texts
sequence
meta
dict
scores
sequence
avg_score
float64
0
0.34
num_sents
int64
5
5
tagged_pii_results
list
[ "The present invention relates to a phase change memory.", "\nPhase change memories use a class of materials that have the property of switching between two phases having distinct electrical characteristics, associated with two different crystallographic structures of the material and variations thereof, such as an amorphous, disordered phase and a crystalline or polycrystalline, ordered phase. ", "The two phases are hence associated to resistivities of considerably different values where the more disordered phases are higher in resistivity and the crystalline phases are lower in resistivity.", "\nCurrently, the alloys of elements of group VI of the periodic table, such as Te or Se, referred to as chalcogenides or chalcogenic materials, can be used advantageously in phase change memory cells. ", "The currently most promising chalcogenide is formed from an alloy of Ge, Sb and Te (Ge2Sb2Te5), which is now widely used for storing information on overwritable disks and has also been proposed for mass storage.", "\nIn the chalcogenides, the resistivity may vary by two or more orders of magnitude when the material passes from the amorphous (more resistive) phase to the crystalline (more conductive) phase, and vice versa.", "\nPhase change can be obtained by locally increasing the temperature. ", "Below 150° C., both the phases are relatively stable, although there is some tendency over a period years at 150 C for the reset amorphous state to crystallize, thereby lowering its resistance. ", "Starting from an amorphous state, and rising the temperature above 200° C., there is a rapid nucleation of the crystallites and, if the material is kept at the crystallization temperature for a sufficiently long time, it undergoes a phase change and becomes crystalline. ", "To bring the chalcogenide back to the amorphous state, it is necessary to raise the temperature above the melting temperature (approximately 600° C.) and then rapidly cool off the chalcogenide." ]
{ "pile_set_name": "USPTO Backgrounds" }
[ 0, 0, 0, 0.01, 0.004739336492890996, 0, 0, 0, 0, 0 ]
0.001474
5
[ { "analysis_explanation": null, "end": 675, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 673 }, { "analysis_explanation": null, "end": 720, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 709 } ]
[ "Bill de Blasio Reflects on Troubled Father’s World War II Service\n\nStanding on board the USS Intrepid this morning, Mayor Bill de Blasio reflected on the military service of his father, a troubled World War II veteran who committed suicide when Mr. de Blasio was 18.", "\n\n“For my father, those battles he went through, including Okinawa, one of the bloodiest in the history of this nation, he was so honored to serve his country no matter what was thrown at him,” Mr. de Blasio said on Memorial Day.", "\n\n“Towards the end of the battle of Okinawa, a Japanese grenade came near him, went off, he lost half of his leg and he came back to this country and he had to fight again, and every veteran knows this,” the mayor continued. “", "You know it from your own lives. ", "You know it from the people you serve with. ", "He had to fight again to physically rehabilitate and he had to fight against things that were harder to identify.”", "\n\nMr. de Blasio’s father served in the Pacific theater and his mother worked in the Office of War Information. ", "His wife’s father served in the army in Europe and her mother worked on the assembly line in the Springfield, Massachusetts armory.", "\n\nLater in life, Mr. de Blasio’s father, Warren Wilhelm Sr., ", "became an alcoholic and grew estranged from his family. ", "Mr. de Blasio was born Warren Wilhelm Jr. and changed his name as an adult in a seeming effort to distance himself from his father.", "\n\nBut on Memorial Day, his father was on his mind.", "\n\n“The stories I heard from my father who was in places like the Aleutian Islands, Leyte Gulf, and ultimately Okinawa, [he] talked about ships like the Intrepid with awe,” recalled Mr. de Blasio. “", "They saw the Intrepid and the other great ships as their protectors. ", "And they knew that these ships were therefore targets for the enemy. ", "In fact this ship suffered five kamikaze airplane strikes, which is extraordinary that it came and it earned that title, Intrepid, for sure.”", "\n\nMr. de Blasio placed a wreath on the Hudson River in commemoration of deceased soldiers and solemnly stood while a 100-foot American flag was unfurled and a three volley rifle salute filled the air. ", "Before leaving, he posed for pictures and signed autographs for a crowd that gathered around him.", "\n\n“Now the Intrepid has always meant a lot to me. ", "Whenever I’ve been here, it doesn’t feel abstract, doesn’t feel I’m in a museum. ", "It feels like I’m touching something that is part of our own family’s lives,” Mr. de Blasio said." ]
{ "pile_set_name": "Pile-CC" }
[ 0.011278195488721804, 0.004366812227074236, 0, 0, 0, 0, 0.018018018018018018, 0, 0.03278688524590164, 0, 0.015267175572519083, 0, 0.02030456852791878, 0.014492753623188406, 0, 0.0070921985815602835, 0.004975124378109453, 0, 0.02, 0, 0.010309278350515464 ]
0.007566
5
[ { "analysis_explanation": null, "end": 14, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 0 }, { "analysis_explanation": null, "end": 114, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 102 }, { "analysis_explanation": null, "end": 136, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 122 }, { "analysis_explanation": null, "end": 258, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 249 }, { "analysis_explanation": null, "end": 265, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 263 }, { "analysis_explanation": null, "end": 331, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 324 }, { "analysis_explanation": null, "end": 472, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 463 }, { "analysis_explanation": null, "end": 493, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 481 }, { "analysis_explanation": null, "end": 536, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 529 }, { "analysis_explanation": null, "end": 548, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 540 }, { "analysis_explanation": null, "end": 925, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 916 }, { "analysis_explanation": null, "end": 956, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 949 }, { "analysis_explanation": null, "end": 1067, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1061 }, { "analysis_explanation": null, "end": 1129, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1118 }, { "analysis_explanation": null, "end": 1144, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1131 }, { "analysis_explanation": null, "end": 1181, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1172 }, { "analysis_explanation": null, "end": 1210, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1192 }, { "analysis_explanation": null, "end": 1281, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1272 }, { "analysis_explanation": null, "end": 1309, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1291 }, { "analysis_explanation": null, "end": 1419, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1407 }, { "analysis_explanation": null, "end": 1528, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1508 }, { "analysis_explanation": null, "end": 1540, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1530 }, { "analysis_explanation": null, "end": 1564, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1557 }, { "analysis_explanation": null, "end": 1641, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1632 }, { "analysis_explanation": null, "end": 1938, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1929 }, { "analysis_explanation": null, "end": 1974, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1958 }, { "analysis_explanation": null, "end": 2057, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2049 }, { "analysis_explanation": null, "end": 2442, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2433 } ]
[ "The Edmonton Oilers have a venerable past and an optimistic future. ", "How did this franchise get to where it is today? ", "We take a look at the Oilers, from the WHA years and the glorious '80s, to recent frustrations and back-to-back last-place finishes.", "\n\nOur infographic visualizes a year-by-year breakdown of how the Oilers were put together and how well they did. ", "But the magic of the Internet makes this more than just a cursory glance. ", "Each data point also has some history, context and explanation.", "\n\nHover with your mouse over the category titles on the left side to see more information. ", "Hover over each of the orange boxes, stars or columns of blue-and-orange boxes to see information windows pop up. ", "Those windows aim to give you a deeper understanding beyond the numbers.", "\n\nFor best results please use Chrome or Firefox to view this infographic.", "\n\nTo read more about this project and other Oilers news, click here. ", "To check out the Oilers on the web, click here.", "\n\nSeason record vs the Flames:\n\nPlayoff notes: The Oilers did not meet the Flames in the playoffs this season.", "\n\nSeason record vs the Flames:\n\n1-2-1\n\nPlayoff notes: The Oilers did not meet the Flames in the playoffs this season.", "\n\nSeason record vs the Flames:\n\n5-2-1\n\nPlayoff notes: The Oilers did not meet the Flames in the playoffs this season.", "\n\nSeason record vs the Flames:\n\n8-3-2\n\nPlayoff notes: The Oilers romped 4-1 in the first playoff meeting between the clubs, winning two games 10-2 and 9-1. ", "Andy Moog, not Grant Fuhr, played all five games in net for the Oilers, who spent most of the time terrorizing the Calgary goalies. ", "Edmonton scored 74 goals in 12 games through the first three playoff rounds, but they came up empty in the final against the New York Islanders.", "\n\nSeason record vs the Flames:\n\n11-3-1\n\nPlayoff notes: The Oilers outlasted the Flames in seven games in a series that was noteworthy because only two games had fewer than eight goals. ", "The teams used all of their goalies ¬- Grant Fuhr won three games and Andy Moog the final one 7-4 while the much-maligned Reggie Lemelin won twice and Don Edwards had one win. ", "The Oilers were 2-1 at Calgary in the series and only 2-2 at the Northlands Coliseum, a building where they seldom lost during the regular season. ", "Of note: Edwards was playing with the Buffalo Sabres when he gave up Wayne Gretzky's 77th goal to break Phil Esposito's single-season record on Feb. 24, 1982.", "\n\n6-1-1\n\nPlayoff notes: The Oilers did not meet the Flames in the playoffs this season.", "\n\nSeason record vs the Flames:\n\n9-5-1\n\nPlayoff notes: The Flames beat the Oilers in seven games when defenceman Steve Smith, who had turned 23 that day, went back to get a puck and unbelievably had his pass go off goalie Grant Fuhr's leg and into the Edmonton net early in the third period of Game 7. ", "Calgary won 3-2.", "\n\n\"I got good wood on it,\" said Smith, now the Oilers assistant coach who later went on to play for the Flames, as well.", "\n\n\"I turned and saw Lanny's (McDonald) hands in the air and I had to ask what happened,\" said Flames forward Perry Berezan, who got credit for the goal because he was the last Calgary player to touch the puck.", "\n\nIt was the only goal Berezan, an Edmonton native, would score in the playoffs.", "\n\n\"Sometimes, the good Lord smiles on you,\" said McDonald.", "\n\nAs much as Smith's gaffe was costly, people forget the Oilers had most of a period left and had a six-on-four manpower advantage in the last minute when Calgary got caught for too many men on the ice and the Oilers yanked Fuhr for an extra skater. ", "Lost in Game 7, as well, was this: Calgary lost its second-best defenceman, Gary Suter, to badly damaged knee ligaments after taking a hit from Mark Messier. ", "Suter, who scored six points in the second-to-last league game against the Oilers, was done for the rest of the playoffs.", "\n\nIn Game 6, Calgary also lost forward Carey Wilson to a ruptured spleen, with Smith fingered as the culprit.", "\n\nSeason record vs the Flames:\n\n1-6-1\n\nPlayoff notes: The Oilers did not meet the Flames in the playoffs this season.", "\n\nSeason record vs the Flames:\n\n7-4-1\n\nPlayoff notes: his time, the Oilers went in as slight underdogs, even though they were the defending Stanley Cup champions, because Calgary had won the Smythe Division while the Oilers finished second. ", "In the end, the regular season meant squat as the Oilers won the series 4-0.", "\n\nThe most dynamic game was the second one when Jari Kurri tied the score with four minutes left in the third period, going around Calgary defenceman Paul Reinhart and blowing a 30-footer past Mike Vernon. ", "Wayne Gretzky won the game in overtime with a short-handed slapper while coming down the left wing just before Mark Messier's tripping penalty expired.", "\n\n\"Biggest goal I ever scored,\" said Gretzky.", "\n\nIn Game 3, Marty McSorley speared Mike Bullard after the Oilers' tough guy had been drilled face-first into the boards by Gary Roberts. ", "McSorley was looking to even the score against anybody in a Calgary sweater. ", "Bullard happened by and left on a stretcher.", "\n\nSeason record vs the Flames:\n\nPlayoff notes: The Oilers did not meet the Flames in the playoffs this season.", "\n\nSeason record vs the Flames:\n\n3-4-1\n\nPlayoff notes: The Oilers did not meet the Flames in the playoffs this season.", "\n\nSeason record vs the Flames:\n\n7-7-1\n\nPlayoff notes: The Oilers prevailed in seven games in what have been the best-ever playoff between the clubs with both of the final two games going to overtime. ", "There was Theo Fleury sliding across the ice on his knees, absolutely ecstatic, after his OT winner on the Oilers' Grant Fuhr in Game 6 to tie the series 3-3, then a disbelieving Esa Tikkanen beating Calgary goalie Mike Vernon seven minutes into OT in Game 7 at the Saddledome.", "\n\nThe Oilers fell behind 3-0 before Tikkanen gave Edmonton a sliver of life in the dying seconds of the first period with a bad goal on Vernon. ", "The winner was a fluke. ", "Tikkanen was standing beside the boards to Vernon's left and sent a harmless shot in the goalie's direction, but the puck glanced off Flames defenceman Frank Musil and nestled past Vernon.", "\n\nMusil now works for the Oilers as a scout while his son, David, is playing junior with the Edmonton Oil Kings and was the Oilers' second-round draft pick in 2011.", "\n\nSeason record vs the Flames:\n\n3-3-1>\n\nPlayoff notes: The Oilers did not meet the Flames in the playoffs this season.", "\n\nSeason record vs the Flames:\n\n1-6-0>\n\nPlayoff notes: The Oilers did not meet the Flames in the playoffs this season.", "\n\nSeason record vs the Flames:\n\n1-5-0\n\nPlayoff notes: The Oilers did not meet the Flames in the playoffs this season.", "\n\nSeason record vs the Flames:\n\n1-4-0\n\nPlayoff notes: The Oilers did not meet the Flames in the playoffs this season.", "\n\nSeason record vs the Flames:\n\n2-4-0\n\nPlayoff notes: The Oilers did not meet the Flames in the playoffs this season.", "\n\nSeason record vs the Flames:\n\n3-2-0\n\nPlayoff notes: The Oilers did not meet the Flames in the playoffs this season.", "\n\nSeason record vs the Flames:\n\n3-1-1\n\nPlayoff notes: The Oilers did not meet the Flames in the playoffs this season.", "\n\nSeason record vs the Flames:\n\n4-1-1\n\nPlayoff notes: The Oilers did not meet the Flames in the playoffs this season.", "\n\nSeason record vs the Flames:\n\n2-4-0\n\nPlayoff notes: The Oilers did not meet the Flames in the playoffs this season.", "\n\nSeason record vs the Flames:\n\n4-0-1\n\nPlayoff notes: The Oilers did not meet the Flames in the playoffs this season.", "\n\nSeason record vs the Flames:\n\n2-2-1\n\nPlayoff notes: The Oilers did not meet the Flames in the playoffs this season.", "\n\nSeason record vs the Flames:\n\n2-3-0\n\nPlayoff notes: The Oilers did not meet the Flames in the playoffs this season.", "\n\nSeason record vs the Flames:\n\n1-4-1\n\nPlayoff notes: The Oilers did not meet the Flames in the playoffs this season.", "\n\nSeason record vs the Flames:\n\n3-5-0\n\nPlayoff notes: The Oilers did not meet the Flames in the playoffs this season.", "\n\nSeason record vs the Flames:\n\n3-5-0\n\nPlayoff notes: The Oilers did not meet the Flames in the playoffs this season.", "\n\nSeason record vs the Flames:\n\n4-4-0\n\nPlayoff notes: The Oilers did not meet the Flames in the playoffs this season.", "\n\nSeason record vs the Flames:\n\n3-3-0\n\nPlayoff notes: The Oilers did not meet the Flames in the playoffs this season.", "\n\nSeason record vs the Flames:\n\n0-6-0\n\nPlayoff notes: The Oilers did not meet the Flames in the playoffs this season.", "\n\nSeason record vs the Flames:\n\n1-5-0\n\nPlayoff notes: The Oilers did not meet the Flames in the playoffs this season.", "\n\nSeason record vs the Flames:\n\n2-4-0\n\nPlayoff notes: The Oilers did not meet the Flames in the playoffs this season.", "\n\nDid not qualify\n\nThe Oilers tied Minnesota Fighting Saints for the last playoff spot - both finished with a record of 38-37-3 - and, in a one-game sudden-death affair held at the neutral-site Stampede Corral in Calgary, lost 4-2 and didn't make post-season. ", "Bill Hunter's club had beaten the Fighting Saints 5-3 in the final regular-season game, and Hunter thought that meant they were in the playoffs because they had won what was a tie-breaker in his mind. ", "But the WHA said they had to play the one-game playoff.", "\n\nPreliminary Round\n\nOnce again, the Fighting Saints, who played out of the old St. Paul Civic Center with its clear acrylic glass boards, got the best of the Oilers, this time in the WHA Western Division semifinals as seeds Nos. ", "2 and 3, respectively. ", "This time, coach Harry Neale's team made short work of Edmonton, finishing them off in five games of the best-of-seven affair. ", "Fighting Saints centre Mike (Shaky) Walton was Neale's best player that campaign; he was crowned the WHA scoring champ with 117 points.", "\n\nDid not qualify\n\nOilers GM Bill Hunter replaced head coach Brian Shaw with himself down the stretch, but the squad went 6-12-1 the rest of the way and missed the playoffs, finishing last in the five-team Canadian Division. ", "Lesson learned: they should have kept Shaw.", "\n\nQuarterfinals\n\nThe Oilers returned to the playoffs after finishing fourth in the Canadian Division but never had a prayer against Bobby Hull, Anders Hedberg and Ulf Nilsson in a four-game Winnipeg Jets sweep. ", "This was very much a Christians vs. lions affair, as the Jets finished atop the WHA with a record of 52-27-2 for 105 points, while the Oilers went 27-49-5 for 59 points.", "\n\nQuarterfinals\n\nGlen Sather started the season as captain but took over as bench boss from Bep Guidolin in the last 18 games and got the Oilers into the playoffs, where they were routed four games to one by the Houston Aeros, who featured Gordie, Mark and Marty Howe and NHLers-to-be Tery Ruskowski, Rich Preston and John Tonelli.", "\n\nPreliminary Round\n\nThe Oilers finished fifth in the 10-team circuit, good enough for a respectable 79 points in 80 games, but got bounced by the New England Whalers in five games with Gordie, Mark and Marty Howe now re-located to Hartford, with Gordie and Mark notching 96 and 91 regular-season points, respectively.", "\n\nFinals\n\nThe Oilers finally finished atop the WHA standings in the last year of the league's operations. ", "There were seven remaining teams - Edmonton, Winnipeg, Quebec, New England, Cincinnati, Birmingham and Indianapolis, with the Indy Racers dropping out on Dec. 15, 1978 because they couldn't make a financial go of it. ", "That season, touring teams from the Soviet Union and Czechoslovakia played the WHA clubs and points from those games counted in the final tally. ", "But even though the Oilers finished 11 points ahead of the second-place Nordiques that season and advanced to the league final, they didn't win the Avco Trophy - the long-time rival Winnipeg Jets beat them in six games. ", "Of the four WHA franchises that joined the NHL the next season, the Oilers were the only one not to win the Avco Trophy.", "\n\nPreliminary round\n\nThe Oilers were put in the Smythe Division to start their NHL days, playing with the Chicago Blackhawks, the St. Louis Blues, the Vancouver Canucks, the Winnipeg Jets and the Colorado Rockies. ", "They finished with 69 points, one back of the Canucks, to finish fourth. ", "The top four teams in each of the four divisions made the playoffs, with the team having the fewest points starting as the No. ", "16 seed and drawing the club with the most points as No. ", "1 seed in a best-of-five series. ", "As it turned out, the Oilers had the fewest points of the playoff clubs and drew the Philadelphia Flyers, who had started the 1979-80 campaign on a record undefeated tear, recording a point in their first 35 games (25-0-10). ", "The Flyers swept the Oilers in three games, ultimately falling to the New York Islanders in the Stanley Cup final.", "\n\nQuarterfinals\n\nThis playoff defined the early NHL Oilers, who entered the playoffs in 1980-81 as the No. ", "14 seed, because they shockingly KO'd the Montreal Canadiens in Round 1, sweeping Les Glorieux in three straight while backstopped by the unheralded Andy Moog in net; he gave up just six goals in the three games. ", "Wayne Gretzky did a number on Canadiens goalie Richard Sevigny, who had foolishly said he'd put No. ", "99 in his hip pocket, winger Dave Hunter so infuriated the third-seeded Habs with his robust checking of Guy Lafleur that Guy Lapointe tried to hit him with a swinging helmet in a scuffle, and Jari Kurri won a tense game two with a late snipe.", "\nIn Round 2, the Oilers drew the defending Cup champion Islanders and pushed them to six games, singing \"Here We Go Oilers, Here We Go\" on the bench on Long Island in their Game 5 win. ", "The Islanders, who would go on to win four Cups in a row, turned the series in game four when defenceman Ken Morrow, armed with a shot that was timed with a sun-dial, dribbled the OT winner past Moog to give them a 3-1 series lead. ", "The Oilers won a legion of new fans in this series with Al Arbour's juggernaut.", "\n\nPreliminary round\n\nThis playoff proved to be the Oilers' wake-up call, as they were shockingly ousted in the first round to the Los Angeles Kings. ", "Wayne Gretzky had scored 92 goals and put up 212 points during the regular season, and the Oilers were 48 points better than Don Perry's Tinseltown club. ", "But in what is known infamously in Edmonton as the Miracle on Manchester, the Oilers blew a 5-0 lead in the middle period of Game 3, with the series tied at one apiece. ", "Steve Bozek scored in the dying seconds of regulation with their goalie Mario Lessard pulled and Daryl Evans, now a Kings' radio commentator, ripped a 30-foot shot past Grant Fuhr on Doug Smith's face-off win 2 1/2 minutes into OT for a 6-5 L.A. win. ", "When the game was over, the Oilers looked like they'd been run over by a cement mixer.", "\n\nThe Oilers won the low-scoring games (3-2 twice) but lost all the high-scoring ones (10-8 in the first game, blowing a 4-1 lead 10 minutes in, then the 6-5 Game 3 loss and 7-4 in the final game). ", "The teams had chartered back from L.A. following Game 4 on the same plane.", "\n\nThe series loss was an inconceivable result considering the Oilers had scored 103 more goals (417 to 314) than the Kings in regular-season play. ", "It was the series in which Oilers assistant coach Billy Harris ripped the team for being unprepared and cavalier in their approach to playing an inferior team.", "\n\nStanley Cup Finals\n\nThe Oilers continued their education on what it takes to be champions this campaign, making it all the way to the finals for the first time, losing only one game in their first three series along the way (against the Winnipeg Jets, the Calgary Flames and the Chicago Blackhawks) and got a lesson in what it took to win from the Islanders, who stifled them in a four-game sweep. ", "The Oilers, who had scored 79 goals in 13 games over the first three rounds (that's six a game), potted just six in the four losses to the powerhouse Islanders, who claimed their fourth Stanley Cup in a row in beating Edmonton. ", "The whole series was like trying to walk up a down escalator.", "\n\n\"When I was leaving the building, I looked into the Islanders dressing room, and they were celebrating with ice-bags on their shoulders, jaws, knees,\" said Oilers' defenceman Kevin Lowe, who got the visual, visceral message that skill was fine, but sacrifice was what it really took to win a Stanley Cup.", "\n\nStanley Cup Finals\n\nThis time, the Oilers got it done against the Islanders and beat the defending champions in five games to win their first of five Cups in a glorious seven-year period.", "\n\nJust as owner Peter Pocklington had boldly predicted back in 1979, his team won a Cup within their first five years in the NHL, much to the dismay of teams such as the Toronto Maple Leafs, which hadn't won (and still haven't won) since 1967.", "\n\nThere were some scares along the way. ", "In Round 2, they had to go seven games to beat Badger Bob Johnson's Flames, with Calgary coming back from 3-1 down in the series to force a Game 7. ", "Calgary won two overtime games (Game 2 and Game 6.) ", "In Game 7, the Oilers lit up goalie Reggie Lemelin, however, and cruised to victory. ", "The interesting thing about the first three rounds in '84: Glen Sather played both Grant Fuhr and Andy Moog in net, and Sather would need Moog to close the deal in the finals with the Islanders.", "\n\nThere were two pivotal moments in the final. ", "In the first game on Long Island, Kevin McClelland, who had come over from Pittsburgh in a trade for Tom Roulston to add pugnaciousness to the lineup, snuck one past Billy Smith in the third period for the only goal of the game, with Fuhr getting the shutout. ", "McClelland had just 10 goals all season. \"", "Somebody yelled at Mac that he was a national hero now,\" Kevin Lowe said in recollection.", "\n\nIn Game 3, Mark Messier went end-to-end on a swashbuckling play, sliding between the defensive duo of Denis Potvin and Gord Dineen and tucking one past Smith to start a 7-1 rout. ", "The Oilers went to Moog for the last two games when Fuhr injured his shoulder after being plowed into the end boards by Pat LaFontaine in Game 4. ", "LaFontaine turned a 4-0 rout into a 4-2 nail-biter with two goals early in the third in game five, but Dave Lumley put it away with an empty-netter.", "\n\n\"Everything was a blur when the game ended. ", "My stick, gloves, everything went in the air. ", "I have no idea where they went,\" said Lowe.", "\n\nStanley Cup Finals\n\nIt's never easy repeating with a bullseye on your back, but the Oilers got it done, whipping the Philadelphia Flyers in five games in the final.", "\nThey got even for the '82 Miracle on Manchester, beating the Los Angeles Kings in Round 1, in which they scored two OT wins (courtesy Lee Fogolin and Glenn Anderson tallies in games 1 and 3, respectively).", "\n\nThe Oilers tortured Chicago Blackhawks goalie Murray Bannerman in the Campbell Conference final, scoring 11, 10, eight and seven goals in their four wins. ", "When Bannerman threw his goalie stick into the crowd after the final tilt of the six-game series, the Chicago Stadium fans threw it back. \"", "It'll probably go through his legs,\" yelled one disgruntled customer. ", "After the 11-2 Game 1 wall-papering, Hawks coach Orval Tessier said his club needed a \"heart transplant,\" which appropriately made his players ready to grab the coach by the throat.", "\n\nIn the Stanley Cup final, a comedy of errors plagued the team ahead of the series opener in Philadelphia: Glenn Anderson missed the plane to Philly for the opener, the team bus taking the Oilers to practice got lost, then the bus broke down in front of someone's yard, and the Oilers went inside the fellow's place and watched TV or threw a baseball around. ", "It was a harbinger of a 4-1 setback in Game 1. ", "But they got their act together after that and bounced back to win the next four to claim their second straight Cup title.", "\n\nQuarterfinals\n\nNobody will forget Oilers defenceman Steve Smith's own-goal on goalie Grant Fuhr in Game 7 of the team's Round 2 series against their nemesis, the Calgary Flames, which effectively ended their quest for a third straight Stanley Cup. ", "The young Smith, substituting for the injured Lee Fogolin, was behind his net six minutes into the third period, attempting a long head-man pass when his bobbled breakout attempt bounced off the left leg of Fuhr, who wasn't guarding the post. \"", "What the heck just happened ... how is the puck in our net?\" ", "Oilers' associate coach John Muckler asked.", "\n\nPerry Berezan, the last Flames' player to touch the puck before Smith's pass, got credit for the 3-2 winner. ", "After the game, to his credit, Smith took on all-comers as wave after wave of reporters descended on his locker stall. ", "He got bags and bags of mail that summer from kids and supportive fans and became a bit of a folk hero because of the flub.", "\n\nStanley Cup Finals\n\nThe Oilers swung a flurry of deals in '87, sending away in separate transactions former captain Lee Fogolin, Wayne Gretzky's bodyguard Dave Semenko and the tough-as-nails Don Jackson, getting in return Norm Lacombe and the rights to a little puck-moving Finnish defenceman named Rexi Ruotsalainen. ", "GM Glen Sather also traded a draft pick to Minnesota for winger Kent Nilsson at the deadline and immediately slapped the hugely-talented but enigmatic former Flames sniper on a line with Mark Messier and Glenn Anderson. ", "Arguably, this was the fastest line in NHL history.", "\n\nThen Oilers beat the Flyers in a thrilling seven-game final, outlasting Philly goalie Ron Hextall, who won the Conn Smythe trophy but incurred the wrath of the NHL and Oilers fans with a ripping two-hander on Nilsson that got him suspended following the playoffs. \"", "Wasn't that hard,\" Hextall said years later, feeling Nilsson had milked it a tad.", "\n\nThe Oilers led the Staley Cup final three games to one against an injury-riddled but never-quit Flyers and their psychological coach Mike Keenan, who had somehow seconded the Stanley Cup and put it on a table in his club's dressing room before games 5 and 6 as inspiration. ", "Before Game 7, Keenan tried it again at Northlands Coliseum but couldn't find it. \"", "It's on the way down the road with the lions and tigers after the circus left town,\" kidded Oilers' equipment man Lyle Kulchisky, who had actually hid it away. ", "In the final game, Anderson beat Hextall late in the third with a shot through the goalie's wickets to put it away.", "\n\nStanley Cup Finals\n\nIt was a turbulent Oilers season, starting very early. ", "They dealt Paul Coffey to Pittsburgh over money in November, getting young winger Craig Simpson in return, and goalie Andy Moog refused to sign a new contract, opting instead to play for the 1988 Canadian Olympic team. ", "Moog was later traded for future Conn Smythe Trophy winner Bill Ranford and winger Geoff Courtnall. ", "Ranford backed up Grant Fuhr.", "\n\nBefore the Oilers beat the Bruins in the finals, they polished off Calgary four straight in Round 2, which featured Wayne Gretzky's shorthanded OT slapper in Game 2 that sailed by Mike Vernon - one of No. ", "99's all-time favourite goals. ", "It gave the Oilers a 2-0 series lead following the opening pair of games in Calgary, and they made short work of the Flames thereafter.", "\n\nThe Oilers beat the Bruins in the Stanley Cup final for their fourth title in five years, in a four-game sweep with an asterisk. ", "It actually went five games, with Game 4 on May 24, 1988, wiped out with the score 3-3 in the second period. ", "A power transformer in the city's north end blew and the old Garden went dark after the clubs had already skated in fog-like conditions much of the night because the humidity was so high in the building.", "\n\n\"We didn't have any light in our room except for some from the TV cameras and we were sending out for pizzas,\" former Oilers' equipment man Lyle Kulchisky said.", "\n\nThe game was cancelled, the NHL moved the contest to Edmonton, and the Oilers won it 6-3, ending the series. ", "Nobody knew Kevin Lowe had played with three broken ribs on his left side since Ray Neufeld hit him in the first playoff round with the Winnipeg Jets. ", "Nobody knew when Gretzky posed for a group picture after getting the Cup that it was his final game in an Oilers jersey. ", "He left for Los Angeles 2-1/2 months later.", "\n\nPreliminary round\n\nThe Oilers went down to Wayne Gretzky and the Kings in Round 1, with Los Angeles taking the last three games behind goalie Kelly Hrudey. ", "It was a difficult series for No. ", "99 and the Oilers, who would have done anything to avoid playing one another, especially in the opening round. ", "The Oilers had only lost in Round 1 of the playoffs three times in their first 10 years of NHL post-season play, and two of those series losses came at the hands of the Kings. ", "Kevin Lowe, who hit everything that moved in his NHL career, admittedly said he didn't have much stomach for nailing his buddy Gretzky. \"", "It was tough,\" Lowe said.", "\n\nStanley Cup Finals\n\nThe Oilers won the Stanley Cup minus Gretzky, beating Ray Bourque and the Boston Bruins in five games in the final but not before some scary playoff moments in the lead-up to their fifth Cup. ", "It started in Round 1 when they fell behind three games to one to the Winnipeg Jets. ", "Winnipeg's Finnish assistant coach Alpo Suhonen made the mistake in the papers of saying the Oilers looked confused, and grabbing at any psychological straw they could, Edmonton clawed back and won the series in seven. ", "Unheralded centre Mark Lamb had two game-winners in the series, including one in OT in Game 2.", "\n\nIn Round 3, they were trailing the Chicago Blackhawks 2-1 with game four at the madhouse Stadium when Mark Messier took over. ", "He grabbed his teammates and the series by the throat in an unbelieveably riveting performance, getting three points in a 4-2 win and abusing any Chicago player who dared look at him the wrong way. \"", "He could have had a penalty on every shift,\" griped Blackhawks coach Mike Keenan, who later had Messier on his Cup-winning 1994 Rangers squad and appreciated The Moose a lot more. ", "The Oilers won the last three games of their Campbell Conference final series against the Blackhawks and had an easy time against the Bruins in the final - following Game 1, anyway.", "\n\nOilers winger Petr Klima got the winner in the Stanley Cup opener with five minutes left in the third OT frame, when he slid one past goalie Andy Moog, using Craig MacTavish as a decoy on a 2-on-1 break. ", "Klima had sat on the bench for about three hours because coach John Muckler didn't like his effort. \"", "I felt like the doorman,\" said Klima, who busied himself opening and closing the bench gate as the periods dragged on. ", "The Oilers won Game 2 on Jari Kurri's hat-trick en route to claiming their fifth Cup, the only one on the road. ", "Family, friends and rats in the Garden dressing room. ", "Much more subdued than the first four Cup wins.", "\n\nConference Finals\n\nThe Oilers somehow got to the Campbell Conference final once again, but this time, they were playing on fumes. ", "They outlasted the Calgary Flames in seven games in the opening round when Esa Tikkanen's bad-angle shot seven minutes into OT glanced off defenceman Frank Musil and past goalie Mike Vernon in the stirring final game. ", "The Oilers had trailed the game 3-0 at one point. ", "The series caught the imagination of everybody and, truthfully, was way more riveting than the Cup final between Pittsburgh and Minnesota.", "\n\nNot to be outdone by the hair-raising win over the Flames, the Oilers battled through a six-game affair with Wayne Gretzky's Los Angeles Kings in Round 2, with four of those contests going to overtime. ", "They won three of them, two of them in double OT (courtesy the much-maligned Petr Klima and the pest Tikkanen) and got the series-clinching win on a Craig MacTavish's goal past goalie Kelly Hrudey.", "\n\nThey were out of gas and it showed in Round 3 - the conference final -- against Minnesota. ", "They bowed out of the post-season in losing to the North Stars in five games.", "\n\nConference Finals\n\nThey were losing stars left, right and centre - Mark Messier, Grant Fuhr and Glenn Anderson, all who've had their sweater numbers retired by Edmonton, were dealt in the preseason - but the Oilers lasted in the NHL postseason until the Campbell Conference final once again before going down in four straight games to coach Mike Keenan's Chicago Blackhawks, who featured Eddie Belfour in net and forward dynamo Jeremy Roenick, who scored the winning goals in games 3 and 4. ", "Belfour would be a constant thorn in the Oilers' sides for years to come, particularly at the turn of the century in playoff play as a member of the Dallas Stars.", "\n\nThe Oilers beat Gretzky's L.A. Kings in Round 1 and the Vancouver Canucks in the Round 2 Smythe Division final, both taking six games. ", "New playoff heroes emerged for the Oilers, with Joe Murphy netting two game-winners, one in OT, against the Canucks. ", "Once again, however, the team was spent by the time they reached the conference final. ", "Little did anybody know that the May 22, 1992, Game 4 loss would be the last Oilers playoff game until April 16, 1997. ", "Oilers fans enjoyed a charmed life for a dozen years, then they endured a post-season drought when their beloved team finished 20th, 23rd, 22nd and 21st overall in league play the next four seasons.", "\n\nDid not qualify\n\nThe Oilers did not qualify for the playoffs this season.", "\n\nDid not qualify\n\nThe Oilers did not qualify for the playoffs this season.", "\n\nDid not qualify\n\nThe Oilers did not qualify for the playoffs this season.", "\n\nDid not qualify\n\nThe Oilers did not qualify for the playoffs this season.", "\n\nWestern Semifinals\n\nThe Oilers returned to the NHL playoffs following four seasons trolling near the league's basement, lasting two rounds. ", "They lost out to star goalie Patrick Roy's Colorado Avalanche, but the big story of Edmonton's postseason was how they eliminated the No. ", "2 Western Conference seed Dallas Stars.", "\n\nThe Oilers stunned the NHL world by somehow beating Dallas in seven hair-raising opening-round games. ", "Dallas amassed 104 points in regular season, while the seventh-seeded Oilers had collected 81.", "\nIn Game 3, completely shackled and down 3-0 with four minutes left in the contest, the Oilers somehow forced overtime, with most of the crowd already in the parking lots and trying to stampede back into the building. ", "Checker Kelly Buchberger won it against former Oilers goalie Andy Moog halfway through the first OT in one of those Ripley's Believe It Or Not deals.", "\n\nIn Game 5, Ryan Smyth notched the game's only goal early in the second OT as Curtis Joseph out-dueled Moog.", "\n\nThen came the Game 7 stunner, in which Joseph - known affectionately league-wide as Cujo - robbed Joe Nieuwendyk with a staggering blocker stop in his crease (maybe the best save any goalie has ever made in post-season) and Todd Marchant raced down seconds later, stepped around stumbling Stars defenceman Grant Ledyard and whipped a far side shot past Moog for a 4-3 OT victory to clinch the series.", "\n\n\"In those days, you'd be playing a team with a payroll $30 million or $40 million more than you. ", "This was big,\" said then-top line Oilers centre Doug Weight, who fed Marchant for the winner. \"", "All I remember was Toddy flying and I got him the puck.\"", "\n\nWestern Semifinals\n\nAs satisfying as the Oilers beating the Dallas Stars was in 1997, knocking off the game's second-winningest goalie Patrick Roy and the mighty Avalanche a year later was arguably an even-bigger feat. ", "The Oilers, who had dealt Jason Arnott to New Jersey for Bill Guerin halfway through the season and had peddled rugged defenceman Bryan Marchment to Tampa Bay for Roman Hamrlik, were down three games to one in the first-round series against the powerful Avs but came back to win three straight. ", "Curtis Joseph recorded back-to-back shutouts in games 6 and 7 (the last one 4-0 in Denver, which turned the building into a library). ", "Cujo gave up only one goal in his last nine periods against a team that was 15 points better in regular-season, and that had won the Stanley Cup two years before and would win again in 2001. ", "The Oilers fell to Dallas in Round 2, but again, they proved a point knocking off a much superior team in one playoff round. ", "Following the season, however, the Oilers watched free-agent Cujo sign a four-year, $16-million deal with the Toronto Maple Leafs. ", "A big loss.", "\n\nQuarterfinals\n\nTop Oilers scorer Doug Weight suffered a knee injury this season and could only play 43 games, but the team somehow snuck into the playoffs anyway, going out four straight to Dallas in the first round. ", "They lost all four games by a single goal, the last one when Joe Nieuwendyk tipped a Sergei Zubov shot past recently acquired goalie Tommy Salo with 2-1/2 minutes to go in the third overtime. ", "Salo came from the New York Islanders for Mats Lindgren and an eighth-round pick that turned into defenceman Radek Martinek. ", "Salo went 8-2-2 in his 12 starts down the regular-season stretch.", "\n\nQuarterfinals\n\nThe Oilers featured a popgun attack this campaign, with only player Doug Weight recording more than 54 points, but the exceptional goaltending of Tommy Salo - who sported a sparkling 2.33 goals-against average in 70 games - propelled the team into the playoffs. ", "Trouble was they drew Dallas again in the opening playoff round, and Ed Belfour outplayed Salo as the Oilers lost in five games. ", "The season began with a 15-foot bronze statue of the retired Wayne Gretzky erected outside the front doors of Rexall Place, with his No. ", "99 jersey retired and pulled up to the rafters. ", "At season's end, GM Glen Sather bolted for the New York Rangers because he couldn't get along with a couple of members of the Oilers' ownership group.", "\n\nQuarterfinals\n\nPush the rewind button. ", "The Oilers lost again to Dallas in round one, this time in six games, with the Stars winning three games in overtime, the most crippling one being Game 5 when current Carolina Hurricanes coach Kirk Muller beat Salo in extra time. ", "Belfour again bested Salo in the goalie battle, an annual spring rite. ", "To get to the playoffs, new Oilers GM Kevin Lowe did some horse-trading, shockingly moving Billy Guerin, who was due to be an unrestricted free-agent following the season, to Boston for Anson Carter. ", "Guerin had 21 points in 22 games at the time. ", "Carter was good, but he was no Guerin. ", "Salo was terrific again in regular-season play (eight shutouts), while up front, Doug Weight had 90 points and Ryan Smyth 31 goals. ", "The Oilers enjoyed a nine-game winning streak from Feb. 20 to March 13, giving up just 13 goals in that span - the run helped solidify their playoff spot.", "\n\nDid not qualify\n\nThe Oilers did not qualify for the playoffs this season.", "\n\nQuarterfinals\n\nAfter missing the post-season in 2001-02, with Doug Weight traded to the St. Louis Blues over salary concerns, the Oilers bounced back but lost yet again to Dallas in the first round. ", "They'd won two of the first three but stumbled after that, eventually falling in six games. ", "Tommy Salo, who had an ordinary regular-season (2.71 goals-against average), put up a 3.15 average in the playoffs. ", "To get to the postseason, the Oilers saw Todd Marchant enjoy a career year (60 points) and parlay that into a big free-agent contract with Columbus the following summer. ", "To shake things up, the Oilers pulled off a couple of late deals, moving defenceman Janne Niinimaa to the Islanders for wingers Raffi Torres and Brad Isbister, and sent Anson Carter to the Rangers for forward Radek Dvorak and defenceman Cory Cross.", "\n\nDid not qualify\n\nThe Oilers did not qualify for the playoffs this season.", "\n\nStanley Cup Finals\n\nAnd then came a miracle Stanley Cup run that aroused the magic and memories of the glory years. ", "The Oilers came within one win of a Cinderella finish, losing to the Carolina Hurricanes in the deciding game of a thrilling seven-game final after coming back from being down three games to one to force the winner-take-all in Raleigh, N.C.\n\nEverything worked for the Oilers, who finished the campaign with 95 points, the most points they'd run up since '87-88, when they put up 99. ", "It was good for just eighth place in the ultra-competitive West, however, but GM Kevin Lowe had pushed all the right buttons.", "\n\nThe Oilers stunned the top-seeded Red Wings in Round 1 by veering away from their usual forechecking style and adopting the trap. ", "They stayed in the neutral zone and thoroughly frustrated the Wings, who went down in six games. ", "Dwayne Roloson also greatly outplayed Detroit goalie Manny Legace, who patrolled the Detroit net with Chris Osgood hurt.", "\n\nIn Round 2, Shawn Horcoff saved them against the San Jose Sharks. ", "After losing the first two games, Horcoff banged one home two minutes into the third overtime of Game 3. ", "The Oilers fed off the heroics to win three more in a row and win the series, outscoring the Sharks 14-6 over the last three games. ", "Roli the Goalie gave up only 10 goals in the six-game affair.", "\n\nIn the Western Conference final, the Oilers went into Anaheim and beat them twice 3-1, and playoff hero Fernando Pisani notched two game-winners in the series to give him a total of three in the playoffs.", "\n\nIn the Cup final, Roloson was hurt in Game 1 when Oilers defenceman Marc-Andre Bergeron pushed Ladd into him. ", "Little-used backup Ty Conklin gave up that game's winner to Rod Brind'Amour when he got tied up behind the net with captain Jason Smith. ", "Third-string goalie Jussi Markkanen, who hadn't played in months, got the call after that. ", "Down three games to one in the series, Pisani put the overtime winner past Hurricanes goalie Cam Ward on a breakaway while shorthanded. ", "Game 6 saw the Oilers walloped the Canes 4-0 at Rexall Place as Pisani got his 14th playoff goal and fifth game-winner of the playoffs. ", "In Game 7, the Oilers were nervous out of the gate and fell behind 2-0. ", "Pisani came within inches of tying it in the third, and Carolina forward Justin Williams ended their dream with an empty-netter.", "\n\nAt season's end, Chris Pronger floored the franchise when he shockingly said he wanted out of Edmonton and was traded to Anaheim. ", "Michael Peca left as a free-agent as did Samsonov and Spacek.", "\n\nThe Oilers haven't made the playoffs since.", "\n\nDid not qualify\n\nThe Oilers did not qualify for the playoffs this season.", "\n\nDid not qualify\n\nThe Oilers did not qualify for the playoffs this season.", "\n\nDid not qualify\n\nThe Oilers did not qualify for the playoffs this season.", "\n\nDid not qualify\n\nThe Oilers did not qualify for the playoffs this season.", "\n\nDid not qualify\n\nThe Oilers did not qualify for the playoffs this season.", "\n\nDid not qualify\n\nThe Oilers did not qualify for the playoffs this season.", "\n\nBill Hunter\n\nThere would be no NHL Oilers without Bill Hunter, who chose the team name and shepherded the club through its first three World Hockey Association seasons.", "\n\nHunter was larger-than-life, lots of bluster with a carnival barker's mentality for what he was trying to sell.", "\nWhile promoters Dennis Murphy and Gary Davidson came up with the idea of a WHA, Hunter and his buddy, Benny Hatskin, who lived in Winnipeg, did most of the groundwork for starting the league and coming up with the owners.", "\n\nHunter failed to get an expansion NHL franchise or buy a team (Pittsburgh Penguins) and move it here, but he dived in to set up the WHA. ", "He didn't have a lot of his own money in the Oilers, but he surrounded himself with people who did, like Dr. Charles Allard, who founded Allarcom-TV, and Zane Feldman (Crosstown Motors) and a group of others that included Blue Willow restauranteur Vic Mah.", "\n\nAllard, a physician by trade who started buying up land in what would become Riverbend, paying $400 an acre and selling it for $50,000, was the main money man for the Oilers but stayed in the background, letting Hunter have the titular label of owner.", "\n\nHunter, who got the nickname Wild Bill after a run-in with a referee one night, owned the junior Medicine Hat Tigers in the 1950s and the Edmonton Oil Kings, starting in 1965. ", "When he got on the WHA train in 1971, he was in his element in a pro league. ", "The team was called the Alberta Oilers in the first WHA season in 1972-73, then the Edmonton Oilers in Year 2. ", "He was famous for his news conferences, always looking for a photo opportunity. ", "When he signed Jim Harrison after the centre left the Toronto Maple Leafs, he had the player wheel into the news conference with a bundle of cash in a shopping cart.", "\n\nIn his last news conference as one of the owners, he invited the media to a downtown Edmonton hotel to say goodbye, and locked the doors.", "\n\n\"I don't want you a...holes leaving. ", "You're going to listen to what I have to say,\" he bellowed, with a twinkle in his eye.", "\n\nNelson Skalbania\n\nWas the wheeler-dealer real-estate guy from Vancouver who at one time bought more than 30 Eatons stores across Canada and the Omni complex in Atlanta that he sold to Ted Turner. ", "He bought the Oilers in 1975 from majority owner Charles Allard - they had done business together because Skalbania was an engineer by trade and Allard a surgeon/real estate developer - and Allard's other partners, including Bill Hunter. ", "Skalbania said he lost $300,000 the first month he owned the team, which is why he brought in Peter Pocklington as a part-owner the next season. ", "The team's debt load was reportedly over $1.5 million.", "\n\nSkalbania got out entirely in 1977. ", "He reportedly got a $150,000 diamond ring off Pocklington's wife Eva's finger over dinner one night; at least 10 Pocklington paintings, including many Group of Seven works; a Rolls Royce from the Great Gatsby movie, starring Robert Redford, and two more Rolls.", "\n\nSkalbania would later become much more famous, owning the WHA's Indianapolis Racers and bringing aboard a then mop-haired, skinny 17-year-old Wayne Gretzky in June 1978. ", "Gretzky signed the seven-year, $1.75-million personal-services contract on a sheet of foolscap on the plane into Edmonton on June 6 for a secret news conference with CFRN's Rod Phillips and the Journal's Jim Matheson. ", "He wanted the personal-service deal because he felt a merger with the NHL was coming and surmised that his Racers wouldn't be one of the teams included in the move. ", "But he felt he could get some renumeration down the line from the WHA survivors, or if he sold the kid.", "\n\n\"If it doesn't work out, Wayne can be a deckhand on my boat for that money,\" said a joking Skalbania.", "\n\nWith his Racers was taking a bath nightly at the gate (they had about only 2,300 season-ticket holders), he traded Gretzky to Pocklington's Oilers after just eight games with Indianapolis in 1978.", "\n\nPeter Pocklington\n\nWas soon called Peter Puck shortly after he became the owner. ", "He first made his millions selling cars, and later got into real estate and meat packing plants and trust companies. ", "But his hockey team was what got him his notoriety. ", "He was brash, loved the TV cameras, and was all about the big splash, from signing Wayne Gretzky on the ice to his 10-year, $3-million contract on the teenager's 18th birthday in 1978 to trumpet that the Oilers, once they got into the NHL in 1979, would win a Stanley Cup in five years.", "\n\nHe was right on the money about the first championship after giving Gretzky his dough with the entire clan on the ice with a birthday cake.", "\n\nPocklington, who made no bones about having a large ego, basked in the glory of the Oilers in their early NHL days. ", "Selling Mustangs at Westown Ford was fine, and so was distributing milk (Palm Dairies), but not as much fun as being the ringleader of a travelling circus with not just Gretzky but five other kids who would later make the Hall of Fame - Mark Messier, Jari Kurri, Paul Coffey, Grant Fuhr and Glenn Anderson.", "\n\nAfter that, fans were slapping a black 10-gallon hat on Pocklington's head. ", "He didn't win many friends in Edmonton when he said Gretzky was faking his tears at the final press conference at Molson House before No. ", "99 flew to L.A. for his coming-out party, or saying that Gretzky had an ego the size of Manhattan.", "\n\nHe got $15 million US from Kings' owner Bruce McNall, who would later wind up in jail for bank fraud, and the team got Jimmy Carson, Martin Gelinas and three first-round draft picks.", "\nTo this day, Pocklington steadfastly says it wasn't about the money - that he needed to keep his other companies going - but there's no denying he was handsomely rewarded for moving the 27-year-old Gretzky, who would play another 11 years (Kings, St. Louis Blues and New York Rangers) before retiring. ", "Pocklington says he dealt Gretzky because his star forward was going to become a free agent who could have walked away.", "\n\n\"I expected all my businesses to pay their way and that included the hockey team,\" Pocklington said in a National Post commentary. \"", "I knew in another year and a half, Wayne was going to be a very expensive hockey player and I wouldn't be able to keep him.\"", "\n\nGretzky, in an ESPN series of star athlete profiles, confirmed that his contract was an issue, but he has long said that when news started trickling out that he might be traded, he felt blindsided. ", "In the end, the Oilers won another Stanley Cup in 1990 without Gretzky, but it was still Pocklington's darkest hockey hour.", "\n\nEIG LP\n\nAfter Peter Pocklington ran out of cash, Cal Nichols, who made his millions with Gasland, stepped in to save the Oilers. ", "He gathered a group of 38 investors, and at the last minute stopped the Oilers from being dragged off to Houston, where former stock trader Les Alexander had an NBA team and wanted to add an NHL club to his portfolio. ", "He'd been trying to get an NHL expansion team but was rebuffed.", "\n\nPocklington originally had Alexander interested for $120 million Cdn. ", "Alexander said he'd keep the team in Edmonton as long as the rink lease with Northlands was terminated and attendance was satisfactory and they could shortly find local ownership, but city council balked at Alexander's terms (especially the rink lease). ", "So Alexander went directly to the Alberta Treasury Branch with the same $120-million pitch. ", "The ATB was all ears, even though Alexander was going to back up the moving vans and get the Oilers to Houston, but decided to give Nichols and his group time to match Alexander's offer. ", "In March '98, the Edmonton Investors Group came up with same $7 million Cdn downpayment, and 40 days later paid the ATB another $100 million Cdn.", "\n\nThe 38 investors (all in for different percentages) ran the gamut from those in the oil and gas industry; the car and trucking business; glass (Ed Bean, Crystal Glass); computer software (Bruce Saville); engineering (Jim Hole, Lockerbie and Hole); product distribution to the auto, heavy trucking and agricultural sectors (Gary Gregg's Gregg Distributors)' newspapers (the Journal); and even a comic-book guy, Todd McFarlane (Spawn), who went on to design the team's third jersey logo (sharp blades, five rivets to signify the five Cup wins, inner and outer gears, and an oil drop) with blue and silver colours.", "\n\nIt was the largest ownership group in the NHL, and the largest in pro sport outside the NFL's Green Bay Packers. ", "On the surface, it was an unwieldy group - some with large ownership shares (Saville, Hole, Gregg, Bean, Nichols) and others with $1-million slices of the pie. ", "But with Nichols as the front man, it worked, although it was very much a small-market, tight-budget operation with the odd cash call.", "\n\nIn 2007, Daryl Katz came calling, with the first of four offers for the club starting at $145 million. ", "EIG ceased to be on June 18, 2008, after some of the shareholders (Gregg, Bill Butler, Jakob Ambrosius and Brian Nilsson) originally tried to mount a rival group to match Katz's offer.", "\n\nWithout the EIG's community effort, there would be no Oilers here. ", "They would be in Houston or somewhere else.", "\n\nRexall Sports\n\nDaryl Katz grew up an Oilers fan during their glory days and satisfied his hankering to buy the club when the Edmonton Investors Group finally accepted his fourth offer of $200 million in January 2008.", "\n\nEIG had two strong factions - Cal Nichols, the front man for the group, and Gary Gregg on the one side, and Bruce Saville and Jim Hole on the other. ", "Nichols, according to a former member of the EIG group, was the impetus for the sale to Katz, who went to high school at Jasper Place and got a law degree at the University of Alberta before diving into the family pharmaceutical business.", "\n\nKatz offered $145 million to start the bidding in May 2007, upped it to $185 million, then $188 million, and finally got the club for $200 million. ", "He's around the rink a fair bit with his son, who has also shown up on stage at the NHL entry draft with the first overall pick.", "\n\nKatz, 51, has spent considerable time trying to get a new downtown building - something the EIG was also planning, it should be pointed out.", "\n\nKatz, who owns the Rexall drug stores, along with the Medicine Shoppe chain, is reported to be among the 20 richest people in Canada with a net worth of at least $2 billion.", "\n\nBill Hunter\n\nWas the general manager of the Edmonton Oil Kings junior team before the World Hockey Association came along. ", "He put together the Oilers' first team for 1972-73 season, protecting four NHL players - Bobby Clarke, Norm Ullman, Phil Myre and Bruce MacGregor - in the inaugural WHA draft. ", "Only the winger MacGregor, who had been with the professional Edmonton Flyers before getting to the NHL, played for the Oilers during Hunter's tenure. ", "Ullman came to the WHA later.", "\n\nHunter's first WHA team was heavy on former Oil Kings and Alberta-born guys. ", "He knew them best, but it was little bit of overkill. ", "Doug Barrie, Bob Falkenberg, MacGregor, Ron Walters, Eddie Joyal, Ron Anderson, Dennis Kassian, Derek Harker, Al Hamilton, Ross Perkins and Bob McAneeley were all former junior players under Hunter's watchful eye when he owned the Oil Kings. ", "He also brought in Jimmy Harrison, the Maple Leafs' centre who was born in Glendon. ", "That was his best move. ", "Harrison scored 10 points one game against the New York Raiders at the old Edmonton Gardens in January 1973. ", "He finished with 86 points in only 66 games for 14th place in the high-scoring WHA, which Andre Lacroix led with 124 points.", "\n\nHunter could put teams together. ", "The Oilers finished with the sixth-best record in their first season in the WHA. ", "But he was impatient, especially with his coaches. ", "He continually thought he could do a better job, so kept parachuting in to work the bench. ", "He hired Ray Kinasewich, the Memorial Cup-winning Oil Kings coach, for the first WHA campaign, but Kinasewich was gone after 45 games. ", "The next season, Hunter hired the flamboyant Brian Shaw, who once coached Hall of Famer Marcel Dionne in junior, but he was out the door 59 games into his second season. ", "Then it was the legendary Clare Drake, who took a sabbatical from his University of Alberta Golden Bears' teams, for the '75-76 season, but was fired after 48 games.", "\n\nHunter could always be counted on to do something daffy. ", "One time, he was back in Edmonton while the Oilers were in Hartford, Conn., and wanted to give his club a pep-talk, so he set up a conference call over a speakerphone. ", "He told the players to gather in a meeting room at their hotel. ", "The players dutifully filed in for the rah-rah speech, but they didn't hang around long. ", "As the call wore on, Hunter was basically talking to himself.", "\n\nAt his final news conference as general manager, he locked the doors of the banquet room at a downtown hotel.", "\n\n\"I don't want you a...holes leaving,\" he bellowed at the media. \"", "You're going to listen to everything I have to say.\"", "\n\nArmand \"Bep\" Guidolin\n\nHis claim to fame before he became the Oilers' second general manager was being the youngest NHL player, getting into a game at age 16 in November 1942 with the Boston Bruins. ", "Boston's famous Kraut Line of Woody Dumart, Milt Schmidt and Bobby Bauer were doing military duty at the time. ", "Guidolin was later traded to the Detroit Red Wings for forward Billy Taylor, who once had seven assists in a game but was later kicked out of the NHL for gambling.", "\n\nGuidolin had never been a professional general manager before taking on the dual title of GM-coach with the Oilers after Bill Hunter moved on. ", "He could coach - both junior and the pros with Boston and the Kansas City Scouts - but as a manager, he was in over his head. ", "He knew little about the WHA's players. ", "In fact, he called up a reporter one morning not to berate him for anything he'd written but to ask if he knew anything about a couple of players on another team.", "\n\nBrian Conacher\n\nWas Foster Hewitt's colourman on the TV broadcasts at the 1972 Canada-Russia series. ", "He spent only one year as the Edmonton general manager, during Glen Sather's first year as the Oilers' coach.", "\n\nHe had also been GM of the Indianapolis Racers and, in his one season with the Oilers, brought in Ron Chipperfield and Blair MacDonald, who would become the NHL team's first and second captains, respectively, along with Minnesota-born defenceman Joe Micheletti, who has gone on to a bright broadcasting career, currently working as the New York Rangers TV commentator.", "\n\nConacher, the son of Lionel (The Big Train) Conacher - Canada's athlete of the first half century - had a brief NHL career, winning a Stanley Cup ring with the Toronto Maple Leafs in 1967. ", "He got into TV work, then management, and later became manager of Maple Leaf Gardens.", "\n\nLarry Gordon\n\nContrary to popular belief, Larry Gordon and not Glen Sather was the Oilers general manager when Edmonton got into the NHL in 1979. ", "Gordon was the GM when the Oilers got Wayne Gretzky from Indianapolis during the last WHA season. ", "He was also responsible for the Oilers' protected list for the NHL-WHA merger and he kept No. ", "99 and Bengt Gustafsson. ", "The Swedish centre was ruled ineligible and went on to have a fine career with the Washington Capitals.", "\n\nAfter Gordon, who was the WHA's executive director before he came to the Oilers, left the team in June 1980, he ran Edmonton's main farm club in Wichita, Kan., in the Central Hockey League. ", "Then he purchased the Muskegon Mohawks for $1 in 1984 and built the team into a powerhouse in the International Hockey League.", "\n\nGordon now lives in Cabo San Lucas, Mexico, the same place where former Oilers' amateur scouting head Barry Fraser resides.", "\n\nGlen Sather\n\nWas the Oilers general manager for 20 years, starting in June 1980 and ending in 2000, when he felt his control seeping away because of perceived interference from some members of the Edmonton Investment Group. ", "He moved to the New York Rangers for what, some said, was $5 million a year and has been there ever since.", "\n\nThe cigar-smoking Sather grew up in Wainwright, but has lived in Banff during the summers since he was a role-playing NHL winger. ", "He's worth a lot of money - some said he had more than his owner, Peter Pocklington - but he's been best at putting teams together. ", "He also had a great scout, Barry Fraser, in the Oilers' early NHL days, and gave Fraser free rein to draft Jari Kurri and Glenn Anderson in the fourth round and Andy Moog in the seventh. ", "Sather also had a gut feeling for Mark Messier when the youngster was putting up no numbers with the Cincinnati Stingers. ", "He made sure they took him the third round in 1980.", "\n\nSather was in charge of the Oilers' first NHL team, culling the list of NHL organizations and getting guys like Dave Lumley and Pat Hughes from the Montreal Canadiens. ", "They would eventually be part of his first Stanley Cup-winning team in 1984. ", "He also picked up a rock-hard defenceman named Colin Campbell, who gave them some abrasiveness right off the bat. ", "Later, he was a master at making trades. ", "He got a goalie named Ron Low from the Quebec Nordiques for his first captain, Ron Chipperfield, and Low helped the Oilers make the playoffs, going 8-2-1 down the stretch. ", "He traded skill centre Tom Roulston to the Pittsburgh Penguins for Kevin McClelland, who scored the biggest goal in Oilers' history at the time (the only goal in a 1-0 win over the New York Islanders in Game 1 of the 1984 Cup final on Long Island).", "\n\nHe dealt a third-round draft pick for Kent Nilsson in '87; and Gord Sherven and Terry Martin for Mark Napier, who had 35 points in 33 games and another 10 playoff points after coming from Minnesota North Stars in '85. ", "At the urging of his good friend, Boston GM Harry Sinden, he took a chance on a troubled Boston centre named Craig MacTavish, who won four Stanley Cups and became their coach for almost a decade.", "\n\nSather was the Oilers' GM when Wayne Gretzky was dealt, but he always said: \"That was a sale.\"", "\n\nAll in all, he traded six Hall of Famers - Gretzky, Messier, Kurri, Anderson, Paul Coffey and Fuhr, in large part because the Oilers couldn't afford them. ", "He also dealt the Oilers' first draft pick, Kevin Lowe, to the Rangers and struck out, getting a slow-footed Russian forward Roman Oksiuta.", "\n\nBut almost all of his trades worked. ", "Getting Bugsy Watson to coach to start the second NHL season was a mistake. ", "Watson wanted to play older players and didn't much like Kurri, for instance. ", "About six weeks into the season, Sather pulled the plug on his friend. ", "Hiring George Burnett as his coach rather than Low in '94 was an error, too. ", "Burnett proved to be too rigid for NHLers.", "\n\nKevin Lowe\n\nWas the Oilers' first NHL draft pick and their third NHL general manager, succeeding Glen Sather when he hiked off to the New York Rangers. ", "He was on the job for eight seasons, with a roller-coaster ride of emotions - the playoffs in his first season, the Cinderella ride to the Stanley Cup final against the Carolina Hurricanes in 2006, but out of the post-season five times in the dog-eat-dog Western Conference, including missing the playoffs the year after they almost won the Cup. ", "He handed things over to Steve Tambellini in 2008.", "\n\nLowe made some blockbuster moves, trading for Chris Pronger and Michael Peca in 2005. ", "He dealt captain Doug Weight to the St. Louis Blues in a money situation in 2001; made a big splash to sign hometown kid Mike Comrie in 2000, then they had an acrimonious split 2-1/2 years later and he moved the small forward to the Philadelphia Flyers after Comrie said he was living in a goldfish bowl. ", "Lowe also traded Billy Guerin (money) for Anson Carter in 2001, his most popular player Ryan Smyth (money) to the New York Islanders in 2007, captain Jason Smith to the Flyers the same year, and Matt Greene and Jarret Stoll to the Los Angeles Kings for Lubomir Visnovsky.", "\n\nHe gambled on a first-round draft for goalie Dwayne Roloson, who was stunningly good in the 2006 playoffs and got good return for Sergei Samsonov in an '06 trade deadline deal, but the second-round pick they gave to Boston was turned into Milan Lucic.", "\n\nLowe would have to send Pronger to the Anaheim Ducks in 2006 when the future Hall of Famer said he couldn't live in Edmonton. ", "Dealing Smyth was a battle over a few dollars and the Oilers got Robert Nilsson, Ryan O'Marra and a first-round draft pick (Alex Plante). ", "Smyth is back, but Nilsson was in Russia last season, O'Marra is in Finland now, and Plante is in Oklahoma City.", "\n\nLowe's tenure will be forever stamped by the rogue Dustin Penner signing in 2007, as well. ", "Looking for an offensive jump start, Lowe tried to sign Buffalo's Tomas Vanek to a seven-year, $50-million deal, but the Sabres matched it. ", "Then he went after his Plan B, Penner, knowing the Ducks were vulnerable. ", "He knew they liked Ryan Getzlaf and Corey Perry more and he made a five-year, $21.5-million pitch for Penner.", "\n\nDucks general manager Brian Burke was furious and let Penner walk away. ", "Lowe and Burke, who had been buddies, didn't speak for a long time after that and Burke publicly said he wanted to fight Lowe. ", "Penner had one very good year (63 points, 32 goals in 2009-10), when he was a Canadian Olympic team possibility, but was not a good fit, at all. ", "The fans got on him and Tambellini moved him to the Los Angeles Kings in his fourth year.", "\n\nSteve Tambellini\n\nWhen Lowe quit as general manager in July 2008 and moved upstairs to be president of hockey operations, he tabbed Steve Tambellini as his replacement. ", "The two had worked together on preparing Canada's Olympic squad in 2002 and with Canada's World Cup team in 2004. ", "Tambellini, who had been with the Vancouver Canucks for 17 years and was assistant GM to Dave Nonis and Mike Gillis, got a four-year contract and signed an undisclosed extension last summer.", "\n\nTambellini had Craig MacTavish as his first coach, but only for one season. ", "MacTavish stepped aside with a year to go on his contract. ", "That started a coaching carousel.", "\n\nTambellini went old school, bringing in Pat Quinn, who had a long relationship with him in Vancouver. ", "Quinn was between NHL coaching gigs after the Toronto Maple Leafs had let him go, but was fresh from coaching Canada's world junior team to a gold medal at Ottawa. ", "The coaching hire, while seemingly inspired at the time, didn't work. ", "The Oilers finished dead last in 2009-10, and Tom Renney, who was hired along with Quinn, took over for another two seasons in their rebuilding effort. ", "After two more years out of the playoffs (finishing 30th and 29th), Ralph Krueger, who was hired by Renney to be his associate coach, takes over.", "\n\nTambellini decided after the 62-point '09-10 season to rip everything apart and go young. ", "There was lots of pain and very little gain in the standings. ", "Today, the Oilers are a team that everybody in the NHL likes because of its young guns, but is still years away from winning a Stanley Cup. ", "The Oilers have had three straight first overall picks in Taylor Hall, Ryan Nugent-Hopkins and Nail Yakupov (when they won the lottery after finishing 29th, beating out the Columbus Blue Jackets for the top pick).", "\n\nThe Oilers have tons of promise, but still no playoff games since their wonderful Stanley Cup run in 2006.", "\n\nHaving failed to make the playoffs during his tenure as general manager, Steve Tambellini was replaced by Craig MacTavish on April 15, 2013.", "\n\nCraig MacTavish\n\nHaving failed to make the playoffs during his tenure as general manager, Steve Tambellini was replaced by Craig MacTavish on April 15, 2013.", "\n\nRay Kinasewich\n\nWas probably more well-known for owning the local Stork Diaper Service than coaching the Edmonton Oilers in their first season in the World Hockey Association because he lasted only 45 games until general manager Bill Hunter stepped in.", "\n\nThe daffy thing was the gentlemanly Kinasewich stayed on to run the practices while Hunter was behind the bench on game nights and Kinasewich moved up to the press box.", "\n\nKinasewich, 79, had significant success as a junior coach, taking Hunter's Oil Kings with defenceman Al Hamilton, who would later captain the Oilers, to the 1966 Memorial Cup. ", "He also coached the\n\nHouston Apollos in the Central Hockey League and Salt Lake Golden Eagles in the Western Hockey League before the Oilers' job came along.", "\n\nHe was also a very good scorer as a minor-league pro in the American Hockey League. ", "He had three separate stints with the Edmonton Flyers and had 44- and 42-goal seasons with the Seattle Americans, with Val Fonteyne on his wing. ", "Fonteyne (one minor penalty) played for Kinasewich in the Oilers' first season.", "\n\nBrian Shaw\n\nAfter one Oilers' road game at Chicago in the WHA in the mid-1970s, the team bus had to wait while Shaw returned from a shopping trip. ", "He bought a cape one day, although he didn't wear it on the bench.", "\n\nAs his good friend Ken Hodge said: \"He dressed for success and had a distinguished look about him. ", "The cigars needed to be big to fit his image.\"", "\n\nHis look aside, Shaw was a good coach. ", "He started in midget with the Jasper Place Mohawks, went to the Moose Jaw Canucks junior team, then moved to the Ontario Hockey League's St. Catharines Black Hawks, where he had Marcel Dionne on his team.", "\n\nHe had a two-year run with the Oilers starting in 1973, before Bill Hunter fired him late in Season 2. ", "Hunter fired his junior coach, Hodge, as well.", "\n\nShaw and Hodge wound up buying the Oil Kings from Hunter and relocating to Portland.", "\n\nShaw, who famously banned slapshots in practice for a time because Oilers goalie Jack Norris kept taking shots off his noggin, died of cancer in July 1993 at age 62, 20 years after his first coaching gig with the Oilers.", "\n\nClare Drake\n\nThe legendary Clare Drake took a sabbatical from the University of Alberta to coach the Oilers in 1975, but it was a bittersweet year because he lasted only 48 games before Bill Hunter fired him.", "\n\nDrake was up for election to the Hockey Hall of Fame in 2011 as one of the game's all-time builders but, unfortunately, fell short in the vote count. ", "He is the winningest coach (697 wins) in Canadian university history, starting with the Golden Bears in 1956. ", "He was also an acknowledged mentor to NHL coaches Ken Hitchcock and Mike Babcock, who tried to get him into the HHOF.", "\n\nDrake, who is now in his 80s, was on the coaching staff with Tom Watt and Lorne Davis on Canada's 1980 Olympic team, an assistant coach with the Winnipeg Jets and a special assignments guy with the San Jose Sharks. ", "He's also in the Canadian Sports Hall of Fame.", "\n\nHunter pushed a lot of the right buttons psychologically as a coach, but Drake has forgotten more than Hunter ever knew about the technical aspects of coaching.", "\n\nArmand \"Bep\" Guidolin\n\nWhat was Bep Guidolin's legacy as Oilers coach for all but 18 games in 1976-77? ", "He always wore multi-coloured sweaters and decided captain Glen Sather should coach the team when it was 18 games under .500 with the season wearing down. ", "Guidolin had let Sather run practices while he attended to his general manager duties anyway.", "\n\nGuidolin coached the Boston Bruins and Kansas City Scouts in the NHL, but it always seemed like he was putting in time with the Oilers after new owner Nelson Skalbania gave him the dual general manager/coach portfolio. ", "He ordered Sather to coach the last month and the Oilers went 9-7-2.", "\n\n\"He told me I had to coach or I'd be sitting in the seats,\" Sather said.", "\n\nSather stayed as a player/coach, but gave up playing the next season.", "\n\nGuidolin, who died at age 82, left the Oilers and coached the Philadelphia Firebirds in the American Hockey League for a season, replaced Pat Kelly as the NHL's Colorado Rockies coach during the '78-79 season (Don Cherry came in the next season), and finished coaching junior with the Brantford Alexanders in the Ontario Hockey League.", "\n\nTed Green\n\nGot five Stanley Cup rings as an assistant coach with the Oilers, then took over as head coach in 1991 when John Muckler left for a general manager's job with the Buffalo Sabres and Mark Messier hiked off to the New York Rangers.", "\n\nThe Oilers made the NHL's final four in Green's first year as coach, but fell on hard times after that. ", "He coached in '92-93, when the Oilers missed the playoffs, and then with his health failing, he was relieved of his duties early in the '93-94 season.", "\n\nGreen, who is now 78 and living in Edmonton, survived an awful stick swinging incident with Wayne Maki that almost killed him in the late 1960s. ", "He had a rough exterior, but was a split-personality.", "\n\nHe was polite to a fault with one and all media members, and as hard on himself as the players as a coach. ", "He took every loss to heart, and there were many after the '91-92 season, when the Oilers had very little talent. ", "The team was stripped bare after about 12 years of success.", "\n\nGreen's two most vivid stories were relearning how to write with his left hand after Maki clubbed him senseless, and standing in a stairwell of the team bus day after day in the early 1990s, fighting off kidney stones. ", "He was ashen-faced, but refused to give in to the pain and go to hospital.", "\n\nGreen has done extensive charity work with The Mustard Seed.", "\n\nGeorge Burnett\n\nCoached the second-fewest games with the Oilers, only 35 in '94-95, the lockout season.", "\n\nHe was coaching Edmonton's farm team on Cape Breton Island in Nova Scotia for two years and got the nod over Oilers assistant coach Ron Low, in part because owner Peter Pocklington thought Burnett was outwardly more polished. ", "Burnett also won over former U.S. president Gerald Ford, who was on one of Pocklington's boards, at a team winter golf tournament in California. \"", "He's a leader amongst men,\" said Ford.", "\n\nUnfortunately, he wasn't good enough.", "\n\nBurnett rankled some of the veterans with his rules (ie., ", "they had to wear ties everywhere). ", "If he'd won more, it wouldn't have mattered, but Burnett, who had to wait until Jan. 20, 1995, to coach his first game because of the lockout, didn't get enough wins. ", "He was 12-13-3 after 27 games, but lost seven in a row. ", "He was fired when the team was in Anaheim and was replaced by Low.", "\n\nBurnett, 50, did get back to the NHL as Craig Hartsburg's assistant with the Anaheim Ducks in the late '90s, but he's now coach and GM of the junior Belleville Bulls. ", "He's had a very successful coaching career in Niagara Falls, Guelph and Oshawa in the Ontario Hockey League and working with Hockey Canada junior programs.", "\n\nKevin Lowe\n\nPeople forget Kevin Lowe was the Edmonton Oilers' head coach for a season before he became the general manager.", "\n\nIt happened right after he had to quit as a player after a virus caused an inner-ear problem and ongoing dizziness.", "\n\nLowe had returned to the Oilers from the New York Rangers in 1996 for a final hurrah as a defenceman. ", "He played one full season, then seven games into a second season when the inner-ear problem KO'd him after he was hit in the head.", "\n\nHe was Ron Low's assistant for a year, and when Low left, Lowe took over in 1998-99 as the Oilers snuck into the playoffs as the 16th seed and, as usual, drew the Dallas Stars. ", "They were bounced in four straight but lost all four games by a single goal.", "\n\nCraig MacTavish\n\nCoached 656 games, second-only to Glen Sather's 842, and had 301 wins. ", "Only 30 NHL coaches have won more than MacTavish, who paid his dues as an assistant, first with John Muckler in New York for two years, then as Kevin Lowe's right-hand man in 1999-2000. ", "When Lowe took over from Sather as general manager, he passed the baton to his good friend MacTavish, who returned as Oilers' vice-president of hockey operations and is now the Oilers' general manager.", "\n\nEverything with the Oilers' coaching over the years has seemed a natural progression, from Sather to Muckler to Ted Green, Ron Low to Lowe to MacTavish, with the exception of George Burnett taking over from Green instead of Green's assistant Low in 1994.", "\n\nMacTavish made the playoffs in his first season, losing in six games to Dallas, with the Stars winning three of four games in overtime. ", "The Oilers lost again to Dallas in six games in the first round in 2003, but went all the way to the Stanley Cup final in 2006.", "\n\nIn the first round, he shocked people by employing a neutral zone trap against the Detroit Red Wings, stifling them with a passive approach, coupled with several hundred blocked shots. ", "They stunned the Wings in six games, rallied from two games down in Round 2 to beat the San Jose Sharks and then the Anaheim Ducks in five games, before losing to the Carolina Hurricanes in seven games.", "\n\nHis clubs missed the playoffs five times, however, including three straight before he left in April 2009.", "\n\nIt was later revealed that MacTavish had non-Hodgkin's lymphoma, which is in a dormant state.", "\n\nPat Quinn\n\nWhen the Oilers came calling for Pat Quinn in the summer of 2009, he hadn't coached since the Toronto Maple Leafs let him go in 2006.", "\n\nIn the interim, he had a shot at the Boston Bruins' job, but didn't feel right about it, so he bided his time as a part-owner (with Ron Toigo) of the junior Vancouver Giants along with a stirring gold-medal win with Jordan Eberle and the rest of Canada's world junior team in 2009 at Ottawa.", "\n\nWhen Craig MacTavish left as coach, Quinn got a three-year deal as the head man, with Tom Renney brought in as his associate coach. ", "Quinn had first hired Oilers general manager Steve Tambellini in Vancouver after Tambellini's playing career ended. ", "Tambellini was also part of the 2002 Olympic team management group with Quinn as head coach, so there was obviously a history there.", "\n\nBut Quinn was 66 at the time and the Oilers had a young group. ", "It wasn't the fit people thought it could be.", "\n\nQuinn was a quote-master, filling notebooks and TV sports shows.", "\n\n\"We have a lot of morning glories,\" he'd say, referring to players who do their best work at the morning skate but not in the games.", "\n\n\"Too many fly-by players,\" he'd say, when forwards like Robert Nilsson wouldn't stop and check somebody.", "\n\nThe team finished 30th, with only 27 wins, and got Taylor Hall in the NHL entry draft.", "\n\nBut Quinn only lasted one year as coach, with Tambellini saying he was restructuring the club. ", "Quinn was to now be a special advisor. ", "He claimed to be unaware when the club announced his new title, saying nobody had told him of plans for the restructuring.", "\n\nTom Renney\n\nWas hired in the summer of 2009. ", "Pat Quinn only lasted one season, and Renney, who was his right-hand man, took over and stayed as head coach for two seasons.", "\n\nRenney wasn't dealt a great hand, with Tambellini overhauling the club and starting anew. ", "It made for a lot of teaching and a lot of hard lessons learned and a lot of losses as they finished 30th and 29th overall.", "\n\nRenney tried to balance playing the older players to keep things respectable and going all-in with his kids. ", "He protected Ryan Nugent-Hopkins, Jordan Eberle and Taylor Hall rather than overplaying them, feeling that was the way to go.", "\n\nIn the end, Tambellini decided he wanted a new face. ", "That's his prerogative, but he probably took too long to inform Renney he was out, rather than make the hard decision at the end of the 2011-12 season.", "\n\nRenney knew the club was in a major transition and hoped he'd be the guy for the long haul. ", "Before he wasn't rehired, he said, \"Am I going to be the guy standing here when this team lifts the Stanley Cup? ", "What are the odds? ", "I sure hope so, but I have to do everything to leave my legacy behind.\"", "\n\nIn the end, Renney won't be part of the team picture should the Oilers win a Stanley Cup in the next few years. ", "He's now Mike Babcock's associate coach with the Detroit Red Wings. ", "The former Oilers/Vancouver Canucks/New York Rangers coach landed on his feet.", "\n\nRalph Krueger\n\nFunny how things work out. ", "Tom Renney was looking for an associate coach in 2010 and called up Ralph Krueger when his first choice, Don Hay, the Vancouver Giants junior coach and former NHL head man, said no thanks. ", "Krueger had just retired as head coach of Switzerland's national team, and Renney and Krueger were old friends from international competitions. ", "Krueger, who grew up in Manitoba, jumped at the NHL chance and wound up getting Renney's job.", "\n\nKrueger was looked upon as a longshot when the 2011-12 season ended with Brent Sutter and Marc Crawford's names front and centre, along with hotshot American Hockey League coach Jon Cooper, but general manager Steve Tambellini decided to stay in-house as he continued to rebuild the Oilers. ", "Tambellini felt it better to have a familiar face for the young players than bring in an outsider, and Krueger, a great motivational speaker, was well-liked by the players.", "\n\nBill Hunter\n\nLiked to hire and fire coaches and put himself behind the bench, like it was part of his DNA. ", "He did it three times as the Oilers general manager, getting rid of Ray Kinasewich, Brian Shaw and, finally, the esteemable Clare Drake, all during the season. ", "Shaw, at least, lasted almost two full seasons; the others just part of their first season.", "\n\n\"Bill was a promoter and a salesman and he always seemed to fire the coach halfway through the season. ", "I don't know if it ever made a difference, but in Bill's mind it did,\" Oilers captain Al Hamilton told Ed Willes in his book, The Rebel League.", "\n\n\"He was an old-fashioned coach who believed in a very simple game and lots of emotion. ", "I was in charge of enthusiasm,\" said goalie Ken Brown, who was tasked with the team cheer, 'We're the Oilers and we know it ... clap your hands.'\"", "\n\nHunter had coached the senior Saskatoon Quakers and junior Medicine Hat Tigers, so he wasn't a neophyte behind the bench, but Hunter had no patience. ", "He always felt he could do better, and he'd only have to answer to himself as the GM if things went sour. ", "He was a better salesman than a coach. ", "One day, after the team arrived just before game time due to bad weather, he came up with a novel idea for a pre-game meal.", "\n\n\"Go to the store and get some chocolate bars for the boys. ", "And make them big bars,\" said Hunter.", "\n\nGlen Sather\n\nCoached the Oilers for 842 NHL games, with a couple of interruptions when he stepped back in for Teddy Green in the mid-1990s and Bryan (Bugsy) Watson in the early '80s after being just the general manager. ", "Sather started coaching in 1977 in the World Hockey Association as a player/coach. ", "Coach/GM Bep Guidolin ordered Sather to coach or sit in the stands and Sather, never shy, took him up on the offer and had a better-than-.500 record down the stretch.", "\n\nA coach was born. ", "He later won four Stanley Cups with the Oilers. ", "His strength as an NHL coach was as much psychological as technical. ", "He knew which buttons to push. ", "John Muckler was the Xs and Os guy. ", "Sather could be sarcastic, but he was also a father-figure as a coach and knew who could be pushed and which players needed a shoulder to cry on. ", "For instance, he had many run-ins with the wonderful offensive talent Paul Coffey about taking care of his own end, but they co-existed nicely until Coffey wanted more money than Sather, the GM, wanted to pay. ", "Coffey was traded in 1987 to the Pittsburgh Penguins.", "\n\nSather was also smart enough to watch Anders Hedberg, Ulf Nilsson and Bobby Hull plus defenceman Lars-Erik Sjoberg with the WHA's Winnipeg Jets and realized that's the way he wanted his NHL team to play: Free-flowing, five-men into the attack.", "\n\n\"One of the reasons I got to coach the Oilers was because Glen respected the way the Jets played. ", "We were ahead of the curve,\" former Winnipeg defenceman Ted Green said in The Rebel League by Eddie Willes.", "\n\n\"I took a lot of their transition skills,\" admitted Sather, who fortunately had Wayne Gretzky, Mark Messier, Jari Kurri, Glenn Anderson and Coffey to make it work.", "\n\nGlen Sather\n\nCoached the Oilers for 842 NHL games, with a couple of interruptions when he stepped back in for Teddy Green in the mid-1990s and Bryan (Bugsy) Watson in the early '80s after being just the general manager. ", "Sather started coaching in 1977 in the World Hockey Association as a player/coach. ", "Coach/GM Bep Guidolin ordered Sather to coach or sit in the stands and Sather, never shy, took him up on the offer and had a better-than-.500 record down the stretch.", "\n\nA coach was born. ", "He later won four Stanley Cups with the Oilers. ", "His strength as an NHL coach was as much psychological as technical. ", "He knew which buttons to push. ", "John Muckler was the Xs and Os guy. ", "Sather could be sarcastic, but he was also a father-figure as a coach and knew who could be pushed and which players needed a shoulder to cry on. ", "For instance, he had many run-ins with the wonderful offensive talent Paul Coffey about taking care of his own end, but they co-existed nicely until Coffey wanted more money than Sather, the GM, wanted to pay. ", "Coffey was traded in 1987 to the Pittsburgh Penguins.", "\n\nSather was also smart enough to watch Anders Hedberg, Ulf Nilsson and Bobby Hull plus defenceman Lars-Erik Sjoberg with the WHA's Winnipeg Jets and realized that's the way he wanted his NHL team to play: Free-flowing, five-men into the attack.", "\n\n\"One of the reasons I got to coach the Oilers was because Glen respected the way the Jets played. ", "We were ahead of the curve,\" former Winnipeg defenceman Ted Green said in The Rebel League by Eddie Willes.", "\n\n\"I took a lot of their transition skills,\" admitted Sather, who fortunately had Wayne Gretzky, Mark Messier, Jari Kurri, Glenn Anderson and Coffey to make it work.", "\n\nBryan (Bugsy) Watson\n\nHad the shortest stint of any Oilers coach: 18 games. ", "He was hand-picked by Glen Sather, who had coached Edmonton's first NHL season in 1979-80, but after just four wins, Sather realized the mistake and went back behind the bench.", "\n\nWatson played 16 NHL seasons because he was mean. ", "He could check and fight and make life miserable for opposing skill players. ", "He finished his pro career with the WHA's Cincinnati Stingers in '78-79 and caught on with the Oilers in management.", "\n\nWhen Sather became general manager and president in 1980, he gave Watson the job, but his failing was wanting to play veteran players over youngsters like Jari Kurri. ", "When he was let go, Watson stayed on as an assistant with Billy Harris.", "\n\nJohn Muckler\n\nThe Oilers wouldn't have won their first four Stanley Cups without John Muckler, a master tactician. ", "Through the regular season, Glen Sather's right-hand man would let his guys freewheel, but in the last month of regular season and into the playoffs, Sather leaned on Muckler to set out the game plans. ", "The Oilers soaked it all in. ", "Muckler's ideas of going after certain defencemen, like Ray Bourque and Mark Howe in the Boston Bruins and Philadelphia Flyers playoff series, respectively, always worked.", "\n\n\"Just dump it into their corner, make them go back for the puck, and pound them every shift until they get tired,\" Muckler would say.", "\n\nWhen Wayne Gretzky was traded to the Los Angeles Kings in 1988, Sather decided to coach one more year, then handed over the reins to Muckler, who had been his co-coach.", "\n\nSather didn't feel it was right to run out after No. ", "99 was dealt; but he needn't have worried. ", "Muckler, who first started coaching in the Eastern Hockey League in 1959, got the Oilers their last Stanley Cup win in 1990 as head coach.", "\n\nMuckler, 78, was a phenomenal technical coach. ", "He was set in his ways; he didn't like Petr Klima's penchant for playing only as hard as he wanted on some shifts. ", "In the 1990 championship final against the Boston Bruins, he benched Klima for hours on the clock, over three full periods of the marathon overtime Game 1 in Boston. ", "Then he sent out Klima, who scored the winner. \"", "Just a hunch,\" Muckler said.", "\n\nMuckler was later head coach with the Buffalo Sabres and New York Rangers.", "\n\nGlen Sather\n\nCoached the Oilers for 842 NHL games, with a couple of interruptions when he stepped back in for Teddy Green in the mid-1990s and Bryan (Bugsy) Watson in the early '80s after being just the general manager. ", "Sather started coaching in 1977 in the World Hockey Association as a player/coach. ", "Coach/GM Bep Guidolin ordered Sather to coach or sit in the stands and Sather, never shy, took him up on the offer and had a better-than-.500 record down the stretch.", "\n\nA coach was born. ", "He later won four Stanley Cups with the Oilers. ", "His strength as an NHL coach was as much psychological as technical. ", "He knew which buttons to push. ", "John Muckler was the Xs and Os guy. ", "Sather could be sarcastic, but he was also a father-figure as a coach and knew who could be pushed and which players needed a shoulder to cry on. ", "For instance, he had many run-ins with the wonderful offensive talent Paul Coffey about taking care of his own end, but they co-existed nicely until Coffey wanted more money than Sather, the GM, wanted to pay. ", "Coffey was traded in 1987 to the Pittsburgh Penguins.", "\n\nSather was also smart enough to watch Anders Hedberg, Ulf Nilsson and Bobby Hull plus defenceman Lars-Erik Sjoberg with the WHA's Winnipeg Jets and realized that's the way he wanted his NHL team to play: Free-flowing, five-men into the attack.", "\n\n\"One of the reasons I got to coach the Oilers was because Glen respected the way the Jets played. ", "We were ahead of the curve,\" former Winnipeg defenceman Ted Green said in The Rebel League by Eddie Willes.", "\n\n\"I took a lot of their transition skills,\" admitted Sather, who fortunately had Wayne Gretzky, Mark Messier, Jari Kurri, Glenn Anderson and Coffey to make it work.", "\n\nRon Low\n\nWas the Oilers' head coach for 341 games in the 1990s. ", "Only Glen Sather and Craig MacTavish had longer stints behind the bench, with Low replacing George Burnett for the last 13 games of the 1994-95 lockout season, then staying on for the next four seasons. ", "He had two unforgettable moments: The stunning first-round playoff upsets of the Dallas Stars in 1997 and the Colorado Avalanche and goaltender Patrick Roy in 1998.", "\n\nLow started with the Oilers in 1980, coming over from the Quebec Nordiques in a late-season trade to get Edmonton into the playoffs with some splendid netminding. ", "He was later traded to New Jersey and was in goal the night the Oilers lit up the Devils 13-4 and Wayne Gretzky called them a Mickey Mouse organization for hanging his buddy Low out to dry.", "\n\nLow won two Stanley Cup rings as an Oilers assistant coach, first with Sather in 1987 and then with John Muckler in 1990. ", "He coached their Cape Breton farm team before he got his first NHL head coaching gig.", "\n\nNobody worked harder on the ice and off. ", "Sweat was always pouring off him, and he was a strong motivator behind the bench. ", "He almost got into a fight with Marc Crawford one playoff night when he thought the Avalanche coach was trying to take advantage physically on the game's last shift by putting out slugger Warren Rychel with the Oilers having the win in the bag.", "\n\nWhen the Oilers knocked off the Stars in Game 7 in '97 on Todd Marchant's goal on Andy Moog in overtime, Low almost broke a leg running onto the ice. ", "Showing his goalie colours, he put Curtis Joseph in a bear hug before he congratulated Marchant because Cujo had stoned Joe Nieuwendyk seconds before the Oilers winger scored the game-winner. ", "The next year, Low was on Cloud 9 when his club knocked off the juggernaut Avalanche, ending the series in Denver.", "\n\nEdmonton Gardens\n\nThe WHA Oilers spent their first two seasons at the Gardens.", "\n\n\"Must have been the smallest building any major league sport played in,\" said former owner/general manager/coach Bill Hunter.", "\n\nIt was the ultimate barn, built just before the First World War started. ", "In its original incarnation, there were wooden seats and steel girders everywhere blocking sightlines.", "\n\nIn 1966, the City of Edmonton spent almost $700,000 to renovate the building for the Oil Kings junior hockey team, with a seating capacity of 5,200. ", "By then, there were concrete stands, and while it was functional for the early WHA years, it was an eyesore.", "\n\nThe building was eventually knocked down in 1982. ", "The current Edmonton Expo Centre on the Northlands grounds is where the Gardens used to stand.", "\n\nNorthlands Coliseum\n\nPat Bowlen, who has been the owner of the NFL's Denver Broncos for years, and his partner Peter Batoni finished building the new arena in 1974 for $14 million. ", "That was two years after they put the first shovel in.", "\n\nIt was originally named Northlands because the venerable organization ran the arena on their grounds. ", "It was open for business on Nov. 10, 1974, with seating for 15,200.", "\n\nNext to the rundown Edmonton Gardens, it was the ultimate palace, certainly one of the nicer WHA buildings until the league folded in 1979. ", "It was home to Wayne Gretzky and the glory days of the NHL Oilers, and there were four Stanley Cup celebrations in the building in 1984, '85, '87 and '88. ", "The Cup delirium on the ice made way for a mosh-pit picture where all the players, coaches and training staff members crowd in. ", "Now every NHL club does it for posterity sake.", "\n\nEdmonton Coliseum\n\nNorthlands Coliseum became Edmonton Coliseum in 1994. ", "It remained Edmonton Coliseum until 1998 when Skyreach bought the naming rights.", "\n\nSkyreach Centre\n\nLocal businessman Barry Weaver, one of the Oilers' minority owners in the Edmonton Investors Group, had a company called Skyreach Equipment (power lifts) that he founded in 1977. ", "When the St. Albert native got involved with EIG, he bought the naming rights to the hockey rink for $5 or $6 million (stories differ) over five years. ", "For the outgoing Weaver, having the building called Skyreach Centre cost him plenty, but it was a good return considering the company name was mentioned whenever an Oilers game was on TV and there was the giant logo on the arena that everybody saw. ", "It was great advertising. ", "The company was later sold to United Rentals. ", "Weaver, a character who loved to have fun, died of a heart attack two years ago at age 65.", "\n\nRexall Place\n\nWhen Daryl Katz bought the Oilers from the Edmonton Investors Group, the name of the rink naturally became something to do with his chain of stores. ", "While Rexall Place is the name, there's an inclination to simply call it The Drugstore in hockey stories.", "\n\nThere's lots of NHL buildings named for auto companies or banks, insurance companies or airlines, soft drinks, telecommunications, phone companies or energy companies, but Rexall Place is the only one that has to do with pharmacists and cosmeticians.", "\n\nThere's the Honda Center in Anaheim, Calif., the HSBC Arena in Buffalo, N.Y.; PNC Arena in Carolina, Air Canada Centre in Toronto, American Airlines Center in Dallas, United Center in Chicago, the Xcel Energy Center in St. Paul, Minn., the Consol Energy Center in Pittsburgh, the Pepsi Center in Colorado, and the Bell Centre in Montreal.", "\n\nThere are lots of Centers or Centres of activity, but only one Place. ", "One Rexall Place.", "\n\nAl Hamilton\n\nHis No. ", "3 jersey is retired and hanging from the rafters at Rexall Place, next to Gretzky, Messier and Co. It's a testament to his enduring spot in Oilers' history as the team's first WHA captain.", "\n\nThe former Buffalo Sabres defenceman was in four World Hockey Association all-star games and a first-team, end-of-season all-star in 1977-78 and a second-teamer in '73-74. ", "Unfortunately, Hamilton took a puck in the eye in the last WHA season and could play only 31 games in the Oilers' first NHL campaign before retiring.", "\n\nHamilton, who is now an executive with The Driving Force, also played for Bill Hunter's junior Edmonton Oil Kings. ", "His son, Steve, is an assistant to current Oil Kings head coach Derek Laxdal.", "\n\n\"I never regretted leaving the NHL. ", "We had an adventure that would be envied by anyone,\" said Hamilton, who signed a five-year deal starting at $80,000 and going up to $100,000 at the end of the contract.", "\n\nGlen Sather\n\nWhen Sather left the Minnesota North Stars and signed with the Oilers in 1976, Bep Guidolin made him the captain instead of Al Hamilton.", "\nSather had played 658 NHL games over 10 seasons in a vagabond career that took him from the Boston Bruins to the Pittsburgh Penguins to the New York Rangers to the St. Louis Blues to the powerhouse Montreal Canadiens in the early 1970s and Minnesota.", "\n\nThe former Oil Kings forward was a dogged role player, scoring only 80 career goals and one hat trick. \"", "A write-in the next day on the scoresheet,\" Sather always joked of the scoring change.", "\n\nHe was captain for only one WHA season.", "\n\nPaul Shmyr\n\nThe defenceman had the same kind of haircut as Larry in the Three Stooges, and he was as funny as Larry, Moe and Curly Joe. ", "He never had a bad day as a player.", "\n\nShmyr got the \"C\" with the Oilers when Glen Sather became coach in 1977. ", "He captained them for two WHA seasons, then went back to the NHL to play for the Minnesota North Stars and Hartford Whalers. ", "He was on the WHA's all-star team against the Soviet Union in 1974 and was one of only two WHA players (Bobby Hull was the other) invited to try out for the '76 Canada-USSR series.", "\n\nIt was only after he quit and was later diagnosed with throat cancer in 1999 that people saw a quieter side of the third Oilers captain. ", "Always a fighter, he went through an aggressive treatment called stereotactic radiation and bought himself five years when he was originally given only three months to live. ", "He died at age 58.", "\n\n\"Everything was a lot of fun when he was around, but he was also as tough as they came and absolutely maximized his abilities,\" said Al Hamilton, the first Oilers captain, in Ed Willes' book, Rebel League.", "\n\nRon Chipperfield\n\nThe silky-smooth centre wore No. ", "7 with the Oilers during the last two WHA seasons and most of Edmonton's first NHL campaign in 1979-80, when he was traded to the Quebec Nordiques for goalie Ron Low. ", "Incidentally, the two had been teammates with the Dauphin Kings in the Manitoba Junior Hockey League once upon a time.", "\n\n\"Toughest trade we ever had to make. ", "Chipper's mother was very sick,\" said then-head coach Glen Sather.", "\n\nChipperfield was a sensational junior in Brandon, scoring 90 goals one season and racking up 470 points in four years with the Wheat Kings. ", "He was an early draft pick of the lamentable California Golden Seals, but opted to play in the WHA instead, first with the Vancouver Blazers, then the Calgary Cowboys and the Oilers.", "\n\nHe hiked to Italy to play in the mountain town of Bolzano for three seasons after being traded to the Nords, and wound up being an executive there and then became a player agent along with another former Oiler, Brett Callighen, getting North Americans to the European leagues.", "\n\nBlair MacDonald\n\nBlair (or B.J., as in Blair Joseph) MacDonald's claim to fame was playing on Wayne Gretzky's line in the Oilers' first NHL season. ", "He popped 46 goals and had 94 points to finish 10th in league scoring, tied with Hall of Famer-to-be Bernie Federko.", "\n\nMacDonald was also fourth in voting for the Lady Byng Trophy with just three minor penalties all season.", "\n\nHis former coach, Glen Sather, later gave him a shot, saying \"a fire-hydrant could score 40 with Gretzky,\" but MacDonald, now one of the chief bird dogs for the NHL's Central Scouting Bureau, had lots of offensive pop. ", "He only lost his spot alongside No. ", "99 because the younger Jari Kurri came along, and Glenn Anderson was the other hotshot right-winger.", "\n\nMacDonald, 59, was traded to the Vancouver Canucks in March 1981 for centre Ken Berry and defenceman Garry Lariviere (Lariviere was a player, Berry wasn't), but somehow was out of the NHL playing in Austria a couple of years later.", "\n\nHe later coached in Austria and was the International Hockey League coach of the year with the Muskegon Mohawks before turning to scouting.", "\n\nLee Fogolin\n\nWas the Oilers captain before Wayne Gretzky got the \"C.\" The hard-as-nails, shot-blocking defencemen, who was one of the Oilers' picks in the expansion draft in 1979, stepped aside for No. ", "99. ", "He became captain when Blair MacDonald was traded in March '81 and kept it until 1983.", "\n\nNobody was tougher than Fogolin, who once pried the cap off an infected tooth using a sharp curtain hook in a hotel room on the road.", "\n\nFogolin, who wore No. ", "2, came to Edmonton from the Buffalo Sabres and played 586 league games and another 78 in the playoffs with the Oilers. ", "He was a menace to play against. ", "He liked to say there was an inviting spot where the cuff of the glove and the arm meet, and he would often take the lumber to that unguarded area if anybody was going past him.", "\n\n\"You hit them there and their arm is going to go dead,\" said Fogolin, who left the Oilers in '87 because Steve Smith and Jeff Beukeboom had arrived on the scene.", "\n\nHe was traded to Buffalo for Norm Lacombe and retired shortly after that. ", "Fogolin was a master carpenter when he played for the Oilers and later got into the construction business. ", "He once built a dining room table out of six or seven different kinds of wood.", "\n\nWayne Gretzky\n\nWas the Oilers captain for five years, until he was traded to the Los Angeles Kings on Aug. 9, 1988. ", "He led by example, as Sidney Crosby does now with the Pittsburgh Penguins.", "\n\nGretzky wouldn't raise his voice much in the dressing room; that was his successor Mark Messier's role. ", "But Gretzky was clearly the leader of the merry band of Oilers through their glory days. ", "He captained them to four Stanley Cups, which meant he got the trophy first before the conga line for happy teammates got their turn hoisting the mug.", "\n\nThe most endearing captain's memory of Gretzky was holding the Cup aloft when the Oilers won their first NHL championship on May 19, 1984. ", "Gretzky was 23 years old and had the wide-eyed look of a kid on Christmas morning as Paul Coffey and Dave Lumley helped him lift the trophy. ", "Lumley had salted the game away with an empty-net goal after two quick scores by Pat LaFontaine turned a 4-0 rout in Game 5 into a nail-biter.", "\n\nGretzky and defenceman Jason Smith (2001-07, excluding the 2004-05 NHL lockout) are tied for the longest tenure as Oilers' captain.", "\n\nMark Messier\n\nTook the \"C\" after Wayne Gretzky left for Los Angeles, but he acted like the Oilers captain even when he didn't have that letter on his chest. ", "Messier was the quintessential leader, even when he only wore an \"A\" as alternate captain. ", "He was strong-willed, pulling people along with him.", "\n\nHe captained the Oilers to their last Stanley Cup championship in 1990 and did it again with the Rangers in 1994, guaranteeing a win over the New Jersey Devils in Game 6 of the Stanley Cup semifinals, which New York trailed at the time. ", "He's the only NHLer to captain two NHL championship teams.", "\n\nMessier has been called the greatest leader of all-time, not just on a 200x85-foot sheet of ice. ", "Who can argue? ", "The boldest stroke of Messier's captaincy as an Oiler came in Game 4 of the 1990 semifinal at the old Chicago Stadium with Edmonton trailing 2-1 in the series to Mike Keenan's Blackhawks. ", "Messier was at his nasty best, taking a run at Blackhawks' defenceman Doug Wilson early to set the tone, and winding up with three points in the Oilers' 4-2 win. ", "After that, they won the series and their last Cup.", "\n\n\"He was like a lot of great generals in wartime history,\" said Oilers defenceman Kevin Lowe, who succeeded Messier as captain.", "\n\nKevin Lowe\n\nBecame the captain after Mark Messier was traded to the New York Rangers in '91 for Bernie Nicholls, Louie DeBrusk (now the Oilers' TV colourman) and Steven Rice, who never played in the NHL.", "\n\nLowe had long been part of the team's inner circle of leaders, with an \"A\" on his jersey, so he was a natural choice as Oilers captain. ", "He'd been the first English-speaking captain of the Quebec\n\nRemparts in his junior days, so he was used to responsibility before the Oilers made him their first NHL draft pick in 1979. ", "Lowe had the \"C\" for only one season, however.", "\n\nWhen he became a restricted free-agent in '92, he was dealt to the New York Rangers for lanky Russian forward Roman Oksiuta. ", "It wasn't a great return; Oksiuta played only 36 games with the Oilers.", "\n\nCraig MacTavish\n\nWas the captain for two years, trying to lead a leaky ship through some very troubled waters. ", "The Oilers had only 60 and 64 points during those seasons, with the '92-93 team losing eight of its first 10 games and 11 of its final 12. ", "The next season, the Oilers dropped 13 of their first 16 games, with coach Ted Green, whose health was failing, leaving the bench after 24 games.", "\n\nMacTavish was dealt in March '94 to the Rangers, making it three straight captains going to New York (Mark Messier, Kevin Lowe and MacTavish). ", "Centre Todd Marchant was retrieved from New York and wound up playing 678 games with Edmonton.", "\n\nHe was on the ice in the last two seconds of the Rangers' first Stanley Cup championship since 1940, taking the faceoff to clinch the 3-2 win over the Vancouver Canucks in Game 7.", "\n\nShayne Corson\n\nWas a skilled, hard-nosed guy, but had the shortest run as captain, just 34 games in George Burnett's tenure as coach during the '94-95 lockout.", "\nBurnett stripped Corson of the \"C\" one game before he was fired in the midst of a nine-game losing streak, apparently because Corson tried to get the official scorer to give him an extra assist on a goal and Jason Arnott was furious and got in Corson's face.", "\n\nCorson came to the Oilers from the Montreal Canadiens in a 1992 trade for Vincent Damphousse and played three years in Edmonton. ", "He left for St. Louis after the lockout season and was one of three captains (Brett Hull and Wayne Gretzky were the others) for the Blues in the '95-96 season.", "\n\nKelly Buchberger\n\nThe current assistant coach played 795 games with the Oilers, fifth-most in team history, and was captain for four years.", "\n\nOnly Wayne Gretzky and Jason Smith had the \"C\" longer than the role-playing winger, who had the captaincy until he was picked up by the Atlanta Thrashers in the 1999 expansion draft. ", "He spent only one season in Atlanta, then was traded to the Los Angeles Kings along with Nelson Emerson for Donald Audette and Frank Kaberle.", "\n\nBuchberger wore the \"C\" on his chest and his heart on his sleeve as Oilers captain, fighting battles, killing penalties, leading completely by example. ", "Considering that he had been a ninth-round draft choice (188th overall) in 1985, he not only battled huge odds to make the NHL, but to get the captaincy was icing on the cake.", "\n\nDoug Weight\n\nSpent 8-1/2 years in Edmonton, after being acquired from the New York Rangers in a trade for Esa Tikkanen in 1994.", "\n\nHe was the captain his last two seasons before he was moved to the St. Louis Blues because the Oilers couldn't afford him. ", "He went to the Blues on Canada Day 2001 for Marty Reasoner and Jochen Hecht. ", "Reasoner was a good Oiler; Hecht didn't last long.", "\n\nWeight wound up his 19-year career as captain of the New York Islanders, where he's now an assistant coach and advisor to general manager Garth Snow.", "\n\nWeight and Lee Fogolin are the only American-born Oilers captains.", "\n\nConceivably, as the Oilers' best player through his tenure in Edmonton, he easily could have had the \"C\" longer than anybody if the Oilers hadn't dealt him.", "\n\nJason Smith\n\nThe defenceman had the \"C\" for five years until he was traded to the Philadelphia Flyers in 2007. ", "He was the defensive version of Kelly Buchberger.", "\n\nHe played hurt, played tough, led by example.", "\n\nIt's hard to fathom how the Toronto Maple Leafs just gave him away on March 23, 1999, sending him to the Oilers for second- and fourth-round draft choices because then-Toronto assistant coach and former blue-liner Ricky Ley didn't think Smith closed well enough on the puck-carrier.", "\n\nSmith was captain when the Oilers got to Game 7 of the 2006 Stanley Cup final with the Carolina Hurricanes, but with the arrival of the younger Matt Greene, Smith was deemed expendable in 2007 and sent to the Flyers in a package with Joffrey Lupul for defenceman Joni Pitkanen and Geoff Sanderson. ", "Smith was immediately named captain in Philly, too, a testament to his dogged style.", "\n\nHis signature defensive move was a straight-arm shiver to the chest of an attacking winger; he knocked scores of players butt-over-tea kettle.", "\n\nEthan Moreau\n\nWas chosen over defenceman Steve Staios for the captaincy when Jason Smith was traded to the Philadelphia Flyers. ", "The day after he got the \"C\" in 2007, he broke his ankle blocking an Adrian Aucoin shot in an exhibition game. ", "When he came back, he immediately broke his leg, so that season was a write off.", "\n\nLate in the 2008-09 season, he took a stick in the eye from Minnesota Wild winger Antti Miettinen and scratched the cornea. ", "When he came back, he wore a visor, although there was some feeling his eyesight was compromised after the fluke incident.", "\n\nLate in the '09-10 season, the Oilers tried to trade him to a contender, but couldn't swing a deal. ", "After that season, they planned on buying him out with one year left on his four-year contract, but\n\nhe was picked up on waivers by Columbus Blue Jackets general manager Scott Howson, a former Oilers assistant GM.", "\n\nHe retired after last season with concussion problems after the Los Angeles Kings sent him to their American Hockey League affiliate, the Manchester Monarchs. ", "He's now a pro scout for the Montreal Canadiens.", "\n\nMoreau was in the mould of Kelly Buchberger, only he had a better touch around the net. ", "He wasn't as good a fighter, but he could change the temperature of a game with his bolt-up-the-ice style. ", "The run of injuries and diminishing production made the last year of his tenure as captain troublesome.", "\n\nShawn Horcoff\n\nThe 13th Oilers captain is also the longest-serving member of the team. ", "He started in 2000 after half-a-season with the Hamilton Bulldogs, at the time Edmonton's American Hockey League farm club.", "\n\nHorcoff, who was a Hobey Baker finalist as the best college player in the United States while at Michigan State University, has been with the Oilers for 12 years. ", "His first game was Dec. 4, 2000. ", "He's played 765 games, sixth-most all-time.", "\n\nAverage Attendance:\n\nThis was the first year of the World Hockey Association and the Alberta Oilers were playing in the antiquated Edmonton Gardens with a seating capacity of 5,200.", "\n\nAverage Attendance:\n\n4,429\n\nAverage Attendance:\n\n10,722\n\nAverage Attendance:\n\n7,931\n\nAverage Attendance:\n\n8,370\n\nAverage Attendance:\n\n10,235\n\nAverage Attendance:\n\n11,255\n\nAverage Attendance:\n\n15,431\n\nThe Oilers did much better in their first season in the National Hockey League.", "\n\nAverage Attendance:\n\n17,423\n\nThe Oilers added another section of seats in Year 2 of the NHL.", "\n\nAverage Attendance:\n\n17,488\n\nAverage Attendance:\n\n17,495\n\nAverage Attendance:\n\n17,498\n\nAverage Attendance:\n\n17,498\n\nAverage Attendance:\n\n17,358\n\nAverage Attendance:\n\n17,503\n\nAverage Attendance:\n\n17,503\n\nAverage Attendance:\n\n17,503\n\nAverage Attendance:\n\n17,009\n\nAverage Attendance:\n\n16,843\n\nAverage Attendance:\n\n16,179\n\nAverage Attendance:\n\n14,855\n\nAverage Attendance:\n\n13,437\n\nAverage Attendance:\n\n13,123\n\nAverage Attendance:\n\n12,334\n\nThe low point for the franchise at the end of a four-year run when the Oilers failed to make the playoffs. ", "On many nights, there were only 8,000 to 9,000 fans in the building and you could hear in the press box as head coach Ron Low screamed instructions to his players from the bench.", "\n\nAverage Attendance:\n\n16,043\n\nAverage Attendance:\n\n16,245\n\nAverage Attendance:\n\n16,244\n\nAverage Attendance:\n\n15,800\n\nAverage Attendance:\n\n15,611\n\nAverage Attendance:\n\n16,587\n\nAverage Attendance:\n\n16,658\n\nAverage Attendance:\n\n17,677\n\nThe Oilers faced the Canadiens in an outdoor game at Commonwealth Stadium. ", "The extra attendance drove the average attendance to 105 per cent.", "\n\nAverage Attendance:\n\n16,832\n\nAverage Attendance:\n\n16,839\n\nAverage Attendance:\n\n16,839\n\nAverage Attendance:\n\n16,839\n\nAverage Attendance:\n\n16,839\n\nAverage Attendance:\n\n16,839\n\nAverage Attendance:\n\n16,839\n\nOwners\n\nHover the cursor over each orange bar to find out about who owned the Oilers during that time period. ", "Initials appear where full names will not fit, but the full name will appear upon hovering the cursor.", "\n\nGeneral Managers\n\nHover the cursor over each orange bar to find out about who was the Oilers' General Manager during that time period. ", "Initials appear where full names will not fit, but the full name will appear upon hovering the cursor.", "\n\nCoaches\n\nHover the cursor over each orange bar to find out about who coached the Oilers during that time period. ", "Initials appear where full names will not fit, but the full name will appear upon hovering the cursor.", "\n\nTeam Captains\n\nHover the cursor over each orange bar to find out about who captained the Oilers during that time period. ", "Initials appear where full names will not fit, but the full name will appear upon hovering the cursor.", "\n\nArena\n\nHover the cursor over each orange bar to find out about which arena the Oilers played in during that time period. ", "Initials appear where full names will not fit, but the full name will appear upon hovering the cursor.", "\n\nWinning Percentage\n\nHover the cursor over each orange bar to find out the Oilers record and winning percentage for that season.", "\n\nAll Stars\n\nHover the cursor over each star to find out who represented the Oilers at the all star game for that season. ", "Seasons without a star did not have an all star game.", "\n\nAttendance\n\nHover the cursor over each orange bar to find out about the average attendance for Oilers home games during that season.", "\n\nDivisional Position\n\nHover the cursor over each group of boxes in one season to find out about how the Oilers finished in their division. ", "The blue boxes represent other teams in the Oiler's division. ", "The orange boxes represent the Oilers' position in the division. ", "First place is at the top of the cluster, last place at the bottom. ", "The name of the division is listed under the seasons. ", "For the WHA years the division changed annually, so no divisional names are included.", "\n\nPlayoff Results\n\nHover the cursor over each group of boxes in one season to find out about how well the Oilers did in the playoffs that season. ", "The total number of boxes represent playoff rounds. ", "Blue boxes represent rounds the Oilers did not participate in and orange boxes represent Oilers involvement in those rounds. ", "The Stanley Cups over the clusters represent the Oilers five championships.", "\n\nBattle of Alberta\n\nHover the cursor over each group of boxes in one season to find out about how well the Oilers did against the hated Calgary Flames in that season. ", "The orange portion of the bar represents wins, the blue part loses and the white part ties.", "\n\nAlmost Done!", "\n\nPostmedia wants to improve your reading experience as well as share the best deals and promotions from our advertisers with you. ", "The information below will be used to optimize the content and make ads across the network more relevant to you. ", "You can always change the information you share with us by editing your profile.", "\n\nBy clicking \"Create Account\", I hearby grant permission to Postmedia to use my account information to create my account.", "\n\nI also accept and agree to be bound by Postmedia's Terms and Conditions with respect to my use of the Site and I have read and understand Postmedia's Privacy Statement. ", "I consent to the collection, use, maintenance, and disclosure of my information in accordance with the Postmedia's Privacy Policy.", "\n\nPostmedia wants to improve your reading experience as well as share the best deals and promotions from our advertisers with you. ", "The information below will be used to optimize the content and make ads across the network more relevant to you. ", "You can always change the information you share with us by editing your profile.", "\n\nBy clicking \"Create Account\", I hearby grant permission to Postmedia to use my account information to create my account.", "\n\nI also accept and agree to be bound by Postmedia's Terms and Conditions with respect to my use of the Site and I have read and understand Postmedia's Privacy Statement. ", "I consent to the collection, use, maintenance, and disclosure of my information in accordance with the Postmedia's Privacy Policy." ]
{ "pile_set_name": "Pile-CC" }
[ 0, 0, 0.007575757575757576, 0.008849557522123894, 0, 0, 0, 0, 0, 0, 0, 0, 0.02727272727272727, 0.02564102564102564, 0.02564102564102564, 0.019230769230769232, 0.022727272727272728, 0.013888888888888888, 0.021621621621621623, 0.017045454545454544, 0, 0.02531645569620253, 0.022988505747126436, 0.023255813953488372, 0, 0.025, 0.019138755980861243, 0.025, 0.017241379310344827, 0.012, 0.012658227848101266, 0.008264462809917356, 0.01834862385321101, 0.02564102564102564, 0.02074688796680498, 0.013157894736842105, 0.014563106796116505, 0.013245033112582781, 0, 0.028985507246376812, 0.012987012987012988, 0, 0.02727272727272727, 0.02564102564102564, 0.01, 0.01444043321299639, 0.020833333333333332, 0, 0.02127659574468085, 0.018292682926829267, 0.025423728813559324, 0.025423728813559324, 0.02564102564102564, 0.02564102564102564, 0.02564102564102564, 0.02564102564102564, 0.02564102564102564, 0.02564102564102564, 0.02564102564102564, 0.02564102564102564, 0.02564102564102564, 0.02564102564102564, 0.02564102564102564, 0.02564102564102564, 0.02564102564102564, 0.02564102564102564, 0.02564102564102564, 0.02564102564102564, 0.02564102564102564, 0.02564102564102564, 0.011538461538461539, 0.009950248756218905, 0.01818181818181818, 0.017391304347826087, 0, 0.015748031496062992, 0.02962962962962963, 0.017777777777777778, 0.046511627906976744, 0.018957345971563982, 0.01775147928994083, 0.02416918429003021, 0.0220125786163522, 0.018867924528301886, 0, 0.006896551724137931, 0.00909090909090909, 0.025, 0.02336448598130841, 0, 0, 0, 0, 0.008888888888888889, 0.02631578947368421, 0, 0.018779342723004695, 0.03, 0.01646090534979424, 0.005405405405405406, 0.01293103448275862, 0.012658227848101266, 0.013422818791946308, 0.01948051948051948, 0.01775147928994083, 0.0199203187250996, 0, 0.005050505050505051, 0, 0.013605442176870748, 0.006289308176100629, 0.005, 0.013157894736842105, 0, 0.006535947712418301, 0.005291005291005291, 0.012345679012345678, 0, 0.013513513513513514, 0, 0.011764705882352941, 0.015463917525773196, 0, 0.011538461538461539, 0.023809523809523808, 0.011235955056179775, 0.011049723756906077, 0.00684931506849315, 0.006756756756756757, 0, 0, 0.023255813953488372, 0.012048192771084338, 0.024271844660194174, 0.025477707006369428, 0.014388489208633094, 0, 0.011049723756906077, 0.008333333333333333, 0, 0, 0.016, 0.00819672131147541, 0, 0.023255813953488372, 0.02702702702702703, 0.008403361344537815, 0, 0.01875, 0.022727272727272728, 0.0196078431372549, 0.0149812734082397, 0.012345679012345678, 0.007246376811594203, 0.012048192771084338, 0.0125, 0.008695652173913044, 0, 0.0136986301369863, 0.03, 0.034482758620689655, 0.00966183574879227, 0, 0.007407407407407408, 0, 0, 0, 0.012345679012345678, 0.02702702702702703, 0.013245033112582781, 0.008264462809917356, 0, 0.0189873417721519, 0, 0.009009009009009009, 0.017045454545454544, 0.014598540145985401, 0.04, 0.004672897196261682, 0, 0.0182648401826484, 0.010638297872340425, 0.0078125, 0, 0.016666666666666666, 0.016574585635359115, 0.014563106796116505, 0.019801980198019802, 0.008403361344537815, 0.008928571428571428, 0, 0, 0.007575757575757576, 0.022935779816513763, 0.02, 0, 0.014705882352941176, 0.02030456852791878, 0, 0, 0.02231237322515213, 0.012345679012345678, 0.021897810218978103, 0.02564102564102564, 0, 0, 0, 0.013333333333333334, 0.013333333333333334, 0.013333333333333334, 0.013333333333333334, 0.014084507042253521, 0.021739130434782608, 0.02564102564102564, 0.019230769230769232, 0.010638297872340425, 0.0045871559633027525, 0.026845637583892617, 0.01834862385321101, 0.009950248756218905, 0, 0.010526315789473684, 0.017857142857142856, 0.013574660633484163, 0.023728813559322035, 0.007462686567164179, 0, 0, 0.015267175572519083, 0, 0.0045662100456621, 0.015625, 0.024, 0, 0.007168458781362007, 0.015503875968992248, 0.014598540145985401, 0, 0.02666666666666667, 0, 0.013043478260869565, 0, 0.02, 0.021739130434782608, 0.02564102564102564, 0.015151515151515152, 0, 0.013333333333333334, 0.014925373134328358, 0, 0.008620689655172414, 0.0058823529411764705, 0.028225806451612902, 0.013333333333333334, 0.00847457627118644, 0.007832898172323759, 0.016, 0.015151515151515152, 0.010309278350515464, 0.025, 0.014705882352941176, 0.009523809523809525, 0.007575757575757576, 0, 0.014563106796116505, 0.026785714285714284, 0.021897810218978103, 0.01098901098901099, 0.007352941176470588, 0.007352941176470588, 0.013888888888888888, 0.0078125, 0.022727272727272728, 0.01639344262295082, 0.022222222222222223, 0.013333333333333334, 0.013333333333333334, 0.013333333333333334, 0.013333333333333334, 0.013333333333333334, 0.013333333333333334, 0.01764705882352941, 0.008849557522123894, 0.02252252252252252, 0.02877697841726619, 0.0234375, 0.011857707509881422, 0.016853932584269662, 0.012987012987012988, 0.018018018018018018, 0, 0.012121212121212121, 0.007194244604316547, 0, 0, 0.015151515151515152, 0.02100840336134454, 0.006896551724137931, 0, 0, 0.019230769230769232, 0.01744186046511628, 0.022935779816513763, 0.006060606060606061, 0.009708737864077669, 0.009708737864077669, 0.005050505050505051, 0.024096385542168676, 0, 0, 0.017482517482517484, 0, 0, 0.0196078431372549, 0.01282051282051282, 0.021739130434782608, 0, 0.021739130434782608, 0.009900990099009901, 0.008403361344537815, 0.014925373134328358, 0.008064516129032258, 0.005, 0.016260162601626018, 0.030534351145038167, 0.013761467889908258, 0.015873015873015872, 0.013888888888888888, 0.011811023622047244, 0.021739130434782608, 0.026737967914438502, 0.006896551724137931, 0.011419249592169658, 0.017391304347826087, 0.0125, 0.007462686567164179, 0.009523809523809525, 0.03260869565217391, 0.014492753623188406, 0, 0.009174311926605505, 0.026490066225165563, 0.012605042016806723, 0, 0.0078125, 0.007042253521126761, 0.005714285714285714, 0.016, 0.03977272727272727, 0.033112582781456956, 0.034482758620689655, 0.0379746835443038, 0, 0.049586776859504134, 0.023809523809523808, 0, 0.01834862385321101, 0.016129032258064516, 0.02857142857142857, 0.024691358024691357, 0, 0, 0.022222222222222223, 0.011764705882352941, 0.012121212121212121, 0.01694915254237288, 0.011904761904761904, 0, 0, 0.01639344262295082, 0, 0, 0, 0.009950248756218905, 0.018018018018018018, 0.024539877300613498, 0.027586206896551724, 0.007936507936507936, 0.025, 0, 0.019417475728155338, 0.027522935779816515, 0.01891891891891892, 0.015706806282722512, 0.011764705882352941, 0.033783783783783786, 0.04081632653061224, 0.02127659574468085, 0.04, 0.009708737864077669, 0.026041666666666668, 0.007936507936507936, 0.024, 0.004424778761061947, 0.009433962264150943, 0.007575757575757576, 0.007575757575757576, 0.03208556149732621, 0.01639344262295082, 0, 0.03529411764705882, 0, 0.008771929824561403, 0, 0.023255813953488372, 0.020161290322580645, 0.01818181818181818, 0.010256410256410256, 0.03125, 0.025477707006369428, 0.02877697841726619, 0, 0, 0.02564102564102564, 0, 0.012987012987012988, 0.023809523809523808, 0.03896103896103896, 0.005780346820809248, 0.02, 0.022727272727272728, 0.01639344262295082, 0.04059040590405904, 0.011857707509881422, 0.0078125, 0.036231884057971016, 0.03571428571428571, 0.021505376344086023, 0.02142857142857143, 0.02702702702702703, 0.027522935779816515, 0.013513513513513514, 0.031496062992125984, 0.006896551724137931, 0.02247191011235955, 0.017543859649122806, 0, 0.02631578947368421, 0.01282051282051282, 0.01694915254237288, 0, 0.009615384615384616, 0.024390243902439025, 0, 0.019736842105263157, 0.013793103448275862, 0, 0, 0.014285714285714285, 0.023474178403755867, 0, 0.014084507042253521, 0.018867924528301886, 0.01968503937007874, 0.01764705882352941, 0.02247191011235955, 0.025477707006369428, 0.011627906976744186, 0.020689655172413793, 0.02531645569620253, 0.026845637583892617, 0, 0.009900990099009901, 0, 0.024390243902439025, 0.0196078431372549, 0.01904761904761905, 0.043478260869565216, 0.023255813953488372, 0.013513513513513514, 0.01904761904761905, 0.006578947368421052, 0, 0.02564102564102564, 0.009216589861751152, 0, 0.018518518518518517, 0.01904761904761905, 0.0064516129032258064, 0.010752688172043012, 0.02262443438914027, 0.014705882352941176, 0, 0, 0.02373887240356083, 0.024793388429752067, 0.018867924528301886, 0.006666666666666667, 0.013605442176870748, 0, 0, 0.008771929824561403, 0, 0.004524886877828055, 0, 0, 0.01904761904761905, 0.021929824561403508, 0.02054794520547945, 0.02631578947368421, 0, 0.016666666666666666, 0, 0.005988023952095809, 0, 0, 0.023668639053254437, 0.025806451612903226, 0.016, 0, 0.009615384615384616, 0.007692307692307693, 0.01675977653631285, 0, 0.022222222222222223, 0.021505376344086023, 0.01990049751243781, 0.03125, 0, 0.007874015748031496, 0.0053475935828877, 0.01485148514851485, 0, 0.021052631578947368, 0.0273972602739726, 0.017064846416382253, 0.022388059701492536, 0.034482758620689655, 0.007575757575757576, 0.03076923076923077, 0, 0, 0, 0.009433962264150943, 0.022727272727272728, 0.020618556701030927, 0.02564102564102564, 0, 0.02127659574468085, 0.016, 0.010869565217391304, 0, 0, 0.024, 0.01818181818181818, 0.006622516556291391, 0, 0, 0, 0, 0.017543859649122806, 0.029411764705882353, 0.01282051282051282, 0.022727272727272728, 0.026455026455026454, 0.020833333333333332, 0.021505376344086023, 0.023890784982935155, 0.005813953488372093, 0.009174311926605505, 0.025, 0.01098901098901099, 0.009523809523809525, 0.02097902097902098, 0, 0.0136986301369863, 0.02631578947368421, 0.009433962264150943, 0, 0, 0, 0.02702702702702703, 0.009009009009009009, 0.012048192771084338, 0.018072289156626505, 0, 0.020833333333333332, 0.014492753623188406, 0, 0.027777777777777776, 0, 0.009523809523809525, 0.018867924528301886, 0.02857142857142857, 0.03, 0.028037383177570093, 0.030303030303030304, 0.009009009009009009, 0.012048192771084338, 0.018072289156626505, 0, 0.020833333333333332, 0.014492753623188406, 0, 0.027777777777777776, 0, 0.009523809523809525, 0.018867924528301886, 0.02857142857142857, 0.03, 0.028037383177570093, 0.030303030303030304, 0.01282051282051282, 0.011363636363636364, 0.038461538461538464, 0, 0.02586206896551724, 0.011834319526627219, 0.028169014084507043, 0.02564102564102564, 0.009900990099009901, 0.034482758620689655, 0.023391812865497075, 0.007407407407407408, 0.01764705882352941, 0, 0, 0.021739130434782608, 0, 0.008695652173913044, 0.012048192771084338, 0.020833333333333332, 0.03571428571428571, 0.02631578947368421, 0.009009009009009009, 0.012048192771084338, 0.018072289156626505, 0, 0.020833333333333332, 0.014492753623188406, 0, 0.027777777777777776, 0, 0.009523809523809525, 0.018867924528301886, 0.02857142857142857, 0.03, 0.028037383177570093, 0.030303030303030304, 0.030303030303030304, 0.009852216748768473, 0.012195121951219513, 0.01818181818181818, 0.010582010582010581, 0.016129032258064516, 0.011764705882352941, 0, 0, 0.012295081967213115, 0.019736842105263157, 0.020833333333333332, 0.008771929824561403, 0, 0.007874015748031496, 0, 0, 0.006622516556291391, 0, 0, 0.010638297872340425, 0.01639344262295082, 0, 0, 0, 0.014084507042253521, 0.012903225806451613, 0, 0.021739130434782608, 0.013333333333333334, 0.025, 0.020202020202020204, 0.006578947368421052, 0, 0, 0, 0, 0.01818181818181818, 0.01904761904761905, 0.007936507936507936, 0.029411764705882353, 0.013888888888888888, 0.058823529411764705, 0.043478260869565216, 0.02127659574468085, 0.011494252873563218, 0.020134228187919462, 0.03418803418803419, 0.025974025974025976, 0.02631578947368421, 0.005952380952380952, 0.019867549668874173, 0.01593625498007968, 0.009433962264150943, 0, 0, 0.028985507246376812, 0, 0.02666666666666667, 0.016, 0.016666666666666666, 0, 0, 0, 0.014492753623188406, 0.018867924528301886, 0.03592814371257485, 0.00847457627118644, 0, 0.030303030303030304, 0.014084507042253521, 0.016483516483516484, 0.007194244604316547, 0.05333333333333334, 0.017241379310344827, 0.009433962264150943, 0.01809954751131222, 0, 0.02, 0.02575107296137339, 0.014184397163120567, 0.014705882352941176, 0, 0.011627906976744186, 0.007407407407407408, 0.041666666666666664, 0.025, 0, 0, 0.024539877300613498, 0.013157894736842105, 0.018691588785046728, 0, 0.025423728813559324, 0.02702702702702703, 0.009433962264150943, 0, 0, 0.02127659574468085, 0.014184397163120567, 0.014084507042253521, 0.022556390977443608, 0.018867924528301886, 0.01098901098901099, 0, 0.012552301255230125, 0.034482758620689655, 0, 0, 0.026595744680851064, 0.024691358024691357, 0, 0.015625, 0.03902439024390244, 0.014492753623188406, 0.016216216216216217, 0.021739130434782608, 0.015748031496062992, 0.014084507042253521, 0.008849557522123894, 0.007194244604316547, 0.013793103448275862, 0.027586206896551724, 0.02127659574468085, 0.011049723756906077, 0.012422360248447204, 0.019305019305019305, 0.030534351145038167, 0.012578616352201259, 0.0070921985815602835, 0.016216216216216217, 0.028368794326241134, 0, 0.011428571428571429, 0.023255813953488372, 0.016, 0.025974025974025976, 0.06, 0.013245033112582781, 0.014705882352941176, 0.0189873417721519, 0.017699115044247787, 0.02040816326530612, 0, 0.01056338028169014, 0.02666666666666667, 0, 0, 0.03076923076923077, 0, 0, 0, 0, 0.00980392156862745, 0.018779342723004695, 0.018633540372670808, 0.020833333333333332, 0.022222222222222223, 0, 0, 0.011235955056179775, 0.024390243902439025, 0.01818181818181818, 0, 0, 0.01092896174863388, 0.0035587188612099642, 0.02127659574468085, 0.001838235294117647, 0.0056179775280898875, 0.003236245954692557, 0, 0.0031746031746031746, 0, 0.0072992700729927005, 0, 0.008695652173913044, 0, 0.008130081300813009, 0, 0.008130081300813009, 0, 0, 0, 0, 0, 0.007142857142857143, 0.016129032258064516, 0.015384615384615385, 0, 0, 0, 0.0136986301369863, 0, 0.008, 0.013333333333333334, 0.011904761904761904, 0, 0, 0, 0, 0, 0, 0.005847953216374269, 0.015384615384615385, 0, 0, 0, 0, 0.005847953216374269, 0.015384615384615385 ]
0.013557
5
[ { "analysis_explanation": null, "end": 115, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 110 }, { "analysis_explanation": null, "end": 165, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 152 }, { "analysis_explanation": null, "end": 187, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 183 }, { "analysis_explanation": null, "end": 809, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 803 }, { "analysis_explanation": null, "end": 820, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 813 }, { "analysis_explanation": null, "end": 968, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 962 }, { "analysis_explanation": null, "end": 1069, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1058 }, { "analysis_explanation": null, "end": 1077, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1071 }, { "analysis_explanation": null, "end": 1185, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1174 }, { "analysis_explanation": null, "end": 1193, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1187 }, { "analysis_explanation": null, "end": 1301, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1290 }, { "analysis_explanation": null, "end": 1309, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1303 }, { "analysis_explanation": null, "end": 1466, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1457 }, { "analysis_explanation": null, "end": 1482, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1472 }, { "analysis_explanation": null, "end": 1579, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1572 }, { "analysis_explanation": null, "end": 1732, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1714 }, { "analysis_explanation": null, "end": 1740, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1734 }, { "analysis_explanation": null, "end": 1966, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1956 }, { "analysis_explanation": null, "end": 1996, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1987 }, { "analysis_explanation": null, "end": 2053, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2039 }, { "analysis_explanation": null, "end": 2079, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2068 }, { "analysis_explanation": null, "end": 2123, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2116 }, { "analysis_explanation": null, "end": 2238, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2220 }, { "analysis_explanation": null, "end": 2256, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2249 }, { "analysis_explanation": null, "end": 2324, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2309 }, { "analysis_explanation": null, "end": 2359, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2344 }, { "analysis_explanation": null, "end": 2397, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2384 }, { "analysis_explanation": null, "end": 2483, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2472 }, { "analysis_explanation": null, "end": 2491, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2485 }, { "analysis_explanation": null, "end": 2606, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2595 }, { "analysis_explanation": null, "end": 2716, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2704 }, { "analysis_explanation": null, "end": 2742, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2734 }, { "analysis_explanation": null, "end": 2791, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2784 }, { "analysis_explanation": null, "end": 2836, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2831 }, { "analysis_explanation": null, "end": 2943, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2938 }, { "analysis_explanation": null, "end": 3040, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3027 }, { "analysis_explanation": null, "end": 3101, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3094 }, { "analysis_explanation": null, "end": 3156, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3149 }, { "analysis_explanation": null, "end": 3169, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3161 }, { "analysis_explanation": null, "end": 3280, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3275 }, { "analysis_explanation": null, "end": 3411, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3396 }, { "analysis_explanation": null, "end": 3424, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3417 }, { "analysis_explanation": null, "end": 3490, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3486 }, { "analysis_explanation": null, "end": 3554, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3547 }, { "analysis_explanation": null, "end": 3598, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3588 }, { "analysis_explanation": null, "end": 3668, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3656 }, { "analysis_explanation": null, "end": 3675, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3670 }, { "analysis_explanation": null, "end": 3810, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3803 }, { "analysis_explanation": null, "end": 3841, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3829 }, { "analysis_explanation": null, "end": 3874, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3869 }, { "analysis_explanation": null, "end": 3906, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3900 }, { "analysis_explanation": null, "end": 4014, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4003 }, { "analysis_explanation": null, "end": 4022, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4016 }, { "analysis_explanation": null, "end": 4192, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4185 }, { "analysis_explanation": null, "end": 4388, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4378 }, { "analysis_explanation": null, "end": 4421, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4409 }, { "analysis_explanation": null, "end": 4468, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4461 }, { "analysis_explanation": null, "end": 4493, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4480 }, { "analysis_explanation": null, "end": 4534, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4523 }, { "analysis_explanation": null, "end": 4549, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4536 }, { "analysis_explanation": null, "end": 4661, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4647 }, { "analysis_explanation": null, "end": 4730, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4723 }, { "analysis_explanation": null, "end": 4757, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4743 }, { "analysis_explanation": null, "end": 4778, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4766 }, { "analysis_explanation": null, "end": 4866, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4854 }, { "analysis_explanation": null, "end": 4876, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4868 }, { "analysis_explanation": null, "end": 4935, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4928 }, { "analysis_explanation": null, "end": 4996, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4990 }, { "analysis_explanation": null, "end": 5097, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5086 }, { "analysis_explanation": null, "end": 5105, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5099 }, { "analysis_explanation": null, "end": 5213, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5202 }, { "analysis_explanation": null, "end": 5221, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5215 }, { "analysis_explanation": null, "end": 5434, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5423 }, { "analysis_explanation": null, "end": 5505, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5503 }, { "analysis_explanation": null, "end": 5538, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5528 }, { "analysis_explanation": null, "end": 5604, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5592 }, { "analysis_explanation": null, "end": 5620, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5613 }, { "analysis_explanation": null, "end": 5639, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5628 }, { "analysis_explanation": null, "end": 5653, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5640 }, { "analysis_explanation": null, "end": 5661, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5659 }, { "analysis_explanation": null, "end": 5689, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5679 }, { "analysis_explanation": null, "end": 5747, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5739 }, { "analysis_explanation": null, "end": 5831, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5825 }, { "analysis_explanation": null, "end": 5906, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5900 }, { "analysis_explanation": null, "end": 6020, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6009 }, { "analysis_explanation": null, "end": 6044, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6038 }, { "analysis_explanation": null, "end": 6108, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6103 }, { "analysis_explanation": null, "end": 6207, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6203 }, { "analysis_explanation": null, "end": 6215, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6209 }, { "analysis_explanation": null, "end": 6324, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6313 }, { "analysis_explanation": null, "end": 6332, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6326 }, { "analysis_explanation": null, "end": 6441, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6430 }, { "analysis_explanation": null, "end": 6449, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6443 }, { "analysis_explanation": null, "end": 6557, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6546 }, { "analysis_explanation": null, "end": 6565, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6559 }, { "analysis_explanation": null, "end": 6673, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6662 }, { "analysis_explanation": null, "end": 6681, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6675 }, { "analysis_explanation": null, "end": 6789, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6778 }, { "analysis_explanation": null, "end": 6797, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6791 }, { "analysis_explanation": null, "end": 6905, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6894 }, { "analysis_explanation": null, "end": 6913, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6907 }, { "analysis_explanation": null, "end": 7021, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7010 }, { "analysis_explanation": null, "end": 7029, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7023 }, { "analysis_explanation": null, "end": 7137, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7126 }, { "analysis_explanation": null, "end": 7145, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7139 }, { "analysis_explanation": null, "end": 7253, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7242 }, { "analysis_explanation": null, "end": 7261, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7255 }, { "analysis_explanation": null, "end": 7369, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7358 }, { "analysis_explanation": null, "end": 7377, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7371 }, { "analysis_explanation": null, "end": 7485, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7474 }, { "analysis_explanation": null, "end": 7493, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7487 }, { "analysis_explanation": null, "end": 7601, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7590 }, { "analysis_explanation": null, "end": 7609, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7603 }, { "analysis_explanation": null, "end": 7717, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7706 }, { "analysis_explanation": null, "end": 7725, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7719 }, { "analysis_explanation": null, "end": 7833, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7822 }, { "analysis_explanation": null, "end": 7841, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7835 }, { "analysis_explanation": null, "end": 7949, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7938 }, { "analysis_explanation": null, "end": 7957, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7951 }, { "analysis_explanation": null, "end": 8065, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8054 }, { "analysis_explanation": null, "end": 8073, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8067 }, { "analysis_explanation": null, "end": 8181, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8170 }, { "analysis_explanation": null, "end": 8189, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8183 }, { "analysis_explanation": null, "end": 8297, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8286 }, { "analysis_explanation": null, "end": 8305, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8299 }, { "analysis_explanation": null, "end": 8413, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8402 }, { "analysis_explanation": null, "end": 8421, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8415 }, { "analysis_explanation": null, "end": 8529, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8518 }, { "analysis_explanation": null, "end": 8749, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8742 }, { "analysis_explanation": null, "end": 8787, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8776 }, { "analysis_explanation": null, "end": 8802, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8789 }, { "analysis_explanation": null, "end": 8887, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8881 }, { "analysis_explanation": null, "end": 9327, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9314 }, { "analysis_explanation": null, "end": 9360, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9352 }, { "analysis_explanation": null, "end": 9466, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9460 }, { "analysis_explanation": null, "end": 9476, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9471 }, { "analysis_explanation": null, "end": 9598, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9587 }, { "analysis_explanation": null, "end": 9629, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9619 }, { "analysis_explanation": null, "end": 9825, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9821 }, { "analysis_explanation": null, "end": 9967, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9957 }, { "analysis_explanation": null, "end": 9983, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9969 }, { "analysis_explanation": null, "end": 9999, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9988 }, { "analysis_explanation": null, "end": 10067, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10057 }, { "analysis_explanation": null, "end": 10251, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10241 }, { "analysis_explanation": null, "end": 10450, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10444 }, { "analysis_explanation": null, "end": 10456, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10452 }, { "analysis_explanation": null, "end": 10471, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10461 }, { "analysis_explanation": null, "end": 10503, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10489 }, { "analysis_explanation": null, "end": 10517, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10505 }, { "analysis_explanation": null, "end": 10534, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10522 }, { "analysis_explanation": null, "end": 10732, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10728 }, { "analysis_explanation": null, "end": 10747, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10737 }, { "analysis_explanation": null, "end": 10774, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10766 }, { "analysis_explanation": null, "end": 10787, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10781 }, { "analysis_explanation": null, "end": 10796, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10792 }, { "analysis_explanation": null, "end": 10928, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10915 }, { "analysis_explanation": null, "end": 11000, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10992 }, { "analysis_explanation": null, "end": 11010, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11002 }, { "analysis_explanation": null, "end": 11018, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11012 }, { "analysis_explanation": null, "end": 11031, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11020 }, { "analysis_explanation": null, "end": 11043, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11033 }, { "analysis_explanation": null, "end": 11055, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11045 }, { "analysis_explanation": null, "end": 11072, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11060 }, { "analysis_explanation": null, "end": 11124, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11111 }, { "analysis_explanation": null, "end": 11222, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11206 }, { "analysis_explanation": null, "end": 11241, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11227 }, { "analysis_explanation": null, "end": 11601, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11586 }, { "analysis_explanation": null, "end": 11745, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11731 }, { "analysis_explanation": null, "end": 12295, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12288 }, { "analysis_explanation": null, "end": 12595, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12588 }, { "analysis_explanation": null, "end": 12701, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12689 }, { "analysis_explanation": null, "end": 12765, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12756 }, { "analysis_explanation": null, "end": 12833, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12820 }, { "analysis_explanation": null, "end": 12882, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12867 }, { "analysis_explanation": null, "end": 12960, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12949 }, { "analysis_explanation": null, "end": 13036, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13025 }, { "analysis_explanation": null, "end": 13054, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13042 }, { "analysis_explanation": null, "end": 13123, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13113 }, { "analysis_explanation": null, "end": 13228, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13219 }, { "analysis_explanation": null, "end": 13326, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13315 }, { "analysis_explanation": null, "end": 13361, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13352 }, { "analysis_explanation": null, "end": 13463, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13453 }, { "analysis_explanation": null, "end": 13530, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13528 }, { "analysis_explanation": null, "end": 13547, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13543 }, { "analysis_explanation": null, "end": 13647, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13636 }, { "analysis_explanation": null, "end": 13820, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13807 }, { "analysis_explanation": null, "end": 13888, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13870 }, { "analysis_explanation": null, "end": 13943, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13932 }, { "analysis_explanation": null, "end": 13954, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13944 }, { "analysis_explanation": null, "end": 14004, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13996 }, { "analysis_explanation": null, "end": 14033, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14023 }, { "analysis_explanation": null, "end": 14141, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14130 }, { "analysis_explanation": null, "end": 14169, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14162 }, { "analysis_explanation": null, "end": 14215, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14202 }, { "analysis_explanation": null, "end": 14238, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14227 }, { "analysis_explanation": null, "end": 14309, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14299 }, { "analysis_explanation": null, "end": 14325, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14313 }, { "analysis_explanation": null, "end": 14352, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14339 }, { "analysis_explanation": null, "end": 14360, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14358 }, { "analysis_explanation": null, "end": 14370, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14367 }, { "analysis_explanation": null, "end": 14375, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14371 }, { "analysis_explanation": null, "end": 14557, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14553 }, { "analysis_explanation": null, "end": 14606, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14596 }, { "analysis_explanation": null, "end": 14702, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14698 }, { "analysis_explanation": null, "end": 14946, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14934 }, { "analysis_explanation": null, "end": 15401, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15392 }, { "analysis_explanation": null, "end": 15601, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15592 }, { "analysis_explanation": null, "end": 15668, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15660 }, { "analysis_explanation": null, "end": 15793, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15784 }, { "analysis_explanation": null, "end": 15917, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15907 }, { "analysis_explanation": null, "end": 16112, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16103 }, { "analysis_explanation": null, "end": 16216, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16206 }, { "analysis_explanation": null, "end": 16256, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16239 }, { "analysis_explanation": null, "end": 16290, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16286 }, { "analysis_explanation": null, "end": 16340, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16318 }, { "analysis_explanation": null, "end": 16465, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16461 }, { "analysis_explanation": null, "end": 16572, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16552 }, { "analysis_explanation": null, "end": 16593, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16586 }, { "analysis_explanation": null, "end": 16660, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16653 }, { "analysis_explanation": null, "end": 16755, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16741 }, { "analysis_explanation": null, "end": 16847, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16844 }, { "analysis_explanation": null, "end": 16860, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16849 }, { "analysis_explanation": null, "end": 16883, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16873 }, { "analysis_explanation": null, "end": 16897, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16888 }, { "analysis_explanation": null, "end": 16932, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16928 }, { "analysis_explanation": null, "end": 16983, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16974 }, { "analysis_explanation": null, "end": 17062, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 17051 }, { "analysis_explanation": null, "end": 17080, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 17064 }, { "analysis_explanation": null, "end": 17115, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 17105 }, { "analysis_explanation": null, "end": 17143, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 17131 }, { "analysis_explanation": null, "end": 17207, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 17196 }, { "analysis_explanation": null, "end": 17268, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 17264 }, { "analysis_explanation": null, "end": 17300, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 17290 }, { "analysis_explanation": null, "end": 17355, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 17352 }, { "analysis_explanation": null, "end": 17400, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 17390 }, { "analysis_explanation": null, "end": 17446, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 17434 }, { "analysis_explanation": null, "end": 17537, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 17525 }, { "analysis_explanation": null, "end": 17553, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 17542 }, { "analysis_explanation": null, "end": 17580, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 17575 }, { "analysis_explanation": null, "end": 17625, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 17621 }, { "analysis_explanation": null, "end": 17658, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 17654 }, { "analysis_explanation": null, "end": 17736, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 17722 }, { "analysis_explanation": null, "end": 17862, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 17851 }, { "analysis_explanation": null, "end": 18243, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 18233 }, { "analysis_explanation": null, "end": 18314, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 18312 }, { "analysis_explanation": null, "end": 18341, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 18330 }, { "analysis_explanation": null, "end": 18360, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 18346 }, { "analysis_explanation": null, "end": 18429, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 18422 }, { "analysis_explanation": null, "end": 18440, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 18430 }, { "analysis_explanation": null, "end": 18464, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 18448 }, { "analysis_explanation": null, "end": 18513, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 18511 }, { "analysis_explanation": null, "end": 18520, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 18515 }, { "analysis_explanation": null, "end": 18571, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 18562 }, { "analysis_explanation": null, "end": 18829, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 18816 }, { "analysis_explanation": null, "end": 19053, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19041 }, { "analysis_explanation": null, "end": 19069, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19055 }, { "analysis_explanation": null, "end": 19096, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19090 }, { "analysis_explanation": null, "end": 19434, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19421 }, { "analysis_explanation": null, "end": 19542, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19529 }, { "analysis_explanation": null, "end": 19572, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19562 }, { "analysis_explanation": null, "end": 19740, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19735 }, { "analysis_explanation": null, "end": 19782, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19771 }, { "analysis_explanation": null, "end": 19814, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19803 }, { "analysis_explanation": null, "end": 19936, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19932 }, { "analysis_explanation": null, "end": 20067, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20055 }, { "analysis_explanation": null, "end": 20088, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20075 }, { "analysis_explanation": null, "end": 20488, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20485 }, { "analysis_explanation": null, "end": 20554, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20543 }, { "analysis_explanation": null, "end": 20571, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20556 }, { "analysis_explanation": null, "end": 20594, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20582 }, { "analysis_explanation": null, "end": 20629, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20618 }, { "analysis_explanation": null, "end": 20661, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20649 }, { "analysis_explanation": null, "end": 20708, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20701 }, { "analysis_explanation": null, "end": 20743, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20726 }, { "analysis_explanation": null, "end": 20759, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20748 }, { "analysis_explanation": null, "end": 20797, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20788 }, { "analysis_explanation": null, "end": 20821, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20809 }, { "analysis_explanation": null, "end": 20944, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20932 }, { "analysis_explanation": null, "end": 20963, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20949 }, { "analysis_explanation": null, "end": 21095, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 21089 }, { "analysis_explanation": null, "end": 21114, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 21103 }, { "analysis_explanation": null, "end": 21139, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 21128 }, { "analysis_explanation": null, "end": 21233, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 21226 }, { "analysis_explanation": null, "end": 21326, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 21315 }, { "analysis_explanation": null, "end": 21343, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 21336 }, { "analysis_explanation": null, "end": 21509, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 21498 }, { "analysis_explanation": null, "end": 21660, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 21654 }, { "analysis_explanation": null, "end": 21851, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 21837 }, { "analysis_explanation": null, "end": 21910, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 21902 }, { "analysis_explanation": null, "end": 22096, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 22085 }, { "analysis_explanation": null, "end": 22110, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 22100 }, { "analysis_explanation": null, "end": 22133, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 22125 }, { "analysis_explanation": null, "end": 22169, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 22156 }, { "analysis_explanation": null, "end": 22201, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 22192 }, { "analysis_explanation": null, "end": 22269, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 22265 }, { "analysis_explanation": null, "end": 22297, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 22293 }, { "analysis_explanation": null, "end": 22337, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 22326 }, { "analysis_explanation": null, "end": 22364, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 22352 }, { "analysis_explanation": null, "end": 22391, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 22376 }, { "analysis_explanation": null, "end": 22400, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 22393 }, { "analysis_explanation": null, "end": 22421, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 22411 }, { "analysis_explanation": null, "end": 22497, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 22490 }, { "analysis_explanation": null, "end": 22554, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 22539 }, { "analysis_explanation": null, "end": 22569, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 22567 }, { "analysis_explanation": null, "end": 22614, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 22603 }, { "analysis_explanation": null, "end": 22742, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 22735 }, { "analysis_explanation": null, "end": 22883, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 22873 }, { "analysis_explanation": null, "end": 22980, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 22968 }, { "analysis_explanation": null, "end": 23391, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 23377 }, { "analysis_explanation": null, "end": 23459, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 23451 }, { "analysis_explanation": null, "end": 23529, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 23519 }, { "analysis_explanation": null, "end": 23598, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 23587 }, { "analysis_explanation": null, "end": 23682, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 23675 }, { "analysis_explanation": null, "end": 23802, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 23791 }, { "analysis_explanation": null, "end": 23821, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 23803 }, { "analysis_explanation": null, "end": 23879, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 23866 }, { "analysis_explanation": null, "end": 23922, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 23911 }, { "analysis_explanation": null, "end": 23977, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 23965 }, { "analysis_explanation": null, "end": 24211, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 24191 }, { "analysis_explanation": null, "end": 24230, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 24219 }, { "analysis_explanation": null, "end": 24310, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 24300 }, { "analysis_explanation": null, "end": 24434, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 24427 }, { "analysis_explanation": null, "end": 24528, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 24521 }, { "analysis_explanation": null, "end": 24549, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 24538 }, { "analysis_explanation": null, "end": 24779, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 24772 }, { "analysis_explanation": null, "end": 24808, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 24796 }, { "analysis_explanation": null, "end": 24938, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 24930 }, { "analysis_explanation": null, "end": 24990, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 24980 }, { "analysis_explanation": null, "end": 25007, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 24998 }, { "analysis_explanation": null, "end": 25063, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 25061 }, { "analysis_explanation": null, "end": 25117, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 25110 }, { "analysis_explanation": null, "end": 25189, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 25177 }, { "analysis_explanation": null, "end": 25354, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 25347 }, { "analysis_explanation": null, "end": 25463, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 25453 }, { "analysis_explanation": null, "end": 25481, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 25470 }, { "analysis_explanation": null, "end": 25504, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 25497 }, { "analysis_explanation": null, "end": 25528, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 25524 }, { "analysis_explanation": null, "end": 25568, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 25563 }, { "analysis_explanation": null, "end": 25681, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 25671 }, { "analysis_explanation": null, "end": 25787, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 25777 }, { "analysis_explanation": null, "end": 25846, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 25834 }, { "analysis_explanation": null, "end": 25867, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 25865 }, { "analysis_explanation": null, "end": 25913, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 25904 }, { "analysis_explanation": null, "end": 25936, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 25921 }, { "analysis_explanation": null, "end": 25972, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 25967 }, { "analysis_explanation": null, "end": 26015, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 25998 }, { "analysis_explanation": null, "end": 26042, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 26030 }, { "analysis_explanation": null, "end": 26105, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 26100 }, { "analysis_explanation": null, "end": 26225, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 26213 }, { "analysis_explanation": null, "end": 26621, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 26607 }, { "analysis_explanation": null, "end": 26650, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 26637 }, { "analysis_explanation": null, "end": 26658, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 26656 }, { "analysis_explanation": null, "end": 26693, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 26682 }, { "analysis_explanation": null, "end": 26721, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 26710 }, { "analysis_explanation": null, "end": 26923, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 26913 }, { "analysis_explanation": null, "end": 26937, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 26928 }, { "analysis_explanation": null, "end": 27063, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 27048 }, { "analysis_explanation": null, "end": 27081, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 27064 }, { "analysis_explanation": null, "end": 27189, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 27187 }, { "analysis_explanation": null, "end": 27228, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 27218 }, { "analysis_explanation": null, "end": 27307, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 27290 }, { "analysis_explanation": null, "end": 27337, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 27325 }, { "analysis_explanation": null, "end": 27428, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 27419 }, { "analysis_explanation": null, "end": 27463, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 27452 }, { "analysis_explanation": null, "end": 27587, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 27575 }, { "analysis_explanation": null, "end": 27599, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 27589 }, { "analysis_explanation": null, "end": 27618, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 27604 }, { "analysis_explanation": null, "end": 27676, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 27668 }, { "analysis_explanation": null, "end": 27862, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 27849 }, { "analysis_explanation": null, "end": 27909, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 27896 }, { "analysis_explanation": null, "end": 27950, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 27936 }, { "analysis_explanation": null, "end": 28006, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 27999 }, { "analysis_explanation": null, "end": 28063, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 28058 }, { "analysis_explanation": null, "end": 28112, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 28089 }, { "analysis_explanation": null, "end": 28355, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 28345 }, { "analysis_explanation": null, "end": 28391, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 28389 }, { "analysis_explanation": null, "end": 28546, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 28530 }, { "analysis_explanation": null, "end": 28618, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 28604 }, { "analysis_explanation": null, "end": 28672, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 28659 }, { "analysis_explanation": null, "end": 28705, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 28694 }, { "analysis_explanation": null, "end": 28758, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 28747 }, { "analysis_explanation": null, "end": 28763, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 28759 }, { "analysis_explanation": null, "end": 28817, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 28796 }, { "analysis_explanation": null, "end": 28891, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 28880 }, { "analysis_explanation": null, "end": 28965, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 28954 }, { "analysis_explanation": null, "end": 29039, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 29028 }, { "analysis_explanation": null, "end": 29113, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 29102 }, { "analysis_explanation": null, "end": 29197, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 29185 }, { "analysis_explanation": null, "end": 29297, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 29284 }, { "analysis_explanation": null, "end": 29316, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 29298 }, { "analysis_explanation": null, "end": 29347, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 29339 }, { "analysis_explanation": null, "end": 29491, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 29485 }, { "analysis_explanation": null, "end": 29541, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 29535 }, { "analysis_explanation": null, "end": 29691, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 29679 }, { "analysis_explanation": null, "end": 29917, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 29908 }, { "analysis_explanation": null, "end": 29946, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 29934 }, { "analysis_explanation": null, "end": 30018, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 30008 }, { "analysis_explanation": null, "end": 30087, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 30074 }, { "analysis_explanation": null, "end": 30150, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 30144 }, { "analysis_explanation": null, "end": 30193, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 30189 }, { "analysis_explanation": null, "end": 30217, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 30203 }, { "analysis_explanation": null, "end": 30323, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 30312 }, { "analysis_explanation": null, "end": 30342, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 30329 }, { "analysis_explanation": null, "end": 30424, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 30411 }, { "analysis_explanation": null, "end": 30462, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 30458 }, { "analysis_explanation": null, "end": 30520, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 30510 }, { "analysis_explanation": null, "end": 30662, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 30651 }, { "analysis_explanation": null, "end": 30680, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 30672 }, { "analysis_explanation": null, "end": 30723, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 30718 }, { "analysis_explanation": null, "end": 30840, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 30836 }, { "analysis_explanation": null, "end": 30902, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 30891 }, { "analysis_explanation": null, "end": 30940, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 30928 }, { "analysis_explanation": null, "end": 31013, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 31001 }, { "analysis_explanation": null, "end": 31027, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 31017 }, { "analysis_explanation": null, "end": 31043, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 31032 }, { "analysis_explanation": null, "end": 31120, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 31105 }, { "analysis_explanation": null, "end": 31133, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 31124 }, { "analysis_explanation": null, "end": 31232, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 31229 }, { "analysis_explanation": null, "end": 31283, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 31270 }, { "analysis_explanation": null, "end": 31359, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 31353 }, { "analysis_explanation": null, "end": 31408, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 31404 }, { "analysis_explanation": null, "end": 31514, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 31500 }, { "analysis_explanation": null, "end": 31558, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 31549 }, { "analysis_explanation": null, "end": 31593, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 31589 }, { "analysis_explanation": null, "end": 31620, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 31614 }, { "analysis_explanation": null, "end": 31740, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 31730 }, { "analysis_explanation": null, "end": 31785, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 31781 }, { "analysis_explanation": null, "end": 31802, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 31793 }, { "analysis_explanation": null, "end": 31907, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 31896 }, { "analysis_explanation": null, "end": 32059, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 32053 }, { "analysis_explanation": null, "end": 32155, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 32141 }, { "analysis_explanation": null, "end": 32177, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 32165 }, { "analysis_explanation": null, "end": 32223, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 32213 }, { "analysis_explanation": null, "end": 32242, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 32229 }, { "analysis_explanation": null, "end": 32276, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 32272 }, { "analysis_explanation": null, "end": 32309, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 32300 }, { "analysis_explanation": null, "end": 32327, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 32319 }, { "analysis_explanation": null, "end": 32395, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 32381 }, { "analysis_explanation": null, "end": 32401, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 32397 }, { "analysis_explanation": null, "end": 32557, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 32546 }, { "analysis_explanation": null, "end": 32634, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 32624 }, { "analysis_explanation": null, "end": 32768, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 32762 }, { "analysis_explanation": null, "end": 32819, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 32809 }, { "analysis_explanation": null, "end": 32834, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 32830 }, { "analysis_explanation": null, "end": 32879, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 32869 }, { "analysis_explanation": null, "end": 32943, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 32930 }, { "analysis_explanation": null, "end": 33015, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 33009 }, { "analysis_explanation": null, "end": 33069, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 33057 }, { "analysis_explanation": null, "end": 33275, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 33269 }, { "analysis_explanation": null, "end": 33448, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 33437 }, { "analysis_explanation": null, "end": 33458, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 33454 }, { "analysis_explanation": null, "end": 33481, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 33474 }, { "analysis_explanation": null, "end": 33499, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 33495 }, { "analysis_explanation": null, "end": 33531, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 33525 }, { "analysis_explanation": null, "end": 33593, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 33583 }, { "analysis_explanation": null, "end": 33648, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 33636 }, { "analysis_explanation": null, "end": 33715, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 33705 }, { "analysis_explanation": null, "end": 33726, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 33720 }, { "analysis_explanation": null, "end": 33743, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 33731 }, { "analysis_explanation": null, "end": 33751, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 33745 }, { "analysis_explanation": null, "end": 33797, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 33791 }, { "analysis_explanation": null, "end": 33828, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 33822 }, { "analysis_explanation": null, "end": 33834, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 33830 }, { "analysis_explanation": null, "end": 33922, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 33911 }, { "analysis_explanation": null, "end": 33951, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 33941 }, { "analysis_explanation": null, "end": 34032, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 34013 }, { "analysis_explanation": null, "end": 34189, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 34178 }, { "analysis_explanation": null, "end": 34235, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 34224 }, { "analysis_explanation": null, "end": 34246, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 34239 }, { "analysis_explanation": null, "end": 34264, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 34253 }, { "analysis_explanation": null, "end": 34369, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 34363 }, { "analysis_explanation": null, "end": 34492, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 34482 }, { "analysis_explanation": null, "end": 34652, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 34639 }, { "analysis_explanation": null, "end": 34672, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 34659 }, { "analysis_explanation": null, "end": 34745, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 34737 }, { "analysis_explanation": null, "end": 34866, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 34852 }, { "analysis_explanation": null, "end": 34883, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 34874 }, { "analysis_explanation": null, "end": 34908, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 34896 }, { "analysis_explanation": null, "end": 34926, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 34913 }, { "analysis_explanation": null, "end": 34949, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 34937 }, { "analysis_explanation": null, "end": 34989, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 34977 }, { "analysis_explanation": null, "end": 35015, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 35005 }, { "analysis_explanation": null, "end": 35089, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 35078 }, { "analysis_explanation": null, "end": 35205, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 35190 }, { "analysis_explanation": null, "end": 35253, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 35243 }, { "analysis_explanation": null, "end": 35441, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 35434 }, { "analysis_explanation": null, "end": 35447, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 35443 }, { "analysis_explanation": null, "end": 35567, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 35561 }, { "analysis_explanation": null, "end": 35653, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 35649 }, { "analysis_explanation": null, "end": 35681, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 35671 }, { "analysis_explanation": null, "end": 35957, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 35943 }, { "analysis_explanation": null, "end": 35988, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 35981 }, { "analysis_explanation": null, "end": 36008, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 35996 }, { "analysis_explanation": null, "end": 36035, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 36028 }, { "analysis_explanation": null, "end": 36057, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 36045 }, { "analysis_explanation": null, "end": 36089, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 36076 }, { "analysis_explanation": null, "end": 36199, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 36188 }, { "analysis_explanation": null, "end": 36490, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 36483 }, { "analysis_explanation": null, "end": 36548, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 36533 }, { "analysis_explanation": null, "end": 36721, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 36702 }, { "analysis_explanation": null, "end": 36733, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 36729 }, { "analysis_explanation": null, "end": 36773, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 36763 }, { "analysis_explanation": null, "end": 36819, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 36804 }, { "analysis_explanation": null, "end": 36879, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 36868 }, { "analysis_explanation": null, "end": 36916, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 36901 }, { "analysis_explanation": null, "end": 36945, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 36939 }, { "analysis_explanation": null, "end": 37017, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 37011 }, { "analysis_explanation": null, "end": 37073, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 37065 }, { "analysis_explanation": null, "end": 37178, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 37172 }, { "analysis_explanation": null, "end": 37322, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 37316 }, { "analysis_explanation": null, "end": 37380, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 37372 }, { "analysis_explanation": null, "end": 37404, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 37389 }, { "analysis_explanation": null, "end": 37460, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 37448 }, { "analysis_explanation": null, "end": 37475, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 37462 }, { "analysis_explanation": null, "end": 37547, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 37539 }, { "analysis_explanation": null, "end": 37573, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 37566 }, { "analysis_explanation": null, "end": 37587, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 37575 }, { "analysis_explanation": null, "end": 37624, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 37616 }, { "analysis_explanation": null, "end": 37753, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 37742 }, { "analysis_explanation": null, "end": 37827, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 37816 }, { "analysis_explanation": null, "end": 37901, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 37890 }, { "analysis_explanation": null, "end": 37975, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 37964 }, { "analysis_explanation": null, "end": 38049, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 38038 }, { "analysis_explanation": null, "end": 38123, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 38112 }, { "analysis_explanation": null, "end": 38136, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 38125 }, { "analysis_explanation": null, "end": 38186, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 38175 }, { "analysis_explanation": null, "end": 38300, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 38294 }, { "analysis_explanation": null, "end": 38435, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 38422 }, { "analysis_explanation": null, "end": 38453, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 38440 }, { "analysis_explanation": null, "end": 38492, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 38486 }, { "analysis_explanation": null, "end": 38521, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 38508 }, { "analysis_explanation": null, "end": 38544, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 38536 }, { "analysis_explanation": null, "end": 38634, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 38628 }, { "analysis_explanation": null, "end": 38888, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 38874 }, { "analysis_explanation": null, "end": 38931, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 38919 }, { "analysis_explanation": null, "end": 39020, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 39013 }, { "analysis_explanation": null, "end": 39028, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 39022 }, { "analysis_explanation": null, "end": 39240, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 39234 }, { "analysis_explanation": null, "end": 39280, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 39274 }, { "analysis_explanation": null, "end": 39352, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 39343 }, { "analysis_explanation": null, "end": 39403, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 39394 }, { "analysis_explanation": null, "end": 39448, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 39444 }, { "analysis_explanation": null, "end": 39486, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 39482 }, { "analysis_explanation": null, "end": 39600, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 39593 }, { "analysis_explanation": null, "end": 39636, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 39630 }, { "analysis_explanation": null, "end": 39745, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 39733 }, { "analysis_explanation": null, "end": 39977, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 39969 }, { "analysis_explanation": null, "end": 40167, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 40146 }, { "analysis_explanation": null, "end": 40217, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 40208 }, { "analysis_explanation": null, "end": 40281, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 40275 }, { "analysis_explanation": null, "end": 40313, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 40306 }, { "analysis_explanation": null, "end": 40340, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 40330 }, { "analysis_explanation": null, "end": 40370, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 40366 }, { "analysis_explanation": null, "end": 40405, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 40391 }, { "analysis_explanation": null, "end": 40457, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 40448 }, { "analysis_explanation": null, "end": 40493, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 40487 }, { "analysis_explanation": null, "end": 40578, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 40567 }, { "analysis_explanation": null, "end": 40589, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 40580 }, { "analysis_explanation": null, "end": 40627, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 40612 }, { "analysis_explanation": null, "end": 40691, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 40674 }, { "analysis_explanation": null, "end": 40723, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 40708 }, { "analysis_explanation": null, "end": 40789, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 40780 }, { "analysis_explanation": null, "end": 40814, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 40810 }, { "analysis_explanation": null, "end": 40873, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 40862 }, { "analysis_explanation": null, "end": 40884, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 40881 }, { "analysis_explanation": null, "end": 40915, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 40906 }, { "analysis_explanation": null, "end": 41055, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 41041 }, { "analysis_explanation": null, "end": 41086, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 41077 }, { "analysis_explanation": null, "end": 41218, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 41207 }, { "analysis_explanation": null, "end": 41232, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 41219 }, { "analysis_explanation": null, "end": 41245, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 41236 }, { "analysis_explanation": null, "end": 41254, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 41247 }, { "analysis_explanation": null, "end": 41276, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 41266 }, { "analysis_explanation": null, "end": 41368, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 41360 }, { "analysis_explanation": null, "end": 41378, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 41372 }, { "analysis_explanation": null, "end": 41432, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 41420 }, { "analysis_explanation": null, "end": 41463, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 41451 }, { "analysis_explanation": null, "end": 41764, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 41759 }, { "analysis_explanation": null, "end": 41834, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 41825 }, { "analysis_explanation": null, "end": 41958, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 41951 }, { "analysis_explanation": null, "end": 42023, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 42011 }, { "analysis_explanation": null, "end": 42031, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 42027 }, { "analysis_explanation": null, "end": 42050, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 42033 }, { "analysis_explanation": null, "end": 42078, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 42068 }, { "analysis_explanation": null, "end": 42379, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 42366 }, { "analysis_explanation": null, "end": 42405, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 42398 }, { "analysis_explanation": null, "end": 42466, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 42462 }, { "analysis_explanation": null, "end": 42529, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 42525 }, { "analysis_explanation": null, "end": 42568, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 42558 }, { "analysis_explanation": null, "end": 42645, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 42638 }, { "analysis_explanation": null, "end": 42824, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 42804 }, { "analysis_explanation": null, "end": 42858, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 42846 }, { "analysis_explanation": null, "end": 43002, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 42995 }, { "analysis_explanation": null, "end": 43087, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 43077 }, { "analysis_explanation": null, "end": 43100, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 43089 }, { "analysis_explanation": null, "end": 43112, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 43102 }, { "analysis_explanation": null, "end": 43131, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 43117 }, { "analysis_explanation": null, "end": 43247, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 43239 }, { "analysis_explanation": null, "end": 43268, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 43261 }, { "analysis_explanation": null, "end": 43362, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 43358 }, { "analysis_explanation": null, "end": 43411, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 43404 }, { "analysis_explanation": null, "end": 43444, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 43435 }, { "analysis_explanation": null, "end": 43467, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 43465 }, { "analysis_explanation": null, "end": 43498, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 43486 }, { "analysis_explanation": null, "end": 43577, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 43565 }, { "analysis_explanation": null, "end": 43593, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 43579 }, { "analysis_explanation": null, "end": 43640, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 43632 }, { "analysis_explanation": null, "end": 43826, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 43815 }, { "analysis_explanation": null, "end": 43834, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 43827 }, { "analysis_explanation": null, "end": 43867, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 43851 }, { "analysis_explanation": null, "end": 43942, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 43931 }, { "analysis_explanation": null, "end": 43964, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 43957 }, { "analysis_explanation": null, "end": 44145, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 44134 }, { "analysis_explanation": null, "end": 44217, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 44194 }, { "analysis_explanation": null, "end": 44224, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 44219 }, { "analysis_explanation": null, "end": 44316, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 44309 }, { "analysis_explanation": null, "end": 44561, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 44557 }, { "analysis_explanation": null, "end": 44577, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 44570 }, { "analysis_explanation": null, "end": 44607, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 44596 }, { "analysis_explanation": null, "end": 44629, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 44610 }, { "analysis_explanation": null, "end": 44662, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 44645 }, { "analysis_explanation": null, "end": 44691, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 44680 }, { "analysis_explanation": null, "end": 44819, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 44804 }, { "analysis_explanation": null, "end": 44872, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 44865 }, { "analysis_explanation": null, "end": 44913, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 44900 }, { "analysis_explanation": null, "end": 45053, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 45042 }, { "analysis_explanation": null, "end": 45157, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 45149 }, { "analysis_explanation": null, "end": 45199, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 45189 }, { "analysis_explanation": null, "end": 45378, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 45369 }, { "analysis_explanation": null, "end": 45501, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 45492 }, { "analysis_explanation": null, "end": 45568, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 45561 }, { "analysis_explanation": null, "end": 45597, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 45590 }, { "analysis_explanation": null, "end": 45657, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 45648 }, { "analysis_explanation": null, "end": 45751, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 45738 }, { "analysis_explanation": null, "end": 45942, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 45935 }, { "analysis_explanation": null, "end": 45992, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 45979 }, { "analysis_explanation": null, "end": 46016, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 46008 }, { "analysis_explanation": null, "end": 46027, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 46018 }, { "analysis_explanation": null, "end": 46126, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 46114 }, { "analysis_explanation": null, "end": 46215, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 46201 }, { "analysis_explanation": null, "end": 46600, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 46593 }, { "analysis_explanation": null, "end": 46606, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 46602 }, { "analysis_explanation": null, "end": 46692, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 46685 }, { "analysis_explanation": null, "end": 46818, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 46814 }, { "analysis_explanation": null, "end": 46830, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 46820 }, { "analysis_explanation": null, "end": 46947, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 46934 }, { "analysis_explanation": null, "end": 46986, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 46981 }, { "analysis_explanation": null, "end": 46999, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 46988 }, { "analysis_explanation": null, "end": 47016, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 47001 }, { "analysis_explanation": null, "end": 47034, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 47021 }, { "analysis_explanation": null, "end": 47190, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 47183 }, { "analysis_explanation": null, "end": 47281, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 47265 }, { "analysis_explanation": null, "end": 47425, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 47413 }, { "analysis_explanation": null, "end": 47468, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 47457 }, { "analysis_explanation": null, "end": 47513, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 47503 }, { "analysis_explanation": null, "end": 47548, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 47535 }, { "analysis_explanation": null, "end": 47561, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 47553 }, { "analysis_explanation": null, "end": 47583, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 47576 }, { "analysis_explanation": null, "end": 47873, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 47865 }, { "analysis_explanation": null, "end": 48100, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 48098 }, { "analysis_explanation": null, "end": 48237, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 48233 }, { "analysis_explanation": null, "end": 48365, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 48359 }, { "analysis_explanation": null, "end": 48423, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 48407 }, { "analysis_explanation": null, "end": 48587, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 48573 }, { "analysis_explanation": null, "end": 48631, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 48619 }, { "analysis_explanation": null, "end": 48644, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 48633 }, { "analysis_explanation": null, "end": 48655, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 48646 }, { "analysis_explanation": null, "end": 48675, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 48660 }, { "analysis_explanation": null, "end": 48846, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 48840 }, { "analysis_explanation": null, "end": 48863, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 48857 }, { "analysis_explanation": null, "end": 48893, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 48887 }, { "analysis_explanation": null, "end": 48952, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 48945 }, { "analysis_explanation": null, "end": 49029, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 49018 }, { "analysis_explanation": null, "end": 49045, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 49031 }, { "analysis_explanation": null, "end": 49069, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 49058 }, { "analysis_explanation": null, "end": 49082, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 49071 }, { "analysis_explanation": null, "end": 49096, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 49084 }, { "analysis_explanation": null, "end": 49112, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 49098 }, { "analysis_explanation": null, "end": 49126, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 49114 }, { "analysis_explanation": null, "end": 49139, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 49128 }, { "analysis_explanation": null, "end": 49153, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 49141 }, { "analysis_explanation": null, "end": 49171, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 49158 }, { "analysis_explanation": null, "end": 49215, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 49209 }, { "analysis_explanation": null, "end": 49293, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 49279 }, { "analysis_explanation": null, "end": 49342, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 49335 }, { "analysis_explanation": null, "end": 49376, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 49368 }, { "analysis_explanation": null, "end": 49459, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 49443 }, { "analysis_explanation": null, "end": 49475, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 49463 }, { "analysis_explanation": null, "end": 49580, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 49567 }, { "analysis_explanation": null, "end": 49608, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 49602 }, { "analysis_explanation": null, "end": 49703, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 49685 }, { "analysis_explanation": null, "end": 49881, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 49867 }, { "analysis_explanation": null, "end": 49967, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 49957 }, { "analysis_explanation": null, "end": 50008, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 49993 }, { "analysis_explanation": null, "end": 50016, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 50010 }, { "analysis_explanation": null, "end": 50048, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 50038 }, { "analysis_explanation": null, "end": 50094, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 50067 }, { "analysis_explanation": null, "end": 50161, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 50144 }, { "analysis_explanation": null, "end": 50200, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 50189 }, { "analysis_explanation": null, "end": 50297, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 50284 }, { "analysis_explanation": null, "end": 50335, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 50329 }, { "analysis_explanation": null, "end": 50419, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 50411 }, { "analysis_explanation": null, "end": 50453, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 50445 }, { "analysis_explanation": null, "end": 50460, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 50455 }, { "analysis_explanation": null, "end": 50734, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 50728 }, { "analysis_explanation": null, "end": 51019, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 50998 }, { "analysis_explanation": null, "end": 51155, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 51149 }, { "analysis_explanation": null, "end": 51172, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 51159 }, { "analysis_explanation": null, "end": 51203, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 51197 }, { "analysis_explanation": null, "end": 51253, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 51241 }, { "analysis_explanation": null, "end": 51269, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 51258 }, { "analysis_explanation": null, "end": 51316, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 51308 }, { "analysis_explanation": null, "end": 51383, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 51371 }, { "analysis_explanation": null, "end": 51480, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 51472 }, { "analysis_explanation": null, "end": 51604, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 51593 }, { "analysis_explanation": null, "end": 51668, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 51662 }, { "analysis_explanation": null, "end": 51825, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 51814 }, { "analysis_explanation": null, "end": 51963, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 51944 }, { "analysis_explanation": null, "end": 51979, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 51964 }, { "analysis_explanation": null, "end": 52022, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 52018 }, { "analysis_explanation": null, "end": 52029, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 52023 }, { "analysis_explanation": null, "end": 52036, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 52030 }, { "analysis_explanation": null, "end": 52067, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 52054 }, { "analysis_explanation": null, "end": 52083, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 52075 }, { "analysis_explanation": null, "end": 52121, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 52108 }, { "analysis_explanation": null, "end": 52132, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 52122 }, { "analysis_explanation": null, "end": 52194, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 52182 }, { "analysis_explanation": null, "end": 52269, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 52253 }, { "analysis_explanation": null, "end": 52289, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 52274 }, { "analysis_explanation": null, "end": 52384, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 52375 }, { "analysis_explanation": null, "end": 52415, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 52401 }, { "analysis_explanation": null, "end": 52532, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 52524 }, { "analysis_explanation": null, "end": 52551, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 52545 }, { "analysis_explanation": null, "end": 52621, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 52599 }, { "analysis_explanation": null, "end": 52711, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 52707 }, { "analysis_explanation": null, "end": 52821, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 52799 }, { "analysis_explanation": null, "end": 52853, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 52841 }, { "analysis_explanation": null, "end": 52873, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 52862 }, { "analysis_explanation": null, "end": 52918, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 52910 }, { "analysis_explanation": null, "end": 52943, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 52939 }, { "analysis_explanation": null, "end": 52951, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 52945 }, { "analysis_explanation": null, "end": 52996, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 52983 }, { "analysis_explanation": null, "end": 53014, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 53002 }, { "analysis_explanation": null, "end": 53160, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 53144 }, { "analysis_explanation": null, "end": 53173, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 53166 }, { "analysis_explanation": null, "end": 53278, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 53272 }, { "analysis_explanation": null, "end": 53373, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 53364 }, { "analysis_explanation": null, "end": 53390, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 53382 }, { "analysis_explanation": null, "end": 53418, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 53411 }, { "analysis_explanation": null, "end": 53424, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 53420 }, { "analysis_explanation": null, "end": 53509, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 53505 }, { "analysis_explanation": null, "end": 53589, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 53583 }, { "analysis_explanation": null, "end": 53617, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 53603 }, { "analysis_explanation": null, "end": 53625, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 53619 }, { "analysis_explanation": null, "end": 53697, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 53685 }, { "analysis_explanation": null, "end": 53723, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 53707 }, { "analysis_explanation": null, "end": 53763, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 53755 }, { "analysis_explanation": null, "end": 53786, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 53777 }, { "analysis_explanation": null, "end": 53805, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 53801 }, { "analysis_explanation": null, "end": 54084, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 54074 }, { "analysis_explanation": null, "end": 54108, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 54103 }, { "analysis_explanation": null, "end": 54127, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 54116 }, { "analysis_explanation": null, "end": 54251, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 54234 }, { "analysis_explanation": null, "end": 54339, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 54327 }, { "analysis_explanation": null, "end": 54370, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 54356 }, { "analysis_explanation": null, "end": 54387, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 54381 }, { "analysis_explanation": null, "end": 54417, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 54407 }, { "analysis_explanation": null, "end": 54436, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 54422 }, { "analysis_explanation": null, "end": 54470, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 54461 }, { "analysis_explanation": null, "end": 54493, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 54487 }, { "analysis_explanation": null, "end": 54533, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 54521 }, { "analysis_explanation": null, "end": 54598, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 54588 }, { "analysis_explanation": null, "end": 54659, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 54655 }, { "analysis_explanation": null, "end": 54784, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 54773 }, { "analysis_explanation": null, "end": 54799, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 54789 }, { "analysis_explanation": null, "end": 54904, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 54900 }, { "analysis_explanation": null, "end": 54967, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 54953 }, { "analysis_explanation": null, "end": 55090, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 55083 }, { "analysis_explanation": null, "end": 55156, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 55140 }, { "analysis_explanation": null, "end": 55268, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 55256 }, { "analysis_explanation": null, "end": 55316, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 55300 }, { "analysis_explanation": null, "end": 55454, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 55450 }, { "analysis_explanation": null, "end": 55479, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 55468 }, { "analysis_explanation": null, "end": 55532, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 55520 }, { "analysis_explanation": null, "end": 55539, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 55536 }, { "analysis_explanation": null, "end": 55557, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 55545 }, { "analysis_explanation": null, "end": 55574, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 55562 }, { "analysis_explanation": null, "end": 55590, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 55579 }, { "analysis_explanation": null, "end": 55698, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 55695 }, { "analysis_explanation": null, "end": 55740, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 55734 }, { "analysis_explanation": null, "end": 55756, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 55744 }, { "analysis_explanation": null, "end": 55795, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 55789 }, { "analysis_explanation": null, "end": 55824, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 55809 }, { "analysis_explanation": null, "end": 55894, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 55879 }, { "analysis_explanation": null, "end": 55940, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 55927 }, { "analysis_explanation": null, "end": 56067, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 56059 }, { "analysis_explanation": null, "end": 56080, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 56069 }, { "analysis_explanation": null, "end": 56089, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 56085 }, { "analysis_explanation": null, "end": 56200, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 56190 }, { "analysis_explanation": null, "end": 56262, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 56255 }, { "analysis_explanation": null, "end": 56284, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 56271 }, { "analysis_explanation": null, "end": 56343, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 56331 }, { "analysis_explanation": null, "end": 56383, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 56362 }, { "analysis_explanation": null, "end": 56405, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 56399 }, { "analysis_explanation": null, "end": 56461, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 56456 }, { "analysis_explanation": null, "end": 56492, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 56477 }, { "analysis_explanation": null, "end": 56508, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 56498 }, { "analysis_explanation": null, "end": 56516, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 56510 }, { "analysis_explanation": null, "end": 56569, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 56555 }, { "analysis_explanation": null, "end": 56605, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 56602 }, { "analysis_explanation": null, "end": 56632, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 56625 }, { "analysis_explanation": null, "end": 56683, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 56668 }, { "analysis_explanation": null, "end": 56776, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 56765 }, { "analysis_explanation": null, "end": 56855, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 56842 }, { "analysis_explanation": null, "end": 56930, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 56914 }, { "analysis_explanation": null, "end": 56946, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 56936 }, { "analysis_explanation": null, "end": 57016, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 57012 }, { "analysis_explanation": null, "end": 57044, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 57033 }, { "analysis_explanation": null, "end": 57134, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 57126 }, { "analysis_explanation": null, "end": 57207, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 57191 }, { "analysis_explanation": null, "end": 57215, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 57211 }, { "analysis_explanation": null, "end": 57276, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 57263 }, { "analysis_explanation": null, "end": 57293, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 57281 }, { "analysis_explanation": null, "end": 57301, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 57297 }, { "analysis_explanation": null, "end": 57331, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 57320 }, { "analysis_explanation": null, "end": 57383, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 57379 }, { "analysis_explanation": null, "end": 57435, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 57424 }, { "analysis_explanation": null, "end": 57443, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 57439 }, { "analysis_explanation": null, "end": 57497, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 57480 }, { "analysis_explanation": null, "end": 57568, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 57562 }, { "analysis_explanation": null, "end": 57637, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 57625 }, { "analysis_explanation": null, "end": 57662, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 57650 }, { "analysis_explanation": null, "end": 57670, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 57666 }, { "analysis_explanation": null, "end": 57706, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 57696 }, { "analysis_explanation": null, "end": 57748, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 57744 }, { "analysis_explanation": null, "end": 57769, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 57758 }, { "analysis_explanation": null, "end": 57797, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 57784 }, { "analysis_explanation": null, "end": 57814, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 57803 }, { "analysis_explanation": null, "end": 57831, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 57819 }, { "analysis_explanation": null, "end": 57878, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 57861 }, { "analysis_explanation": null, "end": 57939, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 57925 }, { "analysis_explanation": null, "end": 57976, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 57972 }, { "analysis_explanation": null, "end": 58025, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 58010 }, { "analysis_explanation": null, "end": 58035, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 58032 }, { "analysis_explanation": null, "end": 58102, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 58096 }, { "analysis_explanation": null, "end": 58130, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 58119 }, { "analysis_explanation": null, "end": 58192, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 58188 }, { "analysis_explanation": null, "end": 58256, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 58248 }, { "analysis_explanation": null, "end": 58271, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 58266 }, { "analysis_explanation": null, "end": 58337, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 58323 }, { "analysis_explanation": null, "end": 58351, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 58339 }, { "analysis_explanation": null, "end": 58393, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 58382 }, { "analysis_explanation": null, "end": 58401, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 58396 }, { "analysis_explanation": null, "end": 58422, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 58415 }, { "analysis_explanation": null, "end": 58436, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 58430 }, { "analysis_explanation": null, "end": 58448, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 58437 }, { "analysis_explanation": null, "end": 58471, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 58464 }, { "analysis_explanation": null, "end": 58487, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 58481 }, { "analysis_explanation": null, "end": 58507, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 58494 }, { "analysis_explanation": null, "end": 58573, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 58560 }, { "analysis_explanation": null, "end": 58589, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 58585 }, { "analysis_explanation": null, "end": 58663, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 58656 }, { "analysis_explanation": null, "end": 58677, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 58666 }, { "analysis_explanation": null, "end": 58693, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 58683 }, { "analysis_explanation": null, "end": 58845, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 58833 }, { "analysis_explanation": null, "end": 58861, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 58850 }, { "analysis_explanation": null, "end": 58890, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 58881 }, { "analysis_explanation": null, "end": 58957, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 58946 }, { "analysis_explanation": null, "end": 59000, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 58996 }, { "analysis_explanation": null, "end": 59010, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 59005 }, { "analysis_explanation": null, "end": 59083, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 59078 }, { "analysis_explanation": null, "end": 59152, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 59134 }, { "analysis_explanation": null, "end": 59184, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 59177 }, { "analysis_explanation": null, "end": 59209, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 59201 }, { "analysis_explanation": null, "end": 59302, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 59292 }, { "analysis_explanation": null, "end": 59356, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 59341 }, { "analysis_explanation": null, "end": 59374, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 59358 }, { "analysis_explanation": null, "end": 59422, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 59413 }, { "analysis_explanation": null, "end": 59506, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 59490 }, { "analysis_explanation": null, "end": 59574, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 59568 }, { "analysis_explanation": null, "end": 59598, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 59594 }, { "analysis_explanation": null, "end": 59614, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 59608 }, { "analysis_explanation": null, "end": 59639, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 59635 }, { "analysis_explanation": null, "end": 59651, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 59641 }, { "analysis_explanation": null, "end": 59705, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 59697 }, { "analysis_explanation": null, "end": 59740, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 59730 }, { "analysis_explanation": null, "end": 59756, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 59745 }, { "analysis_explanation": null, "end": 59773, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 59764 }, { "analysis_explanation": null, "end": 59830, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 59819 }, { "analysis_explanation": null, "end": 59842, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 59832 }, { "analysis_explanation": null, "end": 59862, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 59847 }, { "analysis_explanation": null, "end": 59906, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 59896 }, { "analysis_explanation": null, "end": 59943, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 59937 }, { "analysis_explanation": null, "end": 60011, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 60001 }, { "analysis_explanation": null, "end": 60050, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 60041 }, { "analysis_explanation": null, "end": 60101, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 60092 }, { "analysis_explanation": null, "end": 60108, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 60103 }, { "analysis_explanation": null, "end": 60219, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 60213 }, { "analysis_explanation": null, "end": 60265, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 60259 }, { "analysis_explanation": null, "end": 60377, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 60370 }, { "analysis_explanation": null, "end": 60393, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 60383 }, { "analysis_explanation": null, "end": 60425, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 60420 }, { "analysis_explanation": null, "end": 60509, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 60495 }, { "analysis_explanation": null, "end": 60554, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 60541 }, { "analysis_explanation": null, "end": 60570, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 60557 }, { "analysis_explanation": null, "end": 60645, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 60635 }, { "analysis_explanation": null, "end": 60679, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 60674 }, { "analysis_explanation": null, "end": 60792, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 60787 }, { "analysis_explanation": null, "end": 60893, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 60888 }, { "analysis_explanation": null, "end": 61017, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 60998 }, { "analysis_explanation": null, "end": 61034, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 61022 }, { "analysis_explanation": null, "end": 61082, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 61078 }, { "analysis_explanation": null, "end": 61246, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 61242 }, { "analysis_explanation": null, "end": 61337, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 61321 }, { "analysis_explanation": null, "end": 61369, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 61354 }, { "analysis_explanation": null, "end": 61387, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 61373 }, { "analysis_explanation": null, "end": 61404, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 61389 }, { "analysis_explanation": null, "end": 61495, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 61479 }, { "analysis_explanation": null, "end": 61527, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 61512 }, { "analysis_explanation": null, "end": 61545, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 61531 }, { "analysis_explanation": null, "end": 61566, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 61547 }, { "analysis_explanation": null, "end": 61689, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 61671 }, { "analysis_explanation": null, "end": 61787, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 61776 }, { "analysis_explanation": null, "end": 61846, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 61836 }, { "analysis_explanation": null, "end": 61890, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 61884 }, { "analysis_explanation": null, "end": 61926, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 61920 }, { "analysis_explanation": null, "end": 61941, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 61931 }, { "analysis_explanation": null, "end": 61979, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 61969 }, { "analysis_explanation": null, "end": 61983, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 61981 }, { "analysis_explanation": null, "end": 62081, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 62070 }, { "analysis_explanation": null, "end": 62181, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 62166 }, { "analysis_explanation": null, "end": 62499, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 62482 }, { "analysis_explanation": null, "end": 62518, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 62506 }, { "analysis_explanation": null, "end": 62540, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 62532 }, { "analysis_explanation": null, "end": 62582, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 62572 }, { "analysis_explanation": null, "end": 62622, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 62612 }, { "analysis_explanation": null, "end": 62662, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 62655 }, { "analysis_explanation": null, "end": 62690, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 62677 }, { "analysis_explanation": null, "end": 62727, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 62723 }, { "analysis_explanation": null, "end": 62783, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 62776 }, { "analysis_explanation": null, "end": 62854, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 62845 }, { "analysis_explanation": null, "end": 62992, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 62988 }, { "analysis_explanation": null, "end": 63080, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 63075 }, { "analysis_explanation": null, "end": 63202, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 63189 }, { "analysis_explanation": null, "end": 63233, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 63225 }, { "analysis_explanation": null, "end": 63270, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 63266 }, { "analysis_explanation": null, "end": 63290, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 63279 }, { "analysis_explanation": null, "end": 63317, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 63309 }, { "analysis_explanation": null, "end": 63325, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 63319 }, { "analysis_explanation": null, "end": 63370, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 63366 }, { "analysis_explanation": null, "end": 63380, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 63375 }, { "analysis_explanation": null, "end": 63422, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 63416 }, { "analysis_explanation": null, "end": 63449, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 63441 }, { "analysis_explanation": null, "end": 63455, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 63451 }, { "analysis_explanation": null, "end": 63543, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 63532 }, { "analysis_explanation": null, "end": 63605, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 63596 }, { "analysis_explanation": null, "end": 63615, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 63609 }, { "analysis_explanation": null, "end": 63625, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 63617 }, { "analysis_explanation": null, "end": 63683, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 63672 }, { "analysis_explanation": null, "end": 63710, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 63699 }, { "analysis_explanation": null, "end": 63787, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 63783 }, { "analysis_explanation": null, "end": 63818, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 63800 }, { "analysis_explanation": null, "end": 63869, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 63858 }, { "analysis_explanation": null, "end": 63886, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 63881 }, { "analysis_explanation": null, "end": 63941, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 63937 }, { "analysis_explanation": null, "end": 64080, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 64072 }, { "analysis_explanation": null, "end": 64139, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 64135 }, { "analysis_explanation": null, "end": 64204, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 64191 }, { "analysis_explanation": null, "end": 64221, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 64209 }, { "analysis_explanation": null, "end": 64287, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 64280 }, { "analysis_explanation": null, "end": 64328, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 64320 }, { "analysis_explanation": null, "end": 64344, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 64333 }, { "analysis_explanation": null, "end": 64354, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 64348 }, { "analysis_explanation": null, "end": 64361, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 64357 }, { "analysis_explanation": null, "end": 64527, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 64521 }, { "analysis_explanation": null, "end": 64599, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 64594 }, { "analysis_explanation": null, "end": 64630, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 64624 }, { "analysis_explanation": null, "end": 64703, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 64682 }, { "analysis_explanation": null, "end": 64728, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 64714 }, { "analysis_explanation": null, "end": 64783, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 64776 }, { "analysis_explanation": null, "end": 64855, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 64844 }, { "analysis_explanation": null, "end": 64948, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 64940 }, { "analysis_explanation": null, "end": 65042, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 65034 }, { "analysis_explanation": null, "end": 65201, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 65185 }, { "analysis_explanation": null, "end": 65270, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 65264 }, { "analysis_explanation": null, "end": 65294, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 65280 }, { "analysis_explanation": null, "end": 65388, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 65382 }, { "analysis_explanation": null, "end": 65463, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 65448 }, { "analysis_explanation": null, "end": 65473, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 65465 }, { "analysis_explanation": null, "end": 65493, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 65487 }, { "analysis_explanation": null, "end": 65612, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 65603 }, { "analysis_explanation": null, "end": 65673, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 65660 }, { "analysis_explanation": null, "end": 65685, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 65675 }, { "analysis_explanation": null, "end": 65709, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 65694 }, { "analysis_explanation": null, "end": 65815, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 65801 }, { "analysis_explanation": null, "end": 65914, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 65910 }, { "analysis_explanation": null, "end": 65932, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 65920 }, { "analysis_explanation": null, "end": 66006, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 65994 }, { "analysis_explanation": null, "end": 66100, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 66090 }, { "analysis_explanation": null, "end": 66166, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 66160 }, { "analysis_explanation": null, "end": 66295, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 66282 }, { "analysis_explanation": null, "end": 66317, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 66315 }, { "analysis_explanation": null, "end": 66340, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 66332 }, { "analysis_explanation": null, "end": 66399, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 66389 }, { "analysis_explanation": null, "end": 66440, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 66426 }, { "analysis_explanation": null, "end": 66675, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 66662 }, { "analysis_explanation": null, "end": 66764, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 66750 }, { "analysis_explanation": null, "end": 66866, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 66862 }, { "analysis_explanation": null, "end": 66966, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 66951 }, { "analysis_explanation": null, "end": 67146, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 67132 }, { "analysis_explanation": null, "end": 67214, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 67208 }, { "analysis_explanation": null, "end": 67260, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 67252 }, { "analysis_explanation": null, "end": 67294, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 67276 }, { "analysis_explanation": null, "end": 67309, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 67298 }, { "analysis_explanation": null, "end": 67323, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 67314 }, { "analysis_explanation": null, "end": 67375, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 67368 }, { "analysis_explanation": null, "end": 67416, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 67399 }, { "analysis_explanation": null, "end": 67432, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 67425 }, { "analysis_explanation": null, "end": 67469, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 67462 }, { "analysis_explanation": null, "end": 67495, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 67491 }, { "analysis_explanation": null, "end": 67517, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 67506 }, { "analysis_explanation": null, "end": 67548, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 67537 }, { "analysis_explanation": null, "end": 67605, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 67595 }, { "analysis_explanation": null, "end": 67693, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 67686 }, { "analysis_explanation": null, "end": 67835, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 67828 }, { "analysis_explanation": null, "end": 67872, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 67859 }, { "analysis_explanation": null, "end": 68043, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 68036 }, { "analysis_explanation": null, "end": 68076, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 68069 }, { "analysis_explanation": null, "end": 68080, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 68078 }, { "analysis_explanation": null, "end": 68126, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 68109 }, { "analysis_explanation": null, "end": 68176, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 68163 }, { "analysis_explanation": null, "end": 68295, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 68282 }, { "analysis_explanation": null, "end": 68303, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 68297 }, { "analysis_explanation": null, "end": 68402, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 68392 }, { "analysis_explanation": null, "end": 68428, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 68418 }, { "analysis_explanation": null, "end": 68477, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 68469 }, { "analysis_explanation": null, "end": 68697, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 68693 }, { "analysis_explanation": null, "end": 68759, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 68744 }, { "analysis_explanation": null, "end": 68798, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 68783 }, { "analysis_explanation": null, "end": 68881, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 68872 }, { "analysis_explanation": null, "end": 68902, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 68896 }, { "analysis_explanation": null, "end": 68948, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 68941 }, { "analysis_explanation": null, "end": 69034, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 69028 }, { "analysis_explanation": null, "end": 69134, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 69119 }, { "analysis_explanation": null, "end": 69183, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 69170 }, { "analysis_explanation": null, "end": 69315, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 69303 }, { "analysis_explanation": null, "end": 69327, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 69319 }, { "analysis_explanation": null, "end": 69341, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 69332 }, { "analysis_explanation": null, "end": 69363, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 69351 }, { "analysis_explanation": null, "end": 69391, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 69382 }, { "analysis_explanation": null, "end": 69402, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 69398 }, { "analysis_explanation": null, "end": 69493, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 69484 }, { "analysis_explanation": null, "end": 69646, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 69637 }, { "analysis_explanation": null, "end": 69716, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 69707 }, { "analysis_explanation": null, "end": 69725, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 69718 }, { "analysis_explanation": null, "end": 69784, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 69770 }, { "analysis_explanation": null, "end": 69848, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 69844 }, { "analysis_explanation": null, "end": 69897, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 69881 }, { "analysis_explanation": null, "end": 69928, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 69922 }, { "analysis_explanation": null, "end": 70017, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 70011 }, { "analysis_explanation": null, "end": 70057, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 70053 }, { "analysis_explanation": null, "end": 70112, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 70108 }, { "analysis_explanation": null, "end": 70606, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 70596 }, { "analysis_explanation": null, "end": 70711, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 70702 }, { "analysis_explanation": null, "end": 70755, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 70746 }, { "analysis_explanation": null, "end": 70777, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 70759 }, { "analysis_explanation": null, "end": 70845, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 70841 }, { "analysis_explanation": null, "end": 70988, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 70979 }, { "analysis_explanation": null, "end": 71076, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 71063 }, { "analysis_explanation": null, "end": 71099, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 71093 }, { "analysis_explanation": null, "end": 71127, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 71123 }, { "analysis_explanation": null, "end": 71137, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 71131 }, { "analysis_explanation": null, "end": 71159, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 71144 }, { "analysis_explanation": null, "end": 71180, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 71175 }, { "analysis_explanation": null, "end": 71197, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 71187 }, { "analysis_explanation": null, "end": 71235, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 71225 }, { "analysis_explanation": null, "end": 71276, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 71271 }, { "analysis_explanation": null, "end": 71332, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 71316 }, { "analysis_explanation": null, "end": 71345, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 71336 }, { "analysis_explanation": null, "end": 71362, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 71352 }, { "analysis_explanation": null, "end": 71397, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 71387 }, { "analysis_explanation": null, "end": 71423, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 71419 }, { "analysis_explanation": null, "end": 71431, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 71424 }, { "analysis_explanation": null, "end": 71464, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 71459 }, { "analysis_explanation": null, "end": 71529, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 71524 }, { "analysis_explanation": null, "end": 71536, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 71534 }, { "analysis_explanation": null, "end": 71634, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 71629 }, { "analysis_explanation": null, "end": 71798, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 71791 }, { "analysis_explanation": null, "end": 71897, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 71883 }, { "analysis_explanation": null, "end": 71954, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 71950 }, { "analysis_explanation": null, "end": 71968, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 71966 }, { "analysis_explanation": null, "end": 72028, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 72023 }, { "analysis_explanation": null, "end": 72049, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 72041 }, { "analysis_explanation": null, "end": 72075, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 72065 }, { "analysis_explanation": null, "end": 72119, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 72114 }, { "analysis_explanation": null, "end": 72291, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 72276 }, { "analysis_explanation": null, "end": 72319, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 72301 }, { "analysis_explanation": null, "end": 72330, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 72321 }, { "analysis_explanation": null, "end": 72353, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 72343 }, { "analysis_explanation": null, "end": 72445, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 72434 }, { "analysis_explanation": null, "end": 72496, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 72486 }, { "analysis_explanation": null, "end": 72651, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 72647 }, { "analysis_explanation": null, "end": 72802, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 72783 }, { "analysis_explanation": null, "end": 72817, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 72804 }, { "analysis_explanation": null, "end": 72918, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 72908 }, { "analysis_explanation": null, "end": 73099, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 73070 }, { "analysis_explanation": null, "end": 73507, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 73489 }, { "analysis_explanation": null, "end": 73532, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 73518 }, { "analysis_explanation": null, "end": 73676, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 73656 }, { "analysis_explanation": null, "end": 73708, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 73698 }, { "analysis_explanation": null, "end": 73751, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 73747 }, { "analysis_explanation": null, "end": 73779, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 73766 }, { "analysis_explanation": null, "end": 73810, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 73803 }, { "analysis_explanation": null, "end": 73894, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 73887 }, { "analysis_explanation": null, "end": 73940, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 73929 }, { "analysis_explanation": null, "end": 73980, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 73973 }, { "analysis_explanation": null, "end": 74038, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 74031 }, { "analysis_explanation": null, "end": 74063, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 74055 }, { "analysis_explanation": null, "end": 74132, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 74125 }, { "analysis_explanation": null, "end": 74186, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 74172 }, { "analysis_explanation": null, "end": 74210, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 74198 }, { "analysis_explanation": null, "end": 74230, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 74215 }, { "analysis_explanation": null, "end": 74313, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 74303 }, { "analysis_explanation": null, "end": 74351, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 74335 }, { "analysis_explanation": null, "end": 74426, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 74416 }, { "analysis_explanation": null, "end": 74600, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 74589 }, { "analysis_explanation": null, "end": 74778, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 74764 }, { "analysis_explanation": null, "end": 74790, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 74780 }, { "analysis_explanation": null, "end": 74831, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 74820 }, { "analysis_explanation": null, "end": 74854, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 74844 }, { "analysis_explanation": null, "end": 74860, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 74856 }, { "analysis_explanation": null, "end": 74902, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 74879 }, { "analysis_explanation": null, "end": 74946, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 74928 }, { "analysis_explanation": null, "end": 74953, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 74949 }, { "analysis_explanation": null, "end": 75049, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 75039 }, { "analysis_explanation": null, "end": 75105, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 75101 }, { "analysis_explanation": null, "end": 75148, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 75137 }, { "analysis_explanation": null, "end": 75163, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 75154 }, { "analysis_explanation": null, "end": 75335, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 75326 }, { "analysis_explanation": null, "end": 75435, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 75429 }, { "analysis_explanation": null, "end": 75476, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 75459 }, { "analysis_explanation": null, "end": 75561, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 75555 }, { "analysis_explanation": null, "end": 75731, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 75724 }, { "analysis_explanation": null, "end": 75943, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 75937 }, { "analysis_explanation": null, "end": 75956, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 75945 }, { "analysis_explanation": null, "end": 76066, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 76055 }, { "analysis_explanation": null, "end": 76083, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 76070 }, { "analysis_explanation": null, "end": 76093, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 76088 }, { "analysis_explanation": null, "end": 76126, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 76112 }, { "analysis_explanation": null, "end": 76196, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 76192 }, { "analysis_explanation": null, "end": 76593, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 76581 }, { "analysis_explanation": null, "end": 76844, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 76833 }, { "analysis_explanation": null, "end": 76918, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 76912 }, { "analysis_explanation": null, "end": 76979, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 76973 }, { "analysis_explanation": null, "end": 76998, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 76994 }, { "analysis_explanation": null, "end": 77033, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 77027 }, { "analysis_explanation": null, "end": 77079, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 77065 }, { "analysis_explanation": null, "end": 77092, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 77081 }, { "analysis_explanation": null, "end": 77107, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 77097 }, { "analysis_explanation": null, "end": 77141, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 77124 }, { "analysis_explanation": null, "end": 77333, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 77329 }, { "analysis_explanation": null, "end": 77434, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 77425 }, { "analysis_explanation": null, "end": 77475, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 77463 }, { "analysis_explanation": null, "end": 77535, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 77529 }, { "analysis_explanation": null, "end": 77570, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 77557 }, { "analysis_explanation": null, "end": 77584, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 77572 }, { "analysis_explanation": null, "end": 77596, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 77586 }, { "analysis_explanation": null, "end": 77612, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 77598 }, { "analysis_explanation": null, "end": 77623, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 77617 }, { "analysis_explanation": null, "end": 77652, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 77641 }, { "analysis_explanation": null, "end": 77762, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 77751 }, { "analysis_explanation": null, "end": 77779, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 77766 }, { "analysis_explanation": null, "end": 77789, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 77784 }, { "analysis_explanation": null, "end": 77822, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 77808 }, { "analysis_explanation": null, "end": 77892, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 77888 }, { "analysis_explanation": null, "end": 78289, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 78277 }, { "analysis_explanation": null, "end": 78540, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 78529 }, { "analysis_explanation": null, "end": 78614, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 78608 }, { "analysis_explanation": null, "end": 78675, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 78669 }, { "analysis_explanation": null, "end": 78694, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 78690 }, { "analysis_explanation": null, "end": 78729, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 78723 }, { "analysis_explanation": null, "end": 78775, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 78761 }, { "analysis_explanation": null, "end": 78788, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 78777 }, { "analysis_explanation": null, "end": 78803, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 78793 }, { "analysis_explanation": null, "end": 78837, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 78820 }, { "analysis_explanation": null, "end": 79029, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 79025 }, { "analysis_explanation": null, "end": 79130, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 79121 }, { "analysis_explanation": null, "end": 79171, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 79159 }, { "analysis_explanation": null, "end": 79231, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 79225 }, { "analysis_explanation": null, "end": 79266, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 79253 }, { "analysis_explanation": null, "end": 79280, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 79268 }, { "analysis_explanation": null, "end": 79292, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 79282 }, { "analysis_explanation": null, "end": 79308, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 79294 }, { "analysis_explanation": null, "end": 79319, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 79313 }, { "analysis_explanation": null, "end": 79342, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 79337 }, { "analysis_explanation": null, "end": 79446, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 79435 }, { "analysis_explanation": null, "end": 79472, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 79464 }, { "analysis_explanation": null, "end": 79491, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 79475 }, { "analysis_explanation": null, "end": 79502, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 79495 }, { "analysis_explanation": null, "end": 79536, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 79530 }, { "analysis_explanation": null, "end": 79596, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 79590 }, { "analysis_explanation": null, "end": 79618, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 79604 }, { "analysis_explanation": null, "end": 79769, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 79759 }, { "analysis_explanation": null, "end": 79788, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 79782 }, { "analysis_explanation": null, "end": 79845, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 79839 }, { "analysis_explanation": null, "end": 79890, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 79886 }, { "analysis_explanation": null, "end": 79906, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 79900 }, { "analysis_explanation": null, "end": 79999, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 79989 }, { "analysis_explanation": null, "end": 80027, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 80021 }, { "analysis_explanation": null, "end": 80071, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 80059 }, { "analysis_explanation": null, "end": 80085, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 80073 }, { "analysis_explanation": null, "end": 80166, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 80154 }, { "analysis_explanation": null, "end": 80214, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 80196 }, { "analysis_explanation": null, "end": 80229, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 80216 }, { "analysis_explanation": null, "end": 80314, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 80282 }, { "analysis_explanation": null, "end": 80486, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 80475 }, { "analysis_explanation": null, "end": 80500, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 80491 }, { "analysis_explanation": null, "end": 80743, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 80730 }, { "analysis_explanation": null, "end": 80787, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 80783 }, { "analysis_explanation": null, "end": 80795, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 80789 }, { "analysis_explanation": null, "end": 80826, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 80813 }, { "analysis_explanation": null, "end": 81062, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 81058 }, { "analysis_explanation": null, "end": 81113, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 81109 }, { "analysis_explanation": null, "end": 81140, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 81138 }, { "analysis_explanation": null, "end": 81227, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 81215 }, { "analysis_explanation": null, "end": 81302, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 81298 }, { "analysis_explanation": null, "end": 81365, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 81360 }, { "analysis_explanation": null, "end": 81375, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 81370 }, { "analysis_explanation": null, "end": 81455, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 81449 }, { "analysis_explanation": null, "end": 81479, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 81474 }, { "analysis_explanation": null, "end": 81621, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 81610 }, { "analysis_explanation": null, "end": 81731, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 81720 }, { "analysis_explanation": null, "end": 81748, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 81735 }, { "analysis_explanation": null, "end": 81758, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 81753 }, { "analysis_explanation": null, "end": 81791, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 81777 }, { "analysis_explanation": null, "end": 81861, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 81857 }, { "analysis_explanation": null, "end": 82258, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 82246 }, { "analysis_explanation": null, "end": 82509, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 82498 }, { "analysis_explanation": null, "end": 82583, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 82577 }, { "analysis_explanation": null, "end": 82644, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 82638 }, { "analysis_explanation": null, "end": 82663, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 82659 }, { "analysis_explanation": null, "end": 82698, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 82692 }, { "analysis_explanation": null, "end": 82744, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 82730 }, { "analysis_explanation": null, "end": 82757, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 82746 }, { "analysis_explanation": null, "end": 82772, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 82762 }, { "analysis_explanation": null, "end": 82806, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 82789 }, { "analysis_explanation": null, "end": 82998, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 82994 }, { "analysis_explanation": null, "end": 83099, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 83090 }, { "analysis_explanation": null, "end": 83140, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 83128 }, { "analysis_explanation": null, "end": 83200, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 83194 }, { "analysis_explanation": null, "end": 83235, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 83222 }, { "analysis_explanation": null, "end": 83249, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 83237 }, { "analysis_explanation": null, "end": 83261, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 83251 }, { "analysis_explanation": null, "end": 83277, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 83263 }, { "analysis_explanation": null, "end": 83288, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 83282 }, { "analysis_explanation": null, "end": 83318, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 83306 }, { "analysis_explanation": null, "end": 83368, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 83359 }, { "analysis_explanation": null, "end": 83386, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 83375 }, { "analysis_explanation": null, "end": 83406, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 83391 }, { "analysis_explanation": null, "end": 83476, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 83462 }, { "analysis_explanation": null, "end": 83513, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 83506 }, { "analysis_explanation": null, "end": 83571, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 83550 }, { "analysis_explanation": null, "end": 83674, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 83670 }, { "analysis_explanation": null, "end": 83728, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 83717 }, { "analysis_explanation": null, "end": 83736, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 83732 }, { "analysis_explanation": null, "end": 83773, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 83769 }, { "analysis_explanation": null, "end": 83829, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 83818 }, { "analysis_explanation": null, "end": 83851, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 83843 }, { "analysis_explanation": null, "end": 83934, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 83924 }, { "analysis_explanation": null, "end": 83960, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 83951 }, { "analysis_explanation": null, "end": 84012, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 83999 }, { "analysis_explanation": null, "end": 84039, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 84027 }, { "analysis_explanation": null, "end": 84176, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 84172 }, { "analysis_explanation": null, "end": 84203, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 84191 }, { "analysis_explanation": null, "end": 84211, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 84207 }, { "analysis_explanation": null, "end": 84241, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 84230 }, { "analysis_explanation": null, "end": 84467, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 84454 }, { "analysis_explanation": null, "end": 84485, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 84468 }, { "analysis_explanation": null, "end": 84623, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 84610 }, { "analysis_explanation": null, "end": 84721, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 84718 }, { "analysis_explanation": null, "end": 84740, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 84725 }, { "analysis_explanation": null, "end": 84758, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 84749 }, { "analysis_explanation": null, "end": 84865, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 84852 }, { "analysis_explanation": null, "end": 84912, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 84904 }, { "analysis_explanation": null, "end": 84925, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 84921 }, { "analysis_explanation": null, "end": 84951, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 84937 }, { "analysis_explanation": null, "end": 85022, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 85009 }, { "analysis_explanation": null, "end": 85122, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 85116 }, { "analysis_explanation": null, "end": 85186, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 85163 }, { "analysis_explanation": null, "end": 85327, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 85316 }, { "analysis_explanation": null, "end": 85512, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 85508 }, { "analysis_explanation": null, "end": 85534, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 85514 }, { "analysis_explanation": null, "end": 85742, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 85723 }, { "analysis_explanation": null, "end": 85811, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 85807 }, { "analysis_explanation": null, "end": 85863, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 85853 }, { "analysis_explanation": null, "end": 86001, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 85996 }, { "analysis_explanation": null, "end": 86031, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 86019 }, { "analysis_explanation": null, "end": 86071, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 86067 }, { "analysis_explanation": null, "end": 86107, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 86098 }, { "analysis_explanation": null, "end": 86178, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 86168 }, { "analysis_explanation": null, "end": 86287, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 86274 }, { "analysis_explanation": null, "end": 86350, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 86334 }, { "analysis_explanation": null, "end": 86452, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 86448 }, { "analysis_explanation": null, "end": 86482, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 86469 }, { "analysis_explanation": null, "end": 86501, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 86487 }, { "analysis_explanation": null, "end": 86589, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 86585 }, { "analysis_explanation": null, "end": 86594, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 86591 }, { "analysis_explanation": null, "end": 86599, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 86596 }, { "analysis_explanation": null, "end": 86607, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 86604 }, { "analysis_explanation": null, "end": 86855, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 86851 }, { "analysis_explanation": null, "end": 86897, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 86893 }, { "analysis_explanation": null, "end": 86985, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 86973 }, { "analysis_explanation": null, "end": 87132, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 87128 }, { "analysis_explanation": null, "end": 87153, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 87143 }, { "analysis_explanation": null, "end": 87284, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 87274 }, { "analysis_explanation": null, "end": 87309, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 87303 }, { "analysis_explanation": null, "end": 87613, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 87607 }, { "analysis_explanation": null, "end": 87686, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 87673 }, { "analysis_explanation": null, "end": 87696, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 87690 }, { "analysis_explanation": null, "end": 87727, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 87717 }, { "analysis_explanation": null, "end": 88253, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 88246 }, { "analysis_explanation": null, "end": 88261, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 88255 }, { "analysis_explanation": null, "end": 88288, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 88281 }, { "analysis_explanation": null, "end": 88294, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 88290 }, { "analysis_explanation": null, "end": 88317, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 88309 }, { "analysis_explanation": null, "end": 88347, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 88340 }, { "analysis_explanation": null, "end": 88383, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 88377 }, { "analysis_explanation": null, "end": 88409, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 88402 }, { "analysis_explanation": null, "end": 88445, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 88437 }, { "analysis_explanation": null, "end": 88452, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 88447 }, { "analysis_explanation": null, "end": 88492, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 88482 }, { "analysis_explanation": null, "end": 88522, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 88514 }, { "analysis_explanation": null, "end": 88555, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 88547 }, { "analysis_explanation": null, "end": 88656, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 88645 }, { "analysis_explanation": null, "end": 88747, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 88740 }, { "analysis_explanation": null, "end": 88995, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 88988 }, { "analysis_explanation": null, "end": 89025, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 89019 }, { "analysis_explanation": null, "end": 89050, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 89042 }, { "analysis_explanation": null, "end": 89185, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 89177 }, { "analysis_explanation": null, "end": 89264, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 89251 }, { "analysis_explanation": null, "end": 89306, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 89301 }, { "analysis_explanation": null, "end": 89368, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 89356 }, { "analysis_explanation": null, "end": 89472, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 89464 }, { "analysis_explanation": null, "end": 89496, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 89487 }, { "analysis_explanation": null, "end": 89586, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 89575 }, { "analysis_explanation": null, "end": 89665, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 89661 }, { "analysis_explanation": null, "end": 89723, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 89712 }, { "analysis_explanation": null, "end": 89731, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 89725 }, { "analysis_explanation": null, "end": 89772, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 89762 }, { "analysis_explanation": null, "end": 89960, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 89945 }, { "analysis_explanation": null, "end": 89974, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 89965 }, { "analysis_explanation": null, "end": 90104, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 90092 }, { "analysis_explanation": null, "end": 90218, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 90208 }, { "analysis_explanation": null, "end": 90272, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 90267 }, { "analysis_explanation": null, "end": 90323, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 90318 }, { "analysis_explanation": null, "end": 90328, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 90325 }, { "analysis_explanation": null, "end": 90342, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 90333 }, { "analysis_explanation": null, "end": 90366, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 90357 }, { "analysis_explanation": null, "end": 90430, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 90419 }, { "analysis_explanation": null, "end": 90451, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 90447 }, { "analysis_explanation": null, "end": 90636, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 90620 }, { "analysis_explanation": null, "end": 90644, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 90640 }, { "analysis_explanation": null, "end": 90692, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 90682 }, { "analysis_explanation": null, "end": 90738, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 90735 }, { "analysis_explanation": null, "end": 90745, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 90739 }, { "analysis_explanation": null, "end": 90750, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 90746 }, { "analysis_explanation": null, "end": 90835, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 90831 }, { "analysis_explanation": null, "end": 91013, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 91003 }, { "analysis_explanation": null, "end": 91060, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 91043 }, { "analysis_explanation": null, "end": 91087, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 91081 }, { "analysis_explanation": null, "end": 91233, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 91222 }, { "analysis_explanation": null, "end": 91274, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 91264 }, { "analysis_explanation": null, "end": 91311, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 91295 }, { "analysis_explanation": null, "end": 91416, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 91408 }, { "analysis_explanation": null, "end": 91448, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 91441 }, { "analysis_explanation": null, "end": 91511, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 91504 }, { "analysis_explanation": null, "end": 91576, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 91559 }, { "analysis_explanation": null, "end": 91734, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 91723 }, { "analysis_explanation": null, "end": 91748, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 91736 }, { "analysis_explanation": null, "end": 91784, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 91777 }, { "analysis_explanation": null, "end": 91853, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 91843 }, { "analysis_explanation": null, "end": 92076, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 92071 }, { "analysis_explanation": null, "end": 92116, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 92109 }, { "analysis_explanation": null, "end": 92134, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 92121 }, { "analysis_explanation": null, "end": 92285, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 92270 }, { "analysis_explanation": null, "end": 92310, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 92295 }, { "analysis_explanation": null, "end": 92326, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 92318 }, { "analysis_explanation": null, "end": 92358, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 92336 }, { "analysis_explanation": null, "end": 92367, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 92363 }, { "analysis_explanation": null, "end": 92400, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 92375 }, { "analysis_explanation": null, "end": 92445, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 92430 }, { "analysis_explanation": null, "end": 92599, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 92585 }, { "analysis_explanation": null, "end": 92735, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 92724 }, { "analysis_explanation": null, "end": 92810, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 92803 }, { "analysis_explanation": null, "end": 92994, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 92984 }, { "analysis_explanation": null, "end": 93025, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 93011 }, { "analysis_explanation": null, "end": 93075, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 93073 }, { "analysis_explanation": null, "end": 93126, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 93116 }, { "analysis_explanation": null, "end": 93147, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 93138 }, { "analysis_explanation": null, "end": 93178, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 93163 }, { "analysis_explanation": null, "end": 93189, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 93180 }, { "analysis_explanation": null, "end": 93209, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 93204 }, { "analysis_explanation": null, "end": 93268, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 93261 }, { "analysis_explanation": null, "end": 93292, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 93269 }, { "analysis_explanation": null, "end": 93321, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 93314 }, { "analysis_explanation": null, "end": 93379, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 93371 }, { "analysis_explanation": null, "end": 93450, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 93434 }, { "analysis_explanation": null, "end": 93490, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 93477 }, { "analysis_explanation": null, "end": 93612, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 93608 }, { "analysis_explanation": null, "end": 93678, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 93663 }, { "analysis_explanation": null, "end": 93702, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 93693 }, { "analysis_explanation": null, "end": 93725, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 93721 }, { "analysis_explanation": null, "end": 93758, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 93751 }, { "analysis_explanation": null, "end": 93868, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 93861 }, { "analysis_explanation": null, "end": 93902, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 93894 }, { "analysis_explanation": null, "end": 94282, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 94275 }, { "analysis_explanation": null, "end": 94310, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 94307 }, { "analysis_explanation": null, "end": 94330, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 94319 }, { "analysis_explanation": null, "end": 94349, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 94335 }, { "analysis_explanation": null, "end": 94400, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 94393 }, { "analysis_explanation": null, "end": 94417, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 94405 }, { "analysis_explanation": null, "end": 94457, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 94450 }, { "analysis_explanation": null, "end": 94654, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 94636 }, { "analysis_explanation": null, "end": 94688, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 94678 }, { "analysis_explanation": null, "end": 94750, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 94738 }, { "analysis_explanation": null, "end": 94787, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 94774 }, { "analysis_explanation": null, "end": 94834, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 94827 }, { "analysis_explanation": null, "end": 94924, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 94910 }, { "analysis_explanation": null, "end": 94942, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 94935 }, { "analysis_explanation": null, "end": 95018, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 95002 }, { "analysis_explanation": null, "end": 95058, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 95046 }, { "analysis_explanation": null, "end": 95112, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 95107 }, { "analysis_explanation": null, "end": 95217, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 95210 }, { "analysis_explanation": null, "end": 95308, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 95296 }, { "analysis_explanation": null, "end": 95317, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 95310 }, { "analysis_explanation": null, "end": 95334, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 95322 }, { "analysis_explanation": null, "end": 95391, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 95374 }, { "analysis_explanation": null, "end": 95406, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 95395 }, { "analysis_explanation": null, "end": 95422, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 95411 }, { "analysis_explanation": null, "end": 95546, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 95532 }, { "analysis_explanation": null, "end": 95601, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 95594 }, { "analysis_explanation": null, "end": 95628, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 95617 }, { "analysis_explanation": null, "end": 95637, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 95630 }, { "analysis_explanation": null, "end": 95660, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 95653 }, { "analysis_explanation": null, "end": 95744, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 95726 }, { "analysis_explanation": null, "end": 95772, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 95759 }, { "analysis_explanation": null, "end": 95793, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 95782 }, { "analysis_explanation": null, "end": 95890, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 95883 }, { "analysis_explanation": null, "end": 96097, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 96093 }, { "analysis_explanation": null, "end": 96139, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 96135 }, { "analysis_explanation": null, "end": 96242, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 96234 }, { "analysis_explanation": null, "end": 96330, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 96323 }, { "analysis_explanation": null, "end": 96464, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 96457 }, { "analysis_explanation": null, "end": 96515, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 96511 }, { "analysis_explanation": null, "end": 96566, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 96558 }, { "analysis_explanation": null, "end": 96610, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 96597 }, { "analysis_explanation": null, "end": 96621, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 96611 }, { "analysis_explanation": null, "end": 96630, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 96623 }, { "analysis_explanation": null, "end": 96680, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 96670 }, { "analysis_explanation": null, "end": 96704, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 96693 }, { "analysis_explanation": null, "end": 96928, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 96918 }, { "analysis_explanation": null, "end": 96951, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 96944 }, { "analysis_explanation": null, "end": 96974, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 96964 }, { "analysis_explanation": null, "end": 97013, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 97001 }, { "analysis_explanation": null, "end": 97055, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 97052 }, { "analysis_explanation": null, "end": 97075, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 97060 }, { "analysis_explanation": null, "end": 97090, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 97077 }, { "analysis_explanation": null, "end": 97137, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 97126 }, { "analysis_explanation": null, "end": 97391, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 97376 }, { "analysis_explanation": null, "end": 97487, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 97483 }, { "analysis_explanation": null, "end": 97525, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 97510 }, { "analysis_explanation": null, "end": 97581, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 97578 }, { "analysis_explanation": null, "end": 97637, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 97630 }, { "analysis_explanation": null, "end": 97659, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 97646 }, { "analysis_explanation": null, "end": 97753, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 97733 }, { "analysis_explanation": null, "end": 97779, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 97770 }, { "analysis_explanation": null, "end": 97901, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 97888 }, { "analysis_explanation": null, "end": 97918, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 97912 }, { "analysis_explanation": null, "end": 97998, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 97983 }, { "analysis_explanation": null, "end": 98067, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 98058 }, { "analysis_explanation": null, "end": 98161, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 98152 }, { "analysis_explanation": null, "end": 98229, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 98221 }, { "analysis_explanation": null, "end": 98243, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 98231 }, { "analysis_explanation": null, "end": 98255, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 98245 }, { "analysis_explanation": null, "end": 98292, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 98279 }, { "analysis_explanation": null, "end": 98320, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 98312 }, { "analysis_explanation": null, "end": 98365, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 98357 }, { "analysis_explanation": null, "end": 98408, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 98388 }, { "analysis_explanation": null, "end": 98466, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 98462 }, { "analysis_explanation": null, "end": 98565, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 98547 }, { "analysis_explanation": null, "end": 98663, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 98647 }, { "analysis_explanation": null, "end": 98697, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 98691 }, { "analysis_explanation": null, "end": 98714, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 98707 }, { "analysis_explanation": null, "end": 98730, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 98724 }, { "analysis_explanation": null, "end": 98927, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 98915 }, { "analysis_explanation": null, "end": 98972, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 98966 }, { "analysis_explanation": null, "end": 99029, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 99025 }, { "analysis_explanation": null, "end": 99058, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 99040 }, { "analysis_explanation": null, "end": 99081, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 99070 }, { "analysis_explanation": null, "end": 99093, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 99085 }, { "analysis_explanation": null, "end": 99116, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 99107 }, { "analysis_explanation": null, "end": 99141, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 99135 }, { "analysis_explanation": null, "end": 99183, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 99173 }, { "analysis_explanation": null, "end": 99201, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 99188 }, { "analysis_explanation": null, "end": 99253, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 99240 }, { "analysis_explanation": null, "end": 99276, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 99255 }, { "analysis_explanation": null, "end": 99393, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 99383 }, { "analysis_explanation": null, "end": 99413, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 99400 }, { "analysis_explanation": null, "end": 99429, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 99418 }, { "analysis_explanation": null, "end": 99560, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 99556 }, { "analysis_explanation": null, "end": 99602, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 99587 }, { "analysis_explanation": null, "end": 99613, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 99606 }, { "analysis_explanation": null, "end": 99681, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 99667 }, { "analysis_explanation": null, "end": 99700, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 99686 }, { "analysis_explanation": null, "end": 99718, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 99705 }, { "analysis_explanation": null, "end": 99951, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 99947 }, { "analysis_explanation": null, "end": 100066, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 100048 }, { "analysis_explanation": null, "end": 100078, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 100067 }, { "analysis_explanation": null, "end": 100090, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 100082 }, { "analysis_explanation": null, "end": 100174, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 100170 }, { "analysis_explanation": null, "end": 100215, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 100199 }, { "analysis_explanation": null, "end": 100338, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 100323 }, { "analysis_explanation": null, "end": 100357, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 100343 }, { "analysis_explanation": null, "end": 100374, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 100362 }, { "analysis_explanation": null, "end": 100454, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 100447 }, { "analysis_explanation": null, "end": 100575, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 100565 }, { "analysis_explanation": null, "end": 100599, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 100588 }, { "analysis_explanation": null, "end": 100621, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 100613 }, { "analysis_explanation": null, "end": 100714, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 100706 }, { "analysis_explanation": null, "end": 100812, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 100801 }, { "analysis_explanation": null, "end": 100855, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 100845 }, { "analysis_explanation": null, "end": 100910, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 100906 }, { "analysis_explanation": null, "end": 100960, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 100944 }, { "analysis_explanation": null, "end": 101092, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 101078 }, { "analysis_explanation": null, "end": 101183, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 101176 }, { "analysis_explanation": null, "end": 101231, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 101222 }, { "analysis_explanation": null, "end": 101250, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 101245 }, { "analysis_explanation": null, "end": 101296, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 101291 }, { "analysis_explanation": null, "end": 101446, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 101435 }, { "analysis_explanation": null, "end": 101453, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 101448 }, { "analysis_explanation": null, "end": 101483, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 101479 }, { "analysis_explanation": null, "end": 101538, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 101525 }, { "analysis_explanation": null, "end": 101567, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 101554 }, { "analysis_explanation": null, "end": 101587, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 101572 }, { "analysis_explanation": null, "end": 101594, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 101589 }, { "analysis_explanation": null, "end": 101634, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 101628 }, { "analysis_explanation": null, "end": 101834, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 101817 }, { "analysis_explanation": null, "end": 101870, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 101858 }, { "analysis_explanation": null, "end": 101905, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 101894 }, { "analysis_explanation": null, "end": 101952, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 101945 }, { "analysis_explanation": null, "end": 101981, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 101977 }, { "analysis_explanation": null, "end": 102027, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 102011 }, { "analysis_explanation": null, "end": 102163, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 102149 }, { "analysis_explanation": null, "end": 102206, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 102197 }, { "analysis_explanation": null, "end": 102234, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 102219 }, { "analysis_explanation": null, "end": 102501, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 102490 }, { "analysis_explanation": null, "end": 102547, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 102539 }, { "analysis_explanation": null, "end": 102569, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 102560 }, { "analysis_explanation": null, "end": 102666, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 102654 }, { "analysis_explanation": null, "end": 102726, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 102715 }, { "analysis_explanation": null, "end": 102912, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 102906 }, { "analysis_explanation": null, "end": 102949, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 102933 }, { "analysis_explanation": null, "end": 103166, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 103153 }, { "analysis_explanation": null, "end": 103218, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 103205 }, { "analysis_explanation": null, "end": 103228, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 103224 }, { "analysis_explanation": null, "end": 103310, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 103306 }, { "analysis_explanation": null, "end": 103330, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 103317 }, { "analysis_explanation": null, "end": 103379, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 103371 }, { "analysis_explanation": null, "end": 103446, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 103433 }, { "analysis_explanation": null, "end": 103503, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 103486 }, { "analysis_explanation": null, "end": 103577, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 103569 }, { "analysis_explanation": null, "end": 103610, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 103598 }, { "analysis_explanation": null, "end": 103700, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 103686 }, { "analysis_explanation": null, "end": 103803, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 103787 }, { "analysis_explanation": null, "end": 104086, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 104068 }, { "analysis_explanation": null, "end": 104198, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 104192 }, { "analysis_explanation": null, "end": 104703, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 104694 }, { "analysis_explanation": null, "end": 104767, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 104756 }, { "analysis_explanation": null, "end": 104878, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 104871 }, { "analysis_explanation": null, "end": 106750, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 106739 }, { "analysis_explanation": null, "end": 106870, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 106859 }, { "analysis_explanation": null, "end": 106943, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 106926 }, { "analysis_explanation": null, "end": 107057, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 107046 }, { "analysis_explanation": null, "end": 107135, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 107125 }, { "analysis_explanation": null, "end": 107444, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 107433 }, { "analysis_explanation": null, "end": 107463, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 107450 }, { "analysis_explanation": null, "end": 107493, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 107485 }, { "analysis_explanation": null, "end": 107604, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 107594 }, { "analysis_explanation": null, "end": 108003, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 107993 }, { "analysis_explanation": null, "end": 108093, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 108082 }, { "analysis_explanation": null, "end": 108561, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 108555 }, { "analysis_explanation": null, "end": 109305, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 109299 } ]
[ "Who will take on the long and proud heritage of Fnatic?", "\n\nTop of the list\n\nChallenging „Vegas“\n\nStreaks continuing?", "\n\nWho else?", "\n\nThis edition of the DreamHack HoN tournament is a special one in several aspects. ", "Once again the best teams in the world will gather in Sweden to fight for the World Championship. ", "For the first time, a team from Thailand and two teams from Brazil will join the competition. ", "Also significant is the prize money, a whoppingprize pool offered by S2Games – an unprecedented amount for HoN at the DreamHack or elsewhere. ", "The biggest change, however, will be the absence of the best team in HoN history,. ", "Those boys have fully and officially made the switch to Dota 2 and will be featured as part of the Corsair Vengeance tournament held at DreamHack. ", "So the question is, who will take on the long and proud heritage of fnatic as World Champion and dominator at DreamHack.", "Make no mistake, despite recent loses toand a shake performance against Arena Online eSports,is still the odds-on favorite in the upcoming clash. ", "They not only beat every single opponent in the two DreamHon qualifiers they were allowed to attend, but dominated the scene for the last four months, suffering no meaningful defeat prior to past Saturday. ", "They have crushed opponents in every competition since forming under the compLexity tag.", "Of course the defeat against Trademark eSports a few days before an important tournament has raised some concerns and caused some questions for the fans and the players, but compLexity lost to an unusual and bold strategy, executed to perfection. ", "They now have a week to prepare for such a strategy. ", "They still hold a nearly flawless record when going up against a straight up lineup in this metagame and they still have a group of players that are not only functioning within the group, but also have high individual skill.is arguably one of the strongest solo players in the world right now;can go toe-to-toe with every elite carry player;has become a standout in the support role;is widely considered one of the most efficient junglers in the current state of the game. ", "Last but not least there is, who is not only a very skilled player, often dominating the middle lane, but is also a good drafter and team leader.", "The recent results are pointing towards: The individual skill is there. ", "They have all played on the big stage and should have their emotions well in check by the time they face the biggest challenge of their brief careers.", "If this were professional football or basketball, Vegas would list compLexity as the favorite, but the other competitors are „no scrubs“ as Steven A. Smith would eloquently put it. ", "CompLexity's biggest threats areandjust look sexy heading into the competition after carving a path of destruction these last couple of weeks. ", "They rolled every single opponent in the Destination DreamHon tournament, sweeping their opponents,, in the Deathmatch to earn the DreamHack spot. ", "After that they went on to win the It's Gosu Open and the It's Gosu Cup, in addition to their magnificent run through the HonTour Qualifier Bracket in the past month. ", "In some ways they probably have to be considered the best team when you just look at the results past the Redemption tournament. ", "The team headed by drafting geniushas installed itself among the absolute top teams and has had to concede few meaningful matches in the two months since the team finalized its roster.", "The question for them is the LAN atmosphere. ", "Players likeandhave all experienced DreamHack at center stage, but some concerns are still alive.sometimes performs worse offline,andhave not played in the main event since the previous Dreamhack Winter. ", "Onlyandhave played in the last DreamHack Summer, meeting each other in the Bronze Match.", "Next on the list is, no denying why they are here. ", "In the months dictated bywinning pretty much everything, they were the only team able to challenge the American organization. ", "In the DreamHon Online Summer Championship's team took a game off of compLexity - same story in the Redemption competition. ", "Those “smaller” victories got bigger when tdM was able to defeat coL in the finals of the Vanguard tournament, with coL usingas a ringer instead of. ", "That win was considered fluky and not a real indicator towards the actual strength of tdM. All doubts should have been silenced this last Friday night, when Trademark eSports, trailing a one-game deficit, came back in great fashion, thinking outside the box. ", "They ended compLexity's winning streak, gaining not only momentum towards the DreamHon festivities but also a huge boost in confidence. ", "Now the question is whether this victory was just a matter of catching your opponent off guard or whether Trademark eSports are on to something here. ", "Can they repeat their success?In terms of LAN experience, the team possesses a wildcard in their roster. ", "Their carry player,, has never been the center of attention at a huge LAN event like the DreamHack, so one of the storylines going into this tournament is going to be the nerves of this sensational player. ", "The rest of the squad has gathered experience already, withandcompeting withat DreamHack Summer 2012, andbeing a veteran with a third place finish at DreamHack Winter 2011 and a silver medal at DreamHack Summer 2012. ", "The mid player of the team,, played through the BYOC tournament half a year ago, to wind up in the main event – ultimately forfeiting after an exhausting BYOC portion.", "Also in the top class areand, who are considered Top Five teams in the latestcan look back at a fabulous track record in Jönköping, Sweden, with two consecutive Finals appearances. ", "During the last two editions they played great Heroes of Newerth, withshining in an environment without lag and ping issues.", "Unfortunately another streak continued forin relation to the trip to Sweden, as they can't compete with their main roster for the third straight time. ", "Last Winterhad to cancel the trip prior to the event, leaving them withas a replacement. ", "The following event their suicide playerhad to cancel the trip literally days before the flights were set to take off, leaving them withto fill the void. ", "This event they have to replace, usingstandoutto fill in. ", "That streak already continued, will the Runner Up streak stay alive as well?Speaking of streaks, another very unique streak could end or continue atDreamHack. ", "Without of the race for the fifth consecutive DreamHack title, only their longtime support playercan reach that mark now. ", "He will travel to Elmia with his “brainchild”taking it to the next level after being forged out of the community. ", "In the past monthnot only gathered several talented players from smaller teams like, but also discovered new promising players likeand. ", "He will return to the place of this biggest success and try to take his project and his team to the next stage – the first main title for the young squad.", "The biggest concern will be the LAN environment for a relatively unproven and inexperienced roster. ", "Sure you have the biggest veteran in the game with, but the rest of the squad has never stood on the main stage, has never sat in the HoN Arena with several hundred visitors walking by, standing behind them and probably criticizing their plays in loud fashion. ", "It will be a completely different experience and they will have to overcome some nervous jitters to play up to their potential.", "Without being disrespectful to anyone, the other five teams competing for the World Championship are clear underdogs. ", "Although teams likeorhave proven that they can hang with international teams, a huge success is yet to arrive.went head-to-head withandin the Redemption Playoffs, pushing coL to the max in two games. ", "Still in “crunch time” they always got exposed and ended up short. ", "It happened in the OSC tournament, where they were one map shy of advancing, it happened in the Redemption Playoffs, when they threw away two maps against compLexity and it happened last DreamHack, when they had a victory over fnatic, but still ended up one spot short from reaching the. ", "They now have to regain some trust in order to be even in the discussion to make a serious push towards the playoffs. ", "That history and the fact that they have to either overcomeandon their way to the playoffs makes it very unlikely that we will see the Malaysian flag represented in the brackets after Day Two.", "The same story goes for pretty much every other team.has reached the playoffs as the bestteam, but the OSC tournament clearly showed the skill discrepancy between the international client and the CIS region, as both CIS teams went to a combined score of– Cats only victory over fellow Russian teamThe Brazilian teamsandpossess a great skill level, and guys likeandhave proven that in the OSC competition, where they were the upset team of the first week in Group B, but things have been quiet for them for a while.has well known players likeandin their midst, players that have the respect and admiration of their peers on the international client, but ultimately it might be just one event too early for the Brazilians. ", "The stage will get a lot bigger at Elmia, nerves will play a role, so their game might show some mistakes that they could avoid in the secured environment of the Internet. ", "Since those teams only can defeat teams likeandif they get a nearly flawless match and draft, this should be a problem.", "The last and final team in the DreamHon competition is the wildcard in. ", "Literally no one has any intel on them, so the surprise factor could work in their favor the first day. ", "After that teams should be able to adjust and counter strategies appropriately, leveling the plain field, leaving the game back to tactics, skills and coordination. ", "The question here is, ifcan step up to the challenge once teams have figured out their playstyle, do they have the individual skill, do they have the right tactics in place, do they possess the coordination and spirit in clutch situations?Only time can tell, and that time is Thursday when Elmia opens its doors and lets all the players compete for the ultimate prize in HoN – the World Championship." ]
{ "pile_set_name": "OpenWebText2" }
[ 0.01818181818181818, 0, 0, 0, 0, 0, 0.007042253521126761, 0.012048192771084338, 0.006802721088435374, 0.016666666666666666, 0.00684931506849315, 0.0048543689320388345, 0, 0.004048582995951417, 0, 0, 0, 0, 0, 0.0055248618784530384, 0.006993006993006993, 0.013605442176870748, 0, 0.007751937984496124, 0, 0.022222222222222223, 0.004901960784313725, 0.011363636363636364, 0, 0, 0.008064516129032258, 0.006711409395973154, 0.003861003861003861, 0.007352941176470588, 0.006666666666666667, 0.009523809523809525, 0.009708737864077669, 0.009216589861751152, 0.011976047904191617, 0, 0, 0, 0.011235955056179775, 0, 0, 0.006289308176100629, 0.00819672131147541, 0.008771929824561403, 0, 0, 0.01, 0, 0, 0, 0.005, 0, 0.003472222222222222, 0, 0, 0.004160887656033287, 0.005813953488372093, 0, 0.013888888888888888, 0, 0, 0.0025 ]
0.004565
5
[ { "analysis_explanation": null, "end": 54, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 48 }, { "analysis_explanation": null, "end": 266, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 260 }, { "analysis_explanation": null, "end": 344, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 336 }, { "analysis_explanation": null, "end": 370, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 364 }, { "analysis_explanation": null, "end": 508, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 505 }, { "analysis_explanation": null, "end": 1186, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1166 }, { "analysis_explanation": null, "end": 1241, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1219 }, { "analysis_explanation": null, "end": 1389, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1379 }, { "analysis_explanation": null, "end": 1599, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1593 }, { "analysis_explanation": null, "end": 1928, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1921 }, { "analysis_explanation": null, "end": 2529, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2524 }, { "analysis_explanation": null, "end": 2629, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2614 }, { "analysis_explanation": null, "end": 2796, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2770 }, { "analysis_explanation": null, "end": 2859, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2839 }, { "analysis_explanation": null, "end": 2916, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2906 }, { "analysis_explanation": null, "end": 3110, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3096 }, { "analysis_explanation": null, "end": 3388, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3374 }, { "analysis_explanation": null, "end": 3608, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3601 }, { "analysis_explanation": null, "end": 3828, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3818 }, { "analysis_explanation": null, "end": 3926, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3918 }, { "analysis_explanation": null, "end": 4364, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4359 }, { "analysis_explanation": null, "end": 5170, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5159 }, { "analysis_explanation": null, "end": 5241, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5230 }, { "analysis_explanation": null, "end": 5366, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5351 }, { "analysis_explanation": null, "end": 5585, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5576 }, { "analysis_explanation": null, "end": 5593, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5587 }, { "analysis_explanation": null, "end": 5700, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5693 }, { "analysis_explanation": null, "end": 5836, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5830 }, { "analysis_explanation": null, "end": 5926, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5917 }, { "analysis_explanation": null, "end": 6078, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6074 }, { "analysis_explanation": null, "end": 8323, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8314 }, { "analysis_explanation": null, "end": 8664, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8657 }, { "analysis_explanation": null, "end": 8682, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8673 }, { "analysis_explanation": null, "end": 8825, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8811 }, { "analysis_explanation": null, "end": 9091, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9081 }, { "analysis_explanation": null, "end": 9559, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9546 }, { "analysis_explanation": null, "end": 10010, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10002 }, { "analysis_explanation": null, "end": 10100, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10097 }, { "analysis_explanation": null, "end": 1858, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 1850 }, { "analysis_explanation": null, "end": 3570, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 3562 } ]
[ "1) Arsenal 1-1 Chelsea (December 1919)\n\nArsenal and Chelsea may not do each other many favours nowadays but that wasn't always the case. ", "After the first world war, football restarted in the summer of 1919, and, thanks to the Arsenal chairman and Tory grandee Sir Henry Norris, it was set to be a whole new ball game. ", "With the top division expanding from 20 to 22 clubs after the big hiatus, it had been expected – as had happened in the league's two previous expansions – that the two clubs in the previous season's relegation places (1914-15 stragglers Chelsea and Tottenham Hotspur) would be offered a reprieve, while the top two in the Second (Derby County and Preston North End) would go up as normal. ", "Ah but.", "\n\nNorris argued that Spurs should go down as expected but that Chelsea should stay up. ", "His argument? ", "Manchester United would have been in their relegation shoes instead, had they not beaten Liverpool in a 1915 match later proven to be fixed. ", "Chelsea were reprieved and looked forward to a season in the top flight alongside newly promoted Derby and Preston. ", "The league's members would vote for the other team to join Chelsea in the top tier. ", "And so it was that infamously – outrageously – Arsenal, fifth-placed in the Second Division in 1914-15, prevailed over Spurs, and Second Division high-flyers Wolves and Burnley, all of whom had ended the previous season above the Gunners in the league ladder.", "\n\nClever Henry! ", "Norris had swung the vote by not pushing the morals of the 1915 fixing scandal so far as to demand United or Liverpool be punished for their players' misdemeanours, winning the trust of many big clubs. ", "Other chairmen were impressed with the MP's contacts outside of the game, and his close relationship with the League (and Liverpool) chairman \"Honest\" John McKenna. ", "Oh, and there were accusations of bribes having been flung around willy-nilly, but nothing was ever proved. ", "When Spurs finally made it to the top flight, the fixture would soon kick off: the 1922 version saw two men dismissed – unusually for the time – while fans fought pitched battles in the streets outside Highbury. ", "By comparison, the first game after the Norris affair between Arsenal and Chelsea, consolidating in the top division in December 1919, was a curiously pleasant affair. ", "The spoils were shared in a suspiciously symmetrical match, Chelsea on top in the first half, their hosts in the second. ", "Go figure.", "\n\n2) Arsenal 2-4 Chelsea (March 1964)\n\nChelsea won their first and only pre-Mourinho championship in 1954-55 under the auspices of Ted Drake, but a series of mid-table finishes, and a slow start in 1961-62, saw the former Arsenal legend sacked and replaced by Tommy Docherty. ", "The Doc's first game in charge was a 4-0 tonking at Blackpool, and at the end of the season Chelsea were relegated. ", "But they bounced straight back with a side built around Peter Bonetti, Ron Harris, Terry Venables, and their young captain Bobby Tambling.", "\n\nTheir first season back in the top flight was, for such a young team, a triumph. ", "The standout result was a 4-2 win at Highbury, Tambling scoring all four goals on a mudbath, capitalising on three mistakes by Ian Ure, the other a delicious lob. ", "Before the game, Arsenal – built around the attacking talents of George Eastham, Joe Baker and George Armstrong, had held faint hopes of sustaining a title challenge, but they'd been found out. ", "The result seemed to set both teams down very different roads. ", "Chelsea finished in fifth, three places ahead of out-of-puff Arsenal. ", "Docherty's side were instantly anointed as one of the teams of the decade. ", "Tambling scored in their victorious League Cup final against Leicester in 1965, and the 1967 FA Cup final defeat to Spurs. ", "And the club would round off the decade with their first FA Cup win in 1969-70. ", "Arsenal meanwhile ...\n\n3) Chelsea 0-0 Arsenal (February 1966)\n\nSince their elevation to the top flight in 1919, Arsenal surely haven't endured a more humiliating season than the one they suffered in 1965-66. ", "Losing 17 games along the way, they ended the season in 14th place, a mere four points ahead of relegated Northampton Town. ", "Northampton Town. ", "Further shamings included a 3-0 home thumping by Leeds United in front of 4,544 paying spectators, the lowest crowd since the war, and the fact that they spent the campaign running around in all-red shirts, having ditched their classic white sleeves in favour of modernity.", "\n\nBut perhaps the lowest point – if not statistically, then artistically – came after a goalless draw against Chelsea. ", "For a club of Arsenal's grandeur, steeped in classical values, taking an elegant kicking from one of the greatest sports journalists of all time ranks as low as it gets. \"", "Chelsea are of 1966,\" the Observer's John Arlott began. ", "Arsenal were \"still struggling to move out of the 1950s ... they callously garrotted the game for a point. ", "Chelsea played through their hand of the spare man, the overlapping full-back, the through-running half-back, the withdrawn centre-forward, and the forward chip ... time after time Chelsea slid the ball from defence to construction, only to end in a thicket of anti-football.\" ", "Ouch. ", "And all juxtaposed with the dash of local rivals; that it had come to this for the famous Arsenal. ", "But like a recovering alcoholic, at least they had bottomed out: the manager Billy Wright was sacked at the end of the campaign to be replaced by Bertie Mee, the white sleeves soon quietly reinstated.", "\n\n4) Arsenal 5-2 Chelsea (April 1979)\n\nDuring the 1970s, both teams flagged after spectacular starts to the decade. ", "Arsenal won the league and Cup Double in 1971, only to drift. ", "Chelsea followed up their 1970 FA Cup win with the Cup Winners' Cup a year later – at which point they decided to expand Stamford Bridge with a massive East Stand. ", "Up went the stand, and down went Chelsea, the new edifice swallowing up all of the club's cash, the signing of new players suddenly a pipe dream. ", "Eddie McCreadie, one of the stars of the 1960s, led Chelsea back up, with a team built around Butch \"Let's Not Forget Ray Was Known At This Time As Butch\" Wilkins. ", "But they were soon struggling again: boardroom rows meant McCreadie was replaced by another star of the previous decade, Ken Shellito, who in turn was soon supplanted by Danny Blanchflower.", "\n\nThe captain of Tottenham's 1961 Double winners soon found out that \"doing things in style\" and the pursuit of \"glory\" is much easier at a club who have John White rather than Trevor Aylott on the books. ", "In 1978-79, Chelsea won only five league games all season, the killer blow being landed with a spectacular flourish by Arsenal. ", "David O'Leary, Frank Stapleton (2), Alan Sunderland and David Price sent Chelsea down – \"in all but arithmetic fantasy,\" reported the Guardian – with the bedraggled west Londoners' only brief joy coming from terrace favourite Tommy Langley's thriker. ", "To compound Chelsea's misery, Arsenal finished the season by lifting the FA Cup.", "\n\n5) Arsenal 4-1 Chelsea (September 1990)\n\nOn the same weekend as this early-season result, reigning champions Liverpool walloped Manchester United 4-0 at Anfield, a Peter Beardsley hat-trick securing their fifth win in the first five league games. ", "Arsenal's equally impressive win over Chelsea went almost unnoticed by comparison, though it would have more resonance during the rest of the campaign.", "\n\nIt was a tight match, goalless until the 52nd minute, at which point Arsenal's new signing turned the game on its head. ", "Anders Limpar scored the first, and had a hand in another two of the three more goals Arsenal would score in a frantic 21-minute period. ", "A Chelsea side boasting Tony Dorigo, Andy Townsend and Kerry Dixon had no answer. ", "And neither, in the long run, did Liverpool, whose hat-trick hero Beardsley spent the rest of the season in and out of the team. ", "Limpar, though, had announced himself on the big stage – and there would be no more influential player all season as Arsenal romped to the title.", "\n\n6) Arsenal 0-5 Chelsea (November 1998)\n\nIn recent years, both clubs have had their fair share of spectacular away-days. ", "Arsenal's two 2-3 wins at Stamford Bridge towards the end of the 1990s take some beating: Nigel Winterburn's blistering last-minute bolt from the blue in September 1997; Kanu's outrageous shimmy and shake on the byline to complete a 15-minute comeback hat-trick in October 1999.", "\n\nChelsea fans meanwhile have recently enjoyed two emphatic results at the Emirates, taking four and three pieces of candy from Arsène's babies respectively in their last two visits. ", "And they may not like Wayne Bridge much now, but that palpably wasn't the case when the defender raked in a late winner at Highbury in the 2003-04 Champions League quarter finals.", "\n\nBut sometimes when there's a cigarette paper between all the results, the biggest just has to be the best. ", "Chelsea's 0-5 thumping of an Arsenal select XI in November 1998 wasn't Arsenal's heaviest home defeat – that was a 6-0 thrashing by Derby County in the first round of the 1899-1900 FA Cup – but nothing similar has been meted out in modern times. ", "OK, so Arsenal had only put out the reserves plus a recovering Dennis Bergkamp, but let the result do the talking, and let Chelsea take the crown here; Arsenal can console themselves with what happened in the 2002 FA Cup final, after all." ]
{ "pile_set_name": "OpenWebText2" }
[ 0.0072992700729927005, 0.011111111111111112, 0.005141388174807198, 0, 0.034482758620689655, 0, 0, 0.017241379310344827, 0.011904761904761904, 0.023166023166023165, 0, 0.009900990099009901, 0.012121212121212121, 0, 0.009433962264150943, 0.017857142857142856, 0.008264462809917356, 0, 0.010869565217391304, 0.017241379310344827, 0.028985507246376812, 0, 0.012269938650306749, 0.015463917525773196, 0, 0.014285714285714285, 0, 0.008130081300813009, 0, 0, 0.008064516129032258, 0.05555555555555555, 0.003663003663003663, 0.008403361344537815, 0.005847953216374269, 0.03571428571428571, 0, 0.007220216606498195, 0, 0.010101010101010102, 0.01, 0, 0, 0.012195121951219513, 0.00684931506849315, 0.012195121951219513, 0.015873015873015872, 0.014634146341463415, 0.015625, 0.027888446215139442, 0.0125, 0.012048192771084338, 0.006622516556291391, 0.00819672131147541, 0.014598540145985401, 0.04878048780487805, 0.007751937984496124, 0.006896551724137931, 0, 0.007194244604316547, 0.00546448087431694, 0.0111731843575419, 0, 0.008130081300813009, 0.008403361344537815 ]
0.010504
5
[ { "analysis_explanation": null, "end": 37, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 24 }, { "analysis_explanation": null, "end": 204, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 186 }, { "analysis_explanation": null, "end": 250, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 246 }, { "analysis_explanation": null, "end": 275, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 263 }, { "analysis_explanation": null, "end": 515, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 494 }, { "analysis_explanation": null, "end": 542, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 535 }, { "analysis_explanation": null, "end": 659, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 647 }, { "analysis_explanation": null, "end": 681, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 664 }, { "analysis_explanation": null, "end": 720, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 714 }, { "analysis_explanation": null, "end": 830, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 813 }, { "analysis_explanation": null, "end": 911, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 902 }, { "analysis_explanation": null, "end": 921, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 917 }, { "analysis_explanation": null, "end": 1056, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1051 }, { "analysis_explanation": null, "end": 1068, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1061 }, { "analysis_explanation": null, "end": 1256, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1249 }, { "analysis_explanation": null, "end": 1373, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1354 }, { "analysis_explanation": null, "end": 1391, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1384 }, { "analysis_explanation": null, "end": 1434, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1428 }, { "analysis_explanation": null, "end": 1491, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1487 }, { "analysis_explanation": null, "end": 1546, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1537 }, { "analysis_explanation": null, "end": 1761, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1752 }, { "analysis_explanation": null, "end": 1793, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1781 }, { "analysis_explanation": null, "end": 1990, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1986 }, { "analysis_explanation": null, "end": 2113, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2105 }, { "analysis_explanation": null, "end": 2161, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2155 }, { "analysis_explanation": null, "end": 2248, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2235 }, { "analysis_explanation": null, "end": 2375, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2361 }, { "analysis_explanation": null, "end": 2449, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2439 }, { "analysis_explanation": null, "end": 2521, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2514 }, { "analysis_explanation": null, "end": 2553, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2544 }, { "analysis_explanation": null, "end": 2618, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2611 }, { "analysis_explanation": null, "end": 2687, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2673 }, { "analysis_explanation": null, "end": 2750, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2741 }, { "analysis_explanation": null, "end": 2780, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2759 }, { "analysis_explanation": null, "end": 2874, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2861 }, { "analysis_explanation": null, "end": 2886, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2876 }, { "analysis_explanation": null, "end": 2902, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2888 }, { "analysis_explanation": null, "end": 2942, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2928 }, { "analysis_explanation": null, "end": 3159, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3152 }, { "analysis_explanation": null, "end": 3267, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3253 }, { "analysis_explanation": null, "end": 3278, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3269 }, { "analysis_explanation": null, "end": 3299, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3283 }, { "analysis_explanation": null, "end": 3523, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3515 }, { "analysis_explanation": null, "end": 3588, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3578 }, { "analysis_explanation": null, "end": 3660, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3651 }, { "analysis_explanation": null, "end": 3668, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3664 }, { "analysis_explanation": null, "end": 3752, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3742 }, { "analysis_explanation": null, "end": 3791, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3784 }, { "analysis_explanation": null, "end": 3853, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3840 }, { "analysis_explanation": null, "end": 3903, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3899 }, { "analysis_explanation": null, "end": 3999, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3992 }, { "analysis_explanation": null, "end": 4123, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4107 }, { "analysis_explanation": null, "end": 4141, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4125 }, { "analysis_explanation": null, "end": 4204, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4192 }, { "analysis_explanation": null, "end": 4713, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4706 }, { "analysis_explanation": null, "end": 4725, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4721 }, { "analysis_explanation": null, "end": 4754, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4743 }, { "analysis_explanation": null, "end": 4817, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4808 }, { "analysis_explanation": null, "end": 5340, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5328 }, { "analysis_explanation": null, "end": 5407, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5397 }, { "analysis_explanation": null, "end": 5486, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5476 }, { "analysis_explanation": null, "end": 5505, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5496 }, { "analysis_explanation": null, "end": 5564, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5554 }, { "analysis_explanation": null, "end": 5611, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5607 }, { "analysis_explanation": null, "end": 5658, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5654 }, { "analysis_explanation": null, "end": 5708, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5696 }, { "analysis_explanation": null, "end": 5953, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5938 }, { "analysis_explanation": null, "end": 5984, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5975 }, { "analysis_explanation": null, "end": 6037, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6032 }, { "analysis_explanation": null, "end": 6100, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6086 }, { "analysis_explanation": null, "end": 6169, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6160 }, { "analysis_explanation": null, "end": 6221, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6202 }, { "analysis_explanation": null, "end": 6235, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6223 }, { "analysis_explanation": null, "end": 6290, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6272 }, { "analysis_explanation": null, "end": 6323, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6319 }, { "analysis_explanation": null, "end": 6454, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6444 }, { "analysis_explanation": null, "end": 6480, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6467 }, { "analysis_explanation": null, "end": 6505, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6498 }, { "analysis_explanation": null, "end": 6552, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6542 }, { "analysis_explanation": null, "end": 6636, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6623 }, { "analysis_explanation": null, "end": 6653, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6638 }, { "analysis_explanation": null, "end": 6674, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6659 }, { "analysis_explanation": null, "end": 6690, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6679 }, { "analysis_explanation": null, "end": 6802, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6793 }, { "analysis_explanation": null, "end": 6864, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6849 }, { "analysis_explanation": null, "end": 6993, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6979 }, { "analysis_explanation": null, "end": 7015, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6999 }, { "analysis_explanation": null, "end": 7036, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7024 }, { "analysis_explanation": null, "end": 7073, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7064 }, { "analysis_explanation": null, "end": 7100, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7083 }, { "analysis_explanation": null, "end": 7134, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7119 }, { "analysis_explanation": null, "end": 7406, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7391 }, { "analysis_explanation": null, "end": 7487, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7474 }, { "analysis_explanation": null, "end": 7602, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7593 }, { "analysis_explanation": null, "end": 7646, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7635 }, { "analysis_explanation": null, "end": 7661, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7648 }, { "analysis_explanation": null, "end": 7677, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7666 }, { "analysis_explanation": null, "end": 7736, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7727 }, { "analysis_explanation": null, "end": 7768, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7759 }, { "analysis_explanation": null, "end": 7935, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7925 }, { "analysis_explanation": null, "end": 8005, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7992 }, { "analysis_explanation": null, "end": 8023, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8011 }, { "analysis_explanation": null, "end": 8086, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8077 }, { "analysis_explanation": null, "end": 8158, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8138 }, { "analysis_explanation": null, "end": 8196, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8178 }, { "analysis_explanation": null, "end": 8219, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8208 }, { "analysis_explanation": null, "end": 8256, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8242 }, { "analysis_explanation": null, "end": 8262, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8258 }, { "analysis_explanation": null, "end": 8330, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8321 }, { "analysis_explanation": null, "end": 8365, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8353 }, { "analysis_explanation": null, "end": 8448, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8440 }, { "analysis_explanation": null, "end": 8499, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8493 }, { "analysis_explanation": null, "end": 8719, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8687 }, { "analysis_explanation": null, "end": 8898, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8885 }, { "analysis_explanation": null, "end": 8979, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8967 }, { "analysis_explanation": null, "end": 9022, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9006 }, { "analysis_explanation": null, "end": 9159, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9144 }, { "analysis_explanation": null, "end": 9211, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9204 }, { "analysis_explanation": null, "end": 9294, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9290 } ]
[ "Presently, consumer mobile phones have displays, key pads, microprocessors all built into one connected unit. ", "Sometimes there are two modules of this one connected unit. ", "One module comprises a display, anther module comprises a keypad, a microprocessor, and a battery. ", "These two modules are hinged together so that they can be closed and opened in a clam shell configuration, or the display module can slide up and down relative to the keypad module to expose or conceal the keypad.", "\nThese current configurations of the mobile phones need the two modules to be physically connected together to function properly. ", "The two modules can not be taken apart, otherwise the mobile phone is broken and can not perform its normal functions properly such as taking and receiving phone calls.", "\nCertain functions can be better achieved, when one module is taken apart from another module. ", "Therefore, there is a need for an improved mobile phone that can be taken apart and still functions properly as a mobile phone, and one module of the mobile phone is used to remotely control another module of the mobile phone when they are detached from each other. ", "There is also a need for an improved mobile phone that can be used more flexibly." ]
{ "pile_set_name": "USPTO Backgrounds" }
[ 0, 0, 0, 0, 0, 0, 0, 0, 0 ]
0
5
[]
[ "Last year Up In Snow really disappointed me.", "\nMany of the shots had been in other movies, and the soundtrack was just meh.", "\nI avoided buying it this year because of it.", "\nThey may have stepped it up for Cant Stop." ]
{ "pile_set_name": "Pile-CC" }
[ 0, 0, 0, 0 ]
0
5
[ { "analysis_explanation": null, "end": 9, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 0 }, { "analysis_explanation": null, "end": 151, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 142 } ]
[ "Q:\n\ncrash with OAuthTwitterController delegate\n\nI get a EXC_BAD_ACCESS when this delegate function is called : \n OAuthTwitterController: (SA_OAuthTwitterController *) controller authenticatedWithUsername\n\nany ideas ?", "\nmy class looks like this :\n@interface QuizzResultController: UIViewController <NSXMLParserDelegate,SA_OAuthTwitterControllerDelegate> {\n\nIBOutlet UILabel *resultLabel;\n\nIBOutlet UIButton *facebookButton;\nIBOutlet UIButton *twitterButton;\nIBOutlet UIButton *button3;\n// .... other variables ...//\n\nSA_OAuthTwitterEngine *_engine;\nSA_OAuthTwitterController *controller;\n\n}\n\n/// .m\n\n#pragma mark SA_OAuthTwitterControllerDelegate\n\n- (void) OAuthTwitterController: (SA_OAuthTwitterController *) controller authenticatedWithUsername: (NSString *) username{\n\n NSLog(\"@auth done with username : %@\",username);\n\n}\n\n- (void) OAuthTwitterControllerFailed: (SA_OAuthTwitterController *) controller{\n\n}\n\n - (void) OAuthTwitterControllerCanceled: (SA_OAuthTwitterController *) controller{\n\n}\n\nthe crash happens before the NSLog of username, with \"objc_msgSend\" in Thread 1\n\nA:\n\nYour log statement is incorrect, should be:\nNSLog(@\"auth done with username : %@\",username);\n\n" ]
{ "pile_set_name": "StackExchange" }
[ 0, 0.004153686396677051 ]
0.002077
5
[ { "analysis_explanation": null, "end": 37, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15 }, { "analysis_explanation": null, "end": 136, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 114 }, { "analysis_explanation": null, "end": 482, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 475 }, { "analysis_explanation": null, "end": 1035, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1030 } ]
[ "Homologous synthesis: a method for the preparation of mixed substrates and individual compounds.", "\nEquimolar mixtures of several homologous or vinylogous alkyl methanesulfonates (mesylates) are converted, by a series of reactions, into equimolar mixtures of compounds having one methylene group more, per molecule, than the starting material. ", "Such mixtures can be used for studying the specificity of an enzymatic reaction in a single experiment in vivo or in vitro. ", "The simultaneous synthesis of a mixture of compounds is also of great advantage in the preparation of a series of radioactively labelled substances. ", "It is more convenient and much more efficient to prepare several labelled compounds of a homologous or vinylogous series in a single reaction, and to isolate each of them by chromatographic methods, than to synthesize the individual substances separately." ]
{ "pile_set_name": "PubMed Abstracts" }
[ 0, 0, 0, 0, 0 ]
0
5
[]
[ "2013 Birthday Honours (New Zealand)\n\nThe 2013 Queen's Birthday Honours in New Zealand, celebrating the official birthday of Queen Elizabeth II, were appointments made by the Queen in her right as Queen of New Zealand, on the advice of the New Zealand government, to various orders and honours to reward and highlight good works by New Zealanders. ", "They were announced on 3 June 2013.", "\n\nThe recipients of honours are displayed here as they were styled before their new honour.", "\n\nOrder of New Zealand\n Emeritus Professor Albert Wendt – of Auckland. ", "For services to New Zealand.", "\n\nNew Zealand Order of Merit\n\nDame Companion (DNZM)\n Ngāneko Kaihau Minhinnick – of Waiuku. ", "For services to Māori and conservation.", "\n\nKnight Companion (KNZM)\n The Honourable Justice Robert Stanley Chambers – of Auckland. ", "For services to the judiciary. ", "Posthumous award: royal assent had been given to the appointment before Chambers' death, and his knighthood took effect from 20 May 2013.", "\n John Stratton Davies – of Queenstown. ", "For services to business and tourism.", "\n Dr The Right Honourable Alexander Lockwood Smith – of London, United Kingdom. ", "For services as a member of Parliament and as speaker of the House of Representatives.", "\n Gordon Frederick Tietjens – of Tauranga. ", "For services to rugby.", "\n\nCompanion (CNZM)\n The Honourable Christopher John Allan – of Auckland. ", "For services to the judiciary.", "\n Peter Ronald Francis Biggs – of Melbourne, Australia. ", "For services to arts governance and philanthropy.", "\n William Bernard Boyd – of Auckland. ", "For services to Rotary International.", "\n Craig Leonard Heatley – of Auckland. ", "For services to business.", "\n Dr Murray James Horn – of New Plymouth. ", "For services to business and health.", "\n Hamish Henry Cordy Keith – of Auckland. ", "For services to the arts.", "\n John Klaricich – of Omapere. ", "For services to Māori and the community.", "\n Ian Duncan McKinnon – of Wellington. ", "For services to education and the community.", "\n Kevin John Roberts – of Auckland. ", "For services to business and the community.", "\n Deirdre Elizabeth Anne Tarrant – of Wellington. ", "For services to contemporary dance.", "\n Bryan George Williams – of Auckland. ", "For services to rugby.", "\n\nOfficer (ONZM)\n John Adshead – of Tauranga. ", "For services to football.", "\n Ross Albert Keithton Bragg – of Auckland. ", "For services to swimming.", "\n Emeritus Professor John Frederick Burrows – of Christchurch. ", "For services to law and education.", "\n Professor John Charles Butcher – of Auckland. ", "For services to mathematics.", "\n Graham Coe – of Pukekohe. ", "For services to the construction industry.", "\n Dr Douglas Charles Edmeades – of Hamilton. ", "For services to agriculture.", "\n Dr Nigel Thomas Evans – of Auckland. ", "For services to education and the steel industry.", "\n Neil Lindsay Graham – of Christchurch. ", "For services to business and philanthropy.", "\n Adrienne Gail Greenwood – of Auckland. ", "For services to sailing.", "\n David Andrew Irving – of Auckland. ", "For services to business and education.", "\n Alban Gifford Jackson – of Auckland. ", "For services to design.", "\n Ulric Vaughan Leon Jones – of Hamilton. ", "For services to the farming industry.", "\n Penelope Susan Mason – of Waipukurau. ", "For services to the Red Cross.", "\n Dr Wanda Lee Mathias – of Auckland. ", "For services to health and business.", "\n Dr Stephen Paul McCormack – of Christchurch. ", "For services to community health.", "\n Graeme Roderick Milne – of Cambridge. ", "For services to health and the dairy industry.", "\n Associate Professor David Perez – of Dunedin. ", "For services to oncology.", "\n Dr John Oliver Crompton Phillips – of Wellington. ", "For services to historical research and publishing.", "\n Dawn Jane Sanders – of Wellington. ", "For services to theatre.", "\n Professor Piri John Sciascia – of Porirua. ", "For services to Māori arts.", "\n John Bruce Tavendale – of Ashburton. ", "For services to agribusiness.", "\n Norman John Thompson – of Auckland. ", "For services to business and tourism.", "\n John Culyer Wigglesworth – of Auckland. ", "For services to art, waterskiing and the community.", "\n\nMember (MNZM)\n Garth Barfoot – of Auckland. ", "For services to business, sport and the community.", "\n Julie Bartlett – of Auckland. ", "For services to people with disabilities.", "\n Patricia Marion Barwick – of Christchurch. ", "For services to sport.", "\n Donald Bogie – of Christchurch. ", "For services to Land Search and Rescue.", "\n Dr Robert Ellison Brockie – of Waikanae. ", "For services to science and cartooning.", "\n Warwick Miles Brown – of Auckland. ", "For services to the arts.", "\n Professor Carl David Burgess – of Wellington. ", "For services to pharmacology.", "\n Geoffrey Edward Burgess – of Auckland. ", "For services to education.", "\n Joseph Gordon Butterfield – of Timaru. ", "For services to health and the transport industry.", "\n Dr Carolyn Ann Coggan – of Auckland. ", "For services to health.", "\n Glenn Michael James Common – of Nelson. ", "For services to the music industry.", "\n Ross Philip Dallow – of Auckland. ", "For services to the community.", "\n Jennifer Gael Donoghue – of Palmerston North. ", "For services to the pharmaceutical profession.", "\n Sergeant Dene Duthie – of Auckland. ", "For services to the New Zealand Police and Search and Rescue.", "\n Robert Mingi Elliott – of Te Awamutu. ", "For services to Māori and mental health services.", "\n Eric John Faesenkloet – of Auckland. ", "For services to business, golf and the community.", "\n Dr Kaiwan Gan – of Christchurch. ", "For services to education and New Zealand–China relations.", "\n Captain Craig Fraser Harris – of Auckland. ", "For services to the cruise industry.", "\n Zhiyun He – of Auckland. ", "For services to film and the Chinese community.", "\n Elizabeth Clare Kerr – of Waikanae. ", "For services to music.", "\n David Rutherford Kershaw – of Martinborough. ", "For services to business and the community.", "\n Susan Margaret Matthews – of Te Puke. ", "For services to health.", "\n Hugh Morton McCarroll – of Whangamata. ", "For services to shearing sports and agriculture.", "\n Cameron Wylie McGregor – of Auckland. ", "For services to rugby league.", "\n Helen Medlyn – of Auckland. ", "For services to the performing arts.", "\n Graeme Albert Nind – of Timaru. ", "For services to the community.", "\n William Neil Plimmer – of Wellington. ", "For services to the arts.", "\n Craig Potton – of Nelson. ", "For services to photography and conservation.", "\n Corinne Pritchard – of Auckland. ", "For services to hockey.", "\n Peter Barton Rainey – of Nelson. ", "For services to the music industry.", "\n Samantha Jane Scott – of Auckland. ", "For services to theatre.", "\n Dr Mansoor Shafi – of Wellington. ", "For services to wireless communication technologies.", "\n Senior Constable Philip MacDonald Simmonds – of Christchurch. ", "For services to the New Zealand Police and Search and Rescue.", "\n Morvin Te Anatipa Simon – of Whanganui. ", "For services to Māori.", "\n Vivian Joyce Smith – of Mount Maunganui. ", "For services to chess.", "\n Senior Sergeant Gordon John Spite – of Christchurch. ", "For services to the New Zealand Police and the community.", "\n Dr Simon Robert Stables – of Auckland. ", "For services to disaster victim identification.", "\n John Hector Steffens – of Te Anau. ", "For services to the fishing industry.", "\n Darryl Maurice Stevens – of Wellington. ", "For services to youth and the Commonwealth.", "\n Debra Marie Stewart – of Rotorua. ", "For services to bird of prey conservation.", "\n Phillip James Sunderland – of Palmerston North. ", "For services to health and education.", "\n Darrin Arthur Sykes – of Wellington. ", "For services to touch rugby administration.", "\n Garry Frederick Trinder – of Wellington. ", "For services to dance.", "\n Basil John Wakelin – of Wellington. ", "For services to engineering education.", "\n David Thomas Wardell – of Auckland. ", "For services to education.", "\n\nHonorary\n His Excellency Sheikh Abdul Raouf Abu Zinadah – of Jeddah, Kingdom of Saudi Arabia. ", "For services to New Zealand–Saudi Arabia relations.", "\n His Excellency Dr Hamed Abdullah Nasser Al-Riyami – of Muscat, Sultanate of Oman. ", "For services to New Zealand–Oman relations.", "\n Naoya Kakizoe – of Tokyo, Japan. ", "For services to New Zealand–Japan relations.", "\n Antonio Volta – of Barcelona, Spain. ", "For services to New Zealand–Spain relations.", "\n\nCompanion of the Queen's Service Order (QSO)\n Christopher Hugh Blake – of Wellington. ", "For services to the State.", "\n Judge John Russell Callander – of Auckland. ", "For services to the judiciary.", "\n Alice Te Awa Hudson – of Auckland. ", "For services to Māori and the community.", "\n Judge Graeme Roderick Joyce – of Auckland. ", "For services to the judiciary.", "\n John Walter McKinnon – of Wellington. ", "For services to the State.", "\n John Stewart Ombler – of Wellington. ", "For services to the State.", "\n\nQueen's Service Medal (QSM)\n Ailsa Merle Aiken – of Whanganui. ", "For services to the community.", "\n Mihi Lydia Angell – of Auckland. ", "For services to Māori and the community.", "\n Kathleen Elizabeth Barnett – of Nelson. ", "For services to music.", "\n Eric Andrew Batten – of Wellington. ", "For services to the community.", "\n Marlene Caroline Batten – of Wellington. ", "For services to the community.", "\n Muhammud Zayd Ian Blissett – of Blenheim. ", "For services to the community.", "\n Astrid Christine Brocklehurst – of Bluff. ", "For services to the community.", "\n David James Broughton – of Christchurch. ", "For services to the community.", "\n Tui Eileen Brown – of Christchurch. ", "For services to senior citizens and the community.", "\n Marie Eda Burgess – of Gisborne. ", "For services to nursing and the community.", "\n Ronald Talbert Cain – of Dunedin. ", "For services to athletics.", "\n Phillip Lawrence Campbell – of Rotorua. ", "For services to sport and journalism.", "\n Robert John Campbell – of Fairlie. ", "For services to pipe bands and the community.", "\n Barbara Anne Clarke – of Gisborne. ", "For services to health, business and the community.", "\n Charles Alexander Fitzgerald Ransfield Cooke – of Mangawhai. ", "For services to the Royal New Zealand Returned and Services' Association.", "\n Philip Richard Cross – of Kaitaia. ", "For services to the community.", "\n Sharon Faye Davies – of Auckland. ", "For services to the community.", "\n Phroso Dometakis-Bell – of Wellington. ", "For services to the community.", "\n Albert George Duckmanton – of Christchurch. ", "For services to sport.", "\n Brian Joseph Edwards – of Auckland. ", "For services to the New Zealand Fire Service.", "\n Jean Stewart Gould – of Christchurch. ", "For services to sport and the community.", "\n James Andrew Hassall – of Putaruru. ", "For services to the community.", "\n Neil Joseph Hatcher – of Hastings. ", "For services to the community.", "\n Maurice Desmond Hayes – of Auckland. ", "For services to philanthropy and aviation.", "\n Beverly Winifred Hayman – of Tauranga. ", "For services to the community.", "\n Karen Jane Howard – of Te Awamutu. ", "For services to girl guiding.", "\n Trevor Hapi Howse – of Christchurch. ", "For services to Māori and conservation.", "\n Lance Gregory Hutchison – of Auckland. ", "For services to the community.", "\n Kevin Graeme Kalff – of Napier. ", "For services to the New Zealand Police and the community.", "\n Lillian Winifred Kershaw – of Hamilton. ", "For services to music.", "\n Perry Gray Keyte – of Tauranga. ", "For services to the community.", "\n Margaret Caroline King – of Auckland. ", "For services to the community.", "\n John Motunau Katene Kopa – of Hamilton. ", "For services to Māori.", "\n Roger Ewen Laloli – of Auckland. ", "For services to the community.", "\n Francis Ian Levien – of Papakura. ", "For services to brass bands.", "\n Chakara Lim – of Auckland. ", "For services to the Cambodian community.", "\n Sue Peng Lim – of Auckland. ", "For services to health and the Asian community.", "\n Janet Maree Lucas – of Wellington. ", "For services to education.", "\n Alister Fitzgerald Macalister – of Wellington. ", "For services to the blind.", "\n Robert Houston Mayo – of Wellington. ", "For services to the community.", "\n John Ronald McDermott – of Dunedin. ", "For services as a reporter.", "\n Helen Margaret McKay – of Tuatapere. ", "For services to the community.", "\n Ross McKinnon – of Lower Hutt. ", "For services to the community.", "\n Ian Colin McLaren – of Wellington. ", "For services to foster care.", "\n Raewyn Beryl McLaren – of Wellington. ", "For services to foster care.", "\n Barry Fairbairn McLean – of Gisborne. ", "For services to surf life saving.", "\n Stephanie Alison McMillan – of Whangarei. ", "For services to the community.", "\n Dr Christopher John Milne – of Hamilton. ", "For services to sports medicine.", "\n Mary Clare Mouat – of Christchurch. ", "For services to mental health.", "\n James Arthur Newman – of Orewa. ", "For services to veterans and business.", "\n Delphine Anne Parker – of Sanson. ", "For services to the community.", "\n Lynette Kaye Parker – of Queenstown. ", "For services to tourism and children's health.", "\n Heather Ngaire Paterson – of Gore. ", "For services to fashion.", "\n John Robertson Patterson – of Christchurch. ", "For services to senior citizens.", "\n Brian Leslie Poole – of Wellington. ", "For services to health and the community.", "\n Lynette Te Manawa Adrienne Roa – of Reefton. ", "For services to the community.", "\n Ani Kanara Rolfe – of Rotorua. ", "For services to senior citizens and the community.", "\n Kathleen Scott – of Palmerston North. ", "For services to people with diabetes.", "\n Titikura Kipo Irimana Simon – of Whanganui. ", "For services to Māori.", "\n Manmohan Singh – of Auckland. ", "For services to the Indian community.", "\n Barbara Dorothy Smith – of Hamilton. ", "For services to music.", "\n Robert Leslie Thomas – of Levin. ", "For services to the community.", "\n Susanne Margaret Thorp – of New Plymouth. ", "For services to equestrian sport.", "\n George Walter Ward – of Ashburton. ", "For services to agriculture and the community.", "\n Barbara Emilene Watene – of Lower Hutt. ", "For services to foster care.", "\n Jean Allan Newsham West – of Auckland. ", "For services to the community.", "\n Peter John Wheeler – of Auckland. ", "For services to Air Force veterans.", "\n Joan Catherine Whelan – of Whanganui. ", "For services to music.", "\n Jane Elizabeth Shield Wilson – of Dunedin. ", "For services to the community.", "\n Jean Wilson – of Blenheim. ", "For services to senior citizens and the community.", "\n Rodney James Wise – of Hamilton. ", "For services to the community.", "\n David John Withers – of Wairoa. ", "For services to Land Search and Rescue and the community.", "\n Eva Rita Wright – of Dannevirke. ", "For services to the community.", "\n\nHonorary\n Herbert Ingham Jones – of Eketahuna. ", "For services to conservation and music.", "\n Sione Tupukauvalu Liava'a – of Auckland. ", "For services to the Tongan community.", "\n Hans-Heinrich Meyer – of Bad Fallingbostel, Germany. ", "For services to New Zealand–Germany relations.", "\n\nNew Zealand Antarctic Medal (NZAM)\n Professor Thomas George Alan Green – of Hamilton. ", "For services to Antarctic science.", "\n Baden Nolan Norris – of Christchurch. ", "For services to Antarctic history and conservation.", "\n\nNew Zealand Distinguished Service Decoration (DSD)\n Warrant Officer James Ernist Harper – of Auckland. ", "For services to the New Zealand Defence Force.", "\n Lieutenant Colonel Robin Michael Hoult – of Christchurch. ", "For services to the New Zealand Defence Force.", "\n Lieutenant Colonel Stefan John Michie – of Canberra, Australia. ", "For services to the New Zealand Defence Force.", "\n Sergeant Lindsay Norriss – of Blenheim. ", "For services to the New Zealand Defence Force.", "\n Major Brent John Quin – of Upper Hutt. ", "For services to the New Zealand Defence Force.", "\n Petty Officer Scott Matthew Treleaven – of Auckland. ", "For services to the New Zealand Defence Force.", "\n\nReferences\n\nCategory:Birthday Honours\nCategory:2013 awards\nCategory:2013 in New Zealand\nCategory:New Zealand awards" ]
{ "pile_set_name": "Wikipedia (en)" }
[ 0.002881844380403458, 0, 0, 0.013888888888888888, 0, 0.010752688172043012, 0, 0.011111111111111112, 0, 0.0072992700729927005, 0, 0, 0.0125, 0.023255813953488372, 0.06818181818181818, 0, 0.0136986301369863, 0, 0.017857142857142856, 0, 0.02564102564102564, 0.02702702702702703, 0.02564102564102564, 0, 0, 0, 0.023255813953488372, 0, 0.03125, 0.025, 0.025, 0, 0.027777777777777776, 0, 0.0196078431372549, 0, 0.025, 0, 0.02127659574468085, 0, 0.022727272727272728, 0, 0.03125, 0, 0.020833333333333332, 0, 0, 0, 0.044444444444444446, 0, 0.02564102564102564, 0, 0.04878048780487805, 0, 0.024390243902439025, 0, 0.02702702702702703, 0, 0.02564102564102564, 0, 0.023809523809523808, 0, 0.025, 0.03333333333333333, 0.02631578947368421, 0, 0.0425531914893617, 0, 0.025, 0, 0.041666666666666664, 0, 0.019230769230769232, 0, 0, 0, 0.044444444444444446, 0, 0.02564102564102564, 0, 0.02631578947368421, 0, 0.023809523809523808, 0, 0, 0, 0.03125, 0, 0.022222222222222223, 0, 0.058823529411764705, 0.02564102564102564, 0.023255813953488372, 0, 0.02702702702702703, 0, 0.020833333333333332, 0, 0.024390243902439025, 0, 0.04878048780487805, 0, 0.02564102564102564, 0, 0.047619047619047616, 0, 0.02702702702702703, 0, 0, 0, 0.02631578947368421, 0.03278688524590164, 0.05, 0, 0.02564102564102564, 0, 0.05714285714285714, 0, 0.022222222222222223, 0, 0, 0, 0.02631578947368421, 0, 0.020833333333333332, 0, 0.05, 0, 0.04878048780487805, 0, 0.025, 0, 0.03333333333333333, 0, 0.05714285714285714, 0, 0.025, 0, 0.07142857142857142, 0, 0.02857142857142857, 0, 0.05714285714285714, 0, 0.02702702702702703, 0, 0.027777777777777776, 0, 0.015625, 0.03278688524590164, 0.047619047619047616, 0, 0.023255813953488372, 0, 0.03636363636363636, 0.017543859649122806, 0.024390243902439025, 0, 0.05405405405405406, 0, 0.023809523809523808, 0.023255813953488372, 0.05555555555555555, 0, 0, 0, 0.025, 0, 0.023255813953488372, 0, 0.02631578947368421, 0, 0.02631578947368421, 0, 0.010416666666666666, 0, 0.011904761904761904, 0, 0, 0, 0.02564102564102564, 0, 0.022727272727272728, 0.038461538461538464, 0.021739130434782608, 0, 0.02702702702702703, 0.025, 0.043478260869565216, 0, 0.025, 0.038461538461538464, 0.02564102564102564, 0.038461538461538464, 0.03076923076923077, 0, 0, 0.025, 0.047619047619047616, 0, 0.02631578947368421, 0, 0, 0, 0.022222222222222223, 0, 0.045454545454545456, 0, 0.046511627906976744, 0, 0.02631578947368421, 0, 0.02857142857142857, 0, 0.05555555555555555, 0, 0.047619047619047616, 0, 0.02702702702702703, 0, 0.05405405405405406, 0, 0.015625, 0.0136986301369863, 0, 0, 0, 0, 0, 0, 0.043478260869565216, 0, 0.02631578947368421, 0.022222222222222223, 0.05, 0, 0.02631578947368421, 0, 0.07894736842105263, 0, 0.02564102564102564, 0, 0.024390243902439025, 0, 0.05405405405405406, 0, 0.02564102564102564, 0, 0, 0, 0.058823529411764705, 0.017543859649122806, 0.047619047619047616, 0, 0.058823529411764705, 0, 0, 0, 0.07142857142857142, 0, 0.027777777777777776, 0, 0.05555555555555555, 0, 0.034482758620689655, 0, 0.03333333333333333, 0, 0, 0, 0, 0, 0.05128205128205128, 0, 0.05263157894736842, 0, 0.02564102564102564, 0, 0.030303030303030304, 0, 0.02631578947368421, 0, 0.025, 0, 0.05, 0, 0.022222222222222223, 0, 0.046511627906976744, 0, 0.05263157894736842, 0, 0.02857142857142857, 0, 0.05405405405405406, 0, 0.02564102564102564, 0, 0.02702702702702703, 0, 0.043478260869565216, 0, 0.02631578947368421, 0, 0.02127659574468085, 0, 0.030303030303030304, 0, 0.025, 0, 0.021739130434782608, 0, 0, 0, 0.05128205128205128, 0, 0.05714285714285714, 0, 0.022727272727272728, 0, 0.05263157894736842, 0, 0.023809523809523808, 0, 0.024390243902439025, 0, 0.027777777777777776, 0.02857142857142857, 0.05, 0, 0.044444444444444446, 0, 0.034482758620689655, 0, 0.05714285714285714, 0, 0.02857142857142857, 0.017543859649122806, 0.05555555555555555, 0, 0.04081632653061224, 0, 0, 0.02702702702702703, 0.03636363636363636, 0, 0.022727272727272728, 0, 0.024390243902439025, 0.0196078431372549, 0.009523809523809525, 0.021739130434782608, 0.03333333333333333, 0.021739130434782608, 0.015151515151515152, 0.021739130434782608, 0.023809523809523808, 0.021739130434782608, 0.024390243902439025, 0.021739130434782608, 0.01818181818181818, 0.021739130434782608, 0.008547008547008548 ]
0.016476
5
[ { "analysis_explanation": null, "end": 4, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 0 }, { "analysis_explanation": null, "end": 34, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 23 }, { "analysis_explanation": null, "end": 45, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 41 }, { "analysis_explanation": null, "end": 85, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 74 }, { "analysis_explanation": null, "end": 142, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 130 }, { "analysis_explanation": null, "end": 201, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 196 }, { "analysis_explanation": null, "end": 216, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 205 }, { "analysis_explanation": null, "end": 250, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 239 }, { "analysis_explanation": null, "end": 345, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 331 }, { "analysis_explanation": null, "end": 381, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 370 }, { "analysis_explanation": null, "end": 526, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 514 }, { "analysis_explanation": null, "end": 541, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 533 }, { "analysis_explanation": null, "end": 570, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 559 }, { "analysis_explanation": null, "end": 620, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 616 }, { "analysis_explanation": null, "end": 648, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 623 }, { "analysis_explanation": null, "end": 661, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 655 }, { "analysis_explanation": null, "end": 684, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 679 }, { "analysis_explanation": null, "end": 774, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 751 }, { "analysis_explanation": null, "end": 789, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 781 }, { "analysis_explanation": null, "end": 958, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 947 }, { "analysis_explanation": null, "end": 980, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 960 }, { "analysis_explanation": null, "end": 997, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 987 }, { "analysis_explanation": null, "end": 1085, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1061 }, { "analysis_explanation": null, "end": 1097, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1091 }, { "analysis_explanation": null, "end": 1113, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1099 }, { "analysis_explanation": null, "end": 1227, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1202 }, { "analysis_explanation": null, "end": 1242, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1234 }, { "analysis_explanation": null, "end": 1322, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1300 }, { "analysis_explanation": null, "end": 1336, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1328 }, { "analysis_explanation": null, "end": 1395, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1369 }, { "analysis_explanation": null, "end": 1410, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1401 }, { "analysis_explanation": null, "end": 1421, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1412 }, { "analysis_explanation": null, "end": 1493, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1473 }, { "analysis_explanation": null, "end": 1508, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1500 }, { "analysis_explanation": null, "end": 1569, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1548 }, { "analysis_explanation": null, "end": 1583, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1575 }, { "analysis_explanation": null, "end": 1631, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1614 }, { "analysis_explanation": null, "end": 1649, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1637 }, { "analysis_explanation": null, "end": 1712, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1688 }, { "analysis_explanation": null, "end": 1727, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1719 }, { "analysis_explanation": null, "end": 1769, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1755 }, { "analysis_explanation": null, "end": 1806, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1801 }, { "analysis_explanation": null, "end": 1845, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1826 }, { "analysis_explanation": null, "end": 1862, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1852 }, { "analysis_explanation": null, "end": 1927, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1909 }, { "analysis_explanation": null, "end": 1941, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1933 }, { "analysis_explanation": null, "end": 1994, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1987 }, { "analysis_explanation": null, "end": 2017, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1995 }, { "analysis_explanation": null, "end": 2034, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2024 }, { "analysis_explanation": null, "end": 2093, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2072 }, { "analysis_explanation": null, "end": 2108, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2100 }, { "analysis_explanation": null, "end": 2161, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2149 }, { "analysis_explanation": null, "end": 2176, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2168 }, { "analysis_explanation": null, "end": 2215, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2204 }, { "analysis_explanation": null, "end": 2230, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2216 }, { "analysis_explanation": null, "end": 2244, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2236 }, { "analysis_explanation": null, "end": 2313, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2291 }, { "analysis_explanation": null, "end": 2332, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2320 }, { "analysis_explanation": null, "end": 2399, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2379 }, { "analysis_explanation": null, "end": 2413, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2405 }, { "analysis_explanation": null, "end": 2454, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2444 }, { "analysis_explanation": null, "end": 2540, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2516 }, { "analysis_explanation": null, "end": 2554, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2546 }, { "analysis_explanation": null, "end": 2606, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2588 }, { "analysis_explanation": null, "end": 2620, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2612 }, { "analysis_explanation": null, "end": 2691, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2672 }, { "analysis_explanation": null, "end": 2709, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2697 }, { "analysis_explanation": null, "end": 2777, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2754 }, { "analysis_explanation": null, "end": 2791, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2783 }, { "analysis_explanation": null, "end": 2837, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2818 }, { "analysis_explanation": null, "end": 2851, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2843 }, { "analysis_explanation": null, "end": 2914, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2893 }, { "analysis_explanation": null, "end": 2928, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2920 }, { "analysis_explanation": null, "end": 2978, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2954 }, { "analysis_explanation": null, "end": 2992, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2984 }, { "analysis_explanation": null, "end": 3052, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3041 }, { "analysis_explanation": null, "end": 3121, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3104 }, { "analysis_explanation": null, "end": 3135, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3127 }, { "analysis_explanation": null, "end": 3199, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3177 }, { "analysis_explanation": null, "end": 3217, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3205 }, { "analysis_explanation": null, "end": 3274, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3253 }, { "analysis_explanation": null, "end": 3289, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3280 }, { "analysis_explanation": null, "end": 3369, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3358 }, { "analysis_explanation": null, "end": 3382, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3375 }, { "analysis_explanation": null, "end": 3442, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3413 }, { "analysis_explanation": null, "end": 3458, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3448 }, { "analysis_explanation": null, "end": 3529, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3517 }, { "analysis_explanation": null, "end": 3546, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3536 }, { "analysis_explanation": null, "end": 3601, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3583 }, { "analysis_explanation": null, "end": 3637, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3632 }, { "analysis_explanation": null, "end": 3664, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3644 }, { "analysis_explanation": null, "end": 3679, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3670 }, { "analysis_explanation": null, "end": 3731, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3711 }, { "analysis_explanation": null, "end": 3745, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3737 }, { "analysis_explanation": null, "end": 3809, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3785 }, { "analysis_explanation": null, "end": 3823, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3815 }, { "analysis_explanation": null, "end": 3905, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3892 }, { "analysis_explanation": null, "end": 3919, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3911 }, { "analysis_explanation": null, "end": 3986, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3972 }, { "analysis_explanation": null, "end": 4000, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3992 }, { "analysis_explanation": null, "end": 4067, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4044 }, { "analysis_explanation": null, "end": 4085, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4073 }, { "analysis_explanation": null, "end": 4122, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4110 }, { "analysis_explanation": null, "end": 4140, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4128 }, { "analysis_explanation": null, "end": 4199, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4185 }, { "analysis_explanation": null, "end": 4207, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4200 }, { "analysis_explanation": null, "end": 4282, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4263 }, { "analysis_explanation": null, "end": 4296, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4288 }, { "analysis_explanation": null, "end": 4352, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4334 }, { "analysis_explanation": null, "end": 4368, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4358 }, { "analysis_explanation": null, "end": 4423, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4400 }, { "analysis_explanation": null, "end": 4437, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4429 }, { "analysis_explanation": null, "end": 4491, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4466 }, { "analysis_explanation": null, "end": 4577, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4559 }, { "analysis_explanation": null, "end": 4591, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4583 }, { "analysis_explanation": null, "end": 4643, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4617 }, { "analysis_explanation": null, "end": 4655, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4649 }, { "analysis_explanation": null, "end": 4711, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4693 }, { "analysis_explanation": null, "end": 4726, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4718 }, { "analysis_explanation": null, "end": 4781, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4759 }, { "analysis_explanation": null, "end": 4803, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4787 }, { "analysis_explanation": null, "end": 4872, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4861 }, { "analysis_explanation": null, "end": 4886, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4878 }, { "analysis_explanation": null, "end": 4970, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4950 }, { "analysis_explanation": null, "end": 5009, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5004 }, { "analysis_explanation": null, "end": 5059, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5038 }, { "analysis_explanation": null, "end": 5073, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5065 }, { "analysis_explanation": null, "end": 5138, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5128 }, { "analysis_explanation": null, "end": 5156, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5144 }, { "analysis_explanation": null, "end": 5199, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5188 }, { "analysis_explanation": null, "end": 5205, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5200 }, { "analysis_explanation": null, "end": 5244, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5225 }, { "analysis_explanation": null, "end": 5258, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5250 }, { "analysis_explanation": null, "end": 5303, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5297 }, { "analysis_explanation": null, "end": 5320, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5312 }, { "analysis_explanation": null, "end": 5358, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5351 }, { "analysis_explanation": null, "end": 5390, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5370 }, { "analysis_explanation": null, "end": 5453, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5429 }, { "analysis_explanation": null, "end": 5473, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5460 }, { "analysis_explanation": null, "end": 5542, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5519 }, { "analysis_explanation": null, "end": 5602, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5581 }, { "analysis_explanation": null, "end": 5691, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5669 }, { "analysis_explanation": null, "end": 5705, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5697 }, { "analysis_explanation": null, "end": 5749, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5737 }, { "analysis_explanation": null, "end": 5763, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5755 }, { "analysis_explanation": null, "end": 5820, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5802 }, { "analysis_explanation": null, "end": 5886, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5866 }, { "analysis_explanation": null, "end": 5902, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5892 }, { "analysis_explanation": null, "end": 5942, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5930 }, { "analysis_explanation": null, "end": 5954, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5948 }, { "analysis_explanation": null, "end": 6019, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6002 }, { "analysis_explanation": null, "end": 6033, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6025 }, { "analysis_explanation": null, "end": 6078, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6059 }, { "analysis_explanation": null, "end": 6090, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6084 }, { "analysis_explanation": null, "end": 6147, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6128 }, { "analysis_explanation": null, "end": 6161, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6153 }, { "analysis_explanation": null, "end": 6204, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6191 }, { "analysis_explanation": null, "end": 6220, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6210 }, { "analysis_explanation": null, "end": 6308, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6292 }, { "analysis_explanation": null, "end": 6335, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6323 }, { "analysis_explanation": null, "end": 6422, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6399 }, { "analysis_explanation": null, "end": 6437, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6428 }, { "analysis_explanation": null, "end": 6460, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6455 }, { "analysis_explanation": null, "end": 6480, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6462 }, { "analysis_explanation": null, "end": 6501, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6486 }, { "analysis_explanation": null, "end": 6553, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6542 }, { "analysis_explanation": null, "end": 6577, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6565 }, { "analysis_explanation": null, "end": 6660, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6640 }, { "analysis_explanation": null, "end": 6674, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6666 }, { "analysis_explanation": null, "end": 6744, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6724 }, { "analysis_explanation": null, "end": 6757, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6750 }, { "analysis_explanation": null, "end": 6819, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6797 }, { "analysis_explanation": null, "end": 6835, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6825 }, { "analysis_explanation": null, "end": 6900, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6881 }, { "analysis_explanation": null, "end": 6913, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6906 }, { "analysis_explanation": null, "end": 6982, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6958 }, { "analysis_explanation": null, "end": 7004, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6988 }, { "analysis_explanation": null, "end": 7063, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7044 }, { "analysis_explanation": null, "end": 7080, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7070 }, { "analysis_explanation": null, "end": 7149, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7126 }, { "analysis_explanation": null, "end": 7165, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7155 }, { "analysis_explanation": null, "end": 7208, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7190 }, { "analysis_explanation": null, "end": 7224, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7214 }, { "analysis_explanation": null, "end": 7285, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7265 }, { "analysis_explanation": null, "end": 7299, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7291 }, { "analysis_explanation": null, "end": 7371, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7360 }, { "analysis_explanation": null, "end": 7383, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7372 }, { "analysis_explanation": null, "end": 7395, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7389 }, { "analysis_explanation": null, "end": 7404, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7397 }, { "analysis_explanation": null, "end": 7449, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7438 }, { "analysis_explanation": null, "end": 7462, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7450 }, { "analysis_explanation": null, "end": 7523, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7492 }, { "analysis_explanation": null, "end": 7535, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7529 }, { "analysis_explanation": null, "end": 7546, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7537 }, { "analysis_explanation": null, "end": 7554, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7550 }, { "analysis_explanation": null, "end": 7583, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7572 }, { "analysis_explanation": null, "end": 7588, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7584 }, { "analysis_explanation": null, "end": 7613, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7600 }, { "analysis_explanation": null, "end": 7624, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7619 }, { "analysis_explanation": null, "end": 7631, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7626 }, { "analysis_explanation": null, "end": 7660, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7649 }, { "analysis_explanation": null, "end": 7666, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7661 }, { "analysis_explanation": null, "end": 7691, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7678 }, { "analysis_explanation": null, "end": 7706, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7697 }, { "analysis_explanation": null, "end": 7713, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7708 }, { "analysis_explanation": null, "end": 7742, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7731 }, { "analysis_explanation": null, "end": 7748, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7743 }, { "analysis_explanation": null, "end": 7828, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7806 }, { "analysis_explanation": null, "end": 7844, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7834 }, { "analysis_explanation": null, "end": 7901, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7879 }, { "analysis_explanation": null, "end": 7915, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7907 }, { "analysis_explanation": null, "end": 7967, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7948 }, { "analysis_explanation": null, "end": 7981, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7973 }, { "analysis_explanation": null, "end": 8004, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7999 }, { "analysis_explanation": null, "end": 8051, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8030 }, { "analysis_explanation": null, "end": 8066, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8058 }, { "analysis_explanation": null, "end": 8119, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8099 }, { "analysis_explanation": null, "end": 8135, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8125 }, { "analysis_explanation": null, "end": 8183, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8164 }, { "analysis_explanation": null, "end": 8199, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8189 }, { "analysis_explanation": null, "end": 8274, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8257 }, { "analysis_explanation": null, "end": 8289, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8280 }, { "analysis_explanation": null, "end": 8339, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8322 }, { "analysis_explanation": null, "end": 8353, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8345 }, { "analysis_explanation": null, "end": 8376, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8371 }, { "analysis_explanation": null, "end": 8422, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8396 }, { "analysis_explanation": null, "end": 8434, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8428 }, { "analysis_explanation": null, "end": 8477, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8459 }, { "analysis_explanation": null, "end": 8493, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8483 }, { "analysis_explanation": null, "end": 8549, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8526 }, { "analysis_explanation": null, "end": 8565, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8555 }, { "analysis_explanation": null, "end": 8606, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8598 }, { "analysis_explanation": null, "end": 8624, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8612 }, { "analysis_explanation": null, "end": 8639, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8631 }, { "analysis_explanation": null, "end": 8701, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8672 }, { "analysis_explanation": null, "end": 8712, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8707 }, { "analysis_explanation": null, "end": 8766, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8745 }, { "analysis_explanation": null, "end": 8784, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8772 }, { "analysis_explanation": null, "end": 8833, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8817 }, { "analysis_explanation": null, "end": 8851, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8839 }, { "analysis_explanation": null, "end": 8921, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8904 }, { "analysis_explanation": null, "end": 8935, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8927 }, { "analysis_explanation": null, "end": 8999, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8980 }, { "analysis_explanation": null, "end": 9012, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9005 }, { "analysis_explanation": null, "end": 9066, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9041 }, { "analysis_explanation": null, "end": 9079, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9072 }, { "analysis_explanation": null, "end": 9139, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9119 }, { "analysis_explanation": null, "end": 9219, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9200 }, { "analysis_explanation": null, "end": 9233, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9225 }, { "analysis_explanation": null, "end": 9315, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9287 }, { "analysis_explanation": null, "end": 9331, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9316 }, { "analysis_explanation": null, "end": 9347, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9338 }, { "analysis_explanation": null, "end": 9456, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9449 }, { "analysis_explanation": null, "end": 9507, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9489 }, { "analysis_explanation": null, "end": 9521, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9513 }, { "analysis_explanation": null, "end": 9575, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9554 }, { "analysis_explanation": null, "end": 9592, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9582 }, { "analysis_explanation": null, "end": 9649, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9625 }, { "analysis_explanation": null, "end": 9667, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9655 }, { "analysis_explanation": null, "end": 9712, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9692 }, { "analysis_explanation": null, "end": 9726, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9718 }, { "analysis_explanation": null, "end": 9792, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9774 }, { "analysis_explanation": null, "end": 9810, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9798 }, { "analysis_explanation": null, "end": 9873, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9853 }, { "analysis_explanation": null, "end": 9939, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9920 }, { "analysis_explanation": null, "end": 9954, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9946 }, { "analysis_explanation": null, "end": 10008, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9987 }, { "analysis_explanation": null, "end": 10022, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10014 }, { "analysis_explanation": null, "end": 10090, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10067 }, { "analysis_explanation": null, "end": 10104, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10096 }, { "analysis_explanation": null, "end": 10154, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10137 }, { "analysis_explanation": null, "end": 10213, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10202 }, { "analysis_explanation": null, "end": 10237, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10225 }, { "analysis_explanation": null, "end": 10260, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10255 }, { "analysis_explanation": null, "end": 10302, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10279 }, { "analysis_explanation": null, "end": 10317, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10309 }, { "analysis_explanation": null, "end": 10368, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10350 }, { "analysis_explanation": null, "end": 10464, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10440 }, { "analysis_explanation": null, "end": 10478, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10470 }, { "analysis_explanation": null, "end": 10519, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10503 }, { "analysis_explanation": null, "end": 10533, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10525 }, { "analysis_explanation": null, "end": 10588, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10566 }, { "analysis_explanation": null, "end": 10602, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10594 }, { "analysis_explanation": null, "end": 10659, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10635 }, { "analysis_explanation": null, "end": 10673, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10665 }, { "analysis_explanation": null, "end": 10696, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10691 }, { "analysis_explanation": null, "end": 10715, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10698 }, { "analysis_explanation": null, "end": 10730, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10722 }, { "analysis_explanation": null, "end": 10781, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10763 }, { "analysis_explanation": null, "end": 10795, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10787 }, { "analysis_explanation": null, "end": 10837, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10826 }, { "analysis_explanation": null, "end": 10851, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10843 }, { "analysis_explanation": null, "end": 10882, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10873 }, { "analysis_explanation": null, "end": 10906, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10894 }, { "analysis_explanation": null, "end": 10920, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10912 }, { "analysis_explanation": null, "end": 10958, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10953 }, { "analysis_explanation": null, "end": 10987, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10970 }, { "analysis_explanation": null, "end": 11003, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10993 }, { "analysis_explanation": null, "end": 11061, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11032 }, { "analysis_explanation": null, "end": 11077, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11067 }, { "analysis_explanation": null, "end": 11120, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11106 }, { "analysis_explanation": null, "end": 11141, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11131 }, { "analysis_explanation": null, "end": 11195, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11174 }, { "analysis_explanation": null, "end": 11208, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11201 }, { "analysis_explanation": null, "end": 11258, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11238 }, { "analysis_explanation": null, "end": 11273, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11264 }, { "analysis_explanation": null, "end": 11319, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11306 }, { "analysis_explanation": null, "end": 11335, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11325 }, { "analysis_explanation": null, "end": 11385, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11368 }, { "analysis_explanation": null, "end": 11402, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11392 }, { "analysis_explanation": null, "end": 11453, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11433 }, { "analysis_explanation": null, "end": 11469, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11459 }, { "analysis_explanation": null, "end": 11522, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11500 }, { "analysis_explanation": null, "end": 11536, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11528 }, { "analysis_explanation": null, "end": 11597, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11572 }, { "analysis_explanation": null, "end": 11613, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11604 }, { "analysis_explanation": null, "end": 11671, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11649 }, { "analysis_explanation": null, "end": 11685, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11677 }, { "analysis_explanation": null, "end": 11736, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11720 }, { "analysis_explanation": null, "end": 11754, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11742 }, { "analysis_explanation": null, "end": 11806, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11787 }, { "analysis_explanation": null, "end": 11818, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11813 }, { "analysis_explanation": null, "end": 11879, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11859 }, { "analysis_explanation": null, "end": 11892, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11886 }, { "analysis_explanation": null, "end": 11944, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11925 }, { "analysis_explanation": null, "end": 11960, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11950 }, { "analysis_explanation": null, "end": 12032, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12009 }, { "analysis_explanation": null, "end": 12042, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12038 }, { "analysis_explanation": null, "end": 12093, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12069 }, { "analysis_explanation": null, "end": 12111, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12099 }, { "analysis_explanation": null, "end": 12164, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12146 }, { "analysis_explanation": null, "end": 12180, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12170 }, { "analysis_explanation": null, "end": 12234, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12224 }, { "analysis_explanation": null, "end": 12254, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12242 }, { "analysis_explanation": null, "end": 12316, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12300 }, { "analysis_explanation": null, "end": 12329, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12322 }, { "analysis_explanation": null, "end": 12396, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12382 }, { "analysis_explanation": null, "end": 12418, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12402 }, { "analysis_explanation": null, "end": 12485, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12458 }, { "analysis_explanation": null, "end": 12500, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12491 }, { "analysis_explanation": null, "end": 12523, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12518 }, { "analysis_explanation": null, "end": 12539, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12525 }, { "analysis_explanation": null, "end": 12553, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12545 }, { "analysis_explanation": null, "end": 12581, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12575 }, { "analysis_explanation": null, "end": 12614, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12593 }, { "analysis_explanation": null, "end": 12628, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12620 }, { "analysis_explanation": null, "end": 12673, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12653 }, { "analysis_explanation": null, "end": 12684, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12679 }, { "analysis_explanation": null, "end": 12739, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12717 }, { "analysis_explanation": null, "end": 12757, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12745 }, { "analysis_explanation": null, "end": 12811, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12793 }, { "analysis_explanation": null, "end": 12827, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12818 }, { "analysis_explanation": null, "end": 12898, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12876 }, { "analysis_explanation": null, "end": 12914, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12904 }, { "analysis_explanation": null, "end": 12968, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12945 }, { "analysis_explanation": null, "end": 12982, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12974 }, { "analysis_explanation": null, "end": 13033, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13015 }, { "analysis_explanation": null, "end": 13047, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13039 }, { "analysis_explanation": null, "end": 13106, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13085 }, { "analysis_explanation": null, "end": 13121, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13112 }, { "analysis_explanation": null, "end": 13174, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13146 }, { "analysis_explanation": null, "end": 13187, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13180 }, { "analysis_explanation": null, "end": 13231, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13220 }, { "analysis_explanation": null, "end": 13245, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13237 }, { "analysis_explanation": null, "end": 13315, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13298 }, { "analysis_explanation": null, "end": 13329, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13321 }, { "analysis_explanation": null, "end": 13380, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13362 }, { "analysis_explanation": null, "end": 13393, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13387 }, { "analysis_explanation": null, "end": 13468, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13453 }, { "analysis_explanation": null, "end": 13485, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13475 }, { "analysis_explanation": null, "end": 13548, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13528 }, { "analysis_explanation": null, "end": 13644, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13636 }, { "analysis_explanation": null, "end": 13672, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13666 }, { "analysis_explanation": null, "end": 13703, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13684 }, { "analysis_explanation": null, "end": 13735, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13728 }, { "analysis_explanation": null, "end": 13764, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13753 }, { "analysis_explanation": null, "end": 13772, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13765 }, { "analysis_explanation": null, "end": 13811, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13784 }, { "analysis_explanation": null, "end": 13854, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13830 }, { "analysis_explanation": null, "end": 13868, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13860 }, { "analysis_explanation": null, "end": 13895, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13886 }, { "analysis_explanation": null, "end": 13923, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13905 }, { "analysis_explanation": null, "end": 13942, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13930 }, { "analysis_explanation": null, "end": 13969, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13960 }, { "analysis_explanation": null, "end": 14083, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14064 }, { "analysis_explanation": null, "end": 14097, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14089 }, { "analysis_explanation": null, "end": 14184, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14165 }, { "analysis_explanation": null, "end": 14202, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14190 }, { "analysis_explanation": null, "end": 14288, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14270 }, { "analysis_explanation": null, "end": 14302, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14294 }, { "analysis_explanation": null, "end": 14313, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14304 }, { "analysis_explanation": null, "end": 14386, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14371 }, { "analysis_explanation": null, "end": 14400, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14392 }, { "analysis_explanation": null, "end": 14470, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14455 }, { "analysis_explanation": null, "end": 14486, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14476 }, { "analysis_explanation": null, "end": 14572, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14549 }, { "analysis_explanation": null, "end": 14586, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14578 }, { "analysis_explanation": null, "end": 14722, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14711 }, { "analysis_explanation": null, "end": 14743, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14732 } ]
[ "|\n\nCypresswood Drive Widening\n\nCypresswood Drive Widening\n\nThis project includes the construction of two westbound lanes with a 32-foot median to complete a full boulevard roadway section. ", "Gunda Corporation’s scope includes roadway horizontal and vertical geometrics, traffic control, utility conflict resolution, storm sewer hydrology and hydraulic design, signing and pavement marking layouts, widening of the existing bridge over Harris County Flood Control District Channel No. ", "K159-00-00 and concrete slope stabilization of the channel under the bridge. ", "The project is approximately 2,000 feet in length." ]
{ "pile_set_name": "Pile-CC" }
[ 0, 0.006825938566552901, 0.012987012987012988, 0 ]
0.004953
5
[ { "analysis_explanation": null, "end": 492, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 482 }, { "analysis_explanation": null, "end": 486, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 482 } ]
[ "Cerebral histiocytic lymphoma presenting with loss of weight.", "\nAn adult man presented with loss of weight and this progressed over several months before the appearance of signs of neurologic disease. ", "Autopsy showed histiocytic lymphoma with extensive meningeal spread and dense infiltration of the hypothalamus. ", "This diencephalic syndrome has been reported with cerebral tumor, leukemia, encephalitis lethargica, multiple sclerosis, and Alzheimer disease, CT of the brain and examination of the CSF may be helpful in diagnosis." ]
{ "pile_set_name": "PubMed Abstracts" }
[ 0, 0, 0, 0.004651162790697674 ]
0.001163
5
[ { "analysis_explanation": null, "end": 144, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 130 } ]
[ "Q:\n\nios charts - Looking for a way to make custom intervals on the y-axis - swift\n\nI'm looking for a way to set custom intervals on the y-axis in ios charts. ", "So, instead of the precalculated interval of 100, I'm looking for a way to change the step to 60.", "\nInstead of this:\n\nI'm looking for this:\n\nA:\n\nI solved my own problem by using a YAxisRenderer. ", "I set up a custom YAxisRenderer and changed the computeAxisValues function to suit my own needs. ", "Here is my code:\nimport Charts\n\nclass TimelineYAxisRender: YAxisRenderer{\n /// Sets up the axis values. ", "Computes the desired number of labels between the two given extremes.", "\n @objc open override func computeAxisValues(min: Double, max: Double)\n {\n super.computeAxisValues(min: min, max: max)\n\n guard let axis = self.axis else { return }\n\n let labelCount = axis.labelCount\n let range = max - min\n\n // Ensure stops contains at least n elements.", "\n axis.entries.removeAll(keepingCapacity: true)\n axis.entries.reserveCapacity(labelCount)\n\n let lowestHour = Int((min/60).rounded(.down))\n let highestHour = Int((max/60).rounded(.up))\n\n let rangeHour = highestHour - lowestHour\n\n switch range {\n case 160..<600:\n for i in 0...2 * rangeHour{\n axis.entries.append(Double(i) * 30 + Double(lowestHour * 60))\n }\n case 50..<160:\n for i in 0...4 * rangeHour{\n axis.entries.append(Double(i) * 15 + Double(lowestHour * 60))\n }\n case 15..<50:\n for i in 0...12 * rangeHour{\n axis.entries.append(Double(i) * 5 + Double(lowestHour * 60))\n }\n case 0..<15:\n for i in 0...60 * rangeHour{\n axis.entries.append(Double(i) + Double(lowestHour * 60))\n }\n default:\n for i in 0...8{\n axis.entries.append(Double(i) * 180)\n }\n }\n\n }\n}\n\nMy code to set the left y-axis to the new YAxisRenderer:\nlet transformer = barChart.getTransformer(forAxis:.left)\nlet viewPortHandler = barChart.leftYAxisRenderer.viewPortHandler\nbarChart.leftYAxisRenderer = TimelineYAxisRender(viewPortHandler: viewPortHandler, yAxis: barChart.leftAxis, transformer: transformer)\n\nI used a rounding system so I would only load the labels for the part of the graph the user can see, as loading every label would take up too much memory and cause the simulator to stutter. ", "I also used the max - min to determine what labels to load to create a smooth zoom. ", "When the new labels are loaded can be changed by changing the parameters for the switch cases, and the amount of zoom can be changed by changing what is actually appended to axis.entries.", "\n\n" ]
{ "pile_set_name": "StackExchange" }
[ 0, 0, 0, 0, 0.009615384615384616, 0, 0.01935483870967742, 0.001951854261548471, 0, 0, 0 ]
0.002811
5
[ { "analysis_explanation": null, "end": 627, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 622 }, { "analysis_explanation": null, "end": 681, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 678 }, { "analysis_explanation": null, "end": 742, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 739 }, { "analysis_explanation": null, "end": 747, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 744 }, { "analysis_explanation": null, "end": 714, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 705 }, { "analysis_explanation": null, "end": 782, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 775 }, { "analysis_explanation": null, "end": 834, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 827 }, { "analysis_explanation": null, "end": 943, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 928 }, { "analysis_explanation": null, "end": 997, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 982 }, { "analysis_explanation": null, "end": 2037, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 2026 }, { "analysis_explanation": null, "end": 2116, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 2087 } ]
[ "In a disclosure published Feb 15, 2019, Apple has reinforced its commitment to ensuring the minerals it uses for manufacturing is free of armed conflict as well as environmental and social risks.", "\n\nThe report, submitted to the SEC, is meant to represent Apple’s attempt to ethically mine minerals such as Cobalt. ", "Notably, the company suggested an integration of blockchain technology in the mineral supply chain process to improve transparency and quell human rights abuse concerns.", "\n\nObtaining Conflict-Free Cobalt\n\nApple and other tech companies recently came under increased international scrutiny when a Fortune report published Aug 23, 2018, revealed that two-thirds of the world’s cobalt is mined in the Democratic Republic of Congo (DRC) under inhumane conditions. ", "While the company had already taken measures towards identifying offending parties, it continued to work with suppliers from the DRC.", "\n\nIn its report, Apple said that its strict supplier standards ensure that it only obtains minerals that do not directly or indirectly financially contribute to armed conflicts and human rights violations. ", "To that end, it stopped working with five smelters and refiners that were not willing to cooperate with audits or failed to meet Apple’s standards on responsible sourcing. ", "The company also said that it is willing to go beyond the minimum set requirements and internationally accepted due diligence standards in order to protect people at various stages in the supply chain.", "\n\nApple also funded a state-approved program to train young individuals for non-mining related jobs. ", "Fortune reported that around 100 teenagers were being taught a host of money-making vocational skills, including carpentry, catering, and phone repair.", "\n\nBlockchain to the Rescue?", "\n\nGiven that Apple, and a number of other technology companies, are members of the Responsible Business Alliance’s Responsible Minerals Initiative (RMI), they each have an obligation to respond to alleged human rights violations and maintain a clean track record. ", "To achieve this goal, the consortium agreed on the use of blockchain technology to track all steps of the supply chain process.", "\n\nRMI’s Blockchain Guidelines were first published in March of 2018 and included specific directions on the integration of distributed ledger technology within the supply chain process. ", "In its report, Apple said that it contributed significantly to these guidelines, suggesting that it is a key participant.", "\n\nNotably, however, Apple did not include any specifics on how it will be using blockchain technology to increase accountability and ensure a 100 percent conflict-free supply chain. ", "Concerns, however, on the viability and transparency of a blockchain solution continue to persist, given that supply chain-related blockchains can be easily manipulated. ", "For manual control and input to be eradicated, Apple will have to ensure dedicated logging hardware and internet connectivity at mines, both of which are relatively hard to come by in the DRC.", "\n\nDo you think blockchain can help alleviate concerns surrounding the Cobalt supply chain? ", "Let us know your thoughts in the comments below!" ]
{ "pile_set_name": "OpenWebText2" }
[ 0.005128205128205128, 0.02564102564102564, 0, 0, 0, 0.0048543689320388345, 0.005813953488372093, 0, 0.009900990099009901, 0, 0.037037037037037035, 0.011363636363636364, 0, 0.010752688172043012, 0.008264462809917356, 0.005494505494505495, 0, 0.005208333333333333, 0.01098901098901099, 0 ]
0.007022
5
[ { "analysis_explanation": null, "end": 38, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 26 }, { "analysis_explanation": null, "end": 641, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 629 }, { "analysis_explanation": null, "end": 734, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 702 }, { "analysis_explanation": null, "end": 739, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 736 }, { "analysis_explanation": null, "end": 900, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 897 }, { "analysis_explanation": null, "end": 2212, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2199 }, { "analysis_explanation": null, "end": 2994, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2991 } ]
[ "Modelling a tree data structure on postgres and using GraphQL to add and get data from the tree.", "\n\nWhen are tree data structures used ?", "\n\nRecursive or Tree Data Structures are commonly used to model your schema to store data that has a hierarchy.", "\n\nCommon use-cases of tree data structures include:\n\nStoring a directory structure for an application like Google Drive where you would have a root directory. ", "Within this root directory you may have other directories or files. ", "Every directory at any level of nesting can have any number of files or directories inside it.", "\n\nComment threads for blogs or forums where each post or topic can have comments and each comment can in turn have comments (or replies).", "\n\nFinding common connections or friends for a networking application like LinkedIn or Facebook.", "\n\nIn this blog post we are going to take a look at how you can model your database to build a comment thread feature for your application. ", "Moreover, we will also be using GraphQL to add and delete comments.", "\n\nLet’s take an example of a very simple blog and work on enabling comments for each post. ", "To elaborate on what we need\n\nEvery post can have comments\n\nEvery comment can have replies (child comments)\n\nWe want to list these comments in an ordered fashion sorted by when they were created.", "\n\nWe are going to go with Hasura GraphQL engine as it provides a Postgres database with instant GraphQL queries.", "\n\nGetting started\n\nWe will use the Hasura GraphQL engine for instantly getting GraphQL APIs over Postgres. ", "Click on the button below to deploy the GraphQL engine to Heroku’s free tier.", "\n\nClick this button to deploy the GraphQL engine to Heroku\n\nThis will deploy the graphql-engine to Heroku. ", "You might need to create a Heroku account if you don’t have one. ", "The graphql-engine will be running at https://your-app.herokuapp.com (replace your-app with your heroku app name).", "\n\nAPI Console\n\nEvery Hasura cluster comes with an API Console that you can use to build the backend for your application.", "\n\nThe API Console is available at https://your-app.herokuapp.com /console\n\nCreating a table\n\nHead to the Data tab and click on Create Table to create a new table\n\nLet’s call our table post_comments to store the comments for each post. ", "The table will have the following columns\n\nid Integer(auto increment) Primary Key\n\nInteger(auto increment) Primary Key parent_id Integer Nullable\n\nInteger Nullable comment Text\n\nText created_at Timestamp default now()\n\nTimestamp default now() post_id Integer\n\nInteger user_id Integer\n\nHit the create button to create the table.", "\n\nThis is the table where we will store all the comments for each of the blog posts.", "\n\nCreating a self reference\n\nNext, let’s define a foreign key constraint on the parent_id column to the id column.", "\n\nTo do this, head to the Modify tab and click on the Edit button next to parent_id . ", "Check the Foreign Key checkbox, select post_comments as the reference table and id as the reference column.", "\n\nNext, click on the Relationship tab and click on the Add button under the Suggested Array Relationship column. ", "Name the relationship children_comments\n\nHit Save to add this relationship.", "\n\nThe mutation to insert a comment will be\n\nmutation add_comment { insert_post_comments(objects: $objects) { returning{ id parent_id comment created_at user_id post_id } } }\n\nThe $objects variable will be\n\n{ \"objects\": [ { \"user_id\": 1, \"post_id\": 1, \"comment\": \"First comment on post 1\", \"parent_id\": null } ] }\n\nSimilarly, the $objects variable to add a reply to a comment\n\n{ \"objects\": [ { \"user_id\": 1, \"post_id\": 1, \"comment\": \"First comment on post 1\", \"parent_id\": 1 //Or id of the comment to which this comment is a reply to } ] }\n\nIf we are aware of the level of nesting in our comments, then the GraphQL query to fetch comments and all children comments for a post would be\n\nquery get_comments_for_post { post_comments( where: { post_id: 1 parent_id: null } order_by: [\"+created_at\"] ) { id parent_id comment created_at user_id post_id children_comments ( order_by: [\"+created_at\"] ){ id parent_id comment created_at user_id post_id } } }\n\nHere, we are fetching all the comments for a post with an id value of 1 and whose parent_id is null . ", "We are then fetching all the replies ( children_comments ) as a relationship. ", "The +created_at in the order_by field denotes that the comments should be fetched in the ascending order (based on the value of created_at ). ", "Alternatively, - would denote descending. ", "If no symbol is specified in the query, then + is assumed by default.", "\n\nSimilarly, in case you had another level of nesting, the query would be\n\nquery get_comments_for_post { post_comments( where: { post_id: 2 parent_id: null } order_by: [\"+created_at\"] ) { id parent_id comment created_at user_id post_id children_comments ( order_by: [\"+created_at\"] ){ id parent_id comment created_at user_id post_id children_comments( order_by: [\"+created_at\"] ) { id parent_id comment created_at user_id post_id } } } }\n\nWorking with unknown levels of nesting\n\nSites like https://news.ycombinator.com/ allow any level of nesting. ", "Which means that every comment can have one more child comments. ", "In this case, fetching our comment like we did above does not work since we do not know how many levels we need to fetch.", "\n\nOne of the ways of handling this is to fetch the complete list of comments for the particular topic (in this case a blog post) and then arrange it in memory on your client.", "\n\nquery get_comments_for_post { post_comments( where: { post_id: 1 } order_by: [\"created_at\"] ) { id parent_id comment created_at user_id post_id } }\n\nYou could also have another table that keeps a track of ancestry, something like post_comment_ancestry\n\ncomment_id\n\nancestor_id\n\nHere, for each comment you will store a list of all of its ancestors. ", "For eg: if comment A has two child comments B and C and comment C has a child comment D ,\n\nA | - B | - C | - D\n\nthe entry in the post_comment_ancestry table would be\n\n+------------------------+ |comment_id | ancestor_id| +------------------------+ | B | A | | C | A | | D | C | | D | A | +------------------------+\n\nAs you can see, comment D has two entries for A and C respectively. ", "Using this table you can fetch a list of all child comments to any arbitrary amount of nesting for a particular comment.", "\n\nConclusion\n\nIn this blog post we took a look at one of the ways in which we can work with tree data structures on Postgres.", "\n\nIf you would like to see any other use-cases or suggest improvements to the ideas mentioned above, let me know in the comments.", "\n\nHasura gives you instant realtime GraphQL APIs over any Postgres database without having to write any backend code.", "\n\nFor those of you who are new to the Hasura GraphQL engine, this is a good place to get started." ]
{ "pile_set_name": "OpenWebText2" }
[ 0, 0, 0, 0, 0, 0, 0, 0.010526315789473684, 0, 0, 0, 0, 0.008928571428571428, 0.018691588785046728, 0.012987012987012988, 0.018691588785046728, 0.015384615384615385, 0.008771929824561403, 0.008264462809917356, 0.00851063829787234, 0.0030581039755351682, 0, 0, 0.011627906976744186, 0, 0, 0, 0.0009505703422053232, 0, 0.014084507042253521, 0, 0, 0.0018248175182481751, 0, 0, 0, 0, 0, 0, 0.008, 0, 0, 0.010309278350515464 ]
0.003735
5
[ { "analysis_explanation": null, "end": 1633, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1627 }, { "analysis_explanation": null, "end": 1680, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1674 }, { "analysis_explanation": null, "end": 1715, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1709 }, { "analysis_explanation": null, "end": 2351, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2322 }, { "analysis_explanation": null, "end": 6517, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6511 }, { "analysis_explanation": null, "end": 6575, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6567 }, { "analysis_explanation": null, "end": 1815, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.6, "start": 1785 }, { "analysis_explanation": null, "end": 2044, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.6, "start": 2014 }, { "analysis_explanation": null, "end": 5017, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.6, "start": 4988 } ]
[ "Scientists In New York Are Trying To Edit The DNA In Human Sperm\n\nNPR got exclusive access to the only lab known to be trying to edit the DNA in human sperm, which raises all the same thorny issues as modifying genes in human embryos\n\nAUDIE CORNISH, HOST:\n\nCRISPR is a powerful gene-editing technique scientists use to modify genes. ", "NPR has learned that a group of scientists in New York is using it in a new way. ", "They're trying to edit genes in human sperm, and the changes they make could be passed down for generations. ", "NPR health correspondent Rob Stein recently got exclusive access to the lab conducting this controversial experiment. ", "He joins us now in the studio.", "\n\nWelcome back, Rob.", "\n\nROB STEIN, BYLINE: Hey, Audie.", "\n\nCORNISH: This isn't the first time scientists have tried to make changes in human DNA in a way that could be inherited. ", "Haven't they done this kind of thing before with human embryos, though?", "\n\nSTEIN: Yeah, that's right. ", "Scientists have used CRISPR to edit the DNA in human embryos. ", "In fact, you might remember there was a Chinese scientist who announced last year that he'd created the world's first genetically modified babies using embryos that he had edited in his lab and was widely condemned around the world as irresponsible and unethical. ", "And the big reason is is that no one knows if it's safe to do that sort of thing.", "\n\nCORNISH: So why are researchers trying to edit DNA now using human sperm?", "\n\nSTEIN: Well, one reason is that it could be safer than editing DNA in human embryos. ", "One of the big safety concerns about editing human embryos is that you might only end up editing some and not all of the cells in any babies you try to make from an edited embryo. ", "But if you start with sperm, at least theoretically, you can be more confident that all the cells of any resulting baby would have the changes that you're trying to make.", "\n\nCORNISH: Can we go back to the issue of safety, though - right? - ", "and the controversy around using CRISPR to edit genes? ", "What are some of the other concerns that people have?", "\n\nSTEIN: Yeah. ", "Yeah, there's a lot more concerns other than just safety. ", "And, you know, the - one of the big concerns is that, you know, if you make any changes in DNA in babies that could be passed down for generations, somebody someday could try to use the same technology to make, you know, so-called designer babies, where parents pick and choose the traits of their children. ", "And that raises all kinds of sort of scary sci-fi scenarios about genetic haves and genetic have-nots.", "\n\nCORNISH: And scientists still see this as worth doing. ", "What are their hopes for the technology?", "\n\nSTEIN: Yeah, so this group of scientists in New York, they're doing this really for two reasons. ", "One is to possibly find new ways to prevent male infertility by, you know, understanding more about how sperm works and the genetics of sperm. ", "The other one is to try to fix genetic mutations that cause diseases that men pass down to their children. ", "Here's Gianpiero Palermo. ", "He runs the Weill Cornell Medicine lab in New York City, where this experiment is being conducted.", "\n\nGIANPIERO PALERMO: Somebody has a certain genetic abnormality carried in their genome. ", "This can be removed so make sure that the offspring will be void from these abnormalities. ", "Theoretically, in principle, that would be a major, major benefit to society.", "\n\nCORNISH: You actually went to the lab to see this research in action. ", "Can you tell us what it was like?", "\n\nSTEIN: Yeah, it was really fascinating. ", "So what they're trying to do, as I said, is used CRISPR to edit the DNA in human sperm. ", "And the hard thing about sperm is that the DNA is packed really tightly in the head of each sperm cell. ", "So what they're doing is they're literally zapping the sperm with a jolt of electricity to loosen up the DNA to try to get the CRISPR gene-editing tool in there. ", "Let's listen to a little moment that occurred when I was with June Wang. ", "She's a lab technician in the lab in New York.", "\n\nJUNE WANG: I am now taking the sample into the pipette.", "\n\nSTEIN: That's the sperm and the CRISPR together.", "\n\nWANG: Now it's going into the machine.", "\n\nSTEIN: So the CRISPR and the sperm are in this zapping machine.", "\n\nWANG: Here. ", "I'm going to click start. ", "It's very quick.", "\n\nSTEIN: So that's it. ", "It just did it.", "\n\nWANG: Yup.", "\n\nSTEIN: Now, it's important to emphasize that these scientists haven't figured out a way to make it work yet, and, you know, they may never. ", "It could turn out to be technically just too difficult, but they're going to keep trying to see if they can possibly make it work.", "\n\nCORNISH: That's NPR health correspondent Rob Stein.", "\n\nThanks for explaining it.", "\n\nSTEIN: Oh, sure thing.", "\n\n(SOUNDBITE OF SOCCER MOMMY SONG, \"INSIDE OUT\")\n\nCopyright © 2019 NPR. ", "All rights reserved. ", "Visit our website terms of use and permissions pages at www.npr.org for further information.", "\n\nNPR transcripts are created on a rush deadline by Verb8tm, Inc., an NPR contractor, and produced using a proprietary transcription process developed with NPR. ", "This text may not be in its final form and may be updated or revised in the future. ", "Accuracy and availability may vary. ", "The authoritative record of NPR’s programming is the audio record." ]
{ "pile_set_name": "OpenWebText2" }
[ 0.006006006006006006, 0.012345679012345678, 0, 0.01694915254237288, 0, 0.05, 0.03125, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.038461538461538464, 0.01020408163265306, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.03773584905660377, 0, 0, 0, 0, 0.010869565217391304, 0.024844720496894408, 0, 0, 0.015151515151515152 ]
0.003966
5
[ { "analysis_explanation": null, "end": 387, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 379 }, { "analysis_explanation": null, "end": 557, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 548 }, { "analysis_explanation": null, "end": 689, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 686 }, { "analysis_explanation": null, "end": 700, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 691 }, { "analysis_explanation": null, "end": 1050, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1043 }, { "analysis_explanation": null, "end": 1084, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1075 }, { "analysis_explanation": null, "end": 2664, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2656 }, { "analysis_explanation": null, "end": 2983, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2966 }, { "analysis_explanation": null, "end": 3040, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3027 }, { "analysis_explanation": null, "end": 3909, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3900 }, { "analysis_explanation": null, "end": 3956, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3948 }, { "analysis_explanation": null, "end": 4590, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4581 }, { "analysis_explanation": null, "end": 4705, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4701 }, { "analysis_explanation": null, "end": 4799, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.85, "start": 4788 } ]
[ "This blog is dedicated to news, events, profiles and reviews of fine food and wine in the Hudson River Valley. ", "We especially feature and spotlight the burgeoning wineries of the Hudson River Region. ", "We accept and will relay information about releases, events, festivals and any toher happening related to food and wine in the Hudson River Valley. ", "Send pertitnent information to hudsonriverwine@yahoo.com\n\nAbout Me\n\nCarlo DeVito is a long time wine lover, and author of books and magazine articles. ", "He is the author of Wineries of the East Coast. ", "He has traveled to wine regions in California, Canada, up and down the east coast, France, Spain and Chile. ", "He has been a published executive for more than 20 years. ", "He shepherded the wine book program of Wine Spectator as well as worked with Kevin Zraly, Oz Clarke, Matt Kramer, Tom Stevenson, Evan Dawson, Greg Moore, Howard Goldberg, and many other wine writers. ", "He has also published Salvatore Calabrese, Jim Meehan, Clay Risen, and Paul Knorr.", "\nMr. DeVito is the inventor of the mini-kit which has sold more than 100,000,000 copies world wide. ", "He has also publisher such writers as Stephen Hawking, E. O Wilson, Philip Caputo, Gilbert King, James McPherson, John and Mary Gribbin, Thomas Hoving, David Margolick, Arthur M. Schlesinger Jr., John Edgar Wideman, Stanley Crouch, Dan Rather, Dee Brown, Susie Bright, and Eleanor Clift.", "\nHe is also the owner of Hudson-Chatham Winery, co-founder of the Hudson Berkshire Beverage Trail, and president of the Hudson Valley Wine Country.", "\nhttps://carlodevito.wordpress.com/\n\nSARATOGA SPRINGS — Plans are in the works for a new wine\ntrail in Saratoga and Washington counties that could be ready by summer 2014.", "\n\nThe project would include about a dozen local sites that\nbelong to the recently formed Upper Hudson Valley Wine & Grape Association.", "\n\nOrganizers are seeking support from local government before\ngoing to state officials to get required legislation approved under the state’s\nWine Trail Program.", "\n\n“When you have several of these wineries work together, then\nyou can bring people into an area to spend a weekend,” said Wine & Grape\nAssociation President Gerry Barnhardt, who owns Victory View Vineyard in\nEaston.", "\n\nFirms in Saratoga County that might join the trail include\nSaratoga Winery on Route 29, Ledge Rock Hill Winery in Corinth and Johnston’s\nWinery in Ballston Spa.", "\n\n“We’ve approached some of the individual towns,” Barnhardt\nsaid.", "\n\nFor example, he said Ledge Rock representatives have\npresented plans to the Corinth Town Board, and the Easton Town Board has\nalready adopted a resolution of support. ", "The Washington County Board of\nSupervisors is expected to take similar action this week.", "\n\nEventually, it’s hoped that Assemblyman Tony Jordan,\nR-Jackson, and state Sen. Betty Little, R-Glens Falls, will introduce bills in\nthe Legislature. ", "State approval is needed because the Wine Trail Program is\nadministered by the state Department of Transportation, which puts up signs\ndirecting travelers to various wineries.", "\n\nThere are already several other New York wine trails in\nplaces such as the Finger Lakes and eastern Long Island. ", "It’s possible that a\nmeasure could be introduced and passed during the current legislative session\nthat ends in June. ", "However, Barnhardt said, “It wouldn’t surprise me at all if\nit takes until next year. ", "Sometimes it takes a while for bills to get through the\nLegislature.”", "\n\nA bill approved next year would make the wine trail ready\nfor use in 2014.", "\n\nBarnhardt said two main factors have recently made Saratoga\nand Washington counties attractive to vintners.", "\n\nThe first is the availability of land. ", "Several vineyards are\nlocated on former dairy farms.", "\n\nAlso, the University of Minnesota and Cornell University\nhave developed new cold-hardy, northern grapes that are suitable for this\nclimate.", "\n\nJoseph Messina, owner of Amorici Vineyard in Valley Falls,\nsaid there’s a distinct advantage to doing business in the Upper Hudson region.", "\n\n“Logistically, it’s closer to New York City and the densely\npopulated Hudson Valley than the Finger Lakes,” he said.", "\n\nHowever, the weather can be more challenging. ", "Unusual\nlate-summer hurricanes in the past two years brought huge amounts of rain that\ncan cause fungal disease among plants.", "\n\n“The Finger Lakes didn’t get that,” Messina said.", "\n\nHe presented several of his wines to teams of college chefs\nlast week at the American Culinary Federation’s second annual Conference and\nCompetition at Skidmore College.", "\n\n“Everybody likes a different wine,” Messina said. “", "That’s\nwhat makes the world go ’round.”" ]
{ "pile_set_name": "Pile-CC" }
[ 0, 0, 0, 0.006622516556291391, 0.020833333333333332, 0, 0, 0.04, 0.04878048780487805, 0.01, 0.05574912891986063, 0.013605442176870748, 0.005847953216374269, 0.007462686567164179, 0, 0.009259259259259259, 0.012345679012345678, 0.015151515151515152, 0.011834319526627219, 0.011363636363636364, 0.026490066225165563, 0.011428571428571429, 0, 0, 0.011627906976744186, 0, 0, 0.009174311926605505, 0, 0, 0.014184397163120567, 0.02857142857142857, 0, 0, 0, 0, 0.011695906432748537, 0, 0 ]
0.009796
5
[ { "analysis_explanation": null, "end": 403, "entity_type": "EMAIL_ADDRESS", "recognition_metadata": { "recognizer_identifier": "EmailRecognizer_139620637004368", "recognizer_name": "EmailRecognizer" }, "score": 1, "start": 378 }, { "analysis_explanation": null, "end": 109, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 86 }, { "analysis_explanation": null, "end": 197, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 174 }, { "analysis_explanation": null, "end": 345, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 322 }, { "analysis_explanation": null, "end": 362, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 352 }, { "analysis_explanation": null, "end": 591, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 581 }, { "analysis_explanation": null, "end": 599, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 593 }, { "analysis_explanation": null, "end": 627, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 613 }, { "analysis_explanation": null, "end": 635, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 629 }, { "analysis_explanation": null, "end": 642, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 637 }, { "analysis_explanation": null, "end": 652, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 647 }, { "analysis_explanation": null, "end": 710, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 692 }, { "analysis_explanation": null, "end": 800, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 789 }, { "analysis_explanation": null, "end": 811, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 805 }, { "analysis_explanation": null, "end": 824, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 813 }, { "analysis_explanation": null, "end": 839, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 826 }, { "analysis_explanation": null, "end": 852, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 841 }, { "analysis_explanation": null, "end": 864, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 854 }, { "analysis_explanation": null, "end": 881, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 866 }, { "analysis_explanation": null, "end": 953, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 934 }, { "analysis_explanation": null, "end": 965, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 955 }, { "analysis_explanation": null, "end": 977, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 967 }, { "analysis_explanation": null, "end": 993, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 983 }, { "analysis_explanation": null, "end": 1005, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 999 }, { "analysis_explanation": null, "end": 1147, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1132 }, { "analysis_explanation": null, "end": 1160, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1149 }, { "analysis_explanation": null, "end": 1175, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1162 }, { "analysis_explanation": null, "end": 1189, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1177 }, { "analysis_explanation": null, "end": 1206, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1191 }, { "analysis_explanation": null, "end": 1212, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1208 }, { "analysis_explanation": null, "end": 1229, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1217 }, { "analysis_explanation": null, "end": 1244, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1231 }, { "analysis_explanation": null, "end": 1261, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1246 }, { "analysis_explanation": null, "end": 1288, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1263 }, { "analysis_explanation": null, "end": 1308, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1290 }, { "analysis_explanation": null, "end": 1324, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1310 }, { "analysis_explanation": null, "end": 1336, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1326 }, { "analysis_explanation": null, "end": 1347, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1338 }, { "analysis_explanation": null, "end": 1361, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1349 }, { "analysis_explanation": null, "end": 1380, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1367 }, { "analysis_explanation": null, "end": 1639, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1631 }, { "analysis_explanation": null, "end": 1654, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1644 }, { "analysis_explanation": null, "end": 1698, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1687 }, { "analysis_explanation": null, "end": 2106, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2097 }, { "analysis_explanation": null, "end": 2164, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2149 }, { "analysis_explanation": null, "end": 2206, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2200 }, { "analysis_explanation": null, "end": 2232, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2217 }, { "analysis_explanation": null, "end": 2329, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2322 }, { "analysis_explanation": null, "end": 2342, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2334 }, { "analysis_explanation": null, "end": 2367, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2355 }, { "analysis_explanation": null, "end": 2688, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2679 }, { "analysis_explanation": null, "end": 2741, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2730 }, { "analysis_explanation": null, "end": 2781, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2769 }, { "analysis_explanation": null, "end": 3055, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3047 }, { "analysis_explanation": null, "end": 3102, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3090 }, { "analysis_explanation": null, "end": 3126, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3115 }, { "analysis_explanation": null, "end": 3244, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3240 }, { "analysis_explanation": null, "end": 3264, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3255 }, { "analysis_explanation": null, "end": 3330, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3321 }, { "analysis_explanation": null, "end": 3427, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3418 }, { "analysis_explanation": null, "end": 3475, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3471 }, { "analysis_explanation": null, "end": 3486, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3477 }, { "analysis_explanation": null, "end": 3551, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3541 }, { "analysis_explanation": null, "end": 3831, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3817 }, { "analysis_explanation": null, "end": 3858, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3842 }, { "analysis_explanation": null, "end": 3874, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3862 }, { "analysis_explanation": null, "end": 3947, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3935 }, { "analysis_explanation": null, "end": 3999, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3986 }, { "analysis_explanation": null, "end": 4039, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4026 }, { "analysis_explanation": null, "end": 4061, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4045 }, { "analysis_explanation": null, "end": 4138, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4127 }, { "analysis_explanation": null, "end": 4171, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4153 }, { "analysis_explanation": null, "end": 4288, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4281 }, { "analysis_explanation": null, "end": 4364, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4355 }, { "analysis_explanation": null, "end": 4508, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4501 }, { "analysis_explanation": null, "end": 1563, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.6, "start": 1529 }, { "analysis_explanation": null, "end": 403, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 394 } ]
[ "Python Crash Course\n\n';\n\nIf you are new to programming world , Python will be the best place to start . ", "Python is really simple when compared to other programming languages. ", "It doesn't have any confusing curly brackets,semi colons, etc. ", "Most of the python commands are easy to understand.", "What makes Python so popular is its simplicity. ", "In Python, you can write much less code than in other languages such as Java or C#. ", "In short, coding in Python is quick and efficient." ]
{ "pile_set_name": "OpenWebText2" }
[ 0, 0, 0, 0, 0, 0.011904761904761904, 0 ]
0.001701
5
[ { "analysis_explanation": null, "end": 69, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 63 }, { "analysis_explanation": null, "end": 306, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 300 }, { "analysis_explanation": null, "end": 346, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 340 }, { "analysis_explanation": null, "end": 413, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 409 }, { "analysis_explanation": null, "end": 447, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 441 } ]
[ "By David George-Cosh\n\nForget about the upcoming election in Quebec, the big news out of the province is the huge breach of the province's strategic reserve of maple syrup.", "\n\nSticky-fingered thieves made off with almost 30 million Canadian dollars (US$30.4 million) worth of maple syrup from a reserve warehouse in rural Quebec, the provincial body..." ]
{ "pile_set_name": "OpenWebText2" }
[ 0.005847953216374269, 0 ]
0.002924
5
[ { "analysis_explanation": null, "end": 28, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3 }, { "analysis_explanation": null, "end": 66, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 60 }, { "analysis_explanation": null, "end": 324, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 318 } ]
[ "Clutts, Kentucky\n\nClutts is an unincorporated community in Harlan County, Kentucky, United States.", "\n\nReferences\n\nCategory:Unincorporated communities in Harlan County, Kentucky\nCategory:Unincorporated communities in Kentucky" ]
{ "pile_set_name": "Wikipedia (en)" }
[ 0, 0 ]
0
5
[ { "analysis_explanation": null, "end": 6, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 0 }, { "analysis_explanation": null, "end": 16, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8 }, { "analysis_explanation": null, "end": 73, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 60 }, { "analysis_explanation": null, "end": 83, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 75 }, { "analysis_explanation": null, "end": 98, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 85 }, { "analysis_explanation": null, "end": 164, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 151 }, { "analysis_explanation": null, "end": 174, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 166 }, { "analysis_explanation": null, "end": 222, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 214 } ]
[ "Recent developments in leishmaniasis vaccine delivery systems.", "\nThe observation that recovery from infection with Leishmania confers immunity to reinfection suggests that control of leishmaniasis by vaccination may be possible. ", "New generation vaccines, particularly those based on recombinant proteins and DNA, are found to be less immunogenic. ", "There is an urgent need for the development of new and improved vaccine adjuvants. ", "Based on their principal mechanisms of action, adjuvants can be broadly separated into two classes: immunostimulatory adjuvants and vaccine delivery systems. ", "Vaccine delivery systems can carry both antigen and adjuvant for effective delivery to the antigen-presenting cells (APCs). ", "In this article, we review the adjuvants, the delivery systems and their combinations used in the search of an effective vaccine against leishmaniasis. ", "Based on current knowledge, cationic liposomes appear to have better prospects as effective delivery systems for developing a vaccine for leishmaniasis." ]
{ "pile_set_name": "PubMed Abstracts" }
[ 0, 0.006060606060606061, 0, 0, 0, 0.008064516129032258, 0, 0 ]
0.001766
5
[]
[ "Q:\n\nconvert code snippet to C#\n\nVS 2008 \nI have this code snippet I found on a VB website.", "\nBut for some reason I am having trouble converting it to C#.", "\nMy.", "Computer.", "Network.", "IsAvailable\n\nMany thanks,\n\nA:\n\nusing System.", "Net.", "NetworkInformation;\n\n internal class Program\n {\n private static void Main()\n {\n NetworkInterface.", "GetIsNetworkAvailable();\n }\n }\n\nA:\n\nYes, garethm is right, this class (Network) is from a VB.NET library - you need to reference the Microsoft.", "VisualBasic assembly if using in a C# project.", "\nMicrosoft.", "VisualBasic.", "Devices.", "Network n = new Microsoft.", "VisualBasic.", "Devices.", "Network();\nif (n.IsAvailable)\n{\n // do stuff\n}\n\nWorks for me - my network is available :).", "\nAs far as how Network relates to NetworkInterface class, it depends on what you want to do next. ", "For instance, Network has such nice stuff as NetworkAvailabilityChanged event, and UploadFile method. ", "On the other hand, NetworkInterface can give you a bunch of specific technical info such as speed or whether it supports multicast.", "\nBTW, there is nothing undocumented about using a class from Microsoft.", "VisualBasic namespace - it's the core idea behind .NET that you can use classes from assemblies regardless of the language they were written in.", "\n\n" ]
{ "pile_set_name": "StackExchange" }
[ 0.011111111111111112, 0, 0, 0, 0, 0.022727272727272728, 0, 0.0234375, 0.013071895424836602, 0, 0.09090909090909091, 0.08333333333333333, 0, 0.038461538461538464, 0.08333333333333333, 0, 0.010752688172043012, 0.02040816326530612, 0.0196078431372549, 0.007633587786259542, 0.014084507042253521, 0, 0 ]
0.019081
5
[ { "analysis_explanation": null, "end": 39, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 35 }, { "analysis_explanation": null, "end": 375, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 354 }, { "analysis_explanation": null, "end": 412, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 405 }, { "analysis_explanation": null, "end": 665, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 652 }, { "analysis_explanation": null, "end": 460, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 454 }, { "analysis_explanation": null, "end": 656, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 652 } ]
[ "Eagles Release Jason Avant\n\nWhen you already have three high paid wide receivers, there’s not usually room for a fourth anything. ", "Pro Football Talk is reporting that the Philadelphia Eagles have released veteran receiver Jason Avant." ]
{ "pile_set_name": "Pile-CC" }
[ 0.007692307692307693, 0.02912621359223301 ]
0.018409
5
[ { "analysis_explanation": null, "end": 26, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15 }, { "analysis_explanation": null, "end": 232, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 221 } ]
[ "A new and efficient method for the synthesis of trifluoromethylthio- and selenoethers.", "\n[reaction: see text] A new atom-economic procedure for preparation of trifluoromethyl thio- and selenoethers is reported, wherein both halves of aryl and alkyl disulfides and diselenides are able to be utilized with high efficiency." ]
{ "pile_set_name": "PubMed Abstracts" }
[ 0, 0 ]
0
5
[]
[ "/**\n * Copyright (C) 2010-2016 eBusiness Information, Excilys Group\n * Copyright (C) 2016-2020 the AndroidAnnotations project\n *\n * Licensed under the Apache License, Version 2.0 (the \"License\"); you may not\n * use this file except in compliance with the License. ", "You may obtain a copy of\n * the License at\n *\n * http://www.apache.org/licenses/LICENSE-2.0\n *\n * Unless required by applicable law or agreed To in writing, software\n * distributed under the License is distributed on an \"AS IS\" BASIS, WITHOUT\n * WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. ", "See the\n * License for the specific language governing permissions and limitations under\n * the License.", "\n */\npackage org.androidannotations.rest.spring.test;\n\nimport org.androidannotations.annotations.", "EActivity;\nimport org.androidannotations.rest.spring.annotations.", "RestService;\n\nimport android.app.", "Activity;\n\n@EActivity\npublic class MyServiceActivity extends Activity {\n\n\t@RestService\n\tMyService myService;\n\n}\n" ]
{ "pile_set_name": "Github" }
[ 0.01893939393939394, 0.00964630225080386, 0.009615384615384616, 0, 0.015384615384615385, 0.030303030303030304, 0.017857142857142856 ]
0.014535
5
[ { "analysis_explanation": null, "end": 30, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 21 }, { "analysis_explanation": null, "end": 94, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 85 }, { "analysis_explanation": null, "end": 355, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.6, "start": 313 }, { "analysis_explanation": null, "end": 716, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 691 }, { "analysis_explanation": null, "end": 765, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 740 }, { "analysis_explanation": null, "end": 831, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 794 } ]
[ "/* ScummVM - Graphic Adventure Engine\n *\n * ScummVM is the legal property of its developers, whose names\n * are too numerous to list here. ", "Please refer to the COPYRIGHT\n * file distributed with this source distribution.", "\n *\n * This program is free software; you can redistribute it and/or\n * modify it under the terms of the GNU General Public License\n * as published by the Free Software Foundation; either version 2\n * of the License, or (at your option) any later version.", "\n *\n * This program is distributed in the hope that it will be useful,\n * but WITHOUT ANY WARRANTY; without even the implied warranty of\n * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. ", " See the\n * GNU General Public License for more details.", "\n *\n * You should have received a copy of the GNU General Public License\n * along with this program; if not, write to the Free Software\n * Foundation, Inc., 51 Franklin Street, Fifth Floor, Boston, MA 02110-1301, USA.", "\n *\n */\n\n#include \"titanic/carry/arm.h\"\n#include \"titanic/messages/messages.h\"\n#include \"titanic/translation.h\"\n\nnamespace Titanic {\n\nBEGIN_MESSAGE_MAP(CArm, CCarry)\n\tON_MESSAGE(PuzzleSolvedMsg)\n\tON_MESSAGE(TranslateObjectMsg)\n\tON_MESSAGE(UseWithOtherMsg)\n\tON_MESSAGE(MouseDragStartMsg)\n\tON_MESSAGE(MaitreDHappyMsg)\n\tON_MESSAGE(PETGainedObjectMsg)\n\tON_MESSAGE(MouseDragMoveMsg)\nEND_MESSAGE_MAP()\n\nCArm::CArm() : CCarry(), _heldItemName(\"Key\"),\n\t_puzzleUnused(0), _armUnlocked(false), _arboretumFrame(3), _unlockedFrame(0),\n\t_armRect(220, 208, 409, 350) {\n}\n\nvoid CArm::save(SimpleFile *file, int indent) {\n\tfile->writeNumberLine(1, indent);\n\tfile->writeQuotedLine(_heldItemName, indent);\n\tfile->writeNumberLine(_puzzleUnused, indent);\n\tfile->writeRect(_hookedRect, indent);\n\tfile->writeQuotedLine(_hookedTarget, indent);\n\tfile->writeNumberLine(_armUnlocked, indent);\n\tfile->writeRect(_armRect, indent);\n\tfile->writeNumberLine(_arboretumFrame, indent);\n\tfile->writeNumberLine(_unlockedFrame, indent);\n\n\tCCarry::save(file, indent);\n}\n\nvoid CArm::load(SimpleFile *file) {\n\tfile->readNumber();\n\t_heldItemName = file->readString();\n\t_puzzleUnused = file->readNumber();\n\t_hookedRect = file->readRect();\n\t_hookedTarget = file->readString();\n\t_armUnlocked = file->readNumber();\n\t_armRect = file->readRect();\n\t_arboretumFrame = file->readNumber();\n\t_unlockedFrame = file->readNumber();\n\n\tCCarry::load(file);\n}\n\nbool CArm::PuzzleSolvedMsg(CPuzzleSolvedMsg *msg) {\n\t_puzzleUnused = 0;\n\t_canTake = true;\n\n\tCString name = getName();\n\tif (name == \"Arm1\") {\n\t\tCActMsg actMsg(\"LoseArm\");\n\t\tactMsg.execute(\"MaitreD\");\n\t\tCPuzzleSolvedMsg solvedMsg;\n\t\tsolvedMsg.execute(\"AuditoryCentre\");\n\t} else if (name == \"Arm2\") {\n\t\tCPuzzleSolvedMsg solvedMsg;\n\t\tsolvedMsg.execute(\"Key\");\n\t}\n\n\treturn true;\n}\n\nbool CArm::TranslateObjectMsg(CTranslateObjectMsg *msg) {\n\tPoint newPos(_bounds.left + msg->_delta.x, _bounds.top + msg->_delta.y);\n\tsetPosition(newPos);\n\treturn true;\n}\n\nbool CArm::UseWithOtherMsg(CUseWithOtherMsg *msg) {\n\tif (_heldItemName !", "= \"None\") {\n\t\tCShowTextMsg textMsg(ARM_ALREADY_HOLDING);\n\t\ttextMsg.execute(\"PET\");\n\t\treturn false;\n\t} else if (msg->_other->getName() == \"GondolierLeftLever\") {\n\t\tCIsHookedOnMsg hookedMsg(_hookedRect, 0, getName());\n\t\thookedMsg._rect.translate(_bounds.left, _bounds.top);\n\t\thookedMsg.execute(\"GondolierLeftLever\");\n\n\t\tif (hookedMsg._isHooked) {\n\t\t\t_hookedTarget = \"GondolierLeftLever\";\n\t\t} else {\n\t\t\tpetAddToInventory();\n\t\t}\n\t} else if (msg->_other->getName() == \"GondolierRightLever\") {\n\t\tCIsHookedOnMsg hookedMsg(_hookedRect, 0, getName());\n\t\thookedMsg._rect.translate(_bounds.left, _bounds.top);\n\t\thookedMsg.execute(\"GondolierRightLever\");\n\n\t\tif (hookedMsg._isHooked) {\n\t\t\t_hookedTarget = \"GondolierRightLever\";\n\t\t} else {\n\t\t\tpetAddToInventory();\n\t\t}\n\t} else {\n\t\tpetAddToInventory();\n\t}\n\n\treturn true;\n}\n\nbool CArm::MouseDragStartMsg(CMouseDragStartMsg *msg) {\n\tif (!_", "canTake) {\n\t\tCShowTextMsg textMsg(YOU_CANT_GET_THIS);\n\t\ttextMsg.execute(\"PET\");\n\t} else if (checkStartDragging(msg)) {\n\t\thideMouse();\n\t\t_centroid = msg->_mousePos - _bounds;\n\t\tsetPosition(msg->_mousePos - _centroid);\n\n\t\tif (!_", "hookedTarget.empty()) {\n\t\t\tCActMsg actMsg(\"Unhook\");\n\t\t\tactMsg.execute(_hookedTarget);\n\t\t\t_hookedTarget.clear();\n\t\t}\n\n\t\tloadFrame(_visibleFrame);\n\t\treturn true;\n\t}\n\n\treturn false;\n}\n\nbool CArm::MaitreDHappyMsg(CMaitreDHappyMsg *msg) {\n\tCGameObject *petItem;\n\tif (find(getName(), &petItem, FIND_PET)) {\n\t\tif (!_", "armUnlocked)\n\t\t\tplaySound(TRANSLATE(\"z#47.wav\", \"z#578.wav\"));\n\t\tif (_heldItemName == \"Key\" || _heldItemName == \"AuditoryCentre\") {\n\t\t\tCGameObject *heldItem = dynamic_cast<CGameObject *>(getFirstChild());\n\t\t\tif (heldItem) {\n\t\t\t\theldItem->setVisible(true);\n\t\t\t\theldItem->petAddToInventory();\n\t\t\t}\n\n\t\t\t_visibleFrame = _unlockedFrame;\n\t\t\tloadFrame(_visibleFrame);\n\t\t\t_heldItemName = \"None\";\n\t\t\tpetInvChange();\n\t\t}\n\t}\n\n\t_armUnlocked = true;\n\t_canTake = true;\n\treturn true;\n}\n\nbool CArm::PETGainedObjectMsg(CPETGainedObjectMsg *msg) {\n\tif (_armUnlocked) {\n\t\tif (_heldItemName == \"Key\" || _heldItemName == \"AuditoryCentre\") {\n\t\t\tCCarry *child = dynamic_cast<CCarry *>(getFirstChild());\n\t\t\tif (child) {\n\t\t\t\t_visibleFrame = _unlockedFrame;\n\t\t\t\tloadFrame(_visibleFrame);\n\t\t\t\tchild->setVisible(true);\n\t\t\t\tchild->petAddToInventory();\n\t\t\t}\n\n\t\t\t_heldItemName = \"None\";\n\t\t}\n\t}\n\n\treturn true;\n}\n\nbool CArm::MouseDragMoveMsg(CMouseDragMoveMsg *msg) {\n\tsetPosition(msg->_mousePos - _centroid);\n\n\tif (_heldItemName == \"None\" && compareViewNameTo(\"FrozenArboretum.", "Node 5.S\")) {\n\t\tloadFrame(_armRect.contains(msg->_mousePos) ?", "\n\t\t\t_arboretumFrame : _visibleFrame);\n\t}\n\n\treturn true;\n}\n\n} // End of namespace Titanic\n" ]
{ "pile_set_name": "Github" }
[ 0, 0, 0.00392156862745098, 0, 0.017857142857142856, 0.009216589861751152, 0.0019782393669634025, 0.003444316877152698, 0, 0.0064516129032258064, 0.0019138755980861245, 0.01639344262295082, 0.011235955056179775 ]
0.00557
5
[ { "analysis_explanation": null, "end": 915, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 909 }, { "analysis_explanation": null, "end": 935, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 932 }, { "analysis_explanation": null, "end": 1395, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1381 }, { "analysis_explanation": null, "end": 1436, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1420 }, { "analysis_explanation": null, "end": 1954, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1937 }, { "analysis_explanation": null, "end": 2814, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2801 }, { "analysis_explanation": null, "end": 2843, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2830 }, { "analysis_explanation": null, "end": 3012, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2972 }, { "analysis_explanation": null, "end": 3227, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3217 }, { "analysis_explanation": null, "end": 3554, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3544 }, { "analysis_explanation": null, "end": 3881, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3843 }, { "analysis_explanation": null, "end": 3960, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3951 }, { "analysis_explanation": null, "end": 3996, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3976 }, { "analysis_explanation": null, "end": 4568, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4555 }, { "analysis_explanation": null, "end": 5043, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5030 }, { "analysis_explanation": null, "end": 1338, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_139620637004320", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 1336 }, { "analysis_explanation": null, "end": 1504, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_139620637004320", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 1502 }, { "analysis_explanation": null, "end": 1945, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_139620637004320", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 1943 }, { "analysis_explanation": null, "end": 1979, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_139620637004320", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 1977 }, { "analysis_explanation": null, "end": 2322, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_139620637004320", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 2320 }, { "analysis_explanation": null, "end": 2348, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_139620637004320", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 2346 }, { "analysis_explanation": null, "end": 2725, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_139620637004320", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 2723 }, { "analysis_explanation": null, "end": 2896, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_139620637004320", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 2894 }, { "analysis_explanation": null, "end": 3777, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_139620637004320", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 3775 }, { "analysis_explanation": null, "end": 4251, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_139620637004320", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 4249 }, { "analysis_explanation": null, "end": 4851, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_139620637004320", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 4849 }, { "analysis_explanation": null, "end": 5260, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_139620637004320", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 5258 }, { "analysis_explanation": null, "end": 2826, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 2817 }, { "analysis_explanation": null, "end": 3194, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 3187 }, { "analysis_explanation": null, "end": 3226, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 3217 }, { "analysis_explanation": null, "end": 3521, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 3514 }, { "analysis_explanation": null, "end": 3553, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 3544 }, { "analysis_explanation": null, "end": 4163, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 4148 }, { "analysis_explanation": null, "end": 5451, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 5441 }, { "analysis_explanation": null, "end": 930, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 920 }, { "analysis_explanation": null, "end": 930, "entity_type": "US_SSN", "recognition_metadata": { "recognizer_identifier": "UsSsnRecognizer_139620636962048", "recognizer_name": "UsSsnRecognizer" }, "score": 0.05, "start": 920 } ]
[ "Q:\n\nrank of 4x4 matrix f(A) is\n\nLet f(x) be the minimal polynomial of the 4x4 matrix A equal to \n0 0 0 1\n1 0 0 0\n0 1 0 0\n0 0 1 0\nThen rank of the 4x4 matrix f(A) is\n\nA:\n\nFrom definition of minimal polynomial, we have \n$$f(A)=0$$.\nAre you able to compute its rank?", "\n\n" ]
{ "pile_set_name": "StackExchange" }
[ 0, 0 ]
0
5
[]
[ "In the United States Court of Federal Claims\n OFFICE OF SPECIAL MASTERS\n\n******************** *\nKELLY TAVANO, *\n * No. ", "15-1206V\n Petitioner, * Special Master Christian J. Moran\n *\nv. * Filed: December 13, 2017\n *\nSECRETARY OF HEALTH *\nAND HUMAN SERVICES, * Attorneys’ fees and costs; waiver\n *\n Respondent. *", "\n******************** *\n\nRonald C. Homer, Conway, Homer, P.C., Boston, MA, for Petitioner;\nAmy P. Kokot, United States Dep’t of Justice, Washington, DC, for Respondent.", "\n\n UNPUBLISHED DECISION AWARDING\n ATTORNEYS’ FEES AND COSTS 1\n\n After receiving compensation through the Vaccine Program, Kelly Tavano\nfiled a motion for attorneys’ fees and costs. ", "Ms. Tavano is awarded the full\namount of her request, $54,774.54.", "\n * * *\n\n Ms. Tavano alleged that an influenza vaccination caused her to suffer from\ntransverse myelitis. ", "The parties agreed to a stipulation resolving the amount of\ncompensation. ", "The stipulation was incorporated into a decision awarding Ms.\nTavano’s compensation. ", "Decision, issued May 22, 2017, 2017 WL 2616931.", "\n\n\n\n 1\n The E-Government Act, 44 U.S.C. § 3501 note (2012) (Federal Management and\nPromotion of Electronic Government Services), requires that the Court post this decision on its\nwebsite. ", "Pursuant to Vaccine Rule 18(b), the parties have 14 days to file a motion proposing\nredaction of medical information or other information described in 42 U.S.C. § 300aa-12(d)(4).", "\nAny redactions ordered by the special master will appear in the document posted on the website.", "\n\fWith the merits of Ms. Tavano’s case resolved, the parties addressed attorneys’\nfees and costs.", "\n\n Ms. Tavano filed an attorneys’ fees and costs petition on September 27,\n2017, requesting $42,652.00 in fees and $12,060.71 in costs. ", "Ms. Tavano incurred\n$61.83 in costs personally. ", "Statement Regarding Gen. Order No. ", "9, filed Sept. 27,\n2017.", "\n\n The Secretary filed a response representing that he “is satisfied the statutory\nrequirements for an award of attorneys’ fees and costs are met in this case.”", "\nResp’t’s Resp., ", "filed Oct. 5, 2017, at 2. ", "The Secretary did not raise any specific\nobjections and recommended that the Special Master “exercise his discretion”\nwhen determining a reasonable award. ", "Id. at 3.", "\n\n This matter is now ripe for adjudication.", "\n * * *\n\n Because Ms. Tavano received compensation, she is entitled to an award of\nreasonable attorneys’ fees and costs. ", "42 U.S.C. § 300aa–15(e).", "\n\n Pursuant to the rationale established in Swintosky v. Secʼy of Health &\nHuman Servs., ", "No. ", "12-403V, 2017 WL 5899239 (Fed. ", "Cl. ", "Spec. ", "Mstr. ", "Nov. 6,\n2017), 2 the Secretary has waived any objections to the amount of fees requested.", "\nAbsent any objections, Ms. Tavano’s request for attorneys’ fees and costs is\nGRANTED IN FULL:\n\n a. A lump sum of $54,712.71 in the form of a check made payable to\n petitioner and petitioner’s attorney, Ronald C. Homer; and\n\n b. A lump sum of $61.83 in the form of a check made payable to\n petitioner.", "\n These amounts represents reimbursement attorneys’ fees and other litigation\ncosts available under 42 U.S.C. § 300aa-15(e). ", "In the absence of a motion for\n\n\n\n 2\n In Swintosky, the parties submitted a joint notice of decision not to seek review of the\nFees Decision.", "\n\n 2\n\freview filed pursuant to RCFC Appendix B, the clerk of the court is directed to\nenter judgment herewith. ", "3\n\n IT IS SO ORDERED.", "\n s/Christian J. Moran\n Christian J. Moran\n Special Master\n\n\n\n\n 3\n Pursuant to Vaccine Rule 11(a), entry of judgment can be expedited by the parties’ joint\nfiling of notice renouncing the right to seek review.", "\n\n 3\n\f" ]
{ "pile_set_name": "FreeLaw" }
[ 0.0048543689320388345, 0.002570694087403599, 0.02976190476190476, 0.004366812227074236, 0.015384615384615385, 0.00625, 0, 0, 0, 0.009900990099009901, 0, 0, 0.010309278350515464, 0.0070921985815602835, 0.020833333333333332, 0, 0, 0, 0.058823529411764705, 0, 0, 0, 0, 0.005649717514124294, 0, 0, 0, 0.03225806451612903, 0, 0, 0, 0, 0.00906344410876133, 0, 0, 0.006172839506172839, 0, 0.004987531172069825, 0 ]
0.005853
5
[ { "analysis_explanation": null, "end": 29, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3 }, { "analysis_explanation": null, "end": 299, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 281 }, { "analysis_explanation": null, "end": 402, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 385 }, { "analysis_explanation": null, "end": 635, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 620 }, { "analysis_explanation": null, "end": 664, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 658 }, { "analysis_explanation": null, "end": 668, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 666 }, { "analysis_explanation": null, "end": 698, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 686 }, { "analysis_explanation": null, "end": 713, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 700 }, { "analysis_explanation": null, "end": 742, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 732 }, { "analysis_explanation": null, "end": 746, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 744 }, { "analysis_explanation": null, "end": 923, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 911 }, { "analysis_explanation": null, "end": 980, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 974 }, { "analysis_explanation": null, "end": 1070, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1064 }, { "analysis_explanation": null, "end": 1344, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1332 }, { "analysis_explanation": null, "end": 1350, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1346 }, { "analysis_explanation": null, "end": 1423, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1419 }, { "analysis_explanation": null, "end": 1610, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1603 }, { "analysis_explanation": null, "end": 1858, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1852 }, { "analysis_explanation": null, "end": 1935, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1929 }, { "analysis_explanation": null, "end": 1995, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1983 }, { "analysis_explanation": null, "end": 2001, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1997 }, { "analysis_explanation": null, "end": 2068, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2062 }, { "analysis_explanation": null, "end": 2158, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2150 }, { "analysis_explanation": null, "end": 2164, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2160 }, { "analysis_explanation": null, "end": 2358, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2346 }, { "analysis_explanation": null, "end": 2616, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2610 }, { "analysis_explanation": null, "end": 2793, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2775 }, { "analysis_explanation": null, "end": 2837, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2833 }, { "analysis_explanation": null, "end": 2848, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2841 }, { "analysis_explanation": null, "end": 2877, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2871 }, { "analysis_explanation": null, "end": 2883, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2879 }, { "analysis_explanation": null, "end": 2994, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2988 }, { "analysis_explanation": null, "end": 3193, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3178 }, { "analysis_explanation": null, "end": 3478, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3469 }, { "analysis_explanation": null, "end": 3602, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3598 }, { "analysis_explanation": null, "end": 3734, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3726 }, { "analysis_explanation": null, "end": 3813, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3795 }, { "analysis_explanation": null, "end": 3941, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3937 }, { "analysis_explanation": null, "end": 1361, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 1354 }, { "analysis_explanation": null, "end": 2848, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 2841 } ]
[ "Woke up, “…I don’t want to do inktober.”", "\n\nLogin to Facebook, “…Everyone is doing inktober.”", "\n\n… Eh, maybe I’ll do some days. ", "Probably not the whole month. ", "We’ll see.", "\n\nDay 1.", "\n\n" ]
{ "pile_set_name": "OpenWebText2" }
[ 0, 0, 0, 0, 0, 0, 0 ]
0
5
[ { "analysis_explanation": null, "end": 120, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 111 }, { "analysis_explanation": null, "end": 150, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 135 }, { "analysis_explanation": null, "end": 168, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 163 } ]
[ "Intra- and Inter-rater Reliability of Navigated Ultrasound in the Assessment of Pelvic Tilt in Symptom-Free Young Adults.", "\nPelvic tilt is the angle between the anterior pelvic plane and the coronal plane. ", "It affects cup positioning in total hip arthroplasty. ", "The primary objective of this study was to test the intra- and inter-rater reliability of a navigated smart device-based ultrasound system for pelvic tilt assessment. ", "The secondary objective was to test the inter-rater variability of the measurements on a hip phantom. ", "A repeated-measures design was used. ", "Two raters measured the pelvic tilt of 12 symptom-free young adults in upright and supine positions. ", "Additionally, pelvic tilt was measured on a hip phantom. ", "Each rater performed 3 measurements in each body position on the participants and 12 measurements on the hip phantom. ", "Intra- and inter-rater reliability were calculated with the use of intraclass correlation coefficients. ", "The variability in measurements on the hip phantom was assessed by a Bland-Altman analysis of agreement. ", "Intraclass correlation coefficient 95% confidence intervals for intra-rater reliability ranged from good to excellent and moderate to excellent for the supine and upright positions respectively. ", "Intraclass correlation coefficient 95% confidence intervals for inter-rater reliability ranged from poor to excellent for both positions. ", "Hip phantom measurements showed no significant average bias (P > .05) and no significant proportional bias (P > .05). ", "The 95% inter-rater limits of agreement were ±1.3° and ±1.7° for the supine and upright positions, respectively. ", "The intra-rater reliability values achieved were suitable. ", "Intraclass correlation coefficient values for inter-rater reliability remained below an acceptable level. ", "Possible reasons and overcoming strategies were presented. ", "The 95% limits of agreement were good, at less than ±2°." ]
{ "pile_set_name": "PubMed Abstracts" }
[ 0.01652892561983471, 0.012048192771084338, 0, 0, 0, 0, 0, 0, 0, 0, 0.009523809523809525, 0, 0, 0, 0.008849557522123894, 0, 0, 0, 0 ]
0.002471
5
[]
[ "Q:\n\nBuilding a custom formatter and array is not rendering as expected\n\nUsing Drupal 7 with WSClient module. ", "I've built a custom function to post the data from a node to a remote REST API. ", "So far It more or less works except the output of the array behaves unexpectedly. ", "\nIt's outputting the array like this. ", "\n{\n \"id\": {\n \"test\": \"test\",\n \"id\": \"1\",\n \"name\": \"20160725TestStoryTP\",\n \"headline\": \"Clone of This is a test story\",\n \"category\": \"arts\",\n \"author\": \"admin\",\n \"byline\": \"test\\r\\ntest\",\n \"editor_name\": \"admin\",\n \"publication\": \"test-pub\",\n \"body\": \"<p>test test test test test test test test test<\\/p>\\n\",\n \"news_alert_headline\": test,\n \"news_alert_body\": test,\n \"created_user\": \"admin\",\n \"modified_user\": \"admin\",\n \"seo_terms\": null,\n \"publish_datetime\": 1469404800\n },\n \"name\": null,\n \"headline\": null,\n \"category\": null,\n \"author\": null,\n \"byline\": null,\n \"publication\": null,\n \"body\": null,\n \"news_alert_headline\": null,\n \"news_alert_body\": null,\n \"created_user\": null,\n \"modified_user\": null,\n \"seo_terms\": null,\n \"publish_datetime\": null,\n \"video_url\": null,\n \"images\": null\n}\n\nIT should be rendering it as so: \n{\n \"test\": \"test\",\n \"id\": \"1\",\n \"name\": \"20160725TestStoryTP\",\n \"headline\": \"Clone of This is a test story\",\n \"category\": \"arts\",\n \"author\": \"admin\",\n \"byline\": \"test\\r\\ntest\",\n \"editor_name\": \"admin\",\n \"publication\": \"test-pub\",\n \"body\": \"<p>test test test test test test test test test<\\/p>\\n\",\n \"news_alert_headline\": test, \n \"news_alert_body\": test,\n \"created_user\": \"admin\",\n \"modified_user\": \"admin\",\n \"seo_terms\": null,\n \"publish_datetime\": 1469404800\n}\n\nThis is the code that generates the output: (Yes I realize it's a bit messy)\nfunction project_services_code_post_call($payload) {\n $node = node_load($payload);\n\n $service = wsclient_service_load('storyapi');\n\n // Fetch Parent node for certain data.", "\n $parent_node_id = $node->field_parent_story['und'][0]['target_id'];\n $parent_node = node_load($parent_node_id);\n\n // Fetch and parse Publication into new format.", "\n $publication_term = taxonomy_term_load($node->field_publication_of_origin['und'][0]['tid']);\n $publication_name = _srv_fetch_sanitize_term($publication_term->name);\n\n // Fetch and parse Category into new format.", "\n $category_term = taxonomy_term_load($node->field_category['und'][0]['target_id']);\n $category_name = _srv_fetch_sanitize_term($category_term->name);\n\n // Fetch owner of story.", "\n $owner_user = _srv_fetch_user($node->field_owner['und'][0]['target_id']);\n\n // Fetch created TODO Is this different than owner?", "\n $created_user = _srv_fetch_user($node->field_owner['und'][0]['target_id']);\n\n // Fetch modified TODO Is this different than owner?", "\n $modified_user = _srv_fetch_user($node->field_owner['und'][0]['target_id']);\n\n // Fetch Assignment Editor.", "\n $editor_user = _srv_fetch_user($parent_node->field_assignment_editor['und'][0]['target_id']);\n\n // Convert Story Date to unix date stamp.", "\n $timestamp = strtotime($node->field_story_date['und'][0]['value']);\n\n // Construct Data array\n $data = array(\n 'test' => 'test',\n 'id' => $parent_node->nid,\n 'name' => $node->field_slug['und'][0]['value_token_filtered'],\n 'headline' => $node->title,\n 'category' => $category_name,\n 'author' => $owner_user,\n 'byline' => $parent_node->field_byline_final['und'][0]['value'],\n 'editor_name' => $editor_user,\n 'publication' => $publication_name,\n 'body' => $node->body['und'][0]['safe_value'],\n 'news_alert_headline' => $node->field_news_alert_headline['und'][0]['value'],\n 'news_alert_body' => $node->field_news_alert_headline['und'][0]['value'],\n 'created_user' => $created_user,\n 'modified_user' => $modified_user,\n 'seo_terms' => $node->field_seo_terms['und'][0]['value'],\n 'publish_datetime' => $timestamp,\n );\n\n try {\n $response = $service->storypost($data);\n }\n catch (WSClientException $exception) {\n watchdog('click_services_code', $exception->__toString(), array(), WATCHDOG_ERROR);\n return FALSE;\n }\n\n return $response;\n}\n\nIt's based heavily on https://www.drupal.org/node/1114320.", "\nAny help appreicated.", "\n\nA:\n\nAfter some review, I was able to solve the problem partially. ", "I don't know if it was the \"correct\" method, but it will do for what my needs are:\n\nI renamed one of my custom defined values in the $data array to not match what I had defined in the WSClient definition. ", "The data value with the name change still appeared in the output JSON. ", "along with my originally named definition as NULL.", "\nI removed all pre-defined operation fields from the WSClient operations setup and tried again. ", "The array was empty. ", "\nI added only one single value back and tested again. ", "I called the value \"payload\". ", "The array was repopulated with my own custom definitions all nested under the new payload value.", "\n\nSo what I ended up doing was basically the #3 step as my solution. ", "It seemed to work out. ", "It's not perfect but it will do. ", " \nMy final payload looks similar to this:\n{\n \"payload\": {\n \"id\": \"1\",\n \"name\": \"20160725TestStoryTP\",\n \"headline\": \"Clone of This is a test story\",\n \"category\": \"arts\",\n \"author\": \"admin\",\n \"byline\": \"test\\r\\ntest\",\n \"editor_name\": \"admin\",\n \"publication\": \"test-pub\",\n \"body\": \"<p>test test test test test test test test test<\\/p>\\n\",\n \"news_alert_headline\": test,\n \"news_alert_body\": test,\n \"created_user\": \"admin\",\n \"modified_user\": \"admin\",\n \"seo_terms\": null,\n \"publish_datetime\": 1469404800\n },\n}\n\n" ]
{ "pile_set_name": "StackExchange" }
[ 0.009174311926605505, 0, 0, 0, 0.0012322858903265558, 0, 0, 0, 0.007633587786259542, 0.007462686567164179, 0, 0.0070921985815602835, 0.0017301038062283738, 0, 0, 0.004878048780487805, 0, 0.02, 0.010416666666666666, 0, 0, 0, 0, 0, 0, 0, 0 ]
0.002579
5
[ { "analysis_explanation": null, "end": 4429, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4421 }, { "analysis_explanation": null, "end": 4148, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.6, "start": 4112 }, { "analysis_explanation": null, "end": 823, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 813 }, { "analysis_explanation": null, "end": 1675, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 1665 }, { "analysis_explanation": null, "end": 5523, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 5513 }, { "analysis_explanation": null, "end": 823, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 813 }, { "analysis_explanation": null, "end": 1675, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 1665 }, { "analysis_explanation": null, "end": 5523, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 5513 }, { "analysis_explanation": null, "end": 823, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 813 }, { "analysis_explanation": null, "end": 1675, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 1665 }, { "analysis_explanation": null, "end": 4147, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 4140 }, { "analysis_explanation": null, "end": 5523, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 5513 } ]
[ "---\nabstract: 'Axion-like particles (ALPs) are interesting dark matter candidates both from the theoretical as well as from the experimental perspective. ", "Usually they are motivated as pseudo-Nambu-Goldstone bosons. ", "In this case one of their most important features is that their coupling to other particles is suppressed by a large scale, the vacuum expectation value of the field breaking the symmetry that gives rise to them. ", "This naturally endows them with very weak interactions but also restricts the maximal field value and therefore the regions where sufficient dark matter is produced. ", "In this paper we investigate deviations from this simplest setup, where the potential and interactions are as expected for a pseudo-Nambu-Goldstone boson, but the kinetic term has singularities. ", "This leads to a significantly increased area in parameter space where such particles can be dark matter and can be probed by current and near future experiments. ", "We discuss cosmological limits and in the course of this give a simple derivation of a formula for isocurvature fluctuations in models with general anharmonic potentials. ", "As an application of this formula we give an update of the isocurvature constraints for QCD axion dark matter models, using the most recent results for the QCD topological susceptibility and the newest Planck data.'", "\nauthor:\n- |\n Gonzalo Alonso-[Á]{}lvarez and Joerg Jaeckel\\\n *Institut f[ü]{}r Theoretische Physik, Universit[ä]{}t Heidelberg,*\\\n *Philosophenweg 16, 69120 Heidelberg, Germany*\nbibliography:\n- 'resubmit.bib'\ntitle: '**Exploring ALPs beyond the canonical**'\n---\n\nIntroduction {#sec:Bounds}\n============\n\nAxions and axion-like particles (ALPs) are a prediction of some of the best-motivated beyond the standard model physics scenarios (see, e.g. [@jaeckel_low-energy_2010; @cicoli_axion-like_2013; @ringwald_axions_2014] for reviews). ", "Many of their properties are determined by two quantities: the mass, $m$ and the so-called decay constant, $f_a$. An important feature that all these particles share is that they enjoy a shift symmetry, a discrete version of which is preserved at the quantum level. ", "The existence of this symmetry protects their potential from quantum corrections that could otherwise be very large. ", "In the framework of quantum field theory, such particles arise as pseudo Nambu-Goldstone bosons of approximate global chiral symmetries [@peccei_cp_1977; @weinberg_new_1978; @wilczek_problem_1978; @masso_light_1995; @masso_new_1997; @masso_planck-scale_2004]. ", "In other setups such as supergravity or string theory, particles with similar properties appear in the spectrum. ", "For instance, ALPs are a general consequence of the compactification of extra dimensions and string theory [@svrcek_axions_2006; @douglas_flux_2007; @arvanitaki_string_2010; @acharya_m_2010; @higaki_note_2011; @marsh_axiverse_2011; @cicoli_type_2012]. ", "In that context, there can be dozens of such particles whose potentials, kinetic terms and interactions may contain a large number of free parameters. ", "In an attempt to accommodate all these similar particle candidates, we will talk about ALPs in the general sense of a light (pseudo-)scalar particle, and we will reserve the term “axion\" to refer to ALPs that couple to the gluon field strength tensor through the QCD topological term and solve the strong CP problem.", "\n\nAxion-like particles are excellent candidates to account for some or all the dark matter that we observe in the universe [@arias_wispy_2012; @ringwald_exploring_2012; @jaeckel_family_2014; @marsh_axion_2016]. ", "Cosmological and astrophysical observations tell us that dark matter particles should be weakly interacting, stable at cosmological scales and cold. ", "ALPs can naturally fulfil all these requirements. ", "First, the discrete shift symmetry constrains their possible couplings to other fields, and those that are allowed are typically suppressed by $f_a$, which can be a large energy scale. ", "This fact, together with their small mass which limits the possible number and type of decay products as well as the phase space, makes them extremely stable. ", "Naively, the fact that they are very light might seem to contradict the requirement that the ALP dark matter population should be cold. ", "However, it is easy to see that this is not necessarily the case. ", "Because of their feeble interactions with other particles, ALPs are not produced thermally, but rather by the so-called misalignment mechanism, which yields a very non-relativistic population of ALPs that behave as cold dark matter [@preskill_cosmology_1983; @abbott_cosmological_1983; @dine_not-so-harmless_1983; @arias_wispy_2012; @jaeckel_family_2014].", "\n\nAll in all, ALPs and axions are well motivated dark matter candidates, but their possible mass and decay constant span many orders of magnitude thereby providing a significant challenge for experimental tests. ", "Fortunately, their properties, in particular their low mass, also provides for new opportunities for experimental searches and theoretical arguments that can be used to probe their parameter space (see [@graham_experimental_2015] for a recent review).", "\n\nExperimental tests are usually dependent on the coupling to Standard Model particles. ", "One example is a coupling to two gluons, $$\\label{eq:coupling}\n{\\mathcal{L}}\\supset\\frac{\\alpha}{8\\pi f_{a}}\\phi G_{\\mu\\nu}\\tilde{G}^{\\mu\\nu}.$$ This coupling also induces a coupling to a nucleon electric dipole moment (EDM), $${\\mathcal{L}}\\subset g_{d}\\phi\\bar{N}\\sigma_{\\mu\\nu}F^{\\mu\\nu}N$$ that is particularly important for searches when $\\phi$ is dark matter[^1]. ", "The coupling constants are related via [@pospelov_theta-induced_1999; @graham_new_2013] $$g_{d}\\approx \\frac{2.4\\cdot 10^{-16}}{f_a}\\ \\mathrm{e}\\cdot\\mathrm{cm} \\approx 3.4\\cdot 10^{3} \\mathrm{GeV}^{-2} \\left(\\frac{\\mathrm{GeV}}{f_{a}}\\right).$$\n\n![", "Parameter space for canonical axion-like particles, considering gravitational effects and interactions derived from the QCD $G\\tilde{G}$ term. ", "On the horizontal axis we plot the mass of the ALP, while the vertical axis gives the decay constant $f_a$ on the right and the effective coupling to nucleons $g_d\\propto f_a^{-1}$ on the left. ", "Canonical ALP models with a constant mass can only generate enough dark matter via the misalignment mechanism in the yellow and grey shaded areas. ", "Accounting for the anharmonicities of the potential and allowing for a fine-tuned initial condition, this region can be enlarged to also include the orange band (we take the lowest viable Hubble scale of inflation, $H_I\\sim 4.5\\cdot 10^{-23}$ GeV). ", "Note that the QCD axion models are restricted to lie on the magenta line. ", "Taking the interaction to be given by Eq.", " , the region to the left of the QCD axion line is disfavoured by the unavoidable (temperature dependent) contribution to the mass from QCD effects [@blum_constraining_2014] (see also ). ", "This region is shown in light grey. ", "The dark blue region is excluded by the supernova limits estimated in [@raffelt_astrophysical_2008]. ", "Shaded in brown is the area where experiments looking for a static nuclear electric dipole moment (nEDM, see [@abel_search_2017]) would have found the oscillating one, while the dotted lines represent sensitivity estimates for future oscillating EDM experiments [@budker_cosmic_2014; @hexenia_2017]. ", "In the dark green region “BBN” ALPs coupled to QCD are inconsistent with the production of the observed abundance of light elements during Big Bang Nucleosynthesis [@blum_constraining_2014]. ", "The violet and dark red lines dubbed “Earth\" and “Sun\" correspond to constraints from the ALP field being sourced by dense astrophysical objects [@hook_probing_2017]. ", "The dark grey area is disfavoured by the observation of quickly rotating stellar black holes which would have been spun down in a superradiant process (from [@arvanitaki_discovering_2015]). ", "The area above the dashed black lines, plotted for different values of the Hubble scale of inflaton $H_I$, is disfavoured due to the generation of too much power in isocurvature perturbations at the scales probed by the Planck satellite [@ade_planck_2016] (see more details in ). ", "Finally, $f_a$ is (softly) bounded from above by the requirement that it does not exceed the Planck scale.[]{data-label=\"fig:ALP_parameter_space\"}](fig_ALP_parameter_space_final){width=\"62.50000%\" height=\"\\textheight\"}\n\nsummarises the constraints that can be cast on the canonical ALP dark matter scenario from these interactions with the visible sector. ", "In addition we show limits that arise from unavoidable gravitational interactions.", "\n\nUnfortunately, some of the theoretically favoured existing models require high decay constants for the ALPs to be able to account for all the dark matter energy density that we observe in our Universe. ", "This means that some of the better motivated combinations of $(m,f_a)$ are not in the best position to be tested, be it through gravitational interactions or through couplings to gluons and nucleons or photons. ", "It is therefore timely to search for models that can accommodate low enough values of $f_a$ that can be in reach of these searches, while still being able to produce the required dark matter abundance. ", "One option is to enlarge the field range by a monodromy [@silverstein_monodromy_2008; @mcallister_gravity_2010; @kaloper_natural_2009] as done in [@jaeckel_monodromy_2016].", "\n\nIn this paper we pursue the same goal by employing a non-standard kinetic term for the ALP field. ", "This is a possibility that has been exploited in the literature [@alishahiha_dbi_2004; @domcke_pbh_2017] in the context of inflationary models (though not so much for axion inflation), but to our knowledge such a study has not been performed for dark matter models. ", "As we will see, a very rich phenomenology arises when this possibility is allowed. ", "Of special interest is that this scenario will indeed be able to populate regions of the parameter space that can be tested in the near future, either with astrophysical observations or experimental searches. ", "Focusing on the coupling to nucleons, the main motivation for us in this respect is threefold. ", "First, as was already argued, we want to explore the possibility of building an ALP dark matter model with a larger such coupling. ", "Second, we ask ourselves if these models could lie on the region of parameter space to the left of the QCD axion band in . ", "Finally and concerning the Big Bang Nucleosynthesis bound that seems to restrict this area of parameter space, we would like to test its robustness constraining such ALP models.", "\n\nIn this work we study the viability of ALPs with a non-canonical kinetic term as dark matter candidates from a purely phenomenological perspective. ", "Let us nevertheless briefly mention some of the mechanisms that can give rise to this scenario. ", "For instance, a non-minimal coupling of the ALP field to gravity in the so-called Jordan frame induces a non-canonical kinetic function in the usual Einstein frame. ", "In the context of supergravity, an explicit breaking of the shift symmetry in the K[ä]{}hler potential also results in non-standard kinetic terms for the ALP. ", "Finally, in the context of compactifications, string theory *a priori* contains all the necessary ingredients to generate axions with non-canonical kinetic terms, caused, for example, by back-reaction effects. ", "However, no explicit construction of the models that we consider in this work exists as of today, and this task is beyond the scope of this paper. ", "We leave the study of the possibility of embedding this phenomenological study in a more complete framework for future work.", "\n\nThis paper is structured as follows: in  we discuss the effects of non-canonical kinetic terms and set up our explicit case study. ", "In  we study how this modified kinetic terms affects the cosmological evolution of the ALP field, and in  we analyse the isocurvature perturbations predicted in this setup. ", "In  we discuss the impact of allowing for a coupling to QCD in this scenario, and conclude in .", "\n\nBefore getting started on the details we note that, although in this paper we focus mainly on the example of gluon interactions, most of our discussion is completely general and can be applied to any other coupling. ", "Moreover, while the structure of interactions that we consider is inspired by that of pseudo-Nambu-Goldstone bosons, the essential qualitative features should also apply in the case of more general scalars and only depends on the singularities of the non-canonical kinetic terms.", "\n\nNon-canonical kinetic terms {#sec:NonstandardKT}\n===========================\n\nIn this section we examine the effect that a non-standard kinetic term can have on the dynamics of the ALP field. ", "Let us start with the Lagrangian $$\\label{eq:basic_lagrangian}\n{\\cal L} = \\frac{1}{2} K^2(\\phi)\\partial^\\mu\\phi\\partial_\\mu\\phi - V(\\phi),$$ where we have allowed for a general real scalar (and positive definite) function of $\\phi$, $K^{2}(\\phi)$, to scale the kinetic term and thus render it not canonically normalised. ", "For definiteness, we will work with the usual periodic potential for ALP fields, $$\\label{eq:potential}\nV(\\phi) = \\Lambda^4 \\left( 1 - \\cos \\frac{\\phi}{f_a} \\right).$$ We now proceed by performing a field redefinition to obtain the canonically normalised field. ", "The formal solution is to define $$\\label{eq:field_redefinition_general}\n\\varphi (\\phi) = \\int K(\\phi) d\\phi \\equiv g(\\phi),$$ and thus the Lagrangian for $\\varphi$ is $${\\cal L}(\\varphi) = \\frac{1}{2} \\partial^\\mu\\varphi\\partial_\\mu\\varphi - V(g^{-1}(\\varphi)).$$ Being canonically normalised, $\\varphi$ is the physical (propagating) field. ", "Let us see what kind of functions $K$ result in $\\varphi$ being a viable dark matter candidate.", "\n\nThe first condition is that $\\varphi$ behaves like cold dark matter in the late universe. ", "This requires that it oscillates harmonically at late times (see, e.g. [@arias_wispy_2012]). ", "Accordingly the kinetic term should not modify the dynamics close to the origin. ", "This is automatic if the kinetic term approaches a non-vanishing constant value close to the origin, $$K\\rightarrow {\\rm const.}=1\\quad{\\rm for}\\quad \\varphi\\rightarrow 0.$$ As indicated in the equation, this constant can be chosen to be equal to $1$ by a suitable choice of normalisation.", "\n\nSo why should we now choose a non-trivial function for $K$ and what shall we choose? ", "As already mentioned in the introduction, we would like to find a model with larger couplings, i.e. smaller $f_{a}$, that still gives a sufficient dark matter density. ", "Roughly speaking the problem of obtaining a sufficient energy density can be understood as follows. ", "For the potential Eq.", "  the maximal initial energy density is given by $\\Lambda^4$. This is linked to the mass $m$ of the particle via $\\Lambda^4=m^2f^2_{a}$. If $f_{a}$ is too small the initial and in consequence the final energy density is too small to make up all of the dark matter.", "\n\nOne way to avoid this problem would be to break the periodicity of the potential  such that the potential continues to grow for large field values, e.g. by exploiting a monodromy [@jaeckel_monodromy_2016].", "\n\nHere we will explore a different strategy. ", "As long as the Hubble constant is sufficiently large the evolution of the field is frozen and the energy density is approximately constant. ", "As discussed below the evolution and consequently the dilution of the energy starts when $H^2\\sim |V''(\\varphi)|$. Hence, we can increase the energy density today by choosing the kinetic function $K$ such that the potential becomes very flat for large field values[^2]. ", "A cartoon of this is shown in .", "\n\nUsing $$\\frac{\\partial V}{\\partial \\varphi} = \\frac{\\partial V}{\\partial \\phi} \\cdot \\frac{\\partial \\phi}{\\partial \\varphi} = \\frac{1}{K} \\frac{\\partial V}{\\partial \\phi},$$ we see that this can be easily achieved if $K$ has a singularity at some field value $\\phi=a$, $$K\\rightarrow\\infty\\quad{\\rm for}\\quad \\varphi\\rightarrow a.$$\n\nThis singular structure has an additional advantage: The non-canonically normalised field $\\phi$ will never exceed $\\phi=a$ during its evolution. ", "Limits such as the one discussed in  arising from BBN that are based on a sizeable field value at some earlier epoch can thus be avoided if $a$ is sufficiently small.", "\n\nA simple function that satisfies the above requirements while keeping the periodic properties intact is, $$\\label{eq:non_canonical_kinetic_term}\nK(\\phi) = \\frac{1}{\\cos \\left( \\frac{N\\phi}{f_a} \\right)} .$$\n\nWhile this choice might seem rather arbitrary at first, there are some arguments that make it more general than it seems. ", "The approach for obtaining a flattened potential for a scalar via a non-canonical kinetic term has been widely used in the context of inflationary cosmology [@alishahiha_dbi_2004; @domcke_pbh_2017]. ", "Indeed over the last years, $\\alpha$-attractor models [@kallosh_superconformal_2013; @kallosh_planck_2015] have attracted special attention. ", "In this context, [@galante_unity_2015] showed that the determining property of this class of models is the existence of a pole in the kinetic term. ", "More precisely, it is the order and the residue of the pole that play a key role, and not so much the precise functional form of the kinetic function. ", "We can therefore be confident that our results will not depend much on the specific choice of $K$. Similarly to [@galante_unity_2015], here we focus on the case of a second-order pole. ", "As we mentioned before, this case is better motivated and may arise, for instance, as a consequence of a non-minimal coupling to gravity. ", "Nevertheless, we check in Appendix  that our main conclusions remain unchanged if we allow for higher-order poles.", "\n\nAlso, recall that the shift symmetry $\\phi\\rightarrow \\phi + \\text{\\textit{const.}}$ of the ALP field is what protects its mass from large corrections. ", "It thus seems sensible to preserve or only slightly break this symmetry. ", "Indeed, by our choice of potential Eq.", " , we are assuming that a small explicit breaking is present. ", "This breaking typically occurs at the nonperturbative level [@peccei_strong_2008; @kim_axions_2010] and crucially preserves the discrete shift symmetry $\\phi\\rightarrow \\phi + 2 k \\pi f_a$, which allows us to retain a sufficient level of protection against quantum corrections. ", "We would like the kinetic term to preserve, at least, this discrete shift symmetry, which requires that $K(\\phi)$ is a periodic function of $\\phi/f_a$. These arguments quickly lead us to Eq.", " . ", "Once again, we stress that the fact that we are writing a specific kinetic term should not be understood as a construction of a complete model, bur rather as a benchmark for our phenomenological study.", "\n\nThe transformation to the canonically normalised field is given by $$\\label{eq:field_redefinition}\n\\varphi(\\phi) = \\frac{2f_a}{N} \\operatorname{arctanh}\\left( \\tan \\frac{N\\phi}{2f_a} \\right).$$ We should note that the poles of $K(\\phi)$ are located at $\\phi/f_a=\\pi/(2N)$. This means that, when doing the field redefinition , we are restricting the field space to $\\phi/f_a\\in (- \\frac{\\pi}{2N}, \\frac{\\pi}{2N})$. As already mentioned above this will become important when discussing the limits arising from a gluon coupling in . ", "In principle there exist a total of $N$ different branches $\\phi/f_a\\in \\left( (k-{\\frac{1}{2}})\\frac{\\pi}{N}, (k+{\\frac{1}{2}})\\frac{\\pi}{2N}\\right)$ where the field could be trapped. ", "However, the only one which has a minimum in the potential is the one closest to the origin. ", "In other branches, the field would slow-roll towards infinity[^3], making them unappealing for the phenomenologically purposes that the we have in mind. ", "For this reason, we focus on the phenomenologically viable region around zero.", "\n\nUsing the field redefinition  the Lagrangian for the canonically normalised field is given by $$\\label{eq:canonically_normalised_Lagrangian}\n{\\cal L} = \\frac{1}{2} \\partial^\\mu\\varphi\\partial_\\mu\\varphi - \\Lambda^4 \\left[ 1 - \\cos \\left( \\frac{2}{N} \\arctan \\left( \\tanh \\frac{N\\varphi}{2f_a} \\right) \\right) \\right].$$ By expanding about the origin, it can be checked that we indeed recover the quadratic behaviour for small field values. ", "The potential is plotted in  for different values of $N$. It indeed looks quite similar to what we imagined in .", "\n\nWhat about the equations of motion? ", "Let us assume that we have a homogeneous and isotropic field, $\\phi = \\phi (t)$ and consequently $\\varphi = \\varphi (t)$. The Klein-Gordon equation for a homogeneous and isotropic field in an expanding spacetime is $$\\ddot{\\varphi} + 3H\\dot{\\varphi}+\\partial_\\varphi V(\\varphi) = 0,$$ where $H$ is the Hubble expansion parameter.", "\n\nFor convenience we introduce the dimensionless field variable, $$\\psi = \\varphi / f_a,$$ in analogy to how the $\\theta$ angle relates to the original axion field. ", "Thus, we will be expressing the field value in terms of $f_a$ units. ", "The equation of motion can then be written as $$\\ddot{\\psi} + 3H \\dot{\\psi} + m^2 \\frac{1}{\\cosh N\\psi} \\sin \\left[ \\frac{2}{N} \\arctan \\left( \\tanh \\frac{N\\psi}{2} \\right) \\right]=0,$$ where we define $$m^2 = \\frac{\\Lambda^4}{f_a^2},$$ which corresponds to the second derivative of the physical field around the minimum at $\\psi=\\varphi=\\phi=0$. $m$ is the physical mass of the dark matter particles.", "\n\n![", "Potential for the canonically normalised field, plotted for various values of $N$. Note that the potential is quadratic for small field value but flattens away from the origin.[]{data-label=\"fig:potential\"}](fig_potential_nonorm){width=\"70.00000%\" height=\"\\textheight\"}\n\nCosmological evolution and dark matter production {#sec:Cosmological_evolution}\n=================================================\n\nThe goal of this section is to find an estimate for the dark matter density in the model defined above and compare it with the observed abundance. ", "The energy density of the field depends on the parameters $(f_a, m, N)$, as well as the initial conditions for the field and its cosmological evolution. ", "For this purpose it is useful to briefly recall the misalignment mechanism [@preskill_cosmology_1983; @abbott_cosmological_1983; @dine_not-so-harmless_1983], which gives us the basic idea of how our field evolves in a cosmological setup.", "\n\nThe misalignment mechanism {#sec:misalignment}\n--------------------------\n\nHere we briefly summarise how a misaligned light scalar field evolves in an expanding spacetime, closely following the description in [@arias_wispy_2012]. ", "Let us consider the simplified case of a real scalar field with Lagrangian $${\\cal L} = \\frac{1}{2}\\partial_\\mu \\phi \\partial^\\mu \\phi - \\frac{1}{2}m_\\phi^2\\phi^2.$$ Note that our final goal is not the harmonic case but a more complicated potential with strong anharmonicities. ", "However, solving this simplified equation will give us helpful insights to tackle the anharmonic potential. ", "In a homogeneous setting, the equation of motion for $\\phi$ is $$\\label{eq:simpleeom}\n\\ddot{\\phi} + 3H\\dot{\\phi} + m_\\phi^2 \\phi = 0.$$ This is the equation of a damped harmonic oscillator. ", "There are two distinct regimes in the evolution of $\\phi$. First, at very early times when $3H \\gg m_\\phi$, the oscillator is overdamped and so the solution is $\\dot{\\phi} = 0$, and the field is stuck at its initial value. ", "At a later time $t_1$ such that $3H (t_1) = m_\\phi$, the damping has decreased enough so that the field can start to oscillate. ", "The equation of motion for the oscillating regime can then be solved using the WKB approximation: $$\\label{eq:harmonic_WKB}\n\\phi(t) \\simeq \\phi(t_1) \\left( \\frac{a(t_1)}{a(t)} \\right) ^{3/2} \\cos \\left( m_\\phi (t-t_1) \\right),$$ where $a(t)$ is the scale factor. ", "We see that the energy density, which is proportional to the amplitude of the oscillations squared, dilutes with expansion as $a^{-3}$. This means that the oscillating field behaves like pressureless matter for all processes mediated by gravitation. ", "In this simplified setup, the energy density in the axion field today is $$\\label{eq:harm_energy_density}\n\\rho_\\phi (t_0) \\simeq 0.17 \\frac{\\text{keV}}{\\text{cm}^3}\\ \\sqrt{\\frac{m_\\phi}{\\text{eV}}} \\left( \\frac{\\phi_0}{10^{11}\\ \\text{GeV}} \\right)^2 {\\cal F}(T_1),$$ where $${\\cal F}(T_1)= \\frac{\\left( g_\\star(T_1) / 3.36 \\right)^{\\frac{3}{4}}}{\\left( g_{\\star S}(T_1) / 3.91\\right)}$$ is a smooth function (cf.", " [@arias_wispy_2012]) that varies from $1$ to $\\sim 0.3$ when $T_1\\in (T_0,200\\ \\text{GeV})$. The last result assumes that the field starts oscillating during radiation domination and that the comoving entropy is conserved.", "\n\nAnalytical estimate of the dark matter density {#sec:analytic_estimate}\n----------------------------------------------\n\nAfter this small detour to explain the misalignment mechanism for the harmonic potential, let us go back to our case of interest: the ALP field with a non-standard kinetic term. ", "Recall that the equation of motion that we have obtained for the physical field $\\psi$ is $$\\label{eq:nonlinear_eom}\n\\ddot{\\psi} + 3H \\dot{\\psi} + m^2 \\frac{1}{\\cosh N\\psi} \\sin \\left[ \\frac{2}{N} \\arctan \\left( \\tanh \\frac{N\\psi}{2} \\right) \\right] = 0.$$ We see that in the limit of small $\\psi$, when $N\\psi \\ll 1$, this reduces to the simplified case and the evolution is exactly as we described in the simple real scalar field case. ", "However, the situation is different in the regime $N\\psi \\gtrsim 1$. As we can expect by looking at , the flatness of the potential away from the minimum at $\\psi=0$ will have the effect of delaying the start of the oscillations. ", "Moreover, the oscillations, once they start, will not be harmonic until the damping has made the amplitude decrease enough to be in the small field regime. ", "This means that the WKB approximation might not be as good in this case.", "\n\nAlthough we suspect that the WKB approximation might break down when the amplitude of the oscillations is big due to the anharmoniticity of the potential, we will use it as a first approximation to solve the equation of motion and get an analytical estimate of the result. ", "We will later contrast this to a more precise numerical computation. ", "In the analytical approach, we will study the two regimes, where the damping is over- and under-critical, respectively, and build up the global evolution of the field by glueing together the solution for each regime. ", "Our goal is to compute the current energy density of dark matter-like particles given an initial condition for the physical field.", "\n\nAs we saw, the first thing to do is to find the time when the oscillations start. ", "In analogy with the simple case, where the condition was $3H = m_\\phi$, we use a generalisation of this formula for a non harmonic potential, namely $$3H = \\left| V^{\\prime\\prime} (\\psi_0) \\right| ^{1/2}.$$ In  we will see that this indeed works reasonably well to determine when the oscillations start, as it takes into account the flatness of the potential away from the origin. ", "In the limit of large $N\\psi\\gg 1$, the second derivative of the potential can be written as $$V^{\\prime\\prime}(\\psi) \\simeq -2Nm^2 \\exp^{-N\\psi}\\sin \\frac{\\pi}{2N}.$$ This turns out to be a very good approximation for intermediate and even small values of $N\\psi$. One key difference with the harmonic case is that here the point in time when oscillations begin depends on the initial field value $\\varphi_0$. With this we already see that the oscillations are exponentially delayed for big $N\\psi$: $$\\label{eq:tstart}\nt_s \\equiv t_{\\text{start}} = \\frac{3}{2\\left| V^{\\prime\\prime}(\\psi_0) \\right| ^{1/2}} \\simeq \\frac{3}{2m} \\left( 2N\\sin \\frac{\\pi}{2N} \\right)^{-1/2} \\exp^{\\frac{N\\psi_0}{2}} \\propto \\exp^{\\frac{N\\psi_0}{2}},$$ where we have assumed radiation domination so that $H=1/(2t)$. We now use this as an initial condition for the WKB approximation. ", "In this approximation, the energy density of the physical field $\\varphi$ is $$\\label{eq:energy_density_semianalytic}\n\\rho_\\varphi (T) = \\frac{1}{2} m^2 f_a^2 \\psi_0^2 \\frac{g_{\\star S}(T)}{g_{\\star S}(T_s)} \\left( \\frac{T}{T_S}\\right)^3,$$ where we have used the conservation of comoving entropy $S=sa^3$ to express it in terms of temperatures instead of scale factors. ", "Using the expression for the Hubble constant during radiation domination $$\\label{eq:Hubble_temperature}\nH(T) = 1.66\\sqrt{g_\\star(T)} \\frac{T^2}{m_{\\text{pl}}},$$ we can express the current energy density of the field as a function of the initial condition $\\psi_0$, $$\\rho_\\varphi \\simeq 0.17\\ \\frac{\\text{keV}}{\\text{cm}^3} \\cdot \\sqrt{\\frac{m}{1\\ \\text{eV}}} \\left( \\frac{f_a}{10^{11}\\ \\text{GeV}} \\right)^{2} \\psi_0^2\\ {\\cal F}(T_s) \\cdot \\left( 2N \\sin \\frac{\\pi}{2N} \\right)^{-3/4} \\exp^{\\frac{3}{4}N\\psi_0}.$$ We can compare this density with the one corresponding to a harmonic potential. ", "The result is $$\\label{eq:enhancement_analytic}\n\\frac{\\rho^{\\text{anh}}}{\\rho^{\\text{harm}}} \\simeq \\frac{\\mathcal{F}(T_1)}{\\mathcal{F}(T_s)} \\cdot \\left( 2N \\sin \\frac{\\pi}{2N} \\right)^{-3/4} \\exp^{\\frac{3}{4}N\\psi_0} \\sim \\exp^{\\frac{3}{4}N\\psi_0},$$ so the energy density is exponentially enhanced[^4] for large $N$ and initial condition $\\psi_0$. The precise exponent that we obtain here should be taken as a very rough estimate. ", "Indeed, a numerical computation is needed to get a precise result, which is what we will aim for in the following section.", "\n\nAs we can see in the enhancement is exponential in $N\\psi$. This implies that the field values required to yield the correct dark matter abundance are usually not too large. ", "In the phenomenologically interesting region we usually do not need to have values for $N\\psi$ that are bigger than $50$. The largest initial field values happen for $N=1$ and are of order $50$ in units of $f_a$.\n\nAnother constraint that we have to care about is that the field is behaving like dark matter once it comes to dominate the dynamics of the universe, i.e. we do want to avoid having an additional phase of inflationary expansion driven by $\\psi$. A sufficient condition for this is that the field has already started to oscillate at matter radiation equality. ", "Making use of the more precise numerical estimate that we will obtain in the next section, we can estimate what region of parameter space satisfies this condition, $$\\label{eq:second_inflation_limit}\nf_a \\gtrsim 10^{-6}\\ \\mathrm{GeV}\\cdot N\\cdot \\left( \\frac{\\mathrm{eV}}{m} \\right)^{0.81}.$$ This condition excludes the very small values of the mass and the decay constant in the upper left corner of , which are already in tension with the nEDM experiment, BBN observations and the limits from [@hook_probing_2017].", "\n\nNumerical computation {#sec:numerics}\n---------------------\n\nHaving obtained a simple estimate of the cosmological evolution of the field, we now make use of a numerical solution of the equation of motion to have a more precise result. ", "Our goal in this subsection is to quantify how much the solution for the nonlinear equation of motion deviates from the harmonic case .", "\n\nFollowing the usual practice for dealing with anharmonicities in the ALP potential (see [@turner_cosmic_1986; @lyth_axions_1992; @strobl_anharmonic_1994; @bae_update_2008], [@diez-tejedor_cosmological_2017] has a slightly different definition), we use an effective parametrisation in terms of an anharmonicity function $f(\\psi_0)$, such that $$\\rho^{\\text{anh}} = f(\\psi_0) \\rho^{\\text{harm}},$$ where $\\rho$ is the energy density of the ALP field, computed late enough when it is already behaving as cold dark matter. ", "This function only depends on the initial misalignment angle, and it should account for all the deviations from the harmonic solution. ", "This approach is normally used to account for departures from the quadratic potential in the usual axion and ALP models. ", "Our case is slightly different, mostly because we are dealing with an unbounded field range. ", "As a consequence, the usual functional form for $f(\\psi_0)$ does not work here. ", "Guided by the result obtained in the analytical approximation, we work with the following ansatz for the anharmonicity function: $$\\label{eq:anh_func_ansatz}\nf(\\psi_0) = {\\mathrm{e}}^{b N \\psi_0},$$ where $b$ is a real parameter to be determined. ", "This ansatz accounts for the exponential enhancement in energy density that we have found analytically. ", "The normalisation needed is that $f(\\psi_0) \\rightarrow 1$ when $\\psi_0 \\rightarrow 0$, so as to recover the harmonic case in the small field limit.", "\n\nThe goal now is to fit the ansatz to a numerical computation of the energy density. ", "To set the problem in a more straightforward way, we want to compare the numerical solution of $$\\ddot{\\psi} + 3\\tilde{H}(\\tilde{t}) \\dot{\\psi} + \\tilde{m}^2 \\frac{1}{\\cosh N\\psi} \\sin \\left[ \\frac{2}{N} \\arctan \\left( \\tanh \\frac{N\\psi}{2} \\right) \\right] = 0$$ with the solution for the damped harmonic oscillator equation $$\\ddot{\\psi} + 3\\tilde{H}(\\tilde{t}) \\dot{\\psi} + \\tilde{m}^2 \\psi = 0.$$ In this computation we use dimensionless quantities measured in units of $m$, denoted with a tilde: $\\tilde{H}, \\tilde{t}, \\tilde{m} \\dots$ In these units, the time for the start of the oscillations in the harmonic case is $\\tilde{t}_1^{\\text{harm}} = 3/2$ (assuming radiation domination), and the period of the oscillations is $2\\pi$. We solve the equations numerically until we are well within the adiabatic regime in both cases (that is, when the amplitude of the oscillations has decreased enough so that the non-canonical potential is well approximated by the harmonic one). ", "Then, we compute the energy density $\\rho = (1/2)f_a^2\\dot{\\psi}^2 + V(f_a\\psi)$ and extract the anharmonicity factor as the quotient of both energy densities. ", "As we are within the adiabatic regime, $\\rho$ scales as $\\rho\\propto a^{-3}$ in both cases, so the quotient will stay constant. ", "An example of the numerical solution can be seen in .", "\n\n![", "Numerical solution of the non-canonical equation of motion compared to the harmonic solution, using $N=5$ and $\\psi_0=1.5$ as an example. ", "The top panel shows the solution for the field as a function of time, while the middle and bottom ones show the energy density of the field and the quotient of energy densities for the harmonic and non-canonical equations of motion. ", "Note that this quotient approaches a constant as the adiabatic regime is reached, allowing us to obtain the anharmonicity factor. ", "As a comparison and confirmation of our analytical results, the top panel also shows the time at which the oscillations are predicted to start in our analytical approach, Eq. ", ".[]{data-label=\"fig:anh_function_evolution\"}](fig_anh_function_evolution){width=\"75.00000%\" height=\"\\textheight\"}\n\nThis process is repeated for a large number of values of $\\psi_0$ and $N$ and we fit the results to the ansatz . ", "We obtain a very good fit with a value of $b = 0.56$, as can be seen in . ", "One should note that we are fitting a two dimensional data sample with just one parameter, so finding a good fit confirms that we have chosen an adequate ansatz.", "\n\n![", "Fit of the anharmonicity function to the ansatz in Eq. . ", "We plot the result of the fit for a set of values of $N$ and a range of the initial misalignment angle $\\psi_0\\in(0,5)$.[]{data-label=\"fig:anh_function_fit\"}](fig_anh_function_fit_black){width=\"75.00000%\" height=\"\\textheight\"}\n\nThe anharmonicity function allows us to compute the energy density of the non-canonical ALP field in a very simple way, combining the harmonic solution with the anharmonicity function . ", "As long as we are within the adiabatic regime, the energy density in this approximation is given by $$\\label{eq:anharm_energy_density}\n\\begin{aligned}\n\\rho_\\psi^{\\text{anh}} (t) &\\simeq \\frac{1}{2} f_a^2 m^2 f(\\psi_0,N)\\psi_0^2 \\left( \\frac{a_1^{\\text{harm}}}{a(t)} \\right)^3 \\\\\n&= \\frac{1}{2} f_a^2 m^2 f(\\psi_0,N) \\psi_0^2 \\frac{g_{\\star S}(T)}{g_{\\star S}(T_1^{\\text{harm}})} \\left( \\frac{T}{T_1^{\\text{harm}}}\\right)^3.", "\n\\end{aligned}$$ The key difference between this equation and is that here we use the well known solution of the harmonic equation of motion, instead of the full noninear one that arises in our non-canonical setup. ", "All the information about the nonlinearity is encoded in the anharmonicity function, making it much more manageable.", "\n\nIn the analytical approach, we found that the quotient between non-canonical and canonical density scales as $\\rho_\\text{NC}/\\rho_\\text{C}\\sim {\\mathrm{e}}^{(3/4)N\\psi_0}$. In the full numerical approach[^5] we find a somewhat lower coefficient for the exponent of $0.56$.\n\nWe have seen that a non-canonical kinetic term can indeed enhance the energy density of ALP dark matter. ", "In the next few sections we will make use of the solutions for the cosmological evolution of the non-canonical ALP field to make predictions about its phenomenology, and to apply it to some particularly interesting cases.", "\n\nIsocurvature perturbations {#sec:Isocurvature_perturbations}\n==========================\n\nSo far, we have assumed the initial misalignment angle $\\theta_0 = f_a \\phi_0$ to be a constant value all throughout the universe, but of course we have to take into account fluctuations, e.g. those imprinted by inflation. ", "We do this by taking the initial misalignment angle as a spatially varying quantity, and describing it in terms of its average and variance. ", "Two very distinct scenarios arise, depending on whether the mechanism that gives rise to the ALP field turns on before or after the inflationary epoch of our Universe.", "\n\nIf the ALP field was established, e.g. by spontaneous symmetry breaking, after inflation, the variance of the angle can be large even within our Hubble volume. ", "The mean value will be $\\phi_0 = 0$ and the energy density is given by the fluctuations as well as other effects such as, e.g. the decay of topological defects [@sikivie_cosmic_1991; @hagmann_axion_2001]. ", "In particular the latter contributions are not well understood and may also have some model dependence when going beyond the QCD axion.", "\n\nTo avoid this, we will focus on the scenario where the ALP field was present during inflation. ", "Classically, if the ALP field was established before inflation, then the spatial variance of the field within a Hubble patch will be washed out as spacetime is stretched during inflation. ", "This means that $\\sigma_\\phi^2 \\rightarrow 0$, and the misalignment field can take any value $\\phi_0$ in our Hubble patch.", "\n\nHowever, this is not completely true, as any light field present during inflation will acquire quantum fluctuations (see, e.g. [@linde_particle_2005]). ", "The power spectrum of such fluctuations for a canonically normalised scalar field is scale invariant, $$\\braket{\\left| \\delta \\phi (k) \\right|^2} = \\left( \\frac{H_I}{2\\pi} \\right)^2 \\frac{1}{k^3 / (2\\pi^2)}.$$ These fluctuations can be thought of as arising from a thermal spectrum at the Gibbons-Hawking temperature $T_{GH}=H_I/(2\\pi)$ [@gibbons_cosmological_1977]. ", "As long as these fluctuations do not restore the spontaneously broken symmetry that gives rise to the ALPs, i.e., as long as[^6] $T_{GH}<f_a$, this will imprint small fluctuations on top of the otherwise homogeneous ALP field. ", "The corresponding fluctuations of the misalignment angle in Fourier space will have an amplitude of $\\sigma_\\phi (k) = H_I/(2\\pi f_a)$. In real space, the fluctuations are of a size $\\sigma_\\phi = \\gamma H_I/(2\\pi f_a)$, where $\\gamma \\sim \\orderof (1)$ is a dimensionless factor that effectively encodes the dispersive effect of the logarithmically divergent small $k$ modes (see [@lyth_axions_1992]). ", "Its value depends on the length scales that we are interested in. ", "Following [@hertzberg_axion_2008] we will set $\\gamma = 2$ for the CMB characteristic scale $k_\\star = 0.05\\ \\text{Mpc}^{-1}$.\n\nAs the ALP has a negligible contribution to the total energy density of the universe during inflation, fluctuations in the field do not contribute to the usual curvature perturbations. ", "Rather, they manifest themselves as fluctuations in the ratio of the number density of ALPs to the total entropy density, and are completely uncorrelated with the curvature perturbations. ", "This is the reason why they are called *entropy* or *isocurvature perturbations*. ", "As their interactions with other standard model particles are greatly suppressed, ALPs do not thermalise with the other species and their perturbations remain isocurvature [@weinberg_must_2004]. ", "At later stages of the cosmological evolution, the dark matter ALPs pick up a significant contribution to the energy density of the universe, and so they contribute to the temperature and polarisation fluctuations of the CMB as cold dark matter isocurvature modes.", "\n\nPlanck has set strong bounds on isocurvature perturbations [@ade_planck_2016], $$\\beta_\\text{iso} = \\frac{\\Delta_\\phi^2(k_\\star)}{\\Delta_\\phi^2(k_\\star) + \\Delta_{\\cal R}^2 (k_\\star)} < 0.038$$ at $95 \\%$ CL. ", "Here, $\\Delta_\\phi^2(k_\\star)$ and $\\Delta_{\\cal R}^2 (k_\\star)$ are the power spectrum of the axion and curvature perturbations at the pivot scale $k_\\star$, respectively. ", "Once the value of $\\Delta_{\\cal R}^2 (k_\\star)$ is set (Planck gives $ \\Delta_{\\cal R}^2 (k_\\star) = 2.1(9)\\times 10^{-9} $), this translates into a bound on the axion isocurvature fluctuations.", "\n\nTo use this limits to constrain our scenario, we have to compute our prediction for $$\\label{eq:Isocurvature_spectrum}\n\\Delta_\\phi^2 = {\\left.\\Braket{ \\left( \\frac{\\delta\\rho_\\phi}{\\rho_\\phi}\\right) ^2 }\\right\\rvert_{t_\\text{CMB}}^{}},$$ that is, we need to evolve the fluctuations in the energy density until the time of emission of the CMB and compare them with the homogeneous average value.", "\n\nIf the evolution of the field is linear, as it is in the case of canonical ALP models with a purely quadratic potential, the power spectrum is constant during the cosmological evolution. ", "As a consequence, one can evaluate it at any point, such as right after inflation and before the onset of the oscillations in the ALP field. ", "However, in any model that contains anharmonicities, the evolution at early times will be nonlinear, which implies that $\\Delta_\\phi^2$ will evolve nontrivially after inflation. ", "Thus, to arrive at the correct prediction for the isocurvature perturbations, we have to track the evolution of the fluctuations until late times.", "\n\nIn addition to the limits from isocurvature fluctuations, the inflationary fluctuations[^7] in the ALP field also forbid tuning the initial misalignment angle with arbitrary precision. ", "In fact, there is an unavoidable limit to this tuning, and it is that our tuning precision cannot be better than the fluctuations, with $\\sigma_\\theta = \\gamma H_I/(2\\pi f_a)$, as was argued in [@wantz_axion_2010]. ", "This has two related consequences. ", "The first is that the initial misalignment angle cannot be infinitely close to zero. ", "The requirement that the current ALP energy density is not bigger than the measured dark matter density $\\Omega_C h^2 \\sim 0.12 $ then sets a bound on the parameter space. ", "This bound is model independent (as long as all the potentials are approximately quadratic for small $\\theta$) and roughly requires $$m < \\left( \\frac{10^{12} \\text{ GeV}}{H_I} \\right)^4 \\text{ eV}.$$ Secondly, if the field range is compact (as for the usual canonical ALP), an argument similar to the one above tells us that some regions of the parameter space will not yield enough energy density to account for all the dark matter. ", "Indeed, it is not possible to tune the initial value of the field at the top of the potential with infinite precision, due to the presence of fluctuations. ", "The requirement here is that $\\pi - \\theta_0 < \\gamma H_I/(2\\pi f_a)$. This particular limit will strongly depend on the anharmonicity of the potential, so it is not possible to give a more explicit expression. ", "We discuss some particular cases in the next subsection. ", "However, this last effect will not be relevant in our non-canonical model, as there we have an unbounded field range (our potential does not have a maximum).", "\n\nIsocurvature perturbations for anharmonic potentials {#sec:Isocurvature_perturbations_anharmonic}\n----------------------------------------------------\n\nWe now present a general analytical expression to compute the isocurvature perturbations in general ALP models where the potential might have big anharmonicities. ", "We do this using the anharmonicity function formalism that we presented in the previous section. ", "An equivalent result was derived in [@kobayashi_isocurvature_2013] using the $\\delta N$ formalism. ", "Here we provide a more straightforward derivation and extend the use of the formula to more general potentials.", "\n\nTo evaluate expression , we will use the fact that at $t_\\text{CMB}$ the field should already be oscillating harmonically, as observations require it to behave as cold dark matter already by the time of matter-radiation equality. ", "As we are already well within the adiabatic regime, the anharmonicity function approach will work well to describe the evolution of the energy density, which means that we can use equation . ", "As fluctuations are small, we can work to linear order in $\\sigma_\\phi$ to find[^8] $$\\label{eq:isocurvature_anharmonic}\n\\begin{aligned}\n\\Delta_\\phi^2 &= {\\left.\\Braket{ \\left( \\frac{\\delta\\rho_\\phi}{\\rho_\\phi}\\right) ^2 }\\right\\rvert_{t_\\text{CMB}}^{}} = \\left( {\\left.\\frac{\\partial \\log \\rho_\\phi(t_\\mathrm{CMB})}{\\partial \\log \\phi}\\right\\rvert_{\\phi_0}^{}}\\right)^2 \\Braket{ \\left( \\frac{\\delta\\phi_0}{\\phi_0}\\right) ^2 }\\\\\n&=4 \\frac{\\sigma_\\phi^2}{\\phi_0^2} \\left( 1 + \\frac{1}{2} {\\left. ", "\\frac{\\d \\log f(\\theta)}{\\d \\log \\theta}\\right\\rvert_{\\theta_0}^{}} \\right)^2 \\\\\n&= 4\\gamma^2 \\frac{H_I^2}{4\\pi^2 f_a^2 \\theta_0^2} \\left( 1 + \\frac{1}{2} {\\left. ", "\\frac{\\d \\log f(\\theta)}{\\d \\log \\theta}\\right\\rvert_{\\theta_0}^{}} \\right)^2.", "\n\\end{aligned}$$ Note that even if this quantity is evaluated at $t_\\text{CMB}$, it directly depends only on the initial misalignment angle and the statistics of its fluctuations at inflation. ", "All the information about the later evolution is encoded in the anharmonicity function.", "\n\nWe will now apply the formula to both the case of the canonical ALP with a cosine potential and to our non-canonical model, and compare the results with the harmonic approximation.", "\n\nFor the harmonic case, where $f(\\theta_0) = 1$, we have the usual expression $$\\Delta^2_\\phi = \\gamma^2 \\frac{H_I^2}{\\pi^2 f_a^2 \\theta_0^2}.$$ The constraints that one finds, for different values of the energy scale of inflation, are presented in . ", "The harmonic case in particular corresponds to the first column of plots.", "\n\nOf course, the harmonic case can only be an approximation valid for small $\\theta$, as ALP models should preserve the shift symmetry $\\theta + 2\\pi$. Among the potentials that satisfy this condition, the most commonly used is $V(\\theta) = m^2(1-\\cos\\theta)$. The anharmonicity function that appears in this case was studied in [@turner_cosmic_1986; @lyth_axions_1992; @strobl_anharmonic_1994; @bae_update_2008]. ", "After comparing with numerical simulations, we have decided to use a slightly different version of it, proposed in [@diez-tejedor_cosmological_2017] and which provides a better fit to the numerical data, $$\\label{eq:cosine_AF}\nf(\\theta_0) = \\left[ \\log \\left( \\frac{e}{1-\\left( \\theta_0 / \\pi\\right)^4}\\right)\\right]^{3/2} .$$ With this, it is easy to arrive to the following expression for the isocurvature perturbations, $$\\Delta^2_\\phi = \\gamma^2 \\frac{H_I^2}{\\pi^2 f_a^2 \\theta_0^2}\\left( 1 + \\frac{3}{f(\\theta_0)^{2/3}} \\cdot \\frac{1}{(\\pi / \\theta)^4 -1} \\right)^2.$$ Note that this reduces to the harmonic result for small $\\theta_0$. However, for angles close to $\\pi$, the isocurvature perturbations are greatly enhanced. ", "As expected, this function diverges at $\\theta_0=\\pi$, but as we have noted before, this limit is unattainable because of the fluctuations in the field. ", "In , we can see that the limits we can put on the parameter space are a bit stronger than in the harmonic case, in particular for low values of $m$ and $f_a$, which correspond to large values of the initial misalignment angle.", "\n\n[1]{} ![", "Isocurvature limits arising in the three different models studied: the harmonic potential (left), the canonical ALP (centre) and the non-canonical one (right). ", "From top to bottom, we plot the limits in the $(m,f_a)$ parameter space for different values of the energy scale of inflation $H_I$. Note that a higher $H_I$ puts stronger bounds on ALP models. ", "In fact, $H_I \\gtrsim 10^{12}$ GeV rules out the complete parameter space, whereas for $H_I \\lesssim 10^6$ GeV, the limits are very weak.[]{data-label=\"fig:isocurvature\"}](fig_isocurvature_H7_inv \"fig:\"){width=\"1\\linewidth\"} \\[fig:isocurvature\\_H7\\]\n\n\\\n\n[1]{} ![", "Isocurvature limits arising in the three different models studied: the harmonic potential (left), the canonical ALP (centre) and the non-canonical one (right). ", "From top to bottom, we plot the limits in the $(m,f_a)$ parameter space for different values of the energy scale of inflation $H_I$. Note that a higher $H_I$ puts stronger bounds on ALP models. ", "In fact, $H_I \\gtrsim 10^{12}$ GeV rules out the complete parameter space, whereas for $H_I \\lesssim 10^6$ GeV, the limits are very weak.[]{data-label=\"fig:isocurvature\"}](fig_isocurvature_H9_inv \"fig:\"){width=\"1\\linewidth\"} \\[fig:isocurvature\\_H9\\]\n\n\\\n\n[1]{} ![", "Isocurvature limits arising in the three different models studied: the harmonic potential (left), the canonical ALP (centre) and the non-canonical one (right). ", "From top to bottom, we plot the limits in the $(m,f_a)$ parameter space for different values of the energy scale of inflation $H_I$. Note that a higher $H_I$ puts stronger bounds on ALP models. ", "In fact, $H_I \\gtrsim 10^{12}$ GeV rules out the complete parameter space, whereas for $H_I \\lesssim 10^6$ GeV, the limits are very weak.[]{data-label=\"fig:isocurvature\"}](fig_isocurvature_H11_inv \"fig:\"){width=\"1\\linewidth\"} \\[fig:isocurvature\\_H12\\]\n\n\\\n\nFinally, we turn to the non-canonical case. ", "The main difference with the canonical ALP, aside from the shape of the potential, is that here we are dealing with an unbounded field range. ", "As the potential is asymptotically flat, it is always possible to enhance the production of ALPs by choosing a larger initial misalignment angle, as we saw in . ", "This means that this model can always evade the limits related with to underproduction of dark matter. ", "Using the anharmonicity function that we derived in the previous section, we find that the isocurvature power spectrum generated in this scenario is $$\\Delta^2_\\phi = \\gamma^2 \\frac{H_I^2}{\\pi^2 f_a^2 \\theta_0^2}\\left( 1 + \\frac{1}{2} b N \\theta_0 \\right)^2,$$ where $b=0.56$. Again, this reduces to the harmonic case for small $\\theta$. The last column of plots in  illustrate the limits that arise from the Planck data. ", "Note that in the harmonic and canonical model featuring a compact field range a strong restriction on the parameter space is given by the requirement to produce enough dark matter (the limits arising from this condition are shaded in purple in ). ", "As we have already argued, this limit is not present in our non-canonical setup, which features an unbounded field range. ", "As a consequence, this model opens up a large region of parameter space, corresponding to low masses and decay constants, that was disfavoured until now.", "\n\nFinally let us remark that, as is well known, high scale inflation strongly constraints ALP models due to the generation of large isocurvature perturbations, which are not seen in the CMB. ", "The tensor to scalar ratio $r$ is strongly correlated with a high scale of inflation, so a detection of primordial gravitational waves would put a strong constraint on all axion and ALP dark matter models, including ours. ", "Future experiments [@matsumura_mission_2014; @kogut_primordial_2011; @abazajian_cmb-s4_2016] are expected to increase the sensitivity in measuring $r$ and thus the energy scale of inflation.", "\n\nCoupling to QCD: Temperature dependent mass {#sec:QCD}\n===========================================\n\nSo far, we have not assumed a coupling of the ALP to any other field. ", "In what follows, we will allow for a coupling to gluons via a term $\\theta G \\tilde{G}$. We will study two distinct cases. ", "First, we contemplate the possibility of having a non-canonical kinetic term in an otherwise QCD-axion model. ", "Then, we add an extra term to the Lagrangian which, as we will see, allows us to construct a model of light ALPs that enjoys relatively strong gluon couplings.", "\n\nThe QCD axion\n-------------\n\nIn this section we will focus on the QCD axion as introduced by Peccei and Quinn as a solution to the strong CP problem in quantum chromodynamics (QCD) [@peccei_cp_1977; @weinberg_new_1978; @wilczek_problem_1978].", "\n\nThe Lagrangian for the canonically normalised axion field is now $$\\label{eq:QCD_lagrangian}\n{\\cal L}_\\phi = \\frac{1}{2} \\partial^\\mu \\phi \\partial_\\mu \\phi - \\Lambda_{\\text{QCD}}^4 \\left( 1-\\cos \\frac{\\phi}{f_a}\\right),$$ and as usual we can define the angle $\\theta = \\phi/f_a$, so that $\\theta\\in \\left( -\\pi,\\pi \\right]$. For our modification with a non-canonically normalised field, we have $$\\label{eq:QCD_noncan_lagrangian}\n{\\cal L}_{\\phi} = \\frac{1}{2 \\cos ^2 \\left( N \\frac{\\phi}{f_a} \\right)} \\partial^\\mu \\phi \\partial_\\mu \\phi - \\Lambda_{\\text{QCD}}^4 \\left( 1-\\cos \\frac{\\phi }{f_a}\\right),$$ and after we perform a field redefinition to have it canonically normalised, we find the Lagrangian $$\\label{eq:QCD_noncan_lagrangian_norm}\n{\\cal L}_\\varphi = \\frac{1}{2} \\partial^\\mu \\varphi \\partial_\\mu \\varphi \n- \\Lambda_{\\text{QCD}}^4 \\left[ 1-\\cos \\left( \\frac{2}{N} \\arctan \\left( \\tanh \\frac{N\\varphi}{2f_a} \\right) \\right) \\right].$$ There is just one difference that makes the QCD axion case particular, and it is that here the energy scale appearing in the potential is fixed by QCD to be [@di_cortona_qcd_2016] $$\\label{eq:QCD_energy_scale}\n\\Lambda_{\\text{QCD}} = f_\\pi m_\\pi \\frac{\\sqrt{m_u m_d}}{m_u + m_d} \\simeq 76\\ \\text{MeV}.$$ It is easy to see that the mass of the axion, $m_a$, is given by $f_am_a = \\Lambda_{\\text{QCD}}^2$. It is important to note that the numerical value quoted above is only valid at zero (or very low) temperatures. ", "Indeed, the axion potential is affected by finite temperature effects, such that the mass of the axion varies with temperature. ", "At low temperatures below the QCD critical temperature $T_\\mathrm{crit}\\sim 160-170\\ \\text{MeV}$, the mass remains roughly constant[^9]. ", "That said, much of the dynamics that is of interest to us will happen in the early universe, at temperatures close or above $T_\\mathrm{crit}$. There are different ways to compute the temperature dependence of the axion mass [@turner_cosmic_1986; @bae_update_2008; @wantz_axion_2010; @wantz_topological_2010; @di_cortona_qcd_2016; @borsanyi_axion_2016]. ", "The function that controls the temperature dependence of the axion mass is the topological susceptibility $\\chi(T)$, which is usually parametrised as a power law: $$\\label{eq:axion_mass_T}\nm_a^2(T) = \\frac{\\chi (T)}{f_a^2}, \\quad \\text{where}\\quad \\chi(T) \\simeq \\chi_0 \\left( \\frac{T}{T_{\\mathrm{crit}}}\\right)^{2\\alpha}.$$ Here we will use $2\\alpha = -7.1$ and $\\chi_0 = 0.11$, from recent lattice computations [@borsanyi_axion_2016] that are consistent with the instanton values up to an overall normalisation factor.", "\n\nWe see that the main effect is that the mass of the axion is approximately constant until $T_\\mathrm{crit}$, and then it drops as a power law, so that the axion is essentially massless at high temperatures. ", "The most important implication of the temperature dependent mass is that a smaller mass at early times can delay the start of the oscillations of the field, which in turn results in a higher energy density of axionic dark matter today. ", "This happens both for the canonical and non-canonical axion models.", "\n\nAnharmonicity function and isocurvature perturbations revisited: Temperature dependence\n---------------------------------------------------------------------------------------\n\nWe have seen that coupling ALPs to QCD through $\\phi G\\tilde{G}$ results in a temperature-dependent mass for the ALP, both in the canonical and non-canonical setup. ", "This of course has an impact on its cosmological evolution, which can be of importance in computing observables such as the isocurvature perturbations that we discussed in . ", "To account for this effect, we will modify the anharmonicity function formalism that we introduced in  to incorporate the temperature dependence. ", "That is, we want to compute $$F_T(\\theta_0,f_a) \\equiv \\frac{\\rho^{\\mathrm{anh}}_T}{\\rho^{\\mathrm{harm}}},$$ evaluated at a point in time late enough so that the anharmonic and temperature-dependent axion field has already entered the adiabatic regime.", "\n\n![", "Isocurvature constraints on the axion scale $f_{a}$ as a function of the inflation scale $H_{I}$ for the QCD axion with potential . ", "Both the anharmonicities of the potential and the temperature dependence of the mass are taken into account through the anharmonicity function defined in . ", "Our results differ slightly from the ones obtained in [@visinelli_dark_2009] and [@kobayashi_isocurvature_2013] due to the fact that we are using the more recent data from the Planck satellite and a different anharmonicity function.[]{data-label=\"fig:QCD_isocurvature_cosine\"}](fig_QCD_isocurvature_cosine_inv){width=\"0.6\\linewidth\"}\n\nFor definiteness, we will use the following expression for the axion mass, $$\\label{eq:QCD_axion_mass}\nm_a(T) = \\begin{cases}\nm_a \\left( \\frac{T}{T_\\mathrm{crit}} \\right)^\\alpha &\\mathrm{if}\\ T\\geq T_\\mathrm{crit} ,\\\\\nm_a &\\mathrm{if}\\ T\\leq T_\\mathrm{crit} .\\\\\n\\end{cases}$$ First of all, we note that this temperature dependence will only have an effect if the field starts oscillating before the QCD critical temperature $T_\\mathrm{crit}$. In the harmonic limit, this means that if the mass is smaller than $m_a^*$, defined by $3H(T_\\mathrm{crit})=m_a^*$, the field will have acquired its late-time mass by the time it starts oscillating. ", "Thus, the later evolution of the field will be insensitive to the temperature effects that happened earlier on. ", "In terms of decay constants, this sets a distinct scale $$f_a^* \\simeq 8.7\\cdot 10^{16}\\ \\mathrm{GeV}.$$\n\nIf we take into account the anharmonicities of the potential, it might happen that the start of the oscillations is delayed until after $T_\\mathrm{crit}$, even if $f_a<f_a^*$. The condition to be in this regime is that the initial misalignment angle $\\theta_0$ is larger than some value $\\theta_0^* (f_a)$. This value is given for a general anharmonicity function[^10] by $$\\left( \\frac{f_a^*}{f_a} \\right)^{3/2} = f(\\theta_0^*).$$ For the case of a canonical axion with a cosine potential like in , we find $$\\theta_0^* (f_a) \\simeq \\pi \\left[ 1 - \\exp \\left( 1 - \\frac{f_a^*}{f_a} \\right) \\right]^{1/4},$$ whereas in the non-canonical case , we find $$\\psi_0^* (f_a,N) \\simeq \\frac{3}{2bN} \\log \\left( \\frac{f_a^*}{f_a} \\right).$$\n\n![", "Isocurvature constraints on the axion scale $f_{a}$ as a function of the inflation scale $H_{I}$ for the QCD axion with a non-canonical kinetic term . ", "Both the anharmonicities of the potential and the temperature dependence of the mass are taken into account through the anharmonicity function defined in .[]{data-label=\"fig:QCD_isocurvature_noncan\"}](fig_QCD_isocurvature_noncanonical_inv){width=\"0.6\\linewidth\"}\n\nFor any set of decay constants and initial misalignment angles that satisfy $f_a<f_a^*$ and $\\theta_0<\\theta_0^*$, we compute $F_T$ for a generic anharmonic potential, finding $$F_T(\\theta_0,f_a) \\simeq \\left( \\frac{f_a^*}{f_a} \\right)^{\\frac{\\alpha}{2(2-\\alpha)}}\\cdot\\left( f (\\theta_0) \\right)^{\\frac{2(3-\\alpha)}{3(2-\\alpha)}}.$$ The details of the derivation of this result are given in Appendix . ", "Here we see that the result depends critically on the exponent of the temperature-dependence of the axion mass at high temperatures above the QCD critical temperature. ", "To sum up, we can write the full temperature-dependent anharmonicity function as follows, $$\\label{eq:temperature_anharmonicity_function}\nF_T(\\theta_0,f_a) = \n\\begin{cases}\nf(\\theta_0) &\\mathrm{if}\\ f_a > f_a^*,\\\\\nf(\\theta_0) &\\mathrm{if}\\ f_a < f_a^*\\ \\mathrm{and}\\ \\theta_0 > \\theta_0^*,\\\\\n\\left( \\frac{f_a^*}{f_a} \\right)^{\\frac{\\alpha}{2(2-\\alpha)}}\\cdot\\left( f (\\theta_0) \\right)^{\\frac{2(3-\\alpha)}{3(2-\\alpha)}}\\quad &\\mathrm{if}\\ f_a < f_a^*\\ \\mathrm{and}\\ \\theta_0 < \\theta_0^*.", "\n\\end{cases}$$ With this, we can use the same approach as in  to compute the isocurvature perturbations, this time using the temperature-dependent anharmonicity function, $$\\label{eq:isocurvature_anharmonic}\n\\Delta_\\phi^2 = 4\\gamma^2 \\frac{H_I^2}{4\\pi^2 f_a^2 \\theta_0^2} \\left( 1 + \\frac{1}{2} {\\left. ", "\\frac{\\d \\log F_T(\\theta)}{\\d \\log \\theta}\\right\\rvert_{\\theta_0}^{}} \\right)^2.$$\n\nWe apply this formula for both the canonical QCD axion and for our non-canonical model, and obtain the results presented in and , respectively. ", "For the canonical QCD axion, our results are an update from the ones obtained in [@visinelli_dark_2009] and [@kobayashi_isocurvature_2013], as we are using the more recent data from the Planck satellite and a better fitting anharmonicity function.", "\n\nALPs coupled to QCD with $f_{a} m << \\Lambda_{\\rm QCD}^2$\n---------------------------------------------------------\n\nLet us now study the possibility of an ALP having a coupling to the $G\\tilde{G}$ term while satisfying $f_a m << \\Lambda_{\\rm QCD}^2$. This is an interesting region of the parameter space, as ALPs that satisfy these conditions may be found by looking for an oscillating nucleon or atomic electric dipole moment. ", "There exist a number of proposed laboratory searches focusing on this direction [@graham_new_2013; @graham_axion_2011; @budker_cosmic_2014; @hexenia_2017] .", "\n\nHowever, we have seen that coupling the ALP to QCD via a term proportional to $G\\tilde{G}$ induces an irreducible contribution to the mass, given by . ", "Explicitly this contributes $$\\label{eq:fatoma}\nm^{2}_a (T=0) \\simeq \\left(5.7\\times 10^{-5} {\\rm eV }\\left( \\frac{10^{11}{\\rm GeV}}{f_a} \\right)\\right)^2,$$ to the square of the axion mass as given in [@di_cortona_qcd_2016]. ", "This contribution will also have a temperature dependence as described by .", "\n\nA priori, this irreducible contribution to the axion mass seems irreconcilable with the condition $f_a m << \\Lambda_{\\rm QCD}^2$ [@blum_constraining_2014]. ", "The only known way of circumventing this caveat is to precisely cancel this contribution with an additional, fine-tuned term in the Lagrangian. ", "Acknowledging the flaws of this *ad hoc* approach, we follow it and study the phenomenology of such models when allowing for a non-canonical kinetic term.", "\n\nAt the level of the Lagrangian, we add an extra term to the potential so that it becomes $$V(\\phi) = \\Lambda_{\\rm QCD}^4\\left( 1-\\cos \\frac{\\phi}{f_a} \\right) - \\Lambda_0^4\\left(1- \\cos \\left(\\frac{\\phi}{n f_a} + \\alpha \\right) \\right).$$\n\nIn principle there can exist a phase difference between both contributions. ", "For our purposes, it will be necessary to require that this phase difference vanishes, so we will take $\\alpha=0$. This can be viewed as equivalent to asking for a separate a solution to the strong CP problem. ", "In principle any integer $n$ is possible but for simplicity we will limit ourselves to the $n=1$ case. ", "In the small $\\phi$ limit, this potential induces a mass for the ALP $$m^2 = m_a^2(T) - m_0^2,$$ where $m_0f_a = \\Lambda_0^2$ and recall that $m_a$ is completely fixed by $f_a$ as in equation . ", "It is then possible to choose $m_0$ so that we get any zero-temperature mass for the ALP, i.e. we can set $m_0^2 = m_a^2(T=0) - m^2$. We are interested in the $m^2 \\ll m_a^2(T=0)$ regime. ", "The full mass can then be expressed as $$m^2 (T) = m_a^2(T) - m_a^2(0) + m^2.$$ Because at early times the QCD contribution is strongly suppressed, in that regime we have $m^2 (T) < 0$. We will use the following simplified expression for the temperature dependent mass of the ALP $$\\label{eq:temp_mass}\nm^2 (T) = \\begin{cases}\nm^2 & \\quad{\\rm for}\\quad T<T_{\\rm crit} \\\\\n-m_a^2(0) & \\quad{\\rm for}\\quad T>T_{\\rm crit}\n\\end{cases}$$ Note that the negative mass does not indicate an unstable potential but only that $\\phi=0$ is not the minimum at that time.", "\n\n### Canonical case\n\nAs a first step, we implement the mass subtraction and the resulting temperature dependence in an ALP model with a canonically normalised scalar field with potential given by $$\\label{eq:temp_dep_N0}\nV(\\phi) = f_a^2\\ m^2 (T) \\left( 1-\\cos \\frac{\\phi}{f_a} \\right),$$ with $m(T)$ defined in . ", "The most relevant feature of this scenario is that before the QCD phase transition, the potential is minimised at $\\theta=\\pi$ rather than at $\\theta=0$. Accordingly, at early times the field evolves towards its minimum at $\\pi$, around which it will oscillate with damped amplitude. ", "Then, after the QCD phase transition, the potential rapidly acquires its late-time shape, with a minimum at the origin. ", "The field thus oscillates around its CP-conserving value $\\theta=0$ at late times. ", "The main role of the first set of oscillations is to set the initial condition for the second one to be close to $\\pi$. We refer to for a cartoon explaining this evolution. ", "It should be noted that this discussion is only valid if $f_am\\ll \\Lambda^{2}_{\\mathrm{QCD}}$, that is, if we lie to the left of the QCD axion band in . ", "In the other limit, *ie* $f_am\\gg \\Lambda^{2}_{\\mathrm{QCD}}$, the contribution of the QCD mass is negligible and we recover the usual constant mass ALP scenario.", "\n\n![", "Cartoon explaining the evolution of the field. ", "The red and blue lines represent the potential before and after the QCD phase transition, respectively. ", "The green dots and arrows represent the evolution of the field. (", "The oscillations are not drawn explicitly in order to simplify the figure.) ", "The initial misalignement angle $\\theta_0$ and the value of the field at the QCD phase transition, $\\theta_{\\mathrm{crit}}$, are depicted.[]{data-label=\"fig:N0_sketch\"}](fig_N0_sketch){width=\"0.5\\linewidth\"}\n\nLet us now be a bit more quantitative. ", "Initially, $H$ is large and the field is stuck at its initial value $\\theta_0$. Then, as long as the early-time mass $m_a(0)$ overcomes the Hubble friction before the QCD phase transition, the field will oscillate around $\\pi$. The condition for this to happen is roughly $f_a\\gtrsim10^{17}$ GeV, but this value can be modified by the anharmonicities depending on the initial misalignment. ", "These oscillations continue until the temperature decreases to $T_{\\rm crit}$, at which time the amplitude is approximately given by $$\\left( \\pi-\\theta_{\\mathrm{crit}} \\right) \\simeq \\left( \\pi-\\theta_0 \\right)\\left( \\frac{\\mathcal{F}(T_{\\rm crit})}{\\mathcal{F}(T_1)} \\right)^{1/2}\\left( \\frac{f_a}{2\\cdot 10^{17}\\ \\mathrm{GeV}} \\right)^{3/4} f^{1/2}(\\theta_0).$$ Here, the anharmonicity function is given by and $T_1$ is defined by $3H(T_1)=m_a(0)$. The value of $\\theta_{\\mathrm{crit}}$ gives the initial condition for the oscillations that happen after the QCD phase transition, now around $\\theta=0$ and with frequency given by the late-time mass $m$. Typically, $\\theta_{\\mathrm{crit}}$ is very close to $\\pi$ so the anharmonicites of the potential will play a key role. ", "Taking this into account, we can compute the energy density of the oscillating scalar field as $$\\label{eq:N0_energy_density}\n\\rho\\simeq 0.17 \\frac{\\mathrm{keV}}{\\mathrm{cm}^3}\\ \\mathcal{F}(T_2)\\ \\sqrt{\\frac{m}{\\mathrm{eV}}}\\left(\\frac{f_a}{10^{11}\\ \\mathrm{GeV}}\\right)^2 \\ \\theta^2_\\mathrm{crit}\\ f(\\theta_{\\mathrm{crit}}),$$ where $3H(T_2)=m$.\n\n![", "Parameter space of the model defined by the potential given in . ", "We present the isocurvature constraints for different values of $H_I$, ranging from $10^6$ to $10^{11}$ GeV. A higher scale of inflation restricts the model to lie in the respective coloured areas. ", "For the purpose of visualisation we have continuously connected the solution in the two different regimes that we have considered, i.e. to the left and to the right of the QCD axion band. ", "All the other limits presented in  are also applicable in this scenario, as they only depend on the dynamics of the field after the QCD phase transition.[]{data-label=\"fig:N0_parameter_space\"}](fig_N0_parameter_space_final){width=\"0.7\\linewidth\"}\n\nWe can then determine in what region of parameter space the right dark matter abundance can be generated with an initial misalignment angle $\\theta_0$ of order $\\orderof (1)$. It is possible to either enhance or suppress the energy density given in by tuning the initial misalignment angle closer to zero or $\\pi$. However, due to equation , there is an enhancement of the isocurvature perturbations each time the field gets close to a maximum of the potential, where the anharmonicity function becomes large. ", "Because of this, the available tuning of the initial misalignment angle is very limited in this scenario due to the stringent constraints on isocurvature fluctuations. ", "shows how the allowed parameter space shrinks for larger values of the Hubble scale of inflation. ", "Despite the strong isocurvature constraints, we can see that this scenario populates some unexplored regions of parameter space to the left of the QCD axion line that could be probed by upcoming experiments looking for ALPs.", "\n\n### Non-canonical case\n\nWe now want to implement the temperature dependent potential  in our non-canonical ALP scenario. ", "In terms of the cosmological evolution of the field, this is effectively done by writing $$V(\\varphi) = f_a^2 m^2 (T) \\left[ 1 - \\cos \\left( \\frac{2}{N} \\arctan \\left( \\tanh \\frac{N\\varphi}{2f_a} \\right) \\right) \\right].$$ This is the same potential as we had before, except that for high temperatures $T>T_{\\rm crit}$ the mass squared will be negative and will be a function only of $f_a$, as given in . ", "This tells us that, depending on the value of the parameters $m$ and $f_a$, we will have two very different behaviours, which qualitatively can be understood as follows.", "\n\nFirst, if the field does not start rolling until after the QCD phase transition, then all the dynamics and the observables will not be affected at all by the features of the potential at high temperatures. ", "This is because there is no evolution while the field is frozen by Hubble friction. ", "Only after it has acquired its late time mass $m$ does it start rolling, and thus the cosmological evolution is exactly as we computed in . ", "However, the key difference is that now the ALP is coupled to $G\\tilde{G}$, so it may be tested by observables and experiments that exploit this coupling.", "\n\nThe other option is, of course, that the field starts rolling before the QCD phase transition. ", "Then the dynamics can depend strongly on the initial conditions and is rather complicated. ", "However, we will see that this scenario leads to an overproduction of ALPs whose energy density exceeds the observed CDM one. ", "As we are only interested in ALPS as dark matter candidates, the second scenario is not interesting for us and we just need to focus on the first one.", "\n\nLet us now be more quantitative and compute what region of the parameter space allows for ALP dark matter with a non-canonical kinetic term and coupled to QCD. ", "As we have anticipated, this ALP will only be a good dark matter candidate if its evolution is frozen until after the QCD phase transition. ", "Then, the present ALP energy density will only depend on $f_a$, the present mass $m$ and the initial misalignment angle $\\psi_0$. The latter is given by equation , and satisfies $$\\label{eq:initial_misalignment_angle}\n\\psi_0^2\\ {\\mathrm{e}}^{bN\\psi_0} \\simeq \\frac{7.26}{{\\cal F}(T_1)} \\sqrt{\\frac{{\\rm eV}}{m}} \\left( \\frac{10^{11}\\text{ GeV}}{f_a} \\right)^2,$$ where $T_1$ is the temperature at which the oscillations start.", "\n\nWe now need to find what the region of the parameter space is where the field starts oscillating only after the QCD phase transition. ", "The QCD phase transition happens at a temperature of around $T_{\\rm crit}\\sim 160\\ {\\rm MeV}$, which corresponds to a Hubble parameter of $H(T_{\\rm crit})\\sim 10^{-11}\\ {\\rm eV}$. By asking that $3H(T_{\\rm crit}) > | V^{\\prime\\prime}(\\psi_0) |^{1/2}$, we get the condition $$\\label{eq:QCD_rolling_condition}\nH(T_{\\rm crit}) > 3.24\\times 10^{-6}{\\rm eV }\\cdot \\sqrt{2N\\sin\\frac{\\pi}{2N}} \\ {\\cal F}(T_1)^{1/(2b)}\\ \\psi_0^{1/b} \\left( \\frac{m}{{\\rm eV}} \\right)^{1/(4b)} \\left( \\frac{f_a}{10^{11}\\text{ GeV}} \\right)^{1/b-1}.$$ This region is plotted in , together with the further cosmological and astrophysical bounds that restrict the parameter space.", "\n\nFinally we still have to justify our claim that if the field starts oscillating before the QCD phase transition we always get an overproduction of ALPs. ", "For a given $(m,f_a)$, any initial misalignment angle bigger than the one given by will lead to an energy density in ALPs greater than the observed dark matter one. ", "But if the condition is not satisfied, then the field will start rolling towards bigger $\\psi$ values, because $m^2(T)<0$ at high temperatures. ", "Thus, the effect of the rolling at high temperatures is to drive the field away from the required misalignment angle to give the correct dark matter abundance. ", "This statement is independent of what misalignment angle we start with, and thus rules out ALPs in the region coloured in white in  as dark matter candidates[^11].", "\n\n[0.49]{} ![", "Parameter space for ALPs with a non-canonical kinetic term of the form coupled to QCD via a $G\\tilde{G}$ term, along with constraints coming from its cosmological evolution and searches for an oscillating EDM. ", "Each panel represents a different value of the parameter $N$. This scenario can provide the right dark matter density in the yellow shaded region, while the areas excluded by overproduction of dark matter or the condition to avoid a second period of inflation are coloured in white. ", "The brown region is excluded by re-analysing data originally intended to search for a static neutron EDM in order to look for an oscillating one [@abel_search_2017]. ", "The dark green region in the first figure is inconsistent with the production of the observed abundance of light elements during Big Bang Nucleosynthesis [@blum_constraining_2014]. ", "This limit is effective only for $N<4$ and absent in the other figures. ", "Similarly, the limit from [@hook_probing_2017] corresponding to the ALP field being sourced at the Sun only applies for small values of $N$, while the Earth one stays valid in all cases. ", "Finally, $f_a$ is (softly) bounded from above by the requirement that it does not exceed the Planck scale, and from below by the supernova limits estimated in [@raffelt_astrophysical_2008].[]{data-label=\"fig:temperature_BBN_EDM\"}](fig_Noncan_QCD_parameter_space_N1_final \"fig:\"){width=\"1\\linewidth\"} \\[fig:Noncan\\_QCD\\_parameter\\_space\\_N1\\]\n\n[0.49]{} ![", "Parameter space for ALPs with a non-canonical kinetic term of the form coupled to QCD via a $G\\tilde{G}$ term, along with constraints coming from its cosmological evolution and searches for an oscillating EDM. ", "Each panel represents a different value of the parameter $N$. This scenario can provide the right dark matter density in the yellow shaded region, while the areas excluded by overproduction of dark matter or the condition to avoid a second period of inflation are coloured in white. ", "The brown region is excluded by re-analysing data originally intended to search for a static neutron EDM in order to look for an oscillating one [@abel_search_2017]. ", "The dark green region in the first figure is inconsistent with the production of the observed abundance of light elements during Big Bang Nucleosynthesis [@blum_constraining_2014]. ", "This limit is effective only for $N<4$ and absent in the other figures. ", "Similarly, the limit from [@hook_probing_2017] corresponding to the ALP field being sourced at the Sun only applies for small values of $N$, while the Earth one stays valid in all cases. ", "Finally, $f_a$ is (softly) bounded from above by the requirement that it does not exceed the Planck scale, and from below by the supernova limits estimated in [@raffelt_astrophysical_2008].[]{data-label=\"fig:temperature_BBN_EDM\"}](fig_Noncan_QCD_parameter_space_N10_final \"fig:\"){width=\"1\\linewidth\"} \\[fig:Noncan\\_QCD\\_parameter\\_space\\_N10\\]\n\n\\\n\n[0.49]{} ![", "Parameter space for ALPs with a non-canonical kinetic term of the form coupled to QCD via a $G\\tilde{G}$ term, along with constraints coming from its cosmological evolution and searches for an oscillating EDM. ", "Each panel represents a different value of the parameter $N$. This scenario can provide the right dark matter density in the yellow shaded region, while the areas excluded by overproduction of dark matter or the condition to avoid a second period of inflation are coloured in white. ", "The brown region is excluded by re-analysing data originally intended to search for a static neutron EDM in order to look for an oscillating one [@abel_search_2017]. ", "The dark green region in the first figure is inconsistent with the production of the observed abundance of light elements during Big Bang Nucleosynthesis [@blum_constraining_2014]. ", "This limit is effective only for $N<4$ and absent in the other figures. ", "Similarly, the limit from [@hook_probing_2017] corresponding to the ALP field being sourced at the Sun only applies for small values of $N$, while the Earth one stays valid in all cases. ", "Finally, $f_a$ is (softly) bounded from above by the requirement that it does not exceed the Planck scale, and from below by the supernova limits estimated in [@raffelt_astrophysical_2008].[]{data-label=\"fig:temperature_BBN_EDM\"}](fig_Noncan_QCD_parameter_space_N100_final \"fig:\"){width=\"1\\linewidth\"} \\[fig:Noncan\\_QCD\\_parameter\\_space\\_N100\\]\n\n[0.49]{} ![", "Parameter space for ALPs with a non-canonical kinetic term of the form coupled to QCD via a $G\\tilde{G}$ term, along with constraints coming from its cosmological evolution and searches for an oscillating EDM. ", "Each panel represents a different value of the parameter $N$. This scenario can provide the right dark matter density in the yellow shaded region, while the areas excluded by overproduction of dark matter or the condition to avoid a second period of inflation are coloured in white. ", "The brown region is excluded by re-analysing data originally intended to search for a static neutron EDM in order to look for an oscillating one [@abel_search_2017]. ", "The dark green region in the first figure is inconsistent with the production of the observed abundance of light elements during Big Bang Nucleosynthesis [@blum_constraining_2014]. ", "This limit is effective only for $N<4$ and absent in the other figures. ", "Similarly, the limit from [@hook_probing_2017] corresponding to the ALP field being sourced at the Sun only applies for small values of $N$, while the Earth one stays valid in all cases. ", "Finally, $f_a$ is (softly) bounded from above by the requirement that it does not exceed the Planck scale, and from below by the supernova limits estimated in [@raffelt_astrophysical_2008].[]{data-label=\"fig:temperature_BBN_EDM\"}](fig_Noncan_QCD_parameter_space_N200_final \"fig:\"){width=\"1\\linewidth\"} \\[fig:Noncan\\_QCD\\_parameter\\_space\\_N200\\]\n\n\\\n\nBig Bang Nucleosythesis {#secbbn}\n-----------------------\n\nAside from a potential over (or under) production there is an additional constraint that rules out large areas of experimentally accessible parameter space. ", "This arises from cosmology, more precisely BBN [@blum_constraining_2014]. ", "A non-vanishing $\\theta$ angle at the time of BBN can spoil the production of light elements such as $^4$He. ", "This is due to the fact that a non-vanishing $\\theta$ angle induces a difference between the mass of the proton and the neutron [@ubaldi_effects_2010] $$\\delta Q \\equiv m_n-m_p = c_+ \\frac{m_d^2-m_u^2}{\\sqrt{m_u^2+m_d^2+2m_um_d\\cos\\theta}},$$ where $c_+\\simeq 2.5$ can be determined by looking at the mass splitting $M_\\Theta-M_N$ in the baryon octet [@crewther_chiral_1979]. ", "A larger mass splitting means that the freeze-out abundance of neutrons with respect to protons would be lower. ", "In addition to that, the free neutron decay rate is enhanced, which means that more neutrons decay between freeze-out and nucleosynthesis. ", "This depletion of neutrons[^12] eventually turns into an underproduction of $^4$He. ", "Based on the discussion in [@blum_constraining_2014; @stadnik_can_2015], these effects result in a shift that can be estimated as $$\\frac{\\delta Y_p}{Y_p} \\equiv \\frac{Y_p^0-Y_p(\\theta)}{Y_p^0} = \\left( 1- \\frac{Y_p^0}{2} \\right) \\left( \\frac{\\delta \\left(n/p\\right)_{\\mathrm{fr}}}{\\left(n/p\\right)_{\\mathrm{fr}}} + \\delta\\Gamma_n t_{\\mathrm{nuc}} \\right) \\simeq 0.66 \\theta^2.$$ Using the values $Y_p^0=0.25$ and $t_{\\mathrm{nuc}}=880$ s [@mukhanov_physical_2005]. ", "One can now take the conservative limit $|\\delta Y_p/Y_p|<10\\%$ to see that successful nucleosynthesis requires $$\\theta_\\mathrm{BBN} < 0.39.$$ In our non-canonical model, the first thing we notice is that the $\\theta$ angle is bounded, $$| \\theta | = | \\frac{2}{N}\\arctan\\left( \\tanh \\frac{N\\psi}{2} \\right) | \\leq \\frac{\\pi}{2N},$$ so the BBN bound is completely avoided if $N>4$. For smaller N we are in the region of small $\\theta$ and the behaviour is approximately that of a canonical ALP. ", "Here we use the bound given in [@blum_constraining_2014]. ", "The corresponding excluded region is shaded in darker and labeled “BBN” in .", "\n\nConclusions {#sec:Conclusions}\n===========\n\nThe question raised in this paper can be summarised in the following way: Is it possible to have an axion-like particle (ALP) with a non-canonical kinetic term as a phenomenologically viable and interesting dark matter candidate? ", "Our study points towards an affirmative answer. ", "Using in particular a non-canonical term with singularities similar to those used in $\\alpha$-attractor models for inflation we find a significantly enlarged parameter space for dark matter. ", "In particular, regions with larger couplings – where canonical ALPs are underproduced – now become viable, offering interesting possibilities for near future experiments.", "\n\nFor the production via the misalignment mechanism the key feature of the non-canonical kinetic term is that today’s ALP energy density is enhanced due to a delay in the start of the oscillations. ", "This arises because the effective potential is flattened by the growing non-canonical kinetic term, which also makes the field range of the physical field unbounded. ", "As a consequence, any combination of mass and decay constant can generate enough ALP energy density to account for all the dark matter that we observe in the universe.", "\n\nAn important cosmological constraint arises from isocurvature fluctuations imprinted by inflation. ", "To apply these constraints to our scenario we give a simple derivation of the size of isocurvature fluctuations in general models with arbitrary potential and even a temperature dependence of the potential. ", "As a useful crosscheck we have updated the isocurvature constraints [@visinelli_dark_2009; @kobayashi_isocurvature_2013] using the newest Planck data [@ade_planck_2016] and the most recent results for the QCD topological susceptibility [@borsanyi_axion_2016]. ", "The result can be found in . ", "In our non-canonical setup the isocurvature constraints are even slightly weaker as can be seen in .", "\n\nAn interesting non-trivial situation arises if the ALP is coupled to the strong interactions, i.e. via a term $\\sim\\phi G\\tilde{G}$. This is of particular interest since a number of experiments are currently searching for ALP dark matter with this coupling [@abel_search_2017; @budker_cosmic_2014; @hexenia_2017]. ", "The coupling to gluons leads to two non-trivial features: the generation of a temperature-dependent, irreducible contribution to the ALP mass and an effective ALP field value dependent nucleons mass. ", "The former naively makes large parts of the low mass region explored by current experiments inaccessible [@blum_constraining_2014]. ", "This can be avoided by invoking a precise cancellation with an additional term in the ALP potential (with or without non-canonical terms). ", "The latter leads to strong constraints from Big Bang Nucleosynthesis. ", "These are significantly weakened in our scenario with a non-canonical kinetic term. ", "This opens up significant parameter space that can be explored in near future experiments such as Casper [@budker_cosmic_2014] and HeXeniA [@hexenia_2017], as well as EDM storage rings [@chang_axion_2017].", "\n\nAcknowledgements {#acknowledgements .unnumbered}\n================\n\nThis project has received funding from the European Union’s Horizon 2020 research and innovation programme under the Marie Sklodowska-Curie grant agreements No $690575$ (RISE InvisiblesPlus) and No $674896$ (ITN ELUSIVES).", "\n\nEffect of higher-order poles in the kinetic function {#sec:Appendix1}\n====================================================\n\nIn this appendix we briefly study how our results change if we allow our non-canonical kinetic term for the ALP field to have a pole of arbitrary (even) order. ", "We work with the Lagrangian , this time with the kinetic function given by $$K(\\phi) = \\frac{1}{\\cos^{p} \\left( \\frac{N\\phi}{f_a} \\right)}\\ ,\\quad p\\in\\mathbb{N}.$$ Note that with this definition the order of the pole is $2p$. In the main body we have focused in the $p=1$ case. ", "As opposed to the $p=1$ case, for a general value of $p$ it is not possible to find an exact analytic expression for the transformation to the canonically normalised field $\\psi(\\phi)$. However, we can find an approximate expression, valid close to the pole at $\\phi/f_a = \\pi/(2N)$, by expanding $K(\\phi)$ in a Laurent series and keeping only the leading divergent term. ", "With that, we can then proceed as in  and obtain an estimation for the enhancement in the relic density. ", "The result is $$\\label{eq:p_cases}\n\\frac{\\rho^{\\mathrm{anh}}}{\\rho^{\\mathrm{harm}}} \\propto \n\\left\\{\n\\begin{aligned}\n&\\exp^{\\frac{3}{4}N\\psi_0},\\quad & p&=1 \\\\\n&\\left( N\\psi_0 \\right)^{\\frac{3}{2}\\left(1+\\frac{1/2}{k-1}\\right)},\\quad & p&\\neq1\n\\end{aligned}\n\\right.", "\n.$$ Due to the now unbounded field range, a significant enhancement is possible. ", "Nevertheless, it may seem that the enhancement effect is much weaker in the $p>1$ cases, which could seem counter-intuitive. ", "However, we must note that the field redefinition $\\psi(\\phi)$ is different for different values of $p$, which means that it is not so obvious to compare the distinct cases just by looking at . ", "In order to be able to compare, we can recast  in terms of the non-canonically normalised field $\\phi$, which avoids the problem of the $p$-dependent field redefinition. ", "Doing so, we can write $$\\label{eq:p_cases_theta}\n\\frac{\\rho^{\\mathrm{anh}}}{\\rho^{\\mathrm{harm}}} \\propto \\left( \\frac{1}{\\sqrt{\\frac{\\pi}{2N}-\\theta_0}} \\right)^{2p-1},$$ which is valid for all $p\\in \\mathbb{N}$. Looking at  we can confirm that there exists an enhancement in the ALP relic density for all values of $p$. What’s more, looking at it from the point of view of the non-canonically normalised field, the effect is stronger the higher the order of the pole, as one would naively expect.", "\n\nTemperature dependent anharmonicity function {#sec:Appendix2}\n============================================\n\nIn this section we detail how to implement the effects of the temperature dependence of the QCD axion mass into the anharmonicity function [@visinelli_dark_2009; @diez-tejedor_cosmological_2017]. ", "The approach that we follow allows us to analytically upgrade any anharmonicity function that does not include temperature effects into a full temperature dependent anharmonicity function. ", "The derivation that we present is valid for any scalar field whose potential can be factorised as $$V(\\phi) = m^2(T)\\cdot V_0(\\phi),$$ where $V_0(\\phi)$ is a temperature-independent potential that has a minimum around which the field can oscillate (possibly anharmonically), and the temperature dependence acts only as a scaling. ", "This is the case for general axion models, including those we study in this paper. ", "If there is no temperature dependence at all, then $m(T)\\equiv m$ and working as in  we can express the energy density of the field with an anharmonic potential as $$\\rho^{\\mathrm{anh}} = f(\\theta_0) \\rho^{\\mathrm{harm}},$$ where $\\rho^{\\mathrm{harm}}$ is the solution to the harmonic case described in  and $f(\\theta_0)$ is the anharmonicity function that depends on the initial value of the dimensionless field $\\theta=\\phi/f_a$.\n\nAt the effective level, we can think that the only effect of the anharmonicities is to change the time (or temperature) at which the oscillations start. ", "This is of course not what actually happens, but with this approach we will be able to make a good estimate of the energy density of the field at late times. ", "In this picture, we have that $$\\label{eq:anharmonicity_start_temperature}\nf(\\theta_0) = \\frac{\\rho^{\\mathrm{anh}}}{\\rho^{\\mathrm{harm}}} = \\left( \\frac{T_\\mathrm{S}^{\\mathrm{harm}}}{T_\\mathrm{S}^{\\mathrm{anh}}} \\right) ^3 \\frac{g_{\\star S}(T_\\mathrm{S}^\\mathrm{harm})}{g_{\\star S}(T_\\mathrm{S}^{\\mathrm{anh}})},$$ which follows from the dependence of the WKB solution on the temperature at which oscillations start[^13]. ", "With this we can extend the equation for the condition of the start of the oscillations in the harmonic case, $3H(T_\\mathrm{S}^{\\mathrm{harm}})=m$, to the anharmonic case, using an effective mass that encodes the effects of the anharmonicity. ", "It reads $$\\label{eq:anh_start}\n3H(T_\\mathrm{S}^{\\mathrm{anh}})=m\\left(f(\\theta_0)\\right)^{-2/3}.$$ This expression will be useful later on.", "\n\nWe now assume that there is a temperature dependent mass that evolves as , as is the case for axion models. ", "As was argued in the main body of the paper, if $T_\\mathrm{S}^{\\mathrm{anh}} < T_\\mathrm{crit}$, the oscillations start after the QCD phase transition, when the mass has already attained its low-temperature value, and the temperature dependence has no effect on the later evolution of the field. ", "In the harmonic case, this happens if the zero-temperature mass is smaller than $m^*$ given by $3H(T_\\mathrm{crit})=m^*$, that is, $$m^* = 3\\cdot 1.66\\sqrt{g_\\star(T_\\mathrm{crit})} \\frac{T_\\mathrm{crit}^2}{m_\\mathrm{Pl}} \\simeq 6.6\\cdot 10^{-11}\\ \\mathrm{eV}.$$ In terms of decay constants, this translates into a maximum value $f_a^* \\simeq 8.7\\cdot 10^{16}\\,\\mathrm{GeV}$ above which the temperature dependence does not play a role. ", "In the anharmonic case, it can happen that the anharmonicities delay the start of the oscillations beyond $T_\\mathrm{crit}$, even if $f_a<f_a^*$, if the initial misalignment angle is large enough. ", "We can use equation to find an expression for this critical value $\\theta_0^*$. Writing it in terms of $f_a^*$, it reads $$\\left( \\frac{f_a^*}{f_a} \\right)^{3/2} = f(\\theta_0^*),$$ from where $\\theta_0^*$ can be obtained once an explicit anharmonicity function is chosen.", "\n\nFinally, if both $f_a<f_a^*$ and $\\theta_0<\\theta_0^*$, then $T_\\mathrm{S}^{\\mathrm{anh}} > T_\\mathrm{crit}$ and the temperature dependent evolution of the mass will have an impact on the oscillating behaviour of the field. ", "First of all, we compute how the onset of the oscillations is modified. ", "For this purpose, we can just substitute the constant mass $m$ for the temperature dependent one $m(T)$ in equation . ", "Using the expression for $m(T)$ given in , we have the condition $$3H(T_\\mathrm{S})=m\\left( \\frac{T_\\mathrm{S}}{T_\\mathrm{crit}} \\right)^\\alpha \\left(f(\\theta_0)\\right)^{-2/3}.$$ To simplify the notation, we have denoted $T_\\mathrm{S}$ the temperature at which the oscillations start if we take into account both the anharmonicities of $V_0(\\phi)$ and the temperature dependence of $m(T)$. We can recast this equation in terms of decay constants, finding $$\\frac{T_\\mathrm{S}}{T_\\mathrm{crit}} = \\left( \\frac{f_a^*}{f_a}\\cdot\\left(f(\\theta_0)\\right)^{-2/3} \\right)^{\\frac{1}{2-\\alpha}}.$$\n\nTo continue, we use the expression for the energy density of an oscillating scalar field with a slowly varying mass, which can be found for instance in [@arias_wispy_2012] and reads[^14] $$\\rho(T) = \\frac{1}{2} m(T) m(T_\\mathrm{S}) f_a^2\\theta_0^2\\, \\frac{g_{\\star S}(T)}{g_{\\star S}(T_\\mathrm{S})} \\left( \\frac{T}{T_\\mathrm{S}} \\right)^3.$$ At low temperatures below the QCD critical temperature, the quotient between this expression and the corresponding one for the harmonic case is $$\\frac{\\rho(T)}{\\rho^\\mathrm{harm}(T)} = \\frac{m(T_\\mathrm{S})}{m} \\frac{g_{\\star S}(T^\\mathrm{harm}_\\mathrm{S})}{g_{\\star S}(T_\\mathrm{S})} \\left( \\frac{T^\\mathrm{harm}_\\mathrm{S}}{T_\\mathrm{S}} \\right)^3.$$ But this is precisely what we need to define the temperature dependent anharmonicity function $F(\\theta_0,f_a)$. Again, neglecting the quotient of effective degrees of freedom, we find $$\\begin{aligned}\nF(\\theta_0,f_a) &\\equiv \\frac{\\rho(T)}{\\rho^\\mathrm{harm}(T)} \\\\\n& \\simeq \\frac{m(T_\\mathrm{S})}{m} \\left( \\frac{T^\\mathrm{harm}_\\mathrm{S}}{T_\\mathrm{crit}} \\right)^3 \\left( \\frac{T_\\mathrm{crit}}{T_\\mathrm{S}} \\right)^3 \\\\\n& = \\left( \\frac{T_\\mathrm{S}}{T_\\mathrm{crit}} \\right)^{\\alpha-3} \\left( \\frac{f_a}{f_a^*} \\right)^{-3/2} \\\\\n& = \\left( \\frac{f_a^*}{f_a} \\right)^{\\frac{\\alpha}{2(2-\\alpha)}} \\left( f (\\theta_0) \\right)^{\\frac{2(3-\\alpha)}{3(2-\\alpha)}}.", "\n\\end{aligned}$$ It can be checked that this result agrees with the ones given in [@visinelli_dark_2009; @diez-tejedor_cosmological_2017], but can be applied in more general contexts.", "\n\n[^1]: The coupling  also induces tree-level $P,T$-violating forces between nucleons, which can give a larger contribution to atomic EDMs than the loop-induced nucleon EDMs [@stadnik_axion-induced_2014]. ", "This is relevant for EDM experiments that use atoms instead of free neutrons, like some of the ones presented in . ", "For those, the limits and projections should be understood as applying directly to $f_a$ and not $g_d$.\n\n[^2]: An alternative is to start in a region of field space where $V'(\\varphi)$ is very small, i.e. the field is close to a maximum. ", "However, this is strongly limited by the existence of inflationary fluctuations [@wantz_axion_2010; @di_cortona_qcd_2016] (see also ).", "\n\n[^3]: In principle one could have tunnelling between different branches. ", "If the decay time of the metastable vacuum is small enough, the field would always eventually end up in the branch closest to zero. ", "However, a calculation of the tunnelling rate is highly model dependent and beyond the scope of this work.", "\n\n[^4]: In Appendix  we check that a significant enhancement also exists if we allow for a kinetic function with a higher-order pole.", "\n\n[^5]: In this study we have limited ourselves to the homogeneous field evolution. ", "Recently, the authors of [@soda_cosmological_2017] showed that potentials like the one we are considering can lead to a parametric resonance instability that can make inhomogeneous modes grow. ", "This effect may help to alleviate some tension that has been pointed out in [@irsic_first_2017] between the existence of ultralight ALPs and Lyman $\\alpha$ forest observations.", "\n\n[^6]: It is also necessary that the symmetry is not restored during reheating [@beltran_isocurvature_2007]. ", "We will assume this to be true.", "\n\n[^7]: Quantum fluctuations of the ALP field should also be considered, but their effect is negligible when compared to the inflationary fluctuations.", "\n\n[^8]: Here we implicitly assume that the fluctuations are still superhorizon when the adiabatic regime is reached. ", "This is indeed the case for all the large scale modes of cosmological interest, like the ones probed by the CMB.", "\n\n[^9]: The small temperature dependence can be computed using chiral perturbation theory as in [@di_cortona_qcd_2016]\n\n[^10]: Note the difference between $f(\\theta_0)$, which is the anharmonicity function presented in  and induced purely by the shape of the potential, and $F_T(\\theta_0,f_a)$, which also includes the effects of the temperature-dependent mass.", "\n\n[^11]: Such an overproduction could, e.g. be ameliorated in scenarios with two stages of inflation [@davoudiasl_inflatable_2016; @hoof_qcd_2017].", "\n\n[^12]: There are other effects that play a role, like the change in the deuteron binding energy or the rise in the freeze-out temperature. ", "We have found that the contribution of these effects is smaller than the one considered above, so we neglected them for this analysis.", "\n\n[^13]: In the following equations, we will neglect all instances of quotients of effective degrees of freedom, as they only introduce a small correction and make the derivation much more cumbersome.", "\n\n[^14]: This expression is a generalisation of the WKB approximation presented before.", "\n" ]
{ "pile_set_name": "ArXiv" }
[ 0, 0, 0, 0, 0, 0, 0, 0.009302325581395349, 0.009208103130755065, 0, 0.008547008547008548, 0.026923076923076925, 0, 0.015873015873015872, 0, 0.0031645569620253164, 0.014218009478672985, 0, 0, 0, 0, 0.007352941176470588, 0, 0.005633802816901409, 0, 0, 0, 0.002702702702702703, 0.008032128514056224, 0.006993006993006993, 0.005154639175257732, 0, 0, 0.013513513513513514, 0.024390243902439025, 0.0106951871657754, 0, 0, 0.013333333333333334, 0, 0.005988023952095809, 0, 0.007142857142857143, 0, 0, 0, 0, 0, 0, 0.01, 0.0037593984962406013, 0, 0, 0, 0.007633587786259542, 0.008130081300813009, 0.005649717514124294, 0, 0, 0.012121212121212121, 0.006289308176100629, 0, 0, 0, 0, 0.005780346820809248, 0.010526315789473684, 0, 0, 0.010309278350515464, 0.003115264797507788, 0.003816793893129771, 0.0029239766081871343, 0, 0, 0, 0, 0, 0, 0, 0, 0.047619047619047616, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.005025125628140704, 0, 0, 0, 0, 0, 0.008771929824561403, 0.006493506493506494, 0, 0.02631578947368421, 0, 0.01079136690647482, 0, 0, 0, 0, 0.005405405405405406, 0, 0, 0, 0.0022522522522522522, 0, 0, 0.0060790273556231, 0, 0, 0, 0, 0.0018214936247723133, 0.006535947712418301, 0.004219409282700422, 0.004310344827586207, 0.0035971223021582736, 0, 0.005263157894736842, 0, 0.0078125, 0.0038022813688212928, 0, 0.007281553398058253, 0.004484304932735426, 0.006666666666666667, 0.00228310502283105, 0, 0, 0.013888888888888888, 0.0036363636363636364, 0, 0, 0, 0, 0.0026246719160104987, 0.004629629629629629, 0, 0.005025125628140704, 0.002304147465437788, 0, 0, 0, 0.005802707930367505, 0.004201680672268907, 0, 0.007677543186180422, 0, 0.008264462809917356, 0, 0, 0.004048582995951417, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.005714285714285714, 0, 0, 0, 0, 0, 0.0024154589371980675, 0.002364066193853428, 0, 0, 0.0026246719160104987, 0.004524886877828055, 0.0031847133757961785, 0, 0.005988023952095809, 0.006172839506172839, 0.004878048780487805, 0.007407407407407408, 0.010309278350515464, 0.005319148936170213, 0, 0.006493506493506494, 0.0027247956403269754, 0.004405286343612335, 0.0024813895781637717, 0, 0.006389776357827476, 0, 0, 0, 0.003787878787878788, 0.014218009478672985, 0, 0.005154639175257732, 0.0025252525252525255, 0.005291005291005291, 0.0070921985815602835, 0, 0, 0.0053475935828877, 0.004651162790697674, 0, 0, 0.005813953488372093, 0, 0, 0, 0, 0, 0.006309148264984227, 0, 0, 0, 0, 0, 0.006060606060606061, 0.012269938650306749, 0.02564102564102564, 0.0051813471502590676, 0, 0.005494505494505495, 0.003968253968253968, 0, 0.004830917874396135, 0.004103967168262654, 0, 0, 0, 0, 0.005154639175257732, 0, 0, 0.005154639175257732, 0, 0, 0.005154639175257732, 0, 0, 0, 0, 0.004739336492890996, 0, 0, 0, 0.010471204188481676, 0.0045045045045045045, 0.015789473684210527, 0.011627906976744186, 0, 0, 0, 0.028688524590163935, 0.00408997955010225, 0, 0.0072992700729927005, 0.0084985835694051, 0.0019230769230769232, 0, 0, 0, 0.005813953488372093, 0, 0, 0, 0, 0.007575757575757576, 0, 0.0020429009193054137, 0, 0.0011876484560570072, 0.006622516556291391, 0, 0.005952380952380952, 0, 0.0033003300330033004, 0.008771929824561403, 0.004048582995951417, 0.004640371229698376, 0.02564102564102564, 0.013071895424836602, 0.004424778761061947, 0, 0, 0, 0, 0, 0, 0, 0, 0.010638297872340425, 0.0018018018018018018, 0.0031847133757961785, 0.007042253521126761, 0.008333333333333333, 0, 0, 0.006535947712418301, 0.006172839506172839, 0, 0, 0.009615384615384616, 0, 0, 0.012096774193548387, 0.002564102564102564, 0.003861003861003861, 0, 0, 0, 0.005319148936170213, 0.0013192612137203166, 0, 0, 0.004464285714285714, 0, 0, 0, 0.004807692307692308, 0, 0, 0.006493506493506494, 0.010309278350515464, 0, 0.007936507936507936, 0, 0.012345679012345678, 0.014285714285714285, 0.004694835680751174, 0.007352941176470588, 0.009202453987730062, 0.0064516129032258064, 0, 0, 0, 0, 0, 0.009523809523809525, 0, 0.006024096385542169, 0, 0, 0.0053475935828877, 0, 0.009523809523809525, 0, 0.006024096385542169, 0, 0, 0.0053475935828877, 0, 0.009523809523809525, 0, 0.006024096385542169, 0, 0, 0.0053475935828877, 0, 0.009523809523809525, 0, 0.006024096385542169, 0, 0, 0.0053475935828877, 0, 0, 0, 0, 0, 0, 0, 0.002145922746781116, 0, 0, 0, 0.0036231884057971015, 0, 0, 0, 0.005050505050505051, 0, 0.005988023952095809, 0, 0, 0.011538461538461539, 0, 0, 0.00949367088607595, 0.01, 0, 0.007194244604316547, 0, 0, 0.014634146341463415, 0.010309278350515464, 0.006993006993006993, 0.007168458781362007, 0, 0, 0.0037735849056603774, 0, 0, 0, 0, 0.002004008016032064, 0.00980392156862745, 0, 0.0030303030303030303, 0, 0, 0, 0.002369668246445498, 0, 0, 0, 0.0033783783783783786, 0, 0, 0, 0, 0, 0, 0.0015368852459016393, 0.00546448087431694, 0.004878048780487805, 0.008695652173913044, 0, 0, 0, 0, 0, 0.007518796992481203, 0, 0, 0.005681818181818182, 0, 0, 0.013245033112582781, 0, 0.008928571428571428, 0, 0.006802721088435374, 0, 0, 0, 0.011494252873563218, 0 ]
0.003043
5
[ { "analysis_explanation": null, "end": 206, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 184 }, { "analysis_explanation": null, "end": 1413, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1385 }, { "analysis_explanation": null, "end": 1513, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1497 }, { "analysis_explanation": null, "end": 1522, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1515 }, { "analysis_explanation": null, "end": 1656, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1650 }, { "analysis_explanation": null, "end": 2494, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2479 }, { "analysis_explanation": null, "end": 5717, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5702 }, { "analysis_explanation": null, "end": 6681, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6679 }, { "analysis_explanation": null, "end": 7469, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7445 }, { "analysis_explanation": null, "end": 7540, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7535 }, { "analysis_explanation": null, "end": 8258, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8227 }, { "analysis_explanation": null, "end": 10875, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10869 }, { "analysis_explanation": null, "end": 11417, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11412 }, { "analysis_explanation": null, "end": 12317, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12295 }, { "analysis_explanation": null, "end": 12536, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12523 }, { "analysis_explanation": null, "end": 12821, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12765 }, { "analysis_explanation": null, "end": 13112, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13106 }, { "analysis_explanation": null, "end": 13428, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13420 }, { "analysis_explanation": null, "end": 13528, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13464 }, { "analysis_explanation": null, "end": 13568, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13560 }, { "analysis_explanation": null, "end": 13663, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13655 }, { "analysis_explanation": null, "end": 13739, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13731 }, { "analysis_explanation": null, "end": 14629, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14627 }, { "analysis_explanation": null, "end": 14776, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14770 }, { "analysis_explanation": null, "end": 15445, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15440 }, { "analysis_explanation": null, "end": 16787, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16773 }, { "analysis_explanation": null, "end": 17558, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 17550 }, { "analysis_explanation": null, "end": 17726, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 17677 }, { "analysis_explanation": null, "end": 17901, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 17899 }, { "analysis_explanation": null, "end": 18355, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 18347 }, { "analysis_explanation": null, "end": 18431, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 18429 }, { "analysis_explanation": null, "end": 18582, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 18579 }, { "analysis_explanation": null, "end": 19013, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19007 }, { "analysis_explanation": null, "end": 19893, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19841 }, { "analysis_explanation": null, "end": 20399, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20394 }, { "analysis_explanation": null, "end": 20932, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20927 }, { "analysis_explanation": null, "end": 22919, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 22906 }, { "analysis_explanation": null, "end": 23541, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 23535 }, { "analysis_explanation": null, "end": 23914, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 23909 }, { "analysis_explanation": null, "end": 24950, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 24945 }, { "analysis_explanation": null, "end": 25089, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 25084 }, { "analysis_explanation": null, "end": 25273, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 25267 }, { "analysis_explanation": null, "end": 26610, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 26604 }, { "analysis_explanation": null, "end": 27534, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 27527 }, { "analysis_explanation": null, "end": 27625, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 27615 }, { "analysis_explanation": null, "end": 27766, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 27758 }, { "analysis_explanation": null, "end": 28580, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 28552 }, { "analysis_explanation": null, "end": 28878, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 28854 }, { "analysis_explanation": null, "end": 32516, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 32497 }, { "analysis_explanation": null, "end": 32564, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 32559 }, { "analysis_explanation": null, "end": 32648, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 32645 }, { "analysis_explanation": null, "end": 32746, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 32727 }, { "analysis_explanation": null, "end": 33432, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 33411 }, { "analysis_explanation": null, "end": 33602, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 33595 }, { "analysis_explanation": null, "end": 34907, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 34905 }, { "analysis_explanation": null, "end": 38657, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 38650 }, { "analysis_explanation": null, "end": 39203, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 39195 }, { "analysis_explanation": null, "end": 39550, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 39533 }, { "analysis_explanation": null, "end": 40833, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 40825 }, { "analysis_explanation": null, "end": 45175, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 45171 }, { "analysis_explanation": null, "end": 45372, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 45354 }, { "analysis_explanation": null, "end": 45453, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 45434 }, { "analysis_explanation": null, "end": 45535, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 45517 }, { "analysis_explanation": null, "end": 46165, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 46138 }, { "analysis_explanation": null, "end": 46625, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 46604 }, { "analysis_explanation": null, "end": 47031, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 47027 }, { "analysis_explanation": null, "end": 47247, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 47220 }, { "analysis_explanation": null, "end": 48283, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 48275 }, { "analysis_explanation": null, "end": 48900, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 48892 }, { "analysis_explanation": null, "end": 49517, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 49509 }, { "analysis_explanation": null, "end": 50387, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 50360 }, { "analysis_explanation": null, "end": 52402, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 52396 }, { "analysis_explanation": null, "end": 52412, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 52407 }, { "analysis_explanation": null, "end": 52560, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 52546 }, { "analysis_explanation": null, "end": 52861, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 52853 }, { "analysis_explanation": null, "end": 53495, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 53485 }, { "analysis_explanation": null, "end": 53798, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 53785 }, { "analysis_explanation": null, "end": 54418, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 54401 }, { "analysis_explanation": null, "end": 55257, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 55241 }, { "analysis_explanation": null, "end": 55591, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 55586 }, { "analysis_explanation": null, "end": 55902, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 55886 }, { "analysis_explanation": null, "end": 56630, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 56624 }, { "analysis_explanation": null, "end": 57646, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 57629 }, { "analysis_explanation": null, "end": 58217, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 58201 }, { "analysis_explanation": null, "end": 58671, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 58655 }, { "analysis_explanation": null, "end": 58852, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 58846 }, { "analysis_explanation": null, "end": 59616, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 59608 }, { "analysis_explanation": null, "end": 60481, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 60458 }, { "analysis_explanation": null, "end": 60528, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 60509 }, { "analysis_explanation": null, "end": 60591, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 60587 }, { "analysis_explanation": null, "end": 60612, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 60592 }, { "analysis_explanation": null, "end": 61837, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 61831 }, { "analysis_explanation": null, "end": 62728, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 62719 }, { "analysis_explanation": null, "end": 65180, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 65145 }, { "analysis_explanation": null, "end": 65301, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 65274 }, { "analysis_explanation": null, "end": 68339, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 68335 }, { "analysis_explanation": null, "end": 71863, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 71854 }, { "analysis_explanation": null, "end": 71938, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 71929 }, { "analysis_explanation": null, "end": 72295, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 72288 }, { "analysis_explanation": null, "end": 74033, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 74009 }, { "analysis_explanation": null, "end": 74289, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 74284 }, { "analysis_explanation": null, "end": 75487, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 75463 }, { "analysis_explanation": null, "end": 75743, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 75738 }, { "analysis_explanation": null, "end": 76946, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 76922 }, { "analysis_explanation": null, "end": 77202, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 77197 }, { "analysis_explanation": null, "end": 78404, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 78380 }, { "analysis_explanation": null, "end": 78660, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 78655 }, { "analysis_explanation": null, "end": 79064, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 79041 }, { "analysis_explanation": null, "end": 80440, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 80409 }, { "analysis_explanation": null, "end": 82045, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 82040 }, { "analysis_explanation": null, "end": 84011, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 83987 }, { "analysis_explanation": null, "end": 84201, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 84195 }, { "analysis_explanation": null, "end": 84509, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 84487 }, { "analysis_explanation": null, "end": 85005, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 84989 }, { "analysis_explanation": null, "end": 85341, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 85329 }, { "analysis_explanation": null, "end": 85724, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 85717 }, { "analysis_explanation": null, "end": 86575, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 86568 }, { "analysis_explanation": null, "end": 86641, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 86624 }, { "analysis_explanation": null, "end": 90076, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 90058 }, { "analysis_explanation": null, "end": 90389, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 90373 }, { "analysis_explanation": null, "end": 90573, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 90567 }, { "analysis_explanation": null, "end": 91953, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 91948 }, { "analysis_explanation": null, "end": 1552, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 1541 }, { "analysis_explanation": null, "end": 84537, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 84531 }, { "analysis_explanation": null, "end": 84575, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 84569 } ]
[ "Genetic interactions link ARF1, YPT31/32 and TRS130.", "\nA genetic screen for synthetic lethal interactions with arf1(-) identified a recessive mutation in TRS130, one of 10 components in the trafficking protein particle (TRAPP) complex (Sacher et al., ", "2000). ", "As TRS130 is an essential gene, the synthetic lethal allele (trs130-101) is a novel one that requires ARF1 for viability. ", "This allele was found to exhibit no defects in secretory function, i.e. processing of carboxypeptidase Y or invertase. ", "YPT31 and YPT32 were identified in a subsequent screen as high-copy suppressors of arf1(-)trs130-101. ", "Increasing the gene dosage of YPT31/32 also suppressed lethality resulting from deletion of TRS130 or TRS120 but not three other essential TRAPP subunit-encoding genes. ", "Although unable to suppress defects in several alleles of ARF1, increasing the gene dosage of YPT31/32 suppressed the cold sensitivity of gcs1(-), an Arf GTPase-activating protein (GAP). ", "Thus, these genetic interactions provide initial evidence for linkage of Arf and TRAPP signalling and for Ypt31/32 proteins functioning downstream of both components in the TRAPP complex and of Arf signalling via the Gcs1 Arf GAP." ]
{ "pile_set_name": "PubMed Abstracts" }
[ 0, 0.01015228426395939, 0, 0, 0, 0.00980392156862745, 0.011834319526627219, 0.0106951871657754, 0.008695652173913044 ]
0.005687
5
[ { "analysis_explanation": null, "end": 158, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 152 }, { "analysis_explanation": null, "end": 247, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 234 }, { "analysis_explanation": null, "end": 253, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 249 }, { "analysis_explanation": null, "end": 265, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 259 }, { "analysis_explanation": null, "end": 707, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 701 } ]
[ "France's \"Heavy1\" radio show recently conducted an interview with GHOST leader and frontman Tobias Forge. ", "You can listen to the entire chat at this location. ", "A few excerpts follow (transcribed by BLABBERMOUTH.NET).", "\n\nOn what inspired the theme behind the band's new studio album, \"Prequelle\":\n\nTobias: \"I think when you're dealing with that sort of imagery, the whole occult and sort of darkness-embracing landscape, there are certain things that are recurring. ", "Anything from spiderwebs to graveyards [laughs] and upside-down crosses, but also the plague and Middle Ages, it's a very clear manifestation of mankind needing a godliness that might not be super-happy with mankind, which is always interesting from a rock point of view. ", "You're dealing with occult rock. ", "It's a record that is surrounded by death, but essentially, it's a record about survival and to stand that ordeal, so yes, it does definitely come with a glimpse of hope.\"", "\n\nOn whether he's a fan of 80s music:\n\nTobias: \"I am a big fan of what most people would regard as 'well-written' music. ", "I like music that moves me and makes me feel things and, more than often, it's music that, I guess, falls within a certain sort of pattern, but that could be anything from FLEETWOOD MAC to VENOM. ", "But, yes, I do appreciate a song that has a little bit of a standardized sort of dramaturgical pattern, but I think pop music, I think that JUDAS PRIEST writes pop music. ", "They have a very pop sensibility to their music. ", "PINK FLOYD is also catchy, even though the songs are way longer. ", "I think if you draw comparisons to film, I mean, yes, it's easy to dismiss a majority of half-hearted films as predictable just because it has an easily foreseen, it's a very premeditated storyline because it falls into a certain dramaturgical structure. ", "But I promise you if we sit down and take films that are being regarded as high in culture because they're different, they also follow the same dramaturgical structure because there's something in our psyche that feels better absorbing something if it's done in a certain a way. ", "Kind of like if you're serving a dish. ", "It needs a certain amount of salt and shouldn't contain excrement in order for it to be tasting well.\"", "\n\nOn whether he would ever add a female to the GHOST clergy:\n\nTobias: \"We already have Sister Imperator. ", "I think it's very important for life and society itself, but if we're focusing in rock, I think it's very important to not only acknowledge, but also to rejoice in the fact rock and roll is based on both genders. ", "I think that oftentimes, especially in metal it has a tendency to be a little bit disregarding of that fact. ", "Nowadays, what you'll see when we start playing live again is there's going to be a little bit more of a unisex band. ", "We have a few girls in the band. ", "That makes life and the show so much better to have that dynamic.\"", "\n\nOn transposing their live show from regular concert halls to a festival setting:\n\nTobias: \"Now we're making things more difficult, I guess, just because on the tour that we're doing before the summer, the show that we intend to do is over two hours long. ", "We're playing 20-plus songs and it's like in two acts. ", "First, we play an hour, then we have intermission, then get started again and do another thing. ", "That won't work in a festival, so regardless, we have to sort of trim it down. ", "Even if you're headlining you might still just play an hour, hour and-a-half. ", "Either way, we have to trim it down. ", "There's a level of production that we're bringing to the tour and that we will bring later to the European headlining tour that we don't really have the ability to do the exact same thing at a festival. ", "But, if you are headlining that stage, that usually gives you a little bit more leeway, a little bit more possibility to recreate your show somewhat.\"", "\n\nOn the biggest misconception about GHOST:\n\nTobias: \"I don't think a lot of our fans — I don't feel misunderstood, but sometimes I guess that from a creator point of view where, obviously, I'm trying to pack this dish with as many interesting things as possible, you could get a little, sometimes it feels like when you do this enormous dish, you stand for three hours and make it and someone comes in and eats it very quickly and they burp and they say, 'That was really good! ", "Let's jump for dessert.' ", "But, at the end of the day, GHOST is one thing in my head and my heart and it's my child and my child can never be everything it is to me to everyone else. ", "I have to be very happy that people like some of it. ", "Also, GHOST means so many different things to so many more people than to me. ", "I'm just happy that I've been able to reach out to people that way. ", "If they like GHOST that might not emphasize so much, fine. ", "I think that's the most important when you're creating. ", "If you're trying to create art, it's one thing if your thing is doing speeches or you're a politician, then your task is to convey a certain opinion or a certain movement that is supposed to go that way, whereas art should be about in some way, just giving people a reason to continue, preferably forwards, but also a great thing about good art is if you're able to get people to, in turn, [start] creating things. ", "That, rather than just absorb. ", "So, with that being said, I think the amount of creativity among a large portion of our fans gives me a receipt that there must be something being done right if it creates this surge of creativity amongst our fans, but it also gives me a little bit of humbleness to the fact that I was saying just before, that GHOST is what I have been part of making seems to have taken on a different life in another people. ", "So, you have to have a little bit of respect to that as well, rather than just saying, 'The whole thing is mine. ", "It's my vision. ", "You're not allowed to touch it.'\"", "\n\nGHOST's new album, \"Prequelle\", landed at position No. ", "3 on this week's Billboard 200 chart. ", "The disc, which arrived on June 1, shifted 66,000 equivalent album units in the week ending June 7. ", "Of that sum, between 61,000 were in traditional album sales.", "\n\nGHOST's first week benefits from a concert ticket/album sale redemption offer in association with the band's spring U.S. theater tour, as well as a pair of arena dates later this year.", "\n\nThe Billboard 200 chart ranks the most popular albums of the week based on multi-metric consumption, which includes traditional album sales, track equivalent albums (TEA) and streaming equivalent albums (SEA).", "\n\nGHOST's last studio release, the \"Popestar\" EP, debuted at No. ", "6 with 21,000 sold in its first week back in September 2016. \"", "Popestar\" started as GHOST's second No. ", "1 on the Hard Rock Albums chart, following \"Infestissumam\", which reigned for a week (May 4, 2013). ", "Meanwhile, 2015's \"Meliora\" also debuted and peaked at No. ", "6 on the Billboard 200.", "\n\n\"Prequelle\" was tracked last year at Artery studios in Stockholm with producer Tom Dalgety (OPETH, ROYAL BLOOD) and mixed in January at Westlake Studios in West Hollywood, California with Andy Wallace (NIRVANA, SLAYER).", "\n\nInterview (audio):" ]
{ "pile_set_name": "OpenWebText2" }
[ 0.009433962264150943, 0, 0, 0, 0, 0, 0, 0, 0.01020408163265306, 0, 0, 0, 0, 0, 0, 0, 0.01904761904761905, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.02631578947368421, 0, 0, 0, 0.014218009478672985, 0.015384615384615385, 0, 0.025, 0.01, 0.01694915254237288, 0.043478260869565216, 0.02262443438914027, 0 ]
0.003666
5
[ { "analysis_explanation": null, "end": 6, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 0 }, { "analysis_explanation": null, "end": 104, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 92 }, { "analysis_explanation": null, "end": 298, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 292 }, { "analysis_explanation": null, "end": 965, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 962 }, { "analysis_explanation": null, "end": 980, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 974 }, { "analysis_explanation": null, "end": 1404, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1392 }, { "analysis_explanation": null, "end": 2279, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2273 }, { "analysis_explanation": null, "end": 2944, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2938 }, { "analysis_explanation": null, "end": 3055, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3045 }, { "analysis_explanation": null, "end": 3104, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3095 }, { "analysis_explanation": null, "end": 3188, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3181 }, { "analysis_explanation": null, "end": 3400, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3393 }, { "analysis_explanation": null, "end": 3562, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3554 }, { "analysis_explanation": null, "end": 3859, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3853 }, { "analysis_explanation": null, "end": 4177, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4166 }, { "analysis_explanation": null, "end": 4338, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4320 }, { "analysis_explanation": null, "end": 5831, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5822 }, { "analysis_explanation": null, "end": 5871, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5867 }, { "analysis_explanation": null, "end": 5928, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5922 }, { "analysis_explanation": null, "end": 5993, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5971 }, { "analysis_explanation": null, "end": 6074, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6064 }, { "analysis_explanation": null, "end": 6171, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6165 }, { "analysis_explanation": null, "end": 6176, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6172 }, { "analysis_explanation": null, "end": 6239, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6224 }, { "analysis_explanation": null, "end": 6306, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6298 }, { "analysis_explanation": null, "end": 6456, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6451 }, { "analysis_explanation": null, "end": 6555, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6536 }, { "analysis_explanation": null, "end": 6573, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6559 }, { "analysis_explanation": null, "end": 6701, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6695 }, { "analysis_explanation": null, "end": 6714, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6703 }, { "analysis_explanation": null, "end": 6732, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6728 }, { "analysis_explanation": null, "end": 6810, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6801 }, { "analysis_explanation": null, "end": 6833, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6824 }, { "analysis_explanation": null, "end": 6864, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6855 }, { "analysis_explanation": null, "end": 6890, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6879 }, { "analysis_explanation": null, "end": 6910, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6899 }, { "analysis_explanation": null, "end": 6932, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6925 }, { "analysis_explanation": null, "end": 6970, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6956 }, { "analysis_explanation": null, "end": 6982, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6972 }, { "analysis_explanation": null, "end": 7000, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6988 }, { "analysis_explanation": null, "end": 212, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 196 }, { "analysis_explanation": null, "end": 208, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 196 } ]
[ "Known lithography techniques to be used during procedures for manufacturing semiconductor elements include a double-patterning technique using ArF immersion exposure, EUV lithography, nanoimprint, and the like. ", "As patterns have become smaller, those conventional lithography techniques entail various problems such as higher costs and lower throughputs.", "\nUnder such circumstances, applications of directed self-assembly (DSA) to the lithography techniques are expected. ", "Directed self-assembly occurs through the spontaneous behavior of energy stabilization, and accordingly, can contribute to formation of patterns with high size precision. ", "Particularly, by a technique utilizing microphase separation of a polymeric block copolymer, periodic structures that are of various shapes and of several to hundreds of nanometers can be formed through simple coating and annealing processes. ", "Spheres, cylinders, lamellas, or the like can be formed depending on the composition ratio in the blocks of the polymeric block copolymer, and sizes can vary depending on the molecular weight. ", "In this manner, dot patterns, hole patterns, pillar patterns, line patterns, or the like of various sizes can be formed.", "\nThe positions of phase separation patterns of a self-assembled material have fluctuations that cannot be artificially controlled. ", "In a case where patterns of interconnects, contact holes, and the like are formed by using a self-assembled material, the fluctuations need to be restrained, and the accuracy of alignment between the upper-layer patterns and the lower-layer patterns needs to be increased." ]
{ "pile_set_name": "USPTO Backgrounds" }
[ 0.009478672985781991, 0, 0.008620689655172414, 0, 0, 0, 0, 0, 0 ]
0.002011
5
[ { "analysis_explanation": null, "end": 689, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 679 } ]
[ "Feb 11, 2016\n\nWith a holy grail box set just released on Captured Tracks, early-'70s power-pop glamsters Milk 'N' Cookies are swinging by Other Music on Tuesday, February 16 to play this very special (and rare) live in-store performance. ", "Their recent reunion show at Baby's All Right saw the band in top rocking form and full of surprises, and we can guarantee you this one's not to be missed...and it's FREE! ", "Cookies rule, OK!!" ]
{ "pile_set_name": "Pile-CC" }
[ 0.008403361344537815, 0.011627906976744186, 0 ]
0.006677
5
[ { "analysis_explanation": null, "end": 12, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 0 }, { "analysis_explanation": null, "end": 173, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 153 }, { "analysis_explanation": null, "end": 397, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 386 } ]
[ "Homicide in Tours (Indre-et-Loire, France): a four-year review.", "\nThis retrospective study examined homicides in two French departments located in the West of France (Indre-et-Loire and Loir-et-Cher) for a four-year period from 2000 to 2003. ", "During this period 63 homicidal deaths were investigated at the Institute of Forensic Science of Tours (Indre-et-Loire). ", "There were 45 male and 18 female victims with an average homicide rate of 1.55 per 100,000 persons. ", "The mean age of the victims was 42 years-old. ", "Forty-five assailants were identified; their mean age was 38 years-old. ", "The most common method of homicide was the use of firearms (40% of the cases), followed by blunt-force injury (36%) and sharp-force injury (16%). ", "51% of the victims knew their assailant, a family member in 26% of the cases. ", "Spousal homicides occurred in 16% of the cases. ", "Dyadic death occurred in six cases. ", "A review of the literature compares these findings to other populations." ]
{ "pile_set_name": "PubMed Abstracts" }
[ 0, 0.005649717514124294, 0.008264462809917356, 0, 0, 0, 0, 0, 0.020833333333333332, 0.027777777777777776, 0 ]
0.005684
5
[ { "analysis_explanation": null, "end": 17, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12 }, { "analysis_explanation": null, "end": 41, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 35 }, { "analysis_explanation": null, "end": 55, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 46 }, { "analysis_explanation": null, "end": 121, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 115 }, { "analysis_explanation": null, "end": 163, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 157 }, { "analysis_explanation": null, "end": 213, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 204 }, { "analysis_explanation": null, "end": 238, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 234 }, { "analysis_explanation": null, "end": 505, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 493 }, { "analysis_explanation": null, "end": 577, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 565 } ]
[ "More Fishy Stories\n\ncaught, much like birders tick species seen. ", "They call themselves various names: life listers, species fishers, rough fishers.", "\n\nFor them, the thrill of angling lies not in the size of the fish, but in its species. ", "It is a realm where field guides matter as much as fishing rods, where fishing stories include identifying species of redhorse and sunfish and darter.", "\n\nIt involves dangling tiny, tiny hooks in front of minnows, and casting huge chunks of meat for river monsters – sometimes in the same day. ", "Sometimes at the same time.", "\n\nFishing and identifying wildlife species are two of my favorite things – and have been since childhood. ", "But generally, they have always been two separate activities. ", "When I started reading about anglers combining the two activities into one, I knew I had to find out more.", "\n\nAnd then Cantrell invited me to join him for a weekend of species seeking near his home in central Illinois. ", "How could I resist?", "\n\nBeyond Bass and Trout\n\nI’ve long considered myself a naturalist with a fly rod. ", "I care little about gear or fish size. ", "I live for the pursuit of beautiful fish in beautiful places. ", "And for the past 15 years, that has largely meant fly fishing for trout.", "\n\nThat pursuit can give a curious naturalist plenty of material. ", "Learning the aquatic invertebrates that trout feed on is a lifetime task. ", "Mayfly hatches are a stunning natural phenomenon often as interesting as the fish themselves. ", "Learning to “read water” requires an immersion – literally – into aquatic habitats.", "\n\nBut I admit that in my fishing focus I often didn’t notice a key element of streams: other fish.", "\n\nAs I looked more closely, I couldn’t help but notice other cool fish swimming about – fish like suckers. ", "That led me to expand my angling horizons. ", "I found that many other anglers didn’t share this curiosity, too often persecuting these so-called “trash fish.” ", "They brought preconceived notions to the stream, and perpetuated fishy myths. ", "Even many conservation-minded fishers considered “rough” fish beneath their dignity.", "\n\nWhat if anglers embraced the full range of fish diversity, I wondered. ", "It turns out, I was way behind on this. ", "Far from the blue-ribbon trout streams, another kind of angler worked – the species angler in pursuit of life lists. ", "They were not content to just focus on bass, trout and walleye – how boring! ", "No, they wanted to catch…everything.", "\n\nAnd that’s apparent the minute I pull into the parking lot of Illinois’ Starved Rock State\n\nFrom Around the Web\n\nPark and meet Cantrell. ", "He immediately begins reeling the options: cast a jig for white bass, or put some bait on the bottom for catfish and drum, or cast a tiny hook for gobies, or…\n\nHe settles into his fishing rhythm and begins telling me of his own path to life listing. ", "Unlike many avid anglers, he was not smitten by fishing as a child. ", "Sure, he’d go out occasionally, but it was a diversion. ", "Nothing more.", "\n\nAs a graduate student at the University of Wisconsin, he was surrounded by lakes and great fishing, and started going out more. ", "But just targeting walleyes on every outing didn’t quite fit his personality.", "\n\n“I admit it. ", "I’m obsessive by nature,” Cantrell says. “", "I think it runs in my family. ", "When I get into a hobby, I get really into it.”", "\n\nMany sunfish species — like this longear sunfish — are quite colorful and fun to catch. ", "Photo: Ben Cantrell\n\nHe always loved keeping records, meticulously recording the details. ", "It led him to a career in engineering – he today works as an engineer for Caterpillar. ", "In college, he was a competitive power lifter – a sport demanding a detailed and precise training regime.", "\n\nThat dedication to detail fueled his hobbies, too. “", "At one point, my big hobby was craft beer,” he says. “", "I kept track of every kind of beer I’d ever had. ", "My list grew to 1500. ", "Then I started fishing.”", "\n\nCantrell’s fishing obsession has led him to many unusual species, like this bandtail puffer. ", "Photo: Ben Cantrell\n\nHe began noting the species he caught. ", "When he stumbled upon the Rough Fish web site in 2010, he was – pardon the pun – hooked. ", "That site had a feature that allowed members to list their species caught and contains detailed information on catching everything from tiny, knuckle-sized minnows to alligator gar bigger than most humans.", "\n\n“I suddenly realized all the fish I could be catching,” he says. “", "I don’t keep track of beer any more. ", "I only have room for one obsession in my life.”", "\n\nBen Cantrell poses with a bowfin.", "\n\nIt becomes apparent how much this requires the skills of a biologist. ", "Before he fishes any stream, he studies field guides, reference books and aquatic surveys. ", "He studies the species so he knows what he might catch: many fish actually look quite similar, so adding a new “lifer” could mean counting fin rays or noting subtle color variation.", "\n\n“The preparation is a big part of the fun,” Cantrell says. “", "You’re lining up the new species you could catch, and figuring out ways to catch them.”", "\n\nStarved Rock State Park is not living up to Ben’s expectations. ", "He’s caught some smallmouth and white bass – common catches. ", "I’ve caught a small channel catfish. ", "It’s a nice spot but Cantrell is thinking ahead. “", "The fishing here isn’t very exciting,” he shrugs. “", "Tomorrow we could catch some cool stuff.”", "\n\nA Journey to Garvana\n\nWe’re walking along a faint trail in the brush on our way to a place that Cantrell calls “Garvana.” ", "The life listing community is still a small one, and a remarkable number of the subculture’s biggest names have fished here. ", "But this is not famous water. ", "There are no designer-clad fly fishers, no sparkling bass boats.", "\n\nBut among certain aficionados, it has almost legendary status. “", "I’ve never seen gar stacked up in such high numbers,” says fellow Cool Green Science writer, and gar expert extraordinaire, Solomon David. “", "They are just stacked there in unbelievable numbers.”", "\n\nBut not today. ", "The river is muddy, the morning is cool and the gar are nowhere to be seen.", "\n\nNot a problem for the species angler: there’s always something to catch. ", "Cantrell is blur of motion as he prepares rods. ", "I’m used to tying on a fly and focusing on one type of fish for the day. ", "Cantrell is considering all the options.", "\n\nHe rigs a couple of rods with nightcrawlers, with heavy weights to keep the bait on the river bottom. ", "He has another rod rigged with a spinning lure. ", "He is tossing in alfalfa pellets to draw in buffalo: a beefy – and wary – sucker species.", "\n\nWithin minutes, my rod bucks over and I’m hard into a freshwater drum – a new species for me but a very common catch in the Midwest. “", "The first drum is exciting,” says Cantrell. “", "But they’re as close to a guarantee as you can get in fishing.”", "\n\nHe is apologizing for the lack of gar when his bobber goes underwater. ", "It’s the goldeye: a streamlined fish with, as you might guess, a noticeably golden eye.", "\n\nHe’s bouncing around with excitement, directing me to his camera: he documents each new species with a photo.", "\n\nAfter he unhooks the fish, he explains part of the thrill of life listing. “", "I’ve fished this river a lot, and I can still catch something new here,” he says. “", "Sometimes I catch something that has not been recorded in a river before.”", "\n\nNow he’s put down his larger rod and is scanning along the shoreline. ", "He points to some tiny fish. “", "Sand shiners,” he says casually. “", "Not very exciting. ", "But they’ll work to show you some microfishing.”", "\n\nThe Heart of the Obsession: The Strange World of Microfishing\n\nI am seeing tiny fish darting around, and all I can think is: Are we really going to fish for them? ", "The biggest one looked under two inches.", "\n\n“I’ve caught fish a lot smaller than that,” Cantrell says.", "\n\nHere is the reality of freshwater fish diversity: a lot of the species are really, really small.", "\n\nBut then there’s the matter of catching them. ", "For Cantrell, his obsession has long ago moved from the realm of microbrews to the realm of microfishing. ", "He is showing me his gear – a hook the size of a 10-font J attached to a wispy thread of light line. ", "I adjust my glasses.", "\n\nThe gear for microfishing – catching tiny fish on tiny gear – originated in Japan, where some anglers try to see how small a fish they can catch.", "\n\nCantrell demonstrates the technique. ", "He puts a tiny fleck of worm on the hook and dangles the line into a school of minnows. ", "He stands still, intent upon the miniature world below him.", "\n\nHe looks like a human heron.", "\n\nAnd then he jerks the rod. “", "When a fish strikes, you have to pop the rod,” he says. “", "The pop is the key.”", "\n\nHe hands me the rod. ", "I am concentrating on minnows – many of them too small to be considered bait. ", "Like the best of outdoor pursuits, nothing else exists but this moment. ", "Nothing but me and the minnows. ", "And yet, there is the vague sense that I am losing my mind.", "\n\nI see a minnow nip at the hook. ", "I miss it. ", "Another is there in a second. ", "I miss again. ", "And again.", "\n\nThis microfishing is not easy. ", "But after a few minutes, I lift the rod – and there is my sand shiner.", "\n\n“Your pop is terrible,” says Cantrell with a grin. “", "But you have a new lifer.”", "\n\nBlogs of Cantrell’s fishing expeditions, as you might imagine, bear little resemblance to your typical fish stories. ", "They are full of photos of fish that fit, easily, in the palm of his hand. ", "He has caught more than 30 darter species, sometimes moving from one stream to the next to catch different endemics.", "\n\nMany anglers see this and see a waste of time. ", "Many naturalists will wonder why he couldn’t just snorkel with the fishes and record the species he sees.", "\n\nBut I understand – and love – the thrill of the chase, and here’s a way to combine that thrill with good old-fashioned natural history skills.", "\n\nAnd maybe something more: while I understand that life listing of any kind can lead to a self-destructive mania (read Mark Obmascik’s The Big Year and Olivia Gentile’s Life List for birding examples), it can also lead to deeper connections with the natural world.", "\n\nThe fact is, most fish species lack champions. ", "Most anglers do not care about diversity. ", "They care about game fish.", "\n\nThe darters, the suckers, the gar and the shiners need a constituency. ", "Who better than someone who knows their habits, perhaps knows them better than most biologists?", "\n\nBut will all that minnow-seeking lead to fish burnout? “", "I try to learn new aspects of fishing every year,” says Cantrell. “", "This year I’m focusing on catching buffalo. ", "I think there is still so much to learn, and so many species to catch.”", "\n\nAnd so he goes on, patrolling the streams, rivers, ponds and ditches for new species. ", "Last week, I got a message from him. ", "He just caught species #300: a redtail chub. ", "And he had looked up my home state of Idaho.", "\n\nBear Lake, in the southeastern corner of the state, contains fish species found nowhere else on earth. ", "Would I be up for an ice-fishing endemic fest? ", "Ben asks. ", "Stay tuned.", "\n\nMatthew L. Miller is director of science communications for The Nature Conservancy and editor of the Cool Green Science blog. ", "A lifelong naturalist and outdoor enthusiast, he has covered stories on science and nature around the globe. ", "Matt has worked for the Conservancy for the past 14 years, previously serving as director of communications for the Idaho program.", "\nMore from Matthew\n\nHey Matt, nice work on the article, this has been making the rounds.", "\nDave and I (the Fish Nerds) started out species fishing, we caught and ate every kind of freshwater fish in NH. ", "After completing the quest we launched our podcast http://www.fishnerds.com we want to interview Ben Cantrell but are having trouble finding his email… any chance you can connect us?", "\nClay\n\nI think the world is ready for microfishing to go mainstream. ", "Just fishing shows with guys catching minnows for their life lists. ", "And Ben should be the host along with professor fish. ", "They could do trips with ken and change the world. ", "You could call it the Ben Ken Pro Show on the Go.", "\n\nI am very happy read this blog.", "This Blog is really perfect fishing ever i seen. ", "Here have perfect way to fishing.", "Here show many fishing method which is helpful info. ", "it is awesome article I thinks it is the best fishing blog. ", "I think it’s carry the best way to perfect fishing. ", "This article is very helpful. ", "I am very satisfied for this blog when i read it. ", "Thanks For Share it." ]
{ "pile_set_name": "Pile-CC" }
[ 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.009009009009009009, 0, 0.012195121951219513, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.014388489208633094, 0, 0, 0, 0, 0.007692307692307693, 0, 0, 0.023809523809523808, 0, 0, 0, 0.011111111111111112, 0.011494252873563218, 0, 0, 0, 0, 0, 0, 0, 0.016666666666666666, 0, 0, 0, 0, 0, 0.02857142857142857, 0, 0, 0, 0.016129032258064516, 0, 0.015151515151515152, 0, 0, 0.02, 0, 0, 0.024193548387096774, 0, 0, 0, 0, 0.014285714285714285, 0, 0, 0, 0, 0, 0, 0.025, 0, 0, 0, 0, 0.022222222222222223, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.016666666666666666, 0, 0, 0.009433962264150943, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.018518518518518517, 0, 0, 0, 0, 0, 0, 0, 0.007547169811320755, 0, 0, 0, 0, 0, 0, 0.014925373134328358, 0, 0, 0, 0, 0, 0, 0, 0, 0.1, 0, 0.015625, 0, 0.007692307692307693, 0.011363636363636364, 0.017699115044247787, 0.01098901098901099, 0, 0, 0.018518518518518517, 0, 0.02040816326530612, 0, 0.02040816326530612, 0, 0, 0, 0, 0, 0, 0 ]
0.003247
5
[ { "analysis_explanation": null, "end": 521, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 509 }, { "analysis_explanation": null, "end": 841, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 833 }, { "analysis_explanation": null, "end": 878, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 869 }, { "analysis_explanation": null, "end": 931, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 923 }, { "analysis_explanation": null, "end": 964, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 960 }, { "analysis_explanation": null, "end": 1159, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1142 }, { "analysis_explanation": null, "end": 2415, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2405 }, { "analysis_explanation": null, "end": 2455, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2447 }, { "analysis_explanation": null, "end": 2520, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2512 }, { "analysis_explanation": null, "end": 3163, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3155 }, { "analysis_explanation": null, "end": 3357, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3345 }, { "analysis_explanation": null, "end": 3833, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3825 }, { "analysis_explanation": null, "end": 3937, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3925 }, { "analysis_explanation": null, "end": 4031, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4027 }, { "analysis_explanation": null, "end": 4247, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4244 }, { "analysis_explanation": null, "end": 4437, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4425 }, { "analysis_explanation": null, "end": 4854, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4846 }, { "analysis_explanation": null, "end": 4974, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4959 }, { "analysis_explanation": null, "end": 4998, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4995 }, { "analysis_explanation": null, "end": 5142, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5134 }, { "analysis_explanation": null, "end": 5224, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5216 }, { "analysis_explanation": null, "end": 5362, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5354 }, { "analysis_explanation": null, "end": 5377, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5370 }, { "analysis_explanation": null, "end": 5684, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5681 }, { "analysis_explanation": null, "end": 5765, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5762 }, { "analysis_explanation": null, "end": 5802, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5789 }, { "analysis_explanation": null, "end": 5873, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5868 }, { "analysis_explanation": null, "end": 5906, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5895 }, { "analysis_explanation": null, "end": 6032, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6024 }, { "analysis_explanation": null, "end": 6143, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6136 }, { "analysis_explanation": null, "end": 6153, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6145 }, { "analysis_explanation": null, "end": 6440, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6433 }, { "analysis_explanation": null, "end": 6557, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6550 }, { "analysis_explanation": null, "end": 6603, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6595 }, { "analysis_explanation": null, "end": 6708, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6705 }, { "analysis_explanation": null, "end": 7636, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7628 }, { "analysis_explanation": null, "end": 7798, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7790 }, { "analysis_explanation": null, "end": 8095, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8090 }, { "analysis_explanation": null, "end": 8168, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8160 }, { "analysis_explanation": null, "end": 8897, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8884 }, { "analysis_explanation": null, "end": 8982, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8974 }, { "analysis_explanation": null, "end": 9042, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9034 }, { "analysis_explanation": null, "end": 9581, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9575 }, { "analysis_explanation": null, "end": 9761, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9748 }, { "analysis_explanation": null, "end": 9797, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9781 }, { "analysis_explanation": null, "end": 10201, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10195 }, { "analysis_explanation": null, "end": 10298, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10290 }, { "analysis_explanation": null, "end": 10311, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10302 }, { "analysis_explanation": null, "end": 10513, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10504 }, { "analysis_explanation": null, "end": 10629, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10624 }, { "analysis_explanation": null, "end": 10640, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10631 }, { "analysis_explanation": null, "end": 10784, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10781 }, { "analysis_explanation": null, "end": 10820, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10803 }, { "analysis_explanation": null, "end": 11042, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11038 }, { "analysis_explanation": null, "end": 11095, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11078 }, { "analysis_explanation": null, "end": 11159, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11154 }, { "analysis_explanation": null, "end": 11261, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11257 }, { "analysis_explanation": null, "end": 11367, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11365 }, { "analysis_explanation": null, "end": 11478, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11466 }, { "analysis_explanation": null, "end": 11556, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11552 }, { "analysis_explanation": null, "end": 11695, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11692 }, { "analysis_explanation": null, "end": 11770, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11767 }, { "analysis_explanation": null, "end": 11444, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.6, "start": 11420 } ]
[ "Q:\n\nVisual Studio 2010 does not warn about build errors when starting to debug\n\nI started using Visual Studio 2010 and am missing the dialog box that used pop up in Visual Studio 2008 and earlier that would warn you if there are build errors. ", "The text was something along the line of \"There were build errors, would you like to continue using the last successful build?\" ", "Then you had the option to continue or cancel (and then go fix the build errors.) ", "\nVS2010 is immediately debugging with the last successful build when there are build errors. ", "This is causing frustration for me. ", "How do I turn this warning back on in VS2010? ", "I looked through the options, but didn't see anything that looked like it would work. ", "\n\nA:\n\nThis is the setting: Prompt to launch\n\n" ]
{ "pile_set_name": "StackExchange" }
[ 0, 0, 0, 0, 0, 0.021739130434782608, 0, 0 ]
0.002717
5
[ { "analysis_explanation": null, "end": 22, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 18 }, { "analysis_explanation": null, "end": 459, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 453 }, { "analysis_explanation": null, "end": 625, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 619 } ]
[ "Q:\n\nDestroy Activity stack\n\nThere are some applications in which you can logout at any point within. ", "e.g you login and then your browse around. ", "you use the action bar or the menu button to logout. ", "I can call finish() at that very point but then it will just pop the last activity. ", "Even if i move the user forward to the Home Activity, still the stack remains in memory. ", "Is there any way to destroy the remaining stack?", "\n\nA:\n\nThe easiest way to do this is to clear the stack back to your home or first activity, and pass an identifier saying to exit the app. ", " For example:\npublic class ActivityOne extends Activity {\n public static final String FINISH_THIS = \"FINISH_THIS\";\n @Override\n protected void onNewIntent(Intent intent) {\n super.onNewIntent(intent);\n if(intent.hasExtra(FINISH_THIS)) {\n finish();\n }\n }\n @Override\n protected void onCreate(Bundle savedInstanceState) {\n super.onCreate(savedInstanceState);\n if(getIntent().hasExtra(FINISH_THIS)) {\n finish();\n }\n }\n}\n\npublic class ActivityTwo extends Activity {\n @Override\n public boolean onOptionsItemSelected(MenuItem item) {\n if(item.getItemId() == R.id.logout) {\n Intent intent = new Intent(this, ActivityOne.class);\n intent.setFlags(Intent.", "FLAG_ACTIVITY_CLEAR_TOP);\n intent.putExtra(ActivityOne.", "FINISH_THIS, true);\n startActivity(intent);\n }\n return true;\n }\n}\n\nIf ActivityOne is the root of your stack and ActivityTwo is where the user selected the option to logout, starting an intent that clears back to ActivityOne will get rid of the backstack. ", " If you want the app to exit when logging out, you can pass an extra like I did with FINISH_THIS to signal the root/home activity to finish.", "\nAnother way to do this would be to call setResult(FINISH_THIS) where FINISH_THIS is an int identifier before calling finish(). ", " Then in all other activities in the stack, you'd override onActivityResult and check the result to see if that activity needs to be finished. ", "If it does, you set the result again and keep passing it down the line.", "\nUsing the intent method I outlined in the beginning is the preferred method for clearing the stack as it doesn't rely on daisy chaining results together but both options work well enough.", "\n\n" ]
{ "pile_set_name": "StackExchange" }
[ 0, 0.023255813953488372, 0, 0, 0.011235955056179775, 0, 0, 0.006561679790026247, 0, 0.01060070671378092, 0, 0, 0, 0, 0, 0 ]
0.003228
5
[ { "analysis_explanation": null, "end": 1888, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1877 }, { "analysis_explanation": null, "end": 1189, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 1182 }, { "analysis_explanation": null, "end": 1206, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 1202 }, { "analysis_explanation": null, "end": 1276, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 1262 }, { "analysis_explanation": null, "end": 1303, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 1294 } ]
[ "<Type Name=\"AVAudioSettings\" FullName=\"MonoMac.", "AVFoundation.", "AVAudioSettings\">\n <TypeSignature Language=\"C#\" Value=\"public static class AVAudioSettings\" />\n <TypeSignature Language=\"ILAsm\" Value=\".class public auto ansi abstract sealed beforefieldinit AVAudioSettings extends System.", "Object\" />\n <AssemblyInfo>\n <AssemblyName>MonoMac</AssemblyName>\n <AssemblyVersion>0.0.0.0</AssemblyVersion>\n </AssemblyInfo>\n <Base>\n <BaseTypeName>System.", "Object</BaseTypeName>\n </Base>\n <Interfaces />\n <Docs>\n <summary>Contains the key values used to configure the AVAudioRecorder using its Settings dictionary.</summary>\n <remarks>To be added.</remarks>\n </Docs>\n <Members>\n <Member MemberName=\"AVChannelLayoutKey\">\n <MemberSignature Language=\"C#\" Value=\"public static MonoMac.", "Foundation.", "NSString AVChannelLayoutKey { get; }\" />\n <MemberSignature Language=\"ILAsm\" Value=\".property class MonoMac.", "Foundation.", "NSString AVChannelLayoutKey\" />\n <MemberType>Property</MemberType>\n <AssemblyInfo>\n <AssemblyVersion>0.0.0.0</AssemblyVersion>\n </AssemblyInfo>\n <ReturnValue>\n <ReturnType>MonoMac.", "Foundation.", "NSString</ReturnType>\n </ReturnValue>\n <Docs>\n <summary>Represents the value associated with the constant AVChannelLayoutKey</summary>\n <value>\n </value>\n <remarks>To be added.</remarks>\n </Docs>\n </Member>\n <Member MemberName=\"AVEncoderAudioQualityKey\">\n <MemberSignature Language=\"C#\" Value=\"public static MonoMac.", "Foundation.", "NSString AVEncoderAudioQualityKey { get; }\" />\n <MemberSignature Language=\"ILAsm\" Value=\".property class MonoMac.", "Foundation.", "NSString AVEncoderAudioQualityKey\" />\n <MemberType>Property</MemberType>\n <AssemblyInfo>\n <AssemblyVersion>0.0.0.0</AssemblyVersion>\n </AssemblyInfo>\n <ReturnValue>\n <ReturnType>MonoMac.", "Foundation.", "NSString</ReturnType>\n </ReturnValue>\n <Docs>\n <summary>Represents the value associated with the constant AVEncoderAudioQualityKey</summary>\n <value>\n </value>\n <remarks>To be added.</remarks>\n </Docs>\n </Member>\n <Member MemberName=\"AVEncoderBitDepthHintKey\">\n <MemberSignature Language=\"C#\" Value=\"public static MonoMac.", "Foundation.", "NSString AVEncoderBitDepthHintKey { get; }\" />\n <MemberSignature Language=\"ILAsm\" Value=\".property class MonoMac.", "Foundation.", "NSString AVEncoderBitDepthHintKey\" />\n <MemberType>Property</MemberType>\n <AssemblyInfo>\n <AssemblyVersion>0.0.0.0</AssemblyVersion>\n </AssemblyInfo>\n <ReturnValue>\n <ReturnType>MonoMac.", "Foundation.", "NSString</ReturnType>\n </ReturnValue>\n <Docs>\n <summary>Represents the value associated with the constant AVEncoderBitDepthHintKey</summary>\n <value>\n </value>\n <remarks>To be added.</remarks>\n </Docs>\n </Member>\n <Member MemberName=\"AVEncoderBitRateKey\">\n <MemberSignature Language=\"C#\" Value=\"public static MonoMac.", "Foundation.", "NSString AVEncoderBitRateKey { get; }\" />\n <MemberSignature Language=\"ILAsm\" Value=\".property class MonoMac.", "Foundation.", "NSString AVEncoderBitRateKey\" />\n <MemberType>Property</MemberType>\n <AssemblyInfo>\n <AssemblyVersion>0.0.0.0</AssemblyVersion>\n </AssemblyInfo>\n <ReturnValue>\n <ReturnType>MonoMac.", "Foundation.", "NSString</ReturnType>\n </ReturnValue>\n <Docs>\n <summary>Represents the value associated with the constant AVEncoderBitRateKey</summary>\n <value>\n </value>\n <remarks>To be added.</remarks>\n </Docs>\n </Member>\n <Member MemberName=\"AVEncoderBitRatePerChannelKey\">\n <MemberSignature Language=\"C#\" Value=\"public static MonoMac.", "Foundation.", "NSString AVEncoderBitRatePerChannelKey { get; }\" />\n <MemberSignature Language=\"ILAsm\" Value=\".property class MonoMac.", "Foundation.", "NSString AVEncoderBitRatePerChannelKey\" />\n <MemberType>Property</MemberType>\n <AssemblyInfo>\n <AssemblyVersion>0.0.0.0</AssemblyVersion>\n </AssemblyInfo>\n <ReturnValue>\n <ReturnType>MonoMac.", "Foundation.", "NSString</ReturnType>\n </ReturnValue>\n <Docs>\n <summary>Represents the value associated with the constant AVEncoderBitRatePerChannelKey</summary>\n <value>\n </value>\n <remarks>To be added.</remarks>\n </Docs>\n </Member>\n <Member MemberName=\"AVFormatIDKey\">\n <MemberSignature Language=\"C#\" Value=\"public static MonoMac.", "Foundation.", "NSString AVFormatIDKey { get; }\" />\n <MemberSignature Language=\"ILAsm\" Value=\".property class MonoMac.", "Foundation.", "NSString AVFormatIDKey\" />\n <MemberType>Property</MemberType>\n <AssemblyInfo>\n <AssemblyVersion>0.0.0.0</AssemblyVersion>\n </AssemblyInfo>\n <ReturnValue>\n <ReturnType>MonoMac.", "Foundation.", "NSString</ReturnType>\n </ReturnValue>\n <Docs>\n <summary>Represents the value associated with the constant AVFormatIDKey</summary>\n <value>\n </value>\n <remarks>To be added.</remarks>\n </Docs>\n </Member>\n <Member MemberName=\"AVLinearPCMBitDepthKey\">\n <MemberSignature Language=\"C#\" Value=\"public static MonoMac.", "Foundation.", "NSString AVLinearPCMBitDepthKey { get; }\" />\n <MemberSignature Language=\"ILAsm\" Value=\".property class MonoMac.", "Foundation.", "NSString AVLinearPCMBitDepthKey\" />\n <MemberType>Property</MemberType>\n <AssemblyInfo>\n <AssemblyVersion>0.0.0.0</AssemblyVersion>\n </AssemblyInfo>\n <ReturnValue>\n <ReturnType>MonoMac.", "Foundation.", "NSString</ReturnType>\n </ReturnValue>\n <Docs>\n <summary>Represents the value associated with the constant AVLinearPCMBitDepthKey</summary>\n <value>\n </value>\n <remarks>To be added.</remarks>\n </Docs>\n </Member>\n <Member MemberName=\"AVLinearPCMIsBigEndianKey\">\n <MemberSignature Language=\"C#\" Value=\"public static MonoMac.", "Foundation.", "NSString AVLinearPCMIsBigEndianKey { get; }\" />\n <MemberSignature Language=\"ILAsm\" Value=\".property class MonoMac.", "Foundation.", "NSString AVLinearPCMIsBigEndianKey\" />\n <MemberType>Property</MemberType>\n <AssemblyInfo>\n <AssemblyVersion>0.0.0.0</AssemblyVersion>\n </AssemblyInfo>\n <ReturnValue>\n <ReturnType>MonoMac.", "Foundation.", "NSString</ReturnType>\n </ReturnValue>\n <Docs>\n <summary>Represents the value associated with the constant AVLinearPCMIsBigEndianKey</summary>\n <value>\n </value>\n <remarks>To be added.</remarks>\n </Docs>\n </Member>\n <Member MemberName=\"AVLinearPCMIsFloatKey\">\n <MemberSignature Language=\"C#\" Value=\"public static MonoMac.", "Foundation.", "NSString AVLinearPCMIsFloatKey { get; }\" />\n <MemberSignature Language=\"ILAsm\" Value=\".property class MonoMac.", "Foundation.", "NSString AVLinearPCMIsFloatKey\" />\n <MemberType>Property</MemberType>\n <AssemblyInfo>\n <AssemblyVersion>0.0.0.0</AssemblyVersion>\n </AssemblyInfo>\n <ReturnValue>\n <ReturnType>MonoMac.", "Foundation.", "NSString</ReturnType>\n </ReturnValue>\n <Docs>\n <summary>Represents the value associated with the constant AVLinearPCMIsFloatKey</summary>\n <value>\n </value>\n <remarks>To be added.</remarks>\n </Docs>\n </Member>\n <Member MemberName=\"AVLinearPCMIsNonInterleaved\">\n <MemberSignature Language=\"C#\" Value=\"public static MonoMac.", "Foundation.", "NSString AVLinearPCMIsNonInterleaved { get; }\" />\n <MemberSignature Language=\"ILAsm\" Value=\".property class MonoMac.", "Foundation.", "NSString AVLinearPCMIsNonInterleaved\" />\n <MemberType>Property</MemberType>\n <AssemblyInfo>\n <AssemblyVersion>0.0.0.0</AssemblyVersion>\n </AssemblyInfo>\n <ReturnValue>\n <ReturnType>MonoMac.", "Foundation.", "NSString</ReturnType>\n </ReturnValue>\n <Docs>\n <summary>Represents the value associated with the constant AVLinearPCMIsNonInterleaved</summary>\n <value>\n </value>\n <remarks>To be added.</remarks>\n </Docs>\n </Member>\n <Member MemberName=\"AVNumberOfChannelsKey\">\n <MemberSignature Language=\"C#\" Value=\"public static MonoMac.", "Foundation.", "NSString AVNumberOfChannelsKey { get; }\" />\n <MemberSignature Language=\"ILAsm\" Value=\".property class MonoMac.", "Foundation.", "NSString AVNumberOfChannelsKey\" />\n <MemberType>Property</MemberType>\n <AssemblyInfo>\n <AssemblyVersion>0.0.0.0</AssemblyVersion>\n </AssemblyInfo>\n <ReturnValue>\n <ReturnType>MonoMac.", "Foundation.", "NSString</ReturnType>\n </ReturnValue>\n <Docs>\n <summary>Represents the value associated with the constant AVNumberOfChannelsKey</summary>\n <value>\n </value>\n <remarks>To be added.</remarks>\n </Docs>\n </Member>\n <Member MemberName=\"AVSampleRateConverterAudioQualityKey\">\n <MemberSignature Language=\"C#\" Value=\"public static MonoMac.", "Foundation.", "NSString AVSampleRateConverterAudioQualityKey { get; }\" />\n <MemberSignature Language=\"ILAsm\" Value=\".property class MonoMac.", "Foundation.", "NSString AVSampleRateConverterAudioQualityKey\" />\n <MemberType>Property</MemberType>\n <AssemblyInfo>\n <AssemblyVersion>0.0.0.0</AssemblyVersion>\n </AssemblyInfo>\n <ReturnValue>\n <ReturnType>MonoMac.", "Foundation.", "NSString</ReturnType>\n </ReturnValue>\n <Docs>\n <summary>Represents the value associated with the constant AVSampleRateConverterAudioQualityKey</summary>\n <value>\n </value>\n <remarks>To be added.</remarks>\n </Docs>\n </Member>\n <Member MemberName=\"AVSampleRateKey\">\n <MemberSignature Language=\"C#\" Value=\"public static MonoMac.", "Foundation.", "NSString AVSampleRateKey { get; }\" />\n <MemberSignature Language=\"ILAsm\" Value=\".property class MonoMac.", "Foundation.", "NSString AVSampleRateKey\" />\n <MemberType>Property</MemberType>\n <AssemblyInfo>\n <AssemblyVersion>0.0.0.0</AssemblyVersion>\n </AssemblyInfo>\n <ReturnValue>\n <ReturnType>MonoMac.", "Foundation.", "NSString</ReturnType>\n </ReturnValue>\n <Docs>\n <summary>Represents the value associated with the constant AVSampleRateKey</summary>\n <value>\n </value>\n <remarks>To be added.</remarks>\n </Docs>\n </Member>\n </Members>\n</Type>\n" ]
{ "pile_set_name": "Github" }
[ 0, 0, 0, 0.005952380952380952, 0.0029154518950437317, 0, 0.017857142857142856, 0, 0.014018691588785047, 0, 0, 0, 0.01694915254237288, 0, 0.013636363636363636, 0, 0, 0, 0.00847457627118644, 0, 0.00909090909090909, 0, 0, 0, 0.008849557522123894, 0, 0.009302325581395349, 0, 0, 0, 0.016260162601626018, 0, 0.013333333333333334, 0, 0, 0, 0.018691588785046728, 0, 0.014354066985645933, 0, 0, 0, 0.017241379310344827, 0, 0.013761467889908258, 0, 0, 0, 0.008403361344537815, 0, 0.00904977375565611, 0, 0, 0, 0.008695652173913044, 0, 0.009216589861751152, 0, 0, 0, 0.01652892561983471, 0, 0.013452914798206279, 0, 0, 0, 0.017391304347826087, 0, 0.009216589861751152, 0, 0, 0, 0.007692307692307693, 0, 0.01293103448275862, 0, 0, 0, 0.009174311926605505, 0, 0.009478672985781991, 0, 0 ]
0.003999
5
[ { "analysis_explanation": null, "end": 205, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 192 }, { "analysis_explanation": null, "end": 313, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 301 }, { "analysis_explanation": null, "end": 909, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 893 }, { "analysis_explanation": null, "end": 1028, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1016 }, { "analysis_explanation": null, "end": 1650, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1634 }, { "analysis_explanation": null, "end": 1775, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1763 }, { "analysis_explanation": null, "end": 2403, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2387 }, { "analysis_explanation": null, "end": 2528, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2516 }, { "analysis_explanation": null, "end": 2820, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2787 }, { "analysis_explanation": null, "end": 3076, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3048 }, { "analysis_explanation": null, "end": 3146, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3130 }, { "analysis_explanation": null, "end": 3266, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3254 }, { "analysis_explanation": null, "end": 3899, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3883 }, { "analysis_explanation": null, "end": 4029, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4017 }, { "analysis_explanation": null, "end": 4640, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4624 }, { "analysis_explanation": null, "end": 4754, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4742 }, { "analysis_explanation": null, "end": 5367, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5351 }, { "analysis_explanation": null, "end": 5490, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5478 }, { "analysis_explanation": null, "end": 5780, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5749 }, { "analysis_explanation": null, "end": 6048, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6014 }, { "analysis_explanation": null, "end": 6118, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6102 }, { "analysis_explanation": null, "end": 6180, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6146 }, { "analysis_explanation": null, "end": 6244, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6232 }, { "analysis_explanation": null, "end": 6537, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6503 }, { "analysis_explanation": null, "end": 6867, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6851 }, { "analysis_explanation": null, "end": 6989, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6977 }, { "analysis_explanation": null, "end": 7620, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7604 }, { "analysis_explanation": null, "end": 7748, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7736 }, { "analysis_explanation": null, "end": 8373, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8357 }, { "analysis_explanation": null, "end": 8495, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8483 }, { "analysis_explanation": null, "end": 9144, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9128 }, { "analysis_explanation": null, "end": 9281, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9269 }, { "analysis_explanation": null, "end": 9903, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9887 }, { "analysis_explanation": null, "end": 10019, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10007 }, { "analysis_explanation": null, "end": 384, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_139620637004320", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 377 }, { "analysis_explanation": null, "end": 1062, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_139620637004320", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 1055 }, { "analysis_explanation": null, "end": 1809, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_139620637004320", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 1802 }, { "analysis_explanation": null, "end": 2562, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_139620637004320", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 2555 }, { "analysis_explanation": null, "end": 3300, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_139620637004320", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 3293 }, { "analysis_explanation": null, "end": 4063, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_139620637004320", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 4056 }, { "analysis_explanation": null, "end": 4788, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_139620637004320", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 4781 }, { "analysis_explanation": null, "end": 5524, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_139620637004320", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 5517 }, { "analysis_explanation": null, "end": 6278, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_139620637004320", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 6271 }, { "analysis_explanation": null, "end": 7023, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_139620637004320", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 7016 }, { "analysis_explanation": null, "end": 7782, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_139620637004320", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 7775 }, { "analysis_explanation": null, "end": 8529, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_139620637004320", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 8522 }, { "analysis_explanation": null, "end": 9315, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_139620637004320", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 9308 }, { "analysis_explanation": null, "end": 10053, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_139620637004320", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 10046 } ]
[ "{\n \"sources\": [\n {\n \"file\": \"morph/official.csv\",\n \"create\": {\n \"from\": \"morph\",\n \"scraper\": \"everypolitician-scrapers/tonga-legislative-assembly\",\n \"query\": \"SELECT *, 'unknown' AS party, 2015 AS term FROM data ORDER BY id\"\n },\n \"source\": \"http://parliament.gov.to/\",\n \"type\": \"membership\",\n \"sourcetype\": \"official\"\n },\n {\n \"file\": \"morph/p39s.csv\",\n \"create\": {\n \"from\": \"morph\",\n \"scraper\": \"everypolitician-scrapers/tonga-assembly-wikidata\",\n \"query\": \"SELECT *, 'unknown' AS party, 2015 AS term FROM data ORDER BY id\"\n },\n \"source\": \"http://wikidata.org/\",\n \"type\": \"membership\",\n \"sourcetype\": \"wikidata\"\n },\n {\n \"file\": \"morph/wikidata.csv\",\n \"create\": {\n \"from\": \"morph\",\n \"scraper\": \"everypolitician-scrapers/tonga-assembly-members-wikidata\",\n \"query\": \"SELECT * FROM data ORDER BY id\"\n },\n \"type\": \"wikidata\",\n \"merge\": {\n \"incoming_field\": \"name\",\n \"existing_field\": \"name\",\n \"reconciliation_file\": \"reconciliation/wikidata.csv\"\n }\n },\n {\n \"file\": \"manual/terms.csv\",\n \"type\": \"term\"\n },\n {\n \"file\": \"morph/genderbalance.csv\",\n \"create\": {\n \"from\": \"morph\",\n \"scraper\": \"everypolitician-scrapers/tonga-assembly-gender-balance\",\n \"query\": \"SELECT uuid, gender FROM data ORDER BY uuid\"\n },\n \"source\": \"http://gender-balance.org/\",\n \"type\": \"person\",\n \"merge\": {\n \"incoming_field\": \"uuid\",\n \"existing_field\": \"uuid\"\n }\n },\n {\n \"file\": \"wikidata/elections.json\",\n \"type\": \"wikidata-elections\",\n \"create\": {\n \"from\": \"election-wikidata\",\n \"office\": \"Q21328621\"\n }\n }\n ]\n}" ]
{ "pile_set_name": "Github" }
[ 0.004434589800443459 ]
0.004435
5
[ { "analysis_explanation": null, "end": 228, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 224 }, { "analysis_explanation": null, "end": 584, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 580 }, { "analysis_explanation": null, "end": 313, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.6, "start": 286 }, { "analysis_explanation": null, "end": 664, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.6, "start": 642 }, { "analysis_explanation": null, "end": 1493, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.6, "start": 1465 }, { "analysis_explanation": null, "end": 1783, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 1774 }, { "analysis_explanation": null, "end": 1783, "entity_type": "US_PASSPORT", "recognition_metadata": { "recognizer_identifier": "UsPassportRecognizer_139620636962000", "recognizer_name": "UsPassportRecognizer" }, "score": 0.1, "start": 1774 } ]
[ "Amino acid sequence of the retinal binding site of squid visual pigment.", "\nThe retinylpeptides of visual pigments of two species of squid were identified in invertebrate visual pigments. ", "Their primary structures were identical: H-Phe-Ala-Lys-Ala-Ser-Ala-Ile-His-Asn-pro-Hse(Met)-OH. ", "The sequence was homologous to those of the corresponding region of other visual pigments, but the eighth amino acid, His, was found in squid visual pigments. ", "In this experiment the retinylpeptides of eleven amino acid residues were isolated by monitoring the absorbance spectrum of the reduced retinal Schiff base without using radio-active [3H]retinal. ", "This method is valid for the isolation and identification of retinylpeptides of other invertebrate visual pigments in which the chromophore is not exchangeable." ]
{ "pile_set_name": "PubMed Abstracts" }
[ 0, 0, 0, 0, 0.00510204081632653, 0 ]
0.00085
5
[]
[ "\"Anything?\" \"", "Nothing.\" \"", "Thanks.\" \"", "There's no sign of her anywhere on Moya's sensors.\" \"", "Of course, we can't see more than 300 metras in this stuff.\" \"", "It's as thick as pea soup.\" \"", "Crichton, Moya's never traveled in a stellar mist as compressed as this.\" \"", "I'm having trouble accelerating and navigating.\" \"", "Perhaps Aeryn's experiencing similar difficulties out there in the transport pod.\" \"", "Let's hope that's all it is, Pilot.\" \"", "Stark?\" \"", "Stark, is that you?\" \"", "I never thought we'd see you again.\" \"", "I was meditating, when did you come aboard?\" \"", "Almost two solar days ago.\" \"", "I finally returned the transport pod you lent me after we escaped from the Gammak base.\" \"", "I'm glad you woke.\" \"", "I must talk to you privately.\" \"", "I have something important to tell you.\" \"", "What are you doing out here, Zhaan?\" \"", "I thought you were locked in your chamber, meditating.\" \"", "I was, but I woke early from my time with the goddess.\" \"", "Aeryn went out to that and we haven't heard from her since.\" \"", "Perhaps you sensed the danger and that's what woke you.\" \"", "How long's she been gone?\" \"", "One solar day.\" \"", "Thought we'd hide in this fog, or whatever it is, from the Peacekeepers.\" \"", "Aeryn went on long- range recon and she hasn't come back yet.\" \"", "No signal from her?\" \"", "Nothing.\" \"", "Moya, is that you?\" \"", "Aeryn!\" \"", "Aeryn?\" \"", "Aeryn, where the hezmana have you been?\" \"", "D'Argo, I'll come on board now if that's all right.\" \"", "Yeah, we've been looking for you.\" \"", "Aeryn?\" \"", "Aeryn?\" \"", "Pilot, I've lost the transmission.\" \"", "I'm locked on her position, but some kind of opening is forming in the mist.\" \"", "I can see a planet below us now.\" \"", "What did Aeryn do to it?\" \"", "Frell...\" \"Looks like she's been in some kind of... battle.\" \"", "I told you.\" \"", "Why isn't she coming out?\" \"", "John turns and raises his arm.\" \"", "What the hell?\" \"", "This is Zeccan leaf.\" \"", "Yeah, so?\" \"", "I gave Aeryn a plant before..\" \"before I started my meditation.\" \"", "She said she was suffering from head pains.\" \"", "Chewing Zeccan leaf provides a potent neuralgesic effect.\" \"", "You don't think maybe this is overkill for a headache?\" \"", "Well, no.\" \"", "No.\" \"", "The plant I gave her was this tiny.\" \"", "Blue, over here.\" \"", "John, you have to get out of here.\" \"", "You have to get out now.\" \"", "How- how- how how long have I been here?\" \"", "Not long.\" \"", "Maybe an arn.\" \"", "An arn?\" \"", "Yes.\" \"", "The mist, the opening, it goes.\" \"", "I have to get back to the planet.\" \"", "My granddaughter's waiting for me.\" \"", "Ennixx can't survive without my transport pod!\" \"", "Aeryn.\" \"", "Shh.\" \"", "There's no other way off the planet.\" \"", "I only came back to warn you to get out of the mist as soon as possible.\" \"", "While you still can.\" \"", "You cannot have a family, a granddaughter.\" \"", "You've only been gone for one solar day.\" \"", "One day?\" \"", "Yes.\" \"", "Look, you're wearing the locket.\" \"", "The locket that Chiana gave you.\" \"", "The one that says,\"Sorry I smashed your Prowler.\" \"\" ", "The one she stole from the last commerce planet we were on.\" \"", "She stole it?\" \"", "She told me she bought it.\" \"", "Well, that's Chi...\" \"Look, if I've only been gone one solar day, then why am I so old?\" \"", "Why everything I've lived my memories, everything\" \"Aeryn, we don't know.\" \"", "We're trying to find that out.\" \"", "Maybe..\" \"maybe your mind created the memories to compensate for your body getting old.\" \"", "Look at you..\" \"I'd forgotten how beautiful you were.\" \"", "You're so young.\" \"", "I'd also forgotten how wrong you could be.\" \"", "If I've only been away for one solar day, how did this locket here get so old?\" \"", "Aeryn, it's an antique locket.\" \"", "I don't care what any of you say.\" \"", "I have lived for 165 cycles.\" \"", "I have had three sons and watched them die and I have a granddaughter..\" \"Aeryn, stop.\" \"... ", "who will die if I don't get to her.\" \"", "Aeryn, Aeryn.\" \"", "May I?\" \"", "Get your hands away from me!\" \"", "There.\" \"", "Take my thoughts.\" \"", "There.\" \"", "Can you feel it?\" \"", "Do you have any idea what's happened to her?\" \"", "Not as yet.\" \"", "I know it is Aeryn.\" \"", "Same DNA, same blood composition, same scars.\" \"", "By my best calculation, she has aged 160 cycles.\" \"", "In one day?\" \"", "I've heard of rapid aging, but... nothing this fast.\" \"", "Is it reversible?\" \"", "It's unlikely.\" \"", "Have you got anything yet?\" \"", "I've been analyzing the stellar mist.\" \"", "It seems to be contracting more, but Moya's sensors don't find any toxins in it that might have caused Aeryn to age like this.\" \"", "Have you analyzed the planet?\" \"", "Could Aeryn have survived there for 160 cycles?\" \"", "No.\" \"", "She wouldn't survive one.\" \"", "Would you look at this frelling place?\" \"", "Fascinating.\" \"", "What are we doing here?\" \"", "We're just seeing if Aeryn came back with anything.\" \"", "But why?\" \"", "She's only been gone a solar day.\" \"", "You don't believe that other yotz, do you?\" \"", "No.\" \"", "But she still mighta come back with something... interesting.\" \"", "Are you going to steal it?\" \"'", "Course not.\" \"", "You're worse than me.\" \"", "I like that.\" \"", "What are you doing in here?\" \"", "Nothing.\" \"", "We're looking for clues to see if we can find out how this terrible, terrible thing happened to Aeryn.\" \"", "There is no dignity in what you are doing.\" \"", "Zhaan would like someone to look after Aeryn.\" \"", "Would you do that, please?\" \"", "Well, you know Aeryn -- why don't you watch her?\" \"", "Chiana...\" \"Oh, frell!\" \"", "I don't see why it's always gotta be me.\" \"", "I mean, why do you always get the girls\" \"Just do it!\" \"", "She may be dying.\" \"", "Hey.\" \"", "I didn't mean to wake you.\" \"", "Hi, Chiana.\" \"", "Would you help me sit up?\" \"", "Sure.\" \"", "Is that okay?\" \"", "There's some water over there.\" \"", "Shh.\" \"", "I'm sorry.\" \"", "Don't make a sound, Chiana.\" \"", "No, no, no.\" \"", "Shh.\" \"", "I'm sorry, Chiana.\" \"", "That's it.\" \"", "That's it.\" \"", "I'm sorry.\" \"", "It's just I don't have much time.\" \"", "And neither do you.\" \"", "Shh.\" \"", "what happened to you?\" \"", "I lived, Pilot.\" \"", "If you don't believe me, you still must convince the others to stay out of the mist.\" \"", "I'm glad I got another chance to see you one last time, my friend.\" \"", "What do you mean?\" \"", "I'll see you... again.\" \"", "No, you won't.\" \"", "Good- bye.\" \"", "Pilot, you let her leave?\" \"", "She asked me not to alert you.\" \"", "You're all free to come and go.\" \"", "Are you certain this mist is harmless?\" \"", "It seems to be, yes.\" \"", "And if I go down to the planet, I'm not going to age 200 cycles, right?\" \"", "Moya has not sensed anything on the planet to cause the accelerated aging we observed in Aeryn.\" \"", "John, we do not know what made Aeryn grow old.\" \"", "She will die if I don't go.\" \"", "I'm gonna go pick her up, bring her back.\" \"", "I'll be on the surface 30 microts, max.\" \"", "Worst case scenario?\" \"", "I age a couple years.\" \"", "Aeryn!\" \"", "I've come to take you back to Moya!\" \"", "Go back before it's too late.\" \"", "I'm not leaving without you.\" \"", "Aeryn, look around you.\" \"", "Is this where you lived for the last 160 cycles?\" \"", "You could not have lived here.\" \"", "I didn't live here.\" \"", "I lived on another planet.\" \"", "Another place.\" \"", "Aeryn, there's nobody here.\" \"", "No one.\" \"", "There's nothing.\" \"", "You don't know what you're talking about.\" \"", "Now, please, just go!\" \"", "Aeryn, no.\" \"", "Come back with me to Moya.\" \"", "Stop it.\" \"", "Go.\" \"", "Aeryn, whoa!\" \"", "Put the rifle down.\" \"", "Now.\" \"", "You touch my grandmother again, and I will kill you.\" \"", "Wait a minute, you're Aeryn's granddaughter?\" \"", "Of course!\" \"", "Who the frell are you?\" \"", "I'm John Crichton.\" \"", "You're Crichton?\" \"", "Huh.\" \"", "She wasn't making it all up.\" \"", "You're real.\" \"", "All her life, grandmother talked about you..\" \"About a..\" \"a ship.\" \"", "Moya.\" \"", "Everyone -- my father..\" \"her own son thought she was crazy.\" \"", "She's only been gone for one solar day.\" \"", "A day?\" \"", "I'm 24 cycles old.\" \"", "I'm her granddaughter.\" \"", "Well, I saw her yesterday.\" \"", "It's all right, Nana.\" \"", "No.\" \"", "I'm here.\" \"", "John... .go.\" \"", "Leave.\" \"", "No, I came to take you back.\" \"", "But the opening only lasts for four arns.\" \"", "It goes away.\" \"", "You have to go.\" \"", "Now.\" \"", "I'm not gonna leave you!\" \"", "I'm trying to save you.\" \"", "If you don't go, you'll get trapped for 55 cycles.\" \"", "Trapped like I was.\" \"", "Aeryn, what the hell is going on?\" \"", "Crichton, go back to Moya.\" \"", "If you want to, come back in 8 arns when the opening reappears.\" \"", "Come back down and you will find me then, but you must go now or you will be trapped.\" \"", "Eight arns!\" \"", "Be here!\" \"", "How's your head?\" \"", "Like I've been kicked by a systic.\" \"", "Why did Aeryn spike me?\" \"", "I didn't want to embarrass you in front of Rygel on the transport pod, but...\" \"You could never embarrass me.\" \"", "Maybe not.\" \"", "But you're one of us now.\" \"", "There's no need for you to act like you're not.\" \"", "D'Argo...\" \"I always do what I want, okay?\" \"", "I don't know why.\" \"", "It's just the way I am.\" \"", "I understand that, but\" \"Yeah, but you're not gonna change me.\" \"", "I'm only just beginning to realize that.\" \"", "You're pretty straight, huh?\" \"", "Yes, I am.\" \"", "We're not gonna make it... are we?\" \"", "D'Argo, you'd better get up here.\" \"", "John's on his way back.\" \"", "Aeryn was telling the truth, or part of it.\" \"", "She had some kind of life down there.\" \"", "I met her granddaughter.\" \"", "Granddaughter?\" \"", "Yeah, she said she had to stay.\" \"", "She had to get back through the opening in the mist before it\" \"Man, you guys feel that up there?\" \"", "Crichton.\" \"", "Moya's sensors indicate that the opening in the mist seems to be closing.\" \"", "Estimated time to the hole 15 microts.\" \"", "Man, holding this thing together is a bitch!\" \"", "D'ARGO John, you're breaking up.\" \"", "Crichton, the planet is disappearing from Moya's sensors!\" \"", "Pilot, what's happening?\" \"", "I don't think the transport pod will be able to survive entry.\" \"", "John, you have to break entry.\" \"", "Break entry now!\" \"", "That's okay.\" \"", "I can hold this thing together.\" \"", "John, can you hear me?\" \"", "Pilot, what's happening?\" \"", "Gonna make it.\" \"", "Gonna make it.\" \"", "Entering the mist.\" \"", "Now.\" \"", "Are you in prayer for Crichton?\" \"", "Yes.\" \"", "And Aeryn.\" \"", "I've thought of something we might try to attempt to discover what's happened to them.\" \"", "Tell me.\" \"", "An ancient named Delik theorized about what he called center halos.\" \"", "He believed that scattered throughout the universe were mists where all dimensions met and where time ceased to exist.\" \"", "What... do you think that Moya is caught in one of these center halos?\" \"", "I thought... if you and I joined spirits...\" \"Joined with you?\" \"", "What would that do?\" \"", "I've been told that Delvians, during a mind link, can sense the time continuum.\" \"", "Yes, that is what we strive for, but... few have achieved it.\" \"", "I thought that maybe together we could catch a glimpse and see if there's a void in the time continuum around Moya, see if no time exists in the mist.\" \"", "But, if I join spirits with you, your mind might overpower mine.\" \"", "It is possible.\" \"", "Like so?\" \"", "I will lead you.\" \"", "Yes, Pilot.\" \"", "We felt it.\" \"", "What happened to him, Nana?\" \"", "Oh, Crichton.\" \"", "He was happy for a few cycles there, too.\" \"", "Something must have reminded him, thank you, of his past.\" \"", "I still think about it sometimes \" \" Moya.\" \"", "You've never been as sad as him.\" \"", "Well, perhaps I hide it better.\" \"", "Will he ever be over it?\" \"", "I've done all I can.\" \"", "We took him from the barren planet.\" \"", "Showed him our favored world.\" \"", "I know you've tried\" \"Why are those from the outside always so unhappy?\" \"", "Because we weren't born here.\" \"", "This is your home.\" \"", "Not ours.\" \"", "Give Crichton a few more cycles.\" \"", "He'll come around.\" \"", "You can rack off.\" \"", "I'm gonna do what I wanna do.\" \"", "No, Crichton.\" \"", "No.\" \"", "I need the wormhole knowledge that you have locked in your brain.\" \"", "That's great, Scorpy.\" \"", "You ain't never gonna get that.\" \"", "I'm dying.\" \"", "I'm dying right here on this planet and you ain't never gonna get what's in my head.\" \"", "Still talking to those visions in your head?\" \"", "Sure...\" \"Yeah.\" \"", "Yeah, yeah.\" \"", "Yeah, he's bitching again.\" \"", "All right.\" \"", "He's gone.\" \"", "Bastard.\" \"", "Wonder if he's still looking for me.\" \"", "Oh, well.\" \"", "Stark has developed a theory.\" \"", "He believes it's possible that Aeryn was telling the truth.\" \"", "She has in fact lived for 160 cycles.\" \"", "How?\" \"", "Ah, yotz!\" \"", "Have you been drinking fellip juice?\" \"", "Now... when Zhaan and I joined an arn ago, did any of you experience anything unusual?\" \"", "Well, yeah.\" \"", "That was you guys?\" \"", "And Rygel, did you experience anything unusual?\" \"", "My thronesled stopped.\" \"", "Huh.\" \"", "I froze in mid- air for a microt.\" \"", "And you were still conscious?\" \"", "Absolutely.\" \"", "Stark believes that Moya is trapped in what is known as a center halo where time does not exist at all.\" \"", "We believe when we joined for a moment we all experienced this absence of time in the mist.\" \"", "You see, it's possible that Aeryn aged normally down there on the planet.\" \"", "So it's us.\" \"", "It's us who are not growing old.\" \"", "I don't believe it.\" \"", "You gotta be frelling with me.\" \"", "So this means everyone we know Crais, Scorpius, my son they're all old now?\" \"", "Yes.\" \"", "It is believed that nothing ages in a halo, and eventually it hardens, and everything inside is trapped without time forever.\" \"", "Pilot says the mist is hardening now.\" \"", "Yes.\" \"", "Well, then let's go!\" \"", "Let's get out of here!\" \"", "Pilot, how long until the planet is due to reappear?\" \"", "If what Aeryn outlined is still holds, the opening will reform in the mist in less than one arn.\" \"", "I'll go no more a- roving with you, fair maid a- roving, a- roving since roving's been my R\" \" U\" \" I\" \" N I'll go no more a'roving.\" \"", "Yes.\" \"", "It seems like yesterday when we planted them.\" \"", "How's your knee?\" \"", "Oh, it's fine.\" \"", "Just chasing beautiful women up and down these hills\" \"Well, why don't you come and sit down here, old man, or you'll give yourself a heart attack.\" \"", "Don't- don't- don't you \"old man\" me, woman.\" \"", "You're 200 cycles older than I am.\" \"", "Ennixx and that sleeping pill she married have arrived.\" \"", "He's not that bad.\" \"", "He's boring.\" \"", "Just like everything else around here, boring.\" \"", "Well, I warned you.\" \"", "I tried to make you go back.\" \"", "I know you did.\" \"", "John, I gave up being who I was, what I was, 100 cycles ago.\" \"", "Why haven't you?\" \"", "Well, I ain't a gardener.\" \"", "I never wanted to be one.\" \"", "That's all we do around here -- garden.\" \"", "Plant things.\" \"", "I was a pilot, Aeryn.\" \"", "Astronaut.\" \"", "I was what I wanted to be.\" \"", "I ain't going to forget that and I can't accept this.\" \"", "Do you regret this?\" \"", "What?\" \"", "Spending the last 55 cycles here with me.\" \"", "Aeryn, you are the one thing which has kept me from doing a kamikaze in the transporter.\" \"", "I just have to try to get back to my old life.\" \"", "Just..\" \"for a day.\" \"", "That's the hope.\" \"", "Hope.\" \"", "That's what keeps me going.\" \"", "All right.\" \"", "Just don't be too disappointed if it doesn't happen.\" \"", "If you can't\" \"You okay?\" \"", "Yes, I'm fine.\" \"", "I'm fine.\" \"", "I'm fine.\" \"", "It's just the same old pain.\" \"", "The same pain.\" \"", "Okay.\" \"", "Let's, uh, get you back to the house.\" \"", "You can lie down.\" \"", "Oh!\" \"", "Gimme that.\" \"", "I got your locket.\" \"", "Whose, uh, image you got in here, anyway?\" \"", "You know who's in there.\" \"", "Your husband?\" \"", "He's been dead 90 cycles.\" \"", "Why would you have his image in there?\" \"", "Oh, just to drive you crazy.\" \"", "You know what I think?\" \"", "What?\" \"", "I don't think it's him in there.\" \"", "I think you've got my picture.\" \"", "Don't flatter yourself.\" \"", "Yeah.\" \"", "Yeah, my picture.\" \"", "Surrounded by roses and hearts and yotz.\" \"", "Open it, then.\" \"", "What?\" \"", "Take a look inside.\" \"", "You'll see his image.\" \"", "The only love of my life.\" \"", "No, I don't wanna see his ugly face.\" \"", "Come on.\" \"", "Let's get you back to the house.\" \"", "He wasn't ugly, you know.\" \"", "Yeah, you keep talking about him and you can walk down by yourself.\" \"", "Hell, you can roll down the hill.\" \"", "Pilot, are you picking up any transmissions?\" \"", "There's nothing.\" \"", "50 cycles I've kept this thing sealed up.\" \"", "Hope it works.\" \"", "Pilot, can you hear me?\" \"", "Been waiting to say that for 50 damn years.\" \"", "Feels good.\" \"", "Pilot, can you hear me?\" \"", "Why are you going?\" \"", "Stay with us.\" \"", "Look, come back to the favored planet and I will take care of you.\" \"", "The mist is dangerous..\" \"Ennixx, listen to me.\" \"", "I grew up a Peacekeeper.\" \"", "We are born in space, and we must die in space.\" \"", "Now, I have spent most of my life down here with you, and it has been glorious.\" \"", "But when I die, I belong up there.\" \"", "Good- bye, Nana.\" \"", "Good girl.\" \"", "Now, go.\" \"", "Before I change my mind.\" \"", "Pilot?\" \"", "Pilot?\" \"", "Nothing.\" \"", "I'm not getting anything!\" \"", "Wait.\" \"", "Something's happening.\" \"", "The opening in the mist \" \" I can see it forming.\" \"", "John, Aeryn, can you hear us?\" \"", "Aww, maybe this thing's bust.\" \"", "Maybe Moya decided not to wait for us.\" \"", "Pilot, can you hear me?\" \"", "Pilot?\" \"", "Pilot?\" \"", "Anybody?\" \"", "Pick up the damn phone, you useless pieces of...\" \"We hear you.\" \"", "listen to this!\" \"", "D'Argo, it's me, John.\" \"", "John, are you all right?\" \"", "Can you make it back to Moya, or you want us down there?\" \"", "Oh, no, no.\" \"", "It's all right.\" \"", "We can get back up to you.\" \"", "We will come back up.\" \"", "Right away.\" \"", "They waited.\" \"", "Oh, ho, ho, ho!\" \"", "Oh!\" \"", "They waited.\" \"", "Yes, they did.\" \"", "Come on.\" \"", "Aeryn, baby, you all right?\" \"", "I'm all right.\" \"", "I'm fine.\" \"", "Let's get back to Moya.\" \"", "Goin' home.\" \"", "I...\" \"I tr\" \" I tried to get back here before, uh...\" \"So's we- we could... you, uh...\" \"She, uh... she died.\" \"", "On the way.\" \"", "She's gone.\" \"", "Aer\" \" Aeryn's gone.\" \"", "The opening is on some kind of..\" \"interdimensional orbit.\" \"", "It appears in the mist over the barren planet every 55 cycles.\" \"", "Do you know how to get us out of the mist?\" \"", "Well, you could go back down to where I was.\" \"", "Then let's do it.\" \"", "Let's go down there.\" \"", "Oh, ain't nothing down there, Chiana.\" \"", "Just a few planets, a small colony of people.\" \"", "I searched it from end to end, there just isn't anything there.\" \"", "It still sounds better than being stuck up here forever.\" \"", "Yeah, maybe.\" \"", "But I have had a lot of time to think.\" \"", "I believe that if we can get out of the mist at the exact point that we entered it I might be able to get my life back.\" \"", "Might be an arn later, maybe 200 cycles later.\" \"", "But I, uh...\" \"But... how do we get back to that exact point where we entered?\" \"", "I might have an answer for that.\" \"", "I'm not sure, but I think we just have to go... backwards.\" \"", "What do you mean, Pilot?\" \"", "Since we've entered it, the mist is moving with us.\" \"", "I think the back of Moya is still right at the edge of the mist.\" \"", "Then go for it.\" \"", "Just back up.\" \"", "I've been trying to.\" \"", "But I can't.\" \"", "The mist has been hardening so much in the last arn, Moya can no longer move.\" \"", "You mean we're stuck.\" \"", "I'm afraid so.\" \"", "Have you tried StarBurst?\" \"", "A leviathan is not structurally designed for a reverse StarBurst.\" \"", "It could destroy us.\" \"", "Pilot, just do a small jump and get us back to where we started.\" \"", "If we're going to try and starburst out,\" \"I think we should go forward down to the planet, not backwards.\" \"", "Is that what you want?\" \"", "You want that?\" \"", "You wanna live your life on that planet?\" \"", "The place where you'll never see anyone you know ever again.\" \"", "I have done that.\" \"", "And let me assure you, whatever the risk, it is worth getting your life back.\" \"", "I'm with John.\" \"", "I do not want to live a life without a past.\" \"", "I want to see my son again.\" \"", "Me, too.\" \"", "I never wanted to go into the mist, anyway.\" \"", "I guess I'm in agreement, as well.\" \"", "Goddess be with us all.\" \"", "Pilot, start initiating sequence for reverse\" \"Leave him, D'Argo.\" \"", "Aeryn... we're going to try to get out of this.\" \"", "I told them our plan, and, uh...\" \"There are so many places that I wanted you to see, people...\" \"There's this lake in Maine.\" \"", "Used to spend summers there when I was a kid.\" \"", "Had more mosquitoes than a dog had fleas.\" \"", "My Dad and I, we'd camp out there..\" \"and one night, the astronauts landed on the moon.\" \"", "I remember looking up at the sky.\" \"", "I knew right then what I was gonna do with the rest of my life.\" \"", "I couldn't have been more than four years old.\" \"", "Yeah, I really wanted you to see that.\" \"", "Damn, baby I...\" \"I miss you already.\" \"", "Who else am I gonna tell this crap to?\" \"", "I love you.\" \"", "Take a look inside.\" \"", "You'll see his image.\" \"", "The only love of my life.\" \"", "John is overcome.\" \"", "Priming first phase of reverse StarBurst.\" \"", "Kahaynu, protect Moya.\" \"", "Pilot presses a lever.\" \"", "What now?\" \"", "Zhaan, what's happening?\" \"", "Pilot!\" \"", "What's happening?\" \"", "Priming for starburst is making everything stop.\" \"", "We must break free!\" \"", "My arms.\" \"", "I can't move.\" \"", "You must initiate manual StarBurst from Command!\" \"", "Doing it!\" \"", "I can't reach the panel!\" \"", "Help us!\" \"", "Stark!\" \"", "Crichton and I once shared Unity.\" \"", "So I can help him.\" \"", "If we join, we can keep time alive for him.\" \"", "Zhaan, how the hell are you talkin' to me?\" \"", "I fused my spirit with Stark.\" \"", "You must get to Command and initiate StarBurst.\" \"", "Why can't Pilot do it?\" \"", "He can't move.\" \"", "No one can move except you.\" \"", "I don't know how long I can keep time alive.\" \"", "Hurry, John.\" \"", "I'm too old for this...\" \"Hurry, John!\" \"", "This is ripping us apart!\" \"", "You must - you must keep going!\" \"", "Keep going!\" \"", "What the hell is this stuff?\" \"", "It appears to be some kind of stellar mist.\" \"", "I'm running tests on its chemical properties now.\" \"", "What do you think?\" \"", "That we should go in there?\" \"", "Well, it might be a good place to hide from Peacekeepers.\" \"", "Scorpius hasn't been chasing us for a while.\" \"", "I'm not sure we should go in there.\" \"", "Don't worry, Chiana.\" \"", "I'll fly a long- range recon in a transport pod to make sure it's safe.\" \"", "What's that?\" \"", "Something Zhaan gave me for my headaches.\" \"", "You know what they're about to do?\" \"", "Yes, and these frelling comms don't work!\" \"", "Pilot, looks like we're all agreed here.\" \"", "Except me.\" \"", "Except for Chiana.\" \"", "Let's head into the mist.\" \"", "Accelerating now.\" \"", "Stop!\" \"", "Pilot!\" \"", "Stop the acceleration!\" \"", "You're young.\" \"", "Zhaan, you all right?\" \"", "What are you doing here?\" \"", "I thought you were locked in your chamber mediating or some yotz like that.\" \"", "Shut up, Rygel.\" \"", "What's the matter, Zhaan?\" \"", "Don't you remember?\" \"", "Remember what?\" \"", "Just trust us.\" \"", "Don't go into the mist.\" \"", "Why not?\" \"", "We had a vision.\" \"", "We sense there's danger in there.\" \"", "I told'em.\" \"", "I told'em we shouldn't go in there.\" \"", "I felt something too, Zhaan.\" \"", "Pilot, uh, change of plan.\" \"", "Hang a louie.\" \"", "That's left, away from the mist.\" \"", "Hard acceleration... away.\" \"", "Stark... how is it that Aeryn and Crichton are young again?\" \"", "We seem to have returned to a time just moments before Moya went into the mist.\" \"", "None of them remember anything, yet... yet we do.\" \"", "Because we've returned to a time before any of it happened.\" \"", "They have nothing to remember, Zhaan.\" \"", "I think we only remember because we were joined when Moya broke free.\" \"", "What about Aeryn's life and the family she had?\" \"", "Let's theorize that through every opening in a center halo, our world splits into an infinite number of universes.\" \"", "Are you saying that Ennixx could still be alive?\" \"", "Yes... and mourning the loss of her grandmother.\" \"", "Um...\" \"I've been waiting to show you this.\" \"", "I found it in a manifest of slaves being sold to the Caton mines.\" \"", "Who is this?\" \"", "The manifest lists him as...\" \"as \"Jothee, son of Ka D'Argo.\" \"", "My son.\" \"", "My son is being sold into slavery.\" \"", "How long have you known?\" \"", "Why didn't you tell me?\" \"", "I just found out.\" \"", "D'Argo, Stark wanted me awake before he told you!\" \"", "D'Argo, let him go, please!\" \"", "There's plenty of time.\" \"", "The auction isn't for a few solar days.\" \"", "We will find a way to rescue Jothee.\" \"", "D'Argo...\" \"All right.\" \"", "I'm sorry, Stark.\" \"", "I, uh...\" \"I've got...\" \"I've gotta... save my son, Zhaan.\" \"", "We've got to find a way.\" \"", "Nothing.\" \"", "Um...\" \"Do you get a feeling?\" \"", "About what?\" \"", "I don't know.\" \"", "I\" \" I just had this... feeling.\" \"", "Something happened.\" \"", "Between us?\" \"", "Well, what kind of something do you think happened?\" \"", "I. Don't.\" \"", "Know.\" \"", "If something happened, I'm sure we would have remembered.\" \"", "Come here.\" \"", "Have a look at this.\" \"", "That's, uh, the locket that Chiana gave me.\" \"", "I found it in the transport pod and somehow it's fused shut.\" \"", "I'm trying to..\" \"Did you put something in there?\" \"", "No, nothing.\" \"", "Looks like something disintegrated in there.\"" ]
{ "pile_set_name": "OpenSubtitles" }
[ 0, 0, 0, 0.018867924528301886, 0, 0, 0.02666666666666667, 0, 0.011904761904761904, 0, 0.1111111111111111, 0.045454545454545456, 0, 0, 0, 0.011111111111111112, 0, 0, 0, 0, 0, 0, 0.016129032258064516, 0, 0, 0, 0.013333333333333334, 0.015625, 0, 0, 0.047619047619047616, 0.1111111111111111, 0.1111111111111111, 0.023809523809523808, 0, 0, 0.1111111111111111, 0.1111111111111111, 0, 0, 0, 0.037037037037037035, 0, 0, 0, 0.030303030303030304, 0, 0, 0, 0.015151515151515152, 0, 0, 0, 0, 0, 0, 0, 0.02702702702702703, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.1111111111111111, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.018867924528301886, 0, 0, 0, 0.011111111111111112, 0.013157894736842105, 0, 0, 0.017857142857142856, 0, 0, 0, 0.030303030303030304, 0, 0, 0.010752688172043012, 0, 0.0625, 0, 0, 0, 0, 0, 0, 0, 0, 0.045454545454545456, 0, 0, 0, 0, 0, 0, 0, 0, 0.015503875968992248, 0, 0.02, 0, 0, 0, 0, 0, 0.018518518518518517, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.009523809523809525, 0, 0.020833333333333332, 0, 0.0196078431372549, 0, 0, 0, 0, 0, 0, 0.07142857142857142, 0, 0, 0, 0, 0, 0, 0.03333333333333333, 0, 0, 0.047619047619047616, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.01020408163265306, 0.04081632653061224, 0, 0, 0.023809523809523808, 0, 0, 0.1111111111111111, 0.02631578947368421, 0, 0, 0.038461538461538464, 0, 0, 0, 0, 0, 0.03333333333333333, 0, 0, 0, 0, 0.07692307692307693, 0.034482758620689655, 0, 0, 0.06666666666666667, 0, 0, 0, 0.02127659574468085, 0, 0, 0.047619047619047616, 0.05263157894736842, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.041666666666666664, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.027777777777777776, 0.06896551724137931, 0, 0, 0, 0, 0, 0, 0.038461538461538464, 0.008928571428571428, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.038461538461538464, 0.021739130434782608, 0, 0, 0, 0, 0, 0.08333333333333333, 0.013157894736842105, 0, 0, 0.02857142857142857, 0.03333333333333333, 0, 0, 0.030303030303030304, 0, 0, 0, 0.04, 0, 0, 0, 0, 0, 0.029411764705882353, 0, 0.07692307692307693, 0, 0, 0.014285714285714285, 0, 0.0136986301369863, 0, 0, 0.012195121951219513, 0, 0.006535947712418301, 0, 0, 0, 0, 0, 0, 0.03333333333333333, 0.0625, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.03125, 0.016129032258064516, 0, 0, 0, 0, 0.011235955056179775, 0, 0, 0.02, 0, 0, 0, 0, 0, 0.02830188679245283, 0, 0.013157894736842105, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.010101010101010102, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.015873015873015872, 0, 0, 0, 0, 0, 0.041666666666666664, 0, 0, 0, 0, 0, 0, 0.01098901098901099, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.037037037037037035, 0, 0, 0, 0.05263157894736842, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.0625, 0, 0, 0, 0, 0, 0, 0, 0, 0.08, 0.037037037037037035, 0.01694915254237288, 0, 0, 0, 0, 0, 0, 0.05555555555555555, 0, 0, 0, 0, 0.03333333333333333, 0, 0, 0.038461538461538464, 0, 0, 0, 0, 0.08695652173913043, 0, 0, 0, 0, 0, 0, 0.025, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.014925373134328358, 0, 0, 0, 0, 0.012345679012345678, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.014705882352941176, 0.02, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.05, 0, 0.04, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.0196078431372549, 0, 0, 0, 0, 0.027777777777777776, 0, 0, 0, 0.03125, 0, 0, 0, 0, 0, 0.06666666666666667, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.043478260869565216, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.05555555555555555, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.03225806451612903, 0.012195121951219513, 0, 0, 0, 0.013888888888888888, 0.02, 0, 0.0196078431372549, 0, 0, 0.014705882352941176, 0, 0.015873015873015872, 0, 0, 0, 0, 0, 0.038461538461538464, 0, 0, 0, 0.02564102564102564, 0, 0.05, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.08333333333333333, 0, 0, 0, 0.043478260869565216, 0, 0, 0, 0, 0 ]
0.006271
5
[ { "analysis_explanation": null, "end": 76, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 72 }, { "analysis_explanation": null, "end": 324, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 319 }, { "analysis_explanation": null, "end": 440, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 435 }, { "analysis_explanation": null, "end": 450, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 445 }, { "analysis_explanation": null, "end": 933, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 928 }, { "analysis_explanation": null, "end": 1092, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1079 }, { "analysis_explanation": null, "end": 1168, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1156 }, { "analysis_explanation": null, "end": 1178, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1173 }, { "analysis_explanation": null, "end": 1300, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1295 }, { "analysis_explanation": null, "end": 1310, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1305 }, { "analysis_explanation": null, "end": 1320, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1315 }, { "analysis_explanation": null, "end": 1339, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1332 }, { "analysis_explanation": null, "end": 1455, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1450 }, { "analysis_explanation": null, "end": 1465, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1460 }, { "analysis_explanation": null, "end": 1638, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1633 }, { "analysis_explanation": null, "end": 1763, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1759 }, { "analysis_explanation": null, "end": 1860, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1855 }, { "analysis_explanation": null, "end": 2164, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2160 }, { "analysis_explanation": null, "end": 2435, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2429 }, { "analysis_explanation": null, "end": 2484, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2479 }, { "analysis_explanation": null, "end": 2722, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2709 }, { "analysis_explanation": null, "end": 2734, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2727 }, { "analysis_explanation": null, "end": 2805, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2799 }, { "analysis_explanation": null, "end": 2866, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2859 }, { "analysis_explanation": null, "end": 3046, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3033 }, { "analysis_explanation": null, "end": 3130, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3125 }, { "analysis_explanation": null, "end": 3438, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3425 }, { "analysis_explanation": null, "end": 3485, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3480 }, { "analysis_explanation": null, "end": 3662, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3657 }, { "analysis_explanation": null, "end": 3916, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3911 }, { "analysis_explanation": null, "end": 4032, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4025 }, { "analysis_explanation": null, "end": 4244, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4240 }, { "analysis_explanation": null, "end": 4311, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4306 }, { "analysis_explanation": null, "end": 4377, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4372 }, { "analysis_explanation": null, "end": 4564, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4559 }, { "analysis_explanation": null, "end": 4637, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4626 }, { "analysis_explanation": null, "end": 4991, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4986 }, { "analysis_explanation": null, "end": 5086, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5081 }, { "analysis_explanation": null, "end": 5141, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5136 }, { "analysis_explanation": null, "end": 5369, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5363 }, { "analysis_explanation": null, "end": 5511, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5505 }, { "analysis_explanation": null, "end": 5556, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5550 }, { "analysis_explanation": null, "end": 6172, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6165 }, { "analysis_explanation": null, "end": 6195, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6191 }, { "analysis_explanation": null, "end": 6285, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6280 }, { "analysis_explanation": null, "end": 6294, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6290 }, { "analysis_explanation": null, "end": 6326, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6321 }, { "analysis_explanation": null, "end": 6454, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6451 }, { "analysis_explanation": null, "end": 6513, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6508 }, { "analysis_explanation": null, "end": 6627, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6622 }, { "analysis_explanation": null, "end": 6811, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6806 }, { "analysis_explanation": null, "end": 6943, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6938 }, { "analysis_explanation": null, "end": 6977, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6973 }, { "analysis_explanation": null, "end": 7006, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7001 }, { "analysis_explanation": null, "end": 7131, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7126 }, { "analysis_explanation": null, "end": 7209, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7196 }, { "analysis_explanation": null, "end": 7471, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7458 }, { "analysis_explanation": null, "end": 7481, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7476 }, { "analysis_explanation": null, "end": 7503, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7490 }, { "analysis_explanation": null, "end": 7559, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7550 }, { "analysis_explanation": null, "end": 7584, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7580 }, { "analysis_explanation": null, "end": 7620, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7609 }, { "analysis_explanation": null, "end": 7893, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7888 }, { "analysis_explanation": null, "end": 7933, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7925 }, { "analysis_explanation": null, "end": 7950, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7946 }, { "analysis_explanation": null, "end": 8209, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8204 }, { "analysis_explanation": null, "end": 8759, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8755 }, { "analysis_explanation": null, "end": 8787, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8782 }, { "analysis_explanation": null, "end": 8911, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8898 }, { "analysis_explanation": null, "end": 9060, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9052 }, { "analysis_explanation": null, "end": 9244, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9240 }, { "analysis_explanation": null, "end": 9277, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9269 }, { "analysis_explanation": null, "end": 9428, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9424 }, { "analysis_explanation": null, "end": 9533, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9529 }, { "analysis_explanation": null, "end": 9679, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9671 }, { "analysis_explanation": null, "end": 9701, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9696 }, { "analysis_explanation": null, "end": 9830, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9825 }, { "analysis_explanation": null, "end": 10031, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10027 }, { "analysis_explanation": null, "end": 10192, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10184 }, { "analysis_explanation": null, "end": 10426, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10422 }, { "analysis_explanation": null, "end": 10641, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10637 }, { "analysis_explanation": null, "end": 10658, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10650 }, { "analysis_explanation": null, "end": 11166, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11158 }, { "analysis_explanation": null, "end": 11730, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11725 }, { "analysis_explanation": null, "end": 11794, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11789 }, { "analysis_explanation": null, "end": 12225, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12220 }, { "analysis_explanation": null, "end": 12244, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12240 }, { "analysis_explanation": null, "end": 12455, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12450 }, { "analysis_explanation": null, "end": 12991, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12986 }, { "analysis_explanation": null, "end": 13245, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13236 }, { "analysis_explanation": null, "end": 13552, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13546 }, { "analysis_explanation": null, "end": 13771, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13767 }, { "analysis_explanation": null, "end": 13989, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13984 }, { "analysis_explanation": null, "end": 14177, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14172 }, { "analysis_explanation": null, "end": 14332, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14327 }, { "analysis_explanation": null, "end": 15632, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15619 }, { "analysis_explanation": null, "end": 15820, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15814 }, { "analysis_explanation": null, "end": 16054, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16050 }, { "analysis_explanation": null, "end": 16338, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16334 }, { "analysis_explanation": null, "end": 16536, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16532 }, { "analysis_explanation": null, "end": 16545, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16541 }, { "analysis_explanation": null, "end": 16597, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16593 }, { "analysis_explanation": null, "end": 16755, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16753 }, { "analysis_explanation": null, "end": 16759, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16757 }, { "analysis_explanation": null, "end": 16763, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16761 }, { "analysis_explanation": null, "end": 16826, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16821 }, { "analysis_explanation": null, "end": 16905, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16901 }, { "analysis_explanation": null, "end": 17081, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 17076 }, { "analysis_explanation": null, "end": 17396, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 17390 }, { "analysis_explanation": null, "end": 18095, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 18091 }, { "analysis_explanation": null, "end": 18273, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 18269 }, { "analysis_explanation": null, "end": 18908, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 18904 }, { "analysis_explanation": null, "end": 19360, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19355 }, { "analysis_explanation": null, "end": 19510, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19501 }, { "analysis_explanation": null, "end": 19699, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19675 }, { "analysis_explanation": null, "end": 19925, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19921 }, { "analysis_explanation": null, "end": 19994, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19987 }, { "analysis_explanation": null, "end": 20008, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20004 }, { "analysis_explanation": null, "end": 20325, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20320 }, { "analysis_explanation": null, "end": 20338, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20330 }, { "analysis_explanation": null, "end": 20510, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20505 }, { "analysis_explanation": null, "end": 20700, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20696 }, { "analysis_explanation": null, "end": 20742, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20738 }, { "analysis_explanation": null, "end": 21178, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 21172 }, { "analysis_explanation": null, "end": 21477, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 21471 }, { "analysis_explanation": null, "end": 22132, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 22127 }, { "analysis_explanation": null, "end": 22156, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 22151 }, { "analysis_explanation": null, "end": 22169, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 22161 }, { "analysis_explanation": null, "end": 22249, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 22245 }, { "analysis_explanation": null, "end": 22487, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 22483 }, { "analysis_explanation": null, "end": 22519, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 22514 }, { "analysis_explanation": null, "end": 22698, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 22692 }, { "analysis_explanation": null, "end": 22881, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 22876 }, { "analysis_explanation": null, "end": 22949, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 22943 }, { "analysis_explanation": null, "end": 22967, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 22958 }, { "analysis_explanation": null, "end": 23246, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 23230 }, { "analysis_explanation": null, "end": 23286, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 23280 }, { "analysis_explanation": null, "end": 23333, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 23328 }, { "analysis_explanation": null, "end": 23789, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 23783 } ]
[ "Canada’s controversial Concealment of Identity Act banning the wearing of masks during riots and \"unlawful assemblies\" has just gone into law, carrying with it a 10-year maximum sentence, reports CBC News. ", "The private member’s bill was introduced in 2011 by MP Blake Richards in response to the increasing prevalence of vandalism at political protests and sporting events.", "\n\nWhat distinguishes an unlawful assembly from a lawful one?", "\n\nIt’s noteworthy that there is already a federal law in Canada that prohibits wearing a disguise \"with intent to commit an indictable offence\" and carries the same 10-year maximum. ", "The distinction in language is deliberate: Richards has criticized the existing law for its high burden of proof. ", "Now, instead of requiring intent to commit a criminal act in order to charge a protester, he or she only needs to be in attendance at an unlawful assembly. ", "Richards has insisted that the law is necessary for dealing with protesters \"pre-emptively,\" before a protest escalates. ", "And what distinguishes an unlawful assembly from a lawful one? ", "The CBC points out that it’s \"an assembly of three or more persons who, with intent to carry out any common purpose, assemble in such a manner… as to cause persons in the neighbourhood… to fear… that they will disturb the peace tumultuously.\"", "\n\nMany, such as Osgoode Hall Law School Professor James Stribopoulos, have pointed to the possible \"chilling effects\" posed by making it unlawful to disguise one’s identity at a protest, say to prevent against reprisals from your boss or coworkers, or to avoid facial recognition software. ", "The CBC notes that exceptions can be made for \"lawful excuses\" for face covergings, like religion or medical conditions, but Stribopoulos has countered that most judgments about an excuse’s \"lawfulness\" will fall to police in the field." ]
{ "pile_set_name": "OpenWebText2" }
[ 0.009708737864077669, 0.006024096385542169, 0, 0, 0.008771929824561403, 0, 0.008264462809917356, 0, 0.004132231404958678, 0.006896551724137931, 0.00847457627118644 ]
0.004752
5
[ { "analysis_explanation": null, "end": 6, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 0 }, { "analysis_explanation": null, "end": 169, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 162 }, { "analysis_explanation": null, "end": 254, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 250 }, { "analysis_explanation": null, "end": 275, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 261 }, { "analysis_explanation": null, "end": 493, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 487 }, { "analysis_explanation": null, "end": 602, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 595 }, { "analysis_explanation": null, "end": 663, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 655 }, { "analysis_explanation": null, "end": 890, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 882 }, { "analysis_explanation": null, "end": 1375, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1357 }, { "analysis_explanation": null, "end": 1734, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1722 } ]
[ "Ceftriaxone-induced drug reaction mimicking acute splenic sequestration crisis in a child with hemoglobin SC disease.", "\nAcute splenic sequestration crisis is a complication of sickle cell disease (SCD) occurring when intrasplenic red blood cell (RBC) sickling prevents blood from leaving the spleen, causing acute splenic enlargement. ", "Although typically seen in young children, it has been reported in older children with hemoglobin (Hb)SC disease, eventually resulting in functional asplenia. ", "Ceftriaxone is a frequently used antibiotic of choice for children with SCD, because of its efficacy against invasive pneumococcal disease. ", "We report a case of a 9-year-old female with HbSC disease, who had a fatal reaction after receiving a dose of ceftriaxone in the outpatient clinic for fever. ", "Her Hb level decreased abruptly from 9.3 to 2.3 mg/dL. RBC clumps with no visible hemolysis were observed in the postreaction sample. ", "Autopsy examination revealed marked splenomegaly with acute congestion and sickled cells in the spleen and liver. ", "Serologic testing revealed a positive direct antiglobulin test with polyspecific antibody, anti-C3, and anti-C3d, but negative with anti-immunoglobulin G. Ceftriaxone-dependent RBC antibodies were detected in her serum and RBC eluate when tested in the presence of the drug. ", "We report a new presentation of ceftriaxone-induced drug reaction in a patient with SCD mimicking an acute splenic sequestration crisis. ", "Review of the literature for cases of ceftriaxone-induced drug reactions in pediatric patients revealed nine previously reported cases of ceftriaxone-induced immune hemolytic anemia in children with SCD since 1995, but none with an initial presentation suggestive of acute splenic sequestration crisis." ]
{ "pile_set_name": "PubMed Abstracts" }
[ 0, 0.009259259259259259, 0, 0.007142857142857143, 0, 0, 0, 0.01818181818181818, 0.0072992700729927005, 0.0033112582781456954 ]
0.004519
5
[ { "analysis_explanation": null, "end": 664, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 654 }, { "analysis_explanation": null, "end": 1204, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1190 }, { "analysis_explanation": null, "end": 1663, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1659 }, { "analysis_explanation": null, "end": 1136, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 1134 } ]
[ "Hollow Anatase TiO2 Octahedrons with Exposed High-Index {102} Facets for Improved Dye-Sensitized Photoredox Catalysis Activity.", "\nThe high activity of exposed facets and large surface area have significant effects on the performance of photocatalysts because most of the photoreactivity properties of materials are related to surface processes. ", "The strategy of combining high-index facets and a hollow structure into one material will provide a new way for designing effective photocatalysts, possessing active exposed facets and a large surface area at the same time. ", "However, fabricating one material with both high-index facets and a hollow structure is still a great challenge due to their thermodynamic instability. ", "Here, hollow anatase TiO2 octahedrons exposed with high-index (102) facets (HTO-102) were successfully fabricated for the first time by a facile hydrothermal method using HF and H2O2 as morphology controlling agents. ", "Compared with two other catalysts (a solid sharp octahedron with (101) facets (SSO-101) and a hollow sharp octahedron with (101) facets (HSO-101)), HTO-102 particles exhibit a better photochemical activity for the selective aerobic oxidation of organic sulfides under visible-light irradiation. ", "Experimental results and theoretical calculations indicate that the excellent photocatalytic activity of HTO-102 particles is mainly due to the synergistic effects of its hollow structure and exposed high-index (102) facets." ]
{ "pile_set_name": "PubMed Abstracts" }
[ 0, 0, 0, 0, 0.004608294930875576, 0.003389830508474576, 0 ]
0.001143
5
[ { "analysis_explanation": null, "end": 31, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 0 } ]
[ "Melissa Westphal Benefiel\n\nMay 5, 2017\n\nI met Theresa through my participation in the Valpo Chamber’s Leadership Academy. ", "She served as a mentor and guide as I went through this program. ", "Theresa is a “go to” person in our community. ", "She is the consummate professional and shows great enthusiasm in all of her leadership roles. ", "Beyond that, she is simply an enjoyable and positive person to be around. ", "She is inspirational!", "\n\nLet’s start\nworking better Together..\n\nIt all starts in your conference room. ", "Enter your email address below to get FREE instant access to our \"Cost Effective Meeting Guidebook\" so you can make the most of your meetings. (", "You'll also get email updates from us.)", "\n\nkind words from happy clients\n\n“Balancing life – this program is not just for sales professionals – every individual can reap reward and direction. ", "This program focuses on you, your life, hopes and dreams, then helps you achieve them.”", "\n\nDee Tasicas\n\nPrudential Executive Group – Valparaiso, IN\n\nGet started today.", "\n\nIt all starts in your conference room. ", "Enter your email address below to get FREE instant access to our \"Cost Effective Meeting Guidebook\" so you can make the most of your meetings. (", "You'll also get email updates from us.)" ]
{ "pile_set_name": "Pile-CC" }
[ 0.02459016393442623, 0, 0, 0, 0, 0, 0.0125, 0.006944444444444444, 0, 0, 0, 0.01282051282051282, 0, 0.006944444444444444, 0 ]
0.004253
5
[ { "analysis_explanation": null, "end": 27, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 0 }, { "analysis_explanation": null, "end": 38, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 27 }, { "analysis_explanation": null, "end": 53, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 46 }, { "analysis_explanation": null, "end": 194, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 187 }, { "analysis_explanation": null, "end": 935, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 922 }, { "analysis_explanation": null, "end": 974, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 964 }, { "analysis_explanation": null, "end": 997, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 992 } ]
[ "Q:\n\nconstruct std::pair in-place in vector::emplace_back\n\nI have a class A defined like bellow:\nclass A\n{\npublic:\n A() = default;\n\n explicit A(uint32_t a, uint32_t b)\n {\n std::cout << \"construct\" << std::endl;\n }\n\n A(const A& obj)\n {\n std::cout << \"copy\" << std::endl;\n *this = obj;\n }\n\n A(const A&& obj)\n {\n std::cout << \"move\" << std::endl;\n *this = obj;\n }\n\n A& operator=(const A& obj)\n {\n std::cout << \"copy operator\" << std::endl;\n return *this;\n }\n\n A& operator=(const A&& obj)\n {\n std::cout << \"move operator\" << std::endl;\n }\n};\n\nI use the class like this:\nstd::vector<std::pair<A, bool>> v;\nv.emplace_back(A(0, 1), true);\n\nThe emplace_back has the following output:\nconstruct\nmove\ncopy operator\n\nMy question is, is there any way to construct A of the pair in-place without calling the move and copy operator?", "\n\nA:\n\nYes, std::pair has this constructor:\n\ncppreference/utility/pair/pair\ntemplate< class... Args1, class... Args2 >\npair( std::piecewise_construct_t,\n std::tuple<Args1...> first_args,\n std::tuple<Args2...> second_args );\n\nForwards the elements of first_args to the constructor of first and forwards the elements of second_args to the constructor of second. ", "This is the only non-default constructor that can be used to create a pair of non-copyable non-movable types.", "\n\nYou can therefore invoke:\nstd::vector<std::pair<A, bool>> v;\nv.emplace_back(std::piecewise_construct, \n std::make_tuple(0, 1), \n std::make_tuple(true));\n\n" ]
{ "pile_set_name": "StackExchange" }
[ 0, 0.0027100271002710027, 0, 0 ]
0.000678
5
[ { "analysis_explanation": null, "end": 908, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 899 }, { "analysis_explanation": null, "end": 1003, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 998 }, { "analysis_explanation": null, "end": 19, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_139620637004320", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 17 }, { "analysis_explanation": null, "end": 44, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_139620637004320", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 42 }, { "analysis_explanation": null, "end": 187, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_139620637004320", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 185 }, { "analysis_explanation": null, "end": 215, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_139620637004320", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 213 }, { "analysis_explanation": null, "end": 262, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_139620637004320", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 260 }, { "analysis_explanation": null, "end": 285, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_139620637004320", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 283 }, { "analysis_explanation": null, "end": 352, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_139620637004320", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 350 }, { "analysis_explanation": null, "end": 375, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_139620637004320", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 373 }, { "analysis_explanation": null, "end": 452, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_139620637004320", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 450 }, { "analysis_explanation": null, "end": 484, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_139620637004320", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 482 }, { "analysis_explanation": null, "end": 563, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_139620637004320", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 561 }, { "analysis_explanation": null, "end": 595, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_139620637004320", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 593 }, { "analysis_explanation": null, "end": 642, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_139620637004320", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 640 }, { "analysis_explanation": null, "end": 654, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_139620637004320", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 652 }, { "analysis_explanation": null, "end": 904, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_139620637004320", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 902 }, { "analysis_explanation": null, "end": 1017, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_139620637004320", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 1015 }, { "analysis_explanation": null, "end": 1051, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_139620637004320", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 1049 }, { "analysis_explanation": null, "end": 1090, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_139620637004320", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 1088 }, { "analysis_explanation": null, "end": 1398, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_139620637004320", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 1396 }, { "analysis_explanation": null, "end": 1410, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_139620637004320", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 1408 }, { "analysis_explanation": null, "end": 1448, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_139620637004320", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 1446 }, { "analysis_explanation": null, "end": 1490, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_139620637004320", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 1488 }, { "analysis_explanation": null, "end": 1529, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_139620637004320", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 1527 } ]
[ "Food & Beverages\n\nWe offer a range of delicious menus with options for a range of event types. ", "While our menus provide an excellent starting point, our team of professional chefs would be delighted to personally develop and customise a menu to suit your theme and budget. ", "We also offer a range of beverage packages to complement your food choices Whether you’re formally dining or casually grazing, to find the best menu options for your next event, please contact our friendly team and let us help you find the perfect option to suits your needs.", "\n\nBuffet Breakfast\n\nPlated Breakfast\n\nMorning & Afternoon Tea\n\nWorking Lunch\n\nBuffet Dinner\n\nPlated Dinner\n\nPacific Island Cuisine\n\nIndian Menu\n\nChinese Menu\n\nThai Menu\n\nVegetarian Options\n\nCanapes & Cocktails\n\nPartner Network\n\nIf you're looking for a someone to help with your event planning or require audio visual or sound and lighting equipment, look no further than our event partners.", "\n\nThe Production & Music Agency\n\nIf you are planning an event, looking for entertainers, require equipment for sound and lighting, AV or staging, then look no further" ]
{ "pile_set_name": "Pile-CC" }
[ 0.010526315789473684, 0, 0, 0.005128205128205128, 0.006024096385542169 ]
0.004336
5
[]
[ "Belanger Ford, a family-run car dealership in Greater Sudbury, helped police stop an international drug smuggling operation.", "\n\nProvincial Police said Wednesday that employees at the Ford dealership in Chelmsford alerted local police that strange packets were stashed within spare tires, that did not match the make and model of Ford Fusions being shipped.", "\n\nEmployees stumbled upon a shipment of methamphetamine, originating from a car factory in Mexico.", "\n\nThe investigation included OPP detachments in Collingwood and Caledon, as well as help from the Ford Motor Company, that helped police track down the destinations of other Ford vehicles being shipped from the same area.", "\n\nAlert Ford employees found packets of meth tucked into spare tires. (", "OPP)\n\nPolice said they believe the shipment was part of an operation run by the Sinaloa Drug Cartel, an international organized crime syndicate.", "\n\nThe group controls the area around the Ford manufacturing plant in Hermosillo, Mexico.", "\n\nIn total, 180 kilograms of meth was located in vehicles shipped transcontinentally to Canada. ", "OPP estimate the street value around $4.5 million." ]
{ "pile_set_name": "OpenWebText2" }
[ 0.008064516129032258, 0.013043478260869565, 0, 0.01809954751131222, 0.014084507042253521, 0.013888888888888888, 0.011363636363636364, 0, 0.02 ]
0.010949
5
[ { "analysis_explanation": null, "end": 13, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 0 }, { "analysis_explanation": null, "end": 61, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 46 }, { "analysis_explanation": null, "end": 157, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 148 }, { "analysis_explanation": null, "end": 449, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 443 }, { "analysis_explanation": null, "end": 508, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 497 }, { "analysis_explanation": null, "end": 520, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 513 }, { "analysis_explanation": null, "end": 963, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 953 }, { "analysis_explanation": null, "end": 971, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 965 }, { "analysis_explanation": null, "end": 1065, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1059 } ]
[ "Kaminski Auctions will host its next Fine Asian Art and Antiques Auction, starting at 10 a.m. March 30, at 117 Elliot St., Beverly, Mass. One of the items garnering the most pre-auction excitement is a large carved jade piece." ]
{ "pile_set_name": "Pile-CC" }
[ 0.008849557522123894 ]
0.00885
5
[ { "analysis_explanation": null, "end": 93, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 86 }, { "analysis_explanation": null, "end": 102, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 94 }, { "analysis_explanation": null, "end": 121, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 111 }, { "analysis_explanation": null, "end": 130, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 123 } ]
[ "If you are a die-hard Ford fan, you will be most displeased to learn of this modified, drag racing 1967 Mustang fastback.", "\n\nNot because it’s been modified to somewhere way, way north of 2,000bhp - the owner reckons on around 2500 horsepower - but more because the nature of that power is delivered via a 6.4-litre small block Chevy V8.", "\n\nWe know, sacrilege, right? ", "Before you get all angry and decamp to an area of the Internet to vent your frustration, just watch the ruddy video first. ", "We’re told this ‘67 Mustang with its steel body and 388ci Chevy V8 runs a pair of 82 Precision turbos turned up to around 35psi on race day.", "\n\nAnd boy, do you want to see what its like on race day. ", "At a drag strip, the thing managed to post a sub-eight-second quarter mile time on a test pass. ", "It also managed to sound like the ‘ride of the Rohirrim set to a Metallica soundtrack.", "\n\nWhat other FrankenCreations would you like to see?" ]
{ "pile_set_name": "OpenWebText2" }
[ 0.01652892561983471, 0.004694835680751174, 0, 0, 0.007142857142857143, 0, 0, 0.011627906976744186, 0.019230769230769232 ]
0.006581
5
[ { "analysis_explanation": null, "end": 103, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 99 }, { "analysis_explanation": null, "end": 678, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 670 }, { "analysis_explanation": null, "end": 332, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 330 }, { "analysis_explanation": null, "end": 550, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 548 } ]
[ "In order to regulate carbon dioxide emissions, which is the main culprit of global warming, the Kyoto Protocol took effect in December, 1997. ", "Thereafter, in order to control huge carbon dioxide emissions, research into a renewable and clean alternative energy source that is renewable and clean such as solar energy, wind power, water power, hydrogen energy, etc., ", "has been actively conducted.", "\nHydrogen has been spotlighted as clean alternative energy, which has been mainly used as an energy source of a fuel cell. ", "The fuel cell is an energy conversion device that directly converts chemical energy included in fuel gas into electrical energy by an electrochemical reaction.", "\nSince the fuel cell system is a direct generation system without performing a combustion process or a mechanical process, differently from an existing thermal power plant, it has high generation efficiency of 40 to 60% and has almost constant efficiency even in a wide load range of 25 to 100% of a rated output.", "\nFurther, even though the fuel cell system may reduce CO2 emissions as much as 30% or more without the combustion process, it discharges a negligible amount of NOx, SO2, and dust, which are the cause of pollution in the existing power plant and also generates very small operation noise. ", "As a result, the fuel cell system has been in the limelight as an eco-friendly energy technology.", "\nAs applications of the present fuel cell technology, a technology has been developed for a medium-large size generation system of 100 kW to several tens MW, a home small size generation system of 1 kW to 10 kW, a car power supply, and a mobile power supply of several W to several kW has been progressed.", "\nAmong the clean energy technologies using hydrogen, a technology storing high-pressure hydrogen gas should be urgently resolved in order to use hydrogen as an energy source.", "\nAs an example, most companies other than GM have developed a fuel cell car in which a high-pressure hydrogen gas storage container is mounted. ", "Currently, each country has competitively developed a high-pressure container withstanding 700 atmosphere since the amount of hydrogen stored in the hydrogen gas storage container determines a traveling distance.", "\nIn the high-pressure gas storage technology, it is difficult to handle hydrogen gas, which is due to strong reactivity, rapid diffusivity, light mass, etc., ", "of hydrogen gas.", "\nHydrogen, which is the lightest gas, may have permeability of 80 times or more as compared with other natural gases in which it can be easily diffused and discharged to the outside of the container but may weaken a material configuring a container through chemical reaction. ", "In addition, even though the amount of hydrogen gas discharged to the outside of the container is insignificant, hydrogen may even be combusted at a concentration even lower than a lean misfire limit. ", "As hydrogen has a very large heating value at the time of combustion and various chain reaction paths, a development of a barrier capable of effectively preventing penetration of hydrogen is urgent for the loss and safety of the stored hydrogen." ]
{ "pile_set_name": "USPTO Backgrounds" }
[ 0, 0, 0, 0, 0, 0, 0, 0, 0.003278688524590164, 0, 0.006944444444444444, 0, 0, 0, 0, 0, 0 ]
0.000601
5
[ { "analysis_explanation": null, "end": 140, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 126 } ]
[ "Tuesday, February 8, 2011\n\nTop Ten Tuesdays: Things I Could Do Without\n\n1. ", "Negative Wind-Chill/Snow – Seriously? ", "It should not be allowed to be BELOW zero nor should snow still be gracing my front yard/porch/roof/driveway. ", "I am a Christmas Day loving snow girl only.", "\n\n2. ", "Decaf Coffee – What is the point? ", "This is like non-alcoholic beer or wine.", "\n\n3. ", "People who go on and on about not doing a popular thing – Be this reading Harry Potter / Twilight, watching the Super Bowl (really you only need to tell twitter/fb ONCE you aren’t watching you don’t get 23432434 bonus points for every gosh darn status/tweet update, not watching the President speak (way to promote not being involved in government) or whatever it seriously drives me bananas. ", "Do you want an effin’ cookie?", "\n\n4. ", "The Bachelor – Really? ", "Just stop. ", "Real relationships take more work, honesty and a lot less drama.", "\n\n5. ", "Junk Mail – It just goes straight to the garbage, why bother wasting the time/paper? ", "I don’t even read/open it!", "\n\n6. ", "People who can’t just answer a question without imputing unneeded information – Gee thanks, NEVER thought of those NEW ideas myself. :::", "eyeroll:::\n\n7. ", "Wet Socks – I dread them in the winter. ", "I usually do pretty good hopping around and avoiding it, but when I get wet socks, I am not happy.", "\n\n8. ", "Static-y Hair – Ughh…\n\n9. ", "Dry skin – I hate the feeling of my hands, feet, arms, legs. ", "There is just not enough lotion in the world.", "\n\n10. ", "Cleaning the House – I would so hire a maid in 2 seconds if I had a full-time job. ", "I hate cleaning. ", "Dusting? ", "Ugh. ", "Cleaning the toilet? ", "Ugh. ", "Washing the mirror 24332 times a week because my husband spits his toothpaste on it? ", "AHHHHHHH…." ]
{ "pile_set_name": "Pile-CC" }
[ 0, 0, 0, 0, 0, 0.029411764705882353, 0, 0, 0.002544529262086514, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.007352941176470588, 0, 0.025, 0, 0, 0.038461538461538464, 0, 0, 0, 0.012048192771084338, 0, 0, 0, 0, 0, 0, 0.1 ]
0.006138
5
[ { "analysis_explanation": null, "end": 43, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 0 }, { "analysis_explanation": null, "end": 434, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 422 }, { "analysis_explanation": null, "end": 559, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 551 }, { "analysis_explanation": null, "end": 1088, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1083 }, { "analysis_explanation": null, "end": 1181, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1171 }, { "analysis_explanation": null, "end": 1478, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1469 }, { "analysis_explanation": null, "end": 1126, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_139620637004320", "recognizer_name": "IpRecognizer" }, "score": 0.1, "start": 1124 }, { "analysis_explanation": null, "end": 1137, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_139620637004320", "recognizer_name": "IpRecognizer" }, "score": 0.1, "start": 1135 }, { "analysis_explanation": null, "end": 559, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 551 }, { "analysis_explanation": null, "end": 559, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 551 } ]
[ "Project Summary/Abstract Chronic pain is the most common complaint of patients, affecting over 100 million Americans, and costing the nation more than $650 billion/year in medical treatment and lost productivity. ", "Most chronic pain patients are resistant to pharmaceutical or surgical therapies, in large part because the underlying pathophysiology of their chronic pain condition is unknown. ", "The ultimate goal of this research program is to rectify this deficiency. ", "Most spinal cord pain-related afferents target the parabrachial nuclear complex (PB), which then projects to multiple pain-related cortical and subcortical targets. ", "New preliminary data indicate that inhibitory inputs from the central nucleus of the amygdala (CeA) to PB are reduced in a rodent neuropathic pain model: chronic constriction of the infraorbital nerve (CCI). ", "This reduced inhibition dramatically `amplifies' both spontaneous and evoked PB neural activity. ", "As a consequence, there is increased PB excitation of several pain-related nuclei, including the rostral ventral medulla (RVM), a key node of the descending pain modulation system. ", "Based on this exciting new evidence we hypothesize that chronic pain results from the development of a pathologic positive feedback network: Reduced inhibition from CeA to PB ?", "> amplified PB activity ?", "> increased activation of RVM neurons ?", "> increased activation of nociceptive neurons in the spinal cord. ", "With the use of electrophysiological recordings from intact rodents and from brain slices, and taking advantage of behavioral approaches, optogenetics and pharmacogenetics, we will directly test this overarching hypothesis. ", "Specifically, we will (1) Test the hypothesis CCI causes a progressive and significant reduction of inhibitory inputs to nociceptive PB neurons that project to RVM, and dramatically increases their firing; (2) Test the hypothesis that amplified PB activity is due to reduced inhibition from CeA.; (3) Test the hypothesis that reduced CeAI inhibition to PB is causally related to the development of CCI-Pain. ", "The anticipated findings are expected to reveal novel mechanisms for the development of chronic pain, and may lead to development of novel therapies to ameliorate, and perhaps even prevent, this devastating condition." ]
{ "pile_set_name": "NIH ExPorter" }
[ 0.004694835680751174, 0, 0, 0.006060606060606061, 0.004807692307692308, 0, 0, 0.005681818181818182, 0, 0, 0, 0, 0.00980392156862745, 0 ]
0.002218
5
[ { "analysis_explanation": null, "end": 116, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 107 }, { "analysis_explanation": null, "end": 729, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 726 } ]
[ "Regulation of cAMP responsive element binding modulator isoforms in cultured rat ovarian granulosa cells.", "\nA pituitary glycoprotein hormone FSH stimulates ovarian granulosa cells to induce ovarian follicular development. ", "In this study we identified rat ovarian genes that were rapidly induced by FSH in the cultured rat granulosa cells by means of subtraction cloning. ", "Complementary DNA clones encoding cAMP responsive element binding modulator (CREM) were identified as one of the FSH inducible genes. ", "Northern blotting and reverse transcription and polymerase chain reaction (RT-PCR) analyses revealed that only the repressor type of CREM gene products, ICER (inducible cAMP early repressor) isoforms, were induced by FSH treatment in cultured rat granulosa cells. ", "The induction of ICER by FSH was mimicked by reagents known to increase intracellular cAMP levels, indicating that the induction is through cAMP and protein kinase A signal transduction system. ", "Induction of ICER was also confirmed as the protein levels. ", "Electrophoretic mobility shift assay of granulosa cell extracts with a radiolabeled double stranded oligonucleotide corresponding to somatostatin cAMP responsive element also revealed that only the ICER proteins were induced by FSH treatment, whereas levels of CREM proteins were nearly constant regardless of the FSH treatment. ", "Our present study demonstrates that FSH-induced and cAMP-mediated induction and attenuation of transcriptional responses by CREM gene products may be a key mechanistic component for the granulosa cell differentiation and proliferation." ]
{ "pile_set_name": "PubMed Abstracts" }
[ 0, 0.017391304347826087, 0.006756756756756757, 0.007462686567164179, 0.011363636363636364, 0.010309278350515464, 0.016666666666666666, 0.00911854103343465, 0.00425531914893617 ]
0.009258
5
[ { "analysis_explanation": null, "end": 639, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 635 }, { "analysis_explanation": null, "end": 1285, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1281 }, { "analysis_explanation": null, "end": 1477, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1473 } ]
[ "t + 1. ", "Let j(s) = 4*p(s) + 14*x(s). ", "Calculate j(g).", "\n10\nLet k(m) = 5*m**3 + 3003*m - m**3 + 1 - 2996*m - 15*m**2 - m**2. ", "Let d(z) = -z**3 + 5*z**2 - 3*z. ", "Let c(r) = 7*d(r) + 2*k(r). ", "Give c(-5).", "\n-13\nSuppose -97 = 2*l - 3*o, -2*l - 5*o - 13 = 44. ", "Let b = l + 51. ", "Let d(v) = 6*v - 12. ", "Calculate d(b).", "\n48\nLet t(o) = o**2 + 3*o + 2. ", "Let b(u) = -3*u - 2. ", "Let l be b(-4). ", "Let c(p) = -2*p**3 + 52*p**2 + p - 20. ", "Let a be c(26). ", "Suppose a*n - n = -l. ", "Calculate t(n).", "\n0\nLet u(m) = -m**2 + 2*m - 7. ", "Suppose -8*s + 13*s - 17 = -2*x, -x = -2*s + 14. ", "Calculate u(s).", "\n-22\nLet w(i) = -2*i - 2604912*i**2 - 21 + 2604915*i**2 - i. What is w(4)?", "\n15\nLet y(v) be the first derivative of -3/2*v**2 - 3*v + 2/3*v**3 + 8. ", "Suppose -4*q + c = -13, -2*c - 3*c = -4*q + 17. ", "Give y(q).", "\n6\nLet b(w) = w**2 - 8*w + 3. ", "Let c(s) = 7*s**2 + 38*s - 10. ", "Let r be c(-11). ", "Suppose -27*z - 149 = -r. ", "What is b(z)?", "\n23\nSuppose 4 = 12*h - 14*h. ", "Let r be (8/12 + h)*(-27)/(-6). ", "Let c(m) = -m**2 - 6*m + 4. ", "Calculate c(r).", "\n4\nLet w be (0 - -1)*(0 - 15). ", "Let r(f) be the first derivative of -f**2/2 - 11*f + 69142. ", "Calculate r(w).", "\n4\nLet d = -3 - -6. ", "Let j(k) = -2*k + 37 + 4 - 22 - 7 - 15. ", "Calculate j(d).", "\n-9\nLet c be (156/24 + 1)*(-2)/(-3). ", "Let a(h) = h**3 - 5*h**2 - 4*h - 5. ", "Give a(c).", "\n-25\nLet b(y) = -2*y + 5. ", "Let v be b(1). ", "Let k(l) = -l + 2. ", "Let p(c) = -c - 4. ", "Let u(g) = 4*k(g) + p(g). ", "Determine u(v).", "\n-11\nLet l = 1093 - 1095. ", "Let k(x) = 2*x**3 + 3*x**2 - x - 3. ", "What is k(l)?", "\n-5\nSuppose 2*i = 2*z - 1083 + 381, -z = 4*i + 1414. ", "Let n = i + 353. ", "Let q(r) = r**2 - 19. ", "Determine q(n).", "\n-19\nSuppose 2*k = 3*k - 3. ", "Let a = -7 + k. Let n(r) be the second derivative of -r**5/20 - r**4/3 + r**2 - 2*r + 779. ", "Calculate n(a).", "\n2\nLet z be (-12 - -2)/(4/804*6). ", "Let f = -330 - z. Let l(m) = -m**2 + 4*m + 5. ", "Give l(f).", "\n0\nLet t(z) = 5 - 4 + 8*z - z. Let l = -152 - -159. ", "Suppose l = 3*x - 5*h + 23, -h = x. Calculate t(x).", "\n-13\nLet t(i) = -i**3 + 5*i**2 + 2*i - 7. ", "Let m(g) be the third derivative of -g**6/60 - g**5/15 + g**4/8 - 2*g**3/3 + 2*g**2 + 3. ", "Let w be m(-3). ", "Calculate t(w).", "\n3\nLet k = -948 + 955. ", "Let c(u) = 143 + k*u - 279 + 131. ", "Determine c(3).", "\n16\nLet j be -6*(-5 + 117/26). ", "Let a(u) be the first derivative of -1/3*u**3 - j*u - 21 + 3*u**2. ", "Give a(2).", "\n5\nLet t(n) = 1. ", "Let f(j) = -3 - 3 - 7 - 2*j + j. Let u(s) = -2*f(s) - 18*t(s). ", "What is u(-7)?", "\n-6\nLet v be ((1/(-10))/(22/528))/(2/15). ", "Let t(b) = -b**3 - 18*b**2 - 2*b - 42. ", "What is t(v)?", "\n-6\nLet i(a) = -33*a + 31. ", "Let p(c) = -217*c + 186. ", "Let x(h) = -13*i(h) + 2*p(h). ", "What is x(14)?", "\n-101\nLet y(x) = 11*x**2 - 2*x + 1. ", "Suppose -w - 16 - 20 = 0. ", "Let b be ((-1)/(-2))/((-18)/w). ", "What is y(b)?", "\n10\nLet s(j) = 3*j - 4. ", "Suppose -17*p + 7 = -27. ", "Suppose p*k - k = 3. ", "What is s(k)?", "\n5\nLet r(f) be the second derivative of -f**4/12 - 17*f**3/6 - 7*f**2 + 12218*f. ", "Calculate r(-7).", "\n56\nLet u(l) = -22*l**2 + 7*l + 3. ", "Let q be u(1). ", "Let y(f) = -8*f - 78. ", "What is y(q)?", "\n18\nLet a(y) = -2*y**3 - 3*y**2 - 3*y + 3. ", "Let m be a(0). ", "Suppose m*s - 4 = 2*t - 17, -3*t - 4*s + 28 = 0. ", "Let f(b) = -b**2 + 7*b + 3. ", "Give f(t).", "\n-5\nLet n(h) = 6644908*h**2 + 33 + 33*h - 7*h**3 - 6644908*h**2. ", "Calculate n(-1).", "\n7\nLet g be (1164/30)/((-1)/(-5)). ", "Let y = -194 + g. Let h(c) = c**3 - c**2 + 2*c + 6. ", "What is h(y)?", "\n6\nLet r(h) = -99 + 2*h + 0*h + 102 + 2*h**3 - 2*h**2 - 105 + 105. ", "Calculate r(-1).", "\n-3\nLet s(g) be the third derivative of g**6/240 + g**5/120 - g**4/24 + 8*g**3/3 - 2*g**2 + 6. ", "Let z(l) be the second derivative of s(l). ", "Calculate z(7).", "\n22\nSuppose -5*u = 49 - 74. ", "Let j(m) = m. Let p(k) = -k. ", "Let q(d) = u*p(d) + 2*j(d). ", "Calculate q(-5).", "\n15\nLet m(l) be the first derivative of 13*l**7/840 - l**6/180 - l**5/120 - l**3 + 3*l**2 - 158. ", "Let d(s) be the third derivative of m(s). ", "Give d(-1).", "\n-14\nLet m(b) = -b**2 - 16*b - 54. ", "Let w be (-1465)/165 + 16/352 - 5/(-6). ", "Determine m(w).", "\n10\nLet w(g) = 10*g - 66 + 18 + 17 - g**2 + 20. ", "Suppose 2*l + 5*q = -9, -4*q + 3 - 7 = 2*l. ", "Calculate w(l).", "\n5\nLet a(t) = 10 + 5*t**3 - 18*t**2 + 0*t**3 - 12*t - 12*t**3 + 6*t**3 - 19*t. ", "What is a(-16)?", "\n-6\nLet m(g) be the third derivative of -g**4/24 + g**3/3 + 14*g**2. ", "Suppose 0 = 8*d + d - 108. ", "Let n be d + (-6 - -2) - 2. ", "Calculate m(n).", "\n-4\nLet o(m) = -26*m - 21*m + 64*m - 4 - 20*m. ", "Let i(c) = c**3 + 2*c**2 - 24*c - 4. ", "Let z be i(4). ", "Determine o(z).", "\n8\nLet x(n) = -n - 4. ", "Suppose 0 = -2*g - 3*g - 25, -4*v + 3*g + 31 = 0. ", "Suppose -v*u = -9*u + 30. ", "Let r be (2/u)/((-3)/36). ", "Calculate x(r).", "\n0\nLet p(k) = -k - 4. ", "Let h be (-2 - 18/6) + -27. ", "Let o = h + 32. ", "Calculate p(o).", "\n-4\nSuppose -2*m = -2*l + 6, 4*m + 6 = -14. ", "Let b(r) = -r**3 - r**2 + r - 4. ", "Let p be b(0). ", "Let z be (l - 1) + 3/p*-4. ", "Let h(q) = -q**2 + q - 3. ", "What is h(z)?", "\n-3\nLet y = -2745 + 2742. ", "Let d(m) = -3*m + 1. ", "What is d(y)?", "\n10\nLet i(z) = 3*z**2 - 2. ", "Let v be 1/2*(-6)/(-15)*10. ", "Suppose -3*q + k = -v*k - 9, -4*q - 28 = 4*k. ", "Calculate i(q).", "\n10\nLet a(l) be the third derivative of -l**5/60 + l**4/4 + 63*l**3/2 - 9466*l**2. ", "What is a(17)?", "\n2\nLet y be (1 + -5)*((-6)/9)/(12/(-45)). ", "Let n(g) = -g**3 - 11*g**2 - 8*g + 18. ", "What is n(y)?", "\n-2\nLet k(u) = -u**3 + 29*u**2 - 55*u + 16. ", "Let c be (1/((-1)/54))/(135 + -137). ", "What is k(c)?", "\n-11\nLet q = 18 + -18. ", "Suppose q = -10*g + 15*g + 15. ", "Let k(s) = -27 + 89 - 33 - 5*s**2 - 3*s - s**3 - 28. ", "Calculate k(g).", "\n-8\nSuppose -22*j - 64 = 2. ", "Let a = -9 + 3. ", "Let p(n) = n**3 + 1. ", "Let l(y) = -5*y**3 + 3*y**2 + 2*y - 9. ", "Let v(z) = a*p(z) - l(z). ", "Determine v(j).", "\n9\nLet p be ((-7)/(-10) + -1)*(-60)/48*1. ", "Let f(o) be the third derivative of 0*o + 0 - 7/60*o**5 - p*o**4 - 4*o**2 - 7/6*o**3 - 1/120*o**6. ", "Give f(-6).", "\n11\nLet i(x) = -89*x - 9. ", "Let l(k) = -122*k - 10. ", "Let a(f) = 4*i(f) - 3*l(f). ", "Give a(6).", "\n54\nLet p(j) = 3383*j + 3388*j - 10149*j - 37 + 3386*j. ", "Calculate p(4).", "\n-5\nLet x(l) = -141*l - 4390. ", "Let t be x(-31). ", "Let q(k) = -k**2 - 14*k + 92. ", "Give q(t).", "\n-3\nSuppose 0 = -3*j + 2*q - 1, 5*j - 3*q - 10 = -2*q. ", "Suppose x - 4*w + 5 = 15, 0 = j*x + w + 9. ", "Let t(d) = d**3 + 3*d**2 + 2*d + 1. ", "Give t(x).", "\n1\nSuppose 96 = 21*d + 11*d. ", "Suppose d*y = -y - 5*y. ", "Let r(b) = b**2 + b - 1. ", "Give r(y).", "\n-1\nLet g(c) be the third derivative of -c**5/30 + c**4/2 - 5*c**3/3 + 345*c**2. ", "What is g(5)?", "\n0\nSuppose -4*v - 4*l = -24, 2*v - 12 = 167*l - 165*l. ", "Let p(k) = -k**3 + 3*k**2 + 17*k + 23. ", "What is p(v)?", "\n17\nSuppose -4*t - 10 = -5*t + 4*b, -2*t + 3*b = -10. ", "Let i(c) = -5 + 0 - t*c + 27 - 15. ", "Calculate i(6).", "\n-5\nLet n(t) = -8 - 18*t**2 + 16*t + 5 - t**3 + 3*t**2. ", "Let z(f) = f**3 + 19*f**2 - 157*f - 191. ", "Let l be z(-25). ", "Determine n(l).", "\n-3\nLet b(m) be the third derivative of m**5/30 - 538*m**2. ", "Determine b(0).", "\n0\nSuppose 14*m = 19*m + 615. ", "Let d = m + 115. ", "Let f be ((-12)/d*1)/(5/10). ", "Let s(k) = k**3 - 4*k**2 + 3*k - 3. ", "Calculate s(f).", "\n-3\nLet q be 12/16 + (-3140)/(-80). ", "Let m be 32/40*(-10)/(-4). ", "Suppose -7*s - q = m. Let k(n) = -n - 6. ", "Determine k(s).", "\n0\nLet s(t) = -4*t - 10. ", "Let y(d) be the first derivative of 5*d**2/2 + 8*d + 29. ", "Let o(m) = -4*s(m) - 3*y(m). ", "Determine o(-11).", "\n5\nLet g(y) = -20*y**3 + 2*y**2 + 2*y + 1. ", "Let z be 21/6*12/21. ", "Let i be (-1)/(2/4 - (-1)/z). ", "Calculate g(i).", "\n21\nLet r(j) be the second derivative of j**5/20 - 11*j**4/6 + 11*j**3/3 - 10*j**2 - 15*j - 18. ", "Give r(21).", "\n1\nLet c(w) = 2*w**2 + 10*w - 1. ", "Let q(v) = -v**2 + 21*v - 25. ", "Let a be q(20). ", "Let m be c(a). ", "Let d(g) = -5*g**3 + g**2 + 3*g + 2. ", "Determine d(m).", "\n5\nLet q(u) = 68*u + 52. ", "Let s(f) = 11*f + 9. ", "Let n(x) = -q(x) + 6*s(x). ", "Suppose -9 = 2*z + 3*w, 0 = 2*w - 4*w - 2. ", "Calculate n(z).", "\n8\nLet d(h) = h**3 - 10*h**2 + 7*h + 7. ", "Let y = -384 + 392. ", "Let p be 78/y - (92/16 - 5). ", "Calculate d(p).", "\n-11\nSuppose o = 4*o + 30. ", "Let g(z) be the second derivative of -z**4/12 - 11*z**3/6 - 7*z**2/2 + 4626*z. ", "Give g(o).", "\n3\nLet d(n) = -2 - 4*n - n**2 - 2*n + 8*n - 8*n. ", "Let y be (3 + 1)/(556/(-695)). ", "Determine d(y).", "\n3\nLet y(n) be the first derivative of 5/2*n**2 - 9*n - 7 - 1/4*n**4 + 5/3*n**3. ", "Calculate y(6).", "\n-15\nLet p = -1230 + 1226. ", "Let s(h) = h**3 + 5*h**2 + 6*h + 4. ", "What is s(p)?", "\n-4\nLet a(b) = 8*b**2 + 111*b - 19. ", "Let d = 473 - 487. ", "Let j be a(d). ", "Let i(x) = x**3 + 6*x**2 + 4*x. ", "Give i(j).", "\n5\nLet p(q) = 10 - q + 9*q + 6*q**2 - 10788*q**3 + 10789*q**3 + q. Determine p(-5).", "\n-10\nLet j(c) = -8 + 95*c + 95*c + 95*c - 288*c. ", "Suppose 3*a + 2*a + 35 = -5*w, 3*a - 2*w = -26. ", "Determine j(a).", "\n16\nLet p = 587 + -584. ", "Let u(l) = 3*l**2 - 6*l**2 - 5 - 2*l**2 " ]
{ "pile_set_name": "DM Mathematics" }
[ 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.045454545454545456, 0, 0, 0, 0, 0.013513513513513514, 0, 0, 0.1, 0, 0, 0, 0.038461538461538464, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.06666666666666667, 0, 0, 0.07692307692307693, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.0196078431372549, 0, 0.011235955056179775, 0, 0, 0, 0, 0.06666666666666667, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.027777777777777776, 0.038461538461538464, 0, 0, 0, 0.04, 0.047619047619047616, 0, 0, 0, 0, 0.06666666666666667, 0, 0.07692307692307693, 0, 0, 0.02040816326530612, 0, 0, 0, 0, 0, 0, 0.07692307692307693, 0, 0, 0.010526315789473684, 0, 0, 0, 0, 0, 0, 0, 0.023809523809523808, 0, 0, 0, 0.06666666666666667, 0, 0, 0, 0, 0, 0, 0.037037037037037035, 0, 0, 0, 0, 0, 0.06666666666666667, 0, 0, 0, 0, 0.06666666666666667, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.06666666666666667, 0, 0.010101010101010102, 0, 0, 0, 0, 0.1, 0, 0.06666666666666667, 0, 0, 0, 0, 0, 0.023255813953488372, 0, 0.1, 0, 0.041666666666666664, 0, 0, 0.012345679012345678, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.06666666666666667, 0, 0, 0, 0, 0, 0, 0, 0, 0.06666666666666667, 0, 0, 0, 0, 0, 0, 0, 0, 0.010416666666666666, 0, 0, 0.03333333333333333, 0, 0, 0, 0.06666666666666667, 0, 0, 0, 0.023255813953488372, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.06666666666666667, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.06666666666666667, 0, 0 ]
0.007212
5
[ { "analysis_explanation": null, "end": 178, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 173 }, { "analysis_explanation": null, "end": 416, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 412 }, { "analysis_explanation": null, "end": 783, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 782 }, { "analysis_explanation": null, "end": 1100, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1098 }, { "analysis_explanation": null, "end": 1288, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1285 }, { "analysis_explanation": null, "end": 2691, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2686 }, { "analysis_explanation": null, "end": 2951, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2943 }, { "analysis_explanation": null, "end": 3153, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3150 }, { "analysis_explanation": null, "end": 3378, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3375 }, { "analysis_explanation": null, "end": 3455, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3448 }, { "analysis_explanation": null, "end": 3464, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3461 }, { "analysis_explanation": null, "end": 4954, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4952 }, { "analysis_explanation": null, "end": 4980, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4977 }, { "analysis_explanation": null, "end": 5124, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5121 }, { "analysis_explanation": null, "end": 5568, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5565 }, { "analysis_explanation": null, "end": 5870, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5867 }, { "analysis_explanation": null, "end": 5932, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5929 }, { "analysis_explanation": null, "end": 5940, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5936 }, { "analysis_explanation": null, "end": 6146, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6137 }, { "analysis_explanation": null, "end": 6182, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6162 }, { "analysis_explanation": null, "end": 6392, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6389 }, { "analysis_explanation": null, "end": 6688, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6685 }, { "analysis_explanation": null, "end": 6713, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6710 }, { "analysis_explanation": null, "end": 7000, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6993 }, { "analysis_explanation": null, "end": 7160, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7157 }, { "analysis_explanation": null, "end": 7215, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7212 }, { "analysis_explanation": null, "end": 7228, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7226 }, { "analysis_explanation": null, "end": 7566, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7563 }, { "analysis_explanation": null, "end": 915, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 911 }, { "analysis_explanation": null, "end": 1631, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 1627 }, { "analysis_explanation": null, "end": 1955, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 1951 }, { "analysis_explanation": null, "end": 1965, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 1961 }, { "analysis_explanation": null, "end": 2344, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 2340 }, { "analysis_explanation": null, "end": 2733, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 2729 }, { "analysis_explanation": null, "end": 3345, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 3341 }, { "analysis_explanation": null, "end": 4019, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 4015 }, { "analysis_explanation": null, "end": 4826, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 4822 }, { "analysis_explanation": null, "end": 5422, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 5418 }, { "analysis_explanation": null, "end": 6008, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 6004 }, { "analysis_explanation": null, "end": 6441, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 6437 }, { "analysis_explanation": null, "end": 6542, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 6538 }, { "analysis_explanation": null, "end": 6614, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 6609 }, { "analysis_explanation": null, "end": 6905, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 6900 }, { "analysis_explanation": null, "end": 7000, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 6996 }, { "analysis_explanation": null, "end": 7512, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 7508 }, { "analysis_explanation": null, "end": 581, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 574 }, { "analysis_explanation": null, "end": 601, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 594 }, { "analysis_explanation": null, "end": 3034, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 3027 }, { "analysis_explanation": null, "end": 3070, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 3063 } ]
[ "The Cancer Coalition can once again 'Get its Rear In Gear' after a giant inflatable colon, used for education, was recovered.", "The colon, used to teach about the dangers of colon cancer, was swiped from a pickup truck earlier this month.", "The inflatable, which is valued around $4,000, is owned by the Cancer Coalition, which hosts walk/run events under a campaign called “Get Your Rear In Gear.", "”The coalition ships the inflatable colon across the country for walkers and runners to see and learn about the progression of colon cancer in a unique way.", "It was on its way to the annual Sisters Living Beyond Breast Cancer 5K Relay Walk when it was stolen.", "Kansas City Police said Monday that the pilfered intestine had been located in a vacant house in the 7100 block of Virginia thanks to a tip.", "Oh, what a relief it is.", "The investigation into this incident continues. ", "So far no arrests have been made - the colon caper remains at large.", "\n\nThe Cancer Coalition can once again 'Get its Rear In Gear' after a giant inflatable colon, used for education, was recovered.", "\n\nThe colon, used to teach about the dangers of colon cancer, was swiped from a pickup truck earlier this month.", "\n\n\nThe inflatable, which is valued around $4,000, is owned by the Cancer Coalition, which hosts walk/run events under a campaign called “Get Your Rear In Gear.”", "\n\nThe coalition ships the inflatable colon across the country for walkers and runners to see and learn about the progression of colon cancer in a unique way.", "\n\nIt was on its way to the annual Sisters Living Beyond Breast Cancer 5K Relay Walk when it was stolen.", "\n\nKansas City Police said Monday that the pilfered intestine had been located in a vacant house in the 7100 block of Virginia thanks to a tip.", "\n\nOh, what a relief it is.", "\n\nThe investigation into this incident continues. ", "So far no arrests have been made - the colon caper remains at large." ]
{ "pile_set_name": "OpenWebText2" }
[ 0.008, 0, 0.00641025641025641, 0, 0.009900990099009901, 0.007142857142857143, 0, 0, 0.014705882352941176, 0, 0, 0.00625, 0, 0.009708737864077669, 0.007042253521126761, 0, 0, 0.014705882352941176 ]
0.004659
5
[ { "analysis_explanation": null, "end": 235, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 217 }, { "analysis_explanation": null, "end": 683, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 677 }, { "analysis_explanation": null, "end": 776, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 768 }, { "analysis_explanation": null, "end": 1171, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1153 }, { "analysis_explanation": null, "end": 1619, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1613 }, { "analysis_explanation": null, "end": 1712, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1704 } ]
[ "1. ", "Introduction {#sec1}\n===============\n\nStruma ovarii refers to a germ cell tumor that is composed of at least 50% thyroid tissue \\[[@B1], [@B2]\\]. ", "These tumors account for about 2-3% of all ovarian tumors \\[[@B1]--[@B3]\\]. ", "They are relatively rare, with no more than 200 cases reported in the literature \\[[@B4]\\].", "\n\nMost struma ovarii are benign, with malignant transformation occurring in only 5% of these tumors \\[[@B5], [@B6]\\]. ", "Malignant struma ovarii (MSO) coexisting with primary thyroid carcinoma is extremely rare, with only a handful of cases reported in the literature \\[[@B2], [@B7], [@B8]\\]. ", "The synchronous development of primary thyroid carcinoma and MSO is not fully understood. ", "Investigations including morphological, immunohistochemical, and molecular analysis suggest that synchronous, albeit distinct, primary tumors in the ovary and cervical thyroid may occur \\[[@B8], [@B9]\\]. ", "A hypothesized \"field cancerization\" and early genomic instability may explain multifocality in all thyroid-type tissue. ", "Some experts, therefore, recommend routine imaging of the thyroid gland for coexisting carcinoma in all patients with high risk MSO \\[[@B8]\\]. ", "Supporting evidence for this approach also comes from a population-level analysis reporting an approximately 9% prevalence of synchronous or metachronous aggressive thyroid cancers in a series of 68 patients with MSO \\[[@B10]\\].", "\n\nGiven the overall rarity of MSO and its possible concurrence with thyroid cancer, the optimal management of MSO is controversial, especially when the tumor is not metastatic \\[[@B11]--[@B13]\\]. ", "Areas of contention include aggressiveness of therapy, prophylactic thyroidectomy, and radioactive iodine (RAI) \\[[@B7], [@B8], [@B13], [@B14]\\]. ", "Here, we present the case of a woman with MSO and concomitant thyroid carcinoma, along with a literature review of similar cases reported in the English literature highlighting the current trends in management of this rare malignancy.", "\n\n2. ", "Clinical Case {#sec2}\n================\n\nA 32-year-old nulliparous female presented to the endocrinology clinic for further evaluation and treatment of a recently diagnosed MSO. ", "Five years prior to this evaluation, she underwent bilateral ovarian cystectomy for complex ovarian masses which were histologically consistent with mature teratomas. ", "Over the ensuing four years, serial ultrasonography showed progressive interval growth of the bilateral cystic masses, especially of the left adnexal mass growing from 4.3 cm to 12.9 cm in approximately 4 years.", "\n\nFive months prior to her endocrinology evaluation, she underwent exploratory laparotomy with left salpingo-oophorectomy, right ovarian cystectomy, lysis of adhesions, and partial omentectomy. ", "Pathology showed a 6.0 cm malignant struma ovarii, with predominantly follicular variant papillary thyroid carcinoma in the left ovary ([Figure 1(a)](#fig1){ref-type=\"fig\"}). ", "The tumor, classified as pT1a pNx; FIGO IA, was organ confined but with lymphatic/vascular invasion ([Figure 1(b)](#fig1){ref-type=\"fig\"}). ", "The omentum was free of tumor, and in the right ovary a hemorrhagic corpus luteum cyst was identified. ", "Postoperatively she underwent an I-123 whole body scan which did not identify any metastatic disease. ", "Specifically, there was no abnormal uptake in the adnexae or the abdomen, although this was likely of limited utility given the intact thyroid gland.", "\n\nWhen seen in the endocrinology clinic, she had no abdominal complaints. ", "Physical exam was unremarkable, including a normal neck exam without palpable thyroid enlargement or nodularity and with a soft abdomen without palpable masses or ascites. ", "Family history was significant for cervical and lung cancer in her mother as well as the maternal grandmother with breast and bone malignancies.", "\n\nLaboratory testing showed TSH 2.98 mcIU/ml (0.35-4.0), FT4 16.7 pmol/L \\[1.3 ng/dL (0.6-1.7)\\], FT3 49.1 pmol/L \\[3.2 ng/dL (87-178)\\], thyroglobulin antibody negative, (\\<1.0) thyroglobulin 108.5 ng/mL (1.3-31.8). ", "A thyroid ultrasound showed a mixed hypo- and isoechoic 0.8 x 0.4 x0.7 cm nodule with several echogenic punctate foci consistent with microcalcifications. ", "Fine needle aspiration biopsy of the nodule was interpreted as atypia of undetermined significance (Bethesda III). ", "Given the clinical history of MSO, indeterminate cytopathology, and patient preference, the decision was made to perform total thyroidectomy. ", "Pathology revealed a 0.6cm papillary thyroid carcinoma with no lymphovascular invasion ([Figure 2](#fig2){ref-type=\"fig\"}). ", "There was, however, a single focus of extra thyroidal extension (pT3). ", "Her postoperative course was complicated by hypoparathyroidism with symptomatic hypocalcemia which resolved with aggressive replacement of calcitriol and elemental calcium. ", "Thyroglobulin levels were 9.5 ng/ml with negative thyroglobulin antibodies at two months after thyroidectomy. ", "She was discharged on calcitriol 0.25mcg BID and calcium carbonate 2500mg TID (3000mg elemental calcium). ", "She was started on liothyronine 25mcg PO daily, in anticipation of planned RAI therapy.", "\n\nThree months later, I-123 WBS/SPECT/CT revealed multiple avid foci in the neck suggestive of lymph node metastasis and residual thyroid tissue, as well as one faint focus in the mid-abdomen possibly representing a metastatic mesenteric lymph node. ", "Ultrasonography failed to reveal abnormal cervical lymph nodes. ", "Considering these findings in total, it was decided to proceed with radioactive iodine therapy and she received 184.3 mCi of I-131 therapy. ", "Post-therapy whole body scan revealed successful targeting of radioiodine therapy to thyroid tissue in the neck, and no convincing abnormal focal uptake in abdomen or pelvis to suggest radioiodine avid metastatic disease. ", "Thyroglobulin levels post-RAI ablation decreased to 0.5ng/ml and subsequently to 0.1ng/ml upon later testing. ", "BRAF mutational analysis testing for the V600E mutation was negative for both ovarian and thyroid papillary carcinomas. ", "Patient also had testing for TERT promoter mutations, which were negative. ", "Post-RAI ablation, patient was switched to levothyroxine 200mcg daily with subsequent titration to 225 mcg daily to achieve suppressed TSH. ", "Hypocalcemia eventually resolved, and she was transitioned off calcitriol and calcium carbonate supplementation. ", "A year after RAI ablation, the patient underwent rhTSH stimulated WBS which did not show any evidence of thyroid cancer recurrence. ", "The most recent thyroid ultrasound (12/2017) showed stable benign appearing lymph nodes, and no evidence of residual or recurrent thyroid tissue (thyroglobulin level of 0.1 ng/ml). ", "A pelvic surveillance MRI showed benign appearing cystic lesions at the right adnexa, but no evidence of metastatic disease. ", "The patient provided written informed consent to publish her case.", "\n\n3. ", "Discussion {#sec3}\n=============\n\nMalignant transformation of struma ovarii occurs in less than 5% of these ovarian tumors \\[[@B5], [@B13]\\]. ", "Patients with MSO typically present with abdominal pain or an incidental ovarian mass, vaginal bleeding, menstrual cycle abnormalities, and symptoms of hyperthyroidism or rarely with ascites \\[[@B13], [@B15]--[@B17]\\]. ", "Patients may occasionally present with symptoms of hyperthyroidism (5-8% of cases) \\[[@B13]\\] or elevated ovarian cancer markers (CA-125) \\[[@B18]\\]. ", "Following diagnosis of differentiated thyroid cancer arising in struma ovarii, further work-up should include thyroid evaluation to exclude synchronous thyroid carcinoma.", "\n\nConcurrence of MSO and intrathyroidal cancer is quite rare. ", "In reviewing the literature, we found 10 publications, 9 case reports \\[[@B2], [@B7]--[@B9], [@B14]--[@B20], [@B21]\\], and one abstract \\[[@B22]\\], describing 10 patients with synchronous MSO and thyroid carcinoma ([Table 1](#tab1){ref-type=\"table\"}). ", "Not shown in [Table 1](#tab1){ref-type=\"table\"} are additional patients reported by two retrospective analyses of the Surveillance, Epidemiology, and End Results (SEER) database from 1973 to 2011 by Goffredo et al. ", "\\[[@B10]\\] and Sisti et al. ", "\\[[@B23]\\]. ", "Goffredo et al. ", "analyzed the entire database (SEER 18 Registries) whereas Sistri et al. ", "only part of it (SEER 9 Registries). ", "Although an overlap of the reported patients between the two analyses cannot be excluded, Goffredo et al. ", "identified 6 patients (median age 36) with concomitant thyroid cancer out of 68 patients with MSO and Sisti et al. ", "one patient with synchronous and one with metachronous thyroid cancer out of 21 patients with MSO. ", "As most patients reported are from institutions outside the US (unlikely overlap with those reported by Goffredo et al.), ", "the total number of reported MSO patients with coexisting thyroid cancer in the English literature is not greater than 17.", "\n\nThe median age of women described with concomitant MSO and intrathyroidal was 42 years (range 30-55), with the majority of them having ovarian masses larger than 5 cm. ", "With exception of two patients \\[[@B20], [@B24]\\] who sought advice for cervical thyroid nodules (MSO diagnosed after thyroidectomy with radioiodine), the remaining patients had manifestations related to the abdomen. ", "Size of thyroid tumors ranged from 0.2 to 1.7 cm. ", "There were two patients with MSO size less than 1.0 cm. ", "Histologically, most tumors were papillary thyroid carcinomas in both sites, with only one discordant case of a follicular thyroid cancer in MSO and papillary thyroid cancer in the cervical thyroid \\[[@B7]\\]. ", "There were five patients with extrathyroidal tumor extension or metastasis to regional lymph nodes at time of thyroidectomy. ", "Our patient had evidence of extrathyroidal tumor extension on thyroid pathology. ", "She was also believed to have metastatic disease to cervical lymph nodes three months after thyroidectomy, based on thyroglobulin measures and nuclear imaging. ", "Similarly, Goffredo et al. ", "reported that the majority (two-thirds) of the patients with synchronous MSO and thyroid carcinoma had evidence of cancer extension outside the gland.", "\n\nThe relatively high prevalence (about 9%) of MSO coexisting with thyroid cancer reported by Goffredo et al. ", "may support the notion for a true association and common pathogenic mechanism \\[[@B10]\\]. ", "Evidence for a common pathogenesis for all papillary thyroid carcinomas was also provided by Schmidt et al. ", "who found BRAF gene mutations in 4 out of 6 patients with MSO and in none of 9 patients with benign struma ovarii \\[[@B25]\\]. ", "These data indicate that the development of MSO is associated with*BRAF* mutations of the type commonly seen in cervical thyroid papillary carcinoma. ", "Although BRAF mutations in MSO were additionally found in other case reports \\[[@B26]\\] or small series of patients \\[[@B27]\\], we could not find any literature reports of BRAF mutations in both MSO and cervical thyroid cancer. ", "Reporting differences in tumor expression of CK-19 in a patient with synchronous MSO and cervical thyroid cancer, Leong et al. ", "\\[[@B8]\\] supported the notion of an autonomous existence of the two cancers and postulated an early genetic instability to explain the multifocal oncogenesis.", "\n\nConcomitant MSO and thyroid cancer should be differentiated from papillary carcinoma of the cervical thyroid with ovarian metastasis, which is extremely rare \\[[@B28]\\]. ", "Presence of teratomatous elements and normal thyroid epithelial tissue in the ovary is suggestive of MSO rather than metastatic thyroid cancer \\[[@B8]\\]. ", "In this respect, ovarian MRI may help distinguish the two by revealing multiloculated ovarian cystic mass with a solid component and a variable signal intensity between locules (\"stained glass imaging\") \\[[@B29]\\]. ", "Our patient had known history of mature ovarian teratoma and the MRI was also consistent with multiloculated cysts.", "\n\nThe optimal management of MSO remains controversial \\[[@B11]--[@B13]\\]. ", "As with most rare diseases, the natural history of MSO is not fully defined and there is a paucity of evidence-based clinical practice guidelines. ", "The extent of ovarian surgery can be a subject of debate \\[[@B30]\\], especially when preservation of fertility is an issue. ", "Preoperative ultrasonography may help differentiate benign from malignant pathologies and allow for ovarian sparing surgical planning if appropriate \\[[@B31]\\]. ", "The most contentious aspects of MSO treatment include need for thyroidectomy and postoperative RAI in patients with no evidence of metastases \\[[@B2]\\]. ", "Presence of metastases poses no therapeutic dilemma and all patients should be treated with thyroidectomy followed by RAI \\[[@B2], [@B5], [@B32]\\]. ", "Given the possible coexistence of synchronous thyroid cancer, total thyroidectomy will exclude thyroid cancer, permit RAI for micrometastasis, and increase reliability of thyroglobulin as a marker for follow-up \\[[@B7]\\]. ", "In six patients treated with thyroidectomy and RAI after resection of MSO, DeSimone et al. ", "\\[[@B13]\\] reported no recurrence. ", "In contrast, Jean et al. ", "\\[[@B33]\\] reported a 21 % recurrence in 42 MSO patients treated only surgically.", "\n\nMost authors \\[[@B5], [@B13]--[@B19], [@B34]--[@B37]\\] endorse an aggressive postoperative treatment with thyroidectomy followed by RAI therapy on the basis that RAI may reduce recurrence and possibly mortality \\[[@B32], [@B33], [@B38]\\] especially in cases of uncertainty about surgery completeness, in an analogy used to treat cervical thyroid cancer \\[[@B1]\\]. ", "In two separate analyses of MSO patients reported in the literature, Devaney et al. ", "\\[[@B1]\\] and DeSimone et al. ", "\\[[@B13]\\] noted that more recurrences occurred in patients who were conservatively treated with surgery only than in those who received primary adjuvant therapy.", "\n\nRisk stratification in MSO has been proposed as a means to help choose the appropriate treatment postoperatively in patients with no evidence of metastases at time of surgery \\[[@B6]\\]. ", "Yassa et al. ", "\\[[@B6]\\] suggested that MSO measuring over 2 cm, or with extraovarian extension, or aggressive histological features should be treated with thyroidectomy and RAI. ", "However, tumor size criteria are not unanimously agreed upon by all authors, with some using cutoff tumor size of 1 cm \\[[@B7]\\]. ", "Furthermore, measuring tumor size can be extremely difficult in cases in which the tumor is intermixed with teratomatous tissue \\[[@B2]\\]. ", "Likewise, histological features of MSO were not found to correlate with clinical outcome in 26 patients with MSO followed up for a period ranging from 5 to 20 years \\[[@B39]\\]. ", "Extraovarian tumor extension is generally considered an indication for aggressive treatment with thyroidectomy and RAI \\[[@B2]\\]. ", "In our patient, the choice of postoperative treatment was indisputable as she had extraovarian tumor extension.", "\n\nGiven the rarity of the disease, the postoperative management of MSO will likely continue to be controversial and be based on results of small observational studies, rather than controlled studies. ", "The present literature review provided a description of the coexistence of MSO and thyroid cancer, highlighting the relatively aggressive cervical thyroid cancer found in 45 % of reported cases ([Table 1](#tab1){ref-type=\"table\"}) which is in agreement with the findings of Goffredo et al. ", "Considering the relatively high prevalence of these synchronous tumors in the SEER database and the generally increasing incidence of thyroid cancer \\[[@B40]\\], the clinician should be aware of the possible association and further investigate it in all patients with MSO. ", "Despite the significant uncertainty and many unsettled issues about treatment, we propose an algorithm ([Figure 3](#fig3){ref-type=\"fig\"}) for the postoperative management of MSO. ", "Again, this algorithm summarizes the current trend of recommendations in the literature, which are based on small retrospective observational studies and are by no means firm and indisputable. ", "As most authors \\[[@B5], [@B13]--[@B19], [@B34]--[@B37]\\], we endorse an aggressive postoperative management that should include thyroidectomy and RAI in all patients with MSO. ", "Patient preferences might only be considered in cases in which the tumor is small and confined to ovary and there is no evidence of thyroid nodules. ", "Ultrasonographic detection of thyroid nodules postoperatively will simply reinforce and justify this aggressive approach.", "\n\n4. ", "Conclusion {#sec4}\n=============\n\nMSO, a rare malignant tumor arising from struma ovarii, can occasionally coexist with thyroid cancer. ", "The present literature review supports the notion that the concurrent cervical thyroid tumors are usually aggressive cancers. ", "Clinicians should be aware of this association and routinely investigate for thyroid nodules in all cases of MSO. ", "In view of this association, we endorse an aggressive postoperative management of all MSO cases that includes thyroidectomy and RAI.", "\n\nWe thank Dr. M. Xing, Johns Hopkins Hospital, for help with TERT promoter mutation testing.", "\n\nMSO:\n\n: Malignant struma ovarii\n\nRAI:\n\n: Radioactive iodine\n\nTSH:\n\n: Thyroid stimulating hormone\n\nFT4:\n\n: Free thyroxine\n\nFT3:\n\n: Free triiodothyronine\n\nWBS:\n\n: Whole body scan\n\nSPECT/CT:\n\n: Single-photon emission computer tomography/computer tomography\n\nLV:\n\n: Lymphovascular\n\nETE:\n\n: Extrathyroid extension.", "\n\nConflicts of Interest\n=====================\n\nThe authors have no conflicts of interest to disclose.", "\n\n![(", "a) Papillary thyroid carcinoma arising in struma ovarii. (", "b) Vascular invasion of malignant struma ovarii.](CRIE2019-7964126.001){#fig1}\n\n![(", "a) Well circumscribed nodule composed of papillary thyroid carcinoma with solid, follicular, and papillary architecture surrounded by fibrosis. (", "b). ", "Areas with papillary architecture with cytologically enlarged nuclei with grooves and open chromatin.](CRIE2019-7964126.002){#fig2}\n\n![", "Algorithm summarizing current trends in postoperative management of malignant struma ovarii.](CRIE2019-7964126.003){#fig3}\n\n###### \n\nReported cases of synchronous malignant struma ovarii and thyroid carcinoma.", "\n\n -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------\n Reference Patient Age (yrs) Ovarian Mass Size\\ MSO Size\\ MSO Pathology MSO Stage Thyroid Carcinoma\\ ONCOGENIC\\\n (cm) (cm) Size (cm), Type EXPRESSION\n --------------------------------- ------------------- -------------------- -------------------- --------------- ---------------------------------------- ----------------------------------------------- --------------------------------\n Boyd et al \\[[@B19]\\] 30 8.5x5x4 \\-* *-* *-* *- Papillary No surface involvement, No LV invasion 1.0,\\ \\-* *-* *-* *-* *-* *-* *-\n Papillary, NO ETE \n\n \n\n Brusca et al. ", "\\[[@B14]\\] 30 7.3x3 0.9 Papillary \\-* *-* *-* *-* *-* *- 0.2,\\ \\-* *-* *-* *-* *-* *-* *-* *-\n Papillary, No ETE \n\n \n\n Janszen et al. ", "\\[[@B7]\\] 52 10x8 \\-* *-* *-* *- Follicular \\-* *-* *-* *-* *-* *-* *- 0.3,\\ \\-* *-* *-* *-* *-* *-\n Papillary,\\ \n No ETE \n\n \n\n Catalina et al. ", "\\[[@B9]\\] 33 9.5x7.5x3.5 2.5 Papillary No surface involvement, No LV invasion 1.4,\\ \\-* *-* *-* *-* *-\n Papillary\\ \n With ETE, Metastatic to lymph nodes \n\n \n\n Leong et al. ", "\\[[@B8]\\] 42 13.5 \\-* *-* *-* *- Papillary No surface involvement, No LV invasion 0.6-0.8,\\ BRAF --\\\n Papillary, bilateral\\ K-RAS --\\\n multifocal, with ETE, mets to lymph nodes RET/PTC -\n\n \n\n Marti et al. ", "\\[[@B2]\\] 44 2.4 \\-* *-* *-* *-* *- Papillary \\-* *-* *-* *-* *-* *-* *-* *- 0.5, Papillary\\ BRAF -\n with ETE, mets to lymph nodes \n\n \n\n Middelbeek et al \\[[@B20]\\] 55   1.5 Papillary No surface involvement, No LV invasion 1.2,\\ BRAF -\n Papillary, No ETE \n\n \n\n Capitato et al. ", "\\[[@B22]\\] 35 8.2x7x6   Papillary No surface involvement 1.7,\\ BRAF -\n Papillary, No ETE \n\n \n\n Krishnamurthy et al. ", "\\[[@B21]\\] 51 13x7.6 0.8 Papillary   0.4, papillary follicular variant \\-* *-* *-* *-\n\n \n\n Lim et al. ", "\\[[@B24]\\] 63 3x2.5x1.5 \\-* *-* *-* *-* *- Papillary No surface involvment, No LV invasion Papillary, mets to lymph nodes \\-* *-* *-* *-\n\n \n\n Present case 30 12.9 6.0 Papillary No surface involvment, LV invasion 0.6, Papillary, with ETE, mets to lymph nodes BRAF --\\\n RET/PTC --\\\n TERT -\n -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------\n\nAbbreviations: MSO, malignant struma ovarii; LV, lymphovascular; ETE, extrathyroid extension.", "\n\n[^1]: Academic Editor: Antonio S. Laganà\n" ]
{ "pile_set_name": "PubMed Central" }
[ 0, 0.0136986301369863, 0.02631578947368421, 0.01098901098901099, 0.01694915254237288, 0.01744186046511628, 0, 0.00980392156862745, 0, 0.006993006993006993, 0.0043859649122807015, 0.01020408163265306, 0.0273972602739726, 0, 0, 0.005649717514124294, 0, 0, 0, 0, 0.007142857142857143, 0, 0, 0, 0, 0, 0, 0.013824884792626729, 0.0064516129032258064, 0.008695652173913044, 0, 0, 0.014084507042253521, 0, 0.00909090909090909, 0.009433962264150943, 0, 0, 0, 0, 0, 0.00909090909090909, 0, 0.013333333333333334, 0, 0, 0, 0, 0, 0, 0, 0.014084507042253521, 0.0136986301369863, 0.013333333333333334, 0, 0, 0.027777777777777776, 0.013953488372093023, 0.03571428571428571, 0.08333333333333333, 0.0625, 0.027777777777777776, 0.02702702702702703, 0.009433962264150943, 0.008695652173913044, 0, 0.00819672131147541, 0, 0, 0.009216589861751152, 0, 0, 0.004784688995215311, 0, 0, 0, 0.037037037037037035, 0, 0.00909090909090909, 0.011111111111111112, 0.009259259259259259, 0.007936507936507936, 0, 0.008771929824561403, 0.007874015748031496, 0.006289308176100629, 0.005813953488372093, 0.006493506493506494, 0.004651162790697674, 0, 0.02702702702702703, 0, 0.008064516129032258, 0.006211180124223602, 0.006535947712418301, 0.02027027027027027, 0.0045045045045045045, 0.01098901098901099, 0.02857142857142857, 0.04, 0.012345679012345678, 0.02459016393442623, 0.011904761904761904, 0.03333333333333333, 0.006172839506172839, 0.005319148936170213, 0, 0.006097560975609756, 0.007692307692307693, 0.007194244604316547, 0.005649717514124294, 0.007692307692307693, 0, 0, 0, 0.007352941176470588, 0.005555555555555556, 0, 0.02824858757062147, 0, 0, 0, 0, 0, 0, 0, 0.03225806451612903, 0.00303951367781155, 0, 0, 0, 0, 0, 0, 0, 0, 0.0038510911424903724, 0.0015503875968992248, 0.0011890606420927466, 0.0024009603841536613, 0.0035545023696682463, 0.003218020917135961, 0.0016, 0.0024154589371980675, 0.002902757619738752, 0.023255813953488372 ]
0.007653
5
[ { "analysis_explanation": null, "end": 328, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 322 }, { "analysis_explanation": null, "end": 991, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 978 }, { "analysis_explanation": null, "end": 1729, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1723 }, { "analysis_explanation": null, "end": 2023, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2012 }, { "analysis_explanation": null, "end": 2157, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2147 }, { "analysis_explanation": null, "end": 2341, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2331 }, { "analysis_explanation": null, "end": 2524, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2503 }, { "analysis_explanation": null, "end": 2537, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2526 }, { "analysis_explanation": null, "end": 2767, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2754 }, { "analysis_explanation": null, "end": 3174, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3169 }, { "analysis_explanation": null, "end": 3835, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3832 }, { "analysis_explanation": null, "end": 4259, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4247 }, { "analysis_explanation": null, "end": 4860, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4850 }, { "analysis_explanation": null, "end": 4926, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4915 }, { "analysis_explanation": null, "end": 5034, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5029 }, { "analysis_explanation": null, "end": 5094, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5076 }, { "analysis_explanation": null, "end": 5763, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5750 }, { "analysis_explanation": null, "end": 6013, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6009 }, { "analysis_explanation": null, "end": 6167, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6162 }, { "analysis_explanation": null, "end": 6314, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6308 }, { "analysis_explanation": null, "end": 6955, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6949 }, { "analysis_explanation": null, "end": 7404, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7391 }, { "analysis_explanation": null, "end": 7997, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7993 }, { "analysis_explanation": null, "end": 8023, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8009 }, { "analysis_explanation": null, "end": 8062, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8053 }, { "analysis_explanation": null, "end": 8080, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8065 }, { "analysis_explanation": null, "end": 8151, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8139 }, { "analysis_explanation": null, "end": 8295, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8280 }, { "analysis_explanation": null, "end": 8332, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8326 }, { "analysis_explanation": null, "end": 8572, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8570 }, { "analysis_explanation": null, "end": 8629, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8614 }, { "analysis_explanation": null, "end": 8841, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8833 }, { "analysis_explanation": null, "end": 9452, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9444 }, { "analysis_explanation": null, "end": 9746, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9734 }, { "analysis_explanation": null, "end": 9847, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9832 }, { "analysis_explanation": null, "end": 10105, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10091 }, { "analysis_explanation": null, "end": 10303, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10290 }, { "analysis_explanation": null, "end": 10706, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10697 }, { "analysis_explanation": null, "end": 10934, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10923 }, { "analysis_explanation": null, "end": 11111, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11096 }, { "analysis_explanation": null, "end": 12775, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12767 }, { "analysis_explanation": null, "end": 12867, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12853 }, { "analysis_explanation": null, "end": 12927, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12917 }, { "analysis_explanation": null, "end": 13457, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13444 }, { "analysis_explanation": null, "end": 13487, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13473 }, { "analysis_explanation": null, "end": 13849, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13838 }, { "analysis_explanation": null, "end": 13921, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13909 }, { "analysis_explanation": null, "end": 14448, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14435 }, { "analysis_explanation": null, "end": 15189, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15175 }, { "analysis_explanation": null, "end": 16178, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16162 }, { "analysis_explanation": null, "end": 16375, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16362 }, { "analysis_explanation": null, "end": 16816, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16809 }, { "analysis_explanation": null, "end": 16860, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16856 }, { "analysis_explanation": null, "end": 17204, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 17192 }, { "analysis_explanation": null, "end": 17375, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 17362 }, { "analysis_explanation": null, "end": 17456, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 17413 }, { "analysis_explanation": null, "end": 17870, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 17827 }, { "analysis_explanation": null, "end": 18256, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 18249 }, { "analysis_explanation": null, "end": 18934, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 18859 }, { "analysis_explanation": null, "end": 19511, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19256 }, { "analysis_explanation": null, "end": 20166, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20158 }, { "analysis_explanation": null, "end": 20997, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20983 }, { "analysis_explanation": null, "end": 21830, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 21819 }, { "analysis_explanation": null, "end": 22237, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 22195 }, { "analysis_explanation": null, "end": 22674, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 22663 }, { "analysis_explanation": null, "end": 23317, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 23283 }, { "analysis_explanation": null, "end": 24956, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 24947 }, { "analysis_explanation": null, "end": 26286, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 26273 }, { "analysis_explanation": null, "end": 26377, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 26360 }, { "analysis_explanation": null, "end": 7634, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.6499999999999999, "start": 7632 }, { "analysis_explanation": null, "end": 7641, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.6499999999999999, "start": 7639 }, { "analysis_explanation": null, "end": 7648, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.6499999999999999, "start": 7646 }, { "analysis_explanation": null, "end": 137, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 135 }, { "analysis_explanation": null, "end": 144, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 142 }, { "analysis_explanation": null, "end": 213, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 211 }, { "analysis_explanation": null, "end": 220, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 218 }, { "analysis_explanation": null, "end": 312, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 310 }, { "analysis_explanation": null, "end": 421, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 419 }, { "analysis_explanation": null, "end": 428, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 426 }, { "analysis_explanation": null, "end": 586, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 584 }, { "analysis_explanation": null, "end": 593, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 591 }, { "analysis_explanation": null, "end": 600, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 598 }, { "analysis_explanation": null, "end": 887, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 885 }, { "analysis_explanation": null, "end": 894, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 892 }, { "analysis_explanation": null, "end": 1158, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 1156 }, { "analysis_explanation": null, "end": 1387, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 1384 }, { "analysis_explanation": null, "end": 1573, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 1570 }, { "analysis_explanation": null, "end": 1581, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 1578 }, { "analysis_explanation": null, "end": 1704, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 1702 }, { "analysis_explanation": null, "end": 1711, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 1709 }, { "analysis_explanation": null, "end": 1719, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 1716 }, { "analysis_explanation": null, "end": 1727, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 1724 }, { "analysis_explanation": null, "end": 6945, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 6943 }, { "analysis_explanation": null, "end": 6953, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 6950 }, { "analysis_explanation": null, "end": 7156, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 7153 }, { "analysis_explanation": null, "end": 7164, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 7161 }, { "analysis_explanation": null, "end": 7172, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 7169 }, { "analysis_explanation": null, "end": 7267, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 7264 }, { "analysis_explanation": null, "end": 7322, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 7319 }, { "analysis_explanation": null, "end": 7656, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 7653 }, { "analysis_explanation": null, "end": 7664, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 7661 }, { "analysis_explanation": null, "end": 7672, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 7669 }, { "analysis_explanation": null, "end": 7701, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 7698 }, { "analysis_explanation": null, "end": 8032, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 8029 }, { "analysis_explanation": null, "end": 8060, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 8057 }, { "analysis_explanation": null, "end": 8961, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 8958 }, { "analysis_explanation": null, "end": 8969, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 8966 }, { "analysis_explanation": null, "end": 9450, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 9448 }, { "analysis_explanation": null, "end": 10192, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 10189 }, { "analysis_explanation": null, "end": 10426, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 10423 }, { "analysis_explanation": null, "end": 10665, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 10662 }, { "analysis_explanation": null, "end": 10704, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 10701 }, { "analysis_explanation": null, "end": 10942, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 10940 }, { "analysis_explanation": null, "end": 11261, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 11258 }, { "analysis_explanation": null, "end": 11415, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 11413 }, { "analysis_explanation": null, "end": 11630, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 11627 }, { "analysis_explanation": null, "end": 11810, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 11807 }, { "analysis_explanation": null, "end": 11818, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 11815 }, { "analysis_explanation": null, "end": 12034, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 12031 }, { "analysis_explanation": null, "end": 12250, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 12247 }, { "analysis_explanation": null, "end": 12403, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 12401 }, { "analysis_explanation": null, "end": 12536, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 12534 }, { "analysis_explanation": null, "end": 12543, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 12541 }, { "analysis_explanation": null, "end": 12551, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 12548 }, { "analysis_explanation": null, "end": 12773, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 12771 }, { "analysis_explanation": null, "end": 12876, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 12873 }, { "analysis_explanation": null, "end": 12936, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 12933 }, { "analysis_explanation": null, "end": 13030, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 13028 }, { "analysis_explanation": null, "end": 13038, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 13035 }, { "analysis_explanation": null, "end": 13046, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 13043 }, { "analysis_explanation": null, "end": 13054, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 13051 }, { "analysis_explanation": null, "end": 13062, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 13059 }, { "analysis_explanation": null, "end": 13229, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 13226 }, { "analysis_explanation": null, "end": 13237, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 13234 }, { "analysis_explanation": null, "end": 13245, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 13242 }, { "analysis_explanation": null, "end": 13370, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 13368 }, { "analysis_explanation": null, "end": 13465, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 13463 }, { "analysis_explanation": null, "end": 13496, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 13493 }, { "analysis_explanation": null, "end": 13833, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 13831 }, { "analysis_explanation": null, "end": 13857, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 13855 }, { "analysis_explanation": null, "end": 14140, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 14138 }, { "analysis_explanation": null, "end": 14279, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 14277 }, { "analysis_explanation": null, "end": 14456, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 14453 }, { "analysis_explanation": null, "end": 14586, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 14584 }, { "analysis_explanation": null, "end": 15347, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 15344 }, { "analysis_explanation": null, "end": 15858, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 15856 }, { "analysis_explanation": null, "end": 15866, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 15863 }, { "analysis_explanation": null, "end": 15874, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 15871 }, { "analysis_explanation": null, "end": 15882, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 15879 }, { "analysis_explanation": null, "end": 15890, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 15887 }, { "analysis_explanation": null, "end": 18877, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 18874 }, { "analysis_explanation": null, "end": 19520, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 19517 }, { "analysis_explanation": null, "end": 20164, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 20162 }, { "analysis_explanation": null, "end": 21005, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 21003 }, { "analysis_explanation": null, "end": 21838, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 21836 }, { "analysis_explanation": null, "end": 22682, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 22680 }, { "analysis_explanation": null, "end": 23307, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 23304 }, { "analysis_explanation": null, "end": 23926, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 23923 }, { "analysis_explanation": null, "end": 24551, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 24548 }, { "analysis_explanation": null, "end": 24965, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 24962 }, { "analysis_explanation": null, "end": 6483, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.2, "start": 6476 }, { "analysis_explanation": null, "end": 17445, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 17438 }, { "analysis_explanation": null, "end": 17732, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 17725 }, { "analysis_explanation": null, "end": 17859, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 17852 } ]
[ ":103E000001C0B7C0112484B790E89093610010926C\r\n:103E10006100882361F0982F9A70923041F081FF01\r\n:103E200002C097EF94BF282E80E0C6D0E9C085E09D\r\n:103E30008093810082E08093C00088E18093C1007C\r\n:103E400081E08093C40086E08093C2008EE0B4D00D\r\n:103E5000259A84E020E93FEF91E03093850020939C\r\n:103E6000840096BBB09BFECF1D9AA8954091C000E0\r\n:103E700047FD02C0815089F793D0813479F490D006\r\n:103E8000182FA0D0123811F480E004C088E0113857\r\n:103E900009F083E07ED080E17CD0EECF823419F44B\r\n:103EA00084E198D0F8CF853411F485E0FACF8535D8\r\n:103EB00041F476D0C82F74D0D82FCC0FDD1F82D01C\r\n:103EC000EACF863519F484E085D0DECF843691F5CB\r\n:103ED00067D066D0F82E64D0D82E00E011E05801EB\r\n:103EE0008FEFA81AB80A5CD0F80180838501FA1018\r\n:103EF000F6CF68D0F5E4DF1201C0FFCF50E040E01C\r\n:103F000063E0CE0136D08E01E0E0F1E06F0182E0A7\r\n:103F1000C80ED11C4081518161E0C8012AD00E5FDA\r\n:103F20001F4FF601FC10F2CF50E040E065E0CE01FB\r\n:103F300020D0B1CF843771F433D032D0F82E30D0C6\r\n:103F400041D08E01F80185918F0123D0FA94F110B0\r\n:103F5000F9CFA1CF853739F435D08EE11AD084E975\r\n:103F600018D085E197CF813509F0A9CF88E024D01A\r\n:103F7000A6CFFC010A0167BFE895112407B600FC33\r\n:103F8000FDCF667029F0452B19F481E187BFE895D4\r\n:103F900008959091C00095FFFCCF8093C6000895CE\r\n:103FA0008091C00087FFFCCF8091C00084FD01C0DC\r\n:103FB000A8958091C6000895E0E6F0E098E190832E\r\n:103FC00080830895EDDF803219F088E0F5DFFFCFC0\r\n:103FD00084E1DFCFCF93C82FE3DFC150E9F7CF9162\r\n:023FE000F1CF1F\r\n:023FFE000008B9\r\n:0400000300003E00BB\r\n:00000001FF\r\n" ]
{ "pile_set_name": "Github" }
[ 0.0007052186177715092 ]
0.000705
5
[ { "analysis_explanation": null, "end": 1033, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 991 }, { "analysis_explanation": null, "end": 1416, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 1406 } ]
[ "Hydroxymethylbilane\n\nHydroxymethylbilane, also known as preuroporphyrinogen, is an organic compound that occurs in living organisms during the synthesis of porphyrins, a group of critical substances that include hemoglobin, myoglobin, and chorophyll. ", "The name is often abbreviated as HMB.", "\n\nThe compound is a substituted bilane, a chain of four pyrrole rings interconnected by methylene bridges . ", " The chain starts with a hydroxymethyl group and ends with an hydrogen, in place of the respective methylene bridges. ", "The other two carbon atoms of each pyrrole cycle are connected to an acetic acid group and a propionic acid group , in that order. ", "\n\nThe compound is generated from four molecules of porphobilinogen by the enzyme porphobilinogen deaminase:\n\nThe enzyme uroporphyrinogen III synthase closes the chain to form a porphyrinogen a class of compounds with the hexahydroporphine macrocycle; specifically, uroporphyrinogen III. ", " In the absence of the enzyme, the compound undergoes spontaneous cyclization and becomes uroporphyrinogen I.\n\nReferences\n\nCategory:Tetrapyrroles" ]
{ "pile_set_name": "Wikipedia (en)" }
[ 0.00796812749003984, 0.02702702702702703, 0, 0, 0, 0.003484320557491289, 0.006896551724137931 ]
0.006482
5
[ { "analysis_explanation": null, "end": 287, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 284 }, { "analysis_explanation": null, "end": 882, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 865 } ]
[ "Periprosthetic femoral fractures--evaluation of risk factors.", "\nEndoprosthetic hip arthroplasty is a surgical intervention that significantly improves the quality of the patient's life, with excellent long term results, but with an increased risk of major complications. ", "One such complication is the periprosthetic femoral fracture, which may occur in both young and old patients due to several risk factors typical to the elderly (osteoporosis, fall risk), cementless press-fit implants, implant loosening, and revision arthroplasty. ", "This study tries to evaluate the risk factors for periprosthetic femoral fractures treated at the Orthopedics and Trauma Department of the Iaşi Rehabilitation Hospital. ", "Retrospective evaluations were conducted on 3454 patients with primary hip arthroplasty and 167 patients with revision hip arthroplasty, the surgical procedures being performed between January 1994 and March 2012. ", "The study was conducted on 47 patients (17 males and 30 females, mean age 68 years) with periprosthetic fracture. ", "The incidence of periprosthetic femoral fractures in primary arthroplasty group was 0.89% (0.63% intraoperative and 0.26% postoperative), with a considerably higher incidence for cementless implants (81.39%), and 9.58% in revision arthroplasty group (8.38% intraoperative and 1.19% postoperative). ", "Vancouver type B was the most frequent, both in operative and postoperative revision arthroplasty and in postoperative primary arthroplasty. ", "88% of the fractures were surgically treated, with a satisfactory postoperative course both in early and long-term follow-up. ", "Periprosthetic femoral fractures result in increased morbidity and mortality rate, are difficult to treat, and require complex therapeutic strategies depending on risk factors, fracture type, bone stock, and implant stability." ]
{ "pile_set_name": "PubMed Abstracts" }
[ 0, 0, 0, 0.011834319526627219, 0, 0, 0, 0, 0, 0 ]
0.001183
5
[ { "analysis_explanation": null, "end": 14, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 0 }, { "analysis_explanation": null, "end": 76, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 62 }, { "analysis_explanation": null, "end": 899, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 879 }, { "analysis_explanation": null, "end": 914, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 904 }, { "analysis_explanation": null, "end": 998, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 986 }, { "analysis_explanation": null, "end": 1337, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1328 } ]
[ "AURA SALON & ACADEMY ( EXCLUSIVE FOR LADIES)\n\nAdditional Details\n\n•Individual Employer•Wellness / Fitness / Sports / Beauty\n\n•Ahmedabad\n\nAboutAura Salon & Academy ( Exclusive For Ladies)\n\nA leading beauty salon & academy exclusive for ladies in Ahmedabad ,managed by an internationally trained beautician. ", "In operation since 1997. ", "Having two branches in Ahmedabad. ", "Present requirement of Assistant Beauticians - FEMALES is for the new branch located in posh locality of Ahmedabad- South Bopal\n\nRecent Jobs at AURA SALON & ACADEMY ( EXCLUSIVE FOR LADIES)\n\nSorry, no vacancies in AURA SALON & ACADEMY ( EXCLUSIVE FOR LADIES) at this moment" ]
{ "pile_set_name": "Pile-CC" }
[ 0.006535947712418301, 0, 0, 0.003676470588235294 ]
0.002553
5
[ { "analysis_explanation": null, "end": 254, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 245 }, { "analysis_explanation": null, "end": 329, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 325 }, { "analysis_explanation": null, "end": 363, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 354 }, { "analysis_explanation": null, "end": 505, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 470 } ]
[ "Change in distribution of cytoskeleton-associated proteins, lasp-1 and palladin, during uterine receptivity in the rat endometrium.", "\nThe epithelium of the uterine lumen is the first point of contact with the blastocyst before implantation. ", "To facilitate pregnancy, these uterine epithelial cells (UECs) undergo morphological changes specific to the receptive uterus. ", "These changes include basal, lateral and apical alterations in the plasma membrane of UECs. ", "This study looked at the cytoskeletal and focal adhesion-associated proteins, lasp-1 and palladin, in the uterus during early pregnancy in the rat. ", "Two palladin isoforms, 140 kDa and 90 kDa, were analysed, with the migration-associated 140-kDa isoform increasing significantly at the time of implantation when compared with the time of fertilisation. ", "Lasp-1 was similarly increased at this time, whilst also being located predominantly apically and laterally in the UECs, suggesting a role in the initial contact between the UECs and the blastocyst. ", "This is the first study to investigate palladin and lasp-1 in the uterine luminal epithelium and suggests an importance for these cytoskeletal proteins in the morphological changes the UECs undergo for pregnancy to occur." ]
{ "pile_set_name": "PubMed Abstracts" }
[ 0, 0, 0, 0, 0, 0.0049261083743842365, 0, 0 ]
0.000616
5
[]
[ "Abstract : This volume is the first of a series on standards of performance for primary aluminum plants. ", "This volume presents the proposed standards and the rationale for the degree of control selected. ", "The volume also discusses the analytical methods for sampling emissions and the environmental and economic impact of the standards." ]
{ "pile_set_name": "Pile-CC" }
[ 0, 0, 0 ]
0
5
[]
[ "The long-awaited Ducktales Volume 4 will soon be released on DVD! ", "It will be the final 25 episodes of the series. ", "There were a total of 100 episodes, and the previous three volumes contained the first 75 episodes. ", "For those of you who are fans of the original Ducktales, this is gold! ", "I for one can’t wait to get this box set from one of the greatest cartoons ever created. ", "There is no release date set in stone yet, but from the internet grumblings, it sounds like by the end of this month (September 2018). ", "We will update this page when we have more information.", "\n\nLink with Volume 4 listed: https://disneymovierewards.go.com/earn-points/blu-ray-dvd?letter=d\n\nDucktales Volume 4 should contain the following episodes:\n\n“The Land of Trala La”\n\n“Allowance Day”\n\n“Bubbeo & Juliet”\n\n“The Good Muddahs”\n\n“My Mother the Psychic”\n\n“Metal Attraction”\n\n“Dough Ray Me”\n\n“Bubba’s Big Brainstorm”\n\n“The Big Flub”\n\n“A Case of Mistaken Secret Identity”\n\n“Blue Collar Scrooge”\n\n“Beaglemania”\n\n“Yuppy Ducks”\n\n“The Bride Wore Stripes”\n\n“The Unbreakable Bin”\n\n“Attack of the Fifty-Foot Webby”\n\n“The Masked Mallard”\n\n“A Duck Tales Valentine (Amour or Less)”\n\n“Ducky Mountain High”\n\n“Attack of the Metal Mites”\n\n“The Duck Who Knew Too Much”\n\n“New Gizmo-Kids on the Block”\n\n“Scrooge’s Last Adventure”\n\n“The Golden Goose” (Episodes 1&2)" ]
{ "pile_set_name": "OpenWebText2" }
[ 0.015151515151515152, 0, 0, 0.014084507042253521, 0, 0, 0, 0.002663115845539281 ]
0.003987
5
[ { "analysis_explanation": null, "end": 658, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.95, "start": 592 }, { "analysis_explanation": null, "end": 490, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 469 }, { "analysis_explanation": null, "end": 506, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 492 }, { "analysis_explanation": null, "end": 1121, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1112 } ]
[ "Q:\n\nxml attributes not being detected\n\nI'm having some trouble with my c# application. ", "It's only able to get the attributes of the first node and then it can't get the following node's attributes.", "\nThe XML is in this format..\n<ALLPRODUCTS>\n <PRODUCT ITEM=\"1\">\n <QUANTITY>5</QUANTITY>\n </PRODUCT>\n <PRODUCT ITEM=\"2\">\n <QUANTITY>6</QUANTITY>\n </PRODUCT>....\n\nThe application gets the first product number as 1 and it has a quantity of 5... but after that it just gives the quantities and says the item number is null. ", "Here is the code im using...\n while (reader.", "Read())\n {\n if (reader.", "Name.", "Equals(\"PRODUCT\"))\n {\n String id;\n String qty; \n\n try\n {\n\n id = reader.", "GetAttribute(\"ITEM\");\n reader.", "ReadToFollowing(\"QUANTITY\");\n qty = reader.", "ReadInnerXml();\n\n if (qty.", "Equals(\"0\"))\n {\n oos++;\n }\n else\n {\n inStock++;\n }\n\n status.", "Refresh();\n stockLevelList.", "Add(id, qty);\n\n }\n catch (Exception e)\n {\n MessageBox.", "Show(e.", "Message, e.Source, MessageBoxButtons.", "OK, MessageBoxIcon.", "Error);\n }\n\n }\n\nCan anyone suggest why the products after the first one are getting null as id? ", "\n\nA:\n\nYou are not checking if the reader is at the beginning of the element. ", "Your code is blowing up because it is trying to process based on the end element of PRODUCT.", "\nAdd this check just after the if statement where it is checking for \"PRODUCT\".", "\nif (reader.", "Name.", "Equals(\"PRODUCT\"))\n{\n if (!", "reader.", "IsStartElement())\n continue;\n\n // Your normal processing code here.", "\n}\n\nThis is what makes using the XmlReader somewhat of a pain. ", "It traverses every single element which means you need to pay attention to where it could be. ", "The first time through, it is at the Start Element. ", "You process and everything is good, but then it reaches the </PRODUCT> element which is still named \"PRODUCT\" and that's where it falls apart. ", "\nBelow is the order based on your code of moving the reader forward.", "\n\nreader.", "Read() moves to the first element: ALLPRODUCTS\nNot what you were looking for so reader.", "Read() again and it finds node type Whitespace because there is no inner text.", "\nreader.", "Read() moved to PRODUCT\nYou get an attribute and then tell it to read to QUANTITY. (", "Note you cannot go back. ", "Order matters)\nreader.", "Read() moves to the next element PRODUCT. ", "This is not <PRODUCT>. ", "It is </PRODUCT>.", "\nYour code now begins most of the above process again, but fails because it was not on <PRODUCT>\n\nEDIT: Also becareful with XmlReader. ", "The XML doesn't necessarily have to be valid in order for XmlReader to work up to a certain point. ", "It will only throw an error once it reaches an issue and you may have already processed several hundred nodes at that point.", "\n\n" ]
{ "pile_set_name": "StackExchange" }
[ 0, 0, 0, 0, 0, 0, 0, 0, 0.016129032258064516, 0, 0.004545454545454545, 0, 0, 0.14285714285714285, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.011904761904761904, 0, 0, 0, 0, 0, 0.007407407407407408, 0.010101010101010102, 0, 0 ]
0.004385
5
[ { "analysis_explanation": null, "end": 922, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 910 }, { "analysis_explanation": null, "end": 1954, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1945 }, { "analysis_explanation": null, "end": 1364, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 1360 } ]
[ "smallest value? ", " (a) -0.2 (b) -4 (c) 0.4 (d) -25\nd\nWhat is the fourth biggest value in 2, -2/3, 1/10, 0.5?", "\n-2/3\nWhich is the third biggest value? ", " (a) 2/7 (b) -5 (c) -1 (d) 93\nc\nWhich is the third smallest value? ", " (a) -1 (b) 6 (c) -0.5 (d) 1/30\nd\nWhat is the second biggest value in -2, 0, -1/2, 5, -2/19?", "\n0\nWhat is the second biggest value in -26, 3, -2/3, 2, -0.5?", "\n2\nWhich is the third smallest value? ", " (a) -2 (b) -1 (c) 0.2 (d) -2/7\nd\nWhat is the biggest value in 2, 3, 5/4?", "\n3\nWhich is the second biggest value? ", " (a) 3 (b) -233 (c) 7\na\nWhich is the fifth biggest value? ", " (a) -0.8 (b) 2 (c) 2/9 (d) -0.1 (e) 28\na\nWhat is the third smallest value in 0.12, 2/3, 11?", "\n11\nWhat is the fourth biggest value in 0.2, -3/14, 0, -5, -2/9?", "\n-2/9\nWhich is the fourth biggest value? ", " (a) -1/5 (b) 0.9 (c) -0.1 (d) -1/3 (e) -6/49\na\nWhat is the second biggest value in -2, 7, -60?", "\n-2\nWhich is the fourth smallest value? ", " (a) -0.2 (b) 8 (c) 2 (d) 2/15\nb\nWhich is the smallest value? ", " (a) 0.1 (b) 0.211 (c) 2 (d) 2/7\na\nWhich is the smallest value? ", " (a) -0.02 (b) 0 (c) 34\na\nWhich is the second smallest value? ", " (a) -4 (b) -5 (c) -72\nb\nWhich is the fourth biggest value? ", " (a) -1/3 (b) -53 (c) 5 (d) -0.1\nb\nWhat is the fifth smallest value in 2, 2/7, 17/5, -3/5, 0.8?", "\n17/5\nWhat is the smallest value in -3/5, -5, -13, -0.02?", "\n-13\nWhich is the third biggest value? ", " (a) -11 (b) 1.2 (c) 1/3\na\nWhich is the smallest value? ", " (a) -4 (b) -1/10 (c) -0.07\na\nWhat is the fifth biggest value in -0.4, -3, 94, -1, -0.6?", "\n-3\nWhat is the second biggest value in -5, 3, 4, -0.2, 13?", "\n4\nWhat is the fourth smallest value in -0.5, -8, -7, 2/7?", "\n2/7\nWhich is the third smallest value? ", " (a) 2/7 (b) 2/3 (c) 170 (d) 0.12 (e) -0.5\na\nWhich is the biggest value? ", " (a) 1 (b) 1/2 (c) 0.014 (d) -1\na\nWhich is the third smallest value? ", " (a) -82 (b) -0.5 (c) 0.07 (d) -2\nb\nWhat is the third smallest value in -2/3, -3.15, -4, 4?", "\n-2/3\nWhich is the biggest value? ", " (a) 2/25 (b) 1055 (c) -1\nb\nWhat is the third smallest value in 5, 15, 0, 0.1?", "\n5\nWhat is the third biggest value in -4, 2/7, 1/5, 3/7?", "\n1/5\nWhat is the second smallest value in -4, 2, 0.1, -21/37?", "\n-21/37\nWhat is the biggest value in 4, -8, 0.2, -33, -0.2?", "\n4\nWhich is the third smallest value? ", " (a) 2 (b) 4 (c) 0 (d) -3 (e) 5/8\ne\nWhat is the biggest value in -3, 3, -3348, -2/13, -0.5?", "\n3\nWhat is the third biggest value in 4, -221, 0.1?", "\n-221\nWhat is the third biggest value in -4, -0.17, 6, 2?", "\n-0.17\nWhich is the biggest value? ", " (a) -1 (b) -5 (c) -0.3\nc\nWhat is the third biggest value in -16, 0.1, 2.5?", "\n-16\nWhat is the second smallest value in -2, -52/5, 0, 2?", "\n-2\nWhat is the fourth biggest value in -0.4, 1/3, -1/3, 8/11, 4?", "\n-1/3\nWhich is the second biggest value? ", " (a) -1/158 (b) 2 (c) -2/15\na\nWhat is the biggest value in -147, -0.1, 3/7, 1/5?", "\n3/7\nWhich is the fifth smallest value? ", " (a) -2 (b) -1/4 (c) 1/3 (d) -4 (e) -17\nc\nWhat is the third biggest value in 4, 0.028, -2/17, -2/13?", "\n-2/17\nWhich is the smallest value? ", " (a) -0.1 (b) -0.2 (c) -0.4 (d) 3/7\nc\nWhich is the second biggest value? ", " (a) -127 (b) 12 (c) 5\nc\nWhich is the smallest value? ", " (a) 7 (b) 12 (c) 0\nc\nWhich is the smallest value? ", " (a) -22 (b) 0.1 (c) 8\na\nWhat is the third biggest value in 4, -4, 0.5, -1/202?", "\n-1/202\nWhich is the smallest value? ", " (a) -0.096 (b) -0.5 (c) -6 (d) 0.1\nc\nWhat is the fifth biggest value in -2/13, 1/21, 0.2, -1/3, -0.1?", "\n-1/3\nWhich is the second biggest value? ", " (a) 18 (b) -0.2 (c) -0.5 (d) 5\nd\nWhich is the second smallest value? ", " (a) -69/5 (b) -0.2 (c) 4/7 (d) -0.3\nd\nWhat is the second smallest value in -228, -0.4, -9?", "\n-9\nWhich is the fourth smallest value? ", " (a) 0.2 (b) -27 (c) 1 (d) 5\nd\nWhich is the third biggest value? ", " (a) -0.3 (b) -197/2 (c) -3\nb\nWhich is the smallest value? ", " (a) 3 (b) -3 (c) -20 (d) 5\nc\nWhich is the second biggest value? ", " (a) -24 (b) 2 (c) -16/5\nc\nWhat is the third smallest value in 1/5, 10, 18?", "\n18\nWhat is the fifth biggest value in 84, 0.3, -1/3, 4, -1/11?", "\n-1/3\nWhich is the smallest value? ", " (a) -1 (b) -9/7 (c) -2 (d) -0.5\nc\nWhich is the smallest value? ", " (a) 0.4 (b) 3 (c) 7\na\nWhich is the fourth biggest value? ", " (a) 0 (b) -2 (c) -7 (d) -3\nc\nWhat is the third smallest value in -4, 2/665, -1/4, -4/5?", "\n-1/4\nWhich is the fifth biggest value? ", " (a) -0.047 (b) 2 (c) 1/7 (d) -3 (e) -1/4\nd\nWhich is the third smallest value? ", " (a) -16 (b) 5 (c) 7/8\nb\nWhich is the biggest value? ", " (a) -8 (b) -3/2 (c) 2/3 (d) 0 (e) -4/3\nc\nWhat is the third biggest value in 0.4, -48, -2?", "\n-48\nWhich is the third biggest value? ", " (a) -0.1 (b) -1 (c) -1/21 (d) 2\na\nWhat is the third biggest value in 1/4, 33, -2/21, -2?", "\n-2/21\nWhat is the smallest value in 424, -1, -4?", "\n-4\nWhat is the smallest value in -4, 3, -2, -24.7?", "\n-24.7\nWhich is the smallest value? ", " (a) 1/4 (b) -5 (c) -0.03 (d) 16 (e) -0.2\nb\nWhich is the biggest value? ", " (a) 1/14 (b) 7 (c) 0\nb\nWhich is the third smallest value? ", " (a) 0.02 (b) 2/7 (c) -0.38\nb\nWhat is the third biggest value in 0, -5, 8, 5?", "\n0\nWhich is the smallest value? ", " (a) -383 (b) 2/19 (c) -3\na\nWhich is the third smallest value? ", " (a) -2/11 (b) -21/2 (c) 0.4\nc\nWhich is the fourth smallest value? ", " (a) 5 (b) 2/11 (c) 177 (d) 1/7 (e) 0.3\na\nWhat is the third biggest value in 0.2, 0.3, -106?", "\n-106\nWhich is the third smallest value? ", " (a) 15 (b) -1/5 (c) 0.5 (d) -4\nc\nWhat is the second biggest value in -2, 0.1, -12, 27?", "\n0.1\nWhich is the biggest value? ", " (a) 1.8 (b) 0.5 (c) 4 (d) -3 (e) 3\nc\nWhat is the third biggest value in 3, 0.06, 1?", "\n0.06\nWhich is the second biggest value? ", " (a) 0.5 (b) 1/237 (c) 1 (d) 0.2\na\nWhat is the biggest value in 5, -70, 1?", "\n5\nWhat is the third smallest value in -5, -100/3, 3/5?", "\n3/5\nWhat is the biggest value in -5995, -1, 2/25?", "\n2/25\nWhat is the third smallest value in -177, 4, -0.1?", "\n4\nWhich is the smallest value? ", " (a) 4 (b) -0.3 (c) -0.055 (d) -1 (e) -0.1\nd\nWhat is the second smallest value in 15, 0.04, -0.04?", "\n0.04\nWhat is the second smallest value in -2/15, -4/3, 0.05?", "\n-2/15\nWhich is the biggest value? ", " (a) 1/7 (b) -4/7 (c) 2/9 (d) -3\nc\nWhich is the fourth biggest value? ", " (a) -2/17 (b) 15 (c) 20 (d) -3/4\nd\nWhat is the third smallest value in 5, 0.5, -1/28?", "\n5\nWhich is the third smallest value? ", " (a) 4 (b) 3 (c) 20\nc\nWhat is the second smallest value in -3/5, -571, 0.2?", "\n-3/5\nWhat is the fourth smallest value in 3, 1/2, 0.2, -0.7?", "\n3\nWhich is the biggest value? ", " (a) 2 (b) -0.1 (c) 137/29 (d) -3/7\nc\nWhat is the fourth biggest value in -1, -2/3, -127, 0, -8?", "\n-8\nWhat is the biggest value in 1/76, 5, -0.2, -0.5?", "\n5\nWhich is the third biggest value? ", " (a) -1 (b) 2/3 (c) 8/13 (d) 34\nc\nWhich is the biggest value? ", " (a) 3/8 (b) 4 (c) 2/5 (d) 1 (e) 0.1\nb\nWhat is the third smallest value in -1/10, 0.5, 3.57, 3?", "\n3\nWhat is the fourth smallest value in -11, -0.5, 6, 0.9, 0.2?", "\n0.9\nWhich is the second smallest value? ", " (a) 21 (b) 0.1 (c) 0.2 (d) 4 (e) 24\nc\nWhat is the fourth smallest value in -21, -1/3, 0, -0.3?", "\n0\nWhich is the third biggest value? ", " (a) -5 (b) 1/13 (c) 101\na\nWhat is the fourth smallest value in -29, -0.3, -3/4, -11?", "\n-0.3\nWhat is the third smallest value in 2/5, -0.3, 12, 60?", "\n12\nWhat is the fifth smallest value in -2, 27/4, 4/5, 3, 4/9?", "\n27/4\nWhat is the biggest value in 0.2, -0.5, 2, 0.3, -1?", "\n2\nWhat is the third biggest value in -3, 2/5, -1, -26?", "\n-3\nWhat is the third smallest value in 3/7, 0.4, -1/11?", "\n3/7\nWhich is the third biggest value? ", " (a) 0 (b) 0.2 (c) -0.1 (d) 256\na\nWhat is the third smallest value in 4, 0, -2.6?", "\n4\nWhat is the third smallest value in 5, 0.2, -749?", "\n5\nWhich is the third biggest value? ", " (a) 2/5 (b) 2/11 (c) -2/353\nc\nWhich is the biggest value? ", " (a) 2 (b) 0 (c) -1043 (d) -0.5\na\nWhich is the third smallest value? ", " (a) -13 (b) -4 (c) -3\nc\nWhich is the biggest value? ", " (a) 0 (b) -9 (c) -1/5 (d) -2/19\na\nWhich is the third smallest value? ", " (a) -4 (b) -2/3 (c) 954\nc\nWhat is the third smallest value in -2/9, 3/7, -1/7, -21, 0.2?", "\n-1/7\nWhich is the biggest value? ", " (a) -4/33 (b) 2 (c) 1 (d) -1\nb\nWhat is the biggest value in -2, 4, -17/10, 5?", "\n5\nWhat is the smallest value in -3, -45, 1/3, -1/20?", "\n-45\nWhat is the second smallest value in 0.1, 176, -0.1, 3, -3/7?", "\n-0.1\nWhich is the fifth smallest val" ]
{ "pile_set_name": "DM Mathematics" }
[ 0, 0, 0, 0.014285714285714285, 0.010526315789473684, 0, 0, 0.013157894736842105, 0, 0, 0, 0.015625, 0, 0.010101010101010102, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.022222222222222223, 0, 0, 0, 0, 0.013888888888888888, 0, 0, 0.0125, 0, 0.01639344262295082, 0.03389830508474576, 0, 0, 0, 0, 0, 0.012987012987012988, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.010638297872340425, 0, 0.014705882352941176, 0, 0, 0, 0.015873015873015872, 0, 0.014925373134328358, 0, 0, 0, 0, 0, 0, 0, 0.010869565217391304, 0.02040816326530612, 0.0196078431372549, 0, 0, 0, 0.012658227848101266, 0, 0, 0, 0, 0, 0.011111111111111112, 0, 0, 0, 0.012987012987012988, 0, 0.04, 0, 0, 0.0196078431372549, 0.01639344262295082, 0, 0, 0.011235955056179775, 0, 0, 0, 0, 0.020202020202020204, 0, 0, 0.015384615384615385, 0, 0.015873015873015872, 0, 0.010101010101010102, 0, 0.022988505747126436, 0, 0, 0.017543859649122806, 0.03636363636363636, 0.017857142857142856, 0, 0, 0, 0, 0, 0, 0, 0, 0.01098901098901099, 0, 0.024691358024691357, 0.018867924528301886, 0, 0 ]
0.004714
5
[ { "analysis_explanation": null, "end": 356, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 355 }, { "analysis_explanation": null, "end": 740, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 736 }, { "analysis_explanation": null, "end": 874, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 873 }, { "analysis_explanation": null, "end": 1311, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1307 }, { "analysis_explanation": null, "end": 1502, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1500 }, { "analysis_explanation": null, "end": 1556, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1553 }, { "analysis_explanation": null, "end": 1558, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1557 }, { "analysis_explanation": null, "end": 1561, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1560 }, { "analysis_explanation": null, "end": 2014, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2012 }, { "analysis_explanation": null, "end": 2187, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2184 }, { "analysis_explanation": null, "end": 2435, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2434 }, { "analysis_explanation": null, "end": 2669, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2665 }, { "analysis_explanation": null, "end": 3301, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3299 }, { "analysis_explanation": null, "end": 3364, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3361 }, { "analysis_explanation": null, "end": 3888, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3886 }, { "analysis_explanation": null, "end": 4593, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4591 }, { "analysis_explanation": null, "end": 4950, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4949 }, { "analysis_explanation": null, "end": 6738, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6737 }, { "analysis_explanation": null, "end": 7066, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7064 }, { "analysis_explanation": null, "end": 7468, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7465 }, { "analysis_explanation": null, "end": 7837, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7833 }, { "analysis_explanation": null, "end": 102, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 98 }, { "analysis_explanation": null, "end": 250, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 246 }, { "analysis_explanation": null, "end": 310, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 306 }, { "analysis_explanation": null, "end": 727, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 723 }, { "analysis_explanation": null, "end": 830, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 826 }, { "analysis_explanation": null, "end": 952, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 948 }, { "analysis_explanation": null, "end": 1441, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 1437 }, { "analysis_explanation": null, "end": 1952, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 1948 }, { "analysis_explanation": null, "end": 2324, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 2320 }, { "analysis_explanation": null, "end": 2742, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 2738 }, { "analysis_explanation": null, "end": 2930, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 2926 }, { "analysis_explanation": null, "end": 2937, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 2933 }, { "analysis_explanation": null, "end": 2944, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 2940 }, { "analysis_explanation": null, "end": 3353, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 3349 }, { "analysis_explanation": null, "end": 3359, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 3355 }, { "analysis_explanation": null, "end": 3955, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 3951 }, { "analysis_explanation": null, "end": 4541, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 4537 }, { "analysis_explanation": null, "end": 4600, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 4596 }, { "analysis_explanation": null, "end": 4611, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 4607 }, { "analysis_explanation": null, "end": 4824, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 4820 }, { "analysis_explanation": null, "end": 5004, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 5000 }, { "analysis_explanation": null, "end": 5059, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 5055 }, { "analysis_explanation": null, "end": 5133, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 5129 }, { "analysis_explanation": null, "end": 5684, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 5680 }, { "analysis_explanation": null, "end": 5690, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 5686 }, { "analysis_explanation": null, "end": 5922, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 5918 }, { "analysis_explanation": null, "end": 5941, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 5937 }, { "analysis_explanation": null, "end": 6051, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 6047 }, { "analysis_explanation": null, "end": 6129, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 6125 }, { "analysis_explanation": null, "end": 6471, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 6467 }, { "analysis_explanation": null, "end": 6549, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 6545 }, { "analysis_explanation": null, "end": 6671, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 6667 }, { "analysis_explanation": null, "end": 6941, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 6937 }, { "analysis_explanation": null, "end": 7300, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 7296 }, { "analysis_explanation": null, "end": 7529, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 7525 }, { "analysis_explanation": null, "end": 7731, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 7727 }, { "analysis_explanation": null, "end": 7902, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 7898 }, { "analysis_explanation": null, "end": 8025, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 8021 } ]
[ "Effective tactile noise facilitates visual perception.", "\nThe fulcrum principle establishes that a subthreshold excitatory signal (entering in one sense) that is synchronous with a facilitation signal (entering in a different sense) can be increased (up to a resonant-like level) and then decreased by the energy and frequency content of the facilitating signal. ", "As a result, the sensation of the signal changes according to the excitatory signal strength. ", "In this context, the sensitivity transitions represent the change from subthreshold activity to a firing activity in multisensory neurons. ", "Initially the energy of their activity (supplied by the weak signals) is not enough to be detected but when the facilitating signal enters the brain, it generates a general activation among multisensory neurons, modifying their original activity. ", "In our opinion, the result is an integrated activation that promotes sensitivity transitions and the signals are then perceived. ", "In other words, the activity created by the interaction of the excitatory signal (e.g., visual) and the facilitating signal (tactile noise) at some specific energy, produces the capability for a central detection of an otherwise weak signal. ", "In this work we investigate the effect of an effective tactile noise on visual perception. ", "Specifically we show that tactile noise is capable of decreasing luminance modulated thresholds." ]
{ "pile_set_name": "PubMed Abstracts" }
[ 0, 0, 0, 0, 0, 0, 0, 0, 0 ]
0
5
[]
[ "console.writeline(\"Unit test for joypad.set using the controller parameter\")\r\nconsole.writeline(\"Core Required: NES (or any multi-player core with U,D,L,R,select,start,A,B as buttons)\")\r\nconsole.writeline(\"Correct behavior:\")\r\nconsole.writeline(\"No Directional button shoudl be imparied in any way, should operate as if nothing was ever pressed\")\r\nconsole.writeline(\"A should be off and user can not push buttons to change that\")\r\nconsole.writeline(\"B should be on and the user can not push buttons to change that\")\r\nconsole.writeline(\"Select should be on, but pressing it turns it off\")\r\nconsole.writeline(\"Start should be unaffected\")\r\nconsole.writeline(\"After frame 600, the console will say 'cleared', and now all buttons should be off and unaffected, as if the script was never run\");\r\n\r\nbuttons = { };\r\n\r\nbuttons[\"Up\"] = false;\r\nbuttons[\"Down\"] = true;\r\nbuttons[\"Left\"] = \"invert\";\r\nbuttons[\"Right\"] = null;\r\njoypad.set(buttons, 1);\r\n\r\npushThings = true;\t\r\n\r\nwhile true do\r\n\tif (pushThings) then\r\n\t\tbuttons = { };\r\n\t\tbuttons[\"A\"] = false;\r\n\t\tbuttons[\"B\"] = true;\r\n\t\tbuttons[\"Select\"] = \"invert\";\r\n\t\tbuttons[\"Start\"] = null;\r\n\t\tjoypad.set(buttons, 1);\r\n\tend\r\n\t\r\n\tif (emu.framecount() == 600) then\r\n\t\tpushThings = false;\r\n\t\tturnoff = { };\r\n\t\tturnoff[\"A\"] = null;\r\n\t\tturnoff[\"B\"] = null;\r\n\t\tturnoff[\"Select\"] = null;\r\n\t\tturnoff[\"Start\"] = null;\r\n\t\t\r\n\t\tjoypad.set(turnoff, 1);\r\n\t\tconsole.writeline(\"cleared\")\r\n\tend\r\n\t\r\n\temu.frameadvance();\r\nend" ]
{ "pile_set_name": "Github" }
[ 0.0027662517289073307 ]
0.002766
5
[ { "analysis_explanation": null, "end": 23, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 0 }, { "analysis_explanation": null, "end": 848, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 835 }, { "analysis_explanation": null, "end": 42, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 33 }, { "analysis_explanation": null, "end": 924, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 915 }, { "analysis_explanation": null, "end": 1142, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 1133 }, { "analysis_explanation": null, "end": 1178, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 1172 }, { "analysis_explanation": null, "end": 1364, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 1355 }, { "analysis_explanation": null, "end": 1428, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 1422 } ]
[ "Do You Have HIPSTER Disease?", "\n\nFinally, a medication that denizens all over Brooklyn, San Francisco and Portland have been waiting for! ", "Or at least, we hope they've been waiting for it.", "\n\nAllow us to introduce you to Unpretentiousil — a \"doctor recommended\" medicine said to cure that pesky HIPSTER disease that appears to be spreading like wildfire throughout our culture. ", "Standing for \"Hyper Involuntary Panic Stress Tension Elevation Response Disorder,\" HIPSTER targets both men and women from that ages of 16-35, leaving those infected often seen as scarf-wearing, fair trade-purchasing, blogging parasites.", "\n\nBefore you laugh too hard, be warned: over-policing other people's HIPSTER status could be a sign that you've already become infected." ]
{ "pile_set_name": "Pile-CC" }
[ 0, 0, 0, 0, 0, 0 ]
0
5
[ { "analysis_explanation": null, "end": 82, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 74 }, { "analysis_explanation": null, "end": 97, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 84 }, { "analysis_explanation": null, "end": 110, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 102 }, { "analysis_explanation": null, "end": 228, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 213 }, { "analysis_explanation": null, "end": 294, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 287 }, { "analysis_explanation": null, "end": 460, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 453 }, { "analysis_explanation": null, "end": 682, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 675 } ]
[ "On the Sunday after the week of Fifa’s very public disrobing in Zurich, Qatar arrived in Crewe for this friendly with Northern Ireland.", "\n\nGiven the controversial awarding of the 2022 World Cup by the Sepp Blatter-led world governing body to the emirate and its terrible record of abusing migrant employees building the tournament’s infrastructure, the timing of this match was apposite. ", "It would offer a chance to hear the response of Qatar, which is led by Abdulaziz Hatem, and their just-appointed coach, José Daniel Carreno, to these issues and an opportunity to become familiar with its players.", "\n\nYet by the time the sides wandered out in front of the Alexandra Stadium’s Ice Cream Van Stand just before 5pm, the silence from Qatar during the build-up had become deafening. ", "Unlike Michael O’Neill’s Northern Ireland, who had two pre-game press days, there had been no media access offered by the state, and close to zero communication from the Qatar Football Association when trying to establish if there might be any.", "\n\nThis was Carreno’s debut match in charge, the Uruguayan replacing Djamel Belmadi after Qatar’s disappointing performance at the recent Asian Cup in Australia. ", "The nation has never played at the World Cup. ", "Their latest quest begins on 11 June in a group including China, Hong Kong, Bhutan and Maldives. ", "Preparations for this also include meeting Scotland on Friday at Easter Road.", "\n\nQatar have drawn criticism for naturalising players from outside the country, and Carreno’s 4-3-3 on Sunday afternoon featured five not born there – Amine Lecomte and Dame Traore, who are French, Mohammed Kasola, who grew up in Ghana, Majdi Siddiq, a left-sided midfielder who hailed from Saudia Arabia, and the attacker Mohammed Muntari, who is also Ghanian by birth. ", "And Qatar’s goal-scorer, Karim Boudiaf, who struck a 20-yard curling shot past the Northern Ireland goalkeeper Michael McGovern, is French-born.", "\n\nO’Neill is critical of the policy. “", "It’s not a good thing. ", "I can understand why a country like Qatar has to take that route,” he said. “", "But the international game is the part of the game least affected by finance. ", "If you go down the naturalisation route, where do you stop? ", "International football could lose a bit of its identity.”", "\n\nThe manager denied there was any debate regarding whether Northern Ireland should take this match. “", "No, not from my point of view, I’m only looking at it from a football perspective,” he insisted. “", "When the game was offered to us it obviously gave us an opportunity to play in the UK, which was suitable given the preparation for Romania. ", "Ultimately the plan was to play Wales on Thursday; that didn’t materialise and now we have the option to go and play in Dublin. ", "The main driving factor was location and making sure the preparation was right.”", "\n\nHassan Al Haidos, perhaps the finest talent Carreno has at his disposal, did not start, though he was offered a late cameo. ", "Qatari by lineage and the current player of the year, the winger is a free-kick specialist and crosser, so it was a surprise he was not introduced directly after the break given the paucity of chances the side had created.", "\n\nBy the time he did come on, O’Neill had brought McGovern on for Roy Carroll and watched as three minutes into the second-half Stuart Dallas registered an inaugural Northern Ireland strike, beating Lecomte from close range following lax Qatar defending.", "\n\nThe Northern Irish support made up the majority of the 3,022 crowd and they were well and truly enjoying themselves. ", "To the beat of a continual drum, they offered ditties about having several drinks with “Georgie Best”, and ones that featured taunts of, “Shall we take a bribe for you?” ", "and “Bribery bribery – if you come from Qatar you’re into bribery”, while waving notes at the players in white.", "\n\nIf this was due to allegations that a murky process granted Qatar the 2022 World Cup, the core of players who may feature then are hoped to come from the Under-20 team.", "\n\nQatar’s best success on the global stage came at the 1981 U20 World Cup in Australia, when they reached the final, beating Brazil and England en route. ", "Qatar lost 4-0 to West Germany at the SCG, 4-0, but the hero of that run, Badr Bilal, who scored three times including a memorable bicycle kick, believes the latest vintage can benefit from competing at the current finals in New Zealand. “", "They will gain great experience at this tournament, and if they continue in the right way they will be a part of the team in 2022,” he said.", "\n\nYet given the crisis at Fifa, there is no certainty Qatar will host those finals. ", "And, on this showing, there is also work to be done on the actual football." ]
{ "pile_set_name": "Pile-CC" }
[ 0.007407407407407408, 0, 0.009433962264150943, 0.00558659217877095, 0.00819672131147541, 0.012422360248447204, 0, 0, 0, 0.016172506738544475, 0.006944444444444444, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.015873015873015872, 0, 0.007874015748031496, 0, 0, 0, 0, 0, 0.008368200836820083, 0, 0.011904761904761904, 0 ]
0.003241
5
[ { "analysis_explanation": null, "end": 28, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3 }, { "analysis_explanation": null, "end": 70, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 64 }, { "analysis_explanation": null, "end": 77, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 72 }, { "analysis_explanation": null, "end": 134, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 118 }, { "analysis_explanation": null, "end": 180, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 176 }, { "analysis_explanation": null, "end": 210, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 198 }, { "analysis_explanation": null, "end": 438, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 433 }, { "analysis_explanation": null, "end": 471, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 456 }, { "analysis_explanation": null, "end": 524, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 505 }, { "analysis_explanation": null, "end": 708, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 693 }, { "analysis_explanation": null, "end": 732, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 727 }, { "analysis_explanation": null, "end": 797, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 782 }, { "analysis_explanation": null, "end": 816, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 800 }, { "analysis_explanation": null, "end": 849, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 845 }, { "analysis_explanation": null, "end": 1036, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1029 }, { "analysis_explanation": null, "end": 1075, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1066 }, { "analysis_explanation": null, "end": 1100, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1093 }, { "analysis_explanation": null, "end": 1112, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1107 }, { "analysis_explanation": null, "end": 1177, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1168 }, { "analysis_explanation": null, "end": 1261, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1254 }, { "analysis_explanation": null, "end": 1288, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1283 }, { "analysis_explanation": null, "end": 1299, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1290 }, { "analysis_explanation": null, "end": 1307, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1301 }, { "analysis_explanation": null, "end": 1320, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1312 }, { "analysis_explanation": null, "end": 1373, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1365 }, { "analysis_explanation": null, "end": 1383, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1377 }, { "analysis_explanation": null, "end": 1405, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1400 }, { "analysis_explanation": null, "end": 1489, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1482 }, { "analysis_explanation": null, "end": 1517, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1501 }, { "analysis_explanation": null, "end": 1562, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1549 }, { "analysis_explanation": null, "end": 1578, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1567 }, { "analysis_explanation": null, "end": 1594, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1588 }, { "analysis_explanation": null, "end": 1611, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1596 }, { "analysis_explanation": null, "end": 1633, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1628 }, { "analysis_explanation": null, "end": 1647, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1635 }, { "analysis_explanation": null, "end": 1702, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1689 }, { "analysis_explanation": null, "end": 1737, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1721 }, { "analysis_explanation": null, "end": 1758, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1751 }, { "analysis_explanation": null, "end": 1778, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1773 }, { "analysis_explanation": null, "end": 1807, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1794 }, { "analysis_explanation": null, "end": 1868, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1852 }, { "analysis_explanation": null, "end": 1896, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1880 }, { "analysis_explanation": null, "end": 1907, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1901 }, { "analysis_explanation": null, "end": 2015, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2010 }, { "analysis_explanation": null, "end": 2322, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2306 }, { "analysis_explanation": null, "end": 2533, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2531 }, { "analysis_explanation": null, "end": 2587, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2580 }, { "analysis_explanation": null, "end": 2626, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2621 }, { "analysis_explanation": null, "end": 2638, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2630 }, { "analysis_explanation": null, "end": 2715, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2709 }, { "analysis_explanation": null, "end": 2814, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2798 }, { "analysis_explanation": null, "end": 2849, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2842 }, { "analysis_explanation": null, "end": 2928, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2922 }, { "analysis_explanation": null, "end": 2974, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2966 }, { "analysis_explanation": null, "end": 3201, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3193 }, { "analysis_explanation": null, "end": 3220, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3209 }, { "analysis_explanation": null, "end": 3249, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3236 }, { "analysis_explanation": null, "end": 3270, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3255 }, { "analysis_explanation": null, "end": 3284, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3278 }, { "analysis_explanation": null, "end": 3325, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3309 }, { "analysis_explanation": null, "end": 3349, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3342 }, { "analysis_explanation": null, "end": 3386, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3381 }, { "analysis_explanation": null, "end": 3416, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3402 }, { "analysis_explanation": null, "end": 3730, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3725 }, { "analysis_explanation": null, "end": 3862, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3857 }, { "analysis_explanation": null, "end": 3871, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3867 }, { "analysis_explanation": null, "end": 3971, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3966 }, { "analysis_explanation": null, "end": 4023, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4019 }, { "analysis_explanation": null, "end": 4050, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4041 }, { "analysis_explanation": null, "end": 4095, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4089 }, { "analysis_explanation": null, "end": 4107, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4100 }, { "analysis_explanation": null, "end": 4123, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4118 }, { "analysis_explanation": null, "end": 4148, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4136 }, { "analysis_explanation": null, "end": 4159, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4156 }, { "analysis_explanation": null, "end": 4202, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4192 }, { "analysis_explanation": null, "end": 4354, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4343 }, { "analysis_explanation": null, "end": 4487, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4483 }, { "analysis_explanation": null, "end": 4556, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4551 }, { "analysis_explanation": null, "end": 4027, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 4024 } ]
[ "Yarrow Point, Washington\n\nYarrow Point is a town in King County, Washington, United States. ", "The population was 1,001 at the 2010 census.", "\n\nBased on per capita income, one of the more reliable measures of affluence, Yarrow Point ranks fifth of 522 areas in the state of Washington to be ranked.", "\n\nHistory\nBefore the arrival of settlers the Duwamish set up two longhouses along Yarrow Bay, although most of the tribe lived in the area occupied by the present day cities of Renton and Seattle.", "\n\nYarrow Point was officially incorporated on June 15, 1959.", "\n\nGeography\nYarrow Point occupies a peninsula near the eastern edge of Lake Washington, lying between the lake's Cozy Cove and Yarrow Bay and nearly all of it north of Washington State Route 520. ", "It is bordered by Hunts Point on the west, Clyde Hill on the south, and by Kirkland on the east.", "\n\nAccording to the United States Census Bureau, the town has a total area of .", "\n\nPolitics\n\nOn the national level, Yarrow Point previously leaned toward the Republican Party. ", "In 2004, Republican George W. Bush received 52 percent of the vote here, defeating Democrat John Kerry, who received around 47 percent. ", "However, in the 2016 presidential election, of the 694 residents who voted, 58.93 voted for Hillary Clinton and 29.83% for Donald Trump.", "\n\nDemographics\n\n2010 census\nAs of the census of 2010, there were 1,001 people, 374 households, and 299 families living in the town. ", "The population density was . ", "There were 407 housing units at an average density of . ", "The racial makeup of the town was 86.4% White, 0.1% African American, 0.2% Native American, 8.8% Asian, 0.7% from other races, and 3.8% from two or more races. ", "Hispanic or Latino of any race were 1.6% of the population.", "\n\nThere were 374 households of which 39.8% had children under the age of 18 living with them, 72.5% were married couples living together, 5.6% had a female householder with no husband present, 1.9% had a male householder with no wife present, and 20.1% were non-families. ", "17.4% of all households were made up of individuals and 10.4% had someone living alone who was 65 years of age or older. ", "The average household size was 2.68 and the average family size was 3.04.", "\n\nThe median age in the town was 46.8 years. ", "27.7% of residents were under the age of 18; 3.6% were between the ages of 18 and 24; 15.7% were from 25 to 44; 33.5% were from 45 to 64; and 19.6% were 65 years of age or older. ", "The gender makeup of the town was 49.6% male and 50.4% female.", "\n\n2000 census\nAs of the census of 2000, there were 1,008 people, 379 households, and 308 families living in the town. ", "The population density was 2,720.3 people per square mile (1,051.9/km²). ", "There were 393 housing units at an average density of 1,060.6 per square mile (410.1/km²). ", "The racial makeup of the town was 93.65% White, 0.79% African American, 3.17% Asian, 0.69% from other races, and 1.69% from two or more races. ", "Hispanic or Latino of any race were 1.98% of the population.", "\n\nThere were 379 households out of which 34.6% had children under the age of 18 living with them, 78.4% were married couples living together, 1.6% had a female householder with no husband present, and 18.5% were non-families. ", "15.3% of all households were made up of individuals and 7.7% had someone living alone who was 65 years of age or older. ", "The average household size was 2.66 and the average family size was 2.96.", "\n\nIn the town, the population was spread out with 25.9% under the age of 18, 3.7% from 18 to 24, 20.9% from 25 to 44, 30.9% from 45 to 64, and 18.7% who were 65 years of age or older. ", "The median age was 45 years. ", "For every 100 females, there were 102.0 males. ", "For every 100 females age 18 and over, there were 95.5 males.", "\n\nThe median income for a household in the town was $117,940, and the median income for a family was $126,075. ", "Males had a median income of $100,000 versus $52,500 for females. ", "The per capita income for the town was $72,135. ", "About 1.6% of families and 3.4% of the population were below the poverty line, including 6.4% of those under age 18 and none of those age 65 or over.", "\n\nGallery\n\nReferences\n\nExternal links\n Town of Yarrow Point\n\nCategory:Towns in King County, Washington\nCategory:Towns in Washington (state)\nCategory:Seattle metropolitan area" ]
{ "pile_set_name": "Wikipedia (en)" }
[ 0, 0, 0.00641025641025641, 0, 0, 0.015306122448979591, 0.020833333333333332, 0.01282051282051282, 0.021052631578947368, 0.014705882352941176, 0.014705882352941176, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.005747126436781609 ]
0.002861
5
[ { "analysis_explanation": null, "end": 12, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 0 }, { "analysis_explanation": null, "end": 63, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 52 }, { "analysis_explanation": null, "end": 75, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 65 }, { "analysis_explanation": null, "end": 90, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 77 }, { "analysis_explanation": null, "end": 128, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 124 }, { "analysis_explanation": null, "end": 225, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 213 }, { "analysis_explanation": null, "end": 277, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 267 }, { "analysis_explanation": null, "end": 343, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 335 }, { "analysis_explanation": null, "end": 382, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 372 }, { "analysis_explanation": null, "end": 473, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 467 }, { "analysis_explanation": null, "end": 485, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 478 }, { "analysis_explanation": null, "end": 499, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 487 }, { "analysis_explanation": null, "end": 544, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 531 }, { "analysis_explanation": null, "end": 568, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 556 }, { "analysis_explanation": null, "end": 630, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 615 }, { "analysis_explanation": null, "end": 666, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 657 }, { "analysis_explanation": null, "end": 681, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 671 }, { "analysis_explanation": null, "end": 769, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 758 }, { "analysis_explanation": null, "end": 793, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 783 }, { "analysis_explanation": null, "end": 959, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 947 }, { "analysis_explanation": null, "end": 1014, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1010 }, { "analysis_explanation": null, "end": 1026, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1016 }, { "analysis_explanation": null, "end": 1041, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1027 }, { "analysis_explanation": null, "end": 1098, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1090 }, { "analysis_explanation": null, "end": 1109, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1099 }, { "analysis_explanation": null, "end": 1163, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1159 }, { "analysis_explanation": null, "end": 1250, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1235 }, { "analysis_explanation": null, "end": 1278, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1266 }, { "analysis_explanation": null, "end": 1298, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1294 }, { "analysis_explanation": null, "end": 1330, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1326 }, { "analysis_explanation": null, "end": 1563, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1547 }, { "analysis_explanation": null, "end": 1585, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1570 }, { "analysis_explanation": null, "end": 1597, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1592 }, { "analysis_explanation": null, "end": 1663, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1655 }, { "analysis_explanation": null, "end": 1673, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1667 }, { "analysis_explanation": null, "end": 2104, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2080 }, { "analysis_explanation": null, "end": 2141, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2137 }, { "analysis_explanation": null, "end": 2221, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2211 }, { "analysis_explanation": null, "end": 2266, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2253 }, { "analysis_explanation": null, "end": 2307, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2278 }, { "analysis_explanation": null, "end": 2400, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2376 }, { "analysis_explanation": null, "end": 2501, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2497 }, { "analysis_explanation": null, "end": 2815, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2799 }, { "analysis_explanation": null, "end": 2828, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2823 }, { "analysis_explanation": null, "end": 2896, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2888 }, { "analysis_explanation": null, "end": 2906, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2900 }, { "analysis_explanation": null, "end": 3291, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3267 }, { "analysis_explanation": null, "end": 3440, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3427 }, { "analysis_explanation": null, "end": 3502, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3494 }, { "analysis_explanation": null, "end": 3547, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3523 }, { "analysis_explanation": null, "end": 3576, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3568 }, { "analysis_explanation": null, "end": 3653, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3647 }, { "analysis_explanation": null, "end": 4050, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4044 }, { "analysis_explanation": null, "end": 4148, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4137 }, { "analysis_explanation": null, "end": 4160, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4150 }, { "analysis_explanation": null, "end": 4189, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4179 }, { "analysis_explanation": null, "end": 4214, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4207 } ]
[ "Tachykinins and tachykinin receptors: structure and activity relationships.", "\nIn addition to the classical neurotransmitters, acetylcholine and noradrenaline, a wide number of peptides with neurotransmitter activity have been identified in the past few years. ", "Among them, the tachykinins substance P (SP), neurokinin A (NKA) and neurokinin B (NKB) appear to act as mediators of nonadrenergic, noncholinergic (NANC) excitatory neurotransmission. ", "Tachykinins interact with specific membrane proteins, belonging to the family of G protein-coupling cell membrane receptors. ", "Until now, three tachykinin receptors termed NK1 (NK1R), NK2 (NK2R) and NK3 (NK3R) have been cloned in different species. ", "A large amount of reports suggests that these peptides are involved in nociception and neuroimmunomodulation, and in the development of different diseases such as bronchial asthma, inflammatory bowel syndrome and psychiatric disorders. ", "Tachykinin receptor antagonists are therefore promising, therapeutically relevant agents. ", "However, and in spite of extensive research, the obtention of selective antagonists of tachykinin receptors have revealed very difficult. ", "An understanding of how ligands interact with their receptors is essential to permit a rational design of compounds acting selectively at the tachykinin receptor level. ", "The major aim of the present article is to review the structure-activity data that exist for tachykinins and their receptors, with the purpose of getting insight into basic structural requirements that determine ligand/receptor interaction." ]
{ "pile_set_name": "PubMed Abstracts" }
[ 0, 0, 0.021621621621621623, 0, 0.01639344262295082, 0, 0.011111111111111112, 0, 0, 0 ]
0.004913
5
[ { "analysis_explanation": null, "end": 26, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16 }, { "analysis_explanation": null, "end": 256, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 238 }, { "analysis_explanation": null, "end": 798, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 777 }, { "analysis_explanation": null, "end": 936, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 926 }, { "analysis_explanation": null, "end": 1113, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1103 } ]
[ "et r = 36547 - 36537. ", "Solve 5*q = -r - u for q.\n-5\nLet c(l) = -2*l**2 + 26*l - 21. ", "Let m be 10/1 + 6 + 1 + -5. ", "Let v be c(m). ", "Solve 15 = -v*u + 3 for u.\n-4\nLet d(w) = w**3 - 18*w**2 - 18*w - 19. ", "Let y be d(19). ", "Let c = -375 + 378. ", "Solve -c*k = -y*k - 9 for k.\n3\nSuppose -3*x + 12 = -3*l, -2*x = -3*l + 6 - 14. ", "Suppose -19 = -3*i - j, -5*i = j - x*j - 27. ", "Solve 1 = u + i for u.\n-5\nLet z(g) = -58 - 2*g + 5*g - 60 + 136. ", "Let t be z(-5). ", "Solve -t = d - 6 for d.\n3\nLet d(w) = -2*w - 8. ", "Let s = -2 - 2. ", "Let x be d(s). ", "Suppose 3*h = -2*m + h + 14, -4*m - h + 22 = x. Solve m*f - f = -8 for f.\n-2\nSuppose 0 = 9572*k - 9568*k - 252. ", "Solve 0 = -10*o - k + 3 for o.\n-6\nLet a = 74 + -67. ", "Suppose -11*o = -15 - a. Solve o*m + 0*m = -4 for m.\n-2\nSuppose -5*v = 5*x + 15, -2*v - 12 = x + 2*v. ", "Suppose -13*l - 261 = -326. ", "Solve -l*r + x = 5 for r.\n-1\nSuppose -2*p - 5 = -3*p. ", "Suppose 0 = -5*l - 5, 9*q - 8*q - 2*l - 4 = 0. ", "Let f(r) = -2*r**3 + 3*r**2 + 6*r - 6. ", "Let h be f(q). ", "Solve -p*t = -h*t + 12 for t.\n-4\nSuppose 4*s - 252 = 840. ", "Let j be (10 - s/27) + (-37)/(-9). ", "Solve j*m = 8*m for m.\n0\nSuppose 8*l = 18*l - 280. ", "Suppose -4*q + 2*c + l = 0, -5*q - 6 = c - 27. ", "Solve q*o - 15 = -0*o for o.\n3\nSuppose -143 = -15*f + 184 + 78. ", "Solve f = -12*w - 21 for w.\n-4\nSuppose -s + 8 = -14. ", "Suppose -17*t = -s*t + 20. ", "Solve 3*n = -n + t for n.\n1\nSuppose 3*c = 0, -5*r + 4*c - 8 = -9*r. ", "Let q(g) = 8 + g**2 - 9*g - 11 - r*g**2. ", "Let z be q(-8). ", "Solve u + z = 3 for u.\n-2\nLet u(f) = f**2 - 5*f - 6. ", "Suppose 5*d + 117 - 147 = 0. ", "Let t be u(d). ", "Solve t = -0*m + 3*m for m.\n0\nSuppose -d + 17 = -4*m + 3, -14 = -4*d - 5*m. ", "Suppose -3*y = 3*a - 5*a + 219, -4*a + 4*y + 432 = 0. ", "Let k = -102 + a. Solve -k*f = -f + d for f.\n-3\nLet x = -76 - -407. ", "Let k = -331 + x. Solve 3*s + 4 + 2 = k for s.\n-2\nLet f(d) = -d**3 + 27*d**2 + 215*d - 5. ", "Let s be f(-7). ", "Solve 13*w = -26*w + s for w.\n4\nLet d be (-94)/8 - (8 - (-62)/(-8)). ", "Let p = 4 + -8. ", "Let g be -4*d/3*(-1)/p. ", "Solve g = 3*b + b for b.\n1\nLet b(x) = 5*x**2 - 35*x + 348. ", "Let c be b(9). ", "Solve c*w = 442*w - 4 for w.\n1\nLet q(o) = -12*o + 137. ", "Let c be q(11). ", "Suppose 4*w = 5*w - c*w. ", "Suppose -4*u + 2*n + 4 = 2, 4*n = -3*u + 18. ", "Solve w*j + u = -j for j.\n-2\nLet a be (7 - (-5 - -8)) + -2. ", "Let d be 5*(a*-1)/(20/(-8)). ", "Solve -13 - 7 = -d*j for j.\n5\nLet n(r) = -6*r - 9. ", "Let y be n(-4). ", "Solve y*t - 147 = -72 for t.\n5\nLet p(k) = -k**2 + 12*k - 2. ", "Let y be p(11). ", "Suppose -2 = -10*v + y*v. ", "Let d be (v/(-2) + 3)*2. ", "Solve d*u = 3*u for u.\n0\nLet h(v) be the second derivative of -v**3/6 + 7*v**2/2 + 30*v. ", "Let f be h(-4). ", "Solve -3*d - 2 = -f for d.\n3\nSuppose 20 = i + 5*w + 2, 3*i + 26 = 5*w. ", "Let c be 18/5 + i/(-5). ", "Let p(s) = s**2 + 4*s. ", "Let g be p(-4). ", "Solve -o - c*o + 5 = g for o.\n1\nLet n be (4/8*3)/((-13)/((-1560)/18)). ", "Solve 36 = n*o - 34 for o.\n7\nLet g = -18253 - -18832. ", "Solve 9*m = g - 552 for m.\n3\nLet s(l) = -5*l - 19. ", "Let i be s(-16). ", "Suppose i*d - 55*d = 0. ", "Solve d = t - 6*t + 15 for t.\n3\nSuppose -5*k + 5 = d + 17, 2*d + k = 21. ", "Solve -19*h = d*h for h.\n0\nSuppose -4*v - v + 15 = 0. ", "Suppose v = -5*r - 62. ", "Let l = -13 - r. Solve l*z + 1 = -z for z.\n-1\nLet g(n) = -n**3 - 7*n**2 - 3. ", "Suppose 2*o = -3 - 11. ", "Let b be g(o). ", "Let z be (8 + b)/1 - 4. ", "Solve -2*c + z = -5 for c.\n3\nLet n = -15976 + 16081. ", "Solve 27*i - 84 = n for i.\n7\nSuppose 2*s + s = 2*s. ", "Let w = 8 - 8. ", "Suppose w = -4*c + c + 9. ", "Solve s = c*o - 11 - 1 for o.\n4\nLet i(n) be the first derivative of 5/2*n**2 + 52*n - 7. ", "Let b be i(-10). ", "Solve 2*s = -b*s - 4 for s.\n-1\nLet g = -119 - -100. ", "Let m = 13 - g. Suppose 5*b + x - 5*x = 49, -3*b + m = -5*x. ", "Solve b = 3*q - 3 for q.\n4\nLet a(u) = -3*u**3 + 26*u**2 + 3*u + 3. ", "Let z be a(8). ", "Let g = z + -83. ", "Solve -2*y - g + 68 = 0 for y.\n-2\nSuppose 0 = -6*a + 33 - 39. ", "Let f be (-6 + 2 - 4/a)/(-4). ", "Solve f*q + 12 = -3*q for q.\n-4\nLet l be (-120)/(-21) + 2/7. ", "Let k(v) = -v**3 + 197*v**2 + 362*v + 7164. ", "Let g be k(199). ", "Solve 6*z - 8*z + l = g for z.\n3\nLet y(u) be the first derivative of u**2/2 - 32*u - 9. ", "Let r be y(10). ", "Let s = r + 22. ", "Solve -3*z + 7 + 2 = s for z.\n3\nLet a be ((-76)/(-95))/(28/(-120) - 2/(-6)). ", "Solve -g - a*g = 5*g for g.\n0\nLet b(o) = -7*o + 24. ", "Let j(t) = -20*t + 72. ", "Let z(q) = -17*b(q) + 6*j(q). ", "Let d be z(23). ", "Let n be (22/(-8))/(d/(-4)). ", "Solve -1 - n = -3*v for v.\n4\nLet a(t) = -2134*t + 14944. ", "Let p be a(7). ", "Suppose -15 = -4*o - o. Suppose -o*d + p = -d, -w - 3*d = -25. ", "Solve -s - w = -5*s for s.\n4\nLet y be (-3 + 1)*(0 + 75/(-30)). ", "Suppose 10*g - y*g = 5*u + 15, -g + 5*u + 7 = 0. ", "Solve z - 3 = -g for z.\n1\nLet s be (-5556)/(-50) - (-354)/(-2950). ", "Solve s + 15 = -14*b for b.\n-9\nSuppose -4*b = -0*b + 2*g - 764, 5*g = 0. ", "Suppose -b = -5*p - 141. ", "Solve p*q - 7*q + 9 = 0 for q.\n-3\nSuppose -13*x + 20 = -12*x. ", "Suppose -j = d - 20, -d + 3*j + x = -j. ", "Suppose -1 = 4*r - 17. ", "Solve -r*u = u + d for u.\n-4\nSuppose -3*q = 9*y - 5*y - 624, 2*y - 3*q = 330. ", "Solve -y = 11*f - 82 for f.\n-7\nSuppose 0 = -j - 3*t + 21, -5*j - 3*t + 95 = -58. ", "Solve 43*q - j*q + 50 = 0 for q.\n-5\nSuppose 0 = 92*k - 332 + 56. ", "Solve 0 = k*v - 61*v - 406 for v.\n-7\nLet g be (-22)/4 + (-21)/(-14) - -9. ", "Let d be (-12)/(-54) + 183/27. ", "Suppose 0 = -4*b + b + 51. ", "Solve b - d = -g*c for c.\n-2\nLet b(i) = i**3 + 29*i**2 - 65*i - 12. ", "Let d be b(-31). ", "Let j = d + -65. ", "Suppose 2*f - j = -4*v, -6*v = f - v - 14. ", "Solve -f*g = 11 + 1 for g.\n-3\nSuppose -2*k - 6*u + 2*u + 54 = 0, -72 = -2*k + 5*u. ", "Let g = k - -1. ", "Let t be 156/g + -1 - (-1)/8. ", "Solve -24 = 5*l - t for l.\n-4\nSuppose 0 = 5*q - 5*s - 175, 4*q + 4*s - 120 = 60. ", "Suppose -1390*r + 1380*r + q = 0. ", "Solve -4 = -r*b - 0*b for b.\n1\nLet v(d) = -d**2 - 11*d - 24. ", "Let w be v(-6). ", "Let h be w/(-6 - (-45)/6). ", "Solve 2 = -2*g - h for g.\n-3\nLet p(d) = -d**3 + 8*d**2 - d + 7. ", "Let j be p(8). ", "Let n be (-3 + (7 - 7))/(j/2). ", "Solve n*i = 4*i for i.\n0\nLet j = -22100 - -22242. ", "Solve -146*s = -j*s - 12 for s.\n3\nLet x = 4334 + -4222. ", "Solve -107*y = -x*y + 10 for y.\n2\nLet d = 15 + -15. ", "Let s be d*(8/(-4) - -3). ", "Let n = -114 + 117. ", "Solve s*x = n*x for x.\n0\nLet k(a) = -173*a**2 - 1386*a + 10. ", "Let n be k(-8). ", "Solve -21*v = -n*v + 35 for v.\n7\nLet l(r) = -5*r**2 + 2*r - 8. ", "Let m(o) = 14*o**2 - 7*o + 23. ", "Let f(v) = 17*l(v) + 6*m(v). ", "Let j be f(-8). ", "Let n = 5 - j. Solve -n*p = -p for p.\n0\nLet d be (0 - 0)/((-7)/(28/(-4))). ", "Solve d = 9*i - 28*i - 19 for i.\n-1\nLet b be (-122)/(-6) + 1 - -1*(-3)/9. ", "Solve 2*g - b*g = 38 for g.\n-2\nLet u(h) = 4*h**2 + 53*h + 102. ", "Let a be u(-13). ", "Solve -2*l - a = -89 for l.\n0\nLet r = -1303 - -2310. ", "Solve r*d + 10 = 1012*d for d.\n2\nSuppose -57*s + 61*s - 24 = 0. ", "Let l = 9 - 5. ", "Let c be -1 - (s/l)/((-9)/24). ", "Solve -2*o - c*o = 0 for o.\n0\nLet i be 525/6*((-240)/(-25))/8. ", "Suppose 2*l + 2*c = 7*l - i, 4*l - 77 = 3*c. ", "Solve l = n + 18 for n.\n5\nLet d = -76 - -81. ", "Let f = 436 + -432. ", "Solve d*t - f*t = 5 for t.\n5\nLet t be (1 - (-16)/(-10))/(59/(-1180)). ", "Let u = t + -7. ", "Solve 0 = -0*i + u*i + 5 for i.\n-1\nLet u be -3 + -1 - (3 + -1 + -7). ", "Let x be ((3 - 3) + -12)*u/(-4). ", "Solve -5*a + 8*a = -x for a.\n-1\nLet a be (-4)/(4/9*(-33)/22). ", "Let g be (-4)/(-6)*(-30)/(-20). ", "Suppose -2*v - 5*h = g, -v - 5*h = -0*h + 3. ", "Solve v*f - a = -f for f.\n2\nLet v(d) = -30*d + 9. ", "Let n be v(1). ", "Let s be (-7 + 2 - (n - 1))*1. ", "Solve -25 = 12*a - s*a for a.\n5\nLet n(l) = 3*l**3 + 51*l**2 - 236*l + 8. ", "Let r be n(4). ", "Solve 0 = -3*z + r - 57 for z.\n5\nLet r = 7422 - 7417. ", "Suppose 0*g + 5*g - 15 = 0. ", "Suppose 4*z = g*z + 6. ", "Solve r*i = z*i - 3 for i.\n3\nLet w be 3068/9 - 992/1116. ", "Solve -347*f + w*f - 42 = 0 for f.\n-6\nLet h(v) = -3*v - 13. ", "Let l be h(-11). ", "Suppose 10 = 3*c + x, c + 3*x - l = 6*x. ", "Suppose -c*d + 11 = 2*i, 2*i - d - 8 = -i. ", "Solve i*z = -z + 4 for z.\n1\nSuppose -12 = -3*v, 3*n - v = -2*n + 296. ", "Solve n = -12*s - 8*s for s.\n-3\nLet g = -695 + 559. ", "Let p = g + 141. ", "Solve p*a = 4*a - 5 for a.\n-5\nLet i(s) = -14*s - 330. ", "Let v be i(-25). ", "Solve -8*u + 72 = -v*u for u.\n-6\nSuppose 3*s = q + 14, -2*q - 2*q + 12 = 5*s. ", "Suppose -575 - 706 = -21*j. ", "Suppose -22 = -j*v + 100. ", "Solve v = s*x - 6 for x.\n2\nLet v be 1/((-17584)/(-2292) - 7 - 18/27). ", "Solve 415 = -28*z + v for z.\n-8\nLet z = 6477 - 6474. ", "Let f(a) be the third derivative of -a**6/120 + a**5/15 - 5*a**4/24 + a**3 - a**2. ", "Let s be f(z). ", "Solve -h + s + 1 = 0 for h.\n1\nLet a = 35564 + -35554. ", "Solve 54*x = 56*x - a for x.\n5\nSuppose 795 = 80*h + 78 - 483." ]
{ "pile_set_name": "DM Mathematics" }
[ 0.045454545454545456, 0, 0, 0, 0.014492753623188406, 0, 0, 0, 0, 0, 0, 0.02127659574468085, 0, 0, 0, 0, 0.00980392156862745, 0.03571428571428571, 0.037037037037037035, 0, 0, 0, 0.017241379310344827, 0, 0, 0, 0, 0.018867924528301886, 0.037037037037037035, 0.014705882352941176, 0, 0, 0, 0, 0, 0.013157894736842105, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.016666666666666666, 0, 0, 0, 0.011235955056179775, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.041666666666666664, 0, 0, 0, 0.012987012987012988, 0, 0, 0, 0, 0.019230769230769232, 0, 0.038461538461538464, 0, 0, 0.019230769230769232, 0.01639344262295082, 0, 0.06666666666666667, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.012987012987012988, 0, 0, 0, 0, 0, 0.017543859649122806, 0, 0, 0.015873015873015872, 0, 0, 0, 0, 0, 0, 0.043478260869565216, 0, 0, 0, 0.013513513513513514, 0, 0, 0, 0, 0, 0, 0, 0.0625, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.01639344262295082, 0, 0, 0, 0, 0, 0, 0.013513513513513514, 0, 0, 0, 0, 0, 0.03225806451612903, 0, 0, 0.044444444444444446, 0, 0, 0, 0.014492753623188406, 0, 0, 0, 0, 0, 0, 0, 0, 0.06666666666666667, 0.018518518518518517, 0, 0, 0, 0, 0, 0, 0, 0.014285714285714285, 0, 0, 0, 0, 0, 0.03571428571428571, 0, 0.02857142857142857, 0.018867924528301886, 0, 0, 0, 0.01639344262295082 ]
0.005256
5
[ { "analysis_explanation": null, "end": 47, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 45 }, { "analysis_explanation": null, "end": 81, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 72 }, { "analysis_explanation": null, "end": 152, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 150 }, { "analysis_explanation": null, "end": 163, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 160 }, { "analysis_explanation": null, "end": 575, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 568 }, { "analysis_explanation": null, "end": 590, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 585 }, { "analysis_explanation": null, "end": 741, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 728 }, { "analysis_explanation": null, "end": 853, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 837 }, { "analysis_explanation": null, "end": 1248, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1243 }, { "analysis_explanation": null, "end": 1767, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1762 }, { "analysis_explanation": null, "end": 2146, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2135 }, { "analysis_explanation": null, "end": 2176, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2171 }, { "analysis_explanation": null, "end": 2266, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2262 }, { "analysis_explanation": null, "end": 2533, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2529 }, { "analysis_explanation": null, "end": 2589, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2588 }, { "analysis_explanation": null, "end": 2701, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2697 }, { "analysis_explanation": null, "end": 2883, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2863 }, { "analysis_explanation": null, "end": 3273, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3266 }, { "analysis_explanation": null, "end": 3532, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3520 }, { "analysis_explanation": null, "end": 3763, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3758 }, { "analysis_explanation": null, "end": 3851, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3846 }, { "analysis_explanation": null, "end": 3886, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3882 }, { "analysis_explanation": null, "end": 4005, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4001 }, { "analysis_explanation": null, "end": 4110, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4107 }, { "analysis_explanation": null, "end": 4256, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4251 }, { "analysis_explanation": null, "end": 4395, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4388 }, { "analysis_explanation": null, "end": 4473, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4469 }, { "analysis_explanation": null, "end": 4545, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4540 }, { "analysis_explanation": null, "end": 4763, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4761 }, { "analysis_explanation": null, "end": 4872, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4870 }, { "analysis_explanation": null, "end": 4929, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4927 }, { "analysis_explanation": null, "end": 4960, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4958 }, { "analysis_explanation": null, "end": 5287, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5269 }, { "analysis_explanation": null, "end": 5397, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5392 }, { "analysis_explanation": null, "end": 5615, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5610 }, { "analysis_explanation": null, "end": 5853, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5845 }, { "analysis_explanation": null, "end": 6018, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6015 }, { "analysis_explanation": null, "end": 6853, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6848 }, { "analysis_explanation": null, "end": 7036, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7032 }, { "analysis_explanation": null, "end": 7245, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7234 }, { "analysis_explanation": null, "end": 7509, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7498 }, { "analysis_explanation": null, "end": 7779, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7777 }, { "analysis_explanation": null, "end": 7957, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7954 }, { "analysis_explanation": null, "end": 7979, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7968 }, { "analysis_explanation": null, "end": 20, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 7 }, { "analysis_explanation": null, "end": 2793, "entity_type": "PHONE_NUMBER", "recognition_metadata": { "recognizer_identifier": "PhoneRecognizer_139620637004560", "recognizer_name": "PhoneRecognizer" }, "score": 0.4, "start": 2779 }, { "analysis_explanation": null, "end": 8036, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 8032 }, { "analysis_explanation": null, "end": 8048, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 8044 } ]
[ "Ubiquitination of an artificial RING finger without a substrate and a tag.", "\nAlpha-helical region substitution was applied to the SIAH1 and EL5 RING fingers. ", "The Williams-Beuren syndrome transcription factor (WSTF) PHD_SIAH1 and WSTF PHD_EL5 RING fingers were created as the artificial ubiquitin-ligating enzyme (E3). ", "These fingers possess E3 activities of mono-ubiquitination and poly-ubiquitination, respectively, with ubiquitin-conjugating enzyme (E2)-binding capabilities. ", "Artificial E3s bind two zinc atoms and adopt a zinc-dependent ordered structure and ubiquitinate upon themselves without a substrate and a tag. ", "Ubiquitination experiments using biotinylated ubiquitin showed that the WSTF PHD_EL5 RING finger is poly-ubiquitinated via residue Lys(63) of ubiquitin. ", "Substitution of alpha-helical region might be applicable to various RING fingers with mono-ubiquitination or poly-ubiquitination." ]
{ "pile_set_name": "PubMed Abstracts" }
[ 0, 0.012195121951219513, 0.01875, 0, 0, 0, 0 ]
0.004421
5
[ { "analysis_explanation": null, "end": 175, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 156 }, { "analysis_explanation": null, "end": 313, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 311 }, { "analysis_explanation": null, "end": 340, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 338 }, { "analysis_explanation": null, "end": 451, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 449 } ]
[ "The same explanation is here:\nX-X-X: Pokemon line ups used to describe basic, stage 1 and stage 2 evolution line.", "\nExample: \"I run a 4-2-4 of Charizard. ", "So 4 Charmander, 2 Charmeleon, 4 Charizard\"\n\"I run a 2-2 Blissy line. ", "So 2 Chansey and 2 Blissy\"" ]
{ "pile_set_name": "Pile-CC" }
[ 0, 0.02564102564102564, 0.02857142857142857, 0 ]
0.013553
5
[]
[ "Name: Dashboard\nAntiForgery: enabled\nAuthor: The Orchard Team\nWebsite: http://orchardproject.net\nVersion: 1.10.3\nOrchardVersion: 1.10.3\nDescription: The dashboard module is providing the dashboard screen of the admininstration UI of the application.", "\nFeatureDescription: Standard admin dashboard.", "\nCategory: Core\n" ]
{ "pile_set_name": "Github" }
[ 0.016, 0, 0 ]
0.005333
5
[ { "analysis_explanation": null, "end": 97, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.95, "start": 72 } ]
[ "The correlation of fatty acid content of infected cells and virions with Newcastle disease virus (NDV) virulence.", "\nChick embryo fibroblasts (CEF) infected with virulent strains of Newcastle disease virus (NDV) showed a dramatic increase in total unsaturated fatty acids (UFA). ", "This increase was not seen in cells infected with the avirulent strains of NDV, Sendai virus or influenza A (PR8). ", "The virions of the virulent strains of NDV harvested from the chorioallantoic cavity also had a higher UFA content compared to the avirulent ones. ", "The kinetics of UFA increase in the virulent strains could be correlated with published data on the kinetics of RNA and protein synthesis inhibition, polykaryon formation and membrane permeability changes." ]
{ "pile_set_name": "PubMed Abstracts" }
[ 0.008849557522123894, 0.018404907975460124, 0.017391304347826087, 0.013605442176870748, 0.00975609756097561 ]
0.013601
5
[ { "analysis_explanation": null, "end": 82, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 73 }, { "analysis_explanation": null, "end": 188, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 179 }, { "analysis_explanation": null, "end": 354, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 351 } ]
[ "Strategies for improving diabetic therapy via alternative administration routes that involve stimuli-responsive insulin-delivering systems.", "\nThe encapsulation of insulin in micro- or nanodelivery systems may eliminate the need for frequent subcutaneous injections, improving the quality of life of diabetic patients. ", "Formulations for oral, intranasal, pulmonary, subcutaneous, and transdermal administration have been developed. ", "The use of stimuli-responsive polymeric carriers that can release the encapsulated drug in response to changes of the environmental stimuli or external activation enables the design of less invasive or non-invasive systems for smart insulin delivery from depots in the body. ", "This article will look at strategies for the development of responsive delivery systems and the future meeting of the demands of new modes of insulin delivery." ]
{ "pile_set_name": "PubMed Abstracts" }
[ 0, 0, 0, 0, 0 ]
0
5
[]
[ "Q:\n\nBreadboard circuit doesn't pay attention to sensor unless attached to multimeter probe?", "\n\nBasically I'm using a programmable microchip to turn motors when a QTI infrared sensor reads a black surface. ", "The sensor is connected to an LM293N comparator so that it outputs voltage on a black surface instead of a white surface. ", "My problem is, the chip acts like there's no voltage whatsoever coming from the sensor and my circuit doesn't function. ", "But then, when I connect the positive probe of a multi meter to the positive battery, and negative probe to the comparator output, I do see the correct output voltage and the circuit works properly. ", "I apologize that I don't have a diagram to show, the one supplied by my teacher is slightly wrong so I had to make an alteration to it and I don't want to create more confusion. ", "I hope the photo doesn't confuse you more. ", "Does anyone know why connecting the probes \"completes\" the circuit?", "\n\nA:\n\nThe LM293 comparator is an open drain output part. ", "What that means is that the part can pull the output low bit not high. ", "You have to add a suitable pull-up resistor to provide the high level output when the comparator shuts it's output transistor off. ", "\nWhen you connected your meter between the comparator output and the positive supply rail the internal resistance of the meter was acting as a pull-up resistor!!", "\nLooking closely at your photo it is fairly clear that you did not provision the LM293 output with a pull-up.", "\n\n" ]
{ "pile_set_name": "StackExchange" }
[ 0, 0.008928571428571428, 0, 0, 0, 0, 0, 0, 0.017543859649122806, 0, 0, 0, 0.009174311926605505, 0 ]
0.002546
5
[ { "analysis_explanation": null, "end": 945, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 940 }, { "analysis_explanation": null, "end": 1435, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 1430 } ]
[ "Angiofollicular lymph node hyperplasia of the parotid.", "\nAngiofollicular lymph node hyperplasia (AFLNH) is a condition of uncertain aetiology usually presenting with mediastinal lymphadenopathy. ", "Occasionally other lymph node groups are affected and there may be associated wide ranging systemic manifestations. ", "A case of AFLNH affecting parotid lymph nodes is presented. ", "The histological features of AFLNH and its variants are discussed, and current ideas on its pathogenesis are summarised." ]
{ "pile_set_name": "PubMed Abstracts" }
[ 0, 0, 0, 0, 0 ]
0
5
[]
[ "Friday, October 03, 2008\n\nLeading up to and immediately following the vice presidential debate Thursday night between Sen. Joe Biden and Gov. Sarah Palin the burning question was, who'd win and who'd lose. ", "But there were really no major surprises. ", "Biden sounded like the knowledgeable and experienced six-term Senator he is and Palin sounded like the colossal airhead she is. ", "So, the biggest loser of all? ", "Moderator Gwen Ifill. ", "She was there occupying space and her lips moved, but she was virtually invisible the entire evening.", "\n\nIt's unfortunate, but the American media is neutered. ", "For eight years it's given the Bush administration a free pass to invade Iraq on lies and faulty intelligence and conflate that war with the 9-11 attacks; to torture and spy on whoever the hell it wants; and generally govern in the most reckless manner through cronyism and corruption, trampling all over the Constitution. ", "And now when the nation is at a critical crossroads with the upcoming presidential election, journalists like Ifill are simply asleep at the wheel yet again.", "\n\nCase in point: when Biden challenged Palin to answer the question about Sen. John McCain's role in deregulating Wall Street and the banking industry, which led to the current financial meltdown, the plucky little hockey mom thumbed her nose at both her opponent and Ifill:\n\n\"Well I'm still on the tax thing because I want to correct ya on that again...and I want to let ya know what I did as a mayor and as a governor. ", "And I may not answer the questions the way that either the moderator or you wanna hear but I'm gonna talk straight to the American people and let 'em know my track-record also.\"", "\n\nIfill sat there motionless and silent as Palin essentially rewrote the debate rules and said, \"fuck you all, gosh-darnit! ", "I'll answer whatever I want, whenever I want. ", "And when I don't have the answer to one of your \"gotcha\" questions, I'll just fill air with my usual inane, disjointed, incoherent gibberish about shout-outs, Joe Sixpack, soccer games, mavericks, reforms, energy independence, and greed and corruption...all the while givin' y'all a flash of my pearly whites and my cutesy lil wink. ", "It'll drive the boys crazy and make the girls all want to be my friend!\"", "\n\nHow come Ifill didn't come back at Palin with : \"With all due respect Governor, the economy is in crisis and Congress is being asked to pass a $700-billion bailout bill funded with taxpayers' money. ", "Voters want to know what you be believe was Sen. McCain's role in deregulating banks and Wall Street.\"", "\n\nWould this sort of aggressive moderating have been out of line? ", "Would it have been condescending?Sexist? ", "Or unfair on any level? ", "Of course not. ", "It would've been exactly what Ifill was supposed to do\n\nAnd while she was at it, Ifill could've nailed the spunky igloo-dwelling, Putin-watching BluffQueen on her convoluted mumbo-jumbo about the \"Constitutional\" role of the VP; the Founding Fathers; her lies about Obama's tax plan and troop funding; her Afghanistan war \"Gen. McLellan\" mix-up; and any other of her many embarrassing gaffes. ", "I suppose that would've been too much to ask for.", "\n\n79 Comments:\n\nSuperb commentary! ", "This was in no way a debate at all, - but a platform for Sarah Palin's recital of memorized talking points that were spewed with robot-like precision and rapidity. ", "It was also a forum for Joe Biden to play nice and prove he was not a gaffe-prone bully who would dare challenge the non-sequiturs and folksy winks of his stage companion. ", "There was not a single hard ball question, not a follow-up to some of Palin's outrageous responses, and nothing remotely resembling a debate. ", "Gwen Ifill was an embarrassment.", "\n\ngreat article----hey Andy, Id like you to personally respond to this---didnt Palin look as if she was READING a teleprompter??? ", "Therse NO FUCKING WAY she spoke that fluently. ", "Her words were all talking point garbage like you said, but she spoke fluently like she was reading it off something. ", "What do you think?", "\n\nAnd that bitch had ZERO compassion for Biden's mention of his family when he choked up. ", "She just continued with the talking points like the cold-hearted BITCH she is. ", "Can you believe that?", "\n\nWell,Palin received a 20% rating for her phoniness at that debate as she followed orders to smile,act sweet, speak very softly and ignore any questions that she could not answer and just change the subject to something that she was more aware of.(and wink a lot)Moderator might as well not have even been there since she did nothing to force Palin to answer questions!", "\n\nI have been watching these debates since they became a regular feature of presidential races and I have ALWAYS noted that those debating have pre-scripting talking points that they make sure they get out REGARDLESS of the question. ", "Both of them did it that night and to focus on Palin is little more than a testament to your own biases.", "\n\nNeutered media? ", "Are you kidding me? ", "The left wing has had the media in its pockets for YEARS. ", "Look at MSNBC where they had to change their anchors because one got tingles in his leg listening to one candidate and the other was simply spewing.", "\n\nThe Times, the Washington Post, the LA Times - CNN (the Clinton News Network) and other electronic media are deep in the tank. ", "Cycle after cycle, you get blind poll results that indiacte that 90% or so of the Washington Press corps backs the Democrat candidate. ", "And you all really think it doesn't affect their reportage?", "\n\nSpare me - anyone who desires to be taken seriously can't deny the human element.", "\n\nLook at today's Times. ", "They did today what they did for Clinton in 1992.", "\n\nThey couldn't NOT report on Whitewater. ", "So what did they do? ", "They waited till towards the end and then pushed it out on a Saturday, the least read paper of the week. ", "And only after they felt comfortable that he had a good enough lead.", "\n\nNow with Obama cresting at his high, they finally get around to the fact that this wingnut has questionable associations to terrorists and subversives. ", "Oh, and it gets reported on a Saturday again. ", "This time, they didn't have a principled guy like Jeff Gersh, so the article leads off with the defense rather than the allegation, a very strange way to report on allegations.", "\n\nThe Press is deep in the tank.", "\n\nTo the extent that Ifill was neutered it was only because she put herself in an impossible position - writing a pro-Obama book timed to come out on innauguration day without disclosing it in advance. ", "That's the kind of thing that leftist journalists skate away with but conservatives get skewered for.", "\n\nSo after it got attention, she had little choice but to play it up the middle. ", "Which is what irks you guys so much - you are so used to having the media in the bag for you that when someone plays it up the middle, it offends you.", "\n\nThe important issue is that Obama LIED. ", "He said that he knew the guy because their kids went to school together. ", "Turns out he hosted his first fundraiser for him, sat on boards together and on 9/11/01 was quoted in the NY Times as saying he only wished he threw more bombs.", "\n\nAnd then there is the Reverend Wright - again he lies. ", "This is a guy who has been a nutjob for ever. ", "He was his pastor for 25 years, went to more than 500 services and never even had a clue that the guy was off the hook? ", "Even as he walked past the recordings of his most interesting sermons in the lobby of the church?", "\n\nThe guy lies about his connections. ", "How about Tony Rezko? ", "The guy gave him his very first political contribution and then happened to pay full price for an empty lot adjacent to a house that Obama bought at a deep discount from a seller who insisted on selling both at once?", "\n\nThis guy is an empty suit which makes his associations all the more important.", "\n\nBury your head in the sand all you like - you guys would vote for Attilla the Hun if he were a Democrat and then use your silly rhetoric to beat back anyone who challenged it.", "\n\namazing,just f**king amazing,the great one(OBAMA)who couldn't even serve in the boys scouts let a alone hold a meeting in the sub committee he heads on nato. ", "At least mccains second has done more for the common man than this senator that held office less than 2 years and not only thinks but demands the highest office in the land. ", "Andy get your head out of your ass. ", "the more you cut down mccains pick the more you show how no one with any grit could vote the obama ticket\n\nwhen did obama lie? ", "he has said that they served on commissions together.", "\n\ni dont even get the point of the times article...\"obama has played down their association but they are not close\"\n\nso what is the point?", "\n\nguess what, mccain served for years in the same body that housed ted stevens...does that make mccain a corrupt politician?", "\n\nmccain is losing...he is watching his career and whatever good will he once had with the american people go down the tubes...so now will come the attack ads...wall to wall ads on wright, ayers and whoever else they can dredge up\n\nwell guess what...2 can play the same game....obama doesnt have to...thousands of bloggers will\n\nlets start here...\n\ntodd palin was the member of an extremely dangerous seperatist group in alaska...one that calls for the seccession of alaska from the other 49 states...the leaders of that group attended a seccionist conclave last year that was also attended by neo nazis and kkk members\n\ntherefore todd palin is a racist nazi....why does sarah continue to be married and sleep with an enemy of the state?", "\n\nno wonder he daughter turned into a slut and her son had to leave the states in order to escape prosecution for drug use and willfull destruction of property\n\nwhat a fucked up family they are.", "\n\nand the fact that mccain picked her shows how much he really hates america...but he has no morals anyway...ask his first wife, who he cheated on repeatedly with hookers and strippers.", "\n\nWe Americans over and over again overlook the greed that motivates those with power.", "\n\nThere was talk of Ifill stepping down as moderator because her book favoring Obama will be available on Inauguration Day. ", "It was considered that she had a personal interest in the outcme of the debate -- possible in the millions of dollars should her book be a success. ", "However, if Obama loses he will be \"old news\" and people will be less likely to buy her book.", "\n\nShe refused to resign as moderator. ", "It was obvious, however, that she could not risk being criticized for favoring Biden hence her poor, self-concerned, motiviated by greed performance.", "\n\nI KNEW she would be soft on Palin. ", "She had too much to lose if she weren't. ", "Why was that not obvious to everybody?", "\n\nPalin is not running for President. ", "Palin will not be President. ", "Should it eventually turns out that she is, it would not be for the entire four years. ", "Should she try to to something that is \"punishable by death\" in other countries, she can be impeached, and of course arrested. ", "So it's not to worry.", "\n\nWhat's to worry is the President being connected with a convicted criminal; a preacher and a group that hate America, a terrorist who bombed DC, a group that has tried to \"fix\" this election, Plager who connects with the Black Liberation Thelogy, and numberous relatives who are Muslims and one whom he supported financially in his election bid. ", "Not to mention, Obama has changed his position on key promises that he made during the primary.", "\n\n12:41Don't insult your intelligence like that. ", "There is no proof that Obama was \"palling\" with this man. ", "Look up the definition of \"pal\" if you don't know it. ", "Now if you want to see who was spending his 70th birthday with which infamous Russian underworld figure, check out this\n\nDo yourself a favor man and stay home during election day. ", "Even a cretin can see how dangerous this fluffy bunny is.", "\n\nI could not endure being in the same room with anyone who had BOMBED DC or NY or anywhere else. ", "I couldn't allow such a person to help me or contribute to my political intentions I could not sit in my seat and listen to anyone screaming how rotten America is, and how awful an entire race of people are. ", "It would be an outrage if our President a \"pal\" of a 9/11 terrorist or a domestic one. ", "It's the old \"birds of a feather flock together.\"", "\n\nHey -- Jeff. ", "I'll certainly not deprive myself of the privilege of \"saving the contry\" by voting for McCain on election day. ", "I'm just not afraid of \"fluffy bunnies\". ", "I'm afraid of terrorists and hate-ridden people.", "\n\nIfill said that Palin just blew her off and her only option was to whine and plead with Palin: Oh please, answer my questions Remember there were to be no follow-up questions.", "\n\nI think Ifill did the right thing by letting Palin go on and on. ", "Palin appealed to the right wing base which McCain already has their votes. ", "So what good did Palin do with her ramblings?", "\n\nWake up folks! ", "Learn all the facts before you shoot the moderator. ", "Also why is it NOT okay to talk about the past when it comes to Bush and McCain's support for his policies and okay to connect Obama with Ayers when Obama was 8 years old?", "\n\nBoy is McCain/Palin desperate. ", "I hope Obama comes back in a week with all the crap on both McCain and Palin.", "\n\nThe situation in Florida has changed dramatically in favor of Obama. ", "Last Friday I drove through the main downtown roads in Tampa and every a couple of traffic lights there were a bunch of young people holding Obama signs and waving. ", "Along the same roads I saw only one middle-aged couple having volunteered for the McCain camp. ", "The contrast in number was impressive. ", "Although they had posted signs, there were no other volunteers. ", "One of their signs read: \"God, guns and guts is what has made America great.", "\"Trying to attract the undecided?With that kind of sign? ", "In a city where thousands of students are voting for the first time?Remember the motto \"Target your audience?\"I have come to the conclusion that elections are won not by the best candidate but by the most competent campaign team.", "\n\nActually, McCain DID NOT pal around with Charles Keating. ", "No less than Bill Bennett - the guy who defended Clinton - was the investigator of the Keating matter and he has gone on the record as saying that McCain did NOTHING wrong and that the only reason he was kept in the group was because the Keating scandal was a Democratic scandal and they needed to have a Republican involved as well.", "\n\nThe real issue with Obama is his abject lack of experience and his heavy reliance upon advisors as a result. ", "That's why he chose Biden, who otherwise can't help him electorally.", "\n\nThe problem with Obama's advisors is he lacks the judgment to wisely choose them.", "\n\nHe was not a Christian until he arrived in Chicago, or so he claims. ", "He chose a church knowingly and fully aware that the church's basic message was a black liberation theology. ", "He HAD to know that this guy Wright was a wingnut and he has consistently lied about it. ", "No one in his right mind (pardon the pun) could really believe his denial that he had no idea that Wright was way way way off the reservation.", "\n\nYet, he baptized him and sat in that church at least 500 times during his 25 year memebership. ", "He had him as an advisor to his campaign and only took him down when people began to notice the guy was nuts.", "\n\nNow there are two ways to look at this - either he, a man who needs to rely heavily on advisors - chose a key advisely poorly, or he knowingly chose a maniac as an advisor. ", "He loses on the judgment issue either way.", "\n\nThen there is the Tony Rezko relationship.", "\n\nRezko gave him his very first campaign contribution and he had a long history of close support. ", "As a State Senator, he wrote official letters urging government loans to Rezko to rehab slums long after it was clear that he was doing a very lousy job of it. ", "He ultimately defaulted on 10s of millions of dollars of loans. ", "Many of the people affected lived in Obama's own district.", "\n\nBut when it came time for Obama to start \"moving on up\", he let Rezko know he was looking for a mansion.", "\n\nTurns out good old Tony found a place for sale across the street from his own house in Hyde Park. ", "Problem is it was out of his price range AND the seller insisted on selling the house and an adjacent lot at the same time.", "\n\nSo what happens? ", "Rezko pays full asking price for the lot while Obama gets the house at a deep discount. ", "Later on, Obama buys a piece of that lot for his yard at cost - reducing the buildable area and imparing the value of the lot.", "\n\nHmm - who would do that for the average guy? ", "And who would ever ASK?", "\n\nOnce Rezko is convicted, he too disappears from the scene.", "\n\nAs to Ayers, they have a long relationship. ", "Obama's first fundraiser was held in Ayers living room.", "\n\nBy then Obama KNEW who Ayers was and it takes a special relationship for a person to open his home to a political candidate in that way. ", "This was no passing acquaintance and Obama HAD to know what Ayers' background was. ", "Why would he have ANYTHING to do with a man who threw real bombs at American targets for political purposes? ", "Who in their right mind, looking for a political career would naively accept support without even questioning the background?", "\n\nThey spent a lot of time together on boards, including one that gave financial support to Islamic groups with an anti-Israel agenda.", "\n\nAnd when Obama was asked about the relationship, he simply said that he knew him from the neighborhood because their kids went to school together - a clear LIE.", "\n\nOnce again, it's a question of extremely poor judgement. ", "And Obama's weak effort was to make the Ayers thing go away.", "\n\nThen there's Franklin Raines - a guy who is at the center of the Fannie Mae implosion. ", "A guy who was involved with cooked books that led to him getting $91 million in pay over 5 years from a failing company. ", "Once Fannie became a problem, all of a sudden, the guy is not an advisor.", "\n\nThat's the pattern with Obama. ", "Heavily dependent upon advisors because of his lack of experience who chooses badly and tries to sweep them under the rug when their flaws become public.", "\n\nI see the McCain supporters are getting more and more desperate.... Obama was baptized late in life... maybe a latent atheist, or even a Muslim...Obama had beers with a terrorist...Obama was not toilette trained until he was five....\n\nEverything Poster 8:35 writes is true. ", "Obama's assocation with terrorists and radicals was documented and shown Sunday night on TV and it was hard to watdh it was so frightening. ", "The entire long-range relationship with foreign and domestic anti-American people could be interpreted as organized and purposeful. ", "How can we risk having a President with such, to him, amiable connections?", "\n\nIt was reported that the Obama campaign will not allow any of his college records to be released to the public for scrutiny. ", "That includes Columbia and Harvard, of course. ", "It was during that time that Obama associated with radicals. ", "It is not clear under what circumstances Obama was acceapted at Harvard.", "\n\nMy brother had an encounter with a McCain supporter in a bar in northern Michigan. ", "The guy was going on about McCain. ", "My brother asked him if he was a working man. ", "The guy said yes, I'm retired now, but I've been a union man my whole working life. ", "My brother asked him what have the Republicans ever done for the working man? ", "The guy sputtered and came up with the usual raising taxes stuff. ", "My brother then asked him point blank: Harry, are you a racist? ", "Well Harry, turned very red and just stompted out of the bar!!!", "\n\nSo I ask: Why are working folks voting for McCain and the Republicans who are against their own economic interests???????", "\n\nIt’s been a bad stretch for Sen. John McCain, but few have been willing to go this far: Former Hillary Clinton spokesman Howard Wolfson, now writing for The New Republic, declares flatly “The race is over.” ", "Sen. Barack Obama will win, he says.", "\n\n“John McCain’s candidacy is as much a casualty of Wall Street as Lehman or Merrill. ", "Like those once vibrant institutions, McCain’s collapse was stunning and quick. ", "One minute you are a well-respected brand. ", "The next you are yelling at the messengers of your demise as all around you the numbers start blinking red and stop adding up.” ", "Before the Wall Street collapse, Wolfson writes, “Senator McCain was ahead.” ", "But today, “an election dominated at its inception by the war in Iraq is now overwhelmingly focused on the economy. ", "More than half of voters in polls say that the economy is their top concern and Senator Obama enjoys double digit leads among voters asked who can better fix our economic mess. ", "Put simply, there is no way Senator McCain can win if he continues to trail Senator Obama by double digits on the top concern of more than half of voters.”", "\n\nThe economic crisis was caused by the deterioration of lending standards that were initally instituted by Carter and his Community Reinvestment Act which required banks to lend to people who didn't qualify for loans under sound business practices.", "\n\nThis was further exacerbated by Clinton who forced the GSEs to further lower the standards for buying subprime loans so that things like welfare, foodstamps and unemployment insurance counts towards credit standing.", "\n\nThe GSEs replenished the cash spent on these loans by selling them on Wall Streets as collatarlized debt instruments and Wall St bought them based on the implicit US Government guarantees.", "\n\nBush sought to add more oversight in 01 and was rebuffed by people like Dodd, Frank, Schumer and Bennett Johnson. ", "He ratcheted up the alarm later on but faced the same roadblocks. ", "With terrorism, the war and other issues on the plate, it didn't hit the headlines and didn't get adequate followup.", "\n\nBeyond that Greenspan rang the bells too, only to be told to go fly a kite.", "\n\nGreenspan owns some of this because of the long period he held rates low. ", "That increased the pool of 5 year low rate arms which touched off this mess when their re-sets started and defaults started to cascade.", "\n\nThe real problem here is the govt social plan to expand housing to people who couldn't afford it, primarily a Democratic issue, but one that Bush trumpeted as well. ", "Nonetheless, only Republicans sought to rein it in and Democrats stopped them at every effort.", "\n\nThe sick thing here is that Dems started the fire, and Obama benefits.", "\n\nTo add more irony, Obama, as President will continue the policy of helping/subsidizing the poor with even more expensive programs. ", "The Democratic Party will continue facilitating home ownership for people who cannot afford them. ", "Our standard of living for all will be lower, we will struggle; and, then all will say \"our chickens have come home to roost\" because we were so mean to poor people.", "\n\nI am your average \"man on the street\" but even I by watching Greenspan on TV knew he was making a huge mistake. ", "He said that all was well and we were going in the right direction.", "\n\nACORN is clearly an organization that has huge corrution going on in its past regarding election fraud. ", "And in several states too.", "\n\nNot only was he their lawyer at one time and assisted regarding the laws they've been regularly violating, it appears that he has paid them $800,000 this election which he tried to disclose in a misleading way.", "\n\nThe guy is bad news. ", "Period.", "\n\nAnd it should have been the issue from the jump, because he's simply unfit.", "\n\nBY Steven A. Holme\"In a move that could help increase home ownership rates among minorities and low-income consumers, the Fannie Mae Corporation is easing the credit requirements on loans that it will purchase from banks and other lenders.\"", "\n\n\"The action, which will begin as a pilot program involving 24 banks in 15 markets - including the New York metropolitan region - will encourage those banks to extend home mortgages to individuals whose credit is GENERALL NOT GOOD ENOUGH TO QUALIFY FOR CONVENTIONAL LOANS. ", "Fannie May officials say they hope to make it a nationwide program by next spring.\"", "\n\n\"Fannie Mae, the nation's biggest underwriter of home mortgages, has been under increasing pressure from the CLINTON Administration to expand Mortgage loans among low and moderate income people and felt pressure from stock holders to maintain its phenomenal growth in profits.\"", "\n\n\" . . . ", "Demographic information on these borrowers is sketchy. ", "But at least one study indicates that 18 percent of the loans in the subprime market went to black borrowers, compared to 5 percent of loans in the conventional loan market.\"", "\n\n\"In moving, even tentatively, into this new area of lending, FannieMae is taking on significantly more risk, which may not pose any difficulty during flush economic times. ", "But the government-subsidized corporation may run into trouble in an economic downturn, prompting a government rescue similar to that of the savings and loan industry in the 1980's.\"", "\n\nI thought you Obama supporters were pleased when a candidate reversed a position. ", "Obama was against spying before he was for it; OBama was against a connection between chruch and state before he was for it; Obama was against drilling before he was for it; and so many other changes of his mind. ", "I guess that's why you're for him, 8:02 He changes his postion more than McCain.", "\n\nIt seems, now that it's all coming out, that Clinton and his administration laid the groundwork for our financial disaster when he forced Fannie Mae to grant loans to people who did not qualify. ", "So what wotries me now is OBama has surrounded himself with the same financial advisors who were in Clinton's administration. ", "They are telling Obama what to do. ", "We'll have the same financial philosophy -- social reformation trumps the welfare of most Americans and the countr.", "\n\nOne of the positive things about this blog is that it shows the level of discussion Republicans are holding. ", "No wonder you have lost this election big time. ", "No wonder your leader thinks so little of you that he decided he could get you going with someone like Palin.", "I mean... you guys are an embarrassment to this great nation.", "\n\nIt was during e McCain rally that one of YOU shouted \"KILL HIM.\" ", "And the old man did not react. ", "This is the mirror of your soul. ", "Scared, worthless, losers, high school drop-outs, junkies on parole, war maniacs, assassins.", "\n\nWASHINGTON — GOP presidential nominee John McCain has past connections to a private group that supplied aid to guerrillas seeking to overthrow the leftist government of Nicaragua in the Iran-Contra affair.", "\n\nMcCain's ties are facing renewed scrutiny after his campaign criticized Barack Obama for his link to a former radical who engaged in violent acts 40 years ago.", "\n\nThe U.S. Council for World Freedom was part of an international organization linked to former Nazi collaborators and ultra-right-wing death squads in Central America. ", "The group was dedicated to stamping out communism around the globe.", "\n\nThe council's founder, retired Army Maj. ", "Gen. John Singlaub, said McCain became associated with the organization in the early 1980s as McCain was launching his political career in Arizona. ", "Singlaub said McCain was a supporter but not an active member in the group.", "\n\n\"McCain was a new guy on the block learning the ropes,\" Singlaub told The Associated Press in an interview. \"", "I think I met him in the Washington area when he was just a new congressman. ", "We had McCain on the board to make him feel like he wasn't left out. ", "It looks good to have names on a letterhead who are well-known and appreciated.", "\n\n\"I don't recall talking to McCain at all on the work of the group,\" Singlaub said.", "\n\nThe renewed attention over McCain's association with Singlaub's group comes as McCain's campaign steps up criticism of Obama's dealings with William Ayers, a college professor who co-founded the Weather Underground and years later worked on education reform in Chicago alongside Obama. ", "Ayers held a meet-the-candidate event at his home when Obama first ran for public office in the mid-1990s.", "\n\n\"The Administration\" will redefine words like \"patriotic\" and \"neighborliness\" to mean paying more taxes. \"", "The Administration\" will decide how much of your hard earned money is \"fair\" for you to keep while seizing the rest for redistribution. \"", "The Administration\" will raise taxes on all American businesses that will result in higher unemployment rates and more companies relocating to countries with more favorable tax burdens.", "\n\n\"The Administration\" will change America once and for all. ", "Domestic terrorist friends of \"The Administration\" will finally get their way.", "\n\nMcCain has suffered from his own manifest lack of interest in economic issues. ", "He was chairman of the Senate Commerce Committee for four years, but you’d never know it. ", "He repeatedly misstates his only real tax proposal for the middle class, an increase in the dependent exemption. ", "Often, he calls it a credit. ", "In the first debate, he called it a dividend. ", "He might as well lurch into Tina Fey territory and call it that “hoozie-what’s-it.” ", "Most voters probably didn’t even know that McCain had a (creative) health-care plan until Obama began lambasting it.", "\n\nHa! ", "I love the crazies coming out of the woodwork warning us all that Obama will deprive people of their civil liberties...\n\nWhere are their posts noting that Bush et al IN FACT ALREADY have repeatedly violated civil liberties and human rights?", "\n\nWhat they don't realize is that the truth (Obama is a liberal, will spend more on government programs, and is inexperienced) is actually more effective than outlandish claims like him being \"pals\" with Ayers, this Odinga bullshit,this Corsi crap, the taking out of context pieces of Rev. Wright's sermons. ", "But, please, with all that is wrong in the world today, please keep the nonsense coming. ", "It only ensures that obama will be your President come January.", "\n\nAs always Obama hedged and didn't answer questions directly. ", "When asked who he would appoint as Sec. ", "of the Treasury, he rpeated MCCain's Buffet, as he used to repeat Hillary's plans. ", "Obama had no candidate of his own to offer. ", "As always he give a lenthy introduction with repeititve info so little time is left for a full explanation.", "\n\nAnd he had the nerve to pull that \"I'm from an underpriveleged backgrouns,\" His grandmother struggled on her salary as a bank Presidnet and couldn't always buy why she needed because she was paying his tuition. ", "Food stamps, too. ", "Ha.", "\n\nAnd hesaid he went to the elite schools on scholarships but hiscampagin won't let the info frin Columbia and Harvard be released.", "\n\nSidney said \"Where are their posts noting that Bush et al IN FACT ALREADY have repeatedly violated civil liberties and human rights?\"", "\n\nConceding that tired dog for the moment, for the sake of argument. ", "If true, the question compare who's civil liberties and human rights would Obama violate compared to those claimed to have been violated by Bush.", "\n\nAt worst, Bush violated human rights of those fighting against us and with those trying to destroy us.", "\n\nObama, on the other hand has shown a willingness to target critics and suppress free speech by taking drastic measures to silence them and using law enforcement to intimidate.", "\n\nSo Sidney, whose rights are you most concerned about: foreign radicals or domestic critics?", "\n\nSomehow in the sick liberal mind there is freedom of expression when it comes to photos of a crucifix submerged in urine, but not when somebody is criticizing your messiah.", "\n\nThanks LIBS for fighting to free some thugs from Gitmo into the US. ", "One of your liberal judges just freed some into the US yesterday. ", "How long will it be before one of them is caught trying to kill Americans?", "\n\n\"At worst, Bush violated human rights of those fighting against us and with those trying to destroy us.\"", "\n\nA) this assumes that everyone tortured, imprisoned for years without hearing or access to counsel, etc.. whether at Guantanamo, Abu Ghraib, Bagram air base, any number of black sites around the world, all were \"fighting against us.\" ", "This has been proven many times (and even acknowledged by the federal government) to be demonstratively and patently false.", "\n\n2) I believe the warrantless wiretapping in contravention of the law did, in fact, involve a great many more people that do not fall under the \"fighting against us\" rubric. ", "So again, you're full of shit and play fast and loose with the facts.", "\n\nBut Obama did cave on the FISA bill. ", "That is my primary grievance against him. ", "However, many other senators, McCain included, voted for it. ", "This election presents us with a binary choice. ", "You're not going to sway anyone to vote for McCain by arguing that Obama voted for FISA, when McCain did as well. ", "It's not as if anyone other than those two stand a chance to be President. ", "So I must swallow hard when it comes to FISA.", "\n\nAccording to STATSIndiana, In 2007, Indianapolis/Marion County had an estimated population of 876,804. ", "Of that number 232,607 were below 18 years of age, for a total of 644,197 people in Marion County/Indianapolis 18 or over and thus eligible to vote. (", "Indiana allows felons to vote as long as they are not incarcerated).", "\n\nSo we have 644,197 people eligible to be registered in Marion County/Indianapolis, and 677,401 people registered. ", "Congratulations go to Indianapolis for having 105% of its residents registered!", "\n\nACORN is active and succrssfully organizing and implementing voter fraud in Ohio. ", "They are recruiting the dead, felons, drug addicts and the homeless and paying them for their \"vote\" for Obama. ", "Obama's \"team\" has become like Bush's \"Team\" in participating in voter fraud. ", "What kind of change is that?", "\n\n\"Charlene Davis, co-director of the election board in Jackson County, where Kansas City is, said the fraudulent registration forms came from the Association of Community Organizations for Reform Now, or ACORN. ", "She said they were bogging down work Wednesday, the final day Missourians could register to vote.\"", "\n\nI think most of these people mentioned in the article are not trying to commit fraud. ", "I have worked in voters registration for many years and what happens is that many people after realizing they made a mistake or after suspecting they made a mistake, send another application. ", "If an application contains a mistake it is being discarded and if it is submitted twice, the second time is discarded. ", "We never classified such acts as fraud before, these are regular mishaps during registration period. ", "We fix them. ", "If on the final day we still have problems, we give the option of provisional votes until we verify everything.", "In Florida the situation was very different. ", "The problem was with the ballots themselves.", "\n\nThis is exactly why voters must be forced to show identification. ", "Of course, the Democrats are against identification checks at the polls because they need organizations like ACORN to help them steal elections from the American people.", "\n\n\"CLEVELAND - Two Ohio voters, including Domino's pizza worker Christopher Barkley , claimed yesterday that they were hounded by the community-activist group ACORN to register to vote several times, even though they made it clear they'd already signed up.\"", "\n\n12:50 Are you Little Mary Sunshine? ", "Of course it was fraud in FL. ", "I'm not going to rehash that. ", "And of course the same thing is going on right now mostly by Acorn. ", "I saw one Acorn person said tjat they were going to shelters to get the people to vote and she admitted she was telling them to for for Obama. ", "She may not even know it's illegal since she admitted it on TV. ", "Something has got to be done immediately. ", "This is how governments are overthrown. ", "I'd feel the same if the crimes were committed for McCain. ", "How can it be stopped?????????????????????", "\n\nreally amazing...acorn is now enemy number one...this small group has not only committed massive voter fraud (amazingly all caught) but also figured out a way to bring down all the financial institutions of america...all under the wingnuts eyes\n\nand still no one can show a direct connection from acorn to obama\n\nand after 20 months on the campaign trail...with fox news doing its best, no one has found anything in obama's past to show that he is a radical anything...my god, he was doing stuff that should make every progressive nuts...he was funneling tax dollars to church based programs...what a fucking commie bastard....oh wait...wasnt that what bush was doing?", "\n\nand you guys keep throwing out names...but nothing sticks...cuz there is nothing there\n\nbut breaking today (well, really it broke months ago, but the msm refused to talk about it) is the story that americans were indeed spied upon...their intimate consversations listened to\n\nbut no...you guys would rather refight the 60s\n\nwell tell you what...post your addresses and i will be happy to plant bombs in all your toilets\n\n\"At the same time the Bush administration was negotiating a still elusive agreement to keep the U.S. military in Iraq, Democratic presidential candidate Barack Obama tried to convince Iraqi leaders in private conversations that the president shouldn't be allowed to enact the deal without congressional approval.\"", "\n\n1. ", "Direct connection between Obama and Acorn has been proven. ", "2. ", "Banks have testified that Acorn reps threatrned them and intimidated them to make the bad loans.3. ", "The money Obama was pushing through for churches was for Pflager's Churcn and Trinity. ", "Also Acorn. ", "4. ", "Omaba voted to continue to support spying on Americans. ", "He flipped to Bush's side.", "\n\n\"CLEVELAND - A man at the center of a voter-registration scandal told The Post yesterday he was given cash and cigarettes by aggressive ACORN activists in exchange for registering an astonishing 72 times, in apparent violation of Ohio laws.\"", "\n\nOne of the reasons I wanted Hillary for President was so Bill could fix the economy. ", "Now, because of the crisis we're in, I've learned that Bill is the one who started the crash by insisting Fannie Mae give loans to people who could not pay back; and, he started what became the rush to send our jobs over seas. ", "Bill Clinton, despite the good times then, started the mess we're in right now.", "\n\nso 2 people say they weree paid to register multiple times...yet the post provides no paper trail...yet their is significant evidence that thousands (not 72) of legal voters have been purged from the voter roles in battleground states\n\nand there you go again, trying to blame poor people for the economic collapse, when it was wall street that ended up doing funny things by repackaging mortgages and gambling on them...and it wasnt first home buyers that caused the crash, it was people who refi'd or got seconds....look it up nimrod\n\nas for the acorn/obama connection..there isnt one...except in the minds of you wingnut idiots\n\nevery election cycle you guys go off on acorn...and every election cycle it is proven that acorn has done absolutely nothing\n\nso shove off\n\nim so sick of you evil fucks\n\nwhy dont you go attend a mccain campaign and bitch and moan about how scared you are about what will happen if obama becomes prez...cuz shoot, things are so great after 8 years of the god bush\n\n\"CHICAGO (AP) - Jailed political fundraiser Antoin \"Tony\" Rezko, the Chicago real estate developer who helped launch Barack Obama on his political career, is whispering secrets to federal prosecutors about corruption in Illinois and the political fallout could be explosive.\"" ]
{ "pile_set_name": "Pile-CC" }
[ 0.009708737864077669, 0, 0.0078125, 0, 0.045454545454545456, 0, 0, 0.0030959752321981426, 0, 0.004750593824228029, 0, 0, 0, 0.003003003003003003, 0, 0.004975124378109453, 0.00980392156862745, 0, 0, 0, 0, 0.010178117048346057, 0, 0, 0.006097560975609756, 0.005813953488372093, 0, 0.03125, 0, 0.02127659574468085, 0, 0, 0.011111111111111112, 0, 0, 0, 0, 0, 0, 0, 0, 0.006756756756756757, 0.031007751937984496, 0.014814814814814815, 0, 0, 0.04, 0.02040816326530612, 0.023809523809523808, 0, 0, 0, 0, 0, 0.005681818181818182, 0, 0.0049504950495049506, 0, 0, 0, 0, 0, 0.00625, 0.017543859649122806, 0, 0, 0, 0, 0.045454545454545456, 0, 0, 0.011299435028248588, 0.00625, 0, 0.027777777777777776, 0, 0, 0, 0, 0.005427408412483039, 0, 0, 0, 0, 0, 0.010752688172043012, 0, 0.006711409395973154, 0, 0, 0, 0, 0, 0, 0, 0, 0.0028735632183908046, 0, 0, 0.017241379310344827, 0, 0.005555555555555556, 0, 0.01020408163265306, 0, 0, 0, 0.06666666666666667, 0.008928571428571428, 0, 0, 0, 0, 0.013157894736842105, 0, 0, 0, 0.017543859649122806, 0.030303030303030304, 0.025974025974025976, 0, 0.006060606060606061, 0.010526315789473684, 0, 0, 0, 0, 0, 0.03333333333333333, 0.015015015015015015, 0, 0.014705882352941176, 0, 0, 0, 0.011235955056179775, 0.007042253521126761, 0, 0, 0, 0, 0.022727272727272728, 0, 0.0125, 0, 0, 0, 0.01, 0, 0, 0, 0.007936507936507936, 0, 0.043478260869565216, 0, 0, 0, 0.007194244604316547, 0.012048192771084338, 0, 0, 0, 0.006172839506172839, 0, 0.016666666666666666, 0.02247191011235955, 0, 0.0136986301369863, 0, 0, 0.014492753623188406, 0, 0, 0, 0, 0.0425531914893617, 0, 0.027777777777777776, 0.011764705882352941, 0.02857142857142857, 0, 0, 0, 0, 0.015625, 0.015873015873015872, 0.008130081300813009, 0.014354066985645933, 0.027777777777777776, 0.03488372093023256, 0.0125, 0, 0, 0.025974025974025976, 0, 0.005649717514124294, 0.012903225806451613, 0.004016064257028112, 0.004608294930875576, 0.005263157894736842, 0.04310344827586207, 0, 0, 0.012987012987012988, 0.013157894736842105, 0, 0.005988023952095809, 0, 0.013888888888888888, 0, 0.01020408163265306, 0, 0.008771929824561403, 0, 0, 0, 0, 0, 0, 0, 0.008264462809917356, 0, 0, 0.007168458781362007, 0, 0, 0, 0.005747126436781609, 0, 0.011904761904761904, 0.009389671361502348, 0.0125, 0.01015228426395939, 0.015873015873015872, 0.02857142857142857, 0, 0, 0, 0, 0, 0.014925373134328358, 0, 0, 0, 0.00966183574879227, 0.006211180124223602, 0.005917159763313609, 0, 0.023255813953488372, 0.02027027027027027, 0.02666666666666667, 0.02702702702702703, 0, 0.014492753623188406, 0, 0.023809523809523808, 0.013888888888888888, 0.009433962264150943, 0, 0.0072992700729927005, 0.005405405405405406, 0, 0, 0.012345679012345678, 0.011111111111111112, 0, 0, 0, 0, 0.008620689655172414, 0, 0.004166666666666667, 0.012987012987012988, 0, 0, 0.015873015873015872, 0.025, 0.03614457831325301, 0.022727272727272728, 0, 0, 0, 0, 0.015267175572519083, 0.007407407407407408, 0, 0.006896551724137931, 0.009615384615384616, 0, 0, 0, 0, 0, 0, 0.009433962264150943, 0.00425531914893617, 0, 0, 0, 0.05128205128205128, 0, 0.01639344262295082, 0, 0.02631578947368421, 0, 0.022222222222222223, 0.009523809523809525, 0, 0, 0, 0, 0, 0, 0.01282051282051282, 0, 0.009433962264150943, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.011673151750972763, 0.02631578947368421, 0, 0, 0.014705882352941176, 0, 0, 0, 0, 0.01694915254237288, 0, 0.0014925373134328358, 0.002717391304347826, 0, 0, 0, 0.010101010101010102, 0.034482758620689655, 0, 0, 0, 0.038461538461538464, 0.00411522633744856, 0.022988505747126436, 0.00881057268722467, 0.012658227848101266, 0.0023584905660377358 ]
0.00629
5
[ { "analysis_explanation": null, "end": 24, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 0 }, { "analysis_explanation": null, "end": 103, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 95 }, { "analysis_explanation": null, "end": 109, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 104 }, { "analysis_explanation": null, "end": 132, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 123 }, { "analysis_explanation": null, "end": 153, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 142 }, { "analysis_explanation": null, "end": 253, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 248 }, { "analysis_explanation": null, "end": 333, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 328 }, { "analysis_explanation": null, "end": 426, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 416 }, { "analysis_explanation": null, "end": 528, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 510 }, { "analysis_explanation": null, "end": 564, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 556 }, { "analysis_explanation": null, "end": 599, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 588 }, { "analysis_explanation": null, "end": 619, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 615 }, { "analysis_explanation": null, "end": 661, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 657 }, { "analysis_explanation": null, "end": 1090, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1085 }, { "analysis_explanation": null, "end": 1107, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1102 }, { "analysis_explanation": null, "end": 1153, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1142 }, { "analysis_explanation": null, "end": 1614, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1606 }, { "analysis_explanation": null, "end": 1708, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1703 }, { "analysis_explanation": null, "end": 2000, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1989 }, { "analysis_explanation": null, "end": 2276, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2271 }, { "analysis_explanation": null, "end": 2490, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2484 }, { "analysis_explanation": null, "end": 2717, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2712 }, { "analysis_explanation": null, "end": 2817, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2812 }, { "analysis_explanation": null, "end": 2953, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2948 }, { "analysis_explanation": null, "end": 2999, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2988 }, { "analysis_explanation": null, "end": 3018, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3010 }, { "analysis_explanation": null, "end": 3228, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3215 }, { "analysis_explanation": null, "end": 3355, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3346 }, { "analysis_explanation": null, "end": 3569, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3564 }, { "analysis_explanation": null, "end": 3646, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3636 }, { "analysis_explanation": null, "end": 3694, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3690 }, { "analysis_explanation": null, "end": 3751, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3740 }, { "analysis_explanation": null, "end": 3818, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3797 }, { "analysis_explanation": null, "end": 4025, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4020 }, { "analysis_explanation": null, "end": 4180, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4175 }, { "analysis_explanation": null, "end": 4517, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4512 }, { "analysis_explanation": null, "end": 4823, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4818 }, { "analysis_explanation": null, "end": 4968, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4963 }, { "analysis_explanation": null, "end": 5369, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5361 }, { "analysis_explanation": null, "end": 5536, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5531 }, { "analysis_explanation": null, "end": 5560, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5555 }, { "analysis_explanation": null, "end": 5586, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5579 }, { "analysis_explanation": null, "end": 5594, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5590 }, { "analysis_explanation": null, "end": 5726, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5718 }, { "analysis_explanation": null, "end": 5760, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5752 }, { "analysis_explanation": null, "end": 5845, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5840 }, { "analysis_explanation": null, "end": 6021, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6013 }, { "analysis_explanation": null, "end": 6089, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6079 }, { "analysis_explanation": null, "end": 6358, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6349 }, { "analysis_explanation": null, "end": 6802, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6797 }, { "analysis_explanation": null, "end": 6969, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6962 }, { "analysis_explanation": null, "end": 7080, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7074 }, { "analysis_explanation": null, "end": 7174, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7166 }, { "analysis_explanation": null, "end": 7418, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7408 }, { "analysis_explanation": null, "end": 7558, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7553 }, { "analysis_explanation": null, "end": 7789, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7782 }, { "analysis_explanation": null, "end": 7797, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7794 }, { "analysis_explanation": null, "end": 7819, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7811 }, { "analysis_explanation": null, "end": 8159, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8142 }, { "analysis_explanation": null, "end": 8228, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8224 }, { "analysis_explanation": null, "end": 8381, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8376 }, { "analysis_explanation": null, "end": 8596, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8590 }, { "analysis_explanation": null, "end": 8613, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8608 }, { "analysis_explanation": null, "end": 8678, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8672 }, { "analysis_explanation": null, "end": 8707, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8701 }, { "analysis_explanation": null, "end": 8798, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8790 }, { "analysis_explanation": null, "end": 8886, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8880 }, { "analysis_explanation": null, "end": 8893, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8888 }, { "analysis_explanation": null, "end": 9058, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9048 }, { "analysis_explanation": null, "end": 9126, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9120 }, { "analysis_explanation": null, "end": 9172, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9166 }, { "analysis_explanation": null, "end": 9266, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9257 }, { "analysis_explanation": null, "end": 9340, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9330 }, { "analysis_explanation": null, "end": 9357, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9353 }, { "analysis_explanation": null, "end": 9375, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9370 }, { "analysis_explanation": null, "end": 9654, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9648 }, { "analysis_explanation": null, "end": 9704, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9697 }, { "analysis_explanation": null, "end": 9826, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9817 }, { "analysis_explanation": null, "end": 9981, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9976 }, { "analysis_explanation": null, "end": 10186, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10181 }, { "analysis_explanation": null, "end": 10383, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10378 }, { "analysis_explanation": null, "end": 10482, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10477 }, { "analysis_explanation": null, "end": 10569, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10564 }, { "analysis_explanation": null, "end": 10605, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10600 }, { "analysis_explanation": null, "end": 10714, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10693 }, { "analysis_explanation": null, "end": 10981, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10974 }, { "analysis_explanation": null, "end": 11008, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11006 }, { "analysis_explanation": null, "end": 11151, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11144 }, { "analysis_explanation": null, "end": 11232, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11227 }, { "analysis_explanation": null, "end": 11382, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11377 }, { "analysis_explanation": null, "end": 11551, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11544 }, { "analysis_explanation": null, "end": 11644, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11632 }, { "analysis_explanation": null, "end": 11781, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11779 }, { "analysis_explanation": null, "end": 11959, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11952 }, { "analysis_explanation": null, "end": 12156, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12152 }, { "analysis_explanation": null, "end": 12252, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12246 }, { "analysis_explanation": null, "end": 12268, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12256 }, { "analysis_explanation": null, "end": 12381, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12376 }, { "analysis_explanation": null, "end": 12453, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12448 }, { "analysis_explanation": null, "end": 12586, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12581 }, { "analysis_explanation": null, "end": 12606, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12601 }, { "analysis_explanation": null, "end": 12651, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12645 }, { "analysis_explanation": null, "end": 12699, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12694 }, { "analysis_explanation": null, "end": 12858, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12854 }, { "analysis_explanation": null, "end": 12869, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12863 }, { "analysis_explanation": null, "end": 12922, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12917 }, { "analysis_explanation": null, "end": 12933, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12928 }, { "analysis_explanation": null, "end": 12944, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12939 }, { "analysis_explanation": null, "end": 12960, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12949 }, { "analysis_explanation": null, "end": 12975, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12969 }, { "analysis_explanation": null, "end": 12981, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12976 }, { "analysis_explanation": null, "end": 13005, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13000 }, { "analysis_explanation": null, "end": 13026, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13020 }, { "analysis_explanation": null, "end": 13059, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13053 }, { "analysis_explanation": null, "end": 13069, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13064 }, { "analysis_explanation": null, "end": 13095, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13088 }, { "analysis_explanation": null, "end": 13138, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13133 }, { "analysis_explanation": null, "end": 13151, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13140 }, { "analysis_explanation": null, "end": 13200, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13195 }, { "analysis_explanation": null, "end": 13286, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13281 }, { "analysis_explanation": null, "end": 13393, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13387 }, { "analysis_explanation": null, "end": 13572, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13565 }, { "analysis_explanation": null, "end": 13748, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13737 }, { "analysis_explanation": null, "end": 13883, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13877 }, { "analysis_explanation": null, "end": 13923, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13908 }, { "analysis_explanation": null, "end": 13950, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13938 }, { "analysis_explanation": null, "end": 13981, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13974 }, { "analysis_explanation": null, "end": 14019, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14012 }, { "analysis_explanation": null, "end": 14078, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14072 }, { "analysis_explanation": null, "end": 14170, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14163 }, { "analysis_explanation": null, "end": 14195, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14185 }, { "analysis_explanation": null, "end": 14240, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14230 }, { "analysis_explanation": null, "end": 14284, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14279 }, { "analysis_explanation": null, "end": 14393, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14388 }, { "analysis_explanation": null, "end": 14459, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14454 }, { "analysis_explanation": null, "end": 14541, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14532 }, { "analysis_explanation": null, "end": 14569, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14562 }, { "analysis_explanation": null, "end": 14732, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14726 }, { "analysis_explanation": null, "end": 14891, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14885 }, { "analysis_explanation": null, "end": 15010, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15003 }, { "analysis_explanation": null, "end": 15378, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15364 }, { "analysis_explanation": null, "end": 15755, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15750 }, { "analysis_explanation": null, "end": 15803, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15798 }, { "analysis_explanation": null, "end": 15900, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15896 }, { "analysis_explanation": null, "end": 15973, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15964 }, { "analysis_explanation": null, "end": 16168, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16163 }, { "analysis_explanation": null, "end": 16219, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16214 }, { "analysis_explanation": null, "end": 16470, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16465 }, { "analysis_explanation": null, "end": 16508, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16503 }, { "analysis_explanation": null, "end": 16545, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16540 }, { "analysis_explanation": null, "end": 16572, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16567 }, { "analysis_explanation": null, "end": 16587, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16582 }, { "analysis_explanation": null, "end": 16738, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16733 }, { "analysis_explanation": null, "end": 16761, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16756 }, { "analysis_explanation": null, "end": 16855, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16847 }, { "analysis_explanation": null, "end": 17111, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 17104 }, { "analysis_explanation": null, "end": 17138, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 17127 }, { "analysis_explanation": null, "end": 17161, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 17156 }, { "analysis_explanation": null, "end": 17374, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 17369 }, { "analysis_explanation": null, "end": 17410, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 17405 }, { "analysis_explanation": null, "end": 17454, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 17439 }, { "analysis_explanation": null, "end": 17609, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 17602 }, { "analysis_explanation": null, "end": 17737, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 17732 }, { "analysis_explanation": null, "end": 17909, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 17903 }, { "analysis_explanation": null, "end": 17966, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 17961 }, { "analysis_explanation": null, "end": 18036, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 18030 }, { "analysis_explanation": null, "end": 18044, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 18039 }, { "analysis_explanation": null, "end": 18079, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 18074 }, { "analysis_explanation": null, "end": 18172, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 18167 }, { "analysis_explanation": null, "end": 18252, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 18240 }, { "analysis_explanation": null, "end": 18381, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 18368 }, { "analysis_explanation": null, "end": 18544, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 18539 }, { "analysis_explanation": null, "end": 18720, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 18715 }, { "analysis_explanation": null, "end": 18793, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 18788 }, { "analysis_explanation": null, "end": 18861, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 18855 }, { "analysis_explanation": null, "end": 18901, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 18893 }, { "analysis_explanation": null, "end": 18936, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 18930 }, { "analysis_explanation": null, "end": 19114, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19103 }, { "analysis_explanation": null, "end": 19256, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19251 }, { "analysis_explanation": null, "end": 19286, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19281 }, { "analysis_explanation": null, "end": 19389, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19383 }, { "analysis_explanation": null, "end": 19409, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19398 }, { "analysis_explanation": null, "end": 19506, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19495 }, { "analysis_explanation": null, "end": 19572, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19557 }, { "analysis_explanation": null, "end": 19597, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19583 }, { "analysis_explanation": null, "end": 19686, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19674 }, { "analysis_explanation": null, "end": 19718, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19707 }, { "analysis_explanation": null, "end": 19834, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19828 }, { "analysis_explanation": null, "end": 19880, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 19870 }, { "analysis_explanation": null, "end": 20081, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20074 }, { "analysis_explanation": null, "end": 20105, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20099 }, { "analysis_explanation": null, "end": 20127, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20122 }, { "analysis_explanation": null, "end": 20187, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20183 }, { "analysis_explanation": null, "end": 20327, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20322 }, { "analysis_explanation": null, "end": 20453, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20447 }, { "analysis_explanation": null, "end": 20500, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20495 }, { "analysis_explanation": null, "end": 20679, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20673 }, { "analysis_explanation": null, "end": 20854, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20847 }, { "analysis_explanation": null, "end": 20971, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 20961 }, { "analysis_explanation": null, "end": 21224, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 21220 }, { "analysis_explanation": null, "end": 21259, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 21257 }, { "analysis_explanation": null, "end": 21296, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 21292 }, { "analysis_explanation": null, "end": 21303, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 21298 }, { "analysis_explanation": null, "end": 21312, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 21305 }, { "analysis_explanation": null, "end": 21332, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 21317 }, { "analysis_explanation": null, "end": 21538, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 21529 }, { "analysis_explanation": null, "end": 21602, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 21593 }, { "analysis_explanation": null, "end": 21700, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 21694 }, { "analysis_explanation": null, "end": 21923, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 21913 }, { "analysis_explanation": null, "end": 21948, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 21944 }, { "analysis_explanation": null, "end": 21997, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 21986 }, { "analysis_explanation": null, "end": 22032, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 22023 }, { "analysis_explanation": null, "end": 22095, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 22091 }, { "analysis_explanation": null, "end": 22123, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 22118 }, { "analysis_explanation": null, "end": 22158, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 22153 }, { "analysis_explanation": null, "end": 22599, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 22590 }, { "analysis_explanation": null, "end": 23177, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 23159 }, { "analysis_explanation": null, "end": 23503, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 23495 }, { "analysis_explanation": null, "end": 23750, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 23739 }, { "analysis_explanation": null, "end": 24619, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 24615 }, { "analysis_explanation": null, "end": 24643, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 24638 }, { "analysis_explanation": null, "end": 24711, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 24706 }, { "analysis_explanation": null, "end": 24798, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 24792 }, { "analysis_explanation": null, "end": 24836, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 24831 }, { "analysis_explanation": null, "end": 24998, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 24992 }, { "analysis_explanation": null, "end": 25052, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 25045 }, { "analysis_explanation": null, "end": 25302, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 25295 }, { "analysis_explanation": null, "end": 25343, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 25338 }, { "analysis_explanation": null, "end": 25455, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 25446 }, { "analysis_explanation": null, "end": 25567, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 25556 }, { "analysis_explanation": null, "end": 25737, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 25732 }, { "analysis_explanation": null, "end": 25823, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 25817 }, { "analysis_explanation": null, "end": 26033, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 26023 }, { "analysis_explanation": null, "end": 26072, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 26061 }, { "analysis_explanation": null, "end": 26201, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 26192 }, { "analysis_explanation": null, "end": 26235, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 26229 }, { "analysis_explanation": null, "end": 26313, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 26301 }, { "analysis_explanation": null, "end": 26387, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 26375 }, { "analysis_explanation": null, "end": 26487, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 26483 }, { "analysis_explanation": null, "end": 26554, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 26539 }, { "analysis_explanation": null, "end": 26683, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 26670 }, { "analysis_explanation": null, "end": 26696, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 26690 }, { "analysis_explanation": null, "end": 26755, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 26740 }, { "analysis_explanation": null, "end": 26765, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 26759 }, { "analysis_explanation": null, "end": 26811, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 26804 }, { "analysis_explanation": null, "end": 26821, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 26813 }, { "analysis_explanation": null, "end": 26833, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 26827 }, { "analysis_explanation": null, "end": 26896, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 26890 }, { "analysis_explanation": null, "end": 26953, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 26945 }, { "analysis_explanation": null, "end": 27034, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 27024 }, { "analysis_explanation": null, "end": 27089, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 27083 }, { "analysis_explanation": null, "end": 27258, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 27252 }, { "analysis_explanation": null, "end": 27301, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 27293 }, { "analysis_explanation": null, "end": 27341, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 27335 }, { "analysis_explanation": null, "end": 27369, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 27361 }, { "analysis_explanation": null, "end": 27393, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 27387 }, { "analysis_explanation": null, "end": 27432, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 27427 }, { "analysis_explanation": null, "end": 27462, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 27449 }, { "analysis_explanation": null, "end": 27522, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 27499 }, { "analysis_explanation": null, "end": 27538, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 27527 }, { "analysis_explanation": null, "end": 27576, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 27569 }, { "analysis_explanation": null, "end": 27592, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 27587 }, { "analysis_explanation": null, "end": 27599, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 27594 }, { "analysis_explanation": null, "end": 27654, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 27649 }, { "analysis_explanation": null, "end": 27699, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 27686 }, { "analysis_explanation": null, "end": 27999, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 27991 }, { "analysis_explanation": null, "end": 28173, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 28166 }, { "analysis_explanation": null, "end": 28277, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 28271 }, { "analysis_explanation": null, "end": 28413, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 28403 }, { "analysis_explanation": null, "end": 28664, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 28656 }, { "analysis_explanation": null, "end": 28761, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 28755 }, { "analysis_explanation": null, "end": 28807, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 28802 }, { "analysis_explanation": null, "end": 28904, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 28899 }, { "analysis_explanation": null, "end": 28992, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 28988 }, { "analysis_explanation": null, "end": 29122, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 29117 }, { "analysis_explanation": null, "end": 29281, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 29276 }, { "analysis_explanation": null, "end": 29294, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 29288 }, { "analysis_explanation": null, "end": 29314, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 29309 }, { "analysis_explanation": null, "end": 29368, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 29362 }, { "analysis_explanation": null, "end": 29434, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 29429 }, { "analysis_explanation": null, "end": 29531, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 29524 }, { "analysis_explanation": null, "end": 29548, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 29543 }, { "analysis_explanation": null, "end": 29707, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 29700 }, { "analysis_explanation": null, "end": 29722, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 29717 }, { "analysis_explanation": null, "end": 30004, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 29995 }, { "analysis_explanation": null, "end": 30112, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 30106 }, { "analysis_explanation": null, "end": 30238, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 30232 }, { "analysis_explanation": null, "end": 30283, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 30279 }, { "analysis_explanation": null, "end": 30513, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 30508 }, { "analysis_explanation": null, "end": 30577, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 30573 }, { "analysis_explanation": null, "end": 30593, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 30589 }, { "analysis_explanation": null, "end": 30687, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 30682 }, { "analysis_explanation": null, "end": 30867, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 30861 }, { "analysis_explanation": null, "end": 31189, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 31187 }, { "analysis_explanation": null, "end": 31245, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 31243 }, { "analysis_explanation": null, "end": 31255, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 31246 }, { "analysis_explanation": null, "end": 31330, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 31321 }, { "analysis_explanation": null, "end": 31347, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 31343 }, { "analysis_explanation": null, "end": 31497, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 31492 }, { "analysis_explanation": null, "end": 31575, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 31565 }, { "analysis_explanation": null, "end": 31583, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 31577 }, { "analysis_explanation": null, "end": 32046, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 32041 }, { "analysis_explanation": null, "end": 32152, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 32146 }, { "analysis_explanation": null, "end": 32275, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 32269 }, { "analysis_explanation": null, "end": 32297, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 32292 }, { "analysis_explanation": null, "end": 32325, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 32319 }, { "analysis_explanation": null, "end": 32494, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 32490 }, { "analysis_explanation": null, "end": 32508, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 32496 }, { "analysis_explanation": null, "end": 32522, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 32509 }, { "analysis_explanation": null, "end": 32612, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 32597 }, { "analysis_explanation": null, "end": 32660, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 32647 }, { "analysis_explanation": null, "end": 32673, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 32661 }, { "analysis_explanation": null, "end": 32721, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 32714 }, { "analysis_explanation": null, "end": 32851, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 32838 }, { "analysis_explanation": null, "end": 32864, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 32852 }, { "analysis_explanation": null, "end": 32931, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 32919 }, { "analysis_explanation": null, "end": 33009, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 32997 }, { "analysis_explanation": null, "end": 33057, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 33053 }, { "analysis_explanation": null, "end": 33169, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 33164 }, { "analysis_explanation": null, "end": 33176, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 33171 }, { "analysis_explanation": null, "end": 33206, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 33202 }, { "analysis_explanation": null, "end": 33293, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 33279 }, { "analysis_explanation": null, "end": 33346, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 33332 }, { "analysis_explanation": null, "end": 33365, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 33354 }, { "analysis_explanation": null, "end": 33534, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 33525 }, { "analysis_explanation": null, "end": 33561, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 33550 }, { "analysis_explanation": null, "end": 33724, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 33714 }, { "analysis_explanation": null, "end": 34117, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 34104 }, { "analysis_explanation": null, "end": 34220, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 34213 }, { "analysis_explanation": null, "end": 34390, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 34381 }, { "analysis_explanation": null, "end": 34527, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 34519 }, { "analysis_explanation": null, "end": 34557, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 34553 }, { "analysis_explanation": null, "end": 34617, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 34598 }, { "analysis_explanation": null, "end": 34637, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 34628 }, { "analysis_explanation": null, "end": 34856, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 34854 }, { "analysis_explanation": null, "end": 35097, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 35092 }, { "analysis_explanation": null, "end": 35302, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 35296 }, { "analysis_explanation": null, "end": 35561, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 35554 }, { "analysis_explanation": null, "end": 35679, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 35670 }, { "analysis_explanation": null, "end": 36004, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 36000 }, { "analysis_explanation": null, "end": 36122, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 36117 }, { "analysis_explanation": null, "end": 36156, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 36146 }, { "analysis_explanation": null, "end": 36223, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 36214 }, { "analysis_explanation": null, "end": 36338, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 36335 }, { "analysis_explanation": null, "end": 36463, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 36459 }, { "analysis_explanation": null, "end": 36537, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 36533 }, { "analysis_explanation": null, "end": 36554, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 36550 }, { "analysis_explanation": null, "end": 36566, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 36556 }, { "analysis_explanation": null, "end": 36602, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 36590 }, { "analysis_explanation": null, "end": 36626, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 36621 }, { "analysis_explanation": null, "end": 36785, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 36780 }, { "analysis_explanation": null, "end": 36930, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 36925 }, { "analysis_explanation": null, "end": 36988, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 36982 }, { "analysis_explanation": null, "end": 37022, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 37017 }, { "analysis_explanation": null, "end": 37071, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 37062 }, { "analysis_explanation": null, "end": 37091, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 37087 }, { "analysis_explanation": null, "end": 37188, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 37179 }, { "analysis_explanation": null, "end": 37334, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 37330 }, { "analysis_explanation": null, "end": 37377, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 37370 }, { "analysis_explanation": null, "end": 37403, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 37399 }, { "analysis_explanation": null, "end": 37486, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 37482 }, { "analysis_explanation": null, "end": 37666, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 37654 }, { "analysis_explanation": null, "end": 37890, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 37888 }, { "analysis_explanation": null, "end": 38247, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 38240 }, { "analysis_explanation": null, "end": 38292, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 38287 }, { "analysis_explanation": null, "end": 38566, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 38560 }, { "analysis_explanation": null, "end": 38651, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 38646 }, { "analysis_explanation": null, "end": 38711, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 38704 }, { "analysis_explanation": null, "end": 38737, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 38730 }, { "analysis_explanation": null, "end": 38792, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 38773 }, { "analysis_explanation": null, "end": 38805, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 38798 }, { "analysis_explanation": null, "end": 38858, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 38846 }, { "analysis_explanation": null, "end": 38957, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 38949 }, { "analysis_explanation": null, "end": 1419, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 1409 }, { "analysis_explanation": null, "end": 2086, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 2071 }, { "analysis_explanation": null, "end": 8659, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 8647 }, { "analysis_explanation": null, "end": 8828, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 8818 }, { "analysis_explanation": null, "end": 9002, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 8995 }, { "analysis_explanation": null, "end": 9202, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 9191 }, { "analysis_explanation": null, "end": 9739, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 9728 }, { "analysis_explanation": null, "end": 35366, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 35354 }, { "analysis_explanation": null, "end": 35398, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 35390 }, { "analysis_explanation": null, "end": 35566, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 35554 }, { "analysis_explanation": null, "end": 35818, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 35805 }, { "analysis_explanation": null, "end": 36078, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 36067 }, { "analysis_explanation": null, "end": 36251, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 36242 }, { "analysis_explanation": null, "end": 37797, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 37787 }, { "analysis_explanation": null, "end": 37836, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 37826 }, { "analysis_explanation": null, "end": 38156, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 38147 }, { "analysis_explanation": null, "end": 38307, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 38293 }, { "analysis_explanation": null, "end": 38415, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 38405 }, { "analysis_explanation": null, "end": 38669, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 38660 }, { "analysis_explanation": null, "end": 23661, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 23649 }, { "analysis_explanation": null, "end": 12065, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 12061 } ]
[ "Hypercalciuria induced by a high dose of cinacalcet in a renal-transplant recipient.", "\nThe successful use of cinacalcet in dialysis patients and in patients with primary hyperparathyroidism has prompted transplant physicians to use it to treat renal-transplant patients with persisting hyperparathyroidism. ", "However, in the setting of kidney transplantation, many questions remain unanswered, i.e. the time of initiation of cinacalcet after transplantation, its dosage and the side effects on kidney function all remain unknown. ", "Herein, we report on a kidney-transplant recipient with persisting hyperparathyroidism who developed hypercalciuria afterreceiving high doses of cinacalcet. ", "Cinacalcet was started 3 months after transplantation at a once-daily dose of 60 mg. ", "Thereafter, the dosage was increased progressively because of persistant hyperparathyroidism and hypercalcemia. ", "At a dose of 90 mg b.i.d, hypercalciuria occurred. ", "The latter disappeared after reduction of cinacalcet dosage. ", "Cinacalcet might be responsible for urinary calcium excretion, either by reduction of tubular calcium reabsorption via the reduction of PTH level, or by its direct effect on the calcium sensor receptor located in the upper thick ascending limb of the loop of Henle. ", "We conclude that cinacalcet should be used with caution in renal-transplant patients. ", "Further investigations are required to determine the best way to use this drug in this setting." ]
{ "pile_set_name": "PubMed Abstracts" }
[ 0, 0, 0, 0.006369426751592357, 0, 0, 0, 0, 0.0037593984962406013, 0, 0 ]
0.000921
5
[ { "analysis_explanation": null, "end": 14, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 0 }, { "analysis_explanation": null, "end": 714, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 706 }, { "analysis_explanation": null, "end": 752, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 747 }, { "analysis_explanation": null, "end": 920, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 906 }, { "analysis_explanation": null, "end": 1131, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1128 } ]
[ "Is Craft Beer Really a Good Business Bet?", "\n\nThe craft beer business is booming, but one of the nation’s biggest alcoholic beverage companies has no plans to get in on the action.", "\n\nRob Sands, chief executive of beer and wine distributor Constellation Brands (STZ), is not interested in buying up any of the nearly 2,500 craft breweries that have sprung up across the nation in recent years.", "\n\n“People expect one of the big guys to get in and roll up the craft business,” Sands said in a recent interview. “", "But it’s not clear that’s a good strategy.”", "\n\nFor fans of locally made beer, that may come as a bit of a relief. ", "But it’s also a bit surprising considering the explosive growth craft beers have experienced in recent years.", "\n\nRelated: Small craft breweries hit it big\n\nCraft beers made up nearly 8% of the overall beer market by volume in 2013, up from 3.7% in 2007, according to the Brewers Association. ", "The group estimates that craft brews had a retail value of $14.3 billion last year." ]
{ "pile_set_name": "Pile-CC" }
[ 0, 0, 0.014218009478672985, 0.008695652173913044, 0, 0, 0, 0.0055248618784530384, 0 ]
0.00316
5
[ { "analysis_explanation": null, "end": 186, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 177 }, { "analysis_explanation": null, "end": 385, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 373 }, { "analysis_explanation": null, "end": 720, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 708 }, { "analysis_explanation": null, "end": 839, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 835 }, { "analysis_explanation": null, "end": 861, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 857 }, { "analysis_explanation": null, "end": 983, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 974 } ]
[ "Q:\n\nwhile loop does not terminate - float arithmetic\n\nI am working on C program with float values, below is my code. ", "\n#include<stdio.h>\n#include<stdlib.h>\n#include<float.h> \n\nint main()\n{\n int counter = 0;\n float quarter = 0.25;\n float dime = 0.10;\n float nickel = 0.05;\n float penny = 0.01;\n\n float change = 0.00;\n\n printf(\"hi, how much do i owe u?\\t\");\n scanf(\"%f\", &change);\n\n while(change > 0.0)\n {\n if(change >= quarter)\n {\n change -= quarter;\n printf(\"quarter %.2f\\n\", quarter);\n }\n else if(change >= dime)\n {\n change -= dime;\n printf(\"dime %.2f\\n\", dime);\n }\n else if(change >= nickel)\n {\n change -= nickel;\n printf(\"nickel %.2f\\n\", nickel);\n }\n else if(change >= penny)\n {\n change -= penny;\n printf(\"penny %.2f\\n\", penny);\n }\n\n counter++; \n }\n\n printf(\"your count is %i\\n\", counter);\n\n return 0;\n}\n\nOutput is:\nhi, how much do i owe u? ", " .45\nquarter 0.25\ndime 0.10\nnickel 0.05\npenny 0.01\npenny 0.01\npenny 0.01\npenny 0.01\n`^C`\n\nI have to press ctrl c to terminate loop \nLast printf(\"your count is %i\\n\", counter); does not execute at all - to count # of coins used\nIf i replace float type with int it works OK. ", "\nPlease help with this problem\n\nA:\n\nAdding this at the beginning of your loop:\nif (change < penny) {\n printf(\"remaining: %.10f\\n\", change);\n break;\n}\n\nWill issue this output:\nhi, how much do i owe u? ", " .45\nquarter 0.25\ndime 0.10\nnickel 0.05\npenny 0.01\npenny 0.01\npenny 0.01\npenny 0.01\nremaining: 0.0099999849\nyour count is 7\n\nThis is caused by the internal float numbers representation. ", "There's an intrinsic error - most float numbers do not have an exact representation - they're just really good approximates.", "\n\n" ]
{ "pile_set_name": "StackExchange" }
[ 0, 0, 0, 0, 0, 0, 0 ]
0
5
[ { "analysis_explanation": null, "end": 503, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 493 }, { "analysis_explanation": null, "end": 549, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 542 }, { "analysis_explanation": null, "end": 1646, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 1636 }, { "analysis_explanation": null, "end": 1646, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 1636 } ]
[ "Introduction {#s1}\n============\n\nAutotomy is an efficient reflexive response that is considered to be a useful adaptive mechanism for avoiding predators and limiting injuries, which commonly occur in both vertebrate and invertebrate populations (Wasson et al., [", "@B63]; Knope and Larson, [@B22]). ", "Although autotomy can help animals temporarily escape from danger, the loss of one or more limbs can cause several adverse effects. ", "For example, chelipeds play an important role in the defense, capture, manipulation, and subjugation of prey for crustaceans (Lawton, [@B24]). ", "Moreover, cheliped autotomy may result in the loss of long-term energy and functionality (Fleming et al., [", "@B10]). ", "Thus, the damage or loss of limbs and chelipeds can cause profound effects on feeding efficiency (Brock and Smith, [@B4]), immunity and antibacterial response (Yang et al., [", "@B68]), molting cycle (Quinitio and Estepa, [@B46]), survival rate (Simonson, [@B51]), and ecological community distribution (Oliveira et al., [", "@B38]). ", "In addition, limb autotomy in the context of life- threatening situations typically serves as a temporary buffer. ", "When an animal who has experienced limb-loss is attacked again, it is generally difficult for it to escape. ", "Therefore, limb regeneration is the most effective means for crabs to compensate for the heavy cost of limb-loss.", "\n\nThe Chinese mitten crab, *Eriocheir sinensis*, is an important specialty aquaculture species, which occupies an important position in the Chinese aquaculture industry. ", "In the pond culture of *E. sinensis*, various factors can cause a high rate of limb-loss (autotomy and impairment), including predation, fighting behavior, defense and foraging, lack of food, unsuccessful or unsynchronized molting, high-density farming, or artificial harvesting (Mcvean and Findlay, [@B34]; Lipcius and Herrnkind, [@B29]; Thomas et al., [", "@B55]; Riquelme-Bugueño, [@B47]; Rodriguez et al., [", "@B48]; Sui et al., [", "@B54]). ", "Furthermore, a high rate of limb autotomy can seriously impact the culture benefit of *E. sinensis*. ", "Therefore, it is of particular importance to artificially promote limb regeneration.", "\n\nOne study on the regulatory mechanisms of limb regeneration in *Uca pugilator* found that the process is primarily dependent on the co-regulation of ecdysteroid and molt-inhibiting hormone (MIH), in which ecdysteroid from the Y-organs and other tissues can promote regeneration. ", "Moreover, since MIH produced in the eyestalk inhibits limb regeneration (Hopkins, [@B19]), in theory, eyestalk ablation can promote limb regeneration. ", "However, there are no reports describing the effect of eyestalk on the limb regeneration of *E. sinensis*.", "\n\nMelatonin is a well-known pineal hormone that participates in both circadian and seasonal rhythms and has been widely studied in vertebrates. ", "Although melatonin has been found in almost all organisms, the role of melatonin in invertebrates is not fully understood. ", "In crustaceans, melatonin is distributed throughout many tissues and organs, including the hemolymph, cranial ganglia, and eyestalk ganglia (Meyer-Rochow, [@B35]; Tilden et al., [", "@B56]; Pape et al., [", "@B42]). ", "Moreover, some studies have demonstrated that melatonin has many significant physiological functions in crustaceans, such as regulating hemolymph glucose (Maciel et al., [", "@B30]), enhancing antioxidant capacity (Maciel et al., [", "@B31]), affecting reproductive function (Girish et al., [", "@B12]), promoting limb regeneration (Tilden et al., [", "@B57]), controlling the molting cycle, and mediating circadian rhythms (Sainath et al., [", "@B49]). ", "However, the role of melatonin in the promotion of limb regeneration has not been studied in *E. sinensis*.", "\n\nIn crustaceans, ecdysteroid receptors (EcR) are activated by binding ecdysteroid (Hopkins et al., [", "@B18]). ", "Moreover, chitinase (Chi) is crucial for crustacean molting and regeneration processes (Priya et al., [", "@B44]). ", "Furthermore, digestive enzyme activity directly reflects the ability of an organism to digest and absorb nutrients, which determines the rate of growth and development (Lin et al., [", "@B27]). ", "Although some studies have reported that eyestalk ablation or limb-impairment will affect crustacean immunity, the protective effect of melatonin on this type of injury has not been reported (Maggioni et al., [", "@B32]; Yang et al., [", "@B68]).", "\n\nIn the present study, we evaluated the cheliped regeneration rate (bud length R value), the expression of growth-related genes (*EcR, MIH*, and *Chi*), and the digestive enzyme activity of the hepatopancreas (activity of α-amylase, trypsin, and lipase) to verify the effect of melatonin on limb regeneration in *E. sinensis*. ", "Moreover, we also evaluated the effects of melatonin on the survival rate of *E. sinensis* with cheliped autotomy and eyestalk-ablation, as well as the impact on immune function by measuring the changes in serum immune factors \\[total hemocyte counts (THC), hemocyanin content, and hydrolytic enzyme\\] and antioxidant capacity \\[total antioxidant capacity (T-AOC), superoxide dismutase (SOD), and glutathione peroxidase activity (GSH-Px)\\] during this process. ", "Through the above experimental results, we initially explored the effects of melatonin on cheliped regeneration the mechanism of action, and potential relationship with the eyestalk.", "\n\nMaterials and methods {#s2}\n=====================\n\nExperimental crabs\n------------------\n\nAll experimental protocols were reviewed and approved by the Animal Bioethics Committee, Shanghai Ocean University, China. ", "During early July 2017, 400 male hard-shelled crabs that had just completed molting and limb-intact *E. sinensis* (*Crustacea*; *Decapoda*; *Grapsidae*) juvenile crabs (4.98 g ± 0.90 g) were collected from a commercial farm in Jintan (Jiangsu Province, China). ", "The juvenile crabs were acclimated for 1 week in monoculture systems that were supplied with continuous aerated freshwater \\[26--28°C; pH: 7.84 ± 0.08; dissolved oxygen (DO) concentration: 6.3 ± 0.4 mg/L; salinity: 0.3%, total ammonia: 0.36 ± 0.03 mg/L; chloride level: 136 ± 15 mg/L; and basal nitrite \\<0.05 mg/L^−1^\\] and natural photoperiod conditioning for 1 week. ", "The crabs were fed once a day with a commercial crab diet.", "\n\nExperimental design\n-------------------\n\nHealthy and limb-intact crabs were selected from the 400 crabs and subjected to autotomy of the left cheliped. ", "Autonomy was achieved by gently grasping the limbs using the researcher\\'s fingers, at which point, the crab would spontaneously autotomize the corresponding limb. ", "The autotomized crabs were randomly divided into five groups (in triplicate): (1) Control group (C): autotomy of the left cheliped; (2) Saline group (S): a 20 μL injection of crustacean saline per crab (0.21 M NaCl, 13.6 mM KCl, 8.6 mM H~3~BO~3~, 4.75 mM NaOH, 20 mM MgSO~4~ · 7H~2~O; pH 7.2); (3) Unilateral eyestalk ablation group (UESA): unilateral eyestalk ablation was performed by clipping the left eyestalk using sterile scissors, and the wound was immediately cauterized to prevent the loss of hemolymph and avoid infection; (4) Melatonin injection group (MT): standard melatonin was purchased from Sigma-Aldrich Chemical company (USA) and dissolved in crustacean saline adjusted to a concentration of 10^−6^ mol/crab (absolute ethanol less than 1%), and 20 μL/crab was injected (Girish et al., [", "@B12]); (5) Unilateral eyestalk ablation + melatonin injection group (UESA+MT): following a unilateral eyestalk- ablation, the crabs were injected with 20 μL/crab standard melatonin solution. ", "Prior to cheliped autotomy and eyestalk ablation, the crabs were anesthetized using ice, and both the crabs and experimental tools (i.e., scissors and tweezers) were disinfected with 75% alcohol cotton balls, respectively. ", "The crabs were immediately returned to the aerated water in monoculture systems at the aquaculture environmental conditions described above.", "\n\nSample collection\n-----------------\n\nCrab cheliped buds were measured every 3 days for 12 days using a digimatic micrometer and dissecting microscope. ", "The length of each cheliped bud was converted to a standardized *R*-value: *R* = (limb bud length/carapace width)^\\*^100 (Tilden et al., [", "@B57]). ", "The experiment was completed after 2 weeks, and the survival rate of all groups was calculated at the end of the experiment. ", "Ten individuals were randomly taken from each group for sample collection and were anesthetized on ice before each sampling. ", "Hemolymph was drawn using a sterile 1-mL syringe from the unsclerotized membrane of the right third periopods and was immediately diluted 1:1 with sterile anticoagulant (30 mM trisodium citrate, 338 mM NaCl, 115 mM glucose, and 10 mM EDTA) for the total hemocyte counts (THC). ", "The mixture was centrifuged at 42000 × g for 5 min, after which the serum was collected and stored at −20°C until the serum immune and antioxidant capacity could be evaluated. ", "Hepatopancreas, epidermis, muscle, midgut, and hindgut samples were stored at −80°C for RNA isolation and further analysis using qRT-PCR to evaluate the level of *EcR, MIH*, and *Chi* gene expression. ", "The remaining hepatopancreas samples were stored at −20°C for evaluation of digestive enzyme activity.", "\n\nLevel of EcR, MIH, and chi gene expression using quantitative RT-PCR\n--------------------------------------------------------------------\n\nTotal RNA was extracted from the hepatopancreas, epidermis, muscle, midgut, and hindgut tissues using RNAiso™ plus reagent (RNA Extraction Kit, TaKaRa, Japan) according to the manufacturer\\'s protocol. ", "The concentration and quality of the total RNA were estimated using a micro-volume ultraviolet-visible spectrophotometer (Quawell Q5000; Thmorgan, China) and agarose-gel electrophoresis, respectively. ", "The samples were reverse transcribed using the PrimeScript™ RT reagent Kit (Perfect Real Time, TaKaRa, Japan) according to the manufacturer\\'s protocol. ", "The obtained cDNA was diluted to 1:2 with double-distilled water and used as the qRT-PCR template. ", "Relative quantification was performed using the ABI 7500 Real-Time PCR System (Life Technology, USA) with a SYBR® Premix Ex Taq™ (Tli RNaseH Plus, TaKaRa, Japan) kits using the following program: 95°C for 30 s; 40 cycles at 95°C for 5 s, 60°C for 34 s; followed by a melting curve at 95°C for 15 s, 60°C for 1 min, and 95°C for 15 s. The PCR primer sequences for *EcR, MIH*, and *Chi* are presented in Table [1](#T1){ref-type=\"table\"} (Sangon Biotech Co. Ltd., Shanghai, China). ", "β-actin was used as the internal control and performed in triplicate for each sample. ", "Relative changes in the level of gene expression were determined by the 2^−ΔΔCt^ method. ", "Data were analyzed and presented as the average values ± standard deviation (SD).", "\n\n###### \n\nPrimer information for quantitative real-time polymerase chain reaction.", "\n\n **Primers** **Sequences (5′-3′)**\n ------------- -------------------------\n *EcR*-F GGGCATCGGGCTACCACTACAAC\n *EcR*-R GGCACTGAGACTCGGGCACAACA\n *MIH*-F TGAAGACTGCGCCAACATCT\n *MIH*-R GCTCGTCAGGGTAGGTGGTG\n *Chi*-F GAGCCCTACGTCTACAGCATCAC\n *Chi*-R GGTCTCAACACTCCAAACCATCA\n *β-actin*-F TCATCACCATCGGCAATGA\n *β-actin*-R TTGTAAGTGGTCTCGTGGATG\n\nEvaluation of hepatopancreas digestive ability\n----------------------------------------------\n\nThe level of α-amylase, trypsin, and lipase activity was measured using a UV-spectrophotometer (Beijing Purkinje General Instrument Co., Ltd.) at 253, 660, and 420 nm with corresponding detection kits (Nanjing Jiancheng Bioengineering Institute, Nanjing, China) according to the manufacturer\\'s protocol.", "\n\nHemolymph sample analysis\n-------------------------\n\n### Hemocyte THC levels\n\nThe levels of THC were obtained with a drop of the hemolymph anti-coagulant placed onto a hemocytometer using a Leica DMIL microscope (Leica Microsystems GmbH, Wetzlar, Germany). ", "The count for each crab was repeated three times.", "\n\n### Immune-related parameters\n\nHemocyanin concentrations were determined using a UV-Spectrophotometric (Beijing Purkinje General Instrument Co., Ltd.) at 335 nm with 10 μL of serum diluted in 990 μL distilled water in a quartz cuvette, manually calibrated with distilled water. ", "Hemocyanin concentrations (mmol/L) = 2.69 E (1%, 1 cm) mmol/L (Nickerson and Holde, [@B37]).", "\n\nAcid phosphatase (ACP) and alkaline phosphatase (ALP) were measured using a UV-spectrophotometer (Beijing Purkinje General Instrument Co., Ltd.) at 520 nm with corresponding detection kits (Nanjing Jiancheng Bioengineering Institute, Nanjing, China) according to the manufacturer\\'s protocols.", "\n\n### Anti-oxidant defense systems parameters\n\nCommercial kits obtained for the total antioxidant capacity (T-AOC), superoxide dismutase (SOD), and glutathione peroxidase (GSH-Px) from Nanjing Jiancheng Bioengineering Institute (Nanjing, China) were used to measure their respective activity in the hemolymph supernatant. ", "The activity of T-AOC (U/mL) (Fe^3+^ reduced to Fe^2+^ method), SOD (U/mL) (a method of superoxide anion radical ($\\text{O}_{2}^{-}$) oxidize hydroxylamine to form nitrite) and GSH-Px (μmol/L) (5, 5′-dithiobis-\\[2 -nitrobenzoic acid\\] method \\[DTNB\\]) were measured using a UV-spectrophotometer (Beijing Purkinje General Instrument Co., Ltd.) at 520, 550, 412 nm as described by the manufacturer\\'s protocols, respectively.", "\n\nStatistical analyses\n--------------------\n\nData are presented as the average values of 10 replicates ± standard deviation (SD). ", "In addition, the percentage values (dependent variable) were arcsine transformed before the analysis. ", "A Tukey\\'s Honestly Significant Difference Test (Tukey\\'s HSD) and one-way ANOVA were used to analyze the statistical significance between the five groups, and a *P*-value \\< 0.05 was considered significant. ", "All statistical analyses were performed using SPSS 20.0 software (Chicago, USA; Version 22.0).", "\n\nResults {#s3}\n=======\n\nCheliped regeneration\n---------------------\n\n### Cheliped bud length\n\nFigure [1](#F1){ref-type=\"fig\"} shows the cheliped bud growth of the crabs over 12 days for the different treatment groups. ", "The cheliped bud length was converted to a standardized *R*-value: *R* = (limb bud length /carapace width)^\\*^100. ", "The R-value of the UESA group was significantly higher than that of the control group on Days 3, 6, 9, and 12. ", "The cheliped bud length was significantly longer in MT group on Days 6, 9, and 12 compared to the saline and UESA groups on the same days. ", "Moreover, the bud length of the UESA+MT group was significantly longer than that of other groups on Days 6, 9, and 12, with the exception that UESA+MT was not significantly from MT group.", "\n\n![", "The cheliped bud length of *E. sinensis* over 12 days following the different treatments. ", "The values are expressed as the means ± SD (*n* = 10). ", "Different letters placed above column represent significant differences between treatments (*P* \\< 0.05).](fphys-09-00269-g0001){#F1}\n\n### The level of EcR, MIH, and Chi gene expression\n\nTo investigate the effect of the MT injection and eyestalk-ablation on regeneration-related gene expression during *E. sinensis* cheliped regeneration, the total RNA extracted from hepatopancreas, muscle, epidermis, midgut, and hindgut were subjected to quantitative real-time PCR using the primers pairs listed in Table [1](#T1){ref-type=\"table\"}. ", "The results show a similar trend in all tissues (Figure [2](#F2){ref-type=\"fig\"}). ", "We observed that MT injection and/or unilateral eyestalk-ablation both caused a significant increase in *EcR-mRNA* expression in muscle and epidermis (*P* \\< 0.05); However, the expression of *EcR-mRNA* in the muscle was very low compared with the other tissues (Figure [2A](#F2){ref-type=\"fig\"}).", "\n\n![", "The level of *EcR, MIH*, and *Chi* gene expression normalized to β-actin in the hepatopancreas, muscle, epidermal, midgut, and hindgut of *E. sinensis* for each of the different treatments. **(", "A)** *EcR*, ecdysteroid receptor; **(B)** *MIH*, molt-inhibiting hormone; and **(C)** *Chi*, chitinase. ", "The values are expressed as the means ± SD (*n* = 5). ", "Different letters placed above column represent significant differences between treatments (*P* \\< 0.05).](fphys-09-00269-g0002){#F2}\n\nThe expression of *MIH-mRNA* was significantly decreased in the UESA and MT groups in the hepatopancreas, muscle, epidermal, and hindgut tissues compared with the crabs in the control and saline groups (*P* \\< 0.05) (Figure [2B](#F2){ref-type=\"fig\"}).", "\n\nThe level of *Chi* gene expression exhibited a similar trend to that of *EcR* (Figures [2A,C](#F2){ref-type=\"fig\"}). ", "The level of Chi-mRNA expression was significantly increased in the MT group compared with the saline group in the hepatopancreas, muscle, and epidermal tissue (*P* \\< 0.05). ", "The results also revealed that the level of *Chi-mRNA* expression in the UESA group was significantly increased compared with the control group in the hepatopancreas, midgut, and hindgut tissues (*P* \\< 0.05). ", "Moreover, the level of *Chi-mRNA* expression of the crabs in the UESA+MT group was significantly higher than that in the tissues of all the other groups (*P* \\< 0.05) (Figure [2C](#F2){ref-type=\"fig\"}).", "\n\nDigestive enzyme activity in the hepatopancreas\n-----------------------------------------------\n\nIt was found that α-amylase activity was significantly improved by unilateral eyestalk-ablation (0.16 ± 0.01 U/mg prot) compared with the control group (0.12 ± 0.03 U/mg prot) (*P* \\< 0.05), whereas the highest level was observed in the UESA+MT group of trypsin activity (2.19 ± 0.07 U/mg prot), and it was significantly higher when compared to the other groups (*P* \\< 0.05). ", "Moreover, lipase activity in the UESA group, UESA+MT group, and MT group (6.59 ± 0.74 U/mg prot, 6.18 ± 0.80 U/mg prot, 5.41 ± 0.64 U/mg prot, respectively) were significantly increased compared with that of the control group (4.07 ± 0.30 U/mg prot) and saline group (3.62 ± 0.54 U/mg prot) (*P* \\< 0.05) (Table [2](#T2){ref-type=\"table\"}).", "\n\n###### \n\nEffect of unilateral eyestalk ablation (UESA) and melatonin injection (MT) on the digestive enzymes activity in *E. sinensis*.", "\n\n **Digestive enzymes (U/mgprot)** **Groups** \n ---------------------------------- ---------------- ----------------- ---------------- ----------------- ----------------\n α-Amylase activity 0.12 ± 0.03^a^ 0.14 ± 0.01^ab^ 0.16 ± 0.01^b^ 0.15 ± 0.01^ab^ 0.13 ± 0.01^a^\n Trypsin activity 1.85 ± 0.11^a^ 1.81 ± 0.08^a^ 1.79 ± 0.12^a^ 2.19 ± 0.07^b^ 1.91 ± 0.07^a^\n Lipase activity 4.07 ± 0.30^a^ 3.62 ± 0.54^a^ 6.59 ± 0.74^b^ 6.18 ± 0.80^b^ 5.41 ± 0.64^b^\n\n*The values are expressed as the means ± SD (n = 10). ", "Different letters represent significant differences between treatments (P \\< 0.05)*.", "\n\nSurvival rate and hemolymph analysis\n------------------------------------\n\n### Survival rate\n\nAt the end of the experiment, we evaluated the survival rates of all groups as shown in Figure [3](#F3){ref-type=\"fig\"}. ", "The survival rate of the crabs in the UESA group (47.22 ± 4.81%) was significantly lower than that of the control group (69.44 ± 4.81%) (*P* \\< 0.05). ", "However, the survival rate of the UESA+MT group (68.89 ± 3.85%) was significantly increased compared to that of the UESA group (*P* \\< 0.05). ", "The UESA+MT survival in addition to being higher than the UESA group (*P* \\< 0.05) is also not significantly different from the control and saline groups. ", "In addition, the survival rate of the MT group (77.78 ± 13.88%) was improved compared with that of the saline group (66.67 ± 8.33%), however, this improvement was not significant.", "\n\n![", "The survival rate of *E. sinensis* for all groups at the completion of the experiment. ", "The values are expressed as the means ± SD (*n* = 3). ", "Different letters placed above column represent significant differences between treatments (*P* \\< 0.05).](fphys-09-00269-g0003){#F3}\n\n### Total hemocyte counts (THC)\n\nCompared with the crabs in the control group (1.95 ± 0.13 × 10^6^ cells/mL), the level of THC exhibited a decreasing trend in the UESA group (1.40 ± 0.29 × 10^6^ cells/mL). ", "However, the THC levels of the crabs in the UESA+MT group (2.36 ± 0.30 × 10^6^ cells/mL) were significantly higher compared with that of the UESA group (*P* \\< 0.05). ", "These results also showed that the level of THC was significant higher in the MT group (2.58 ± 0.38 × 10^6^ cells/mL) compared to that of the saline (2.00 ± 0.30 × 10^6^ cells/mL; *P* \\< 0.05) and control groups *(P* \\< 0.05*)* (Figure [4](#F4){ref-type=\"fig\"}).", "\n\n![", "The level of THC in *E. sinensis* according to each treatment. ", "The values are expressed as the means ± SD (*n* = 10). ", "Different letters placed above column represent significant differences between treatments (*P* \\< 0.05).](fphys-09-00269-g0004){#F4}\n\n### Phosphatase activity and antioxidant capacity\n\nThe hemocyanin content was significantly decreased in the UESA group (0.58 ± 0.10 mmol/mL), compared with that of the control group (0.78 ± 0.10 mmol/mL) (*P* \\< 0.05), whereas it was significantly increased in the UESA+MT group (0.80 ± 0.09 mmol/mL) compared with that of the UESA group *(P* \\< 0.05). ", "Moreover, the results also showed that the hemocyanin content in the MT group (0.99 ± 0.08 mmol/mL) was significantly higher than that of the saline group (0.80 ± 0.10 mmol/mL) (*P* \\< 0.05) (Figure [5A](#F5){ref-type=\"fig\"}).", "\n\n![", "The effect of unilateral eyestalk ablation and melatonin injection on the immune and antioxidant capacity in *E. sinensis*. **(", "A)** Hemocyanin content; **(B)** acid phosphatase (ACP) activity; **(C)** alkaline phosphatase (ALP) activity; **(D)** total antioxidant capacity (T-AOC); **(E)** superoxide dismutase (SOD) activity; and **(F)** glutathione peroxidase (GSH-PX) activity. ", "The values are expressed as the means ± SD (*n* = 10). ", "Different letters placed above column represent significant differences between treatments (*P* \\< 0.05).](fphys-09-00269-g0005){#F5}\n\nACP activity was significantly increased in the MT group (2.77 ± 0.51 U/100 mL), compared with that in the other groups (*P* \\< 0.05). ", "In addition, unilateral eyestalk ablation (1.59 ± 0.23 U/100 mL) caused a decreasing trend in ACP activity compared to the control group (1.95 ± 0.26 U/100 mL). ", "In contrast, after the crabs were unilaterally eyestalk-ablated, an injection with the standard melatonin solution (UESA+MT group: 1.80 ± 0.38 U/100 mL) increased ACP activity; however, the difference was not statistically significant (Figure [5B](#F5){ref-type=\"fig\"}). ", "Moreover, similar results were observed in that the ALP activity in the UESA group (13.06 ± 1.25 King unit/100 mL) was significantly lower than that of the other groups (*P* \\< 0.05). ", "The ALP activity in the UESA+MT group (24.03 ± 2.94 King unit/100 mL) was significantly increased compared with that of the UESA group (*P* \\< 0.05) (Figure [5C](#F5){ref-type=\"fig\"}).", "\n\nT-AOC and GSH-PX activity in the UESA group (5.53 ± 0.71 U/mL and 182.4 ± 30.2 μmol/L, respectively) were significantly lower than that of the control group (9.77 ± 1.10 U/mL and 252.13 ±14.00 μmol/L, respectively) (*P* \\< 0.05) (Figures [5D,F](#F5){ref-type=\"fig\"}). ", "In contrast, T-AOC was significantly increased in the UESA+MT group (8.34 ± 0.90 U/mL) compared with that of the USEA group (*P* \\< 0.05). ", "Moreover, T-AOC and GSH-PX activity in the MT group (13.22 ± 1.16 U/mL and 406.23 ± 71.42 μmol/L, respectively) were significantly higher than that of the saline group (10.06 ± 1.79 U/mL and 267.16 ± 35.57 μmol/L, respectively) (*P* \\< 0.05) (Figures [5D,F](#F5){ref-type=\"fig\"}). ", "Moreover, SOD activity in the MT group (296.08 ± 27.04 U/mL) was only significantly higher than that of the UESA group (225.80 ± 13.35 U/mL) (*P* \\< 0.05) (Figure [5E](#F5){ref-type=\"fig\"}).", "\n\nDiscussion {#s4}\n==========\n\nCheliped regeneration\n---------------------\n\n### Cheliped regeneration and growth-related gene expression\n\nIn nature, the limb autotomy phenomenon of crustaceans is extremely common, and is associated with several adverse effects, including the long-term loss of energy and functionality (Fleming et al., [", "@B10]), which affects feeding efficiency (Brock and Smith, [@B4]), and the distribution of ecological communities (Oliveira et al., [", "@B38]). ", "Our previous study found that cheliped autotomy in *E. sinensis* caused a significant decrease in immunity and antibacterial ability (Yang et al., [", "@B68]). ", "Moreover, in the pond culture of *E. sinensis*, limb autotomy seriously impacts quality and economic benefits. ", "Therefore, it is of great significance to promote limb regeneration.", "\n\nThe limb regeneration process of crabs is performed under the joint regulation of ecdysteroid and molt-inhibiting hormone (MIH). ", "Ecdysteroid is produced by Y-organs and other tissues and promotes limb regeneration, while MIH is produced from the eyestalk and can inhibit the release of ecdysteroid (Hopkins, [@B19]). ", "Therefore, eyestalk ablation can reduce the release of molt-inhibiting hormone and promote limb regeneration. ", "Tilden et al. ([", "@B57]) reported that melatonin promotes the limb regeneration of *U. pugilator* and hypothesized that melatonin promoted the limb regeneration of crabs by inhibiting the release of MIH or directly stimulating the release of ecdysteroid (Tilden et al., [", "@B57]). ", "In the present study, we found that consistent with the findings of Tilden et al. ([", "@B57]), both unilateral eyestalk ablation and the injection of melatonin promoted limb regeneration. ", "To investigate the mechanism by which melatonin promotes limb regeneration, we examined the expression of *EcR-mRNA* and *MIH-mRNA* in tissues of *E. sinensis* using qRT-PCR. ", "The results revealed that unilateral eyestalk ablation significantly reduced the expression of *MIH-mRNA*, whereas *EcR-mRNA* expression was significantly increased compared to control and saline treatment groups. ", "Similar results were observed in the MT injection group and UESA+MT group. ", "However, the expression of *MIH-mRNA* in the MT injection group was higher than that of the unilateral eyestalk ablation group, and the expression of *EcR-mRNA* was significantly increased in the MT injection group. ", "Girish et al. ([", "@B12]) reported that an injection of melatonin caused a marked increase in the ecdysteroid levels of *Scylla serrata*, which was consistent with our results (Girish et al., [", "@B12]). ", "Therefore, we speculate that melatonin inhibits the release of MIH and indirectly accelerates the expression of *EcR-mRNA*. ", "Moreover, melatonin also directly stimulates the expression of *EcR-mRNA* to promote the limb regeneration of *E. sinensis*.", "\n\nLimb regeneration of crabs is usually accompanied by a complete molting cycle. ", "Since the limb regeneration process of crabs is relatively slow, the regeneration of new limbs is typically accompanied by the need to undergo a complete molting cycle (He et al., [", "@B15]). ", "The molting activity of crustaceans is regulated by the promoting hormones (i.e., ecdysteroid and methyl farnesoate) and the inhibiting hormones (i.e., MIH and mandibular organ-inhibiting hormone \\[MOIH\\]). ", "A scholar hypothesized that ecdysteroid and methyl farnesoate are secreted by the Y-organs and mandibular organ (MO), whereas MIH and MOIH are secreted by the X-organ-sinus gland (XO-SG) system in the eyestalk (Chang, [@B5]). ", "Therefore, following eyestalk-ablation, the secretion of MIH decreased and the Y-organ was activated, compelling the Y-organs to secrete ecdysteroid, resulting in an increase of ecdysteroid in the hemolymph and accelerating the completion of molting cycle and limb regeneration. ", "Similar studies have been reported in *Litopenaeus vannamei* (Sainz-Hernández et al., [", "@B50]), *Macrobrachium nipponense* (Sindhu Kumari, [@B52]), and *Penaeus monodon* (Nan et al., [", "@B36]).", "\n\nChitinase is crucial for both the crustacean molting and regeneration processes. ", "Studies have shown that the binding of melatonin with the EcR and retinoid X receptor (RXR) positively regulate the expression of the chitinase gene in crustaceans (Priya et al., [", "@B44]). ", "In the present study, we observed similar trends in *Chi-mRNA* and *EcR-mRNA* expression in the tissues of *E. sinensis*. ", "Therefore, we concluded that melatonin and unilateral eyestalk-ablation could improve the expression of growth-promoting genes and facilitate the limb regeneration of *E. sinensis*.", "\n\n### Analysis of hepatopancreas digestive ability\n\nBoth unilateral eyestalk ablation and melatonin injection caused a significant increase in the expression of growth-related genes and accelerated the growth of *E. sinensis*. ", "Therefore, we evaluated the effects of each of the different treatments on hepatopancreas digestive ability, and investigated the impact of eyestalk ablation and melatonin on digestibility. ", "In crustaceans, the ability of the organism to digest and absorb nutrients can directly reflect the level of digestive enzyme activity, indicating an animal\\'s status of growth and development (Girish et al., [", "@B12]; Lin et al., [", "@B27]). ", "In the present study, unilateral eyestalk ablation significantly increased the level of α-amylase and lipase activity, whereas the trypsin activity did not change substantially. ", "This is consistent with the findings of (Wu et al., [", "@B64]). ", "In addition, the results of a study on *Palaemon serratus* showed that eyestalk ablation could significantly enhance digestive enzyme activity in the hepatopancreas (van Wormhoudt, [@B60]). ", "In crustaceans, amylase and lipase are the main functional participants involved in the catabolism of carbohydrates and lipids. ", "A previous study showed that unilateral eyestalk ablation caused carbohydrate and lipid content to significantly decrease in *Portunus sanguinolentus* (Sudhakar et al., [", "@B53]). ", "Similarly, following eyestalk ablation in *Marsupenaeus japonicus*, the hepatopancreas index of parent shrimp decreased significantly, while glucose and triglyceride levels increased significantly in the hemolymph, indicating that eyestalk ablation accelerated the metabolism of carbohydrates and lipids in the body (Chao et al., [", "@B6]). ", "Therefore, in this study, unilateral eyestalk ablation promoted the cheliped regeneration of *E. sinensis*, which consumed a large amount of energy. ", "In addition, cheliped regeneration also requires a continued supply of energy; therefore, this process requires the hydrolysis and metabolism of additional carbohydrates and lipids, accelerating the metabolism, and recycling of materials, which is achieved by regulating the activity of amylase and lipase.", "\n\nMoreover, similar results were also observed in the melatonin injection group. ", "We found that a melatonin injection caused a significant increase in lipase activity in the hepatopancreas. ", "Our observations in this study are consistent with the previous report that exogenous melatonin can prevent obesity in mice (Xu et al., [", "@B66]), reduces fat accumulation *in vivo*, and accelerates lipid metabolism. ", "There was also a reported positive correlation between the level of melatonin and digestive enzyme activity, and digestive enzymes and gut melatonin exhibited an identical pattern of daily rhythms in *Catla catla* (Pal et al., [", "@B40]). ", "Another study demonstrated that melatonin plays an important role in promoting intestinal digestion in *C. catla* (Maitra et al., [", "@B33]). ", "Therefore, after the crabs were injected with melatonin, hepatopancreas lipase activity was increased, and the digestive and absorption ability of the crabs was enhanced, promoting growth, molting, and limb regeneration.", "\n\nImmunological analysis\n----------------------\n\nIt has been established that the survival rate and immune functionality of an organism are directly connected; when an organism\\'s immune function is weakened, its survival rate is reduced. ", "In the present study, we calculated the survival rate of each group throughout the experimental period, and found that unilateral eyestalk ablation significantly reduced the survival rate of *E. sinensis*. ", "A similar result was also observed in *L. vannamei* with a unilateral or bilateral eyestalk ablation (Sainz-Hernández et al., [", "@B50]); however, interestingly, melatonin could significantly increase the survival rate of *E. sinensis* following a unilateral eyestalk ablation. ", "Based on these results, we hypothesized that unilateral eyestalk ablation could weaken the immune system, whereas melatonin could enhance immunity and improve the anti-stress response by regulating the immune function of *E. sinensis*. ", "Based on this point, the THC level, phosphatase activity, and antioxidant capacity were also investigated in the present study.", "\n\nSeveral studies involving crustaceans have demonstrated that hematological parameters are important for assessing the immune response, including the level of THC, hydrolase activity, and antioxidant capacity (Cheng and Chen, [@B7]; Vogan and Rowley, [@B61]; Powell and Rowley, [@B43]). ", "In the present study, we examined the effects of MT injection and unilateral eyestalk ablation on the hematological parameters of *E. sinensis* and subsequently assessed its effect on immune function. ", "Studies have shown that THC is the most commonly used performance parameter for evaluating cellular immunity in crustaceans (van de Braak et al., [", "@B59]). ", "In the current study, we observed that THC did not significantly decline following a unilateral eyestalk-ablation, whereas THC increased significantly following the melatonin injection. ", "These results indicate that while the cellular immunity of the crab decreased following the unilateral eyestalk-ablation, a melatonin injection could improve this impairment. ", "Similar results were also observed in female *L. vannamei* with unilateral eyestalk ablation (Maggioni et al., [", "@B32]).", "\n\nNon-self-recognition protein, immunoglobulin, coagulation protein, antibacterial peptide, and other humoral factors play an important role in the immune defense of crustaceans (Lee and Söderhäll, [@B26]). ", "In crustaceans, hemocyanin is an important multifunctional protein that primarily exists in the hemolymph, which accounts for more than 90% of the total protein in the serum (Lee et al., [", "@B25]; Zhang and Huang, [@B70]; Galindo et al., [", "@B11]). ", "Hemocyanin plays several important roles, including carrying oxygen, transporting metal ions, storing proteins, osmoregulation, antibacterial activity, and the regulation of molting, which are all important functional participants in the immune system (Decker et al., [", "@B9]; Pan and Jin, [@B41]). ", "In the present study, we observed that a unilateral eyestalk ablation significantly reduced hemocyanin levels in the serum, whereas the hemocyanin content returned to normal levels when melatonin was injected following a unilateral eyestalk-ablation. ", "These results suggest that the unilateral eyestalk ablation reduced the immune function of *E. sinensis*, while the injection of melatonin enhanced the immunity of *E. sinensis*. ", "In this study, a unilateral eyestalk ablation resulted in a significant decrease in the hemocyanin content, which is consistent with our previous studies on the effect of hemocyanin content following cheliped-ablation of *E. sinensis* (Yang et al., [", "@B68]). ", "However, some studies have demonstrated that salinity (Wang et al., [", "@B62]) and hypoxia stress (Qin et al., [", "@B45]) can increase the hemocyanin content. ", "These results indicate that the hemocyanin content was one of the evaluation indexes for the stress response of *E. sinensis*, and that different sources of stress have differential effects on the hemocyanin content.", "\n\nALP and ACP are two important non-specific phosphohydrolases that play an important role in the organism\\'s self-defense system, and are considered to be important non-specific indicators of crustaceans, and reflect the overall health status of aquatic animals (Xue and Renault, [@B67]; Lin et al., [", "@B28]; Han et al., [", "@B14]). ", "Thus, as the activities of ACP and ALP increase, cellular metabolism *in vivo*, non-specific immunity, and the rapid growth of the organism are improved. ", "In the present study, unilateral eyestalk ablation resulted in a significant decrease in ALP activity, whereas the melatonin injection significantly increased ACP activity. ", "These results imply that the unilateral eyestalk ablation of crabs reduced their non-specific immunity, and the injection of melatonin is able to enhance such immunity. ", "Studies have shown that a melatonin injection in *Sparus aurata* L, increased immune-related gene expression (e.g., interleukin-1β) levels and non-specific immune immunoreactivity (i.e., phagocytosis), indicating that melatonin can enhance the immune response (Cuesta et al., [", "@B8]). ", "Herrero et al. ([", "@B16]) reported that increased plasma melatonin levels following dietary supplementation with melatonin reduced cortisol levels in *Dicentrarchus labrax*, thereby improving the anti-stress response (Herrero et al., [", "@B16]). ", "In addition, Azpeleta et al. ([", "@B1]) induced acute stress in goldfish by exposing them to air and found that this stress increased plasma cortisol levels, which could be reduced by melatonin injection group (Azpeleta et al., [", "@B1]). ", "The results demonstrate that melatonin can improve the immune and anti-stress response by reducing cortisol levels.", "\n\nThe antioxidant defense system is also an important component of the crustacean immune defense system. ", "T-AOC, superoxide dismutase (SOD), catalase (CAT), and glutathione peroxidase (GPH-Px) are important components of the crustacean antioxidant defense system (Zhao et al., [", "@B71]). ", "When invertebrates are infected by pathogens, oxygen is released to enhance their resistance. ", "An important indicator of crustacean cellular defense is the production of ROS, which is essential for normal cell function (e.g., redox signaling and anti-microbial responses); however, excessive ROS can induce oxidative damage, organ dysfunction, as well as DNA, protein, enzyme, and cell membrane destruction (Halliwell, [@B13]; Qin et al., [", "@B45]; Wu et al., [", "@B65]). ", "SOD can convert harmful $\\text{O}_{2}^{-}$ into hydrogen peroxide and then degrade the hydrogen peroxide product through GSH-Px to protect cells from oxidative damage (Holmblad and Söderhäll, [@B17]). ", "In the present study, unilateral eyestalk ablation caused a significant decrease in GSH-Px and SOD activity in *E. sinensis*, while the injection of melatonin repaired the injury caused by unilateral eyestalk-ablation and the GSH-Px and SOD activity was significantly increased. ", "These results indicate that melatonin can significantly improve the antioxidant capacity of *E. sinensis*. ", "Moreover, T-AOC levels in the hemolymph of *E. sinensis* followed the same trend as GSH-Px and SOD. ", "Several studies have emphasized that exogenous melatonin activity at pharmacological and physiological doses reduce oxidative stress by stimulating antioxidative enzymes (Barlow-Walden et al., [", "@B2]; Kotler et al., [", "@B23]; Trivedi and Jena, [@B58]). ", "Baydas et al. ([", "@B3]) also demonstrated that melatonin can directly or indirectly stimulate GSH-Px to reduce lipid peroxidation (Baydas et al., [", "@B3]). ", "Furthermore, an injection of melatonin can significantly increase the immunity and antioxidant capacity of *Carassius auratus* (Jung et al., [", "@B20]), *Perdicula asiatica* (Kharwar and Haldar, [@B21]), and rats (Ozturk et al., [", "@B39]; Zhang et al., [", "@B69]). ", "Therefore, our observations are consistent with previous reports that melatonin can enhance the immune defense of *E. sinensis*.", "\n\nIn conclusion, in the present study, we found that unilateral eyestalk ablation and a melatonin injection can promote limb regeneration by regulating the expression of growth-related genes and accelerate growth by enhancing hepatopancreas digestion. ", "Moreover, unilateral eyestalk-ablation reduced the immune function of *E. sinensis*, whereas melatonin could enhance the body\\'s antioxidant ability and immune defensive capacity. ", "Our findings provide indications that the regulation the immune response in *E. sinensis* by melatonin may function at several levels of hematological immunity and antioxidant defense systems, rather than regulating the activity of a particular enzyme or immune-related protein. ", "Moreover, unilateral eyestalk ablation did not inhibit the function of melatonin. ", "Therefore, we speculate that melatonin can regulate immunity and limb regeneration through pathways other than the eyestalk in *E. sinensis*.", "\n\nAuthor contributions {#s5}\n====================\n\nX-zY designed the experiment and CZ wrote the article. ", "M-jX, QZ, H-yR completed the determination of experimental indicators, G-yH and LH collected and analyzed data and Y-xC revised the article and made some positive suggestions.", "\n\nConflict of interest statement\n------------------------------\n\nThe authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.", "\n\nThis work was supported by the the Extension of Chinese Mitten Crab Eriocheir Sinensis Aquaculture Technology that was found from Shanghai Agricultural Commission \\[grant number 2015D1-7\\], the Aquaculture Engineering Research Platform in Shanghai Established by Shanghai Science and Technology Commission \\[grant number 16DZ2281200\\]), and the China Agriculture Research System \\[grant number CARS-48\\].", "\n\n[^1]: Edited by: Nour Eissa, University of Manitoba, Canada\n\n[^2]: Reviewed by: Theresa Joan Grove, Valdosta State University, United States; Falong Yang, Southwest University for Nationalities, China\n\n[^3]: This article was submitted to Aquatic Physiology, a section of the journal Frontiers in Physiology\n\n[^4]: †These authors have contributed equally to this work.", "\n" ]
{ "pile_set_name": "PubMed Central" }
[ 0.007633587786259542, 0.11764705882352941, 0, 0.006993006993006993, 0, 0.125, 0.011494252873563218, 0.041666666666666664, 0.125, 0, 0, 0, 0, 0.008450704225352112, 0.057692307692307696, 0.05, 0.125, 0, 0, 0.0035587188612099642, 0.019867549668874173, 0, 0.006944444444444444, 0.016260162601626018, 0.01675977653631285, 0.09523809523809523, 0.125, 0.011695906432748537, 0.03571428571428571, 0.017543859649122806, 0.018867924528301886, 0.011235955056179775, 0.125, 0.009345794392523364, 0.009900990099009901, 0.125, 0.019417475728155338, 0.125, 0.005494505494505495, 0.125, 0.004761904761904762, 0.09523809523809523, 0.14285714285714285, 0.006097560975609756, 0.004338394793926247, 0, 0.009302325581395349, 0, 0.002702702702702703, 0.017241379310344827, 0, 0.006097560975609756, 0.007462686567164179, 0.005208333333333333, 0, 0, 0, 0, 0.125, 0, 0, 0.01444043321299639, 0.005681818181818182, 0.01990049751243781, 0.00980392156862745, 0.014577259475218658, 0.009950248756218905, 0.013071895424836602, 0, 0.008350730688935281, 0.011627906976744186, 0, 0, 0, 0.0037974683544303796, 0.011583011583011582, 0, 0.0035714285714285713, 0.043478260869565216, 0.006779661016949152, 0.003105590062111801, 0.018912529550827423, 0, 0, 0.009615384615384616, 0.02127659574468085, 0, 0, 0.009009009009009009, 0.007194244604316547, 0, 0, 0, 0, 0.007462686567164179, 0, 0, 0, 0.010362694300518135, 0, 0, 0.0025906735751295338, 0.008403361344537815, 0, 0.004761904761904762, 0, 0, 0.0058823529411764705, 0.014598540145985401, 0.0015267175572519084, 0, 0, 0.006622516556291391, 0.007042253521126761, 0.0064516129032258064, 0, 0, 0, 0, 0.008797653958944282, 0.011976047904191617, 0.003816793893129771, 0, 0.015873015873015872, 0, 0.010224948875255624, 0.008849557522123894, 0, 0, 0.007874015748031496, 0, 0.003703703703703704, 0.012422360248447204, 0.007380073800738007, 0.010869565217391304, 0.010869565217391304, 0.018518518518518517, 0.014388489208633094, 0.017793594306049824, 0.015789473684210527, 0, 0.015037593984962405, 0.125, 0.006756756756756757, 0.125, 0, 0, 0.007633587786259542, 0.02127659574468085, 0, 0, 0.019762845849802372, 0.125, 0, 0.009900990099009901, 0.005714285714285714, 0.004672897196261682, 0, 0.004629629629629629, 0, 0.005747126436781609, 0.125, 0.016129032258064516, 0.008064516129032258, 0, 0, 0.125, 0.004830917874396135, 0.017699115044247787, 0.0035842293906810036, 0.011494252873563218, 0.03125, 0.14285714285714285, 0, 0.016666666666666666, 0.125, 0, 0.0055248618784530384, 0, 0.005263157894736842, 0, 0.1, 0.125, 0, 0.018867924528301886, 0.125, 0.010526315789473684, 0, 0.0058823529411764705, 0.125, 0.0030211480362537764, 0.14285714285714285, 0, 0, 0, 0, 0.0072992700729927005, 0.01282051282051282, 0.008771929824561403, 0.125, 0.015267175572519083, 0.125, 0.004545454545454545, 0.0041841004184100415, 0, 0.007874015748031496, 0.013513513513513514, 0.00423728813559322, 0.007874015748031496, 0.027777777777777776, 0, 0.013605442176870748, 0.125, 0.010752688172043012, 0, 0.008928571428571428, 0.14285714285714285, 0.00966183574879227, 0.005319148936170213, 0.08163265306122448, 0.125, 0.007434944237918215, 0.10714285714285714, 0.00398406374501992, 0, 0.004, 0.125, 0.014492753623188406, 0.05, 0.022727272727272728, 0, 0.019867549668874173, 0.05, 0.125, 0.012987012987012988, 0.011560693641618497, 0, 0.010830324909747292, 0.14285714285714285, 0, 0.009259259259259259, 0.125, 0, 0.010256410256410256, 0.14285714285714285, 0.008695652173913044, 0, 0.01744186046511628, 0.125, 0, 0.008695652173913044, 0.10526315789473684, 0.125, 0.009950248756218905, 0.0035842293906810036, 0.009345794392523364, 0, 0, 0.09090909090909091, 0.08823529411764706, 0.0625, 0.015503875968992248, 0.14285714285714285, 0.007042253521126761, 0.058823529411764705, 0.09090909090909091, 0.125, 0.0078125, 0, 0, 0.0035842293906810036, 0, 0.0070921985815602835, 0, 0.011428571428571429, 0, 0.014778325123152709, 0.018970189701897018, 0 ]
0.0263
5
[ { "analysis_explanation": null, "end": 275, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 270 }, { "analysis_explanation": null, "end": 561, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 555 }, { "analysis_explanation": null, "end": 791, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 786 }, { "analysis_explanation": null, "end": 859, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 848 }, { "analysis_explanation": null, "end": 894, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 886 }, { "analysis_explanation": null, "end": 912, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 908 }, { "analysis_explanation": null, "end": 939, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 931 }, { "analysis_explanation": null, "end": 1004, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 989 }, { "analysis_explanation": null, "end": 1363, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1356 }, { "analysis_explanation": null, "end": 1497, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1490 }, { "analysis_explanation": null, "end": 1555, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1544 }, { "analysis_explanation": null, "end": 1806, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1800 }, { "analysis_explanation": null, "end": 1849, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1840 }, { "analysis_explanation": null, "end": 1872, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1859 }, { "analysis_explanation": null, "end": 1925, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1909 }, { "analysis_explanation": null, "end": 1946, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1936 }, { "analysis_explanation": null, "end": 2056, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2045 }, { "analysis_explanation": null, "end": 2678, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2667 }, { "analysis_explanation": null, "end": 3122, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3109 }, { "analysis_explanation": null, "end": 3144, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3133 }, { "analysis_explanation": null, "end": 3324, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3311 }, { "analysis_explanation": null, "end": 3381, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3368 }, { "analysis_explanation": null, "end": 3439, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3426 }, { "analysis_explanation": null, "end": 3493, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3480 }, { "analysis_explanation": null, "end": 3583, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3569 }, { "analysis_explanation": null, "end": 3700, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3689 }, { "analysis_explanation": null, "end": 3745, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3742 }, { "analysis_explanation": null, "end": 3911, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3899 }, { "analysis_explanation": null, "end": 4102, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4092 }, { "analysis_explanation": null, "end": 4321, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4306 }, { "analysis_explanation": null, "end": 4329, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4325 }, { "analysis_explanation": null, "end": 4343, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4332 }, { "analysis_explanation": null, "end": 4487, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4484 }, { "analysis_explanation": null, "end": 4562, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4548 }, { "analysis_explanation": null, "end": 4678, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4667 }, { "analysis_explanation": null, "end": 5536, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5531 }, { "analysis_explanation": null, "end": 5560, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5545 }, { "analysis_explanation": null, "end": 5688, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5679 }, { "analysis_explanation": null, "end": 5789, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5765 }, { "analysis_explanation": null, "end": 5796, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5791 }, { "analysis_explanation": null, "end": 5844, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5838 }, { "analysis_explanation": null, "end": 6108, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6102 }, { "analysis_explanation": null, "end": 6167, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6161 }, { "analysis_explanation": null, "end": 6818, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6811 }, { "analysis_explanation": null, "end": 6825, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6821 }, { "analysis_explanation": null, "end": 7186, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7183 }, { "analysis_explanation": null, "end": 7345, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7332 }, { "analysis_explanation": null, "end": 7987, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7975 }, { "analysis_explanation": null, "end": 7999, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7992 }, { "analysis_explanation": null, "end": 8191, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8178 }, { "analysis_explanation": null, "end": 8245, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8238 }, { "analysis_explanation": null, "end": 8780, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8775 }, { "analysis_explanation": null, "end": 8920, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8906 }, { "analysis_explanation": null, "end": 8960, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8953 }, { "analysis_explanation": null, "end": 9072, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9069 }, { "analysis_explanation": null, "end": 9135, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9121 }, { "analysis_explanation": null, "end": 9222, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9219 }, { "analysis_explanation": null, "end": 9396, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9382 }, { "analysis_explanation": null, "end": 9506, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9501 }, { "analysis_explanation": null, "end": 9703, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9698 }, { "analysis_explanation": null, "end": 9860, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9855 }, { "analysis_explanation": null, "end": 10103, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10100 }, { "analysis_explanation": null, "end": 10164, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10159 }, { "analysis_explanation": null, "end": 10317, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10312 }, { "analysis_explanation": null, "end": 10371, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10368 }, { "analysis_explanation": null, "end": 10473, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10465 }, { "analysis_explanation": null, "end": 10480, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10475 }, { "analysis_explanation": null, "end": 10956, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10943 }, { "analysis_explanation": null, "end": 11237, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11223 }, { "analysis_explanation": null, "end": 11557, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11550 }, { "analysis_explanation": null, "end": 11564, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11559 }, { "analysis_explanation": null, "end": 11809, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11805 }, { "analysis_explanation": null, "end": 11854, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11847 }, { "analysis_explanation": null, "end": 11863, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11856 }, { "analysis_explanation": null, "end": 12528, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12521 }, { "analysis_explanation": null, "end": 12535, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12530 }, { "analysis_explanation": null, "end": 12771, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12764 }, { "analysis_explanation": null, "end": 12815, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12808 }, { "analysis_explanation": null, "end": 12822, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12817 }, { "analysis_explanation": null, "end": 12937, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12931 }, { "analysis_explanation": null, "end": 13128, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13098 }, { "analysis_explanation": null, "end": 13521, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13514 }, { "analysis_explanation": null, "end": 13836, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13829 }, { "analysis_explanation": null, "end": 13841, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13838 }, { "analysis_explanation": null, "end": 14038, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14031 }, { "analysis_explanation": null, "end": 14288, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14279 }, { "analysis_explanation": null, "end": 14291, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14290 }, { "analysis_explanation": null, "end": 14374, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14365 }, { "analysis_explanation": null, "end": 14438, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14425 }, { "analysis_explanation": null, "end": 14549, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14540 }, { "analysis_explanation": null, "end": 14684, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14677 }, { "analysis_explanation": null, "end": 15090, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15079 }, { "analysis_explanation": null, "end": 15158, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15144 }, { "analysis_explanation": null, "end": 15198, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15191 }, { "analysis_explanation": null, "end": 15713, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15710 }, { "analysis_explanation": null, "end": 15790, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15776 }, { "analysis_explanation": null, "end": 15846, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15835 }, { "analysis_explanation": null, "end": 16287, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16273 }, { "analysis_explanation": null, "end": 16319, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16312 }, { "analysis_explanation": null, "end": 16681, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16667 }, { "analysis_explanation": null, "end": 16892, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16878 }, { "analysis_explanation": null, "end": 16913, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16906 }, { "analysis_explanation": null, "end": 17350, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 17346 }, { "analysis_explanation": null, "end": 18088, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 18077 }, { "analysis_explanation": null, "end": 18372, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 18365 }, { "analysis_explanation": null, "end": 18511, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 18504 }, { "analysis_explanation": null, "end": 18633, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 18626 }, { "analysis_explanation": null, "end": 21546, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 21535 }, { "analysis_explanation": null, "end": 23318, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 23314 }, { "analysis_explanation": null, "end": 24195, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 24190 }, { "analysis_explanation": null, "end": 24278, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 24263 }, { "analysis_explanation": null, "end": 24353, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 24342 }, { "analysis_explanation": null, "end": 24435, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 24424 }, { "analysis_explanation": null, "end": 25066, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 25054 }, { "analysis_explanation": null, "end": 25139, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 25137 }, { "analysis_explanation": null, "end": 25321, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 25308 }, { "analysis_explanation": null, "end": 25413, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 25401 }, { "analysis_explanation": null, "end": 25947, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 25945 }, { "analysis_explanation": null, "end": 26030, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 26028 }, { "analysis_explanation": null, "end": 26211, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 26199 }, { "analysis_explanation": null, "end": 26387, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 26374 }, { "analysis_explanation": null, "end": 26645, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 26634 }, { "analysis_explanation": null, "end": 27239, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 27237 }, { "analysis_explanation": null, "end": 27340, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 27335 }, { "analysis_explanation": null, "end": 27689, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 27667 }, { "analysis_explanation": null, "end": 27766, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 27753 }, { "analysis_explanation": null, "end": 27810, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 27800 }, { "analysis_explanation": null, "end": 27831, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 27822 }, { "analysis_explanation": null, "end": 27964, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 27961 }, { "analysis_explanation": null, "end": 28080, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 28068 }, { "analysis_explanation": null, "end": 28393, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 28382 }, { "analysis_explanation": null, "end": 28426, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 28412 }, { "analysis_explanation": null, "end": 28618, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 28607 }, { "analysis_explanation": null, "end": 28710, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 28696 }, { "analysis_explanation": null, "end": 29018, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 29005 }, { "analysis_explanation": null, "end": 29039, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 29029 }, { "analysis_explanation": null, "end": 29279, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 29270 }, { "analysis_explanation": null, "end": 29455, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 29441 }, { "analysis_explanation": null, "end": 29470, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 29457 }, { "analysis_explanation": null, "end": 29776, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 29761 }, { "analysis_explanation": null, "end": 30116, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 30105 }, { "analysis_explanation": null, "end": 30232, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 30221 }, { "analysis_explanation": null, "end": 30768, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 30754 }, { "analysis_explanation": null, "end": 30904, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 30895 }, { "analysis_explanation": null, "end": 31211, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 31201 }, { "analysis_explanation": null, "end": 31335, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 31327 }, { "analysis_explanation": null, "end": 31351, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 31338 }, { "analysis_explanation": null, "end": 31441, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 31420 }, { "analysis_explanation": null, "end": 32024, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 32013 }, { "analysis_explanation": null, "end": 32078, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 32066 }, { "analysis_explanation": null, "end": 32259, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 32248 }, { "analysis_explanation": null, "end": 32536, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 32525 }, { "analysis_explanation": null, "end": 32881, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 32876 }, { "analysis_explanation": null, "end": 32890, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 32886 }, { "analysis_explanation": null, "end": 32904, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 32899 }, { "analysis_explanation": null, "end": 32931, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 32925 }, { "analysis_explanation": null, "end": 32942, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 32936 }, { "analysis_explanation": null, "end": 33728, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 33717 }, { "analysis_explanation": null, "end": 33780, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 33765 }, { "analysis_explanation": null, "end": 33788, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 33784 }, { "analysis_explanation": null, "end": 33972, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 33969 }, { "analysis_explanation": null, "end": 34182, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 34172 }, { "analysis_explanation": null, "end": 34198, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 34193 }, { "analysis_explanation": null, "end": 34208, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 34203 }, { "analysis_explanation": null, "end": 34232, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 34218 }, { "analysis_explanation": null, "end": 34523, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 34520 }, { "analysis_explanation": null, "end": 34531, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 34528 }, { "analysis_explanation": null, "end": 34896, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 34885 }, { "analysis_explanation": null, "end": 34969, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 34958 }, { "analysis_explanation": null, "end": 35219, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 35208 }, { "analysis_explanation": null, "end": 35297, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 35286 }, { "analysis_explanation": null, "end": 35338, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 35328 }, { "analysis_explanation": null, "end": 35510, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 35499 }, { "analysis_explanation": null, "end": 35868, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 35865 }, { "analysis_explanation": null, "end": 35900, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 35890 }, { "analysis_explanation": null, "end": 35921, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 35911 }, { "analysis_explanation": null, "end": 36495, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 36479 }, { "analysis_explanation": null, "end": 36703, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 36690 }, { "analysis_explanation": null, "end": 36727, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 36714 }, { "analysis_explanation": null, "end": 36884, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 36864 }, { "analysis_explanation": null, "end": 36945, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 36931 }, { "analysis_explanation": null, "end": 36984, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 36970 }, { "analysis_explanation": null, "end": 37181, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 37166 }, { "analysis_explanation": null, "end": 37580, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 37569 }, { "analysis_explanation": null, "end": 38028, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 38018 }, { "analysis_explanation": null, "end": 38048, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 38039 }, { "analysis_explanation": null, "end": 38236, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 38228 }, { "analysis_explanation": null, "end": 38250, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 38241 }, { "analysis_explanation": null, "end": 38384, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 38373 }, { "analysis_explanation": null, "end": 38644, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 38633 }, { "analysis_explanation": null, "end": 38938, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 38918 }, { "analysis_explanation": null, "end": 38954, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 38948 }, { "analysis_explanation": null, "end": 38970, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 38965 }, { "analysis_explanation": null, "end": 38979, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 38972 }, { "analysis_explanation": null, "end": 38988, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 38984 }, { "analysis_explanation": null, "end": 39011, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 38999 }, { "analysis_explanation": null, "end": 39142, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 39129 }, { "analysis_explanation": null, "end": 39292, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 39281 }, { "analysis_explanation": null, "end": 39323, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 39305 }, { "analysis_explanation": null, "end": 39378, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 39365 }, { "analysis_explanation": null, "end": 39401, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 39389 }, { "analysis_explanation": null, "end": 39539, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 39528 }, { "analysis_explanation": null, "end": 39780, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 39766 }, { "analysis_explanation": null, "end": 39874, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 39863 }, { "analysis_explanation": null, "end": 40060, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 40049 }, { "analysis_explanation": null, "end": 40472, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 40461 }, { "analysis_explanation": null, "end": 41046, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 41039 }, { "analysis_explanation": null, "end": 41238, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 41230 }, { "analysis_explanation": null, "end": 41423, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 41413 }, { "analysis_explanation": null, "end": 41455, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 41449 }, { "analysis_explanation": null, "end": 41494, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 41476 }, { "analysis_explanation": null, "end": 41536, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 41523 }, { "analysis_explanation": null, "end": 41549, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 41538 }, { "analysis_explanation": null, "end": 41596, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 41591 }, { "analysis_explanation": null, "end": 41716, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 41710 }, { "analysis_explanation": null, "end": 267, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 264 }, { "analysis_explanation": null, "end": 293, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 290 }, { "analysis_explanation": null, "end": 568, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 565 }, { "analysis_explanation": null, "end": 684, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 681 }, { "analysis_explanation": null, "end": 807, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 805 }, { "analysis_explanation": null, "end": 867, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 864 }, { "analysis_explanation": null, "end": 912, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 909 }, { "analysis_explanation": null, "end": 946, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 943 }, { "analysis_explanation": null, "end": 1012, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 1009 }, { "analysis_explanation": null, "end": 1825, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 1822 }, { "analysis_explanation": null, "end": 1856, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 1853 }, { "analysis_explanation": null, "end": 1880, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 1877 }, { "analysis_explanation": null, "end": 1906, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 1903 }, { "analysis_explanation": null, "end": 1933, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 1930 }, { "analysis_explanation": null, "end": 1954, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 1951 }, { "analysis_explanation": null, "end": 2510, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 2507 }, { "analysis_explanation": null, "end": 3106, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 3103 }, { "analysis_explanation": null, "end": 3130, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 3127 }, { "analysis_explanation": null, "end": 3152, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 3149 }, { "analysis_explanation": null, "end": 3332, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 3329 }, { "analysis_explanation": null, "end": 3389, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 3386 }, { "analysis_explanation": null, "end": 3447, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 3444 }, { "analysis_explanation": null, "end": 3501, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 3498 }, { "analysis_explanation": null, "end": 3591, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 3588 }, { "analysis_explanation": null, "end": 3807, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 3804 }, { "analysis_explanation": null, "end": 3919, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 3916 }, { "analysis_explanation": null, "end": 4110, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 4107 }, { "analysis_explanation": null, "end": 4329, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 4326 }, { "analysis_explanation": null, "end": 4351, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 4348 }, { "analysis_explanation": null, "end": 7353, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 7350 }, { "analysis_explanation": null, "end": 8199, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 8196 }, { "analysis_explanation": null, "end": 9686, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 9681 }, { "analysis_explanation": null, "end": 10419, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 10417 }, { "analysis_explanation": null, "end": 12283, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 12280 }, { "analysis_explanation": null, "end": 13965, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 13963 }, { "analysis_explanation": null, "end": 14908, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 14906 }, { "analysis_explanation": null, "end": 15291, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 15289 }, { "analysis_explanation": null, "end": 15375, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 15373 }, { "analysis_explanation": null, "end": 15673, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 15671 }, { "analysis_explanation": null, "end": 16180, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 16178 }, { "analysis_explanation": null, "end": 16415, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 16413 }, { "analysis_explanation": null, "end": 16532, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 16530 }, { "analysis_explanation": null, "end": 17120, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 17118 }, { "analysis_explanation": null, "end": 17933, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 17931 }, { "analysis_explanation": null, "end": 19023, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 19021 }, { "analysis_explanation": null, "end": 19946, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 19944 }, { "analysis_explanation": null, "end": 20565, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 20563 }, { "analysis_explanation": null, "end": 20838, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 20836 }, { "analysis_explanation": null, "end": 21402, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 21400 }, { "analysis_explanation": null, "end": 21994, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 21992 }, { "analysis_explanation": null, "end": 22544, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 22542 }, { "analysis_explanation": null, "end": 22913, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 22911 }, { "analysis_explanation": null, "end": 23181, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 23179 }, { "analysis_explanation": null, "end": 23601, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 23599 }, { "analysis_explanation": null, "end": 23792, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 23790 }, { "analysis_explanation": null, "end": 24152, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 24149 }, { "analysis_explanation": null, "end": 24211, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 24209 }, { "analysis_explanation": null, "end": 24286, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 24283 }, { "analysis_explanation": null, "end": 24443, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 24440 }, { "analysis_explanation": null, "end": 24940, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 24937 }, { "analysis_explanation": null, "end": 25075, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 25072 }, { "analysis_explanation": null, "end": 25329, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 25326 }, { "analysis_explanation": null, "end": 25422, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 25419 }, { "analysis_explanation": null, "end": 26220, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 26217 }, { "analysis_explanation": null, "end": 26395, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 26392 }, { "analysis_explanation": null, "end": 26913, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 26910 }, { "analysis_explanation": null, "end": 27346, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 27344 }, { "analysis_explanation": null, "end": 27721, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 27718 }, { "analysis_explanation": null, "end": 27773, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 27770 }, { "analysis_explanation": null, "end": 27818, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 27815 }, { "analysis_explanation": null, "end": 28088, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 28085 }, { "analysis_explanation": null, "end": 29026, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 29023 }, { "analysis_explanation": null, "end": 29047, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 29044 }, { "analysis_explanation": null, "end": 29287, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 29284 }, { "analysis_explanation": null, "end": 29477, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 29474 }, { "analysis_explanation": null, "end": 29784, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 29781 }, { "analysis_explanation": null, "end": 30123, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 30121 }, { "analysis_explanation": null, "end": 30912, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 30909 }, { "analysis_explanation": null, "end": 31219, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 31216 }, { "analysis_explanation": null, "end": 31359, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 31356 }, { "analysis_explanation": null, "end": 32159, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 32156 }, { "analysis_explanation": null, "end": 32896, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 32894 }, { "analysis_explanation": null, "end": 32922, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 32919 }, { "analysis_explanation": null, "end": 32949, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 32946 }, { "analysis_explanation": null, "end": 33306, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 33303 }, { "analysis_explanation": null, "end": 33788, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 33785 }, { "analysis_explanation": null, "end": 33993, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 33990 }, { "analysis_explanation": null, "end": 34190, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 34187 }, { "analysis_explanation": null, "end": 34215, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 34212 }, { "analysis_explanation": null, "end": 34240, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 34237 }, { "analysis_explanation": null, "end": 34517, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 34515 }, { "analysis_explanation": null, "end": 34538, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 34535 }, { "analysis_explanation": null, "end": 35227, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 35224 }, { "analysis_explanation": null, "end": 35305, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 35302 }, { "analysis_explanation": null, "end": 35346, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 35343 }, { "analysis_explanation": null, "end": 35887, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 35884 }, { "analysis_explanation": null, "end": 35908, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 35905 }, { "analysis_explanation": null, "end": 35929, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 35926 }, { "analysis_explanation": null, "end": 36710, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 36708 }, { "analysis_explanation": null, "end": 36736, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 36733 }, { "analysis_explanation": null, "end": 36953, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 36950 }, { "analysis_explanation": null, "end": 36992, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 36990 }, { "analysis_explanation": null, "end": 37188, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 37186 }, { "analysis_explanation": null, "end": 37588, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 37585 }, { "analysis_explanation": null, "end": 38015, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 38012 }, { "analysis_explanation": null, "end": 38036, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 38033 }, { "analysis_explanation": null, "end": 38056, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 38053 }, { "analysis_explanation": null, "end": 38257, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 38254 }, { "analysis_explanation": null, "end": 38945, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 38943 }, { "analysis_explanation": null, "end": 38969, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 38966 }, { "analysis_explanation": null, "end": 38995, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 38992 }, { "analysis_explanation": null, "end": 39019, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 39017 }, { "analysis_explanation": null, "end": 39149, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 39147 }, { "analysis_explanation": null, "end": 39300, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 39297 }, { "analysis_explanation": null, "end": 39351, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 39348 }, { "analysis_explanation": null, "end": 39386, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 39383 }, { "analysis_explanation": null, "end": 39409, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.3, "start": 39406 } ]
[ "Hugh Pavletich, one of the report’s authors, said housing had become more affordable in Australia over the past year as prices fell amid tightening credit. ", "He said that Ms. Ardern’s government, which took office in October 2017, had been “messing around” by focusing too much on the hotly debated plan to build 100,000 more houses — called KiwiBuild — instead of freeing up more land for construction, which he said could have kept prices in check.", "\n\n“If they’d got out of the starting blocks with structural reforms centered around land supply and infrastructure financing soon after the election, it would have sent a far clearer signal to the market and subdued it significantly as these changes were put in place,” he said.", "\n\nBut the center-left Labour Party that Ms. Ardern leads has now conceded that its flagship policy will not ease the housing crisis as rapidly as it had hoped. ", "The prime minister told reporters Wednesday that the government would still build 100,000 housing units in a decade, but that its interim targets would be scrapped.", "\n\nThe government now expects to have 300 new homes built under the plan by July, rather than the original plan for 1,000.", "\n\nPhil Twyford, the housing minister, said Wednesday that there would be a “recalibration” of the policy, noting that demand for the new homes in some areas had been weaker than expected. ", "KiwiBuild has faced criticism from political opponents that even its cheapest houses are too expensive for first-time buyers who had been shut out of the market." ]
{ "pile_set_name": "OpenWebText2" }
[ 0.00641025641025641, 0.003424657534246575, 0, 0.0125, 0, 0, 0.005319148936170213, 0.006211180124223602 ]
0.004233
5
[ { "analysis_explanation": null, "end": 14, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 0 }, { "analysis_explanation": null, "end": 97, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 88 }, { "analysis_explanation": null, "end": 116, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 103 }, { "analysis_explanation": null, "end": 179, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 173 }, { "analysis_explanation": null, "end": 227, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 215 }, { "analysis_explanation": null, "end": 774, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 768 }, { "analysis_explanation": null, "end": 927, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 918 }, { "analysis_explanation": null, "end": 999, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 991 }, { "analysis_explanation": null, "end": 1126, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1122 }, { "analysis_explanation": null, "end": 1181, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1169 }, { "analysis_explanation": null, "end": 1219, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1210 } ]
[ "Relating individual differences in internalizing symptoms to emotional attention set-shifting in children.", "\nA growing body of evidence points to links between internalizing symptoms and various executive functioning deficits, and especially to inhibition and set-shifting difficulties. ", "However, there is limited developmental research regarding the impact of internalizing symptoms on the shifting function, particularly during middle childhood. ", "The current study investigated attention shifting in a sample of 108 early school age children (7-11 years) using a task-switching paradigm which required participants to alternate between emotional and nonemotional judgments. ", "Results indicated that higher levels of internalizing symptoms (anxiety and depression) had a detrimental effect on performance efficiency (measured by response times) but not on response accuracy. ", "This effect was only observed on emotional (and not on nonemotional) repetition trials and did not affect switching trials; moreover, it was only present when feedback was presented to participants. ", "The findings partially support the predictions of the Attentional Control Theory in a developmental sample and suggest that individual differences in internalizing symptoms play a role in children's ability to flexibly alternate between emotional judgments." ]
{ "pile_set_name": "PubMed Abstracts" }
[ 0, 0, 0, 0, 0, 0, 0.0038910505836575876 ]
0.000556
5
[ { "analysis_explanation": null, "end": 551, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 540 } ]
[ "LaunchTemplateSpotMarketOptions\n\nContents\n\nThe required duration for the Spot Instances (also known as Spot blocks), in minutes.", "\nThis value must be a multiple of 60 (60, 120, 180, 240, 300, or 360).", "\n\nType: Integer\n\nRequired: No\n\ninstanceInterruptionBehavior\n\nThe behavior when a Spot Instance is interrupted.", "\n\nType: String\n\nValid Values: hibernate | stop | terminate\n\nRequired: No\n\nmaxPrice\n\nThe maximum hourly price you're willing to pay for the Spot Instances.", "\n\nType: String\n\nRequired: No\n\nspotInstanceType\n\nThe Spot Instance request type.", "\n\nType: String\n\nValid Values: one-time | persistent\n\nRequired: No\n\nvalidUntil\n\nThe end date of the request. ", "For a one-time request, the request remains active until\nall instances launch, the request is canceled, or this date is reached. ", "If the request\nis persistent, it remains active until it is canceled or this date and time is reached.", "\n\nType: Timestamp\n\nRequired: No\n\nSee Also\n\nFor more information about using this API in one of the language-specific AWS SDKs,\nsee the following:" ]
{ "pile_set_name": "Pile-CC" }
[ 0.0078125, 0, 0, 0.006493506493506494, 0, 0, 0, 0, 0.006896551724137931 ]
0.002356
5
[ { "analysis_explanation": null, "end": 127, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 120 }, { "analysis_explanation": null, "end": 408, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 402 }, { "analysis_explanation": null, "end": 628, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 616 } ]
[ "Q:\n\nHow to find a numerical antiderivative with NIntegrate methods?", "\n\n@JimBelk asked in\nInterpolating an Antiderivative\nhow to find a numerical antiderivative.", "\nI gave an answer that uses NDSolve with the default method for integrating\n$y'=f(x,y)$.\nHowever for $f(x,y)=g(x)$, more powerful integration rules are available, like Gauss-Kronrod.", "\nIs there a way to use NIntegrate integration rules within NDSolve to solve IVPs of the form y'[x] == f[x]?", "\nFor instance, to find\nNDSolve[{y'[x] == Sin[x^2], y[0] == 0}, y, {x, 0, 15}]\n\nwith a method from NIntegrate.", "\n\nA:\n\nWe construct an NDSolve method which can pass an NIntegrate method to NIntegrate to set up an integration rule. ", " We define a method nintegrate implements such a method. ", " The requirements are\n\nthe ODE is of the form y'[x] == f[x], and\nthe NIntegrate method returns an interpolatory rule.", "\n\nExample:\nfoo = NDSolveValue[{y'[x] == Sin[x^2], y[0] == 0}, y, {x, 0, 15}, \n Method -> nintegrate, InterpolationOrder -> All]\n\nError plot:\nPlot[\n Evaluate@RealExponent[Integrate[Sin[x^2], x] - foo[x]],\n {x, 0, 15},\n GridLines -> {Flatten@foo@\"Grid\", None}, (* show steps *)\n PlotRange -> {-18.5, 0.5}]\n\nAnother example:\nfoo = NDSolveValue[{y'[x] == Sin[x^2], y[0] == 0}, y, {x, 0, 15}, \n Method -> {nintegrate, \n Method -> {\"ClenshawCurtisRule\", \"Points\" -> 33}}, \n InterpolationOrder -> All, WorkingPrecision -> 32, \n PrecisionGoal -> 24, MaxStepFraction -> 1, StartingStepSize -> 15]\n\nError plot:\nBlock[{$MaxExtraPrecision = 500},\n ListLinePlot[\n Integrate[Sin[x^2], x] - foo[x] /. x -> Subdivide[0, 15, 1000] // \n RealExponent, DataRange -> {0, 15}, PlotRange -> {-35.5, 0.5}, \n GridLines -> {Flatten@foo@\"Grid\", None}]\n ]\n\nCode for method\nnintegrate::nintode = \n \"Method nintegrate requires an ode of the form ``'[``] == f[``]\";\nnintegrate::nintinit = \n \"NIntegrate method `` did not return an interpolatory integration rule.\";", "\n\nnintegrate[___][\"StepInput\"] = {\"F\"[\"T\"], \"H\", \"T\", \"X\", \"XP\"};\nnintegrate[___][\"StepOutput\"] = {\"H\", \"XI\"};\nnintegrate[rule_, order_, ___][\"DifferenceOrder\"] := order;\nnintegrate[___][\"StepMode\"] := Automatic\n\nOptions@nintegrate = {Method -> \"GaussKronrodRule\"};\ngetorder[points_, method_] :=\n Switch[method\n , \"GaussKronrodRule\" | \"GaussKronrod\",\n (* check points should be odd ??? *)", "\n With[{gp = (points - 1)/2},\n If[OddQ[gp], 3 gp + 2, 3 gp + 1]\n ]\n , \"LobattoKronrodRule\",\n (* check points should be odd ??? *)", "\n With[{glp = (points + 1)/2},\n If[OddQ[glp], 3 glp - 2, 3 glp - 3]\n ]\n , \"GauseBerntsenEspelidRule\",\n 2 points - 1\n , \"NewtonCotesRule\",\n If[OddQ[points], points, points - 1]\n , _, points - 1\n ];\nnintegrate /: \n NDSolve`InitializeMethod[nintegrate, stepmode_, sd_, rhs_, state_, \n mopts : OptionsPattern[nintegrate]] := \n Module[{prec, order, norm, rule, xvars, tvar, imeth},\n xvars = NDSolve`SolutionDataComponent[state@\"Variables\", \"X\"];\n tvar = NDSolve`SolutionDataComponent[state@\"Variables\", \"T\"];\n If[Length@xvars !", "= 1,\n Message[nintegrate::nintode, First@xvars, tvar, tvar];\n Return[$Failed]];\n If[! ", "VectorQ[rhs[\"FunctionExpression\"][\n N@NDSolve`SolutionDataComponent[sd, \"T\"],\n Sequence @@ xvars],\n NumericQ\n ],\n Message[nintegrate::nintode, First@xvars, tvar, tvar];\n Return[$Failed]];\n prec = state@\"WorkingPrecision\";\n norm = state@\"Norm\";\n \n imeth = Replace[Method /. mopts, Automatic -> \"GaussKronrodRule\"];\n rule = \n NIntegrate[1, {x, 0, 1}, \n Method -> {\"GlobalAdaptive\", \"SymbolicProcessing\" -> 0, \n Method -> imeth},\n WorkingPrecision -> prec,\n IntegrationMonitor :>\n (Return[Through[#@\"GetRule\"], NIntegrate] &)];\n rule = Replace[rule, {\n {(NIntegrate`GeneralRule | NIntegrate`ClenshawCurtisRule)[idata_]} :>\n idata,\n _NIntegrate :>\n Return[$Failed],\n _ :> (* What happened here? *)", "\n (Message[nintegrate::nintinit, Method -> imeth];\n Return[$Failed])\n }];\n order = \n getorder[Length@First@rule, imeth /. {m_String, ___} :> m];\n \n nintegrate[rule, order, norm]\n ];\n\n(rule : nintegrate[int_, order_, norm_, ___])[\n \"Step\"[rhs_, h_, t_, x_, xp_]] := \n Module[{prec, tt, xx, dx, normh, err, hnew, temp},\n (* Norm scaling will be based on current solution y. *)\n normh = (Abs[h] temp[#1, x] &) /. {temp -> norm};\n tt = Rescale[int[[1]], {0, 1}, {t, t + h}];\n xx = rhs /@ tt;\n dx = h*int[[2]].xx;\n (* Compute scaled error estimate *)\n err = h*int[[3]].xx // normh;\n hnew = Which[\n err > 1 (* Rejected step: reduce h by half *)\n , dx = $Failed; h/2\n , err < 2^-(order + 2), 2 h\n , err < 1/2, h\n , True, h Max[1/2, Min[9/10, (1/(2 err))^(1/(order + 1))]]\n ];\n (* Return step data along with updated method data *)\n {hnew, dx}];\n\n" ]
{ "pile_set_name": "StackExchange" }
[ 0.014925373134328358, 0.02197802197802198, 0.02197802197802198, 0.018691588785046728, 0.009174311926605505, 0.025423728813559324, 0, 0.017094017094017096, 0.0009560229445506692, 0, 0, 0.0018115942028985507, 0, 0.007623888182973317, 0.00546448087431694 ]
0.009675
5
[ { "analysis_explanation": null, "end": 192, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 185 }, { "analysis_explanation": null, "end": 338, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 325 }, { "analysis_explanation": null, "end": 405, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 398 }, { "analysis_explanation": null, "end": 583, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 576 }, { "analysis_explanation": null, "end": 1557, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1555 }, { "analysis_explanation": null, "end": 1647, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1638 }, { "analysis_explanation": null, "end": 2429, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2420 }, { "analysis_explanation": null, "end": 2940, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2886 }, { "analysis_explanation": null, "end": 3810, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3775 }, { "analysis_explanation": null, "end": 4184, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4180 }, { "analysis_explanation": null, "end": 4260, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4255 }, { "analysis_explanation": null, "end": 4278, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4264 }, { "analysis_explanation": null, "end": 4473, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4469 }, { "analysis_explanation": null, "end": 1711, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_139620637004320", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 1709 }, { "analysis_explanation": null, "end": 1802, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_139620637004320", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 1800 }, { "analysis_explanation": null, "end": 2998, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_139620637004320", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 2996 }, { "analysis_explanation": null, "end": 3222, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_139620637004320", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 3220 }, { "analysis_explanation": null, "end": 3872, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_139620637004320", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 3870 }, { "analysis_explanation": null, "end": 4644, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "DateRecognizer_139620637004272", "recognizer_name": "DateRecognizer" }, "score": 0.1, "start": 4640 } ]
[ "AT90S1200 (****)\nAT90S2343 (*)\nATmega2560 (**)\nATmega2561 (**)\nATtiny11 (***)\n" ]
{ "pile_set_name": "Github" }
[ 0.01282051282051282 ]
0.012821
5
[]
[ "Last Frame For 'Sinbad The Fifth Voyage' Is In The Can :)\n\nWell guys it's been an incredibly long road to get here but, I've finally arrived at my destination... all my stop motion for 'Sinbad The Fifth Voyage' is now officially completed. ", "Sorry I don't have any photos I can post or nitty-gritty details to share because I'm not allowed to release anything from the production on my own.", "\n\nI have no idea how long to expect it to take for the production to complete all the rest of the work the film needs. ", "Between mattes, CG effects, sound, music and all the other thousands of details that need to be dealt with, it could still be months of work ahead for them. (", "don't quote me on that, I'm just making and educated guess) The producer has been telling me that there's a new preview that they will be releasing 'soon' but, I don't know what 'soon' means, considering that he started telling me that well over a month ago.", "\n\nI will (of course) keep you as up to date as I possibly can with any news I can bring to you about this production. ", "And now that my part of it is finally completed... I'm sure I'll be as impatient as you are.", "\n\nReplies to This Discussion\n\nSpare time? ", "What's that? ", "I already have three other jobs I'm late to start working on... two are jobs making props and I'm also past starting up on a Dynamation style stop motion scene that will be in the film 'Legend of the Golden Fishcake'. ", "So yeah, no down time for me, I gotta start shifting things around in the shop tomorrow morning and figure out a good working schedule.", "\n\nI read this earlier on FB. ", "Man I can't wait to see your work. ", "Over on the Fifth Voyage's FB page the natives are getting restless. ", "It's not a large tribe but the promise of a new, Exciting!, ", "trailer has been dangled in front of the few of us who visit. ", "Come on Mr producer, Director, Actor, throw us a bone and show us SOMETHING!", "\n\nPuppet Putty\n\nPuppet Putty is formulated by clay animator Don Carlson. ", "Properties include colors that do not bleed on your hands, a matte finish, cleans up with water, is very light weight, firm, non-greasy and has a silky texture.", "\n\nMESSAGE BOARD QUICK LINKS\n\nMessage Board\n\nFirst of all this book has a lot of great info, two thumbs up to the authors.", "My question is I see something called maxi-plast rubber and Plastazote what are these two items? ", "Since the book is from England, maybe it is something they only have…Continue\n\nHi all, I'm new on here and just getting into animation. ", "Got my interest from my 9 year old who makes little Lego movies. ", "I'm more interested in claymation and other forms of stop motion. ", "I've been playing around with some Newplast but having…Continue\n\nHey all,I'm working on a new short film called Uncle Antlers, which, while not primarily stop-motion like my past films (https://vimeo.com/11362592), contains elements of it and I'm animating it traditionally…Continue\n\nOn Thursday night we had the \"Best of Festival\" screening and awards ceremony for a film festival that I did a stop animation for. ", "My film \"Percipient\" was selected for the Best of Fest screening and nominated for a pile of awards. ", "I ended up…Continue" ]
{ "pile_set_name": "Pile-CC" }
[ 0, 0, 0, 0.006329113924050633, 0, 0, 0, 0, 0, 0.0045871559633027525, 0, 0, 0, 0, 0.016666666666666666, 0, 0, 0.0136986301369863, 0, 0, 0, 0, 0.015384615384615385, 0, 0.007228915662650603, 0, 0 ]
0.002366
5
[ { "analysis_explanation": null, "end": 638, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 632 }, { "analysis_explanation": null, "end": 922, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 911 }, { "analysis_explanation": null, "end": 1491, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1483 }, { "analysis_explanation": null, "end": 1499, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1492 }, { "analysis_explanation": null, "end": 1896, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1870 }, { "analysis_explanation": null, "end": 1939, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1928 }, { "analysis_explanation": null, "end": 2292, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2282 }, { "analysis_explanation": null, "end": 2349, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2342 }, { "analysis_explanation": null, "end": 2489, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2479 }, { "analysis_explanation": null, "end": 2881, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2873 }, { "analysis_explanation": null, "end": 2887, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2882 }, { "analysis_explanation": null, "end": 2798, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.6, "start": 2772 }, { "analysis_explanation": null, "end": 2798, "entity_type": "US_BANK_NUMBER", "recognition_metadata": { "recognizer_identifier": "UsBankRecognizer_139620636962096", "recognizer_name": "UsBankRecognizer" }, "score": 0.05, "start": 2790 }, { "analysis_explanation": null, "end": 2798, "entity_type": "US_DRIVER_LICENSE", "recognition_metadata": { "recognizer_identifier": "UsLicenseRecognizer_139620636961856", "recognizer_name": "UsLicenseRecognizer" }, "score": 0.01, "start": 2790 } ]
[ "#ifndef _ROS_geometry_msgs_Vector3Stamped_h\n#define _ROS_geometry_msgs_Vector3Stamped_h\n\n#include <stdint.h>\n#include <string.h>\n#include <stdlib.h>\n#include \"ros/msg.h\"\n#include \"std_msgs/Header.h\"\n#include \"geometry_msgs/Vector3.h\"\n\nnamespace geometry_msgs\n{\n\n class Vector3Stamped : public ros::Msg\n {\n public:\n typedef std_msgs::Header _header_type;\n _header_type header;\n typedef geometry_msgs::Vector3 _vector_type;\n _vector_type vector;\n\n Vector3Stamped():\n header(),\n vector()\n {\n }\n\n virtual int serialize(unsigned char *outbuffer) const\n {\n int offset = 0;\n offset += this->header.serialize(outbuffer + offset);\n offset += this->vector.serialize(outbuffer + offset);\n return offset;\n }\n\n virtual int deserialize(unsigned char *inbuffer)\n {\n int offset = 0;\n offset += this->header.deserialize(inbuffer + offset);\n offset += this->vector.deserialize(inbuffer + offset);\n return offset;\n }\n\n const char * getType(){ return \"geometry_msgs/Vector3Stamped\"; };\n const char * getMD5(){ return \"7b324c7325e683bf02a9b14b01090ec7\"; };\n\n };\n\n}\n#endif" ]
{ "pile_set_name": "Github" }
[ 0.0025906735751295338 ]
0.002591
5
[ { "analysis_explanation": null, "end": 299, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_139620637004320", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 297 }, { "analysis_explanation": null, "end": 343, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_139620637004320", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 341 }, { "analysis_explanation": null, "end": 420, "entity_type": "IP_ADDRESS", "recognition_metadata": { "recognizer_identifier": "IpRecognizer_139620637004320", "recognizer_name": "IpRecognizer" }, "score": 0.6, "start": 418 }, { "analysis_explanation": null, "end": 653, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 644 }, { "analysis_explanation": null, "end": 713, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 704 }, { "analysis_explanation": null, "end": 882, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 873 }, { "analysis_explanation": null, "end": 943, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 934 } ]
[ "#!", "/usr/bin/env python\n\nimport os\nimport plistlib\n\ndef main():\n from optparse import OptionParser, OptionGroup\n parser = OptionParser(\"\"\"\\\nUsage: %prog [options] <path>\n\nUtility for dumping Clang-style logged diagnostics.\\\n\"\"\")\n parser.add_option(\"-a\", \"--all\", action=\"store_true\", dest=\"all\", \n default=False, help=\"dump all messages.\")", "\n parser.add_option(\"-e\", \"--error\", action=\"store_true\", dest=\"error\", \n default=False, help=\"dump 'error' messages.\")", "\n parser.add_option(\"-f\", \"--fatal\", action=\"store_true\", dest=\"fatal\", \n default=False, help=\"dump 'fatal error' messages.\")", "\n parser.add_option(\"-i\", \"--ignored\", action=\"store_true\", dest=\"ignored\", \n default=False, help=\"dump 'ignored' messages.\")", "\n parser.add_option(\"-n\", \"--note\", action=\"store_true\", dest=\"note\", \n default=False, help=\"dump 'note' messages.\")", "\n parser.add_option(\"-w\", \"--warning\", action=\"store_true\", dest=\"warning\", \n default=False, help=\"dump 'warning' messages.\")", "\n (opts, args) = parser.parse_args()\n\n if len(args) !", "= 1:\n parser.error(\"invalid number of arguments\")\n\n levels = {'error': False, 'fatal error': False, 'ignored': False,\n 'note': False, 'warning': False}\n if opts.error:\n levels['error'] = True\n if opts.fatal:\n levels['fatal error'] = True\n if opts.ignored:\n levels['ignored'] = True\n if opts.note:\n levels['note'] = True\n if opts.warning:\n levels['warning'] = True\n\n path, = args\n\n # Read the diagnostics log.", "\n f = open(path)\n try:\n data = f.read()\n finally:\n f.close()\n\n # Complete the plist (the log itself is just the chunks).", "\n data = \"\"\"\\\n<?", "xml version=\"1.0\" encoding=\"UTF-8\"?", ">\n<!", "DOCTYPE plist PUBLIC \"-//Apple Computer//DTD PLIST 1.0//EN\" \\\n \"http://www.apple.com/DTDs/PropertyList-1.0.dtd\">\n<plist version=\"1.0\">\n<array>\n%s\n</array>\n</plist>\"\"\" % data\n\n # Get the list of files and diagnostics to report.", "\n to_report = []\n diags = plistlib.readPlistFromString(data)\n for file_diags in diags:\n file = file_diags.get('main-file')\n\n # Ignore diagnostics for 'conftest.c', which is the file autoconf uses\n # for its tests (which frequently will have warnings).", "\n if os.path.basename(file) == 'conftest.c':\n continue\n\n # Get the diagnostics for the selected levels.", "\n selected_diags = [d\n for d in file_diags.get('diagnostics', ())\n if levels[d.get('level')] or opts.all]\n if selected_diags:\n to_report.append((file, selected_diags))\n\n # If there are no diagnostics to report, show nothing.", "\n if not to_report:\n return\n\n # Otherwise, print out the diagnostics.", "\n print\n print \"**** BUILD DIAGNOSTICS ****\"\n for file,selected_diags in to_report:\n print \"*** %s ***\" % file\n for d in selected_diags:\n print \" %s:%s:%s: %s: %s\" % (\n d.get('filename'), d.get('line'), d.get('column'),\n d.get('level'), d.get('message'))\n\nif __name__ == \"__main__\":\n main()\n" ]
{ "pile_set_name": "Github" }
[ 0, 0.00821917808219178, 0, 0, 0, 0, 0, 0.03389830508474576, 0, 0, 0, 0.02857142857142857, 0, 0.00796812749003984, 0.0035587188612099642, 0.0078125, 0, 0, 0.00558659217877095 ]
0.005032
5
[ { "analysis_explanation": null, "end": 11, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8 }, { "analysis_explanation": null, "end": 1168, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1147 }, { "analysis_explanation": null, "end": 3101, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3088 }, { "analysis_explanation": null, "end": 1953, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.6, "start": 1906 }, { "analysis_explanation": null, "end": 247, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 238 }, { "analysis_explanation": null, "end": 378, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 369 }, { "analysis_explanation": null, "end": 517, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 508 }, { "analysis_explanation": null, "end": 662, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 653 }, { "analysis_explanation": null, "end": 807, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 798 }, { "analysis_explanation": null, "end": 943, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 934 }, { "analysis_explanation": null, "end": 1103, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 1094 }, { "analysis_explanation": null, "end": 1156, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 1147 }, { "analysis_explanation": null, "end": 1323, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 1316 }, { "analysis_explanation": null, "end": 1483, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 1476 }, { "analysis_explanation": null, "end": 1665, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 1661 }, { "analysis_explanation": null, "end": 1695, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 1691 }, { "analysis_explanation": null, "end": 2110, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 2099 }, { "analysis_explanation": null, "end": 2191, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 2183 }, { "analysis_explanation": null, "end": 2362, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 2352 }, { "analysis_explanation": null, "end": 2537, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 2529 }, { "analysis_explanation": null, "end": 2598, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 2594 }, { "analysis_explanation": null, "end": 2620, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 2613 }, { "analysis_explanation": null, "end": 3058, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 3054 }, { "analysis_explanation": null, "end": 3077, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 3073 }, { "analysis_explanation": null, "end": 3092, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 3088 }, { "analysis_explanation": null, "end": 3125, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 3121 }, { "analysis_explanation": null, "end": 3141, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 3137 } ]
[ "PROJECT SUMMARY/ABSTRACT Heterocycles are ubiquitous in small molecule drugs and natural products. ", "Modifying such heterocycles to include quaternary centers may impart a number of beneficial effects on pharmacological properties, including increasing binding affinity, increasing solubility or membrane permeability, increasing metabolic stability, and reducing hERG binding. ", "Using our recently developed enantioselective decarboxylative allylic alkylation method, we can now synthesize ?", "-quaternary centers in a highly enantioselective manner. ", "This project?s overall goal is to provide proof of principle that quaternary heterocycles impart advantages to drug-like molecules. ", "Specifically, our three specific aims serve as case studies to demonstrate the potential advantages of incorporating quaternary centers into heterocycle-containing drugs. ", "In aim I, we will synthesize and evaluate tetra-substituted morpholino derivatives of the antibiotic linezolid to test the hypothesis that tetra-substitution will reduce metabolic clearance, thus reducing the dosage frequency of the drug. ", "In aim II, we will expand our enantioselective allylic alkylation method to synthesize ?", "-quaternary ?", "-lactams. ", "We will then apply the method to synthesize and evaluate analogs of the antibiotic meropenem to test the hypothesis that ?", "-quaternary meropenem analogs will have increased spectrum of activity, including activity against meropenem-resistant bacterial strains. ", "In aim III, we will synthesize and evaluate quaternary piperidine derivatives of the cancer drug ceretinib to test two hypotheses: first, that quaternary centers can access novel binding sites on target enzymes to circumvent resistance in cancer cell lines harboring the clinically significant resistance mutation G1202R; second, that quaternary centers can reduce hERG binding, leading to reduced incidence of QT prolongation. ", "Anticipated outcomes from successful completion of these specific aims, aside from the design of new lead antibiotic and anti-cancer small molecules, include two broadly impactful results: first, this method will provide a new chemical platform to improve the drug-like properties of drugs that contain heterocycles, imparting significant benefits to patients. ", "Second, demonstration of the beneficial pharmacological effects of quaternary heterocycles will warrant their inclusion as privileged motifs in the design of chemical libraries, further expanding the diversity of existing small molecule libraries. ", "Such diversified chemical libraries will facilitate the discovery of quaternary-enhanced hits during high-throughput biological screening against various targets." ]
{ "pile_set_name": "NIH ExPorter" }
[ 0.010101010101010102, 0.0036101083032490976, 0, 0, 0.007575757575757576, 0, 0, 0.011363636363636364, 0, 0, 0, 0, 0.002336448598130841, 0, 0, 0 ]
0.002187
5
[ { "analysis_explanation": null, "end": 37, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 25 } ]
[ "(c) section 6222(c)(2) with respect to appointments of members of the Marine Band and members of the Marine Drum and Bugle Corps to grades not above the grade of captain.", "\n\nSec. ", "2. ", "Reassignment of Functions Assigned. ", "The Secretary of Defense may reassign the functions assigned to him by sections 1(a) and (b) of this order only to civilian officers within the Office of the Secretary of Defense (as defined in section 131(b) of title 10, United States Code) who hold a position for which the President makes an appointment by and with the advice and consent of the Senate. ", "The Secretary of Defense may not reassign the function assigned to him by section 1(c) of this order.", "\n\nSec. ", "3. ", "General Provisions. (", "a) Nothing in this order shall be construed to limit or otherwise affect the authority of the President as Commander in Chief of the Armed Forces of the United States, or under the Constitution and laws of the United States to nominate or to make or terminate appointments.", "\n\n(b) This order is not intended to, and does not, create any right or benefit, substantive or procedural, enforceable at law or in equity by any party against the United States, its departments, agencies, or entities, its officers, employees, or agents, or any other person." ]
{ "pile_set_name": "Pile-CC" }
[ 0.01764705882352941, 0, 0, 0, 0.014005602240896359, 0.009900990099009901, 0, 0, 0.047619047619047616, 0.003663003663003663, 0 ]
0.00844
5
[ { "analysis_explanation": null, "end": 298, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 295 }, { "analysis_explanation": null, "end": 455, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 437 }, { "analysis_explanation": null, "end": 927, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 910 }, { "analysis_explanation": null, "end": 1153, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1136 } ]
[ "Q:\n\nHow can I read a whole file into a string variable\n\nI have lots of small files, I don't want to read them line by line.", "\nIs there a function in Go that will read a whole file into a string variable?", "\n\nA:\n\nUse ioutil.", "ReadFile:\nfunc ReadFile(filename string) ([]byte, error)\n\nReadFile reads the file named by filename and returns the contents. ", "A successful call\n returns err == nil, not err == EOF. ", "Because ReadFile reads the whole file, it does not treat\n an EOF from Read as an error to be reported.", "\n\nYou will get a []byte instead of a string. ", "It can be converted if really necessary:\ns := string(buf)\n\nA:\n\nIf you just want the content as string, then the simple solution is to use the ReadFile function from the io/ioutil package. ", "This function returns a slice of bytes which you can easily convert to a string.", "\npackage main\n\nimport (\n \"fmt\"\n \"io/ioutil\"\n)\n\nfunc main() {\n b, err := ioutil.", "ReadFile(\"file.txt\") // just pass the file name\n if err !", "= nil {\n fmt.", "Print(err)\n }\n\n fmt.", "Println(b) // print the content as 'bytes'\n\n str := string(b) // convert content to a 'string'\n\n fmt.", "Println(str) // print the content as a 'string'\n}\n\nA:\n\nI think the best thing to do, if you're really concerned about the efficiency of concatenating all of these files, is to copy them all into the same bytes buffer.", "\nbuf := bytes.", "NewBuffer(nil)\nfor _, filename := range filenames {\n f, _ := os.", "Open(filename) // Error handling elided for brevity.", "\n io.", "Copy(buf, f) // Error handling elided for brevity.", "\n f.Close()\n}\ns := string(buf.", "Bytes())\n\nThis opens each file, copies its contents into buf, then closes the file. ", " Depending on your situation you may not actually need to convert it, the last line is just to show that buf.", "Bytes() has the data you're looking for.", "\n\n" ]
{ "pile_set_name": "StackExchange" }
[ 0, 0, 0, 0, 0.017857142857142856, 0.009708737864077669, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.015384615384615385, 0, 0, 0, 0.03225806451612903, 0, 0, 0, 0 ]
0.003008
5
[ { "analysis_explanation": null, "end": 603, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 593 }, { "analysis_explanation": null, "end": 1544, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1537 }, { "analysis_explanation": null, "end": 1564, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1554 }, { "analysis_explanation": null, "end": 1541, "entity_type": "URL", "recognition_metadata": { "recognizer_identifier": "UrlRecognizer_139620637004704", "recognizer_name": "UrlRecognizer" }, "score": 0.5, "start": 1537 } ]
[ "Kingdom of Hungary (1920–1946)\n\nThe Kingdom of Hungary (Hungarian: Magyar Királyság), from 1945 to 1946 known as the Hungarian State (Hungarian: Magyar Állam), and sometimes referred to as the Regency or the Horthy era, existed as a country from 1920 to 1946 under the rule of Regent Miklós Horthy. ", "Horthy officially represented the Hungarian monarchy of Charles IV, Apostolic King of Hungary. ", "Attempts by Charles IV to return to the throne were prevented by threats of war from neighbouring countries and by the lack of support from Horthy. ", "Charles died in 1922, leaving the throne empty for the remainder of the country's time as a kingdom.", "\n\nHungary under Horthy was characterized by its conservative, nationalist and fiercely anti-communist character. ", "The regency was based on an unstable alliance of conservatives and right-wingers. ", "Foreign policy was characterized by revisionism - the total or partial revision of the Treaty of Trianon, which had seen Hungary lose over 70% of its territory along with over three million Hungarians, who mostly lived in the border territories outside the new borders of the kingdom. ", "Hungary's interwar politics were dominated with an obsession of the territorial losses suffered in this treaty.", "\n\nGermany's influence in Hungary has led some historians to consider that the country increasingly became a client state of Germany after 1938. ", "The Kingdom of Hungary was an Axis Power during World War II and focused to regain Hungarian majority territory which had been lost in the Treaty of Trianon, achieving this goal in early 1941. ", "By 1944, following heavy setbacks for the Axis, Horthy's government negotiated secretly with the Allies, and also considered leaving the war. ", "Because of this Hungary was occupied by Germany and Horthy was deposed. ", "The extremist Arrow Cross Party's leader Ferenc Szálasi established a new Nazi-backed government, effectively turning Hungary into a German-occupied puppet state.", "\n\nAfter World War II, Hungary fell within the Soviet Union's sphere of influence and the Second Hungarian Republic was established in 1946. ", "In 1949, the communist Hungarian People's Republic was founded.", "\n\nFormation \n\nUpon the dissolution and break-up of Austria-Hungary after World War I, the Hungarian Democratic Republic and then the Hungarian Soviet Republic were briefly proclaimed in 1918 and 1919, respectively. ", "The short-lived communist government of Béla Kun launched what was known as the \"Red Terror\", involving Hungary in an ill-fated war with Romania. ", "In 1920, the country fell into a period of civil conflict, with Hungarian anti-communists and monarchists violently purging the nation of communists, leftist intellectuals, and others whom they felt threatened by, especially Jews. ", " This period was known as the \"White Terror\". ", "In 1920, after the pullout of the last of the Romanian occupation forces, the Kingdom of Hungary was restored.", "\n\nOn 29 February 1920, a coalition of right-wing political forces united and returned Hungary to being a constitutional monarchy. ", " However, it was obvious that the Allies would not accept any return of Charles IV. ", " It was thus decided to select a regent to represent the monarchy. ", " Miklós Horthy, the last commanding admiral of the Austro-Hungarian Navy, was chosen for this position on 1 March. ", "Sándor Simonyi-Semadam was the first Prime Minister of Horthy's regency.", "\n\nIn 1921 Charles IV returned in Hungary and tried to retake its throne, even trying to march on Budapest with some rebel troops in October 1921; however, his attempts failed as much of the army remained loyal to Horthy and thus Charles was arrested and exiled to Madeira.", "\n\nOn 6 November 1921 the Diet of Hungary passed a law nullifying the Pragmatic Sanction of 1713, dethroning Charles IV and abolishing the House of Habsburg's rights to the throne of Hungary.", "\n\nWith civil unrest too great to select a new King, it was decided to confirm Horthy as Regent of Hungary.", "\n\nGovernment \n\nHorthy's rule as Regent possessed characteristics such that it could be construed a dictatorship. ", "As a counterpoint, his powers were a continuation of the constitutional powers of the King of Hungary, adopted earlier during the federation with the Austrian Empire. ", " As Regent, Horthy had the power to adjourn or dissolve the Hungarian Diet (parliament) at his own discretion; he appointed the Hungarian Prime Minister.", "\n\nThe succession after Horthy's death or abdication was never officially established; presumably the Hungarian Parliament would have selected a new regent, or possibly attempted to restore the Habsburgs under Crown Prince Otto. ", "In January 1942, Parliament appointed Horthy's eldest son István as Deputy Regent and expected successor. ", "Whether this represents an attempt to gradually re-establish monarchy in Hungary is unclear; at any rate, István was killed in an airplane crash in August that year, and a new Deputy Regent was not appointed.", "\n\nDuring his first ten years, Horthy led increased repression of Hungarian minorities. ", "In 1920, the numerus clausus law formally placed limits on the number of minority students at university, and legalized corporal punishment for adults in criminal cases. ", "Although the law seemingly applied in equal measure to all minorities, the ethnicity quota system was never fully introduced and the law acted largely to conceal anti-Jewish action from foreign observers. ", "Limitations were relaxed in 1928. ", "Racial criteria in admitting new students were removed and replaced by social criteria. ", "Five categories were set up: civil servants, war veterans and army officers, small landowners and artisans, industrialists, and the merchant classes. ", "Under István Bethlen as Prime Minister the electoral system was changed to reintroduce an open vote system outside Budapest and its vicinity and cities with county municipal rights. ", "His political party, the Party of Unity, won repeated elections. ", "Bethlen pushed for revision of the Treaty of Trianon. ", "After the collapse of the Hungarian economy from 1929 to 1931, national turmoil pushed Bethlen to resign as Prime Minister. ", "In 1938 the changes to the electoral system were reversed.", "\n\nSocial conditions in the kingdom did not improve as time passed, as a very small proportion of the population continued to control much of the country's wealth. ", "Jews were continually pressured to assimilate into Hungarian mainstream culture. ", " The desperate situation forced the Regent, Horthy, to accept the far-right politician Gyula Gömbös as Prime Minister. ", "He pledged to retain the existing political system. ", "Gömbös agreed to abandon his extreme anti-Semitism and allow some Jews into the government.", "\n\nIn power, Gömbös moved Hungary towards a one-party government like those of Fascist Italy and Nazi Germany. ", "Pressure by Nazi Germany for extreme anti-Semitism forced Gömbös out and Hungary pursued anti-Semitism under its “Jewish Laws”. ", "Initially, the government passed laws restricting Jews to 20 percent in a number of professions. ", "Later it scapegoated the Jews for the country's failing economy.", "\n\nIn 1944, responding to the advancing Soviet forces, the Regent Miklós Horthy deposed the pro-German Prime Minister and installed a more balanced government in an effort to engage with the Allies and avoid occupation by the Soviet Union. ", "Shortly afterward, German forces invaded Hungary, deposed Horthy as Regent, and installed a puppet regime led by Ferenc Szálasi of the anti-Semitic and pro-Nazi Arrow Cross Party. ", "The Arrow Cross Party never abolished the Monarchy as a form of government, and Hungarian newspapers continued to refer to the country as the Kingdom of Hungary (Magyar Királyság), although Magyarország (Hungary) was used as an alternative. ", "From May to June 1944, Hungarian authorities rapidly rounded up and transported hundreds of thousands of Hungarian Jews to Nazi concentration camps, where most died.", "\n\nAfter the fall of the Szálasi regime, a Soviet-backed government under Béla Miklós was nominally left in control of the entire country. ", "A High National Council was appointed in January to assume the Regency, and included members of the Hungarian Communist Party, like Ernő Gerő, and later Mátyás Rákosi and László Rajk.", "\n\nEconomy \n\nUpon the kingdom's establishment soon after World War I, the country suffered from economic decline, budget deficits, and high inflation as a result of the loss of economically important territories under the Treaty of Trianon, including Czechoslovakia, Romania, and Yugoslavia. ", "The land losses of the Treaty of Trianon in 1920 caused Hungary to lose agricultural and industrial areas, making it dependent on exporting products from what agricultural land it had left to maintain its economy. ", "Prime Minister István Bethlen's government dealt with the economic crisis by seeking large foreign loans, which allowed the country achieve monetary stabilization in the early 1920s. ", "He introduced a new currency in 1927, the pengő. ", "Industrial and farm production rose rapidly, and the country benefited from flourishing foreign trade during most of the 1920s.", "\n\nFollowing the start of the Great Depression in 1929, the prosperity rapidly collapsed in the country, especially in part due to the economic effects of the failure of the Österreichische Creditanstalt bank in Vienna, Austria. ", "From the mid-1930s to the 1940s, after relations improved with Germany, Hungary's economy benefited from trade. ", "The Hungarian economy became dependent on that of Germany.", "\n\nForeign policy \n\nInitially, despite a move towards nationalism, the new state under Horthy, in an effort to prevent further conflicts, signed the Treaty of Trianon on 4 June 1920, thereby reducing Hungary's size substantially: the whole of Transylvania was taken by Romania; much of Upper Hungary became part of Czechoslovakia; Vojvodina was assigned to the Kingdom of Serbs, Croats, and Slovenes (known after 1929 as Yugoslavia); and the Free State of Fiume was created.", "\n\nWith a succession of increasingly nationalist Prime Ministers, Hungary steadily came to repent the Treaty of Trianon, and aligned itself with Europe's two fascist states, Germany and Italy, which both opposed the changes to national borders in Europe at the end of World War I. The Italian Fascist dictator Benito Mussolini sought closer ties with Hungary, beginning with the signing of a treaty of friendship between Hungary and Italy on 5 April 1927. ", "Gyula Gömbös was an open admirer of the fascist leaders. ", "Gömbös attempted to forge a closer trilateral unity between Germany, Italy and Hungary by acting as an intermediary between Germany and Italy, whose two fascist regimes had nearly come to conflict in 1934 over the issue of Austrian independence. ", " Gömbös eventually persuaded Mussolini to accept Hitler's annexation of Austria in the late 1930s. ", "Gömbös is said to have coined the phrase \"axis\", which he applied to his intention to create an alliance with Germany and Italy; those two countries used it to term their alliance as the Rome–Berlin axis. ", "Just prior to the Second World War, Hungary benefited from its close ties with Germany and Italy when the Munich Agreement obliged Czechoslovakia and Hungary to settle their territorial disputes by negotiation. ", "Finally, the First Vienna Award reassigned the southern parts of Czechoslovakia to Hungary, and shortly after Czechoslovakia was abolished Hungary occupied and annexed the remainder of the Carpatho-Ukraine.", "\n\nWorld War II \n\nAfter the successful revision policy Hungary sought further solutions to the remainder of its former territories and demanded the concession of Transylvanian territory from Romania. ", "The Axis powers were not interested in opening a new conflict in Central Europe; both countries were facing strong diplomatic pressures to avoid any military operations. ", "Finally both parties accepted the arbitration of Germany and Italy, known as the Second Vienna Award, and as a result Northern Transylvania was assigned to Hungary. ", "Shortly afterward, the Kingdom of Hungary joined the Axis powers. ", "Hitler demanded that the Hungarian government follow Germany's military and racial agenda to avoid potential conflict in the future. ", "Anti-Semitism was already an established political cause by the far right in Hungary. ", "In 1944, after the ousting of Horthy by Hitler and before the installation of the National-Socialist Arrow Cross Party, the Hungarian government readily aided Nazi Germany in the deportation of hundreds of thousands of Jews to concentration camps during the Holocaust, where most of them died.", "\n\nIn April 1941, Hungary let the Wehrmacht into her territory, thus supporting Germany and Italy in the invasion of Yugoslavia. ", "After the Independent State of Croatia was proclaimed, Hungary joined the military operations and was allowed to annex the Bačka (Bácska) region in Vojvodina, which had a relative majority of Hungarians, as well as the region of Muraköz (present-day Prekmurje and Medjimurje), which had large Slovenian and Croatian majorities, respectively.", "\n\nOn 27 June 1941, László Bárdossy declared war on the Soviet Union. ", "Fearing a potential turn of support to the Romanians, the Hungarian government sent armed forces to support the German war effort during Operation Barbarossa. ", "This support cost the Hungarians dearly. ", " The entire Hungarian Second Army was lost during the Battle of Stalingrad.", "\n\nBy early 1944, with Soviet forces fast advancing from the east, Hungary was caught attempting to contact the British and the Americans to secretly escape of the war and establish an armistice with the Allies. ", "On 19 March 1944, the Germans responded by invading Hungary in Operation Margarethe. ", " German forces occupied key locations to ensure Hungarian loyalty. ", "They placed Horthy under house arrest and replaced Prime Minister Miklós Kállay with a more pliable successor. ", "Döme Sztójay, an avid supporter of the Nazis, became the new Hungarian Prime Minister. ", "Sztójay governed with the aid of a Nazi military governor, Edmund Veesenmayer.", "\n\nBy October of the same year, the Hungarians were again caught trying to quit the war, and the Germans launched Operation Panzerfaust. ", "They replaced Horthy with Arrow Cross leader Ferenc Szálasi. ", "A new pro-German \"Government of National Unity\" was proclaimed, and it continued the war on the side of the Axis. ", "Szálasi did not replace Horthy as Regent, but was appointed as the \"Nationleader\" (Nemzetvezető) and Prime Minister of the new Hungarian Fascist regime. ", "There has been some debate as to what extent the Hungarian state of the 1930s and '40s can be classified as fascist. ", "However, the regime's increasing economic dependence on Germany, its passage of anti-Semitic legislation and its participation in exterminating local Jews all place it within the realm of international fascism.", "\n\nOn 21 December 1944, a Hungarian \"Interim Assembly\" met in Debrecen, with the approval of the Soviet Union. ", "This assembly elected an interim counter-government headed by Béla Miklós, the former commander of the Hungarian First Army. ", "At the end of March 1945, Szálasi's regime was driven out of Hungary.", "\n\nDissolution \n\nUnder Soviet occupation, the fate of the Kingdom of Hungary was already determined. ", "A High National Council was appointed as the country's collective Head of State until the monarchy was formally dissolved on 1 February 1946. ", "The Regency was replaced by the Second Hungarian Republic. ", "It was quickly followed by the creation of the Hungarian People's Republic.", "\n\nSee also \nHungary between the World Wars\nHungary during World War II\n\nAllied powers of World War II\nAxis powers of World War II\nHungarian volunteers in the Winter War\n\nNotes\n\nCitations\n\nExternal links\n \n\n|align=\"center\"| Preceded by\n\n|align=\"center\" style=\"padding:0 1.0em 0;\"| Kingdom of Hungaryalso known as theRegency1920–1946\n|align=\"center\"| \n\n \nHungary\nCategory:Former polities of the interwar period\n.", "\nCategory:Modern history of Hungary\nCategory:Territorial evolution of Hungary\nCategory:Hungary in World War II\n.", "\n.", "\nCategory:1940s in Hungary\nCategory:States and territories established in 1920\nCategory:States and territories disestablished in 1946\nCategory:1920 establishments in Hungary\nCategory:1946 disestablishments in Hungary\nCategory:20th century in Hungary\nCategory:Axis powers" ]
{ "pile_set_name": "Wikipedia (en)" }
[ 0.013377926421404682, 0.021052631578947368, 0.013513513513513514, 0.01, 0, 0, 0, 0, 0, 0.0051813471502590676, 0.007042253521126761, 0, 0.012345679012345678, 0.007142857142857143, 0.015873015873015872, 0.009302325581395349, 0.0136986301369863, 0, 0.021739130434782608, 0, 0, 0.023809523809523808, 0, 0.008695652173913044, 0.027777777777777776, 0.011029411764705883, 0.015789473684210527, 0.009433962264150943, 0, 0.005988023952095809, 0, 0.017543859649122806, 0.018867924528301886, 0.004807692307692308, 0, 0, 0, 0, 0, 0, 0.00546448087431694, 0.015384615384615385, 0, 0, 0, 0, 0, 0.008403361344537815, 0, 0.010869565217391304, 0.00909090909090909, 0.015625, 0.010309278350515464, 0, 0.0041841004184100415, 0.016666666666666666, 0.012448132780082987, 0, 0.014492753623188406, 0.0273224043715847, 0, 0.004672897196261682, 0.00546448087431694, 0, 0, 0.0043859649122807015, 0, 0, 0.008456659619450317, 0.002197802197802198, 0.017543859649122806, 0.0040650406504065045, 0.030303030303030304, 0.004878048780487805, 0.004739336492890996, 0.0048543689320388345, 0, 0, 0, 0.015151515151515152, 0, 0, 0.006825938566552901, 0, 0.011730205278592375, 0.014492753623188406, 0.006289308176100629, 0, 0.013333333333333334, 0.004739336492890996, 0, 0, 0.009009009009009009, 0, 0.01282051282051282, 0.007352941176470588, 0.03278688524590164, 0, 0.006535947712418301, 0, 0, 0.00909090909090909, 0.016, 0.014492753623188406, 0, 0.014084507042253521, 0.03389830508474576, 0, 0.0024390243902439024, 0, 0, 0.003703703703703704 ]
0.00688
5
[ { "analysis_explanation": null, "end": 18, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 0 }, { "analysis_explanation": null, "end": 54, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 32 }, { "analysis_explanation": null, "end": 65, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 56 }, { "analysis_explanation": null, "end": 83, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 67 }, { "analysis_explanation": null, "end": 103, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 86 }, { "analysis_explanation": null, "end": 132, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 113 }, { "analysis_explanation": null, "end": 143, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 134 }, { "analysis_explanation": null, "end": 258, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 246 }, { "analysis_explanation": null, "end": 297, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 277 }, { "analysis_explanation": null, "end": 342, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 333 }, { "analysis_explanation": null, "end": 365, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 355 }, { "analysis_explanation": null, "end": 392, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 385 }, { "analysis_explanation": null, "end": 416, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 406 }, { "analysis_explanation": null, "end": 540, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 534 }, { "analysis_explanation": null, "end": 549, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 542 }, { "analysis_explanation": null, "end": 562, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 558 }, { "analysis_explanation": null, "end": 650, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 643 }, { "analysis_explanation": null, "end": 663, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 657 }, { "analysis_explanation": null, "end": 964, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 957 }, { "analysis_explanation": null, "end": 1036, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1026 }, { "analysis_explanation": null, "end": 1128, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1121 }, { "analysis_explanation": null, "end": 1240, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1233 }, { "analysis_explanation": null, "end": 1263, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1256 }, { "analysis_explanation": null, "end": 1362, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1355 }, { "analysis_explanation": null, "end": 1373, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1369 }, { "analysis_explanation": null, "end": 1397, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1375 }, { "analysis_explanation": null, "end": 1467, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1458 }, { "analysis_explanation": null, "end": 1566, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1556 }, { "analysis_explanation": null, "end": 1575, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1571 }, { "analysis_explanation": null, "end": 1733, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1726 }, { "analysis_explanation": null, "end": 1757, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1750 }, { "analysis_explanation": null, "end": 1768, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1762 }, { "analysis_explanation": null, "end": 1837, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1823 }, { "analysis_explanation": null, "end": 1860, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1856 }, { "analysis_explanation": null, "end": 1907, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1900 }, { "analysis_explanation": null, "end": 1921, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1915 }, { "analysis_explanation": null, "end": 1972, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1965 }, { "analysis_explanation": null, "end": 2003, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 1985 }, { "analysis_explanation": null, "end": 2057, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2028 }, { "analysis_explanation": null, "end": 2081, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2077 }, { "analysis_explanation": null, "end": 2090, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2086 }, { "analysis_explanation": null, "end": 2203, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2196 }, { "analysis_explanation": null, "end": 2264, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2231 }, { "analysis_explanation": null, "end": 2303, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2274 }, { "analysis_explanation": null, "end": 2335, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2331 }, { "analysis_explanation": null, "end": 2344, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2340 }, { "analysis_explanation": null, "end": 2408, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2400 }, { "analysis_explanation": null, "end": 2471, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2464 }, { "analysis_explanation": null, "end": 2504, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2497 }, { "analysis_explanation": null, "end": 2513, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2509 }, { "analysis_explanation": null, "end": 2579, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2570 }, { "analysis_explanation": null, "end": 2654, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2644 }, { "analysis_explanation": null, "end": 2735, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2731 }, { "analysis_explanation": null, "end": 2789, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2785 }, { "analysis_explanation": null, "end": 2836, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2828 }, { "analysis_explanation": null, "end": 2878, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2856 }, { "analysis_explanation": null, "end": 2912, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2896 }, { "analysis_explanation": null, "end": 2984, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 2977 }, { "analysis_explanation": null, "end": 3102, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3092 }, { "analysis_explanation": null, "end": 3183, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3170 }, { "analysis_explanation": null, "end": 3282, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3275 }, { "analysis_explanation": null, "end": 3306, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3284 }, { "analysis_explanation": null, "end": 3345, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3339 }, { "analysis_explanation": null, "end": 3364, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3360 }, { "analysis_explanation": null, "end": 3375, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3365 }, { "analysis_explanation": null, "end": 3395, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3388 }, { "analysis_explanation": null, "end": 3460, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3452 }, { "analysis_explanation": null, "end": 3499, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3487 }, { "analysis_explanation": null, "end": 3574, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3568 }, { "analysis_explanation": null, "end": 3591, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3584 }, { "analysis_explanation": null, "end": 3646, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3631 }, { "analysis_explanation": null, "end": 3744, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3734 }, { "analysis_explanation": null, "end": 3781, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3773 }, { "analysis_explanation": null, "end": 3815, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3808 }, { "analysis_explanation": null, "end": 3899, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3893 }, { "analysis_explanation": null, "end": 3920, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 3913 }, { "analysis_explanation": null, "end": 4134, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4127 }, { "analysis_explanation": null, "end": 4198, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4179 }, { "analysis_explanation": null, "end": 4336, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4327 }, { "analysis_explanation": null, "end": 4380, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4374 }, { "analysis_explanation": null, "end": 4594, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4582 }, { "analysis_explanation": null, "end": 4623, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4617 }, { "analysis_explanation": null, "end": 4643, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4637 }, { "analysis_explanation": null, "end": 4765, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4758 }, { "analysis_explanation": null, "end": 4797, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4791 }, { "analysis_explanation": null, "end": 4849, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4833 }, { "analysis_explanation": null, "end": 4920, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4901 }, { "analysis_explanation": null, "end": 4928, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4922 }, { "analysis_explanation": null, "end": 4966, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4957 }, { "analysis_explanation": null, "end": 4986, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 4982 }, { "analysis_explanation": null, "end": 5322, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5311 }, { "analysis_explanation": null, "end": 5386, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5382 }, { "analysis_explanation": null, "end": 5646, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5632 }, { "analysis_explanation": null, "end": 5750, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5742 }, { "analysis_explanation": null, "end": 5881, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5874 }, { "analysis_explanation": null, "end": 5963, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5954 }, { "analysis_explanation": null, "end": 5989, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 5977 }, { "analysis_explanation": null, "end": 6022, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6015 }, { "analysis_explanation": null, "end": 6059, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6055 }, { "analysis_explanation": null, "end": 6276, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6272 }, { "analysis_explanation": null, "end": 6332, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6323 }, { "analysis_explanation": null, "end": 6451, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6439 }, { "analysis_explanation": null, "end": 6529, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6523 }, { "analysis_explanation": null, "end": 6594, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6590 }, { "analysis_explanation": null, "end": 6632, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6626 }, { "analysis_explanation": null, "end": 6646, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6639 }, { "analysis_explanation": null, "end": 6705, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6692 }, { "analysis_explanation": null, "end": 6722, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6710 }, { "analysis_explanation": null, "end": 6740, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6736 }, { "analysis_explanation": null, "end": 6748, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6741 }, { "analysis_explanation": null, "end": 6788, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6782 }, { "analysis_explanation": null, "end": 6804, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6797 }, { "analysis_explanation": null, "end": 6906, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6902 }, { "analysis_explanation": null, "end": 6978, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 6974 }, { "analysis_explanation": null, "end": 7021, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7017 }, { "analysis_explanation": null, "end": 7057, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7051 }, { "analysis_explanation": null, "end": 7113, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7103 }, { "analysis_explanation": null, "end": 7249, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7233 }, { "analysis_explanation": null, "end": 7276, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7270 }, { "analysis_explanation": null, "end": 7299, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7292 }, { "analysis_explanation": null, "end": 7315, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7309 }, { "analysis_explanation": null, "end": 7378, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7364 }, { "analysis_explanation": null, "end": 7398, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7386 }, { "analysis_explanation": null, "end": 7411, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7403 }, { "analysis_explanation": null, "end": 7520, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7511 }, { "analysis_explanation": null, "end": 7591, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7569 }, { "analysis_explanation": null, "end": 7609, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7593 }, { "analysis_explanation": null, "end": 7633, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7621 }, { "analysis_explanation": null, "end": 7642, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7635 }, { "analysis_explanation": null, "end": 7693, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7677 }, { "analysis_explanation": null, "end": 7704, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7695 }, { "analysis_explanation": null, "end": 7786, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7777 }, { "analysis_explanation": null, "end": 7791, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7787 }, { "analysis_explanation": null, "end": 7799, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7795 }, { "analysis_explanation": null, "end": 7884, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7878 }, { "analysis_explanation": null, "end": 7920, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 7909 }, { "analysis_explanation": null, "end": 8022, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8015 }, { "analysis_explanation": null, "end": 8115, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8106 }, { "analysis_explanation": null, "end": 8140, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8127 }, { "analysis_explanation": null, "end": 8420, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8406 }, { "analysis_explanation": null, "end": 8429, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8422 }, { "analysis_explanation": null, "end": 8445, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8435 }, { "analysis_explanation": null, "end": 8495, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8491 }, { "analysis_explanation": null, "end": 8510, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8503 }, { "analysis_explanation": null, "end": 8690, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8676 }, { "analysis_explanation": null, "end": 8842, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8827 }, { "analysis_explanation": null, "end": 8880, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 8876 }, { "analysis_explanation": null, "end": 9019, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9010 }, { "analysis_explanation": null, "end": 9064, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9031 }, { "analysis_explanation": null, "end": 9072, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9068 }, { "analysis_explanation": null, "end": 9236, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9230 }, { "analysis_explanation": null, "end": 9245, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9238 }, { "analysis_explanation": null, "end": 9278, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9252 }, { "analysis_explanation": null, "end": 9317, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9310 }, { "analysis_explanation": null, "end": 9326, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9319 }, { "analysis_explanation": null, "end": 9372, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9363 }, { "analysis_explanation": null, "end": 9416, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9409 }, { "analysis_explanation": null, "end": 9508, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9502 }, { "analysis_explanation": null, "end": 9596, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9585 }, { "analysis_explanation": null, "end": 9622, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9615 }, { "analysis_explanation": null, "end": 9691, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9684 }, { "analysis_explanation": null, "end": 9714, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9701 }, { "analysis_explanation": null, "end": 9744, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9730 }, { "analysis_explanation": null, "end": 9792, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9772 }, { "analysis_explanation": null, "end": 9800, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9794 }, { "analysis_explanation": null, "end": 9814, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9806 }, { "analysis_explanation": null, "end": 9832, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9828 }, { "analysis_explanation": null, "end": 9846, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9836 }, { "analysis_explanation": null, "end": 9867, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9853 }, { "analysis_explanation": null, "end": 9876, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9871 }, { "analysis_explanation": null, "end": 9960, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 9953 }, { "analysis_explanation": null, "end": 10038, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10032 }, { "analysis_explanation": null, "end": 10068, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10061 }, { "analysis_explanation": null, "end": 10078, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10073 }, { "analysis_explanation": null, "end": 10140, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10134 }, { "analysis_explanation": null, "end": 10179, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10172 }, { "analysis_explanation": null, "end": 10213, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10197 }, { "analysis_explanation": null, "end": 10245, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10238 }, { "analysis_explanation": null, "end": 10315, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10308 }, { "analysis_explanation": null, "end": 10325, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10320 }, { "analysis_explanation": null, "end": 10341, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10329 }, { "analysis_explanation": null, "end": 10355, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10343 }, { "analysis_explanation": null, "end": 10406, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10400 }, { "analysis_explanation": null, "end": 10467, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10460 }, { "analysis_explanation": null, "end": 10474, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10469 }, { "analysis_explanation": null, "end": 10486, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10479 }, { "analysis_explanation": null, "end": 10531, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10524 }, { "analysis_explanation": null, "end": 10541, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10536 }, { "analysis_explanation": null, "end": 10604, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10600 }, { "analysis_explanation": null, "end": 10631, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10623 }, { "analysis_explanation": null, "end": 10652, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10646 }, { "analysis_explanation": null, "end": 10683, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10674 }, { "analysis_explanation": null, "end": 10700, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10694 }, { "analysis_explanation": null, "end": 10724, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10717 }, { "analysis_explanation": null, "end": 10742, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10728 }, { "analysis_explanation": null, "end": 10750, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10744 }, { "analysis_explanation": null, "end": 10861, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10854 }, { "analysis_explanation": null, "end": 10871, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10866 }, { "analysis_explanation": null, "end": 10935, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10931 }, { "analysis_explanation": null, "end": 10942, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10936 }, { "analysis_explanation": null, "end": 10992, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 10985 }, { "analysis_explanation": null, "end": 11035, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11028 }, { "analysis_explanation": null, "end": 11045, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11040 }, { "analysis_explanation": null, "end": 11094, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11080 }, { "analysis_explanation": null, "end": 11106, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11099 }, { "analysis_explanation": null, "end": 11239, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11225 }, { "analysis_explanation": null, "end": 11250, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11243 }, { "analysis_explanation": null, "end": 11284, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11270 }, { "analysis_explanation": null, "end": 11306, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11299 }, { "analysis_explanation": null, "end": 11426, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11419 }, { "analysis_explanation": null, "end": 11539, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11526 }, { "analysis_explanation": null, "end": 11562, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11555 }, { "analysis_explanation": null, "end": 11643, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11629 }, { "analysis_explanation": null, "end": 11790, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11783 }, { "analysis_explanation": null, "end": 11800, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11795 }, { "analysis_explanation": null, "end": 11873, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11852 }, { "analysis_explanation": null, "end": 11897, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11890 }, { "analysis_explanation": null, "end": 11940, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11918 }, { "analysis_explanation": null, "end": 11971, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11965 }, { "analysis_explanation": null, "end": 11999, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 11990 }, { "analysis_explanation": null, "end": 12025, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12018 }, { "analysis_explanation": null, "end": 12182, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12175 }, { "analysis_explanation": null, "end": 12191, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12187 }, { "analysis_explanation": null, "end": 12220, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12214 }, { "analysis_explanation": null, "end": 12230, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12224 }, { "analysis_explanation": null, "end": 12317, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12308 }, { "analysis_explanation": null, "end": 12347, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12343 }, { "analysis_explanation": null, "end": 12355, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12348 }, { "analysis_explanation": null, "end": 12407, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12403 }, { "analysis_explanation": null, "end": 12491, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12481 }, { "analysis_explanation": null, "end": 12500, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12493 }, { "analysis_explanation": null, "end": 12562, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12555 }, { "analysis_explanation": null, "end": 12572, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12567 }, { "analysis_explanation": null, "end": 12602, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12592 }, { "analysis_explanation": null, "end": 12666, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12659 }, { "analysis_explanation": null, "end": 12732, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12727 }, { "analysis_explanation": null, "end": 12761, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12752 }, { "analysis_explanation": null, "end": 12806, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12796 }, { "analysis_explanation": null, "end": 12840, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12833 }, { "analysis_explanation": null, "end": 12853, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12842 }, { "analysis_explanation": null, "end": 12906, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12897 }, { "analysis_explanation": null, "end": 12919, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12911 }, { "analysis_explanation": null, "end": 12961, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12949 }, { "analysis_explanation": null, "end": 12978, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12963 }, { "analysis_explanation": null, "end": 13011, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 12995 }, { "analysis_explanation": null, "end": 13065, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13056 }, { "analysis_explanation": null, "end": 13080, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13071 }, { "analysis_explanation": null, "end": 13131, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13125 }, { "analysis_explanation": null, "end": 13204, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13194 }, { "analysis_explanation": null, "end": 13301, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13291 }, { "analysis_explanation": null, "end": 13314, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13308 }, { "analysis_explanation": null, "end": 13359, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13352 }, { "analysis_explanation": null, "end": 13404, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13397 }, { "analysis_explanation": null, "end": 13422, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13413 }, { "analysis_explanation": null, "end": 13513, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13500 }, { "analysis_explanation": null, "end": 13526, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13519 }, { "analysis_explanation": null, "end": 13556, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13549 }, { "analysis_explanation": null, "end": 13588, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13582 }, { "analysis_explanation": null, "end": 13638, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13629 }, { "analysis_explanation": null, "end": 13666, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13660 }, { "analysis_explanation": null, "end": 13727, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13714 }, { "analysis_explanation": null, "end": 13771, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13759 }, { "analysis_explanation": null, "end": 13803, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13798 }, { "analysis_explanation": null, "end": 13829, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13820 }, { "analysis_explanation": null, "end": 13885, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13881 }, { "analysis_explanation": null, "end": 13923, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13905 }, { "analysis_explanation": null, "end": 13952, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13928 }, { "analysis_explanation": null, "end": 13968, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 13958 }, { "analysis_explanation": null, "end": 14026, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14019 }, { "analysis_explanation": null, "end": 14079, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14073 }, { "analysis_explanation": null, "end": 14118, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14104 }, { "analysis_explanation": null, "end": 14136, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14126 }, { "analysis_explanation": null, "end": 14264, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14258 }, { "analysis_explanation": null, "end": 14329, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14317 }, { "analysis_explanation": null, "end": 14445, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14436 }, { "analysis_explanation": null, "end": 14464, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14459 }, { "analysis_explanation": null, "end": 14473, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14469 }, { "analysis_explanation": null, "end": 14567, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14560 }, { "analysis_explanation": null, "end": 14596, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14584 }, { "analysis_explanation": null, "end": 14658, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14654 }, { "analysis_explanation": null, "end": 14734, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14718 }, { "analysis_explanation": null, "end": 14747, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14738 }, { "analysis_explanation": null, "end": 14782, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14774 }, { "analysis_explanation": null, "end": 14821, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14805 }, { "analysis_explanation": null, "end": 14896, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14885 }, { "analysis_explanation": null, "end": 14972, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 14951 }, { "analysis_explanation": null, "end": 15016, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15009 }, { "analysis_explanation": null, "end": 15044, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15038 }, { "analysis_explanation": null, "end": 15091, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15069 }, { "analysis_explanation": null, "end": 15256, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15241 }, { "analysis_explanation": null, "end": 15315, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15286 }, { "analysis_explanation": null, "end": 15410, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15403 }, { "analysis_explanation": null, "end": 15441, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15434 }, { "analysis_explanation": null, "end": 15530, "entity_type": "NRP", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15521 }, { "analysis_explanation": null, "end": 15722, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15703 }, { "analysis_explanation": null, "end": 15836, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15829 }, { "analysis_explanation": null, "end": 15878, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15871 }, { "analysis_explanation": null, "end": 15895, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15888 }, { "analysis_explanation": null, "end": 15930, "entity_type": "PERSON", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15916 }, { "analysis_explanation": null, "end": 15941, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15934 }, { "analysis_explanation": null, "end": 15957, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15951 }, { "analysis_explanation": null, "end": 15993, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 15989 }, { "analysis_explanation": null, "end": 16009, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16003 }, { "analysis_explanation": null, "end": 16048, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16044 }, { "analysis_explanation": null, "end": 16088, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16081 }, { "analysis_explanation": null, "end": 16131, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16124 }, { "analysis_explanation": null, "end": 16153, "entity_type": "DATE_TIME", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16132 }, { "analysis_explanation": null, "end": 16164, "entity_type": "LOCATION", "recognition_metadata": { "recognizer_identifier": "SpacyRecognizer_139620637004608", "recognizer_name": "SpacyRecognizer" }, "score": 0.85, "start": 16157 } ]