. ", "To detect the lipid raft aggregation, we used CTXB (1 mg/ml; cat. ", "no. ", "SAE0069-500UG; Sigma-Aldrich; Merck KGaA).", "\n\n### Western blot analysis\n\nWestern blot analysis was performed as previously described ([@b24-or-40-03-1287]). ", "The following antibodies were used: Anti-phospho-Scr (1:250; rabbit monoclonal; cat. ", "no. ", "6943S; Cell Signaling Technology, Danvers, MA, USA), anti-Scr (1:1,000; mouse monoclonal; cat. ", "no. ", "2110s; Cell Signaling Technology), anti-phospho-Cav-1 (1:250; rabbit polyclonal; cat. ", "no. ", "3251s; Cell Signaling Technology), anti-Cav-1 (1:1,000; rabbit polyclonal; cat. ", "no. ", "sc-894; Santa Cruz Biotechnology, Inc., Santa Cruz, CA, USA), anti-phospho-Akt (1:500; rabbit polyclonal; cat. ", "no. ", "9271L; Cell Signaling Technology), anti-Akt (1:1,000; rabbit polyclonal; cat. ", "no. ", "9272S; Cell Signaling Technology), anti-phospho-ERK1/2 (1:500; rabbit polyclonal; cat. ", "no. ", "sc-16982; Santa Cruz Biotechnology), anti-ERK1/2 (1:1,000; rabbit polyclonal; cat. ", "no. ", "9102S; Santa Cruz Biotechnology), anti-RANK (1:500; rabbit polyclonal; cat. ", "no. ", "A303-897A; Bethyl Laboratories, Inc., Montgomery, TX, USA), anti-β-actin (1:1,000; rabbit polyclonal; cat. ", "no. ", "sc-1616-R; Santa Cruz Biotechnology), followed by incubation with appropriate secondary antibodies. ", "Secondary goat anti-rabbit (1:1,000) and goat anti-mouse antibodies were purchased from Santa Cruz Biotechnology, Inc.\n\n### Transwell assay\n\nThe cells were pretreated with appropriate solvent control (dimethyl sulfoxide) or various concentrations of inhibitors (PP2: 10 µM; Nystatin: 50 µg/ml) for 60 min in serum-free media. ", "The treated cells were plated in the upper insert of a 24-well chemotaxis chamber (2×10^4^ cells/well; 8-µm pore size; Corning Inc., Corning, NY, USA) in serum-free medium. ", "Medium containing 2.5% serum (0.5 ml) and recombinant RANKL (1 µ1), with DMSO or inhibitors, was added to the bottom well and incubated for 24 h. The porous inserts were carefully removed, and the cells was stained and counted at ×200 magnification (Olympus Corp., Tokyo, Japan) in at least five different fields of each filter.", "\n\n### Fluorescence microscopy\n\nThe MGC803 cells were first treated with PP2 or nystatin for 1 h, and then RANKL was added at a final concentration of 1 µg/ml for 10 min. ", "The cells were fixed in 4.4% paraformaldehyde for 20 min, permeabilized with 0.2% Triton X-100 for 15 min, and then blocked with 5% bovine serum albumin (BSA; Sigma-Aldrich, Merck KGaA) for 1 h. The slides were incubated with CTXB antibody or anti-RANK antibody for 1 h and then with FITC-conjugated goat anti-mouse or anti-rabbit IgG were added for 1 h. Images were captured with a fluorescence microscope (Olympus Corp.).", "\n\n### Surface RANK expression analysis\n\nSurface RANK expression was determined by flow cytometry as previously described ([@b24-or-40-03-1287]). ", "The following antibodies were used: Mouse anti-RANK (1:500; mouse monoclonal; cat. ", "no. ", "MAB683; R&D Systems, Minneapolis, MN, USA) or isotype control (R&D Systems), FITC-conjugated anti-mouse secondary antibody (1:200; mouse monoclonal; cat. ", "no. ", "sc-2356; Santa Cruz Biotechnology).", "\n\n### Transfection with small interfering (si)RNA\n\nThe cells were cultivated at a density of 2×10^5^/well in 6-well plates. ", "After 24 h, the cells were transfected with siRNA using Lipofectamine™ 2000 reagent (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer\\'s protocol. ", "The CAV-1 siRNAs were designed to target the sequence 5′-AACCAGAAGGGACACACAGTT-3′. The cells were treated with or without RANKL at 48 h post-transfection. ", "The gene silencing effect was evaluated by western blot analysis.", "\n\n### Patients and tissue samples\n\nSpecimens of gastric adenocarcinoma tissue were collected from 228 patients who underwent surgical resection at the First Hospital of China Medical University (Shenyang, China) from March 2006 to October 2011. ", "None of the patients had received operative radiotherapy, chemotherapy or immunotherapy previously. ", "Age, sex, pathological tumor-node-metastasis (pTNM) stage and Lauren grade were evaluated following medical charts and pathological records. ", "The pTNM stage was examined according to the seventh edition of the AJCC Cancer Staging Manual ([@b25-or-40-03-1287]). ", "The Lauren grade was assigned according to the classification of the World Health Organization. ", "The First Hospital of China Medical University Ethical Committee approved the study, and no consent was required due to the retrospective nature of the study.", "\n\n### Immunohistochemistry\n\nFormalin-fixed paraffin-embedded tumor specimens were collected from the Department of Pathology at the First Hospital of China Medical University. ", "The immunohistochemical staining observed with Olympus microscope (Olympus Corp.) was performed using the biotinstreptavidin method (UltraSensitive S-P kit; MaixinBio, Shanghai, China) as previously described ([@b26-or-40-03-1287]). ", "Two observers, who had no prior information of the clinical or pathological parameters, performed the evaluation of results independently. ", "The immunoreactivity was scored based on the intensity of staining (negative, 0; weak, 1; moderate, 2; strong, 3).", "\n\n### Statistical analysis\n\nThe experimental data are summarized and presented as the mean ± standard deviation. ", "The significance of differences was analyzed statistically using Student\\'s two-tailed t-test, P\\<0.05 was considered to indicate a statistically significant difference. ", "Each experiment was repeated at least three times. ", "Statistical analyses were performed using the SPSS statistical package software (SPSS for Windows, version 20.0; IBM Corp., Armonk, NY, USA).", "\n\nResults\n=======\n\n### RANKL induces the migration of gastric cancer cells via phosphoinositide 3-kinase (PI3K)/Akt and ERK pathways\n\nThe western blot analysis revealed the expression of RANK in MGC803, BGC823 and SGC7901 cell lines. ", "Stimulation of the MGC803 and SGC7901 cells with 1.0 µg/ml RANKL significantly increased cell migration by 63.8 and 56.3%, respectively ([Fig. ", "1B](#f1-or-40-03-1287){ref-type=\"fig\"}). ", "As RANKL had no effect on the proliferation of MGC803 or SGC7901 cells (data not shown), the increased number of MGC803 and SGC7901 cells traversing the filter may have resulted from increased migratory abilities. ", "The downstream signaling of RANKL/RANK was also examined in BGC803 cells; Akt and ERK were markedly increased in response to RANKL treatment ([Fig. ", "1C](#f1-or-40-03-1287){ref-type=\"fig\"}). ", "Therefore, the RANKL/RANK pathway appeared to be significantly involved in the migration of gastric cancer cells.", "\n\n### Lipid rafts are involved in RANKL-induced migration\n\nLipid rafts represent a major platform for signaling regulation in cancer. ", "To examine the involvement of lipid rafts in RANKL-induced gastric cancer cell migration, the MGC803 cells were pretreated with nystatin, a lipid raft inhibitor, for 1 h, followed by RANKL treatment for 10 min. ", "The immunofluorescence indicated that RANKL significantly induced lipid raft aggregation, which was reversed by nystatin ([Fig. ", "2A](#f2-or-40-03-1287){ref-type=\"fig\"}). ", "Downstream signals, including the activation of Akt, were also markedly promoted by RANKL, but were decreased by pretreatment with nystatin ([Fig. ", "2B](#f2-or-40-03-1287){ref-type=\"fig\"}). ", "Nystatin also decreased RANKL-induced gastric cancer cell migration from 168.8 to 75.6% ([Fig. ", "2C](#f2-or-40-03-1287){ref-type=\"fig\"}). ", "These results suggested that the aggregation of lipid rafts was associated with RANKL-induced gastric cancer cell migration.", "\n\n### Cav-1 promotes the migration of RANKL-induced gastric cancer cells via interactions with RANK\n\nTo investigate the effect of Cav-1 on gastric cancer cell migration, the activation of Cav-1 was examined. ", "The results showed that RANKL not only activated Cav-1 in a time-dependent manner ([Fig. ", "3A](#f3-or-40-03-1287){ref-type=\"fig\"}), but also triggered an interaction between RANK and Cav-1 ([Fig. ", "3B](#f3-or-40-03-1287){ref-type=\"fig\"}). ", "The knockdown of Cav-1 by siRNA suppressed RANKL-induced lipid raft aggregation, accompanied by a decrease in the activation of Akt and ERK in MGC803 cells ([Fig. ", "3C and D](#f3-or-40-03-1287){ref-type=\"fig\"}). ", "Cav-1 knockdown also significantly reduced RANKL-induced gastric cancer cell migration from 176.2 to 18.5% ([Fig. ", "3E](#f3-or-40-03-1287){ref-type=\"fig\"}). ", "These results suggested that Cav-1 promoted RANKL-induced gastric cancer cell migration via interactions with RANK.", "\n\n### RANKL induces the activity of caveolin-1 via c-Src\n\nTo characterize the downstream mechanisms occurring due to the activation of Cav-1, the cells were incubated with RANKL over different periods of time and examined for the activation of c-Src. ", "As shown in [Fig. ", "4A](#f4-or-40-03-1287){ref-type=\"fig\"}, c-Src was rapidly activated and reached a peak at 10 min. ", "The c-Src inhibitor PP2 inhibited the activation of Cav-1 and Akt/ERK ([Fig. ", "4A](#f4-or-40-03-1287){ref-type=\"fig\"}). ", "The immunofluorescence and Transwell experiments revealed that PP2 significantly suppressed lipid raft aggregation and RANKL-induced migration ([Fig. ", "4B and C](#f4-or-40-03-1287){ref-type=\"fig\"}). ", "Collectively, these results suggested that the c-Src-mediated activation of Cav-1 promoted RANKL-induced gastric cancer cell migration.", "\n\n### RANKL-induced migration is suppressed by Cav-1 knockdown\n\nThe expression of RANK was examined in a variety of cancer cells by flow cytometry. ", "The results showed that H460 (lung cancer), ACHN (renal cancer) and MDA-MB-231 (breast cancer) cells expressed RANK on their surface ([Fig. ", "5A](#f5-or-40-03-1287){ref-type=\"fig\"}). ", "The knockdown of Cav-1 by siRNA significantly suppressed RANKL-induced migration of the cancer cells ([Fig. ", "5B and C](#f5-or-40-03-1287){ref-type=\"fig\"}).", "\n\n### Cav-1 is independently a poor predictive factor for the overall survival rate of patients with gastric cancer\n\nTo examine the association between RANK and Cav-1, 228 histologically confirmed gastric cancer samples were selected for investigation. ", "The follow-up time ranged between 3 and 83 months, with a mean follow-up time of 38 months. ", "The immunostaining confirmed that Cav-1 was expressed in 56.5% of patients ([Table I](#tI-or-40-03-1287){ref-type=\"table\"}), whereas 47.4% were positive for RANK. ", "The correlation between the expression of RANK or Cav-1 and patient characteristics is shown in [Table I](#tI-or-40-03-1287){ref-type=\"table\"}. ", "The expression of RANK, observed in 58.3% of the diffuse patients, was correlated with Lauren classification. ", "The prognostic value of Cav-1 in patients with RANK-positive cells was also analyzed. ", "Within this population, a higher expression of Cav-1 was correlated with poor survival rate (P=0.025), as the mean overall survival rate of patients was 45 months in the Cav-1-positive arm, compared with 64 months in the Cav-1-negative arm ([Fig. ", "6](#f6-or-40-03-1287){ref-type=\"fig\"}). ", "In patients with RANK-positive cells, univariate analysis revealed that the positive expression of Cav-1, T stage, N stage and pTNM stage indicated poor prognosis. ", "The multivariate analysis indicated that Cav-1, T stage and N stage were independent predictors for patients with RANK-positive cells ([Table II](#tII-or-40-03-1287){ref-type=\"table\"}). ", "These results demonstrated that the expression of Cav-1 was predictive of poor prognosis in patients with RANK-positive gastric cancer cells.", "\n\nDiscussion\n==========\n\nThe RANKL/RANK pathway is a classical pathway for osteoclast maturation and activation, whereby RANKL interacts with RANK to recruit TNF-receptor associated factor, resulting in the activation of nuclear factor-FB, c-Jun N-terminal kinase, p38, ERK and Akt ([@b27-or-40-03-1287]--[@b29-or-40-03-1287]). ", "In breast, lung and prostate cancer cells, the inhibition of PI3K and mitogen-activated protein kinase kinase 1/2 can reduce RANKL-induced migration ([@b30-or-40-03-1287]--[@b32-or-40-03-1287]). ", "According to the results of the present study, RANK was expressed in gastric cancer cells. ", "Furthermore, RANKL significantly increased the migration ability of gastric cancer cells, accompanied by the activation of Akt and ERK. ", "As gastric cancer tissues are enriched in infiltrating T cells capable of secreting RANKL, RANKL-induced migration may represent a pivotal mechanism for gastric cancer metastasis. ", "Drugs, including denosumab, which target the RANKL/RANK pathway, likely inhibit this process and can be potentially used as novel therapeutic intervention for treating metastatic gastric cancer.", "\n\nPrevious studies have provided evidence in support of the involvement of lipid rafts in cancer cell invasion and metastasis ([@b33-or-40-03-1287]--[@b35-or-40-03-1287]). ", "Yamaguchi *et al* reported the requirement of lipid rafts for invadopodia formation and extracellular matrix degradation in human breast cancer cells ([@b36-or-40-03-1287]). ", "Chinni *et al* showed that C-X-C motif chemokine ligand 12/C-X-C chemokine receptor type 4 transactivates human epidermal growth factor receptor 2 in lipid rafts to promote prostate cancer cell migration ([@b37-or-40-03-1287]). ", "In the present study, the finding that RANKL triggered lipid raft aggregation, which was reversed by nystatin, and reduced RANKL-induced migration in gastric cancer cells indicated the importance of lipid rafts in gastric cancer cell migration. ", "Lipid rafts are known to be regulated by other important factors, including Cav-1. ", "Cav-1 can also result in further clustering of lipid rafts mediated by the activation of several downstream signaling pathways ([@b36-or-40-03-1287],[@b38-or-40-03-1287]). ", "In the present study, Cav-1 was shown to be involved in RANKL-induced lipid raft aggregation and cell migration. ", "It was confirmed that certain RANK-expressing gastric cancer cells also express Cav-1, which was significantly correlated with the poor prognosis in individuals with RANK-positive cells. ", "Univariate and multivariate analyses demonstrated that the expression of Cav-1 was an independent predictor of poor overall survival rate in these patients. ", "Furthermore, the involvement of Cav-1 in RANKL-induced cell migration was confirmed in several cancer cell lines. ", "These findings indicated that Cav-1 is essential not only for appropriate RANK-localization within the lipid raft, but also for RANKL-induced lipid raft aggregation and cancer cell migration.", "\n\nAlthough the data obtained in the present study revealed that Cav-1 was rapidly activated by RANKL, the question regarding the key mediator remains unanswered. ", "The tyrosine protein kinase c-Src is known to be involved in the regulation of cellular metabolism, survival and proliferation. ", "In cancer cells, the activation of c-Src results in increased tumor progression, invasion and metastasis ([@b39-or-40-03-1287]--[@b42-or-40-03-1287]). ", "Furthermore, RANKL has shown potential in activating c-Src in breast cancer cells ([@b30-or-40-03-1287]). ", "Previous reports have suggested that the interaction between Cav-1 and Rho-GTPases promotes metastasis by controlling the activation of c-Src, Ras and Erk ([@b43-or-40-03-1287]). ", "In the present study, the activation of Cav-1 accompanied that of c-Src. ", "In addition, the activation of Cav-1, lipid raft aggregation and cell migration were almost completely reversed by the PP2-mediated inhibition of c-Src function, which is an important regulator in several signaling pathways ([@b44-or-40-03-1287]). ", "These results suggested that the c-Src-mediated activation of Cav-1 promoted RANKL-induced gastric cancer cell migration.", "\n\nIn conclusion, RANKL-induced gastric cancer cell migration is at least partially dependent on lipid rafts and its main component, Cav-1, and is promoted by the activation of c-Src and Cav-1. ", "These findings demonstrate a detailed mechanism underlying the effect of RANK on gastric cancer cell migration. ", "This may shed light on the potential drug targets for novel treatment of metastatic gastric cancer.", "\n\nNot applicable.", "\n\nFunding\n=======\n\nThe present study was supported by the National Science and Technology Major Project of the Ministry of Science and Technology of China (grant no. ", "2017ZX09304025), the National Natural Science Foundation of China (grant nos. ", "81572374 and 81302128), the Liaoning BaiQianWan Talents Program (grant no. ", "2014921032), the General Project of Liaoning Province Department of Education (grant no. ", "LZ2015073), the Foundation for Selected Overseas Chinese Scholar 2015 Science and Technology Plan Project of Liaoning Province (grant nos. ", "2016007010 and 2015020457) and The Key Research and Development Program of Shenyang (grant no. ", "17-230-9-01).", "\n\nAvailability of data and materials\n==================================\n\nThe datasets used during the present study are available from the corresponding author upon reasonable request.", "\n\nAuthors\\' contributions\n=======================\n\nYW, YL and XQ conceived and designed the study. ", "YW, QW, XZ, LZ, JQ, ZL, LX, YZ, KH, YF and XC performed the experiments. ", "YS provided the samples and collected the patient information. ", "XC and YW contributed in the statistical analysis. ", "YW wrote the manuscript. ", "XQ, YL and XC reviewed and edited the manuscript. ", "All authors read and approved the manuscript and agree to be accountable for all aspects of the research in ensuring that the accuracy or integrity of any part of the work are appropriately investigated and resolved.", "\n\nEthics approval and consent to participate\n==========================================\n\nThe First Hospital of China Medical University Ethical Committee approved the study. ", "No consent was required due to the retrospective nature of the study.", "\n\nPatient consent for publication\n===============================\n\nNo consent was required due to the retrospective nature of the study.", "\n\nCompeting interests\n===================\n\nThe authors declare that they have no competing interests.", "\n\n{#f1-or-40-03-1287}\n\n{#f2-or-40-03-1287}\n\n{#f3-or-40-03-1287}\n\n{#f4-or-40-03-1287}\n\n{#f5-or-40-03-1287}\n\n{#f6-or-40-03-1287}\n\n###### \n\nCorrelation of the expression of RANK and Cav-1 with clinic-pathological parameters in 228 patients with gastric cancer.", "\n\n RANK Cav-1 \n ----------------------------- ----- ------------ ------------ ------------- ----------- ------------ -----------\n Number 228 120 (52.6) 108 (47.4) 74 (43.5) 154 (56.5) \n Age (years) 0.111 0.089\n ≤60 107 50 (46.7) 57 (53.3) 41 (38.3) 66 (61.7) \n \\>60 121 70 (57.9) 51 (42.1) 33 (27.3) 88 (72.7) \n Sex 0.307 0.439\n Male 162 89 (54.9) 73 (45.1) 50 (30.9) 112 (69.1) \n Female 66 31 (47.0) 35 (53.0) 24 (36.4) 42 (63.6) \n T stage 0.500 0.714\n T1 2 0 (0) 2 (100) 1 (50.0) 1 (50.0) \n T2 18 10 (55.6) 8 (44.4) 4 (22.2) 14 (77.8) \n T3 36 17 (47.2) 19 (52.8) 12 (33.3) 24 (66.7) \n T4 172 93 (54.1) 79 (45.9) 57 (33.1) 115 (66.9) \n N stage 0.869 0.149\n N1 51 27 (52.9) 24 (47.1) 19 (37.3) 32 (62.7) \n N2 36 21 (58.3) 15 (41.7) 14 (38.9) 22 (61.1) \n N3 47 25 (53.2) 22 (46.8) 9 (19.1) 38 (80.9) \n N4 94 47 (50.0) 47 (50.0) 32 (34.0) 62 (66.0) \n pTNM stage 0.540 0.323\n I+II 55 31 (56.4) 24 (43.6) 21 (38.2) 34 (61.8) \n III+IV 173 89 (51.4) 84 (48.6) 53 (30.6) 120 (69.4) \n Lauren grade **\\<0.001** 0.059\n Intestinal 89 62 (69.7) 27 (30.3) 21 (23.6) 68 (76.4) \n Diffuse 98 35 (35.7) 63 (64.3) 39 (39.8) 59 (60.2) \n Mixed 41 23 (56.1) 18 (43.9) 14 (34.1) 27 (65.9) \n Location 0.672 \n Cardia 28 15 (53.6) 13 (46.4) 10 (35.7) 18 (64.3) \n Body 20 13 (65.0) 7 (35.0) 6 (30.0) 14 (70.0) \n Antrum 147 74 (50.3) 73 (49.7) 46 (31.3) 101 (68.7) \n Other 33 18 (54.5) 15 (45.5) 12 (36.4) 21 (63.6) \n Histological classification **\\<0.001** **0.023**\n Well 12 8 (66.7) 4 (33.3) 3 (25.0) 9 (75.0) \n Moderate 75 53 (70.7) 22 (29.3) 16 (21.3) 59 (78.7) \n Poor 141 59 (41.8) 82 (58.2) 55 (39.0) 86 (61.0) \n\nP-values shown in bold are statistically significant (two-sided, P\\<0.05). ", "RANKL, receptor activator of nuclear factor-κB; Cav-1, caveolin-1; pTNM, pathological tumor-node-metastasis.", "\n\n###### \n\nCox univariate and multivariate analyses of overall survival in patients with receptor activator of nuclear factor-κB-positive gastric cancer (n=228).", "\n\n Univariate Multivariate \n ------------ ------------ -------------- ----------- ------- -------------- -----------\n Age 1.489 0.876--2.530 0.142 \n T stage 2.812 1.410--5.609 **0.003** 2.559 1.292--5.065 **0.007**\n N stage 1.518 1.176--1.960 **0.001** 1.496 1.156--1.936 **0.002**\n pTNM stage 3.688 1.468--9.263 **0.005** \n Lauren 1.102 0.738--1.645 0.635 \n Caveolin-1 2.392 1.082--5.289 0.031 2.603 1.174--5.773 **0.019**\n\nP-values shown in bold are statistically significant (two-sided, P\\<0.05).", "\n\n[^1]: Contributed equally\n" ]

{ "pile_set_name": "PubMed Central" }

[ 0.0013053934089839458, 0.0006133791757747531, 0.001807922380976379, 0.0016240313416346908, 0.0007569967419840395, 0.0007222775602713227, 0.0006038874853402376, 0.0008423990802839398, 0.0023430308792740107, 0.0007177861989475787, 0.0007702531875111163, 0.0007005425286479294, 0.0008456333307549357, 0.0008054873906075954, 0.001225798623636365, 0.0006238269270397723, 0.0007807077490724623, 0.0006661678780801594, 0.0006195513415150344, 0.0006702885148115456, 0.0006812645588070154, 0.0005924744182266295, 0.0013785817427560687, 0.0007452477002516389, 0.0005936758825555444, 0.0013785817427560687, 0.000804348848760128, 0.000656485150102526, 0.0008928439347073436, 0.0013785817427560687, 0.0006490168161690235, 0.0013785817427560687, 0.0008255304419435561, 0.0013785817427560687, 0.0006690341397188604, 0.0013785817427560687, 0.0007613308844156563, 0.0013785817427560687, 0.000769799342378974, 0.0013785817427560687, 0.0008105873712338507, 0.0013785817427560687, 0.0007448394317179918, 0.0013785817427560687, 0.0006743077537976205, 0.0013785817427560687, 0.0006972708506509662, 0.0013785817427560687, 0.0005806086119264364, 0.0008090428891591728, 0.0005936524248681962, 0.0006174297886900604, 0.0007538393838331103, 0.0008430053130723536, 0.0005931711057201028, 0.0007263507577590644, 0.0013785817427560687, 0.0006750529864802957, 0.0013785817427560687, 0.0006885762559249997, 0.0007256858516484499, 0.0006922440370544791, 0.008090422488749027, 0.0006545858341269195, 0.0005786385736428201, 0.0006693508476018906, 0.0007815433782525361, 0.0006187172839418054, 0.0005476864753291011, 0.0005349645507521927, 0.0006083991029299796, 0.0005710325785912573, 0.0005684542702510953, 0.000615501485299319, 0.0005559908458963037, 0.0005885493592359126, 0.0005588515778072178, 0.0005838786601088941, 0.0009305129060521722, 0.0006713920156471431, 0.0006330958567559719, 0.0006361723644658923, 0.000619626312982291, 0.0006557254237122834, 0.000821055262349546, 0.0009118814487010241, 0.000721591291949153, 0.0006492423126474023, 0.0006595266168005764, 0.0006259098881855607, 0.0006798201939091086, 0.001374513260088861, 0.0006853410741314292, 0.0007711024954915047, 0.0007884319056756794, 0.0006757134106010199, 0.0006338025559671223, 0.000684740487486124, 0.0007084271055646241, 0.0006726559950038791, 0.0009470873628742993, 0.0006976802833378315, 0.000754159118514508, 0.0006224873359315097, 0.0006475019035860896, 0.000604198663495481, 0.0006914979894645512, 0.0006519615999422967, 0.0006412055809050798, 0.0006722842226736248, 0.0008334256708621979, 0.0006828432087786496, 0.0006768022431060672, 0.0006848680786788464, 0.0008156239637173712, 0.0006739149102941155, 0.0009855842217803001, 0.0005647000507451594, 0.0005966830067336559, 0.000568972434848547, 0.0005906411679461598, 0.0006275653722696006, 0.0006619340274482965, 0.0006643655942752957, 0.0007733923848718405, 0.0005895632784813643, 0.0015777961816638708, 0.0010190638713538647, 0.0007484743255190551, 0.0008570734062232077, 0.001112230122089386, 0.0013555965851992369, 0.0011785911628976464, 0.0006587024545297027, 0.0007627811282873154, 0.0010220420081168413, 0.0006920541054569185, 0.0005532304057851434, 0.0006812785286456347, 0.0005934306536801159, 0.0012266471749171615, 0.0007355156703852117, 0.0006512583349831402, 0.0006555498111993074, 0.0005505084991455078, 0.0005838488577865064, 0.0007438570028170943, 0.0009060592856258154, 0.0007619336829520762, 0.0005916528170928359, 0.0005990066565573215, 0.0010097273625433445, 0.0008165945182554424, 0.0008248998201452196, 0.0009338959935121238, 0.0007006947416812181, 0.0005760371568612754, 0.000620718055870384, 0.0006664082175120711, 0.0006239702343009412, 0.0006283945986069739, 0.0006105478387326002, 0.0008705349173396826, 0.0006469578947871923, 0.0008007616852410138, 0.0009304122650064528, 0.0005760957137681544, 0.0005866566207259893, 0.000855287245940417, 0.0006122598424553871, 0.0005108910845592618, 0.000665746396407485, 0.0005843760445713997, 0.0007550133741460741, 0.0006653299788013101, 0.0019055769080296159, 0.0021682458464056253, 0.0007871882990002632, 0.0006839396082796156, 0.0005835851770825684, 0.010730387642979622, 0.0007109771831892431, 0.0007988053257577121, 0.0006228191195987165, 0.0011278324527665973, 0.0006812418578192592, 0.0010793374385684729, 0.0006515842396765947, 0.0005880802636966109, 0.0005758875631727278, 0.0011391416192054749, 0.000812764628790319, 0.001130587188526988, 0.000642817874904722, 0.0006771664484404027, 0.0005960018024779856, 0.0011038407683372498, 0.0005821740487590432, 0.0007292676600627601, 0.0006157634779810905, 0.0010275507811456919, 0.0007958948262967169, 0.0010698370169848204, 0.000691031280439347, 0.0006587269599549472, 0.001027432968840003, 0.0006047984352335334, 0.0005821207887493074, 0.0005974284722469747, 0.0005549525958485901, 0.0010275507811456919, 0.0007738032727502286, 0.0006706141284666955, 0.0005862357211299241, 0.0006379556725732982, 0.0005994630046188831, 0.0010275507811456919, 0.000767093210015446, 0.0011280369944870472, 0.0012255884939804673, 0.013231547549366951, 0.0007984190597198904, 0.0008508473401889205, 0.0013148841680958867, 0.0006726720603182912 ]

[ "This relates to a power distribution network.", "\nA conventional power distribution network may include an interposer mounted on a package substrate. ", "Electrical and mechanical connections between the interposer and the package substrate are provided by a plurality of copper islands on a lower surface of the interposer, a copper island on an upper surface of substrate opposite the copper islands on the lower surface of the interposer, and solder balls or solder bumps connecting the copper islands on the interposer to the copper island on the substrate.", "\nThrough silicon vias (TSV) may extend through the interposer between the copper islands on the lower surface to contact pads on an upper surface of the interposer. ", "Microvias (uVIA) may extend into the package substrate from the upper surface and connect to metal layers in the package substrate. ", "These metal layers are connected by other microvias to still other metal layers or to a lower surface of the package substrate. ", "The microvias and metal layers define electrical interconnection paths that connect the copper island on the upper surface of the package substrate to one or more surface connectors on the lower surface of the package substrate.", "\nUnfortunately, this conventional power distribution network may have a high impedance peak and high Q factor which result in high power noise. ", "The high power noise leads to undesirable high jitter at frequencies over 50 GigaHertz (GHz). ", "The conventional power distribution network described above may also lead to high cost in terms of solder balls or bumps since there is a ball or bump for each power channel, lost space on the interposer and the package substrate that is used for the copper islands and/or lost area that is required for die capacitors." ]

{ "pile_set_name": "USPTO Backgrounds" }

[ 0.0005962540744803846, 0.000554833619389683, 0.0006071525276638567, 0.0006222400697879493, 0.0005983439623378217, 0.0006434424431063235, 0.0005927659221924841, 0.0010851160623133183, 0.0008104020380415022, 0.000661098281852901 ]

[ "1. ", "Introduction {#sec0005}\n===============\n\nPorcine epidemic diarrhea (PED), caused by porcine epidemic diarrhea virus (PEDV), is an intestinal disease characterized by acute diarrhea, vomiting, severe dehydration, and 100 % mortality rates of 1--7 days old suckling piglets ([@bib0190]; [@bib0110]; [@bib0140]). ", "In 1971, PEDV was reported in the UK for the first time ([@bib0180]). ", "PEDV has been spreading in Asia, Europe, and the Americas, causing huge economic losses to the global swine industry ([@bib0170]; [@bib0020]; [@bib0080]). ", "Since 2010, large-scale outbreaks of PED caused by PEDV variant strains have been emerged in China and other Asian countries ([@bib0160]; [@bib0015]; [@bib0065]).", "\n\nPEDV belongs to the Alphacoronavirus genus of Coronaviridae family ([@bib0115]) and is an envelope virus with a positive-sense single-stranded RNA genome ([@bib0005]). ", "The whole genome of PEDV is 28,033 nt, with a 5′ untranslated region (UTR), at least 7 open reading frames (ORF1a, ORF1b, and ORF2 through 6), and a 3\\'UTR ([@bib0055]). ", "ORF1a and 1b encode non-structural proteins (nsps), ORF3 encodes one nonstructural accessory protein (ORF3, 27 kDa) and the remaining ORFs code for four major structural proteins including the spike protein (S,180−220 kDa), the envelope protein (E,7 kDa), the membrane protein (M,27−32 kDa), and the nucleocapsid protein (N,55−58 kDa) from 5′ to 3′ ([@bib0145]; [@bib0030]; [@bib0040]; [@bib0055]). ", "Previous studies showed that the N-protein of coronavirus was highly phosphorylated and formed the helical ribonuclear protein (RNP) that composed the viral core intertwining with the viral genome RNA ([@bib0175]; [@bib0095]). ", "The PEDV N-protein was also shown to be associated with viral nucleolar localization, cell survival, upregulation of IL-8 production, and inhibition of IFN-β expression ([@bib0185]; [@bib0105]; [@bib0130], [@bib0135]).", "\n\nThe N-protein of coronavirus is a highly conserved structural protein and the predominant antigen produced in coronavirus infected cells ([@bib0150]). ", "The N protein of SARS CoV is abundantly released in the patients' blood in the course of early infection, suggesting that the N protein is a suitable candidate for diagnostic applications ([@bib0195]). ", "N protein also can be used as the target for the accurate and early diagnosis of PEDV infection ([@bib0145]). ", "N-protein epitopes play an important role in cellular immunity induction ([@bib0125]), thus can be used for the development of PED vaccines. ", "However, there are only few studies on the PEDV N-protein epitopes, focusing on N1-10 (18--133) and N2-10 (252--262) ([@bib0170]). ", "In a recent study, Lin and C.M et al., ", "found cross-reaction based N-protein epitope in the antisera of PEDV and TGEV. ", "They concluded that more crossover epitopes may be present in the N-protein ([@bib0075]). ", "Ma et al., ", "demonstrated two-way cross reactivity between PEDV and porcine Deltacoronavirus (PDCoV) in the conserved epitope (s) of N-protein ([@bib0090]). ", "Therefore it is of great significance to establish a rapid and accurate diagnosis method to study and analyze the antigenicity of the PEDV N-protein.", "\n\nIn our study, BALB/c mice were immunized with purified and inactivated PEDV followed by cell fusion, which resulted in hybridoma cell lines secreting McAbs specific for the N-protein. ", "The results of epitope mapping showed that three epitopes were identified, including two novel epitopes.", "\n\n2. ", "Materials and methods {#sec0010}\n========================\n\n2.1. ", "Ethics statement {#sec0015}\n---------------------\n\nAll mice were acclimatized to the animal facility for one week. ", "The environment as well as all animal procedures followed the International Guiding Principles for Biomedical Research Involving Animals. ", "The studies were approved by the Institutional Animal Care and Ethics Committee of Nanjing Agricultural University (Nanjing, Jiangsu, China).", "\n\n2.2. ", "Virus and cells {#sec0020}\n--------------------\n\nPEDV classical strain CV777 (AF353511) were propagated in Vero cells in a serum-free DMEM (Corning Cellgro, USA). ", "Vero cells then were cultured in DMEM (Corning Cellgro, USA) supplemented with 10 % fetal bovine serum (FBS) (LONSA, South America) at 37 °C in a humidified incubator containing 5% CO~2~. The myeloma cell SP2/0 and the hybrid cells obtained by fusion of SP2/0 and spleen cells were maintained in RPMI-1640 (Corning Cellgro, USA) supplemented with 15 % fetal bovine serum (FBS) (LONSA, South America). ", "The PEDV SH isolation (GeneBank No. ", "MK841494) belongs to G2a subtype and has a 12-Aa deletion in the N gene. ", "The PEDV MS and YZ strains also belong to G2a, but no deletion in the N gene. ", "TGEV SHXB strain (GeneBank No. ", "KP202848.1) was kindly provided by Dr. Qinghua Yu (College of Veterinary Medicine, Nanjing Agricultural University, Nanjing, China).", "\n\n2.3. ", "Expression of N-protein in prokaryotic and eukaryotic cells {#sec0025}\n----------------------------------------------------------------\n\nTo identify the specificity of the McAbs, recombinant baculo viruses expressing N-protein of PEDV were constructed as previously described ([@bib0210]). ", "Seventeen truncated N-proteins, including A, B, C, A1, A2, A3, A4, A5, A6, C1, C2, C3, C4, C5, C6, C7, and C8 ([Fig. ", "1](#fig0005){ref-type=\"fig\"} ), were expressed in prokaryotic cells to screen the epitope of the McAbs. ", "Based on the gene sequence of PEDV strain CV777, the primers of N truncated protein were designed using Primer 5.0 software. ", "The upstream and downstream primers of the gene were inserted with *BamHI* and *XhoI* restriction sites, respectively ([Table 1](#tbl0005){ref-type=\"table\"} ). ", "All fragments were amplified by RT-PCR using cDNA of PEDV CV777 as a template. ", "The PCR products of N truncated gene were cloned into a pET-32a (m) vector, a reconstructed plasmid with a MsyB label, replacing the TrxA label using XbaI and MscI restriction enzyme sites. ", "The recombinant plasmid were transformed into the *E. coli* strain Rosetta (DE3). ", "The proteins were induced by 1 mM isopropyl-β-[d]{.smallcaps}-thiogalactoside (IPTG). ", "The proteins were purified by inclusion body purification Kit according the manufacture's instruction (Sangon Biotech, Shanghai, China). ", "The purified protein was identified by SDS-PAGE and Western Blot.", "Fig. ", "1Schematic diagram of the truncated N protein**s** To identify the epitopes of PEDV to the McAb, the N gene was divided into 17 truncated genes (A, B, C, A1--A6, C1--C8). ", "A: 1-190Aa, B:101-318Aa, C:241-441Aa, A1:28-190Aa, A2:61-190Aa, A3:80-190Aa, A4:36-190Aa, A5:44-190Aa, A6:52-190Aa, C1:255-372Aa, C2:255-409Aa, C3:241-342Aa, C4:241-350Aa, C5:241-360Aa, C6:241-381Aa, C7:241-389Aa, C8:241-399Aa.", "Fig. ", "1Table 1The primers of N truncated protein.", "Table 1N truncated proteinSequences of primersAnnealing temperature (℃)A: 1-190aa5′- GCGGGATCCTCTAAACAGAAACTT -3\\'565′- TAACTCGAGTCTGTTCTGAGAAGCTCCAC -3\\'B: 101-318aa5′- AATGGATCCGAAGGCGCAAAGACTGAAC -3\\'595′- TATCTCGAGGCCTGACGCATCAACACCTTTTT -3\\'C: 241-441aa5′- GCGGGATCCAGGCATAAGCAACAGCAGAA -3\\'585′- GCGCTCGAGATTTCCTGTATCGAAGATC -3\\'A1: 28-190aa5′- GCGGGATCCAAGCCCCTTTCTAAGGTACTT -3\\'595′- GCGCTCGAGTCTGTTCTGAGAAGCTCCAC -3\\'A2: 61-190aa5′- TTAGGATCCCATGCGCCGTGGTGAGCGAATT -3\\'595′- GCGCTCGAGTCTGTTCTGAGAAGCTCCAC -3\\'A3: 80-190aa5′- TAAGGATCCACAGGACCTCACGGCGA -3\\'595′- GCGCTCGAGTCTGTTCTGAGAAGCTCCAC -3\\'A4: 36-190aa5′- TATGGATCCAACAACGCTGTACCCACTAAC -3\\'575′- TAACTCGAGTCTGTTCTGAGAAGCTCCAC -3\\'A5: 44-190aa5′- TATGGATCCGGGAATAAGGACCAGCAA -3\\'575′- TAACTCGAGTCTGTTCTGAGAAGCTCCAC -3\\'A6: 52-190aa5′- GCGGGATCCTACTGGAATGAGCAA -3\\'575′- TAACTCGAGTCTGTTCTGAGAAGCTCCAC -3\\'C1: 255-372aa5′- GCGGGATCCAACAGCGGCAAAAATACACCT -3\\'575′- TAACTCGAGCATCCACCTGTGAAACAAGAA -3\\'C2: 255-409aa5′- GCGGGATCCAACAGCGGCAAAAATACACCT -3\\'585′- TAACTCGAGTGGCGCACCCACATCAT -3\\'C3: 241-342aa5′- GCGGGATCCAGGCATAAGCAACAGCAGAA -3\\'595′- GCGCTCGAGCTCACGAACAGCCACATT -3\\'C4: 241-350aa5′- GCGGGATCCAGGCATAAGCAACAGCAGAA -3\\'595′- GCGCTCGAGTGTAATCTCGTAAGAGTCCGC -3\\'C5: 241-360aa5′- GCGGGATCCAGGCATAAGCAACAGCAGAA -3\\'595′- GCGCTCGAGTGACTTTGGCACAGTCATTTT -3\\'C6: 241-381aa5′- GCGGGATCCAGGCATAAGCAACAGCAGAA -3\\'595′- GCGCTCGAGGAGTTTTGCATTCCCAGTTT -3\\'C7: 241-389aa5′- GCGGGATCCAGGCATAAGCAACAGCAGAA -3\\'575′- GCGCTCGAGGTTCTTCTTTTCCTTCTTTCT -3\\'C8: 241-399aa5′- GCGGGATCCAGGCATAAGCAACAGCAGAA -3\\'595′- TAACTCGAGTTCATGCTGCTGCAGCGTGGTT -3\\'\n\nA6, C2, and C3 were further divided into 3, 3, and 5 oligopeptides, respectively, to further localize the epitopes of the N-protein. ", "The genes of the short peptide were obtained by annealing with a pair of synthetic oligonucleotides ([Table 2](#tbl0010){ref-type=\"table\"} ) and were cloned into the vector pGEX-6p-1. ", "The methods of expression and purification of the peptides are the same as above.", "Table 2The sequences of synthetic oligonucleotides.", "Table 2片段名称引物序列A6-1: 52-67aa5′-GATCCTACTGGAATGAGCAAATTCGCTGGCGCATGCGCCGTGGTGAGCGAATTC-3\\'5′-TCGAGAATTCGCTCACCACGGCGCATGCGCCAGCGAATTTGCTCATTCCAGTAG-3\\'A6-2: 56-71aa5′-GATCCCAAATTCGCTGGCGCATGCGCCGTGGTGAGCGAATTGAACAACCTTCCC-3\\'5′-TCGAGGGAAGGTTGTTCAATTCGCTCACCACGGCGCATGCGCCAGCGAATTTGG-3\\'A6-3: 60-75aa5′-GATCC CGCATGCGCCGTGGTGAGCGAATTGAACAACCTTCCAATTGGCATTTCC-3\\'5′-TCGAG GAAATGCCAATTGGAAGGTTGTTCAATTCGCTCACCACGGCGCATGCGG-3\\'C3-1: 11-326aa5′-GATCCGAAAAAGGTGTTGATGCGTCAGGCTATGCTCAGATCGCCAGTTTAGCAC-3\\'\\\n5′-TCGAGTGCTAAACTGGCGATCTGAGCATAGCCTGACGCATCAACACCTTTTTCG-3\\'C3-2: 15-330aa5′-GATCCGATGCGTCAGGCTATGCTCAGATCGCCAGTTTAGCACCAAATGTTGCAC-3\\'5′-TCGAGTGCAACATTTGGTGCTAAACTGGCGATCTGAGCATAGCCTGACGCATCG-3\\'C3-3: 19-334aa5′-GATCCTATGCTCAGATCGCCAGTTTAGCACCAAATGTTGCAGCATTGCTCTTTC-3\\'5′-TCGAGAAAGAGCAATGCTGCAACATTTGGTGCTAAACTGGCGATCTGAGCATAG-3\\'C3-4: 23-338aa5′-GATCCGCCAGTTTAGCACCAAATGTTGCAGCATTGCTCTTTGGTGGTAATGTGC-3\\'5′-TCGAGCACATTACCACCAAAGAGCAATGCTGCAACATTTGGTGCTAAACTGGCG-3\\'C3-5: 27-342aa5′-GATCCCCAAATGTTGCAGCATTGCTCTTTGGTGGTAATGTGGCTGTTCGTGAGC-3\\'5′-TCGAGCTCACGAACAGCCACATTACCACCAAAGAGCAATGCTGCAACATTTGGG-3\\'C2-1: 91-402aa5′- GATCCCGTGAAACCACGCTGCAGCAGCATGAAGAGGCCATCC-3\\'5′- TCGAGGATGGCCTCTTCATGCTGCTGCAGCGTGGTTTCACGG-3\\'C2-2: 95-406aa5′- GATCCCTGCAGCAGCATGAAGAGGCCATCTACGATGATGTGC-3\\'5′- TCGAGCACATCATCGTAGATGGCCTCTTCATGCTGCTGCAGG-3\\'C2-3: 98-409aa5′- GATCCCATGAAGAGGCCATCTACGATGATGTGGGTGCGCCAC-3\\'5′- TCGAGTGGCGCACCCACATCATCGTAGATGGCCTCTTCATGG-3\\'\n\n2.4. ", "iELISA {#sec0030}\n-----------\n\nELISA plates were coated with 100 μL purified CV777 (5 μg/ml), eukaryotic N-protein, prokaryotic truncated N-proteins and polypeptide ([Table 3](#tbl0015){ref-type=\"table\"} ) for 2 h at 37 °C. ", "The plate were blocked with 5% skim milk (200 μL) formulated in phosphate-buffered saline containing 0.01 % Tween 20 (PBST) for 3 h at 37 °C. ", "After washing 3 times with PBST, the plate was incubated with two-fold dilutions of serum or hybridoma cultured supernatant for 1 h at 37 °C. ", "After washing 3 times with PBST, HRP-labeled Goat Anti-Mouse IgG (H + L) (Beyotime, China) were added into each well at a dilution of 1:250 at 37 °C for 45 min. ", "After washing with PBST, 100 μL/well TMB substrate (Beyotime, China) was added to develop color for 10 min at room temperature, 50 μL 2 M H~2~SO~4~ were added to stop the reaction. ", "Absorbance was read on Multiscan Spectrum (Epoch, Biotek) at 450 nm.", "Table 3Sequences of synthetic polypeptides.", "Table 3NamesSequencesReference strainPolypeptide IEEAIYDDVGVPSYZPolypeptide IIH EEAIYDDVGAPSCV777Polypeptide IIIEEAIYDDVGAPSCV777Polypeptide IVN EEAIYDDVGVPSYZ\n\n2.5. ", "Preparation of specific monoclonal antibodies {#sec0035}\n--------------------------------------------------\n\nThe virus CV777 were harvested and then purified by sucrose density gradient ultracentrifugation. ", "BALB/c mice of 8 weeks old were subcutaneously immunized with 100 μg purified UV-inactivated CV777 virus resuspended in 200 μL phosphate-buffered saline (PBS) plus equal volumes of complete Freund\\'s adjuvant (first immunization) and incomplete Freund\\'s adjuvant (two boosted immunization) (Sigma Aldrich, USA) at three week intervals. ", "Pre-immune sera were collected before the immunization, and antisera were collected 14 days after the third immunization. ", "Sera were detected by iELISA using purified CV777 as coating antigen and then maintained at 4℃. ", "The mouse with the highest antibody titer was intraperitoneally injected of 50 μg virus without adjuvants three days before hybridoma fusion.", "\n\nThe spleen cells were isolated and fused with SP2/0 cells by standard procedures ([@bib0120]). ", "The splenocytes were harvested from mice immunized with purified CV777 and fused the splenocytes with SP2/0 myeloma cells. ", "The fused hybridoma clones were screened by indirect ELISA for McAbs that have strong reactivity with the purified CV777. ", "Then the fused hybridoma producing antibody to CV777 were subcloned using limiting dilution methods. ", "The purified stable hybridomas were injected into the abdominal cavity of mice to generate ascites fluid. ", "The McAbs were identified by Western blot and indirect immunofluorescence assay (IFA).", "\n\n2.6. ", "Indirect immunofluorescence assay {#sec0040}\n--------------------------------------\n\nTo study the reactivity of McAbs with different isolates, the IFA was used previously described, with some modification ([@bib0205]). ", "Briefly, Vero cells were inoculated with PEDV strains CV777, YZ, SH, MS, respectively and ST were inoculated with TGEV. ", "After absorption for 1 h, the viruses were discarded and DMEM containing 8 μg/ml trypsin (Boisharp, China) was added. ", "When cytopathic effect (CPE) were observed, the cells were gently washed with PBS and fixed with absolute ethyl alcohol for 30 min at 4 °C. ", "The plates were incubated with 2% BSA for 2 h at 37 °C after washing three times. ", "Subsequently, McAbs (1:200 dilution) were added to the cell plates and acted 1 h at 37 °C after washing three times with PBS. ", "A secondary antibody, FITC-labeled Goat Anti-Mouse IgG (H + L) antibody (1:100 dilution) (Beyotime, China), was added to wells for 45 min at 37 °C. ", "Finally, the cells were washed three times in PBS and evaluated by inverted fluorescence microscope. ", "The positive serum against PEDV and TGEV were used as control. ", "RPMI-1640 containing 20 % FCS were used to incubate the control cells to eliminate the effect of medium on McAbs.", "\n\n2.7. ", "Western blot {#sec0045}\n-----------------\n\nThe reaction of McAb with different PEDV strains and Epitope mapping of McAb were identified by Western Blot. ", "The truncated N-protein/peptides and PEDV were separated on a 12 % agarose gel and transferred onto a nitrocellulose (NC) membranes. ", "Non-specific antibody binding sites were blocked with PBST containing 10 % skim milk at room temperature for 2 h. The membranes were incubated with primary antibody overnight at 4 °C. ", "After washing three times with PBST, the membranes were incubated with HRP-labeled Goat Anti-Mouse IgG (H + L) antibody (Beyotime, China) for 45 min at room temperature. ", "After the final three washes, the reaction were visualized using ECL Western blotting substrate (Tanon, China).", "\n\n2.8. ", "Bioinformatics analysis {#sec0050}\n----------------------------\n\nBiological information regarding the presence of the identified epitopes in the different PEDV strains and coronavirus were obtained by using BioEdit V7.0 software. ", "The structure of N-protein were predicted used by I-TASSER website (<https://zhanglab.ccmb.med.umich.edu/I-TASSER>). ", "The spatial characteristics of the identified epitopes were analyzed by mapping the epitope locations onto a 3D model of N-protein using PyMOL software based on the I-TASSER results.", "\n\n3. ", "Results {#sec0055}\n==========\n\n3.1. ", "Production and identification of McAb against PEDV {#sec0060}\n-------------------------------------------------------\n\nTen days after the third immunization, the serum antibody titer of the immunized mice were measured by the indirect ELISA using purified CV777 as coating antigen. ", "The mice with the highest serum titer were injected with 50ug antigen intraperitoneally. ", "The mouse spleen cells were collected after three days and fused with SP2/0 cells to generated hybridoma cells, which were then screened in HAT and HT medium. ", "After two fusions and three subclones, five hybridoma cells stably secreting PEDV antibody were obtained, named 3F10, 3H8, 3H10, 1C9 and 6A11. ", "To identify the subtype of the McAb, a commercial ELISA kit (Proteintech) was used. ", "The IgG subclass of the 3F10, 1C9, and 6A11 was identified as IgG1, with κ-type light chain, 3H8 and 3H10 were identified as IgG2b, with κ-type light chain (data not shown).", "\n\nThe specificity of McAbs against PEDV was identified by IFA and Western blot. ", "The green fluorescence was observed in the cells which were successively infected with CV777 and incubated with the five McAbs, respectively. ", "These findings illustrated that all the five identified McAbs could recognize PEDV CV777 strain ([Fig. ", "2](#fig0010){ref-type=\"fig\"} A). ", "Western blot results showed that all of the five McAbs specifically reacted with PEDV CV777 strain and the N-protein expressed in recombinant baculovirus ([Fig. ", "2](#fig0010){ref-type=\"fig\"}B).Fig. ", "2Identification of monoclonal antibodies by IFA(A) and Western-blot(B). ", "A: After inoculated with PEDV CV777 strain, the Vero cells were fixed and analyzed by IFA with the five McAb. ", "Non-inoculated cells were used as control. ", "To confirm the specificity of McAb, positive serum and the RPMI-1640 containing 20 % FCS (N) were used as antibody to incubated the cells as control. ", "The Vero cells inoculated with CV777 could reacted with the five McAb and positive serum, and showed obvious green fluorescence on the surface. ", "The non-inoculated cells and N control showed no any fluorescence. ", "B: The purified PEDV and N protein expressed in Baculovirus were separated by 10 % agarose gel and transferred onto a nitrocellulose (NC) membranes. ", "After blocking, the membranes were incubated with McAb overnight at 4 °C. ", "After 3 times washes with PBST, the membranes were incubated with HRP-labeled Goat Anti-Mouse IgG (H + L) antibody. ", "The reaction was visualized by using ECL Western blot substrate. ", "Vero cells and Sf9 cells were used as control. ", "Line 1: Purified PEDV; Line 2: Vero cell control; Line 3: N protein expressed in Baculovirus; Line 4: Sf9 cell control.", "Fig. ", "2\n\n3.2. ", "Identification of the epitopes of PEDV N-protein {#sec0065}\n-----------------------------------------------------\n\nTo study the epitopes of McAbs, PEDV N-protein gene was truncated into three overlapping His fusion constructs A (1-190aa)/B (101-318aa)/C (241-441aa) and was successfully expressed in prokaryotic expression system. ", "To obtain pinpoint epitopes, further truncated A and C oligopeptides were expressed (A1-A6, C1--C8) and the short peptide (A6-1∼A6-3, C2-1∼C2-3, C3-1∼C3-5) were obtained.", "\n\nThe results showed that McAb 3F10 bound to the truncated proteins A/A1/A4/A5/A6 and the oligopeptides A6-1 (52-67aa) and A6-2 (56-71aa), indicating that ^56^QIRWRMRRGERI^67^ (named NEP-3F10) was the exact epitope ([Fig. ", "3](#fig0015){ref-type=\"fig\"} A). ", "McAb 6A11 reacted with the truncated proteins C/C1/C2/C3/C4/C5 but does not recognize the proteins A and B and the peptide C3-1∼C3-5 ([Fig. ", "3](#fig0015){ref-type=\"fig\"}B). ", "The epitope of the McAb 6A11 may be included in the ^318^GYAQIASLAPNVAALLFG GNVAVRE^342^ (named NEP-6A11). ", "McAb 1C9 reacts with the truncated proteins C/C2 and the oligopeptide C2-2 (395-406aa) and C2-3 (398-409aa), indicating that the ^398^HEEAIYDDV^406^ (named NEP-1C9) was the exact epitope ([Fig. ", "3](#fig0015){ref-type=\"fig\"}C). ", "The 3H8 and 3H10 did not react with the truncated protein but reacted with PEDV CV777 and the N-protein expressed in eukaryotic cells, signifying that they may recognize conformational epitopes of the N-protein.", "Fig. ", "3Epitope mapping of McAbs by Western blot. ", "The truncated N proteins and the oligopeptides were separated by 12 % agarose gel and transferred onto a nitrocellulose (NC) membranes. ", "After blocking, the membranes were incubated five monoclonal antibody and HRP-labeled Goat Anti-Mouse IgG antibody successively. ", "The line 6P-1 means that the expressed protein of the pGEX-6P-1 vector reacted with the McAb. (", "A) The McAb 3F10 could reacted with the truncated proteins A including A1, A4, A5, A6, A6-1, A6-2. (", "B) The McAb 6A11 could reacted with proteins C, C1, C2, C3, C4 and C5. (", "C) The McAb 1C9 could reacted with the truncated proteins C2, C2-2 and C2-3.Fig. ", "3\n\n3.3. ", "Reactivity and specificity of McAb with the different PEDV strains and TGEV {#sec0070}\n--------------------------------------------------------------------------------\n\nPEDV CV777 and its N-protein were used to identify the McAbs and screen the epitopes. ", "To explore whether the McAbs were specific to the mutant isolates spreading in China, cells inoculated with YZ, SH and MS were used to react with the McAb 1C9, 3F10 and 6A11, respectively, by IFA and Western blot. ", "As shown in [Fig. ", "4](#fig0020){ref-type=\"fig\"} , the strains YZ and MS were identified by all the three McAbs, but the strain SH could only be identified by McAbs 6A11 and 3F10, and not 1C9.Fig. ", "4Reactivity of McAb with the epidemic PEDV strains by IFA and Western blot. ", "Vero cells inoculated with PEDV strain YZ, SH and MS were incubated with 1C9, 6A11 and 3F10, and then stained with FITC labeled goat anti-mouse IgG. Vero cells inoculated with YZ and MS showed specific fluorescence, but Vero cells inoculated with SH 2016 only reacted with the McAb 3F10 and 6A11, not with 1C9. ", "To further verify reactivity of McAb with the epidemic PEDV strains, Vero cells inoculated with PEDV strain YZ, SH2016 and MS were separated by 12 % agarose gel and transferred onto a nitrocellulose (NC) membranes. ", "Non-specific antibody binding sites were blocked with PBST containing 10 % skim milk at room temperature for 2 h. The membranes were successively incubated with McAbs and HRP-labeled Goat Anti-Mouse IgG (H + L) antibody (Beyotime, China). ", "Then the reaction was visualized by using ECL Western blot substrate (Thermo). ", "The result of Western blot was consistent with that of IFA. ", "Vero cells inoculated with PEDV strain CV777 were used as positive control.", "Fig. ", "4\n\nTo study the reactivity of the McAbs with TGEV, ST cells were inoculated with TGEV and successively incubated with the McAb and FITC-labeled Goat Anti-Mouse IgG (H + L) antibody. ", "The specific fluorescence was observed in the cells incubated with McAb 6A11, but not 3F10 and 1C9 ([Fig. ", "5](#fig0025){ref-type=\"fig\"} ).Fig. ", "5Reactivity of McAb with TGEV by IFA. ", "ST cells were inoculated with TGEV and then successively incubated with the McAb and FITC-labeled Goat Anti-Mouse IgG(H + L) antibody. ", "The specific fluorescence was observed in the cells incubated with McAb 6A11, but not with 3F10 and 1C9.Fig. ", "5\n\n3.4. ", "Amino acid alignment of the identified epitopes {#sec0075}\n----------------------------------------------------\n\nTo evaluate the conservation of the McAbs recognized epitopes among different PEDV strains, the alignment of the N-protein B-cell epitopes amino acid sequences among different PEDV strains was performed by BioEdit V7.0 software. ", "As shown in [Fig. ", "6](#fig0030){ref-type=\"fig\"} A, three epitopes are highly conserved among the different PEDV isolates. ", "The epitope ^318^GYAQIASLAPNVAALLFGGNVAVRE^342^ was highly conserved in the reference strains; the epitope ^56^QIRWRMRRGERI^67^ was conserved in the 15 reference strains in the Genebank. ", "A point mutation at the 57^th^ amino acid (I--V) appeared in the three variant PEDV MS/YZ/SH strains, isolated by our lab. ", "Also, multiple stains showed an unique mutation at 398^th^ amino acid (H--N) in the epitope ^398^HEEAIYDDV^406^, and AJ1102/GD-1/LC/ CH HNAY2015 strains showed a point mutation at 400th amino acid (E-D).Fig. ", "6Multiple alignments of the epitopes among PEDV isolates and different coronavirus. ", "The epitope ^56^QIRWRMRRGERI^67^ and ^398^HEEAIYDDV^406^ has little gene differences in all of the PEDV strains, and the epitope ^318^SGYAQIASLAPNVAALLFGGNVA VRE^342^ was completely conservative in all of the PEDV strains (A). ", "While the three epitopes had much differences between different coronaviruses (B).Fig. ", "6\n\nIn our study, the amino acid sequences of the antigenic epitopes were compared with the corresponding sequences of different coronavirus ([Fig. ", "6](#fig0030){ref-type=\"fig\"}B). ", "The results showed that all coronaviridaes, including alphacoronavirus, betacoronavirus, gammacoronavirus, and deltacaronavirus, contained the three epitopes. ", "The obvious differences of the amino acid sequences in epitopes of ^56^QIRWRMRRGERI^67^ and ^398^HEEAIYDDV^406^ between the four genera were identified. ", "The epitope ^318^GYAQIASLAPNVAALLFGGNVAVRE^342^ showed a high homology across the four genera.", "\n\n3.5. ", "The 398th amino acid in the NEP-1C9 is a key amino acid {#sec0080}\n------------------------------------------------------------\n\nCompared with CV777, the epitope NEP-1C9 of variant strains isolated by our lab had an obvious mutation at 398^th^ amino acid (H--N). ", "To understand the effect of this amino acid mutation, four peptides ([Table 3](#tbl0015){ref-type=\"table\"}) were designed and synthesized according the sequences of PEDV CV777 and YZ. ", "The peptides were used as coating antigen to react with McAb and the sera from mice inoculated with inactive PEDV SH and YZ by iELISA. ", "The results demonstrated that McAb 1C9 reacted with polypeptide II (complete NEP-1C9 of CV777) but not with polypeptide I, III (partial NEP-1C9) and IV (complete NEP-1C9 of variant strains). ", "The sera from mice inoculated with inactived PEDV SH had no reactivity with all of the four peptides. ", "The OD~450~ of the YZ-sera reacted with peptide IV was higher than that with peptides I, II and III ([Fig. ", "7](#fig0035){ref-type=\"fig\"} ), indicating that the integrity of NEP-1C9 was associated with its specificity and that the first amino acid residue His^398^ or Nsp^398^ was an important amino acid.", "Fig. ", "7Reactivity of McAb and mice sera against PEDV YZ and SH strain by iELISA. ", "Four synthesized polypeptides were coated in the ELISA plate, respectively. ", "McAb and mice sera were added into the wells and then and HRP-labeled Goat Anti-Mouse IgG (H + L) (Beyotime, China) was added into each well. ", "After developing colour with TMB substrate (Beyotime, China) and stoping with 2 M H~2~SO~4,~ absorbance was read on Multiscan Spectrum (Epoch, Biotek) at 450 nm. ", "PEDV SH: mice sera against PEDV SH strain; PEDV YZ: mice sera against PEDV YZ strain; 1C9: McAb 1C9.Fig. ", "7\n\n3.6. ", "Spatial location of epitope binding {#sec0085}\n----------------------------------------\n\nThe structural analysis of the antigenic epitopes were performed using an online computer software program (I-TASSER). ", "Both NEP-3F10 ^56^QIRWRMRRGERI^67^ and NEP-6A11 ^318^GYAQIASLAPNVAALLFGGNVAVRE^342^ were predicted to be partially buried, forming part of α-helixes ([Fig. ", "8](#fig0040){ref-type=\"fig\"} A, marked in green and 8B, marked in red). ", "The NEP-1C9 ^398^HEEAIYDDV^406^ was predicted to be exposed on the surface of N-protein ([Fig. ", "8](#fig0040){ref-type=\"fig\"}A, marked in orange), exhibiting random coil ([Fig. ", "8](#fig0040){ref-type=\"fig\"}B, marked in orange). ", "As shown in [Fig. ", "8](#fig0040){ref-type=\"fig\"}C, epitope NEP-3F10 showed a high antigenic index and hydrophilicity, suggesting that the epitope was likely to be an important B-cell epitope of PEDV.Fig. ", "8Localization of the identified epitopes. ", "The relative localization of the identified epitopes of 3F10 marked in red, 6A11 marked in green, 1C9 marked in orange, in a partially predicted 3D structure of N protein is highlighted in spheres (A) and a cartoon representation (B). (", "C) Structural features of N protein was predicted using PROTEAN software. ", "All four epitopes are shown in boxes.", "Fig. ", "8\n\n4. ", "Discussion {#sec0090}\n=============\n\nPEDV is one of the most important pathogens causing acute diarrhea in piglets. ", "In recent years, the virus has spread widely around the world. ", "The prevalence of Chinese variant strains has resulted in tremendous economic losses to the pig industry ([@bib0045]). ", "The development of PEDV antibody-based assays is important for detecting infected pigs, confirming previous virus exposure, and monitoring sow herd immunity. ", "However, the potential cross reactivity among porcine coronaviruses is a major concern for the development of pathogen-specific assays. ", "Identification of viral antigenic epitopes and analysis of their conservation can deepen our understanding of antigen structure and virus-antibody interactions, help in establishment of rapid and effective clinical diagnostic methods and development of effective vaccine ([@bib0145]; [@bib0200]).", "\n\nAt present, studies on epitopes mainly focus on S-protein and N-protein. ", "PEDV S-protein, a glycoprotein on the PEDV surface, can be divided into S1 and S2 subunits. ", "The S1 subunit participates in receptor recognition and is an important determinant of PEDV virulence ([@bib0165]), while S2 mediates virus-cell membrane fusion during entry. ", "The S-protein contains multiple neutralizing epitopes and has been utilized for PEDV vaccine development and diagnostic reagents ([@bib0165]; [@bib0010]; [@bib0025]; [@bib0070]; [@bib0155]). ", "An S-protein based ELISA was established and proved better than an N-protein based ELISA ([@bib0050]). ", "However, the S-protein has great variability ([@bib0155]; [@bib0035]; [@bib0100]). ", "Further, the neutralizing McAb of the protein could not inactivate PEDV strain with other genotype ([@bib0085]). ", "The high heterogeneity of the S1 protein among PEDV isolates within and between genogroups limits the sensitivity of S-protein-based assays in the field ([@bib0075]).", "\n\nThe N-protein of PEDV, the most abundant viral protein expressed in the infected cells, is highly conserved among PEDV genogroups (96--99.7 % amino acid identity). ", "Compared to other porcine coronaviruses, the amino acid similarity of the PEDV N-protein is lower than 35 %. ", "PEDV N-protein can be detected early in the virus infection and is an ideal antigen for serological diagnosis ([@bib0060]). ", "However, the epitopes of N-protein are highly conserved among the family Coronaviridae and cross-epitopes with certain TGEV strains have been reported ([@bib0075]). ", "The study of the N-protein specific epitopes is conducive to development of correct and rapid clinical diagnostic methods to distinguish from TGEV and effective vaccination, but currently there are few studies on epitope of N-protein. ", "To our knowledge, only the epitopes N1-10 (18-133aa) and N2-10 (252-262aa) in the N-protein have been reported ([@bib0170]; [@bib0060]). ", "Shi et al. ", "found that the 148-294aa of PEDV N-protein interactded with nucleolar phosphoprotein (NPM1) ([@bib0135]). ", "In this study, using purified PEDV as antigen, five McAbs recognizing PEDV were screened through hybridoma technology. ", "To confirm the specificity of the monoclonal antibody, the N, M, S1 and S2 protein expressed in prokaryotic cells were also used as coating antigen of ELISA. ", "The results shown that these monoclonal antibody could not recognize M and S protein and three recognized N protein. ", "To further confirm the specificity of the monoclonal antibody, N protein expressed in prokaryotic and eukaryotic cells were used as antigen in western blot. ", "The results shown that two of the McAbs, 3H8 and 3H10, reacted with N-protein expressed by baculovirus expression system, but did not bind to N-protein expressed in the prokaryotic expression system. ", "And the other three McAbs, 3F10, 1C9, and 6A11, recognized N-protein expressed in both baculovirus expression system and in the prokaryotic expression system. ", "The results indicated that 3H8 and 3H10 specifically recognized the conformational epitope instead of the linearized epitope. ", "3F10, 1C9, and 6A11 recognized the linearized epitopes. ", "Using iELISA and western blot, three epitopes, ^56^QIRWRMRRGERI^67^, ^398^HEEAIYDDV^406^ and ^318^GYAQIASLAPNVAALLFGGNVAVRE^342^ were recognized by the McAb 3F10, 1C9, and 6A11, respectively. ", "NEP-3F10 was included in N1-10, consistent with previous reports ([@bib0170]). ", "The two novel epitopes, NEP-1C9, and NEP-6A11 were firstly identified.", "\n\nTo further study the specificity of these McAbs, reactivity of the McAbs with TGEV were explored by IFA. ", "The result showed that 3F10 and 1C9 only recognized PEDV, but 6A11 recognized both PEDV and TGEV, consistent with the result of the alignment of the epitopes amino acid sequences. ", "The epitope ^318^GYAQIASLAPNVAALLFGGNVAVRE^342^ had high homology with amino acids in this position of TGEV, explaining why monoclonal antibodies reacted with TGEV. ", "According to these results, it was speculated that 1C9 and 3F10 may be used as the candidate antibody to develop diagnostic method to distinguish PEDV or PEDV and TGEV.", "\n\nThrough the gene sequence analysis of different strains, we found that the 398th amino acids of the three strains of YZ, SH, and MZ isolated in the laboratory were different from that of CV777. ", "To study the effect of this amino acid on antigenicity of the epitope ^398^HEEAIYDDV^406^, four synthesized polypeptides were designed according to the sequence of different strains and were used as coating antigen for iELISA. ", "The results showed that the 1C9 recognized the polypeptide II in which the amino acid residue His^398^ was changed to Nsp^398^, but did not recognize the polypeptide I, III and IV. ", "In other studies, the sera from mice inoculated with inactive PEDV YZ and SH strain were collected and used in this study. ", "The results demonstrated that the OD~450~ of the YZ-sera reacted with peptide IV was the highest compared with polypeptide I, II and III. ", "Because there is a gene deletion of 399--410Aa in N-protein of SH strain, the SH-sera did not react with the peptide. ", "These results indicated that NEP-1C9 can induce humoral immune response in which the first amino acid of NEP-1C9 played an important role.", "\n\nIn conclusion, the epitopes of the 5 McAbs were identified by IFA, Western blot and mapped. ", "In this study, the epitope ^56^QIRWRMRRGERI^67^ was identified, suggesting that 60--80 amino acids were in the dominant epitope regions of PEDV N-proteins. ", "Meanwhile, two novel epitopes ^398^HEEAIYDDV^406^ and ^318^GYAQIASLAPNVAALLFGGNVAVRE^342^ were reported. ", "The present study may provide useful tools for PEDV N-protein structure and function exploration and facilitate the development of diagnostic method and subunit vaccines against PEDV infection.", "\n\nCRediT authorship contribution statement {#sec00005}\n========================================\n\n**Xianwei Wang:** Conceptualization, Methodology, Funding acquisition. **", "Linlin Fang:** Writing - original draft, Visualization, Software. **", "Jing Zhan:** Methodology, Validation. **", "Xiaoli Shi:** Investigation, Validation. **", "Qianyu Liu:** Methodology, Validation. **", "Qianqian Lu:** Investigation, Validation. **", "Juan Bai:** Project administration. **", "Yufeng Li:** Writing - review & editing. **", "Ping Jiang:** Supervision, Writing - review & editing.", "\n\nDeclaration of Competing Interest\n=================================\n\nThe authors declare no conflict of interest.", "\n\nThis work was mainly supported by the National Key Research and Development Program of China (2016YFD0500104), grants from the National Natural Science Foundation of China (31502086), the Fundamental Research Funds for the Central Universities (KJQN201619), the Priority Academic Program Development of Jiangsu higher education institutions (PAPD) and Ministry of Agriculture (CARS-35).", "\n" ]

{ "pile_set_name": "PubMed Central" }

[ 0.0009391900966875255, 0.45930108428001404, 0.000573181314393878, 0.0013404799392446876, 0.0006071539828553796, 0.000802799710072577, 0.0006359796389006078, 0.0006766823353245854, 0.0006931451498530805, 0.0007007258245721459, 0.0006531488033942878, 0.0006408286280930042, 0.0006632379372604191, 0.000559783773496747, 0.0006179838092066348, 0.0005891279433853924, 0.0006661462248302996, 0.0005723719950765371, 0.0006881642621010542, 0.0006183025543577969, 0.0005668983794748783, 0.0007490183925256133, 0.00057979766279459, 0.001185585861094296, 0.0011567610781639814, 0.0006311487522907555, 0.0005616125417873263, 0.0005304728401824832, 0.0013893843861296773, 0.0006674356991425157, 0.0006498493021354079, 0.0007792754331603646, 0.0009206595132127404, 0.0008417346398346126, 0.0006893339450471103, 0.0005633893306367099, 0.0013590181479230523, 0.0007034633890725672, 0.00078199477866292, 0.000617432757280767, 0.0006210053106769919, 0.0006020496366545558, 0.0006238279165700078, 0.0006479235598817468, 0.0009519227896817029, 0.0006434902898035944, 0.0005841561360284686, 0.0007546037086285651, 0.0008292015991173685, 0.000676533323712647, 0.000904985994566232, 0.0008292015991173685, 0.0008888028678484261, 0.0874238908290863, 0.000613437092397362, 0.000565358146559447, 0.0007178522064350545, 0.39834851026535034, 0.0006515649729408324, 0.0013083831872791052, 0.0007910931017249823, 0.004441161174327135, 0.0007429976831190288, 0.0005739182233810425, 0.0006597532774321735, 0.01196419820189476, 0.0008550956263206899, 0.0013461129274219275, 0.0010600409004837275, 0.0008337715989910066, 0.0009553645504638553, 0.0006421363214030862, 0.0018345986027270555, 0.0006617119652219117, 0.0007624526042491198, 0.0009104450582526624, 0.0008681807667016983, 0.0012262470554560423, 0.0007519610808230937, 0.0009036925621330738, 0.0007022252539172769, 0.0006125689251348376, 0.0008771091816015542, 0.000715692644007504, 0.0016337251290678978, 0.0006089336820878088, 0.0006570910336449742, 0.0007767647039145231, 0.0012852742802351713, 0.00087978650117293, 0.0007112344028428197, 0.0007025228114798665, 0.0015930793015286326, 0.0006679100333712995, 0.0013313802191987634, 0.0006354040815494955, 0.0005979967536404729, 0.00061649369308725, 0.00117425003554672, 0.0010631968034431338, 0.0007813735282979906, 0.00108573236502707, 0.0006563634378835559, 0.0008995269308798015, 0.0005648526130244136, 0.0006713034235872328, 0.0007963758544065058, 0.000695234106387943, 0.0006802300922572613, 0.0006710977759212255, 0.0008548659388907254, 0.0006937584839761257, 0.0007014023140072823, 0.0005802015075460076, 0.0006604421068914235, 0.0005851410678587854, 0.0006952297990210354, 0.0007902156794443727, 0.0012953195255249739, 0.0007331283995881677, 0.003807969391345978, 0.0006360174738802016, 0.0006832476938143373, 0.000726584461517632, 0.0008292015991173685, 0.0012902779271826148, 0.000668147171381861, 0.000621570274233818, 0.0008382376981899142, 0.0006708640139549971, 0.0006559466128237545, 0.0006688450812362134, 0.0008508217870257795, 0.0006943729240447283, 0.0006694720359519124, 0.0006726152496412396, 0.0008292015991173685, 0.0014475728385150433, 0.000755681365262717, 0.00388582912273705, 0.0005867237341590226, 0.0006539940950460732, 0.0006364607834257185, 0.0006948419031687081, 0.0014539251569658518, 0.0007258654222823679, 0.0006441812147386372, 0.0006475019035860896, 0.0006265069241635501, 0.0011621491285040975, 0.0018613178981468081, 0.0006354277138598263, 0.0010102816158905625, 0.0006686488050036132, 0.0009344732388854027, 0.0006956178112886846, 0.0008292015991173685, 0.00089697988005355, 0.0006262374809011817, 0.0006808494799770415, 0.0006833974621258676, 0.0014918929664418101, 0.0006206962279975414, 0.0014130540657788515, 0.000694778747856617, 0.0006475019035860896, 0.0006386716850101948, 0.0033596630673855543, 0.0006575370789505541, 0.000660437683109194, 0.0006983258645050228, 0.004736384842544794, 0.0005905592697672546, 0.0005947122699581087, 0.0006673142197541893, 0.0007523975800722837, 0.0009024591417983174, 0.0022739830892533064, 0.0012834978988394141, 0.0008937415550462902, 0.0006121842889115214, 0.0008073058561421931, 0.0006879324209876359, 0.005830854177474976, 0.0007439141045324504, 0.0006441106088459492, 0.0008292015991173685, 0.0014074367936700583, 0.0005970775382593274, 0.0011381208896636963, 0.0005865269340574741, 0.0029685883782804012, 0.0013560742372646928, 0.0006588858086615801, 0.003099108813330531, 0.0006438331911340356, 0.0008373033488169312, 0.0006506627541966736, 0.000645741238258779, 0.0006475019035860896, 0.0006853858940303326, 0.0006729438900947571, 0.0005680315080098808, 0.0006118340534158051, 0.0007084158714860678, 0.0008292015991173685, 0.0013329039793461561, 0.41186484694480896, 0.0007735809776932001, 0.0010278519475832582, 0.0033674188889563084, 0.0005781564977951348, 0.0005784332170151174, 0.0005738649633713067, 0.0009133771527558565, 0.0006525801145471632, 0.0007857670425437391, 0.0006007327465340495, 0.0005920014227740467, 0.0006429216591641307, 0.0006326398579403758, 0.0006897702696733177, 0.0007241235580295324, 0.000655214418657124, 0.000613719574175775, 0.0006113001145422459, 0.0006243649986572564, 0.000744344899430871, 0.0010875153820961714, 0.0006275434861890972, 0.0005552351358346641, 0.0006810003542341292, 0.0006496264250017703, 0.0006375772645696998, 0.0006481051095761359, 0.0006239904323592782, 0.0006325093563646078, 0.0046455468982458115, 0.0006348828319460154, 0.0006058969302102923, 0.0005466671427711844, 0.0006698849028907716, 0.0017291648546233773, 0.0005844902480021119, 0.0005666453507728875, 0.0007041579810902476, 0.0006413210066966712, 0.0006295362836681306, 0.0006659723585471511, 0.0008155793184414506, 0.000743335869628936, 0.0006499453447759151, 0.0007701144204474986, 0.005567741114646196, 0.0005623024771921337, 0.0008750607375986874, 0.0006663723033852875, 0.0006566394004039466, 0.0006533412379212677, 0.0006645476678386331, 0.0007516408222727478, 0.0006890366785228252, 0.0006287159631028771, 0.000641813559923321, 0.0007768531795591116, 0.0005403485847637057, 0.001995444530621171 ]

[ "/******************************************************************************\n * Product: ADempiere ERP & CRM Smart Business Solution *\n * Copyright (C) 2006-2017 ADempiere Foundation, All Rights Reserved. ", " *\n * This program is free software, you can redistribute it and/or modify it *\n * under the terms version 2 of the GNU General Public License as published *\n * or (at your option) any later version.", "\t\t\t\t\t\t\t\t\t\t*\n * by the Free Software Foundation. ", "This program is distributed in the hope *\n * that it will be useful, but WITHOUT ANY WARRANTY, without even the implied *\n * warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. ", " *\n * See the GNU General Public License for more details. ", " *\n * You should have received a copy of the GNU General Public License along *\n * with this program, if not, write to the Free Software Foundation, Inc., *\n * 59 Temple Place, Suite 330, Boston, MA 02111-1307 USA. ", " *\n * For the text or an alternative of this public license, you may reach us *\n * or via info@adempiere.net or http://www.adempiere.net/license.html *\n *****************************************************************************/\n/** Generated Model - DO NOT CHANGE */\npackage org.eevolution.model;\n\nimport java.sql.", "ResultSet;\nimport java.util.", "Properties;\nimport org.compiere.model.*;", "\nimport org.compiere.util.", "KeyNamePair;\n\n/** Generated Model for HR_ShiftGroup\n * @author Adempiere (generated) \n * @version Release 3.9.2 - $Id$ */\npublic class X_HR_ShiftGroup extends PO implements I_HR_ShiftGroup, I_Persistent \n{\n\n\t/**\n\t *\n\t */\n\tprivate static final long serialVersionUID = 20191120L;\n\n /** Standard Constructor */\n public X_HR_ShiftGroup (Properties ctx, int HR_ShiftGroup_ID, String trxName)\n {\n super (ctx, HR_ShiftGroup_ID, trxName);\n /** if (HR_ShiftGroup_ID == 0)\n {\n\t\t\tsetHR_ShiftGroup_ID (0);\n\t\t\tsetName (null);\n } */\n }\n\n /** Load Constructor */\n public X_HR_ShiftGroup (Properties ctx, ResultSet rs, String trxName)\n {\n super (ctx, rs, trxName);\n }\n\n /** AccessLevel\n * @return 3 - Client - Org \n */\n protected int get_AccessLevel()\n {\n return accessLevel.intValue();\n }\n\n /** Load Meta Data */\n protected POInfo initPO (Properties ctx)\n {\n POInfo poi = POInfo.getPOInfo (ctx, Table_ID, get_TrxName());\n return poi;\n }\n\n public String toString()\n {\n StringBuffer sb = new StringBuffer (\"X_HR_ShiftGroup[\")\n .append(get_ID()).append(\"]\");\n return sb.toString();\n }\n\n\t/** Set Description.", "\n\t\t@param Description \n\t\tOptional short description of the record\n\t */\n\tpublic void setDescription (String Description)\n\t{\n\t\tset_Value (COLUMNNAME_Description, Description);\n\t}\n\n\t/** Get Description.", "\n\t\t@return Optional short description of the record\n\t */\n\tpublic String getDescription () \n\t{\n\t\treturn (String)get_Value(COLUMNNAME_Description);\n\t}\n\n\t/** Set Shift Group.", "\n\t\t@param HR_ShiftGroup_ID \n\t\tShift Group\n\t */\n\tpublic void setHR_ShiftGroup_ID (int HR_ShiftGroup_ID)\n\t{\n\t\tif (HR_ShiftGroup_ID < 1) \n\t\t\tset_ValueNoCheck (COLUMNNAME_HR_ShiftGroup_ID, null);\n\t\telse \n\t\t\tset_ValueNoCheck (COLUMNNAME_HR_ShiftGroup_ID, Integer.valueOf(HR_ShiftGroup_ID));\n\t}\n\n\t/** Get Shift Group.", "\n\t\t@return Shift Group\n\t */\n\tpublic int getHR_ShiftGroup_ID () \n\t{\n\t\tInteger ii = (Integer)get_Value(COLUMNNAME_HR_ShiftGroup_ID);\n\t\tif (ii == null)\n\t\t\t return 0;\n\t\treturn ii.intValue();\n\t}\n\n\t/** Set Name.", "\n\t\t@param Name \n\t\tAlphanumeric identifier of the entity\n\t */\n\tpublic void setName (String Name)\n\t{\n\t\tset_Value (COLUMNNAME_Name, Name);\n\t}\n\n\t/** Get Name.", "\n\t\t@return Alphanumeric identifier of the entity\n\t */\n\tpublic String getName () \n\t{\n\t\treturn (String)get_Value(COLUMNNAME_Name);\n\t}\n\n /** Get Record ID/ColumnName\n @return ID/ColumnName pair\n */\n public KeyNamePair getKeyNamePair() \n {\n return new KeyNamePair(get_ID(), getName());\n }\n\n\t/** Set No of Hours this Shift.", "\n\t\t@param NoOfHoursThisShift \n\t\tNo of Hours this Shift work hours of the shift\n\t */\n\tpublic void setNoOfHoursThisShift (int NoOfHoursThisShift)\n\t{\n\t\tset_Value (COLUMNNAME_NoOfHoursThisShift, Integer.valueOf(NoOfHoursThisShift));\n\t}\n\n\t/** Get No of Hours this Shift.", "\n\t\t@return No of Hours this Shift work hours of the shift\n\t */\n\tpublic int getNoOfHoursThisShift () \n\t{\n\t\tInteger ii = (Integer)get_Value(COLUMNNAME_NoOfHoursThisShift);\n\t\tif (ii == null)\n\t\t\t return 0;\n\t\treturn ii.intValue();\n\t}\n\n\t/** Set Friday.", "\n\t\t@param OnFriday \n\t\tAvailable on Fridays\n\t */\n\tpublic void setOnFriday (boolean OnFriday)\n\t{\n\t\tset_Value (COLUMNNAME_OnFriday, Boolean.valueOf(OnFriday));\n\t}\n\n\t/** Get Friday.", "\n\t\t@return Available on Fridays\n\t */\n\tpublic boolean isOnFriday () \n\t{\n\t\tObject oo = get_Value(COLUMNNAME_OnFriday);\n\t\tif (oo !", "= null) \n\t\t{\n\t\t\t if (oo instanceof Boolean) \n\t\t\t\t return ((Boolean)oo).booleanValue(); \n\t\t\treturn \"Y\".equals(oo);\n\t\t}\n\t\treturn false;\n\t}\n\n\t/** Set Monday.", "\n\t\t@param OnMonday \n\t\tAvailable on Mondays\n\t */\n\tpublic void setOnMonday (boolean OnMonday)\n\t{\n\t\tset_Value (COLUMNNAME_OnMonday, Boolean.valueOf(OnMonday));\n\t}\n\n\t/** Get Monday.", "\n\t\t@return Available on Mondays\n\t */\n\tpublic boolean isOnMonday () \n\t{\n\t\tObject oo = get_Value(COLUMNNAME_OnMonday);\n\t\tif (oo !", "= null) \n\t\t{\n\t\t\t if (oo instanceof Boolean) \n\t\t\t\t return ((Boolean)oo).booleanValue(); \n\t\t\treturn \"Y\".equals(oo);\n\t\t}\n\t\treturn false;\n\t}\n\n\t/** Set Saturday.", "\n\t\t@param OnSaturday \n\t\tAvailable on Saturday\n\t */\n\tpublic void setOnSaturday (boolean OnSaturday)\n\t{\n\t\tset_Value (COLUMNNAME_OnSaturday, Boolean.valueOf(OnSaturday));\n\t}\n\n\t/** Get Saturday.", "\n\t\t@return Available on Saturday\n\t */\n\tpublic boolean isOnSaturday () \n\t{\n\t\tObject oo = get_Value(COLUMNNAME_OnSaturday);\n\t\tif (oo !", "= null) \n\t\t{\n\t\t\t if (oo instanceof Boolean) \n\t\t\t\t return ((Boolean)oo).booleanValue(); \n\t\t\treturn \"Y\".equals(oo);\n\t\t}\n\t\treturn false;\n\t}\n\n\t/** Set Sunday.", "\n\t\t@param OnSunday \n\t\tAvailable on Sundays\n\t */\n\tpublic void setOnSunday (boolean OnSunday)\n\t{\n\t\tset_Value (COLUMNNAME_OnSunday, Boolean.valueOf(OnSunday));\n\t}\n\n\t/** Get Sunday.", "\n\t\t@return Available on Sundays\n\t */\n\tpublic boolean isOnSunday () \n\t{\n\t\tObject oo = get_Value(COLUMNNAME_OnSunday);\n\t\tif (oo !", "= null) \n\t\t{\n\t\t\t if (oo instanceof Boolean) \n\t\t\t\t return ((Boolean)oo).booleanValue(); \n\t\t\treturn \"Y\".equals(oo);\n\t\t}\n\t\treturn false;\n\t}\n\n\t/** Set Thursday.", "\n\t\t@param OnThursday \n\t\tAvailable on Thursdays\n\t */\n\tpublic void setOnThursday (boolean OnThursday)\n\t{\n\t\tset_Value (COLUMNNAME_OnThursday, Boolean.valueOf(OnThursday));\n\t}\n\n\t/** Get Thursday.", "\n\t\t@return Available on Thursdays\n\t */\n\tpublic boolean isOnThursday () \n\t{\n\t\tObject oo = get_Value(COLUMNNAME_OnThursday);\n\t\tif (oo !", "= null) \n\t\t{\n\t\t\t if (oo instanceof Boolean) \n\t\t\t\t return ((Boolean)oo).booleanValue(); \n\t\t\treturn \"Y\".equals(oo);\n\t\t}\n\t\treturn false;\n\t}\n\n\t/** Set Tuesday.", "\n\t\t@param OnTuesday \n\t\tAvailable on Tuesdays\n\t */\n\tpublic void setOnTuesday (boolean OnTuesday)\n\t{\n\t\tset_Value (COLUMNNAME_OnTuesday, Boolean.valueOf(OnTuesday));\n\t}\n\n\t/** Get Tuesday.", "\n\t\t@return Available on Tuesdays\n\t */\n\tpublic boolean isOnTuesday () \n\t{\n\t\tObject oo = get_Value(COLUMNNAME_OnTuesday);\n\t\tif (oo !", "= null) \n\t\t{\n\t\t\t if (oo instanceof Boolean) \n\t\t\t\t return ((Boolean)oo).booleanValue(); \n\t\t\treturn \"Y\".equals(oo);\n\t\t}\n\t\treturn false;\n\t}\n\n\t/** Set Wednesday.", "\n\t\t@param OnWednesday \n\t\tAvailable on Wednesdays\n\t */\n\tpublic void setOnWednesday (boolean OnWednesday)\n\t{\n\t\tset_Value (COLUMNNAME_OnWednesday, Boolean.valueOf(OnWednesday));\n\t}\n\n\t/** Get Wednesday.", "\n\t\t@return Available on Wednesdays\n\t */\n\tpublic boolean isOnWednesday () \n\t{\n\t\tObject oo = get_Value(COLUMNNAME_OnWednesday);\n\t\tif (oo !", "= null) \n\t\t{\n\t\t\t if (oo instanceof Boolean) \n\t\t\t\t return ((Boolean)oo).booleanValue(); \n\t\t\treturn \"Y\".equals(oo);\n\t\t}\n\t\treturn false;\n\t}\n\n\t/** Set Immutable Universally Unique Identifier.", "\n\t\t@param UUID \n\t\tImmutable Universally Unique Identifier\n\t */\n\tpublic void setUUID (String UUID)\n\t{\n\t\tset_Value (COLUMNNAME_UUID, UUID);\n\t}\n\n\t/** Get Immutable Universally Unique Identifier.", "\n\t\t@return Immutable Universally Unique Identifier\n\t */\n\tpublic String getUUID () \n\t{\n\t\treturn (String)get_Value(COLUMNNAME_UUID);\n\t}\n\n\t/** Set Search Key.", "\n\t\t@param Value \n\t\tSearch key for the record in the format required - must be unique\n\t */\n\tpublic void setValue (String Value)\n\t{\n\t\tset_Value (COLUMNNAME_Value, Value);\n\t}\n\n\t/** Get Search Key.", "\n\t\t@return Search key for the record in the format required - must be unique\n\t */\n\tpublic String getValue () \n\t{\n\t\treturn (String)get_Value(COLUMNNAME_Value);\n\t}\n}" ]

{ "pile_set_name": "Github" }

[ 0.026865143328905106, 0.0007080140057951212, 0.000696913106366992, 0.0006140153273008764, 0.0005831278394907713, 0.000598663988057524, 0.00165828678291291, 0.0008668127120472491, 0.0007252582581713796, 0.001222548307850957, 0.0013997575733810663, 0.0008028750889934599, 0.0006854459643363953, 0.0010452045826241374, 0.0010326544288545847, 0.0008050043834373355, 0.0009422990260645747, 0.005725163500756025, 0.0023487021680921316, 0.0011629979126155376, 0.0061994027346372604, 0.06270033121109009, 0.0022728019393980503, 0.009376108646392822, 0.0515882708132267, 0.004541847854852676, 0.018607594072818756, 0.05886080116033554, 0.0015420179115608335, 0.013335476629436016, 0.05357867479324341, 0.006164684426039457, 0.013887971639633179, 0.049087636172771454, 0.007888460531830788, 0.01644762046635151, 0.05477302521467209, 0.009733769111335278, 0.011966227553784847, 0.02892536297440529, 0.001066720811650157, 0.0009327386505901814, 0.0007340214215219021, 0.0007688301848247647 ]

[ "Post for Brendan – Landscape Layers 2\n\nThese two photos were taken at the beginning of March on a touristy drive to Oberon and surrounds. ", "It was a very stormy and changeable afternoon. ", "We stopped at Oberon Dam (wall) for a wander. ", "These two views were taken within one minute of each other… After taking the first photo, I turned 90 deg to the right (not trying to line them up) to take the second. ", "Once again, I was looking at all of the many and varied layers, but I was also very amazed at the difference within that minute – I think they look vastly different to each other. ", "The weather was amazing!", "\n\nThanks Lee – oh yes we do love the clouds – these were huge and fabulous!", "\nWe are very dry here and wishing for rain. ", "We had a fantastic day of rain on Wednesday.. or was it Tuesday…mmm, one of those (the first in possibly months?", "\nAnyway much needed and it was wonderful to see. ", "Now wishing for some more 🙂\n\nIt’s a beautiful place Debi, although it was very dry.", "\nI’m so glad you recognised it – Sounds like a good time was had by you panning and being there.", "\nI love being outside too – a camping trip is too long overdue!", "\nThanks for commenting 🙂\n\nart\n\nTop Posts & Pages\n\ncopyright\n\nAll images and content remain the property of Robyn Gosby (c) 2011 - 2017.", "\nPlease do not copy, reblog, PIN or share without my given permission.", "\nAsk me please and thanks so much for respecting my request.", "\n\nSubscribe\n\nEnter your email address to follow this blog and receive notifications of new posts by email. ", "Thankyou for being interested!" ]

{ "pile_set_name": "Pile-CC" }

[ 0.0005523557192645967, 0.0006568928947672248, 0.0008206554921343923, 0.0006535610882565379, 0.0005132596124894917, 0.0006327499286271632, 0.0006454763351939619, 0.0009258130448870361, 0.0006798590766265988, 0.0005417987704277039, 0.0007023996440693736, 0.0007214242359623313, 0.001558321644552052, 0.0006009243079461157, 0.0011117984540760517, 0.0005253757117316127, 0.0006415979587472975, 0.0005513218929991126 ]

[ "Quantifying injury and predicting outcome after trauma.", "\nThe Abbreviated Injury Scale (AIS), Injury Severity Scale and TRISS methodology comprise a mathematically sound system for the analysis of injuries and injured patients. ", "This system is of value for research and audit and has potential applications in forensic medicine, such as its use as a tool to assist the classification and analysis of injuries sustained by those injured in mass disasters." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.0006275172345340252, 0.0005640695453621447, 0.0005471180193126202 ]

[ "Open Economy: The world in the eyes of Zimbabwe\n\nWhen paying attention to policy-makers, captains of industry and budding entrepreneurial start-ups, one can easily assume that as Zimbabweans, we somewhat have an intent to keep pace with the global economy.", "\n\nFor instance, an awareness of industrial competitiveness has become pervasive within policy-making structures such that Government has formed the National Competitiveness Committee.", "\n\nIt seems greater emphasis will be placed on following comparable metrics such as the ones composed within the Global Competitiveness Report.", "\n\nAs should be the case, Government’s enthusiasm to partake in global commerce has mirrored the sentiments of the private sector.", "\n\nConsistent agenda at numerous business conferences has been to enhance productivity and efficiency with a focus on matching foreign competition, if not to beat it out altogether.", "\n\nRising imports have been a prolonged pinch on local business, and realisation has dawned that business should actively protect turf or face demise.", "\n\nPerhaps no other focal point reveals greater global cognisance than the recent growth of entrepreneurial hubs and incubators. ", "At your convenience, I would encourage you to visit a few business development programmes and workshops across the country — not just for the enterprise education on offer, but pay particular attention to the global diction in which we are tutoring business.", "\n\nThese are observations to be excited about.", "\n\nNot too long ago, due to a handful of complexities of which some still exist, our economic perspectives in Zimbabwe lacked global discernment.", "\n\nProgress slacked off accordingly.", "\n\nMarket share was lost.", "\n\nInfrastructural standards got left behind.", "\n\nHoping that we are truly serious to make these occurrences of the past, I do sense a renewed worldly outlook brewing. ", "If not by choice, global consciousness has definitely been pressed by necessity.", "\n\nCommendable responses have been made thus far in policy, regulation and respective business models within our economy. ", "These are the obvious factors that drive competitiveness, and it is especially encouraging that we have begun to weigh them against global benchmarks.", "\n\nHowever, I’d like to offer a more commonly overlooked factor that gives certain economies an upper hand over others. ", "That factor is economic culture!", "\n\nWe have not taken any visible strides on this matter. ", "I dare say that our economic culture remains a weakness. ", "Culture is just as vast as human interaction, so I cannot narrow it down to point out every instance in which we may be culturally flawed.", "\n\nThere is the obvious such as how frustratingly tardy Zimbabweans are. ", "This is so engrained in us that I bet most readers are smirking in acknowledgement than stubbornly refuting this deplorable custom.", "\n\nLikewise, even though we have started working on governance frameworks, corruption is yet to be a practice met with scorn and vile disdain in our society. ", "Cultural elements like these show that Zimbabwe still has much work to do if we are to have a globally competitive economic culture.", "\n\nNotwithstanding, there is opportunity to develop key cultural elements in the short term. ", "I want to highlight two pertinent cultural elements we urgently need in Zimbabwe.", "\n\nFirst, we must encourage curiosity and research! ", "Curiosity is what I would call an economic seed. ", "When planted, it grows committed research in business and education. ", "Companies with a culture of curiosity tend to commit more research into product development and seek greater understanding of target markets.", "\n\nThese are issues we have been slow to comprehend in Zimbabwe. ", "It shows in the rarity in which new products are launched that offer previously unheard of customer utility. ", "Understanding this point will illuminate why in Zimbabwe, business is about penetrating existing markets, and seldom about creating new ones.", "\n\nWe have low investigative interaction between businesses and the customers; hence, our local companies easily lose out customer equity to foreign business.", "\n\nIn Kenya, many observers thought the mobile money company, M-Pesa, would succumb to competition from bigger multi-nationals like Vodafone. ", "However, the local company stood its ground solely because it had the best understanding of Kenyan customers and their utility of the application.", "\n\nSocieties that encourage curiosity naturally demand more research and subsequent invention from institutions of higher education. ", "Curious universities churn out findings of great economic relevance, especially in science and technology.", "\n\nAt last week’s Food Expo in Harare, one astute gentleman pointed out that our agrarian economy risks losing out to foreign seed companies because we have so few research output of our own.", "\n\nHis counsel rings true across more sectors of our economy. ", "How can we compete when we import innovation? ", "Again, how can we compete when we import innovation?", "\n\nSecond, we must foster global interaction deep within our society, not just at State level. ", "The most competitive economies worldwide encourage highly integrated societies. ", "In academics, study abroad or student exchange programmes are commonplace.", "\n\nThis creates a fusion of global perspectives within local institutions. ", "In the adult workplace, work attachments function the same way. ", "A few of our local companies have started trying to assimilate foreign workers. ", "While this may seem inappropriate in a tight job market, the potential benefits outweigh those apprehensions.", "\n\nJapan’s economy boomed in the 1950s to 70s. ", "It has drastically slowed down ever since. ", "While commonly attributed to an aging workforce, I believe this is due to poor assimilation of foreign workers and ideas. ", "It is very hard for foreigners to get a work permit in Japan, and the few foreigners who find work there hardly stay for long.", "\n\nAs a result, innovation in Japan is at an all-time low, with much of the economy stunted by indigenous group-think. ", "This is a reversal of roles with China. ", "China has increasingly become an open economy, assimilating foreign participation and ideas. ", "In the 1960s, Japan had a competing multi-national for every new Western giant.", "\n\nToday, that space belongs to Chinese firms. ", "The simple explanation is that China has integrated foreign ideas into its economy while Japan has stopped.", "\n\nThe lesson for us is that we cannot be competitive globally without integrating our ideas and acumen with those of the rest of the world.", "\n\nWe need more global interaction deep within our society.", "\n\nZimbabwe is having the right conversations with regards to global competitiveness. ", "Our discourse has improved considerably.", "\n\nI hope we can expand that narrative and make it inclusive of economic culture.", "\n\nHere, I have set out to highlight only two elements that can be achieved in the short term. ", "However, there is much more to discuss about how we can foster economically desirable conduct." ]

{ "pile_set_name": "Pile-CC" }

[ 0.0005593362147919834, 0.0005788812995888293, 0.0005427571595646441, 0.0005714467260986567, 0.0005356775945983827, 0.0011770428391173482, 0.0006454265676438808, 0.0005070113111287355, 0.000546530878636986, 0.000588525494094938, 0.0007245526066981256, 0.0008139105048030615, 0.001020927680656314, 0.0005219207960180938, 0.0005336691974662244, 0.0005397041677497327, 0.0005627294885925949, 0.0006351924384944141, 0.0007553311879746616, 0.0005908455932512879, 0.018764449283480644, 0.0009046601480804384, 0.007254651747643948, 0.0024697422049939632, 0.01695319078862667, 0.0005634470726363361, 0.0005196328856982291, 0.000514546933118254, 0.0005589669453911483, 0.000740493240300566, 0.0005411154706962407, 0.0005796639597974718, 0.0006038768333382905, 0.0006647614063695073, 0.0006192098371684551, 0.0006332602933980525, 0.0007455403683707118, 0.0005326467216946185, 0.0005914831417612731, 0.0005645555211231112, 0.0006313725607469678, 0.0005486609297804534, 0.000786986609455198, 0.0007388881640508771, 0.0005557595868594944, 0.0005607971106655896, 0.0005630435771308839, 0.0005472366465255618, 0.000769164296798408, 0.0006442689918912947, 0.0006193887093104422, 0.0005715207662433386, 0.0007336211274378002, 0.0007539162179455161, 0.0009493097313679755, 0.000656097021419555, 0.000622869236394763, 0.0006634778692387044, 0.0006801733979955316, 0.0006264246185310185, 0.0006711665773764253, 0.0009034291142597795, 0.0005959274130873382, 0.0005550036439672112, 0.0005659314920194447, 0.0005202325992286205, 0.0005460591055452824, 0.000519985391292721 ]

[ "\n\n\n\n\n\n\n\n\n\n\n\n\n \n \n \n \n \n \n                                               COURT OF APPEALS\n                                                 SECOND\r\nDISTRICT OF TEXAS\n                                                                FORT\r\nWORTH\n \n \n                                        NO.", "\r\n2-08-238-CR\n \n \nTOMMY\r\nLEE AMELINE A/K/A                                                 APPELLANT\nMARCUS SAVAGE CONNERS III\n \n                                                   V.\n \nTHE STATE OF TEXAS                                                                STATE\n \n                                              ------------\n \n        FROM CRIMINAL DISTRICT\r\nCOURT NO. ", "3 OF TARRANT COUNTY\n \n                                              ------------\n \n                                MEMORANDUM OPINION[1]\n \n                                              ------------\n                                            INTRODUCTION\n\n\n\n\nAppellant Tommy Lee Ameline a/k/a Marcus Savage\r\nConners III entered an open plea of guilty for failure to comply with sexual\r\noffender registration requirements.[2]  After the preparation of a presentence\r\ninvestigation report (PSI), the trial court sentenced him to eight years=\r\nconfinement.", "  We will affirm.", "\n                                     PROCEDURAL BACKGROUND\nOn April 9, 2008, Ameline signed a Judicial\r\nConfession and Written Plea Admonishments, acknowledging that he was entering\r\nan open plea of guilty to the offense of failure to comply with sexual offender\r\nregistration requirementsC a third degree felony\r\npunishable by between two and ten years=\r\nconfinement and up to a $10,000 fine.[3]  The plea included assessment of punishment by\r\nthe trial court after preparation of a PSI.", " \r\nAmeline waived his right to have a court reporter make a record of the\r\nproceedings at which he would enter his guilty plea.", "  Accordingly, the appellate record does not\r\ncontain a court reporter=s transcription of the guilty\r\nplea hearing.", "  The trial court accepted\r\nAmeline=s plea\r\nand deferred sentencing until after the PSI had been prepared.", "\n\n\n\n\nOn July 2, 2008, the trial court reviewed the PSI\r\nand offered the parties an opportunity to present additional evidence regarding\r\npunishment.", "  Ameline=s\r\ngirlfriend=s son testified that despite\r\nAmeline=s\r\ncheckered past, Ameline had turned his life around and that he regularly\r\nattended church.", "  He also said that\r\nAmeline was a positive influence on his mother and that Ameline had been\r\nhomeless during the time he had failed to register as a sexual offender.", "  Based on the premise that Ameline had turned\r\nhis life around, Ameline=s counsel asked the trial court\r\nto assess probation.", "  The State asked the\r\ntrial court to take into consideration Ameline=s PSI,\r\nincluding an apparent discrepancy concerning Ameline=s\r\npreviously registered address and Ameline=s lengthy\r\ncriminal history.", "  At the conclusion of\r\nthe hearing, the trial court found Ameline guilty based upon his earlier guilty\r\nplea and sentenced Ameline to eight years=\r\nconfinement.", "\n                              INDEPENDENT REVIEW OF THE RECORD\nAmeline=s\r\ncourt-appointed appellate counsel has filed a motion to withdraw as counsel and\r\na brief in support of that motion.", "  In\r\nhis motion and brief, counsel avers that in his professional opinion this\r\nappeal is wholly frivolous.", "  Counsel=s brief\r\nand motion meet the requirements of Anders v. California, 386 U.S. 738,\r\n87 S. Ct. ", "1396 (1967), by presenting a professional evaluation of the record\r\ndemonstrating why there are no reversible grounds on appeal and referencing any\r\ngrounds that might arguably support the appeal.", " \r\nSee Mays v. State, 904 S.W.2d 920, 922B23 (Tex.", "\r\nApp.", "CFort\r\nWorth 1995, no pet.).", "  Ameline was\r\nprovided the opportunity to file a pro se brief and has filed one.", "  The State has not filed an appellate brief.", "\n\n\n\n\nIn our duties as a reviewing court, we must\r\nconduct an independent evaluation of the record to determine whether counsel is\r\ncorrect in determining that the appeal is frivolous.", "  See Stafford v. State, 813 S.W.2d 503,\r\n511 (Tex. ", "Crim. ", "App. ", "1991); Mays, 904 S.W.2d at 923.", "  Only then may we grant counsel=s motion\r\nto withdraw.", "  See Penson v. Ohio,\r\n488 U.S. 75, 83B84, 109 S. Ct. ", "346, 351 (1988).", "\nAmeline entered an open plea of guilty, so he\r\nwaived the right to appeal any nonjurisdictional defects, other than the\r\nvoluntariness of his plea, that occurred before entry of the plea so long as\r\nthe judgment of guilt was rendered independent of, and is not supported by, the\r\nalleged error.", "  See Young v. State,\r\n8 S.W.3d 656, 666B67 (Tex. ", "Crim. ", "App. ", "2000); Lewis\r\nv. State, 911 S.W.2d 1, 4B5 (Tex.", "\r\nCrim. ", "App. ", "1995).", "  Therefore, our\r\nindependent review of the record is limited to potential jurisdictional\r\ndefects, the voluntariness of Ameline=s plea,\r\npotential error occurring before Ameline=s plea\r\nthat resulted in or supports the judgment of guilt, and potential error\r\noccurring after the guilty plea.", "  See\r\nYoung, 8 S.W.3d at 666B67.", "\n\n\n\n\n                                             CONCLUSION\nWe have carefully reviewed the record before us,[4]\r\nincluding the indictment, the judgment, and the reporter=s record\r\nfrom the punishment and sentencing hearing, as well as counsel=s brief\r\nand Ameline=s pro se brief.[5]  We agree the appeal is wholly frivolous and\r\nwithout merit.", "  Accordingly, we grant\r\ncounsel=s motion\r\nto withdraw and affirm the trial court=s\r\njudgment.", "\n \nPER\r\nCURIAM\n \nPANEL:  MEIER, WALKER, and MCCOY, JJ.", "\n \nDO NOT PUBLISH\nTex. ", "R. App. ", "P. 47.2(b)\n \nDELIVERED:  October 29, 2009\n\n\n\n\n[1]See Tex. ", "R. App. ", "P. 47.4.", "\n\n\n[2]See Tex. ", "Code Crim. ", "Proc.", "\r\nAnn. ", "art. ", "62.102 (Vernon 2006).", "\n\n\n[3]Tex. ", "Penal Code Ann. '", " 12.34 (Vernon Supp.", "\r\n2009).", "\n\n\n[4]As stated earlier,\r\nAmeline waived the right to have a court reporter present at the hearing at\r\nwhich he entered his guilty plea.", "\n\n\n[5]We conclude that the\r\npoint asserted in Ameline=s brief regarding\r\nineffectiveness of trial counsel does not constitute an arguable ground for\r\nrelief.", "\n\n\n" ]

{ "pile_set_name": "FreeLaw" }

[ 0.000910067290533334, 0.0009798863902688026, 0.002595415571704507, 0.0005902303964830935, 0.0008146464242599905, 0.0011491539189592004, 0.0006178630865179002, 0.000689622713252902, 0.000552202807739377, 0.0012541105970740318, 0.006889768410474062, 0.0009773694910109043, 0.0006714157061651349, 0.0014601509319618344, 0.0005893534398637712, 0.0006134985014796257, 0.0007004226790741086, 0.0005795382894575596, 0.0006886852206662297, 0.000847632298246026, 0.0006845199386589229, 0.0006498840521089733, 0.0006600391352549195, 0.0005825057160109282, 0.0006868774071335793, 0.0018367550801485777, 0.000847632298246026, 0.0007013952708803117, 0.0006313024205155671, 0.0007746783085167408, 0.0006368846516124904, 0.0011656314600259066, 0.000661988218780607, 0.0018367550801485777, 0.000847632298246026, 0.0007359995506703854, 0.0018367550801485777, 0.000847632298246026, 0.0007688169716857374, 0.0006933176191523671, 0.0006552028353326023, 0.000563778739888221, 0.000617048644926399, 0.0006324065616354346, 0.0007725621107965708, 0.0009975661523640156, 0.0005943845026195049, 0.0009975661523640156, 0.000827888201456517, 0.0006431334768421948, 0.0011542157735675573, 0.000995687092654407, 0.0015625481028109789, 0.001342528616078198, 0.0006605371600016952, 0.0008009024313651025, 0.000880821084138006, 0.0008380412473343313, 0.0007564739207737148, 0.00069811922730878, 0.0006695504416711628, 0.001995444530621171 ]

[ "{\n \"I've seen things\": {\n \"like\": [\n \"carrots\",\n \"handbags\",\n \"cheese\",\n \"toilets\",\n \"russians\",\n \"planets\",\n \"hampsters\",\n \"weddings\",\n \"poets\",\n \"stalin\",\n \"kuala lumpur\"\n ]\n },\n \"host\": \"weebls-stuff.com\",\n \"port\": 78304\n}\n" ]

{ "pile_set_name": "Github" }

[ 0.0007035036687739193 ]

[ "The research and development activities of the Signal Processing and Instrumentation Section (SPIS) are collaborative efforts with NIH Institute scientists, and often result in the development of unique, specialized biomedical instruments. ", "Other projects involve signal and video processing algorithm development required for system simulation and data analysis. ", "In-house capabilities and accomplishments have established SPIS as an engineering focal point that strengthens the IRP interactive environment facilitating science through successive iterations of experiment, theory development, and design. ", "With 25+ active projects, SPIS has collaborated with 18 NIH Institutes and Centers on technology and methodology development projects. ", "Example past and current collaborative projects, as well as associated research studies include: 1. ", "Laser Capture Tissue Microdissection (LCM) for Molecular Analysis of Disease States and Normal Development Tissue Activated/Expression Microdissection (TAM, xMD) (NCI, NICHD, NIMH, NIBIB, and CIT). ", "2. ", "Electron Paramagnetic Resonance (EPR) Imaging of In Vivo Oxygen Status Associated with Cancer Treatment Studies (NCI, NINDS, and CIT). ", "3. ", "Technologies for Fly Optomotor Behavioral Analysis and Genetic Dissection of Color-vision Circuit Studies (NICHD). ", "4. ", "Systems Enabling Study of Integration of Chromatic Information in the Higher Visual Center of Drosophila (NICHD). ", "5. ", "Advanced Methods of Whole Mount Sectioning of Prostatectomy Specimens for Imaging, Diagnosis, and Pathology Studies - Correlating In Vivo Prostate MRI and Histopathology using Individualized MR-Based Molds (NCI and CIT). ", "6. ", "System for Continuous Observation of Rodents in Home-cage Environment (SCORHE) for Phenotyping and Cancer Treatment Evaluation (NCI and FDA). ", "7. ", "Quantitative Fluorescence Lifetime Imaging for Disease Detection and Monitoring (NICHD, NCI, NIBIB, and Washington University). ", "8. ", "Perfusion Bioreactor System facilitating 3D Skin Model Development for Cancer and Drug Efficacy Studies (NCI and NIBIB). ", "9. ", "Tumor Cell Monitoring Strategies to Study the Effects of Microenvironment on Anti-cancer Drug Efficacy In Culture Monitoring and Control Technologies for Modeling In Vivo Conditions (NCI). ", "10. ", "Quantitative Characterization of Normal and Disease Cervix Tissue (NICHD and NHLBI). ", "11. ", "High-resolution Gamma Imager and Positron Position Imager for Small Animal Imaging of Radioisotopes for Cancer Treatment (NCI, CC, and Thomas Jefferson National Accelerator Facility). ", "12. ", "Signal Processing of Autonomic Measures for Behavioral Neurophysiology (NIMH). ", "13. ", "Development of a Video-Based Tracking System for the Clinical Evaluation of Motor Disorders (NIDA and NINDS). ", "14. ", "Phenotyping and behavior analysis for Top1mt/Parkin deficient mice (NCI). ", "15. ", "Large-scale video monitoring study of effect of Drd2 gene on obesity (NIDDK). ", "16. ", "Profiling activity of mice on Tempol diet (NCI). ", "17. ", "Wireless Transmission of Anesthesiology Parameters in an MRI Environment (CC). ", "18. ", "Spectral Domain Optical Coherence Tomography (OCT) for Tissue Motion Tracking and Skin Blood Volume Imaging (NHLBI and NICHD). ", "19. ", "Photo Dynamic Therapy (PDT) Technologies Integrated with Cancer Imaging Probes (NCI and NIBIB). ", "20. ", "A Handheld Field Deployable Hematoma Detector: A Practical Application of Motion as Signal in Near Infra-red Imaging (NICHD) 21. ", "Two-Photon Excitation Fluorescence Microscopy (TPEFM) Motion Tracking to Study In-vivo Subcellular Structures (NHLBI). ", "22. ", "Portable Fluorescence Camera System for Offsite Tumor Imaging (NCI, NIBIB, and INOVA Fairfax Hospital). ", "23. ", "Image-Based Robotic Targeting System to Control Micromanipulators for Living Biological Tissues (Brain/Spinal) Studies (NINDS and Columbia University). ", "24. ", "Functional Near Infrared Spectroscopy Imaging Technologies for the Study of Traumatic Brain Injury (NINDS and NICHD). ", "25. ", "Fluorescence Photo Activation Localization 2D/3D Microscopy and Analysis System to Study Biological Processes (NCI, NIAID, NICHD, NIBIB, and CIT). ", "26. ", "Tissue Microarray (TMA) Technologies for Cancer Studies (NCI, Childrens National Medical Center, and Suburban Hospital Pathology). ", "27. ", "Temporal-spectral Programmable Lighting for Health and Rhythm Entrainment (NICHD, OD, NINR, Lawrence Berkeley National Laboratory, and Department of Energy). ", "28. ", "Nonhuman Primate Maternal-fetal Monitoring System for Investigating the Affects of Prenatal Psychological Stress (NICHD). ", "29. ", "Bronchial Tree 3D Models to Enable Development of Radio-frequency and Laser Ablation Methodologies (CC and NCI). ", "30. ", "Obtaining Isolated IR Spectrum of Each Stage in the Polymerization of Abeta Oligomers (NHLBI and NIBIB). ", "31. ", "Visible and IR Optical Scanning Spectrometry to Study Energy Transduction by Bacteriorhodopsin (NHLBI, NIBIB, National Institute of Standards and Technology (NIST), Center for Advanced Research in Biotechnology (CARB) Institute, and Syracuse University). ", "32. ", "Muscle Tension Transients Collection and Analysis Technologies to Study Cardiomyopathy Mutations (NHLBI). ", "33. ", "Real-time Fluorescence-Enhanced Imaging as an Aid to Cancer Surgery (NCI and NIBIB). ", "34. ", "Methods to Indentify Neural Substrates of Behavior in Flies - Flight Initiation Detection System (NIMH). ", "35. ", "Technologies to Assess Saliva Production in Association with Sjgren Syndrome Studies (NIDCR). ", "36. ", "High-Throughput Ultrasound-accelerated Tissue Fixation Technologies to Improve Biomolecule Preservation (NCI and Armed Forces Institute of Pathology (AFIP)). ", "37. ", "MRI Motion Artifacts Technologies to Generate Phantom Motion for the Study of Correction Strategies (NICHD and CIT). ", "38. ", "Technologies for low-field MRI (NICHD). ", "39. ", "Automated Fabrication Technologies for Hydrogels with Gradient of Compliance: Application to Cell Mechanotaxis and Durotaxis (NICHD). ", "40. ", "High Resolution Vibrational Spectroscopic Imaging to Study Cellular Membranes (NIDDK). ", "41. ", "Microfluidics, Microfabrication, and Microanalysis Technologies for Molecular Analysis and Biomedical Research (NIBIB and National Institute of Standards and Technology (NIST)). ", "42. ", "Functional MRI (fMRI) Methodologies and Devices to Study Communication Disorders and Treatments (NIDCD). ", "43. ", "Classification of Monkey Vocalizations for Neurophysiological Studies involving Auditory Processing (NIMH). ", "44. ", "Genetics and Mechanisms of Pain - Developing a Mouse Model - A Non-injurious Assay to Study Mechanisms of Pharmacodynamics and Transmission of Noxious Stimulus (CC and Children's National Medical Center). ", "45. ", "Functional MRI to Study Neural Processes Underlying Self-agency (NINDS and University of Miami). ", "46. ", "Real-time Multispectral Endoscope Imaging as an Aid to Cancer Surgery and HPV Studies (NCI and NIBIB). ", "47. ", "Gait Analysis Technologies (CC, NICHD, and University of Delaware). ", "48. ", "cDNA and Protein Microarray Technologies (NCI, NHGRI, and NIEHS). ", "49. ", "Chromosome Microdissection Technologies (NICHD and NHGRI). ", "50. ", "Single Molecule, DNA, and Chromatin Fiber Mechanics and Manipulation Technologies (NCI and NICHD). ", "51. ", "Atomic Force Microscopy (AFM) Imaging (NIAMS). ", "52. ", "Magnetic Resonance Elastography (MRE) Imaging (NINDS). ", "53. ", "Ultrasound Imaging (NHLBI)." ]

{ "pile_set_name": "NIH ExPorter" }

[ 0.0005216636345721781, 0.0005720112239941955, 0.000550629454664886, 0.0005540327401831746, 0.0005410113371908665, 0.0006030802032910287, 0.001185585861094296, 0.0005635617417283356, 0.00117425003554672, 0.0006027888739481568, 0.0012900278670713305, 0.0005689784302376211, 0.0013671480119228363, 0.001097466447390616, 0.001202064217068255, 0.0006511717801913619, 0.0013101339573040605, 0.0005737175233662128, 0.0014581186696887016, 0.0005627748323604465, 0.00135024543851614, 0.0005652291001752019, 0.0011672148248180747, 0.0007513253367505968, 0.0011401979718357325, 0.0006180868949741125, 0.0011807649862021208, 0.0006944497581571341, 0.0011604013852775097, 0.0006206890684552491, 0.0013701459392905235, 0.000949650420807302, 0.0013238334795460105, 0.0006773291388526559, 0.0011094417423009872, 0.0007330186781473458, 0.001153186080045998, 0.0006071348907426, 0.0012020498979836702, 0.0006344401044771075, 0.0012845105957239866, 0.00062191067263484, 0.0012712616007775068, 0.0006389112677425146, 0.0005821982049383223, 0.0012386090820655227, 0.0005845552077516913, 0.0011174104874953628, 0.0006043892935849726, 0.0012042307062074542, 0.0006575138540938497, 0.001151100150309503, 0.0005956857348792255, 0.001064466661773622, 0.0005844738916493952, 0.0010378165170550346, 0.0005421368987299502, 0.0010886960662901402, 0.0008106287568807602, 0.0011345044476911426, 0.0006601916393265128, 0.001320813549682498, 0.0005970607162453234, 0.0010180178796872497, 0.0006009105127304792, 0.0011280784383416176, 0.000652174698188901, 0.0011522884014993906, 0.0006748693413101137, 0.0010850250255316496, 0.0006108111701905727, 0.0011861083330586553, 0.0005939424736425281, 0.0011382244993001223, 0.0005883320118300617, 0.0010887437965720892, 0.0005904546123929322, 0.0011295127915218472, 0.000601333100348711, 0.001214203075505793, 0.0005900627002120018, 0.0012652340810745955, 0.0006057523423805833, 0.001106628798879683, 0.0005733403377234936, 0.00103920663241297, 0.000601761625148356, 0.00098760228138417, 0.0010330381337553263, 0.0010946064721792936, 0.0008549278718419373, 0.0010456732707098126, 0.000559889420401305, 0.0011000395752489567, 0.0006289653247222304, 0.0010475427843630314, 0.0006189493578858674, 0.0011280461912974715, 0.0005899604293517768, 0.0010995917255058885, 0.0005868495791219175, 0.0011420991504564881, 0.0005851673195138574, 0.001067863660864532, 0.0006206805119290948, 0.0009987415978685021, 0.0006251318845897913, 0.0010335983242839575, 0.0006408952176570892 ]

[ "Article content\n\nThe day after the layoff of 450 Ford workers in Oakville was announced, the NDP went after the Progressive Conservative government at Queen’s Park Tuesday demanding it come up with an auto strategy.", "\n\n“For months our highly skilled, hard working auto workers have been asking for this government to stop hiding, get off your hands and do something to protect this industry,” Niagara NDP MPP Wayne Gates said in the legislature.", "\n\nWe apologize, but this video has failed to load.", "\n\ntap here to see other videos from our team. ", "Try refreshing your browser, or Provincial NDP calls on Ford government for auto strategy Back to video\n\n“Unfortunately, the only time the premier is not sitting on his hands is when he’s waving goodbye to good-paying auto jobs.”", "\n\nThe automaker is planning to end production of the Ford Flex at the end of next month.", "\n\nPhoto by Dan Janisse / Windsor Star\n\nMinister of Economic Development, Job Creation and Trade Vic Fedeli responded to Gates saying the Doug Ford government is disappointed with the layoffs and took the opportunity to take a swipe at the former Liberal government.", "\n\n“It’s not all that long ago that the CEO of Fiat-Chrysler (Sergio Marchionne) told former premier (Kathleen) Wynne that she has made Ontario the most expensive jurisdiction in North America in which to do business,” Fedeli said." ]

{ "pile_set_name": "OpenWebText2" }

[ 0.0008386300760321319, 0.004090009722858667, 0.0006396722747012973, 0.0006559600587934256, 0.0009999340400099754, 0.0007655454683117568, 0.0006908820942044258, 0.000664191204123199 ]

[ "Channel 32 TV stations in Mexico\n\nThe following television stations broadcast on digital or analog channel 32 in Mexico:\n\n XEW-TDT in Mexico City\n XEWT-TDT in Tijuana, Baja California\n XHACN-TDT in Acaponeta y Tecuala, Nayarit \n XHAGU-TDT in Aguascalientes, Aguascalientes \n XHANT-TDT in Autlán de Navarro, Jalisco \n XHAP-TDT in Acapulco, Guerrero \n XHAUC-TDT in Chihuahua, Chihuahua \n XHAZL-TDT in Cerro Azul, Veracruz\n XHBO-TDT in Oaxaca, Oaxaca \n XHBUR-TDT in Morelia, Michoacán de Ocampo \n XHCUA-TDT in Culiacán, Sinaloa \n XHDRG-TDT in Durango, Durango \n XHHUC-TDT in Huixtla (El Triunfo), Chiapas \n XHI-TDT in Ciudad Obregón, Sonora\n XHIJ-TDT in Ciudad Juárez, Chihuahua\n XHLRT-TDT in San Luis Rio Colorado, Sonora\n\n XHMOY-TDT in Monterrey, Nuevo León\n XHNAT-TDT in Nuevo Laredo, Tamaulipas\n\n XHOCC-TDT in Ocosingo, Chiapas\n XHOPCC-TDT in Campeche, Campeche\n XHPNG-TDT in Piedras Negras, Coahuila\n XHPNO-TDT in Santiago Pinotepa Nacional, Oaxaca \n XHSTE-TDT in Santiago Tuxtla, Veracruz\n XHSZT-TDT in Soto La Marina, Tamaulipas\n XHTMPT-TDT in Puebla, Puebla\n\n XHTMQR-TDT in Cancún, Quintana Roo\n XHVIZ-TDT in Villahermosa, Tabasco\n XHVST-TDT in Ciudad Valles, San Luis Potosí\n XHVTT-TDT in Valladolid and Tizimín, Yucatán \n XHWVT-TDT in Arriaga and Tonalá, Chiapas \n XHZ-TDT in Querétaro, Querétaro\n\n32" ]

{ "pile_set_name": "Wikipedia (en)" }

[ 0.0010163277620449662 ]

[ "Collège Saint Joseph – Antoura\n\n- - > http://www.csja.edu.lb\nThe Collège Saint Joseph in Antoura, Lebanon, is the oldest French school in the Middle East. ", "It was established in 1834 by the Lazarist priests, led by Fr. ", "Andrew Francis. ", "The school's current headmaster is Father Jamil Semaan and its student body comprises 5500 students. ", "Located in the valley of Antoura, the campus consists of more than eight buildings with several courts and gardens. ", "Antoura still ranks among the top schools in Lebanon. ", "It is accredited by the French Ministry of Education and has the status of \"école homologuée\". ", "The high school or \"lycée\" offers both the Lebanese and French baccalaureate programs with the possibility of a rather challenging intensive double baccalaureate program.", "\n\nIt is classified as a French international school by the AEFE.", "\n\nThe school also accommodates the oldest scouts group in Lebanon. ", "Previously members of the Scouts et Guides de France, the scouts and guides of Saint Joseph Antoura later joined the Scouts du Liban association when it was formed. ", "The group is still one of the largest and most prominent scouts groups of the nation.", "\n\nAntoura is well known for the visit of French writers Alphonse de Lamartine and Gerard de Nerval, who wrote about the school and the town.", "\n\nHistory\nAs early as 1651, local notable Cheikh Abou Nawfal Khazen requested Jesuit Fathers to establish a mission on his lands in Antoura. ", "In 1773, their efforts were realized. ", "The Lazarists were given the mission to preach God's teaching. ", "In 1834,The apostolic delegate, Monseigneur Auvergne encouraged the transformation of the mission into a teaching college. ", "Antoura's beginnings were quite modest, in October 1834 seven students were enrolled, thus forming the first secondary Francophile school in the Middle East. ", "Over the course of the 19th century, the college developed spectacularly. ", "In 1874, the central building was built. ", "the Left wing opened in 1884 and the big chapel was inaugurated in 1895. ", "The symbol of the school, the tower was built in 1904 and sealed the courtyard beautifully. ", "\n\nDuring World War I and the Armenian Genocide, the Lazarists were expelled by the Ottomans and the college was transformed into an orphanage where, under the direction of Djemal Pasha and Halide Edip Adıvar. ", "About 1,000 Armenian and 200 Kurdish children were forcefully Turkified. ", "The story of the Turkification of the children during the Armenian Genocide is vividly portrayed in Goodbye, Antoura, released in English in 2015 and written by one of the children who were interned at the orphanage.", "\n\nCollege attendance saw a resurgence in 1919, counting 350 Students. ", "In 1936, The French Academy awarded the Grand Prix of French Language to the college. ", "In 1970,a Basketball Court was constructed. ", "In 1977, despite the Lebanese Civil War, the Kindergarten building was built. ", "The Centre Lamartine, named after the illustrious French poet who visited the college, is a documentation center which is used by both students and teachers to further their research. ", "In 1982, the boarding school was opened. ", "The college Then counted 2500 students. ", "In 1994, the College turned 160 years old. ", "1996, the great chapel was 100 years old, and was completely restored. ", "In 2004, the Tower turned 100 years old. ", "The Saint Joseph Sports center was opened in 2006 and includes a semi-Olympic indoor pool, and diverse sport activities take place there.", "\n\nAcademics\nThe College Offers 15 years of schooling, starting with three years of pre-school (\"Maternelle\"), and 12 years of schooling (Grade 1 to 12).", "\nThe school follows the standard Lebanese program. ", "Students in grade 9 are required to pass the Brevet examination before joining the Secondary cycle (\"high school\"). ", "Students graduate after finishing the grade 12 program and successfully passing the Baccalaureate. ", "They are required to select one of four concentrations: Sciences (Life or General), Sociology-Economics or Humanities. ", "The school also offers students the possibility of studying both the French and Lebanese Baccalaureates, in a double intensive program. ", "The selection process for this program is merit-based, and generally requires top 15% ranking in the school. ", "\nThe average size of the graduating class in Antoura varies typically between 200 and 250 students. ", "\n\nAntoura has one of the highest passing rates in the Lebanese and French Baccalaureates, with 98% success in the first session, and more than 99% after the make-up session of the Lebanese Baccalaureate and the oral session of the French Baccalaureate. ", "Most students join one of five major Lebanese universities after graduating: The American University of Beirut, Université Saint Joseph, The Lebanese University, the Lebanese American University, and Notre Dame University Louaize.", "\n\nLocation\nThe town of Antoura sits on a sloping hill overlooking the Mediterranean Sea at an altitude ranging between 250 and 300m above sea level. ", "The Town is bordered by Zouk Mikael and Zouk Mosbeh to the west, Hrash, Jeita and Ain El Rihani to the east.", "\n\nEtymology\nAntoura derives from Syriac `aïn meaning \"fountain\" or \"spring\" and țoura meaning \"mountain\".", "\n\nNotable alumni\nCharles Helou President of Lebanon from 1964 to 1970\nSleiman Frangieh - President of Lebanon from 1970 to 1976\nRené Moawad - President of Lebanon in 1989 (assassinated while in office)\nRiad el Solh - First Lebanese Prime Minister after Lebanon's independence from France in 1943\nSabri Hamade - Speaker of the Parliament\nHamid Frangieh - Politician, Minister and Member of Parliament\nKamal Jumblatt - politician, Member of Parliament and Minister, Druze leader and founder of the Progressive Socialist Party\nZiad Baroud - Interior Minister 2008–2011\nMichel Elefteriades - Producer\nIbrahim Najjar - Justice Minister 2008–2011\nRomeo Lahoud - Director & Composer\nJawad Boulos - Historian and Politician\nElias Abou Chabake - Poet\nRudy Rahmé- Painter, sculptor and poet\nChecri Ganem - Patriot and Poet\nMay Ziadeh - Poet\nGhassan Tueni - Author, diplomat, journalist, public intellectual\nAntoine Abi-Zeid - Attorney, Secretary General, National Bloc Party\nMohammad-Ali Jamalzadeh - One of the most prominent Iranian writers of the 20th century\nYoussef Salameh - Minister\nRoger Eddé - Politician\nAntoine Kazan - Lawyer And Poet\n Bernard Barbour - International financial law counselor\n Nancy Ajram - Signer and Arab Music Idol\n Maurice Gemayel - Politician\n Mansour Bteich - Politician\n\nSee also\n Education in the Ottoman Empire\n\nOfficial website\n\nReferences\n\nCategory:French international schools in Lebanon\nCategory:Educational institutions established in 1834\nCategory:1834 establishments in the Ottoman Empire" ]

{ "pile_set_name": "Wikipedia (en)" }

[ 0.0006505076889880002, 0.0007130528683774173, 0.0008492375491186976, 0.0006827390170656145, 0.0006798944086767733, 0.0006988025270402431, 0.0006163174984976649, 0.0005722942878492177, 0.0006519065937027335, 0.000697772775311023, 0.0006410783971659839, 0.0007771534146741033, 0.0006080037564970553, 0.0006093982374295592, 0.0005792083102278411, 0.0020945370197296143, 0.0005588481435552239, 0.0006415077950805426, 0.0006838333210907876, 0.0006473575485870242, 0.0005912649212405086, 0.0005568640772253275, 0.0008574858657084405, 0.257616251707077, 0.0005972030339762568, 0.0005941058625467122, 0.0005827636341564357, 0.0007413476123474538, 0.0006740029202774167, 0.0005543742445297539, 0.000652917311526835, 0.0006189151317812502, 0.0017359646735712886, 0.0008354754536412656, 0.0012289423029869795, 0.0005889328313060105, 0.0005600358708761632, 0.0006039159488864243, 0.0008897722000256181, 0.0006046825437806547, 0.0005370349390432239, 0.000558681960683316, 0.0006090982351452112, 0.0006080315797589719, 0.0006171665736474097, 0.0005553754162974656, 0.000614864460658282, 0.0007082545780576766, 0.0007681162096560001, 0.0006848921766504645 ]

[ "Various News: Mike Tyson’s One Man Show, iPPV Shoot With Sami Calihan, MTV to Film at PWS\n\n– It was announced today that WWE Hall of Famer Mike Tyson’s one-man show “Undisputed” will be touring nationally. ", "The tour will kick off in February 2013 in Indianapolis and will go through 36 cities. ", "More information available at this link\n\n– CZW will present a live iPPV interview with Sami Callihan tonight featuring matches and Callihan interacting with fans while talking about his career. ", "That can be ordered at this link.", "\n\n– MTV will have a camera crew shooting footage next week at the December 6th PWS Bombshell Ladies of Wrestling event in Metuchen, NJ and the Pro Wrestling Syndicate event at the Sportsplex. ", "Miss Adiva, who works for PWS Bombshell, will be featured on an upcoming episode of MTV’s Made. ", "Here is the lineup for the show…" ]

{ "pile_set_name": "Pile-CC" }

[ 0.0006398148834705353, 0.0006561114569194615, 0.0006033334648236632, 0.0005665373173542321, 0.0006886989576742053, 0.0009581877384334803, 0.0010527806589379907 ]

[ "Central pontine myelinolysis presented after prophylactic cranial irradiation in small cell lung cancer.", "\nProphylactic cranial irradiation (PCI) should now be considered as a part of the standard treatment of patients with small cell lung cancer (SCLC) in complete remission. ", "The PCI has been offered in SCLC to reduce the incidence of brain metastasis and increase survival. ", "The complications of PCI were reported brain necrosis, seizure or dementia. ", "The complications were more frequent when chemotherapy was given at the time of cranial irradiation, or large radiation fraction size was employed. ", "It is established that the pathophysiological reaction to irradiation in the normal brain tissue is necrosis, demyelinization, and diffuse changes due to wall thickening of the vascular structures. ", "However, central pontine myelinolysis (CPM) of low dose irradiation like PCI is very rare. ", "We report a patient with the classical syndrome of CPM following PCI for SCLC. ", "The diagnosis was supported by typical features on magnetic resonance imaging." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.001587247010320425, 0.0007281346479430795, 0.0007635775255039334, 0.0006319667445495725, 0.0006020462024025619, 0.000685101724229753, 0.001206116285175085, 0.0006567648961208761, 0.000561757362447679 ]

[ "31 F.3d 135\nUNITED STATES of America, Appellant at No. ", "94-7000,v.", "Michael M. SCHEIN, Appellant at No. ", "93-7809.", "\nNos. ", "93-7809 & 94-7000.", "\nUnited States Court of Appeals,Third Circuit.", "\nSubmitted Under Third Circuit LAR 34.1(a)June 24, 1994.Decided July 29, 1994.", "\n\nMichael M. Schein, pro se Appellant in No. ", "93-7809, pro se Appellee in No. ", "94-7000.", "\nDavid M. Barasch, U.S. Atty., ", "Dennis C. Pfannenschmidt, Asst. ", "U.S. Atty., ", "Office of U.S. Atty., ", "Harrisburg, PA, for U.S.\nPRESENT: BECKER and HUTCHINSON, Circuit Judges, and PADOVA, District Judge*.", "\nOPINION OF THE COURT\nHUTCHINSON, Circuit Judge.", "\n\n\n1\nAppellant, Michael Schein (\"Schein\"), appeals a final judgment of conviction on obscenity charges entered against him by the United States District Court for the Middle District of Pennsylvania. ", " The government cross-appeals from the district court's decision to depart downward from the Sentencing Guidelines and place Schein on probation. ", " We will affirm Schein's conviction but vacate the sentence of probation because the district court did not give its reasons for departing downward. ", " Accordingly, we will remand the case to the district court to give it an opportunity to make findings in support of its downward departure or, in the absence of evidence to support such findings, to resentence Schein within the applicable guideline range.", "\n\n\n2\nSchein was indicted by a federal grand jury on eight counts, five for mailing obscene materials (Counts One through Five), one for making false declarations (Count Six), and two for criminal forfeiture (Counts Seven and Eight). ", " After Schein waived his right to a jury, the district court held a bench trial and found him guilty of Counts One through Five, not guilty of Count Six and disposed of Counts Seven and Eight charging forfeiture on the basis of a stipulation.", "\n\n\n3\nAt trial the government presented five tapes it had ordered from Schein's mail order catalog. ", " The tapes contain graphic depictions of urination, masturbation, and oral and anal sex among homosexual males. ", " The district court found these tapes were obscene and thus determined appellant was guilty of mailing obscene material in violation of 18 U.S.C.A. Sec. ", "1461 (West 1984). ", " Departing downward, the court sentenced Schein to twelve months probation.", "\n\n\n4\nIn his appeal Schein argues the district court wrongly concluded his videotapes were obscene.1 On cross-appeal the government argues the court's downward departure from the applicable Sentencing Guidelines range of eighteen to twenty-four months, to a sentence of twelve months probation, is not in accord with law.", "\n\n\n5\nWe first consider Schein's appeal from his conviction. ", " Obscene material is not protected by the First Amendment. ", " Whether material is obscene is judged under the three part Miller test. ", " See Miller v. California, 413 U.S. 15, 93 S.Ct. ", "2607, 37 L.Ed.2d 419 (1973). ", " This test requires us to determine:\n\n\n6\n(a) whether \"the average person, applying contemporary community standards\" would find that the work, taken as a whole, appeals to the prurient interest[ ]; (b) whether the work depicts or describes, in a patently offensive way, sexual conduct specifically defined by the applicable state law; and (c) whether the work, taken as a whole, lacks serious literary, artistic, political or scientific value.", "\n\n\n7\nId. at 24, 93 S.Ct. ", "at 2615 (citation omitted). ", " In deciding whether the evidence was sufficient to find Schein guilty of mailing obscene material, we must consider whether there is substantial evidence, viewing the record in a light most favorable to the government, to support the factfinder's verdict of guilty. ", " Government of the Virgin Islands v. Williams, 739 F.2d 936, 940 (3d Cir.1984).", "\n\n\n8\nSchein claims the tapes are not obscene because photographs of \"urolagnic\" pornography by Robert Mapplethorpe were shown at an exhibit funded by the government's National Endowment of the Arts. ", " We reject this argument. ", " Schein is not Mapplethorpe and it is plain that Schein's tapes lack serious artistic value, whatever artistic merit Mapplethorpe's work may have. ", " Moreover, mere availability of similar material is not a defense to obscenity. ", " Hamling v. United States, 418 U.S. 87, 126, 94 S.Ct. ", "2887, 2912, 41 L.Ed.2d 590 (1974) (\" 'Mere availability of similar material by itself means nothing more than that other persons are engaged in similar activity.' \") ", " (quoting, United States v. Manarite, 448 F.2d 583, 593 (2d Cir.1971)).", "\n\n\n9\nSchein next claims his videotapes come within part (c) of the Miller test excluding certain expressive materials from the class of those that are obscene because Schein's tapes promote sexual safety and therefore serve an important social interest. ", " We agree with Schein that materials which promote public health are not obscene just because they graphically depict human sexual or excretory acts. ", " Nevertheless, this argument also fails.", "\n\n\n10\nThe proper inquiry is not whether an ordinary member of any given community would find serious literary, artistic, political, or scientific value in allegedly obscene material, but whether a reasonable person would find such value in the material, taken as a whole.", "\n\n\n11\nPope v. Illinois, 481 U.S. 497, 500-01, 107 S.Ct. ", "1918, 1921, 95 L.Ed.2d 439 (1987) (footnote omitted). ", " Considering Schein's videotapes in their totality, we conclude that the district court did not err in deciding they served no serious public purpose. ", " As noted in Miller, \" '[a] quotation from Voltaire in the flyleaf of a book will not constitutionally redeem an otherwise obscene publication.' \" ", " Miller, 413 U.S. at 25 n. 7, 93 S.Ct. ", "at 2615 n. 7 (quoting Kois v. Wisconsin 408 U.S. 229, 231, 92 S.Ct. ", "2245, 2246, 33 L.Ed.2d 312 (1972)). ", " Schein's videotapes are not redeemed because the participants in the homosexual acts he depicts wear condoms and the viewers are reminded, from time to time, to have \"safe sex.\"", "\n\n\n12\nFinally, Schein argues he is not guilty because he took measures to make sure his videos were sold only to consenting adults, and therefore neither the \"average person\" nor the \"community\" were exposed. ", " Accordingly, he contends it is wrong to judge his work under Miller 's \"average person\" or \"community standards\" test for obscenity. ", " The taking of precautionary measures to make sure obscene materials are distributed only to consenting adults is not a defense to distribution of obscene material. ", " Obscene materials are not immune because only consenting adults see them. ", " Paris Adult Theatre I v. Slaton, 413 U.S. 49, 57, 93 S.Ct. ", "2628, 2635, 37 L.Ed.2d 446 (1973). ", " Schein claims that Paris is distinguishable because an adult movie theater has more impact than the viewing of videotapes in the privacy of one's home. ", " We do not believe this distinction is material. ", " The law prohibits use of the mails to distribute obscene material, and the Supreme Court has decided obscene material is no less obscene because it is viewed only by consenting adults. ", " \"We categorically disapprove the theory ... that obscene, pornographic films acquire constitutional immunity from state regulation simply because they are exhibited for consenting adults only.\" ", " Id. Moreover, it would be impossible for Schein or any other purveyor of obscene materials to provide any real assurance that the persons ordering the obscene materials were all consenting adults who would restrict their viewing to themselves or their families in a private setting.", "\n\n\n13\nIn its cross-appeal the government contends the district court erred in departing downward from the Guidelines sentence. ", " The district court's power to depart downward is a legal question subject to plenary review. ", " United States v. Higgins, 967 F.2d 841, 844 (3d Cir.1992). ", " Whether a departure was based on incorrect factual findings, however, is judged under the clearly erroneous standard. ", " United States v. Shoupe, 929 F.2d 116, 119 (3d Cir.), ", "cert. ", "denied, --- U.S. ----, 112 S.Ct. ", "382, 116 L.Ed.2d 333 (1991).", "\n\n\n14\nHere the sentencing court departed downward from the guideline range of eighteen to twenty-four months incarceration to twelve months probation. ", " It concluded, \"the sentence required by the guidelines overstates the seriousness of the offense committed by the defendant in this case, particularly as he is a first offender....\" Appendix at 112. ", " This conclusory statement is not adequate for us to determine whether Schein meets any of the guideline requirements for downward departure.", "\n\n\n15\n[T]he Sentencing Reform Act requires a sentencing court to impose a sentence within the range prescribed by the Guidelines \"unless the court finds that there exists an aggravating or mitigating circumstance of a kind, or to a degree, not adequately taken into consideration by the Sentencing Commission in formulating the guideline that should result in a sentence different from that described.\" ", " 18 U.S.C.A. Sec. ", "3553(b). ", " \"This provision is mandatory.\"", "\n\n\n16\nShoupe, 929 F.2d at 119 (quoting United States v. Uca, 867 F.2d 783, 786 (3d Cir.1989)). ", " Moreover, there is no provision in the Sentencing Reform Act or the Guidelines that provides for a downward departure because Guidelines overstates the seriousness of the offense, (in contrast, e.g., to overstatement of the seriousness of the defendant's criminal record). ", " Under U.S.S.G. Sec. ", "5H1.4, however, \"an extraordinary physical impairment may be a reason to impose a sentence below the applicable guideline range....\" Schein, an avowed homosexual, has tested HIV positive, and he may have a related serious physical complication. ", " Thus, there may be a reason to grant a downward departure in his case. ", " The district court, however, has not made any findings on the extent to which Schein suffers from physical impairment. ", " Therefore, there is no basis in the present record on which this Court could decide that any mitigating circumstances relating to Schein's health exist that would justify the district court's downward departure. ", " Accordingly, we must vacate the sentence of the district court and remand this case for further appropriate findings or, in their absence, resentencing within the Guidelines.", "\n\n\n17\nWe will affirm Schein's conviction, but, on the government's cross-appeal, we will vacate his sentence and remand to the district court for further proceedings consistent with this opinion.", "\n\n\n\n*\n Hon. ", " John R. Padova, United States District Judge for the Eastern District of Pennsylvania, sitting by designation\n\n\n1\n Appellant also argues the firearms the government seized from him should be returned. ", " This issue was not presented to the district court, and therefore it is not properly raised on appeal. ", " Nevertheless, we note that the government has agreed to have a licensed federal firearms dealer sell the weapons and have the proceeds distributed to Schein\n\n\n" ]

{ "pile_set_name": "FreeLaw" }

[ 0.0007399359601549804, 0.0008831118466332555, 0.0007353941327892244, 0.0008726264932192862, 0.0008322071516886353, 0.0007777112768962979, 0.000868430535774678, 0.0006092611001804471, 0.0007092785672284663, 0.0008002898539416492, 0.0008517972310073674, 0.0009336753282696009, 0.028689196333289146, 0.00093490956351161, 0.0006727104191668332, 0.0006085330969654024, 0.000734851520974189, 0.0008493722416460514, 0.0008254958665929735, 0.000864836445543915, 0.0005965871969237924, 0.0011579114943742752, 0.0014837331837043166, 0.0006055482663214207, 0.951700747013092, 0.0014470042660832405, 0.0007050970452837646, 0.002114845672622323, 0.0009476853883825243, 0.0006286569987423718, 0.006021920591592789, 0.002409812528640032, 0.0007932335138320923, 0.0007358469883911312, 0.0007689470076002181, 0.0008968294714577496, 0.0005839362274855375, 0.0007521176594309509, 0.0006868852651678026, 0.00141151063144207, 0.0008570937206968665, 0.0010959759820252657, 0.0027691228315234184, 0.0011517417151480913, 0.0006208413979038596, 0.0006696060299873352, 0.006158648990094662, 0.04031481221318245, 0.0010543193202465773, 0.0006152792484499514, 0.0010509107960388064, 0.0006156780873425305, 0.0006787374732084572, 0.0007210829644463956, 0.0008895653299987316, 0.00076064164750278, 0.0006733984337188303, 0.5679315328598022, 0.001410856144502759, 0.0010386172216385603, 0.01636313647031784, 0.05282479152083397, 0.0009066875791177154, 0.0007041616481728852, 0.0007642858545295894, 0.0006557976012118161, 0.01358021516352892, 0.0017371284775435925, 0.02275470644235611, 0.0006400531274266541, 0.000710877648089081, 0.0008430069428868592, 0.0005873573827557266, 0.0009658285998739302, 0.0010973613243550062, 0.0007904322119429708, 0.0007010794943198562, 0.0009012637892737985, 0.0007016335730440915, 0.0006300570094026625, 0.0035434276796877384, 0.0014541868586093187, 0.000761775765568018, 0.0006950691458769143, 0.000765427656006068, 0.0005827653221786022, 0.0011194737162441015, 0.12441318482160568, 0.0005745731177739799, 0.0010623822454363108, 0.0008122067665681243, 0.0006085577188059688, 0.0006713283946737647, 0.0009620690834708512, 0.000684630183968693, 0.0006936255376785994, 0.0007142348913475871 ]

[ "Low-dose gonadotrophin stimulation for luteal phase defects--does absence of LH help pregnancy rates?", "\nBased on data suggesting that higher serum LH levels during the follicular phase may decrease subsequent pregnancy rates and increase spontaneous abortion rates, the study presented herein was designed to compare the pregnancy and abortion rates in patients treated with gonadotrophin preparations with and without LH content. ", "Infertile patients with luteal phase defects related to releasing eggs prior to complete follicular maturation were randomized into two treatment arcs: ultra-low-dose (75IU) human menopausal gonadotrophin (hMG) versus pure FSH. ", "However, they were given the right to refuse the recommended treatment and use the other one if they preferred. ", "Pregnancy and spontaneous abortion rates were determined for first cycle of therapy. ", "The pregnancy rates for hMG versus pure FSH was 22.7 percent and 20.3 percent, respectively. ", "The spontaneous abortion rates were also similar (8 percent and 9.1 percent). ", "There were no multiple births resulting from these 36 pregnancies. ", "Ovarian hyperstimulation syndrome was not observed in any of the 164 stimulation cycles. ", "These data demonstrate that the use of an ultra-low-dose gonadotrophin stimulation regimen is an effective method of correcting infertility related to luteal phase defects related to follicular maturation defects since the overall pregnancy rate per first cycle of treatment was 22 percent despite a minimum of 10 months of infertility duration. ", "Furthermore, an ultra-low-dose gonadotrophin regimen is safe for treating luteal phase defects in that there was no ovarian hyperstimulation or multiple births demonstrated. ", "These results also show no advantage of choosing a preparation devoid of LH, thus giving the patient the opportunity to purchase the least expensive medication that is available." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.0009985341457650065, 0.0006723912665620446, 0.00208823150023818, 0.0006050856318324804, 0.0005605309270322323, 0.001995347673073411, 0.0006757623632438481, 0.0009516969439573586, 0.004599049687385559, 0.0010622557019814849, 0.002085383515805006, 0.0006538436282426119 ]

[ "Kutacane\n\nKutacane is a town in Aceh province of Indonesia and it is the seat (capital) of Southeast Aceh Regency, Indonesia. ", "Kutacane is known as the main gate to the Gunung Leuser National Park.", "\n\nSusi Air & NBA flies to Kutacane Airport from Medan and Banda Aceh.", "\n\nReferences \n\nCategory:Populated places in Aceh\nCategory:Regency seats of Aceh" ]

{ "pile_set_name": "Wikipedia (en)" }

[ 0.0009550619288347661, 0.0018761693499982357, 0.0006911455420777202, 0.0006041992455720901 ]

[ "Earlier this month, Angel Dobbs, 38, and her niece Ashley Dobbs, 24, settled a lawsuit with the DPS for $185,000 after they were subjected to a similar roadside cavity search.", "\n\nReceive the latest local updates in your inbox\n\nThe Texas Department of Public Safety is being sued by two Houston women who allege they were subjected to illegal full cavity searches on the side of a road during a traffic stop.", "\n\nThe Houston Chronicle reports 27-year-old Brandy Hamilton and 26 year-old Alexandria Randle were stopped for speeding by trooper Nathaniel Turner as they returned home from the beach on Memorial Day 2012.", "\n\nThe lawsuit, filed last week, alleges Turner radioed for a female officer to search both women for possible drugs.", "\n\n\"Then Defendant Turner tells Plaintiff Hamilton `she is about to get up-close and personal with some womanly parts,\"' the lawsuit says. ", "Turner told Hamilton, \"She (Bui) is going to search you, I ain't, because I ain't about to get up-close and personal with your woman areas ... she is going to put some gloves on.\"", "\n\nThe women allege Trooper Jennie Bui used the same pair of gloves while performing full cavity searches on them while two male officers and passersby observed.", "\n\nA videotape shows that Hamilton was visibly upset while Bui was searching her. \"", "Do you know how violated I feel?\", ", "the plaintiff can be heard telling the female officer in the recording of the dashcam audio.", "\n\nNo drugs were found during the search but the women were given a ticket for possession of drug paraphernalia.", "\n\nIn a statement, DPS officials say Bui was fired June 29 and Turner was suspended June 10 over the incident, the Texas DPS said in a statement Wednesday.", "\n\nThe lawsuit also names as defendants DPS Director Steven McCraw; Brazoria County Sheriff's Deputy Aaron Kindred, who responded to the scene; and Brazoria County Sheriff Charles Wagner.", "\n\nChief Deputy Jeff Adkins of Brazoria County SO declined to comment, saying, \"We have no comment at all about pending civil litigation.\"", "\n\nHouston attorney Allie Booker represents the women and called the search a violation of her clients' constitutional rights.", "\n\n\"These women were violated in ways that no person should endure in broad-open public, on the side of the road,\" the attorney states in the lawsuit.", "\n\nEarlier this month, Angel Dobbs, 38, and her niece Ashley Dobbs, 24, settled a lawsuit with the DPS for $185,000 after they were subjected to a similar roadside cavity search. ", "In the Dobbs' case, the female officer who conducted the search now faces sexual assault charges." ]

{ "pile_set_name": "Pile-CC" }

[ 0.0011725275544449687, 0.003463086439296603, 0.0006002871668897569, 0.007833054289221764, 0.0632086768746376, 0.2536691725254059, 0.004112934228032827, 0.0005976950633339584, 0.02877267636358738, 0.0006374104996211827, 0.0027053707744926214, 0.0006926192436367273, 0.0007286070613190532, 0.0006285955896601081, 0.0008165159379132092, 0.01609269343316555, 0.0011725275544449687, 0.03874336928129196 ]

[ "Field of the Invention\nThe present invention relates generally to apparatus, systems, and methods for noninvasively measuring cardiac output (CO) and left ventricular stroke volume (SV). ", "More specifically, the invention includes systems and methods that measure CO and/or SV using plethysmographic waveform data collected by a pulse oximeter.", "\nDescription of Related Art\nThere has been a long felt need in the medical arts for a noninvasive way to measure left ventricular stroke volume (SV) and cardiac output (CO). ", "SV is the volume of blood pumped by the left ventricle of the heart with a single heart cycle. ", "CO is the product of SV and hear rate (HR). ", "SV and CO are important physiological parameters for a number of medical conditions, including congestive heart failure (CHF).", "\nPatients being treated for heart failure are normally medicated with drugs that regulate diuresis and heart muscle function. ", "An important aim of drug therapy is to maintain a CO that is sufficient to perfuse tissues with oxygenated blood. ", "It is advantageous to use the lowest possible doses of drugs to manage CHF because the drugs used produce unwanted side effects. ", "To optimally manage the dosage and selection of drugs in the treatment of CHF, one must monitor CO to assess the efficacy of the drugs and dosages being administered and/or to monitor patient compliance.", "\nCurrently, CO is measured using invasive techniques such as the Fick method, the Thermodilution method, and implantable microelectromechanical devices (MEMs), also called CardioMEMs. ", "The Fick method involves the measurement of oxygen consumption and computing the arteriovenous difference using samples of arterial blood and mixed venous blood from the pulmonary artery. ", "The thermodilution method measures the rate at which cold saline solution is diluted in the blood. ", "Both of these methods are performed in a hospital setting because they require the placement of a catheter in the pulmonary artery. ", "Additionally, the use of a pulmonary artery catheter use may also increase morbidity in critically ill patients. ", "CardioMEMs are surgically implanted into patients in a hospital setting and, once implanted, provide measurements of SV and CO that can be used to monitor patients. ", "The implantation of the cardioMEMs device into the pulmonary artery, however, is expensive and is performed in a hospital setting and involves the risks associated with heart catheterization.", "\nLess invasive techniques for measuring SV and CO include esophageal Doppler and transesophageal echocardiography. ", "Esophageal Doppler measures blood flow velocity in the descending thoracic aorta using a flexible ultrasound probe that is inserted into the esophagus. ", "The blood flow velocity is combined with an estimate of the cross-sectional area of the aorta estimated from the patient's age, height, and weight to calculate SV and CO. ", "This technique requires someone with technical skill to insert an esophageal Doppler monitor, which must be properly aligned with respect to the thoracic aorta to provide accurate measurements. ", "Transesophageal echocardiography involves measuring SV using flow velocity calculated from the area under the measured Doppler velocity waveform at the pulmonary artery, the mitral valve, or the aortic valve. ", "This technique requires a highly trained operator to position and place the esophageal Doppler monitor. ", "These procedures are not truly noninvasive because accessing the esophagus is perceived by patients as invasively uncomfortable.", "\nTruly noninvasive methods, apparatus, and systems are needed that can measure SV and CO, preferably in the homes of patients without the need for skilled caregivers. ", "Pulse oximetry has been investigated for decades as a possible tool for the noninvasive measurement of SV and CO. ", "A pulse oximeter (PO) is a device that obtains photoplethysmography (PPG) data, which measures changes in blood volume within a tissue caused by the pulse of blood pressure through the vasculature in the tissue. ", "The blood volume change is detected by measuring the amount of light transmitted or reflected to a sensor from a light source used to illuminate the skin. ", "The shape of the PPG waveform varies with the location and manner in which the pulse oximeter is contacted with the body. ", "In addition to PPG data, a pulse oximeter measures peripheral oxygen saturation (SpO2). ", "Most often, the device operates in a transmission mode in which two wavelengths of light are passed through a body part to a photodetector. ", "Changes in absorbance at each of the wavelengths are measured, which allow the determination of the absorbance due to pulsing arterial blood, excluding venous blood, skin, bone, muscle, and other tissues. ", "Alternatively, reflectance pulse oximetry can be used. ", "A typical pulse oximeter comprises a data processor and a pair of light-emitting diodes (LEDs) facing a photodiode. ", "One LED produces red light having a wavelength of 660 nm, the other infrared light having a wavelength of 940 nm. ", "Oxygenated hemoglobin absorbs more infrared light and less red light than hemoglobin. ", "The transmission signals fluctuate over time because of changes in the amount of arterial blood present in the tissue caused by the blood pulse associated with each cycle of the heart. ", "The ratio of red light measured to infrared light measured is calculated by the processor and is converted by the processor to SpO2 using a lookup table based on the Beer-Lambert law.", "\nAwad et al. (", "J. Clinical Monitoring and Computing, 2006, 20:175-184) reports that researchers have been attempting to understand the relationship between central cardiac hemodynamics and the resulting measured peripheral waveforms. ", "Awad et al. ", "studied ear pulse oximeter waveforms in order to understand the underlying physiology reflected in these waveforms and to extract information about cardiac performance. ", "Multi-linear regression analysis of ear plethysmographic waveform components were used to estimate CO from the ear plethysmograph and it was determined that ear plethysmographic width correlates with CO. ", "Awad et al. ", "does not suggest that this correlation allows pulse oximetry or plethysmographic data to be used to calculate SV or CO.", "\nNatalini et al. (", "Anesth. ", "Analg. ", "2006, 103:1478-1484) reports the use of pulse oximetry to predict which hypotensive patients are likely to respond positively to increasing blood volume. ", "Arterial blood pressure changes during mechanical ventilation are reported as accurately predicting fluid responsiveness. ", "Photoplethysmographic (PPG) waveform variations measured by pulse oximetry showed a correlation with measured pulse pressure variation values associated with fluid responsiveness but neither SV nor CO were calculated. ", "Natilini does not indicate that SV or CO can be calculated using PPG data.", "\nUS 2013/0310669 discloses a method for determining mixed venous oxygen saturation (SvO2) using a photoplethysmography pulse oximeter (PPG PO) device that measures changes in pulmonary circulation using a light source and a light detector applied to the thoracic wall of a patient. ", "The light source and the detector are separated by at least 15-20 mm so that the region of illumination overlaps a portion of the pulmonary microcirculation beneath the PPG device. ", "The contribution of circulation in the thoracic wall to the PPG signal must be assessed using an additional detector and/or light source that is attached to the thoracic wall less than 8 mm apart. ", "The SvO2 value can be used to calculate CO using the Fick method from the values of total oxygen consumption, arterial oxygen content and venous oxygen content. ", "One drawback of this method is that the pulmonary microcirculation is surrounded by bone, muscle, and other tissues that make the contribution of circulation in the thoracic wall to the PPG signal difficult to measure reliably. ", "Another drawback is that the measured values depend on the accurate placement of the light emitters and sensors, which may be difficult to reproduce for each subsequent measurement.", "\nU.S. Pat. ", "No. ", "9,289,133 discloses a method and apparatus for monitoring proportional changes in CO from a blood pressure signal measurement obtained by fingertip PPG. ", "A time constant of the arterial tree is defined as the product of the total peripheral resistance (TPR) and a constant arterial compliance and is determined by analyzing long time scale variations of more than one cardiac cycle. ", "A value proportional to CO is determined from the ratio of the blood pressure signal to the estimated time constant using Ohm's law. ", "An invasive, absolute CO calibrating measurement is required to derive absolute CO values from the proportional CO change values obtained using PPG. ", "This method and apparatus cannot measure values for SV or CO without an invasive CO measurement and therefore requires a hospital setting and skilled medical personnel.", "\nWO 2010/0274102 A1 discloses a data processing method and associated apparatus and systems that measures SV and CO from pulse oximetry data. ", "The pulse oximeter system comprises a data processor configured to perform a method that combines a probabilistic processor and a physiological model of the cardiovascular system in a Dynamic State-Space Model (DSSM) that can remove contaminating noise and artifacts from the pulse oximeter sensor output and measure blood oxygen saturation, HR, SV, aortic pressure and systemic pressures. ", "This pulse oximeter and associated method provides truly noninvasive measurement of CO and SV suitable for monitoring patients with CHF. ", "The DSSM comprises a mathematical model of the cardiovascular system that models the physiological processes which produce the pulses measured by the pulse oximeter. ", "In one embodiment, the model comprises parameters including aortic pressure, radial pressure, peripheral resistance, aortic impedance, and blood density." ]

{ "pile_set_name": "USPTO Backgrounds" }

[ 0.0006300206296145916, 0.0006208937265910208, 0.0006994921714067459, 0.008871899917721748, 0.0009606659295968711, 0.000822761794552207, 0.001363922143355012, 0.0016717638354748487, 0.001219731755554676, 0.0006109590758569539, 0.005676328670233488, 0.015882309526205063, 0.004930666647851467, 0.0006636951002292335, 0.0018192320130765438, 0.0007846236694604158, 0.0006234925822354853, 0.0009230218711309135, 0.007425985299050808, 0.00070707977283746, 0.0012008162448182702, 0.0006889832438901067, 0.0020187688060104847, 0.006380664650350809, 0.000685146835166961, 0.0006035391124896705, 0.000837458879686892, 0.0008022819529287517, 0.0005721612251363695, 0.0005655664717778563, 0.0006492187967523932, 0.0006726986030116677, 0.0006401766440831125, 0.0007431824924424291, 0.0005940596456639469, 0.0012552525149658322, 0.0006588365649804473, 0.0006043423782102764, 0.0006411049980670214, 0.0005818847566843033, 0.0007512930897064507, 0.0005366864497773349, 0.0006927687209099531, 0.0007512930897064507, 0.000675894960295409, 0.0006292543257586658, 0.006433678325265646, 0.0010831645922735333, 0.0008233641856350005, 0.0006417835829779506, 0.0006446515908464789, 0.0006883377209305763, 0.0006356945377774537, 0.0005814897594973445, 0.0007486208924092352, 0.001328538521192968, 0.0010747279739007354, 0.0007796282297931612, 0.0010884626535698771, 0.0013785817427560687, 0.0006574562867172062, 0.0006122452905401587, 0.0007307505002245307, 0.0006659526261501014, 0.0005943113937973976, 0.0006226235418580472, 0.0006216514157131314, 0.0006463236641138792, 0.0005862608668394387, 0.0006698108627460897 ]

[ "À une semaine du jour du scrutin, Thomas Mulcair ne s’avoue pas vaincu et continue de prétendre que les Canadiens ont droit à une course à trois, en dépit des sondages qui laissent entrevoir qu’il a perdu des plumes.", "\n\nCar les sondeurs sont loin d’être infaillibles, à ses yeux. « ", "Moi, j’étais là en 2011. ", "J’ai vu les mêmes compagnies de sondage qui nous mettaient à une semaine des élections en quatrième place au Québec », a-t-il lancé lundi à Maple Ridge, en Colombie-Britannique.", "\n\nPour le chef du Nouveau Parti démocratique, l’actuelle campagne reste encore, à ce jour, une course à trois dans laquelle son parti peut sortir gagnant. « ", "Moi, je sais que le NPD offre l’espoir de rompre avec une mauvaise habitude vieille de 148 ans : lorsqu’on est tannés des conservateurs, on est obligés de retourner aux libéraux et ainsi de suite », a-t-il dit.", "\n\nAlors que fusaient les questions des journalistes sur comment il entendait renverser la vapeur, M. Mulcair ne s’est pas laissé ébranler, insistant sur l’importance pour les électeurs de saisir l’occasion qui s’offre à eux. « ", "Pour la première fois de l’histoire du Canada, un autre parti que les deux vieux autres partis est l’opposition officielle et forme un gouvernement en attente », a-t-il rappelé.", "\n\nPour se différencier de Justin Trudeau, qui semble avoir le vent dans les voiles, M. Mulcair a essayé de le mettre dans le même panier que Stephen Harper. ", "Depuis plusieurs jours, il martèle que, comme le chef conservateur, M. Trudeau a voté pour la loi antiterroriste C-51, est en faveur d’une baisse d’impôts pour les grandes sociétés, souhaite que le projet de pipeline Keystone XL fonctionne.", "\n\nEt surtout, le chef libéral s’est rangé derrière le premier ministre sortant dans le dossier du Partenariat transpacifique.", "\n\n« Aujourd’hui, je veux dire directement à M. Harper et à M. Trudeau : pourquoi ne croyez-vous pas qu’un meilleur accord soit possible pour le Canada ? », ", "a-t-il demandé. ", "M. Mulcair affirme qu’il ne se sentirait pas lié à l’entente signée avec 11 autres pays et qu’il forcerait la renégociation du Partenariat.", "\n\nLe point sur les garderies\n\nLe chef néodémocrate a par ailleurs confirmé que ce serait à Québec de décider quoi faire de l’argent qu’un gouvernement du NPD lui verserait pour son système de garderies.", "\n\nLe NPD a promis dans sa plateforme électorale de créer 1 million de places de garderies à travers le pays, au coût de seulement 15 $ par jour. ", "Or, au Québec, le gouvernement de Philippe Couillard module dorénavant le prix des Centres de la petite enfance (CPE) et des garderies privées subventionnées en fonction du revenu des parents. ", "Certains paient ainsi jusqu’à 20 $ par jour pour une place subventionnée par l’État.", "\n\nInvité à préciser sa promesse, M. Mulcair a rappelé que son parti assure Québec d’un droit de compensation sans condition pour tout programme fédéral. ", "Ce serait donc Québec qui déciderait que faire du 800 millions $ de transfert que le NPD calcule comme étant la compensation pour son programme national de garderies.", "\n\nEn d’autres mots, si M. Couillard insistait pour un tarif à 20 $ alors que le reste du Canada disposait de garderies à 15 $, son choix serait respecté.", "\n\n« Ce serait l’ultime ironie, c’est la seule province qui a un système de garderie complet, abordable, pour l’ensemble de la population », a noté M. Mulcair.", "\n\n« Mais oui, c’est le Québec qui va avoir le dernier mot là-dessus », a-t-il ajouté.", "\n\nM. Mulcair mettra le pied dans trois provinces lundi. ", "Après un séjour de deux jours en Colombie-Britannique, il prendra la route pour Saskatoon, puis pour Toronto." ]

{ "pile_set_name": "OpenWebText2" }

[ 0.008578884415328503, 0.03539245203137398, 0.0010430943220853806, 0.0016555736074224114, 0.0010593710467219353, 0.02539816126227379, 0.0079397177323699, 0.011650972999632359, 0.0008647713693790138, 0.00781480222940445, 0.0018385287839919329, 0.001027328660711646, 0.07709626853466034, 0.011742468923330307, 0.0017902632243931293, 0.003078014124184847, 0.0007920408388599753, 0.004490438848733902, 0.0014266762882471085, 0.009390230290591717, 0.01368782203644514, 0.0011360126081854105, 0.01783866062760353, 0.0008121658465825021, 0.0008271178230643272 ]

[ "import Reaction from './Reaction';\nimport NewReaction from './NewReaction';\nimport { updateReaction } from './api';\n\nexport default class Reactions extends React.", "Component {\n constructor(props) {\n super(props);\n\n this.state = {\n t: props.updated || Date.now(),\n reactions: this.props.reactions || [],\n };\n }\n\n static getDerivedStateFromProps(props, state) {\n if (props.onChange && props.reactions !", "== state.reactions) {\n return {\n reactions: props.reactions,\n };\n }\n return null;\n }\n\n onSelect = (name, option) => {\n const { subjectType, subjectId } = this.props;\n\n updateReaction({\n subjectType,\n subjectId,\n name,\n option,\n })\n .then((result) => {\n this.updateReactions(result.updateReaction);\n })\n .catch((errors) => {\n window.", "App.alert(errors);\n });\n };\n\n updateReactions = (newReactions) => {\n const { onChange } = this.props;\n if (onChange) {\n onChange(newReactions);\n } else {\n this.setState({ reactions: [] });\n this.setState({ reactions: [...newReactions] });\n }\n };\n\n render() {\n const { t, reactions = [] } = this.state;\n const { mode = 'normal' } = this.props;\n\n let boxClassName = 'reaction-box';\n if (mode === 'normal' && reactions.length === 0) {\n boxClassName += ' reaction-box-empty';\n }\n return (\n <div class={boxClassName} updated={t}>\n {mode !", "== 'new_button'\n && reactions.map(reaction => (\n <Reaction\n {...this.props}\n reaction={reaction}\n className=\"reaction-summary-item\"\n onSelect={this.onSelect}\n />\n ))}\n {mode !", "== 'list' && <NewReaction {...this.props} onSelect={this.onSelect} />}\n </div>\n );\n }\n}\n" ]

{ "pile_set_name": "Github" }

[ 0.0006877357955090702, 0.0009255881304852664, 0.003924450371414423, 0.0016543043311685324, 0.0009168004617094994, 0.001952720689587295 ]

[ "Systems and methods herein generally relate to current leakage in circuitry and to correcting for current leakage in circuits that are used in humid environments.", "\nFor some high-voltage power supply applications, current leakage from the high-voltage output circuit should be limited because the amount of current leakage correspondingly reduces the amount of output current. ", "One example of such an application is a high-voltage DC current source for charging a bias transfer roll (BTR) in an electrostatic printer. ", "Typically, voltages of up to 6 kV are required in a bias transfer roll to obtain currents well below 100 uA. The current source in a bias transfer roll must also have an accuracy of uA's, so any current leakage can substantially decrease the performance of the bias transfer roll.", "\nHigh-voltage circuits on printed circuit boards (PCB's) can easily leak current if they are situated in a humid environment. ", "The PCB material has the ability to absorb water, which makes the surface relatively conductive, resulting in current leakage. ", "Factors that contribute to current leakage are the material properties and the level of contamination of the surface (flux residue) of the PCB. ", "Further, this effect is especially noticeable at high voltages and low currents, where operation relies on the insulating properties.", "\nThere are a number of methods used to prevent or reduce such current leakage. ", "One method is to encapsulate the high-voltage circuit in a housing so that it is not exposed to the humid environment. ", "These (potting) techniques are very effective, but relatively costly. ", "If the high-voltage output must be available on the PCB for interfacing, this technique is not adequate.", "\nAnother method is to use shielding techniques, where the high-voltage (circuits) are surrounded or separated by conductive shields. ", "The leakage current, picked-up by the shield, is measured and used for correcting the output current or voltage accordingly. ", "This works best if the shield is nearby the high-voltage circuit and completely surrounds it. ", "However, such shields increase the leakage and can potentially cause insulation breakdown (arcing/tracking). ", "Also, on single-sided PCB's the leakage across the top side surface (where there is no shield) cannot be measured.", "\nAnother method, commonly used in printing machines, is to utilize a humidity sensor. ", "With this, the relative humidity of the general machine environment is monitored and fed back to the processor unit for changing the setpoints required for maintaining the image quality. ", "One of these setpoints is the BTR current. ", "This approach does not take into account that the (relative) humidity in the area where the high-voltage power supply (HVPS) resides can be completely different. ", "Also, the contamination degree of the HVPS PCB surface and the content of previously absorbed water in the PCB is not a constant factor over time. ", "Furthermore, such methods rely on an HVPS manufactured with controlled PCB cleanliness." ]

{ "pile_set_name": "USPTO Backgrounds" }

[ 0.0006278758519329131, 0.0006926321657374501, 0.0007222435087896883, 0.0008387799025513232, 0.0007645097794011235, 0.0007554963231086731, 0.0005544899613596499, 0.0007143659167923033, 0.0007576898788101971, 0.0008241993491537869, 0.0007021637284196913, 0.0006186225800774992, 0.0006559310131706297, 0.0007814945420250297, 0.0006567755481228232, 0.0007962256204336882, 0.0007276390679180622, 0.0006291188183240592, 0.0005495420191437006, 0.0005854634800925851, 0.0006041526212356985, 0.0006146043306216598, 0.0007535208715125918 ]

[ "Q:\n\nCan't see the entire text with a nestedscrollview and cardview\n\nI use a coordinator layout, with a collapsing toolbar and a nestedscrollview.", "\nPutting Lorem Ipsum code, I can't see the end of the text, because I can scroll, but not until the end.", "\nAnd when I put more text, I can scroll further, but still not until the end.", "\nHere is my example :\n\nThe last line isn't the last in my code.", "\nMy xml : \n<?", "xml version=\"1.0\" encoding=\"utf-8\"?", ">\n<android.support.design.widget.", "CoordinatorLayout xmlns:android=\"http://schemas.android.com/apk/res/android\"\n xmlns:app=\"http://schemas.android.com/apk/res-auto\"\n xmlns:tools=\"http://schemas.android.com/tools\"\n android:layout_width=\"match_parent\"\n android:layout_height=\"match_parent\"\n android:fitsSystemWindows=\"true\"\n tools:context=\"fr.djey.secretapp.", "MainActivity\">\n\n <android.support.design.widget.", "AppBarLayout\n android:layout_width=\"match_parent\"\n android:layout_height=\"wrap_content\"\n android:theme=\"@style/AppTheme.", "AppBarOverlay\">\n\n <android.support.design.widget.", "CollapsingToolbarLayout\n android:id=\"@+id/collapse_toolbar\"\n android:layout_width=\"match_parent\"\n android:layout_height=\"match_parent\"\n app:layout_scrollFlags=\"scroll|exitUntilCollapsed\"\n android:fitsSystemWindows=\"true\"\n app:contentScrim=\"?attr/colorPrimary\"\n app:expandedTitleMarginStart=\"48dp\"\n app:expandedTitleMarginEnd=\"64dp\">\n\n <ImageView\n android:layout_width=\"wrap_content\"\n android:layout_height=\"wrap_content\"\n android:src=\"@drawable/image\"\n android:fitsSystemWindows=\"true\"\n app:layout_collapseMode=\"parallax\"\n android:scaleType=\"centerCrop\"/>\n\n <android.support.v7.widget.", "Toolbar\n android:id=\"@+id/toolbar\"\n android:layout_width=\"match_parent\"\n android:layout_height=\"?attr/actionBarSize\"\n app:popupTheme=\"@style/ThemeOverlay.", "AppCompat.", "Light\"\n app:layout_collapseMode=\"pin\"/>\n\n </android.support.design.widget.", "CollapsingToolbarLayout>\n\n </android.support.design.widget.", "AppBarLayout>\n\n <android.support.v4.widget.", "NestedScrollView\n android:layout_width=\"match_parent\"\n android:layout_height=\"match_parent\"\n android:layout_gravity=\"fill_vertical\"\n app:layout_behavior=\"@string/appbar_scrolling_view_behavior\">\n\n <android.support.v7.widget.", "CardView\n android:layout_width=\"match_parent\"\n android:layout_height=\"wrap_content\"\n android:layout_margin=\"16dp\">\n\n <LinearLayout\n android:layout_width=\"match_parent\"\n android:layout_height=\"wrap_content\"\n android:orientation=\"vertical\"\n android:padding=\"16dp\">\n\n <TextView\n android:id=\"@+id/description\"\n android:layout_width=\"match_parent\"\n android:layout_height=\"wrap_content\"\n android:text=\"@string/lorem_ipsum\"\n android:textColor=\"@android:color/black\"/>\n\n </LinearLayout>\n\n </android.support.v7.widget.", "CardView>\n\n </android.support.v4.widget.", "NestedScrollView>\n\n <android.support.design.widget.", "FloatingActionButton\n android:id=\"@+id/fab\"\n android:layout_width=\"wrap_content\"\n android:layout_height=\"wrap_content\"\n android:layout_gravity=\"bottom|end\"\n android:layout_margin=\"@dimen/fab_margin\"\n android:src=\"@android:drawable/ic_dialog_email\" />\n\n</android.support.design.widget.", "CoordinatorLayout>\n\nMaybe that's because of the emulator?", "\nEDIT : \nReply for the Madhur answer :\nI've tested to put a frame instead of the nestedscrollview and replace with java this frame on navigationview item click. ", "It replaces the frame here :\n<?", "xml version=\"1.0\" encoding=\"utf-8\"?", ">\n<android.support.design.widget.", "CoordinatorLayout xmlns:android=\"http://schemas.android.com/apk/res/android\"\n xmlns:app=\"http://schemas.android.com/apk/res-auto\"\n xmlns:tools=\"http://schemas.android.com/tools\"\n android:layout_width=\"match_parent\"\n android:layout_height=\"match_parent\"\n android:fitsSystemWindows=\"true\"\n tools:context=\"fr.djey.secretapp.", "MainActivity\">\n\n <android.support.design.widget.", "AppBarLayout\n android:layout_width=\"match_parent\"\n android:layout_height=\"wrap_content\"\n android:theme=\"@style/AppTheme.", "AppBarOverlay\">\n\n <android.support.design.widget.", "CollapsingToolbarLayout\n android:id=\"@+id/collapse_toolbar\"\n android:layout_width=\"match_parent\"\n android:layout_height=\"match_parent\"\n app:layout_scrollFlags=\"scroll|exitUntilCollapsed\"\n android:fitsSystemWindows=\"true\"\n app:contentScrim=\"?attr/colorPrimary\"\n app:expandedTitleMarginStart=\"48dp\"\n app:expandedTitleMarginEnd=\"64dp\">\n\n <ImageView\n android:id=\"@+id/collapsing_image\"\n android:layout_width=\"wrap_content\"\n android:layout_height=\"wrap_content\"\n android:fitsSystemWindows=\"true\"\n app:layout_collapseMode=\"parallax\"\n android:scaleType=\"centerCrop\"\n android:src=\"@drawable/welcome\"/>\n\n <android.support.v7.widget.", "Toolbar\n android:id=\"@+id/toolbar\"\n android:layout_width=\"match_parent\"\n android:layout_height=\"?attr/actionBarSize\"\n app:popupTheme=\"@style/ThemeOverlay.", "AppCompat.", "Light\"\n app:layout_collapseMode=\"pin\"/>\n\n </android.support.design.widget.", "CollapsingToolbarLayout>\n\n </android.support.design.widget.", "AppBarLayout>\n\n <FrameLayout\n android:layout_width=\"match_parent\"\n android:layout_height=\"match_parent\"\n android:id=\"@+id/content_frame\">\n\n </FrameLayout>\n\n <android.support.design.widget.", "FloatingActionButton\n android:id=\"@+id/fab\"\n android:layout_width=\"wrap_content\"\n android:layout_height=\"wrap_content\"\n android:layout_gravity=\"bottom|end\"\n android:layout_margin=\"@dimen/fab_margin\"\n android:src=\"@android:drawable/ic_dialog_email\" />\n\n</android.support.design.widget.", "CoordinatorLayout>\n\nby this fragment :\n<?", "xml version=\"1.0\" encoding=\"utf-8\"?", ">\n<android.support.v4.widget.", "NestedScrollView\n android:layout_width=\"match_parent\"\n android:layout_height=\"match_parent\"\n xmlns:tools=\"http://schemas.android.com/tools\"\n android:layout_gravity=\"fill_vertical\"\n app:layout_behavior=\"@string/appbar_scrolling_view_behavior\"\n xmlns:android=\"http://schemas.android.com/apk/res/android\"\n xmlns:app=\"http://schemas.android.com/apk/res-auto\"\n tools:context=\"fr.djey.secretapp.", "MainActivity\">\n\n <android.support.v7.widget.", "CardView\n android:layout_width=\"match_parent\"\n android:layout_height=\"wrap_content\"\n android:layout_margin=\"16dp\">\n\n <LinearLayout\n android:layout_width=\"match_parent\"\n android:layout_height=\"wrap_content\"\n android:orientation=\"vertical\"\n android:padding=\"16dp\">\n\n <TextView\n android:layout_width=\"match_parent\"\n android:layout_height=\"wrap_content\"\n android:text=\"BIENVENUE\"\n android:textColor=\"@android:color/black\"/>\n\n </LinearLayout>\n\n </android.support.v7.widget.", "CardView>\n\n</android.support.v4.widget.", "NestedScrollView>\n\nBut as you can see, the nestedscrollview doesn't work doing like that :\n\nA:\n\nFinally I've done like that :\nputting the nestedscrollview in the main and a frame inside:\n<android.support.v4.widget.", "NestedScrollView\n android:layout_width=\"match_parent\"\n android:layout_height=\"match_parent\"\n xmlns:tools=\"http://schemas.android.com/tools\"\n android:layout_gravity=\"fill_vertical\"\n app:layout_behavior=\"@string/appbar_scrolling_view_behavior\"\n xmlns:android=\"http://schemas.android.com/apk/res/android\"\n xmlns:app=\"http://schemas.android.com/apk/res-auto\">\n\n <FrameLayout\n android:layout_width=\"match_parent\"\n android:layout_height=\"match_parent\"\n android:id=\"@+id/content_frame\">\n\n </FrameLayout>\n\n </android.support.v4.widget.", "NestedScrollView>\n\nLike that I can see more text, but not until the end. ", "So I put a margin in the cardview inside the fragment : android:layout_marginBottom=\"80dp\"\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.0006429480272345245, 0.0008289882098324597, 0.0006010360084474087, 0.0008417149656452239, 0.0007571554742753506, 0.0006190649583004415, 0.0008281592163257301, 0.000753082218579948, 0.0007492261938750744, 0.0006598582258448005, 0.0008250518585555255, 0.000804712122771889, 0.0007227829773910344, 0.0016190469032153487, 0.0007564126281067729, 0.001406572642736137, 0.000995401176624, 0.0006866352632641792, 0.0007431987905874848, 0.0008220502058975399, 0.0008321234490722418, 0.0008844874682836235, 0.0006825607852078974, 0.0006936265272088349, 0.0007128564757294953, 0.0006190649583004415, 0.0008281592163257301, 0.000753082218579948, 0.0007492261938750744, 0.0006598582258448005, 0.0008250518585555255, 0.0008265123469755054, 0.0007227829773910344, 0.0016190469032153487, 0.0007564126281067729, 0.001406572642736137, 0.0007623541750945151, 0.0008844874682836235, 0.0007360689342021942, 0.0006190649583004415, 0.0008557673427276313, 0.0006860840949229896, 0.0007752348319627345, 0.0007189452298916876, 0.0008220502058975399, 0.0006553193088620901, 0.0007420473266392946, 0.0006539177265949547, 0.0006071375100873411 ]

[ "Accounting ServicesThis service includes the writing up of your businesses’ (be it a company, sole proprietor, partnership or limited liability partnership) accounting records and preparation of quarterly monthly management reports and the statutory annual financial ...\n\nRoadmap and tools with the methodology to implement systematization in your business\n\nAs I see it, businesses that have the following in place have a more predictable\nsuccess patterrn.", "\n** Leadership development** Optimization and turnaround** Creating a\nculture of coaching ** Strategic planning (and implement..." ]

{ "pile_set_name": "Pile-CC" }

[ 0.0006186721730045974, 0.0006596793537028134 ]

[ "There is currently a toxic “you are either with us or against us” type narrative expressed by the #RUReferenceList movement, which has silenced those who have any form of concerns to raise against it. ", "I do hope that this response in itself will break that silence and pave the way for some more meaningful engagement by all concerned persons.", "\n\nI am a staff member of the university currently known as Rhodes, which is why I choose to call it that. ", "When the name does change to something more historically appropriate I will call it by its new name. ", "But for the moment, let us call it Rhodes University so that there is no confusion.", "\n\nI do not form part of the group who call themselves “concerned staff” because I do not identify with all of their views, but that does not make me any less concerned (as many of us are) by some of the sentiments held by Dr Deborah Seddon (“We Will Not Be Silenced”, Daily Maverick, 1 June 2016) and others on Rhodes campus, and the problematic way in which the university management has humoured these sentiments and the manner of their expression.", "\n\nAs such I speak for those of us on Rhodes campus who have been silenced of late by the imminent threat of being labelled a “rape apologist” or of having threats hurled in our direction such as, “I hope you are raped so that you know what it feels like” for wishing to uphold the rule of law, or being threatened to be burned alive in front of our children for trying to protect a student named on the reference list from a mob’s idea of justice.", "\n\nThere is currently a toxic “you are either with us or against us” type narrative expressed by the #RUReferenceList movement, which has silenced those who have any form of concerns to raise against it. ", "I do hope that this response in itself will break that silence and pave the way for some more meaningful engagement by all concerned persons.", "\n\nDr Seddon will have us believe that the protesters in the recent #RUReferenceList protests were peaceful, and that none of the men who were forcibly evicted from their residences during the protest were physically harmed.", "\n\nInstead, these men were simply held captive and frogmarched around campus by a crowd of angry people, and who knows what verbal insults they were subjected to in the process. ", "Of them, Dr Seddon says, “[t]hey were not beaten up, nor injured. ", "And, unlike the protesting survivors, they enjoy the continued right to walk through campus without question, police investigation, or arrest.”", "\n\nThese sentiments are problematic on a number of levels. ", "The first level is that of violence. ", "Many victims of rape and other forms of sexual violence are not physically harmed either, and yet we nonetheless call it violence – because it is. ", "Dr Seddon clearly recognises this in her sympathies toward survivors of rape. ", "And yet the trespassing, kidnapping, crimen iniuria and defamation suffered by those men whose names appeared on an anonymously posted list seem unimportant in the face of the fact that they were not “physically harmed”.", "\n\nInstead, many of these young men’s futures have been destroyed. ", "Many of them student leaders, they have been summarily dismissed from their positions, some have had future contracts of employment cancelled, and everywhere they go they are subjected to whisperings and condemnation from people who have never met them.", "\n\nAnother problematic level is Dr Seddon’s implication that this treatment of those on the list is justified given what they have done. ", "But what have they done? ", "As Dr Seddon has said: no descriptions were offered, no allegations were made, “but the crowd began to grasp what connected the names.”", "\n\nAnd as with all good rumours, what they had done escalated until each of the 11 was as good as a convicted rapist in the eyes of the crowd. ", "But most, if not all of the 11, had never had any kind of formal complaint laid against them, let alone a criminal conviction.", "\n\nDr Seddon accuses management of being unsupportive “of the active, vocal demand for social justice for survivors that has arisen this year”.", "\n\nTo this I offer the opposite, albeit far less popular view of management’s response to the situation. ", "Management was given 24 hours to respond to demands from the protesters. ", "They responded, and they called for the establishment of a task team – a very positive move. ", "But what they refused to do was to violate the Constitution by summarily suspending the students from the university without even a charge being laid against them, let alone a fair hearing. ", "But even in this the university management met the protesters halfway. ", "In probably the most problematic statement issued by the university in the week of 17 April, the university stated as follows on 20 April:\n\n“All students who have been sexually assaulted or raped by people whose names appear on the #RUReferenceList are requested to report the matter and provide a statement to Ms Naledi Mashishi … or Ms Kim Barker … so that prosecution can be expedited. ", "Once statements have been received pre-suspension hearings will be held, with a view to suspending the accused pending finalisation of the case.”", "\n\nImplied in this statement is the preconceived guilt of the men whose names appear on the list, and that due process for suspension of these men is an inconvenient formality which the university is unfortunately bound to comply with. ", "It also implicitly legitimises the “reference list” as a means to pursue justice.", "\n\nIt is interesting to note that following this invitation, the university community has been informed of only one formal complaint being laid against one of the men on the list. ", "In some of the underground rumour, it has been said that for more than one of the men listed, the incident in question involved something that at worst could be construed as sexual harassment, and when asked to stop such conduct the man in question did so, and at least one of the men on the list has no idea why his name appears there at all.", "\n\nBut the general response to these possibilities is a dangerous utilitarian “the end justifies the means” type narrative that undermines more of the rights enshrined in our Constitution than it seeks to uphold. ", "In the process of these engagements, our Vice-Chancellor has been subjected to being called a rapist and being told by a protester that she hopes that his minor daughters are raped so that he can know what it feels like, yet he has still chosen to continue to engage the demands of the protests. ", "And in the face of this our management has been accused of being unsupportive.", "\n\nIt seems to me that the demands of the protesters in this most recent protest have been that the university management solve what is ultimately an ingrained social problem, as though they may have the power to do so. ", "On a more realistic level, the demand seems to be that the university do more to assist survivors of rape and other forms of sexual violence, and to punish the alleged perpetrators. ", "Unfortunately this demand appears to have backfired. ", "The university’s student disciplinary code currently makes special provision for hearings to be held in cases of sexual violence where the burden of proof is on a balance of probabilities (as opposed to beyond reasonable doubt in a criminal trial).", "\n\nWhere the accused is found guilty he is excluded from the university.", "\n\nIn my five years as a warden of a university residence, I have assisted several students who have been subjected to sexual violence. ", "In these cases I have given the students the options of reporting the matter to the police and laying a criminal charge or reporting the matter internally and going the route of university discipline.", "\n\nIn all cases the complainant has indicated that the university’s disciplinary route is likely to be less traumatic and is likely to bring about some form of justice more quickly than the criminal route. ", "The less onerous burden of proof in the student disciplinary code also contributes to a more likely conviction of the accused.", "\n\nBut as a result of these protests it has been recognised that the university is in fact ill-equipped to run cases of sexual violence in any event, and so the likelihood is that this option for survivors will be removed in the near future. ", "Rather, the only option will be for complainants to lay criminal charges with the police, and all that the university will be able to offer is its support services for students who wish to do so.", "\n\nThe interim interdict that the concerned staff members refer to with such distaste was sought by the university to protect students and staff. ", "In it students and staff are interdicted from various forms of unlawful conduct, including kidnapping as well as barricading campus and disrupting lectures.", "\n\nWhile I cannot say that I approve of the manner in which the interdict was sought and implemented (the letter to Ms Knowles based on the strength of an Oppidan Press tweet was absurd in my view), it should be noted that at least one women’s hall of residence has formally requested that the interdict remain in place because it makes them feel safer.", "\n\nRhodes is a fairly unique kind of campus in that it is open to the public and is largely residential. ", "The #FeesMustFall protests were largely a constructive and unifying experience on Rhodes campus, but despite this those in residence were at times made to feel unsafe and quite frightened. ", "This was particularly so when protesters systematically entered residences and in some cases pulled students out of their rooms to join the protest, at times damaging university property in the process such as doors and security features.", "\n\nThe residence that I was a warden of was one of the few not to be entered by protesters, and this was so because the subwardens and I served as a human barricade at the door to protect the students in the residence – a task that our student leaders should never have had to perform. ", "As a hall warden I was called by a student to do a make-shift fix of her window. ", "Campus was barricaded and so emergency maintenance could not be done, and the student in question was too scared to sleep in her room after her window had been broken the night before by protesters.", "\n\nIt is not ideal that a university should specifically list the things that its students are prohibited from doing in a court-sanctioned document. ", "It is also not ideal that the conduct of people involved in a protest movement that ultimately has a worthy cause at its core should be restrained in the way that it has. ", "But what is far less ideal is that one form of alleged violence begets new violence, and that the price of awareness of these very real issues facing our students is the silence of those who could contribute towards rigorous academic debate as to a constitutionally sound way forward.", "\n\nIn the spirit of constructive engagement, I do hope that on the return day for the interim interdict Dr Seddon and the concerned staff members are able to construct a good argument as to why the interim interdict should not be made permanent. ", "Because at this stage, I cannot think of one. ", "DM\n\nVicky Heideman holds degrees from Rhodes and Cambridge universities. ", "She is a lecturer in the Faculty of Law and an admitted attorney. ", "She was also a warden of a Rhodes University residence from 2011-2015, a hall warden in 2015, and she is currently a fellow of Desmond Tutu Hall." ]

{ "pile_set_name": "OpenWebText2" }

[ 0.0018939872970804572, 0.0005945286829955876, 0.0005834060721099377, 0.0005860941018909216, 0.0005836552591063082, 0.0006074474658817053, 0.17085956037044525, 0.0018939872970804572, 0.0005945286829955876, 0.0006512704421766102, 0.0014725170331075788, 0.004003399051725864, 0.0007307094056159258, 0.0006205382524058223, 0.0012717454228550196, 0.011941103264689445, 0.014748700894415379, 0.003083683317527175, 0.0007482486544176936, 0.0006813080981373787, 0.0007655840599909425, 0.000915393466129899, 0.0006201860960572958, 0.11562157422304153, 0.0007618443924002349, 0.0018262158846482635, 0.0006000915309414268, 0.000791519065387547, 0.0005798678030259907, 0.0014751231065019965, 0.0006177373579703271, 0.0012525198981165886, 0.0005653444095514715, 0.0008600401342846453, 0.0006467569037340581, 0.000556055223569274, 0.001250565517693758, 0.000666926964186132, 0.040666986256837845, 0.0010743195889517665, 0.0006322251865640283, 0.0011767576215788722, 0.0010321434820070863, 0.0009245414403267205, 0.00093353126430884, 0.023251794278621674, 0.0005689553800038993, 0.000637240125797689, 0.000712968991138041, 0.001282392768189311, 0.0010027112439274788, 0.0006534589338116348, 0.0024022520519793034, 0.0006002039299346507, 0.0005637212307192385, 0.0005742410430684686, 0.0006859137793071568, 0.0011627011699602008, 0.0015840997220948339, 0.002374209463596344, 0.0006730792229063809, 0.0005795338074676692, 0.0009112391853705049, 0.0005208835937082767, 0.0006089569069445133, 0.0006021818844601512, 0.0006657720659859478, 0.0006733525078743696 ]

[ "5 Myths About the UN Human Rights Council (for US audience)\n\nJanuary 13, 2016\n\nTed Piccone, Senior Fellow, Foreign Policy, at The Brookings Institution published on 12 August 2015 a post entitled: “5 Myths About the UN Human Rights Council”. ", "A bit belatedly I repeat it here for those – especially in the USA – who need a coherent statement in favour of continued engagement by the US in the UN Human Rights Council:\n\nAlmost 10 years ago, the United Nations established a new Human Rights Council to overcome the intense polarization of its Cold War era predecessor and to elevate human rights as the third main pillar of the world body. ", "The Bush administration decided not to join the Council, deeply skeptical it could do a serious job when notorious human rights violators sat in judgment of others. ", "The Obama administration, on the other hand, chose to run for a seat on the Council on grounds the United States had a better shot at influencing its deliberations from the inside. ", "After six years on the Council, Washington is now taking a mandatory gap year and promises to run again for another three-year term in 2017, when a new administration will be in office.", "\n\nWhat has the Human Rights Council achieved in its first ten years of existence? ", "What role has U.S. leadership played in its deliberations and outcomes? ", "And what can we expect looking ahead to the next ten years? ", "Are its critics right when they say the Council is hopelessly tainted by having the likes of China, Saudi Arabia and Cuba as members? ", "Or does the record suggest a net positive balance sheet from U.S. engagement in Geneva? ", "Let’s review the arguments.", "\n\n1. ", "The Council’s membership is fatally stacked against human rights.", "\n\nAs a body of the United Nations, the Council’s 47-seat membership is drawn from all its 193 member states in accordance with a geographical distribution weighted in favor of Asia and Africa. ", "Each regional group runs a closed or competitive slate for election by majority vote of the General Assembly; competitive slates offer a better chance of defeating spoilers. ", "Candidates may submit voluntary human rights pledges to demonstrate their suitability for a seat (only some do), but vote trading and power politics are still the predominant criteria for election.", "\n\nSince the Council was established in 2006, its membership has reflected the UN’s diversity – with states large and small, democratic and authoritarian, and everything in between. ", "This gives the Council unique legitimacy when it speaks out against violations in North Korea or Iran. ", "But the notion that the Council’s membership is mostly comprised of authoritarian regimes is wrong. ", "From 2007-2015, a large majority of its membership has been composed of states that meet the free and partly free standards of Freedom House (between 74 and 85 percent); not-free states have never won more than about a quarter of the seats. ", "While it is true that certain states like China, Russia, Cuba and Venezuela manage to get elected repeatedly, other notorious violators – Iran, Sudan, Syria, Azerbaijan and Belarus, to name a few – have at times been dissuaded from running or defeated in their campaigns. ", "Smaller states like Zambia, Benin, Albania and Sierra Leone have been surprisingly effective at bridging competing alliances and supportive of pro-human rights outcomes despite the daunting demands of an expanding workload. ", "Bigger democracies like India, South Africa and Indonesia, on the other hand, have been a disappointment, too often hiding behind the nonintervention screen instead of leading efforts to address dire situations. ", "It would help if more democracies from every region ran for a seat on the Council and helped each other to strengthen its effectiveness.", "\n\n2. ", "The Council ignores the worst cases of human rights abuses in favor of “softer” topics like the elderly, children and the disabled.", "\n\nWhile thematic topics, including arbitrary detentions, freedom of expression, human trafficking, and religious freedom occupy the majority of the Council’s agenda, its mandate also covers specific country situations of gross violations and it has a range of mechanisms to address them. ", "In its early years, an inordinate amount of time was taken up by the longstanding conflict between Israel and Palestine, but more recently the Council has dramatically increased its scrutiny of such flagrant cases as Libya, Syria, Eritrea, North Korea, Sri Lanka, Iran, Central African Republic and South Sudan. ", "It does so through the dispatch of a growing number of independent experts and commissions of inquiry charged with monitoring and reporting on violations on the ground. ", "The Council also adopts country-specific resolutions that have grown from a low of 17 percent of all resolutions in 2009 to a high of 42 percent in 2015. ", "A growing number of these resolutions are adopted by consensus, reflecting a greater willingness to respond to grave violations; when votes are called on contentious country situations, cross-regional coalitions of democracies are often in the lead.", "\n\nThe Council’s newest mechanism – a universal periodic review of each country’s human rights record – is turning out to be an effective tool for ensuring that every state is called to account for its human rights performance. ", "This is a big change from the old days when months of diplomatic wrangling over a resolution on China or Cuba would lead to stalemate and frustration. ", "To date the process has garnered a remarkable 100 percent participation rate with more and more states accepting recommendations on everything from women’s rights to torture. ", "These assessments attract much-needed media attention in countries under review, give some room (but not enough) to civil society participation, and elevate human rights on the agenda of government ministries across the board.", "\n\n3. ", "The Council is woefully biased against Israel.", "\n\nAmong its ten standing agenda items, the Council has continued a permanent item on Israel’s human rights behavior in the Occupied Palestinian Territories (OPT). ", "This is clearly unfair. ", "While Israel’s treatment of Palestinians certainly deserves close scrutiny, it is hard to justify singling it out for such special attention. ", "When the United States was absent from the Council, its members convened no less than six special sessions on Israel. ", "Since the United States joined the body, only two such sessions have been called and one of these sessions was a hangover from when the United States shunned the Council; a similar decrease in the number of country resolutions devoted to Israel occurred, along with a corresponding increase in attention to cases like North Korea, Iran and Syria. ", "Israel still views the body with trepidation, and fails to cooperate with its fact-finding commissions on OPT, but after initial opposition agreed to participate for a second time in the universal peer review process in 2013. ", "According to Israel’s ambassador in Geneva, “Israel came to the review with respect for the process, belief in the importance of its universality and cooperative nature, and with great pride in its achievements.” ", "Some in Washington argue that the Council’s biased treatment of the United States’ closest ally in the region demands a complete break from the body, but others argue that that would be an enormously high price to pay in terms of U.S. leadership in promoting human rights around the world. ", "The politics of the United Nations suggest little movement on this issue in the near term, but the United States’ willingness to defend Israel against such unfair treatment is best served by engaging directly on the body, and not walking away from it.", "\n\n4. ", "The Council is a toothless debating society with no impact outside Geneva.", "\n\nHuman rights advocates are rightfully frustrated with the machinations and secret handshakes in the halls of the Palais des Nations in Geneva that often lead to time-consuming debates on points of order and feckless resolutions like “human rights and international solidarity.” ", "However, compared to the pre-Council era, when governments met just once a year to fight over name-and-shame resolutions, the scope and depth of the Council’s workload has exploded. ", "This workload includes mandating independent monitoring of a host of human rights challenges. ", "Since its creation, 20 new mandates of independent experts have been established and these mandates are generating dozens more country visits and critical reports. ", "These independent experts act as the eyes and ears of the Council, carrying the UN’s blue flag to dark prison cells and homeless shelters to document abuses of international law and demand remedies from local and national governments. ", "Their recommendations have led to concrete action on problems ranging from combating torture in Jordan to protecting journalists in Cambodia, decriminalizing blasphemy in the United Kingdom and reducing prison sentences in China. ", "The universal periodic review process is adding another layer of transparency and accountability by holding all states to their commitment to uphold international norms: Nearly half of the recommendations made were partially or fully implemented just two-and-a-half years after the first round of reviews.", "\n\nOn some of the most serious cases, the Council has taken action that has led to important and unprecedented results. ", "The commission of inquiry on North Korea, for example, which delivered a hard-hitting report in 2014 documenting crimes against humanity, has changed the conversation from denials of human rights abuses to acceptance that the UN Security Council must address the matter, including through a potential referral to the International Criminal Court. ", "On Sri Lanka, the Council has shifted from initially applauding the bloody termination of the conflict in 2009 to demanding an independent investigation of the abuses; this international pressure had a direct effect on subsequent elections in the country, and helped bring to power a new leader who immediately adopted a set of important reforms. ", "On Syria, where the Security Council has failed to act, the Council has held multiple special sessions to hear from a commission of inquiry that is already passing names of suspects to courts in Europe, paving the way, some day, for real accountability for the manifold crimes in the country. ", "On balance, the Council’s actions turn out to be much more than paper exercises. ", "Resources to do the hard work in the field, however, are pathetically scarce and desperately need to be replenished, not cut, as the Council’s opponents suggest.", "\n\n5. ", "The United States would be more effective on human rights if it cut its losses at the UN and ran.", "\n\nAt the end of the day, critics who argue for leaving the Council in the hands of the spoilers are in effect abandoning the field to those who are determined to block any international scrutiny or condemnation of human rights violations around the world. ", "The evidence against U.S. withdrawal is already available – its absence from the Council’s tables during the first two years of its existence led to setbacks on multiple fronts, including the preponderant focus on Israel. ", "Since the United States joined in 2008, the Council has taken a string of important actions that move the human rights agenda forward on both country situations like North Korea and Syria and on thematic priorities like LGBT rights and freedom of association.", "\n\nThe Obama administration is determined to treat its one-year hiatus in 2016 as no different from being a voting member on the Council, working behind the scenes to knit cross-regional coalitions and lobby in capitals for better candidates to serve on the body. ", "If the next administration decided to walk away, it would lose the leverage that comes from active membership and let others fill the vacuum with damaging attempts to undermine the international human rights system. ", "We’ve seen this movie before. ", "It takes grit, guts and investment of time and resources to make the gears grind forward. ", "Without the United States at the table, the human rights agenda will inevitably fall backwards. ", "The Europeans are key allies but are hamstrung by their own slow internal processes of consensus building. ", "And rising democracies like South Africa and India remain wobbly partners, at best. ", "The United States, like it or not, needs to stay in the fight if it wants to remain a leader for human rights on the world stage." ]

{ "pile_set_name": "Pile-CC" }

[ 0.0006072488613426685, 0.0005473216879181564, 0.0007093302556313574, 0.000779990223236382, 0.0006809509941376746, 0.0006722164107486606, 0.000623619242105633, 0.0006202287040650845, 0.002239768160507083, 0.0005625602789223194, 0.0006092367111705244, 0.0009391900966875255, 0.0012781316181644797, 0.000579367857426405, 0.000668665103148669, 0.0005970305646769702, 0.0007734637474641204, 0.0005851140012964606, 0.0007779862498864532, 0.0006521042087115347, 0.0007675816887058318, 0.0005747798713855445, 0.0006535978172905743, 0.0005816114135086536, 0.001185585861094296, 0.003069183323532343, 0.0006392766954377294, 0.0006153407739475369, 0.0005326233222149312, 0.000606245594099164, 0.000550838652998209, 0.000570419302675873, 0.001359771704301238, 0.0015578868333250284, 0.0005589837091974914, 0.00117425003554672, 0.04388122260570526, 0.0006089761154726148, 0.0010372847318649292, 0.0007477246690541506, 0.0006657612975686789, 0.0005831906455568969, 0.0008242492913268507, 0.0005059060058556497, 0.0006685446132905781, 0.0005739354528486729, 0.0012900278670713305, 0.018682878464460373, 0.002604984911158681, 0.0007564483094029129, 0.0006041638553142548, 0.0005334530724212527, 0.0007935643079690635, 0.0006785615114495158, 0.0005437932559289038, 0.0005317004397511482, 0.0005375324981287122, 0.0006381107377819717, 0.0005277044838294387, 0.0006056250422261655, 0.0063925874419510365, 0.0013671480119228363, 0.0007457187166437507, 0.000877197424415499, 0.0006759449606761336, 0.0005636205314658582, 0.0005672600236721337, 0.0017061610706150532, 0.0006426922627724707, 0.0018146347720175982, 0.0008383623789995909, 0.0018298650393262506, 0.0006432471564039588, 0.0008015407947823405 ]

[ "BRECK LOCAL\n\nBreckenridge Full Calendar of Events\n\n​\n\n​​\n\nCOVID-19 Notice:We're doing our part to respect social distancing measures in our amazing mountain community, and we are confident we will come out of this much stronger in the end. ", "For the time being, we have disabled our event calendars. ", "Rest assured, when this passes, Après-Ski™ will be here waiting for you! ", "Breckenridge is a beautiful outdoor community with plethora of adventures, delicious meals, rejuvenating spas and unique activities. ", "We look forward to you celebrating adventures in our ski town paradise! ", "Be well.", "\n\nBEST OF APRÈS-SKI™ Breck\n\nNominated by locals and awarded by us, Best of Après-Ski™ is your golden ticket to the best après-ski bars, restaurants and activities so you can celebrate your adventures like a local in Breckenridge with ease. ", "Check out the Winter-Spring 2020 Edition & see who made the list!", "\n\nBreckenridge Valentine's Guide\n\nWhether you're with the love of your life, single & ready to mingle, hoping to relax & rejuvenate or think Cupid is stupid, check out the Breckenridge Valentine's Day Guide for a complete list of restaurants/bars, fun things to do, fitness & wellness and live music on Friday!", "\n\nSuper Bowl Sunday in Breck\n\nLooking for a place to watch the big game? ", "The Super Bowl Sunday Guide provides you with all the best spots in town. ", "Not a football fan? ", "Don't worry, we have you covered with the list of activities and deals for a fabulous Sunday Funday Breck-style.", "\n\n\"I saw you on APRÈS-SKI!", "\n\nSki Tips Up: Tip on the Original.", "\n\n​\n\nAPRÈS-SKI™ celebrates the ultimate passage to freedom. ", "For us, skiing isn't just a sport, it's a way of life. ", "Everything we do is geared towards encouraging outdoor adventurers to share experiences together and make the most of every adventure on and off the mountain.", "\n\nTraveling to Breckenridge? ", "APRÈS-SKI: Breckenridge is your golden ticket to the best après-ski bars, restaurants and activities so you can celebrate your adventures like a local in Breckenridge with ease. ", "Cheers!" ]

{ "pile_set_name": "Pile-CC" }

[ 0.0006102839834056795, 0.0009260829538106918, 0.000886316120158881, 0.0006846918840892613, 0.0006129196262918413, 0.001206478220410645, 0.0006620431086048484, 0.000611441966611892, 0.04939499869942665, 0.0008565529133193195, 0.0005963961593806744, 0.0013032978167757392, 0.0012476714327931404, 0.0013396281283348799, 0.0006515444838441908, 0.0006163967773318291, 0.0009129442041739821, 0.0005525876767933369, 0.0008542764117009938, 0.0007596560753881931, 0.0006400890997610986 ]

[ "[\n\t{\n\t\t\"code\": \"CONSTANT_OR_VARIABLE RANDOM_STRING_NAME = \\\"RANDOM_STRING_VALUE_0\\\"\\nprint(\\\"NAME_NATURAL_0|capitalizedFirst is \\\\(NAME_0)\\\")\",\n\t\t\"answers\": [\n\t\t\t{\n\t\t\t\t\"text\": \"NAME_NATURAL_0|capitalizedFirst is VALUE_0\"\n\t\t\t}\n\t\t]\n\t},\n\n {\n \"code\": \"CONSTANT_OR_VARIABLE RANDOM_INT_NAME = RANDOM_SMALL_INT\\nprint(\\\"NAME_NATURAL_0|capitalizedFirst doubled is \\\\(NAME_0 * 2)\\\")\",\n \"answers\": [\n {\n \"text\": \"NAME_NATURAL_0|capitalizedFirst doubled is ${VALUE_0 * 2}\"\n }\n ]\n },\n\n {\n \"code\": \"var RANDOM_INT_NAMEValue = RANDOM_MEDIUM_INT\\n\\nfunc reset(NAME_0: inout Int) {\\n\\tNAME_0 = 0\\n}\\n\\nreset(NAME_0: &NAME_0Value)\\n\\nprint(\\\"NAME_NATURAL_0|capitalizedFirst is now \\\\(NAME_0Value)\\\")\",\n \"answers\": [\n {\n \"text\": \"NAME_NATURAL_0|capitalizedFirst is now 0\"\n }\n ]\n },\n\n {\n \"code\": \"let RANDOM_INT_NAME1 = RANDOM_TINY_INT\\nlet NAME_02 = RANDOM_TINY_INT\\nlet NAME_03 = RANDOM_TINY_INT\\n\\nlet NAME_0Total = NAME_01 + NAME_02 + NAME_03\\nprint(\\\"The sum is \\\\(NAME_0Total)\\\")\",\n \"answers\": [\n {\n \"text\": \"The sum is ${VALUE_0 + VALUE_1 + VALUE_2}\"\n }\n ]\n },\n\n\t{\n\t\t\"code\": \"var RANDOM_STRING_NAME = \\\"RANDOM_STRING_VALUE_0\\\"\\nNAME_0 = \\\"RANDOM_STRING_VALUE_0\\\"\\nprint(\\\"NAME_NATURAL_0|capitalizedFirst is \\\\(NAME_0)\\\")\",\n\t\t\"answers\": [\n\t\t\t{\n\t\t\t\t\"text\": \"NAME_NATURAL_0|capitalizedFirst is VALUE_1\"\n\t\t\t}\n\t\t]\n\t},\n\n {\n \"code\": \"let RANDOM_STRING_NAMEDict = [String: String]()\\nlet selected = NAME_0Dict[\\\"test\\\", default: \\\"Unknown\\\"]\\nprint(selected)\",\n \"answers\": [\n {\n \"text\": \"Unknown\"\n }\n ]\n },\n\n {\n \"code\": \"var counter = 0\\n\\nfor i in 1...10 {\\n\\tif i == RANDOM_SMALL_INT {\\n\\t\\tbreak\\n\\t}\\n\\n\\tcounter += 1\\n}\\n\\nprint(\\\"Counted to \\\\(counter)\\\")\",\n \"answers\": [\n {\n \"text\": \"Counted to ${VALUE_0 - 1}\"\n }\n ]\n },\n\n {\n \"code\": \"let score = RANDOM_MEDIUM_INT\\n\\nswitch score {\\ncase 0...50:\\n\\tprint(\\\"Fail\\\")\\ncase 51...70:\\n\\tprint(\\\"Pass\\\")\\ncase 71...85:\\n\\tprint(\\\"Merit\\\")\\ndefault:\\n\\tprint(\\\"Distinction\\\")\\n}\",\n \"answers\": [\n {\n \"conditions\": [\n {\n \"left\": \"VALUE_0\",\n \"check\": \"<=\",\n \"right\": \"50\"\n }\n ],\n \"text\": \"Fail\"\n },\n {\n \"conditions\": [\n {\n \"left\": \"VALUE_0\",\n \"check\": \"<=\",\n \"right\": \"70\"\n }\n ],\n \"text\": \"Pass\"\n },\n {\n \"conditions\": [\n {\n \"left\": \"VALUE_0\",\n \"check\": \"<=\",\n \"right\": \"85\"\n }\n ],\n \"text\": \"Merit\"\n },\n {\n \"text\": \"Distinction\"\n }\n ]\n },\n\n\t{\n\t\t\"code\": \"var RANDOM_STRING_NAME = \\\"RANDOM_STRING_VALUE_0\\\"\\n\\nif NAME_0.count RANDOM_OPERATOR RANDOM_SMALL_INT {\\n\\tNAME_0 = \\\"RANDOM_STRING_VALUE_0\\\"\\n}\\n\\nprint(\\\"NAME_NATURAL_0|capitalizedFirst is \\\\(NAME_0)\\\")\",\n\t\t\"answers\": [\n\t\t\t{\n\t\t\t\t\"conditions\": [\n\t\t\t\t\t{\n\t\t\t\t\t\t\"left\": \"VALUE_1|count\",\n\t\t\t\t\t\t\"check\": \"OPERATOR_0\",\n\t\t\t\t\t\t\"right\": \"VALUE_0\"\n\t\t\t\t\t}\n\t\t\t\t],\n\t\t\t\t\"text\": \"NAME_NATURAL_0|capitalizedFirst is VALUE_2\"\n\t\t\t},\n\t\t\t{\n\t\t\t\t\"text\": \"NAME_NATURAL_0|capitalizedFirst is VALUE_1\"\n\t\t\t}\n\t\t]\n\t},\n\n\t{\n\t\t\"code\": \"CONSTANT_OR_VARIABLE RANDOM_INT_NAME = RANDOM_SMALL_INT\\nCONSTANT_OR_VARIABLE RANDOM_INT_NAME = RANDOM_SMALL_INT\\n\\nCONSTANT_OR_VARIABLE multiplied = NAME_0 * NAME_1\\n\\nif multiplied % 2 == 0 {\\n\\tprint(\\\"Even number\\\")\\n} else {\\n\\tprint(\\\"Odd number\\\")\\n}\",\n\t\t\"answers\": [\n\t\t\t{\n\t\t\t\t\"conditions\": [\n\t\t\t\t\t{\n\t\t\t\t\t\t\"left\": \"${(VALUE_0 * VALUE_1) % 2}\",\n\t\t\t\t\t\t\"check\": \"==\",\n\t\t\t\t\t\t\"right\": \"0\"\n\t\t\t\t\t}\n\t\t\t\t],\n\t\t\t\t\"text\": \"Even number\"\n\t\t\t},\n\t\t\t{\n\t\t\t\t\"text\": \"Odd number\"\n\t\t\t}\n\t\t]\n\t}\n]\n" ]

{ "pile_set_name": "Github" }

[ 0.003839528188109398 ]

[ "Good news for the fans of Britannia, the historic Roman Empire saga is back for another run. ", "Sky Atlantic renewed the show for ‘Britannia Season 2’ back in March 2018. ", "Despite the mixed reviews, the fantasy series received the green light for its sophomore run. ", "That is because, the series became a huge on-demand hit for Sky.", "\n\nBritannia is a historical fantasy series set in AD 43. ", "The Ferryman author Jez Butterworth pens the show. ", "Britannia is the first collaboration series between the Sky and Amazon Prime Video. ", "The show debuted on January 18, 2018, follows the Roman conquest of Britain.", "\n\nBritannia Season 2: First Look From The Show\n\nBritannia’s official Twitter handle recently posted the character’s first look from the second season. ", "One of the pictures shows David Morrissey recurring in the role of Aulus, standing still as a proud ruler of Britannia.", "\n\nBritannia series 2: David Morrissey, Mackenzie Crook and more in first-look images https://t.co/A32jLfUCB7 via @EFTelevision pic.twitter.com/HZZLTD0ifj — Entertainment Focus (@Ent_Focus) February 19, 2019\n\n\n\nMackenzie Crook also shouts out in the picture from Britannia Season 2, but as Harka, the brother of Veran. ", "Harka is described as ‘The Dead Man.’ ", "Crook also played the role of Veran in the first season and will likely be seen in the second season as well.", "\n\nExclusive: Watch Mackenzie Crook's 2.5 hour transformation into Harka.#Britannia series two coming in 2019. ", "pic.twitter.com/9bQPiGQGJf — Sky Atlantic (@skyatlantic) February 19, 2019\n\n\n\nEleanor Worthington Cox will also reprise her role as Cait. ", "She is the only person who can fulfill the prophecy and free the Britannia from the cruel Roman rule.", "\n\n\n\nWhat Will Happen in Britannia Season 2?", "\n\nAccording to speculations, the second season will return with a two-year time jump into the future. ", "General Aulus will continue his mission to kill the Celt tribe’s every single man alive who will try to rebel. ", "Celtic Queen Amena (Annabel Scholey) will also help him in his urge to become the sole power.", "\n\nHowever, the Queen also seemed scared about the spirits from her past. ", "She thinks that the spirits will come back to haunt her. ", "Meanwhile, the actions of Aulus are raising uncertainties for the Druids.", "\n\nAnd for the Druids and Celts, Cait is the only hope that can save the Britannia from the punitive rule of Aulus. ", "Druid Divis (Nicolaj Lie Kaas) has been briskly training and transforming her to complete the prophecy.", "\n\nHowever, Veran and Harka’s epic battle of Wills will act as a threat to the prophecy. ", "That battle will divide the Druids, which is not good.", "\n\nBritannia Season 2 Release Date\n\nJust after the release of the first season in the UK, Amazon Prime streamed the show worldwide. ", "The first season of Britannia released on January 18, 2019. ", "Therefore, Britannia Season 2 may premiere in the fall of 2019. ", "However, Sky is yet to announce the premiere date for the second season. ", "The audience is desperately waiting for the second season." ]

{ "pile_set_name": "OpenWebText2" }

[ 0.0006266941782087088, 0.0005894857458770275, 0.0005717275198549032, 0.001048508333042264, 0.001062431838363409, 0.0006944314809516072, 0.0006979256286285818, 0.0006643776432611048, 0.0005822275998070836, 0.0006374617805704474, 0.0006833659135736525, 0.002891810145229101, 0.0009076980059035122, 0.000735931156668812, 0.00072514358907938, 0.006712139584124088, 0.0007744089816696942, 0.0006261270027607679, 0.6108879446983337, 0.0015383338322862983, 0.0006625741953030229, 0.006205425597727299, 0.0012342133559286594, 0.004851785022765398, 0.0007736071711406112, 0.0019381543388590217, 0.005568134132772684, 0.0005783755914308131, 0.0006238979985937476, 0.0006196304457262158, 0.0006068060174584389, 0.0007325568003579974 ]

[ "# $Id: en_GB.po,v 1.34 2006/03/22 04:19:38 mindless Exp $\n#\n# Gallery - a web based photo album viewer and editor\n# Copyright (C) 2000-2006 Bharat Mediratta\n#\n# This program is free software; you can redistribute it and/or modify\n# it under the terms of the GNU General Public License as published by\n# the Free Software Foundation; either version 2 of the License, or (at\n# your option) any later version.", "\n#\n# This program is distributed in the hope that it will be useful, but\n# WITHOUT ANY WARRANTY; without even the implied warranty of\n# MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. ", " See the GNU\n# General Public License for more details.", "\n#\n# You should have received a copy of the GNU General Public License\n# along with this program; if not, write to the Free Software\n# Foundation, Inc., 51 Franklin Street - Fifth Floor, Boston, MA 02110-1301, USA.", "\nmsgid \"\"\nmsgstr \"\"\n\"Project-Id-Version: Gallery: ImageMagick 1.0.6\\n\"\n\"POT-Creation-Date: 2003-06-25 11:45+0100\\n\"\n\"PO-Revision-Date: 2003-06-25 15:57+0100\\n\"\n\"Last-Translator: Joan McGalliard <gallery@joanhenge.plus.com>\\n\"\n\"Language-Team: British <gallery-devel@lists.sourceforge.net>\\n\"\n\"MIME-Version: 1.0\\n\"\n\"Content-Type: text/plain; charset=UTF-8\\n\"\n\"Content-Transfer-Encoding: 8bit\\n\"\n\"Plural-Forms: nplurals=2; plural=(n !", "= 1);\\n\"\n\nmsgid \"ImageMagick\"\nmsgstr \"ImageMagick\"\n\nmsgid \"ImageMagick / GraphicsMagick Graphics Toolkit\"\nmsgstr \"ImageMagick / GraphicsMagick Graphics Toolkit\"\n\nmsgid \"Graphics Toolkits\"\nmsgstr \"Graphics Toolkits\"\n\nmsgid \"Convert to\"\nmsgstr \"Convert to\"\n\nmsgid \"target width\"\nmsgstr \"target width\"\n\nmsgid \"(optional) target height, defaults to same as width\"\nmsgstr \"(optional) target height, defaults to same as width\"\n\nmsgid \"Scale the image to the target size, maintain aspect ratio\"\nmsgstr \"Scale the image to the target size, maintain aspect ratio\"\n\nmsgid \"target height\"\nmsgstr \"target height\"\n\nmsgid \"Resize the image to the target dimensions\"\nmsgstr \"Resize the image to the target dimensions\"\n\nmsgid \"rotation degrees\"\nmsgstr \"rotation degrees\"\n\nmsgid \"Rotate the image\"\nmsgstr \"Rotate the image\"\n\nmsgid \"left edge %\"\nmsgstr \"\"\n\nmsgid \"top edge %\"\nmsgstr \"\"\n\nmsgid \"width %\"\nmsgstr \"\"\n\nmsgid \"height %\"\nmsgstr \"\"\n\nmsgid \"Crop the image\"\nmsgstr \"Crop the image\"\n\nmsgid \"overlay path\"\nmsgstr \"\"\n\nmsgid \"overlay mime type\"\nmsgstr \"\"\n\nmsgid \"overlay width\"\nmsgstr \"\"\n\nmsgid \"overlay height\"\nmsgstr \"\"\n\nmsgid \"alignment type\"\nmsgstr \"\"\n\nmsgid \"alignment x %\"\nmsgstr \"\"\n\nmsgid \"alignment y %\"\nmsgstr \"\"\n\nmsgid \"Overlay source image with a second one\"\nmsgstr \"\"\n\nmsgid \"page number\"\nmsgstr \"\"\n\nmsgid \"Select a single page from a multi-page file\"\nmsgstr \"\"\n\nmsgid \"target size in kb\"\nmsgstr \"\"\n\nmsgid \"Reduce image quality to reach target file size\"\nmsgstr \"\"\n\nmsgid \"Get the width and height of the image\"\nmsgstr \"\"\n\nmsgid \"Get the number of pages\"\nmsgstr \"\"\n\nmsgid \"Get the colorspace of the image\"\nmsgstr \"Get the colourspace of the image\"\n\nmsgid \"File does not exist\"\nmsgstr \"File does not exist\"\n\nmsgid \"Problem executing binary:\"\nmsgstr \"Problem executing binary:\"\n\nmsgid \"Binary output:\"\nmsgstr \"Binary output:\"\n\nmsgid \"ImageMagick Settings\"\nmsgstr \"ImageMagick Settings\"\n\nmsgid \"Settings saved successfully\"\nmsgstr \"Settings saved successfully\"\n\nmsgid \"\"\n\"ImageMagick is a graphics toolkit that can be used to process images that you upload to \"\n\"Gallery. ", " You must install the ImageMagick binaries on your server, then enter the path to \"\n\"them in the text box below. ", " If you're on a Unix machine, don't forget to make the binaries \"\n\"executable (<i>chmod 755 *</i> in the ImageMagick directory should do it)\"\nmsgstr \"\"\n\"ImageMagick is a graphics toolkit that can be used to process images that you upload to \"\n\"Gallery. ", " You must install the ImageMagick binaries on your server, then enter the path to \"\n\"them in the text box below. ", " If you're on a Unix machine, don't forget to make the binaries \"\n\"executable (<i>chmod 755 *</i> in the ImageMagick directory should do it)\"\n\nmsgid \"Directory to ImageMagick/GraphicsMagick binaries:\"\nmsgstr \"\"\n\nmsgid \"You must enter a path to your ImageMagick binaries\"\nmsgstr \"\"\n\nmsgid \"The path you entered is not a valid directory or is not accessible.\"", "\nmsgstr \"\"\n\nmsgid \"\"\n\"The path you entered doesn't contain valid ImageMagick binaries. ", "Use the 'test' button to \"\n\"check where the error is.\"", "\nmsgstr \"\"\n\nmsgid \"The path you entered isn't a valid path.\"", "\nmsgstr \"\"\n\nmsgid \"JPEG Quality:\"\nmsgstr \"JPEG Quality:\"\n\nmsgid \"\"\n\"ImageMagick can detect non-webviewable color spaces like CMYK and create a webviewable copy \"\n\"of such images. ", "Only activate this option if you actually add CMYK based JPEG or TIFF images \"\n\"since the color space detection slows down the add item process a little bit.\"", "\nmsgstr \"\"\n\"ImageMagick can detect non-webviewable colour spaces like CMYK and create a webviewable copy \"\n\"of such images. ", "Only activate this option if you actually add CMYK based JPEG or TIFF images \"\n\"since the colour space detection slows down the add item process a little bit.\"", "\n\nmsgid \"CMYK Support:\"\nmsgstr \"\"\n\nmsgid \"Save Settings\"\nmsgstr \"Save Settings\"\n\nmsgid \"Test Settings\"\nmsgstr \"Test Settings\"\n\nmsgid \"Cancel\"\nmsgstr \"Cancel\"\n\nmsgid \"Reset\"\nmsgstr \"Reset\"\n\nmsgid \"ImageMagick binary test results\"\nmsgstr \"\"\n\nmsgid \"Binary Name\"\nmsgstr \"Binary Name\"\n\nmsgid \"Pass/Fail\"\nmsgstr \"\"\n\nmsgid \"Passed\"\nmsgstr \"Passed\"\n\nmsgid \"Failed\"\nmsgstr \"Failed\"\n\nmsgid \"Error messages:\"\nmsgstr \"\"\n\nmsgid \"Version\"\nmsgstr \"Version\"\n\n#, c-format\nmsgid \"\"\n\"Warning: This version of %s has a %sknown vulnerability%s that can be exploited to cause \"\n\"infinite loops. ", "You may wish to upgrade. ", "This determination may be inaccurate for %sDebian%s.\"", "\nmsgstr \"\"\n\nmsgid \"Use this version anyway\"\nmsgstr \"Use this version anyway\"\n\nmsgid \"Supported MIME Types\"\nmsgstr \"Supported MIME Types\"\n\nmsgid \"The ImageMagick module can support files with the following MIME types:\"\nmsgstr \"\"\n\n#, c-format\nmsgid \"Debug output (%d failed test)\"\nmsgid_plural \"Debug output (%d failed tests)\"\nmsgstr[0] \"\"\nmsgstr[1] \"\"\n\nmsgid \"\"\n\"We gathered this debug output while testing your ImageMagick binaries. ", " If you read through \"\n\"this carefully you may discover the reason why your ImageMagick binaries failed the tests.\"", "\nmsgstr \"\"\n\"We gathered this debug output while testing your ImageMagick binaries. ", " If you read through \"\n\"this carefully you may discover the reason why your ImageMagick binaries failed the tests.\"", "\n" ]

{ "pile_set_name": "Github" }

[ 0.0009642126387916505, 0.0006268531433306634, 0.0005712580168619752, 0.0005935005028732121, 0.0009286980493925512, 0.0008988330373540521, 0.0006774330395273864, 0.0009257675847038627, 0.0006774330395273864, 0.0009907707571983337, 0.001007103594020009, 0.0007366521167568862, 0.0011273350100964308, 0.0006932029500603676, 0.0006701907841488719, 0.0006999589968472719, 0.0006529157399199903, 0.001127694733440876, 0.0006216141046024859, 0.0008920697146095335, 0.0007428118260577321, 0.0006139515317045152, 0.000722462369594723, 0.0006139515317045152, 0.001995444530621171 ]

[ "Q:\n\nHibernate, Java 9 and SystemException\n\nI've been trying to run Hibernate 5.2.11 application in Java 9/Spring Boot 1.5.x/Maven project but I'm failing at missing class:\nCaused by: java.lang.", "NoClassDefFoundError: javax/transaction/SystemException\n at java.base/java.lang.Class.forName0(Native Method)\n at java.base/java.lang.Class.forName(Class.java:375)\n at org.jboss.logging.", "Logger$1.run(Logger.java:2554)\n at java.base/java.security.AccessController.doPrivileged(Native Method)\n at org.jboss.logging.", "Logger.getMessageLogger(Logger.java:2529)\n at org.jboss.logging.", "Logger.getMessageLogger(Logger.java:2516)\n at org.hibernate.internal.", "HEMLogging.messageLogger(HEMLogging.java:28)\n at org.hibernate.internal.", "HEMLogging.messageLogger(HEMLogging.java:24)\n at org.hibernate.jpa.boot.internal.", "EntityManagerFactoryBuilderImpl.<clinit>(EntityManagerFactoryBuilderImpl.java:115)\n at org.springframework.orm.jpa.vendor.", "SpringHibernateJpaPersistenceProvider.createContainerEntityManagerFactory(SpringHibernateJpaPersistenceProvider.java:54)\n at org.springframework.orm.jpa.", "LocalContainerEntityManagerFactoryBean.createNativeEntityManagerFactory(LocalContainerEntityManagerFactoryBean.java:353)\n at org.springframework.orm.jpa.", "AbstractEntityManagerFactoryBean.buildNativeEntityManagerFactory(AbstractEntityManagerFactoryBean.java:370)\n at org.springframework.orm.jpa.", "AbstractEntityManagerFactoryBean.afterPropertiesSet(AbstractEntityManagerFactoryBean.java:359)\n at org.springframework.beans.factory.support.", "AbstractAutowireCapableBeanFactory.invokeInitMethods(AbstractAutowireCapableBeanFactory.java:1687)\n at org.springframework.beans.factory.support.", "AbstractAutowireCapableBeanFactory.initializeBean(AbstractAutowireCapableBeanFactory.java:1624)\n ... 33 more\n\nHas anyone encountered this exception and knows a workaround? ", "I tried adding --add-modules for javax.bind or java.se.ee but they didn't help.", "\nThe above error shows in a mavan-failsafe (2.20.1) integration test that starts Spring context with Hibernate.", "\nApplication doesn't have any Java 9 specific code.", "\n\nA:\n\nAccording to the migration guide and the java docs, since the module java.transaction which exports the package javax.transaction has been marked as @Deprecated. ", "\nYou should ideally migrate your code to be using javaee/javax.transaction instead. ", "Currently, you can do so using automatic module converted from the dependency:\n<dependency>\n <groupId>javax.transaction</groupId>\n <artifactId>javax.transaction-api</artifactId>\n <version>1.2</version>\n</dependency>\n\nand adding to the module-info.java the following:- \nrequires javax.transaction.api;\n\nAdditionally while using the maven-failsafe-plugin, make sure you are using the minimum compatible version 2.20.1 or above as mentioned in the progress document of Maven.", "\n<plugin>\n <groupId>org.apache.maven.plugins</groupId>\n <artifactId>maven-failsafe-plugin</artifactId>\n <version>2.20.1</version>\n</plugin>\n\n@Deprecated(forRemoval=\"after OP's confirmation\")\nOn the other hand, a temporary workaround (since eventually these modules will be removed from the JDK) could be to make use of:-\n--add-modules java.transaction\n\nAs mentioned in the comments, since the required dependency for javax.transaction-api is already available on the classpath, you shouldn't be required to add any compiler option or else you would end up overriding the current package with the java.transaction module's exported javax.transaction package which ideally for your use case doesn't consist of SystemException.", "\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.0007864625658839941, 0.0008715101284906268, 0.0009312060428783298, 0.00251268339343369, 0.005631760228425264, 0.0009619279881007969, 0.0010802658507600427, 0.0007636822992935777, 0.0008998081320896745, 0.0009289644658565521, 0.0008115987293422222, 0.0007695569074712694, 0.0007271278882399201, 0.0006875690305605531, 0.0007702384609729052, 0.0007907937979325652, 0.000660999387037009, 0.0006087473593652248, 0.0006342593696899712, 0.0007150296587496996, 0.0006537439185194671, 0.001995444530621171 ]

[ "A 25-year-old Indian woman in the US has been sentenced to three years’ probation for money laundering and faces imminent deportation for her role in an $170,000 phone scam in which thousands of dollars were netted from unwitting victims from 32 states. ", "Also Read - How to use your smartphone camera to attend video calls instead of the webcam\n\nNikita Patel worked as a “runner”, picking up money sent by people. ", "She fooled people into believing that they owed the Internal Revenue Service (IRS) back taxes, according to authorities. ", "Also Read - The xHelper malware explained: Why it is so dangerous and how to get rid of it?", "\n\nShe would take a cut for herself and then send the rest to India, where the fraudulent phone calls originated, Assistant Bergen County Prosecutor Brian Lynch said on Friday. ", "Also Read - World’s smallest 3G smartphone is now available for sale on Kickstarter; Details\n\nPatel was arrested with another runner, Akash S Patel last September. ", "She has been sentenced to three years’ probation for a charge of money laundering on Friday by Superior Court Judge Susan J Steele who said that frauds like the one perpetrated by her seem to be an endemic problem.", "\n\nLocal prosecutors said scam involved 72 people in 32 states. ", "Federal government has placed a deportation detainer on her. ", "As a result she continues to be in jail.", "\n\nThe Patels were originally charged with conspiracy to commit theft by deception, a second-degree crime. ", "Nikita later pleaded guilty to third-degree money laundering, a media report said. ", "Akash, 33, pleaded guilty to a third-degree theft charge in November. ", "He was also sentenced to probation, according to court records.", "\n\nLynch said yesterday that Akash, who is an Indian citizen, has since been deported." ]

{ "pile_set_name": "OpenWebText2" }

[ 0.006265691481530666, 0.0005672156694345176, 0.0009636125760152936, 0.0011247086804360151, 0.0007575235795229673, 0.0006943051121197641, 0.002287879353389144, 0.004673178307712078, 0.0010482665384188294, 0.01292897667735815, 0.0033497773110866547, 0.0016020081238821149, 0.0016289815539494157, 0.0017036200733855367, 0.0031331791542470455 ]